WorldWideScience

Sample records for as1 cells expressing

  1. Upregulated long non-coding RNA AGAP2-AS1 represses LATS2 and KLF2 expression through interacting with EZH2 and LSD1 in non-small-cell lung cancer cells.

    Science.gov (United States)

    Li, W; Sun, M; Zang, C; Ma, P; He, J; Zhang, M; Huang, Z; Ding, Y; Shu, Y

    2016-01-01

    Recently, long non-coding RNAs (lncRNAs) are identified as new crucial regulators of diverse cellular processes, including cell proliferation, differentiation and cancer cells metastasis. Accumulating evidence has revealed that aberrant lncRNA expression plays important roles in carcinogenesis and tumor progression. However, the expression pattern and biological function of lncRNAs in non-small-cell lung cancer (NSCLC) remain largely unknown. In this study, we performed comprehensive analysis of lncRNA expression in human NSCLC samples by using microarray data from Gene Expression Omnibus. After validation in a cohort of 80 pairs of NSCLC tissues, we identified a differentially expressed novel oncogenic lncRNA termed as AGAP2-AS1. The AGAP2-AS1 expression level was significantly upregulated in NSCLC tissues and negatively correlated with poor prognostic outcomes in patients. In vitro loss- and gain-of-function assays revealed that AGAP2-AS1 knockdown inhibited cell proliferation, migration and invasion, and induced cell apoptosis. In vivo assays also confirmed the ability of AGAP2-AS1 to promote tumor growth. Furthermore, mechanistic investigation showed that AGAP2-AS1 could bind with enhancer of zeste homolog 2 and lysine (K)-specific demethylase 1A, and recruit them to KLF2 and LATS2 promoter regions to repress their transcription. Taken together, our findings indicate that AGAP2-AS1 may act as an oncogene by repressing tumor-suppressor LATS2 and KLF2 transcription. By clarifying the AGAP2-AS1 mechanisms underlying NSCLC development and progression, these findings might promote the development of novel therapeutic strategies for this disease. PMID:27195672

  2. [Expression of the apomictic potential and selection for apomixis in sorghum line AS-1a].

    Science.gov (United States)

    El'konin, L A; Beliaeva, E V; Fadeeva, I Iu

    2012-01-01

    Expression of elements of apomixis was studied for ten seasons in sorghum line AS-la and its backcross hybrids on the 9E and A3 sterile cytoplasms. Cytoembryological analysis revealed aposporous embryo sacks (apo-ESs), their initial cells, and, rare, parthenogeneic proembryos in ovules of line AS-la and its BC2 and BC3 hybrids on the 9E cytoplasm. The A3 sterile cytoplasm suppressed the development of parthenogenetic proembryos, but did not affect the apo-ES formation. The frequency of apomictic elements increased in seasons with high daily temperatures and total precipitation deficiency in the period when the ovule and megagametophyte developed (r = -0.805, P anthocyan color of coleoptyles and leaves in seedlings. Plants of the maternal type were found in the progenies of these crosses at a frequency of 1.4-28.1%. The genetic structure of the endosperm in grains with maternal-type seedlings was inferred from the electrophoretic patterns of storage proteins (kafirins). The kafirin spectra of grains producing maternal-type seedlings was similar to the spectrum of line AS-la and differed from the spectra of grains producing hybrid seedlings, indicating that the endosperm developed independently when apomictic grains formed in line AS-1a. The results showed that lines with facultative apomixis can be constructed in functionally diploid plants. PMID:22567852

  3. HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma.

    Science.gov (United States)

    Huang, Jin-lan; Ren, Ting-yu; Cao, Shun-wang; Zheng, Shi-hao; Hu, Xiu-mei; Hu, Yan-wei; Lin, Li; Chen, Jing; Zheng, Lei; Wang, Qian

    2015-10-20

    Accumulating evidence supports an important role for the hepatitis B virus x protein (HBx) in the pathogenesis of hepatitis B virus (HBV)-induced hepatocellular carcinoma (HCC), but the underlying mechanisms are not entirely clear. Here, we identified a novel long noncoding RNA (lncRNA) DBH-AS1 involved in the HBx-mediated hepatocarcinogenesis. The levels of DBH-AS1 were positively correlated with hepatitis B surface antigen (HBsAg) and tumor size in HCC tissues. Functionally, transgenic expression of DBH-AS1 significantly enhanced cell proliferation and tumorigenesis, whereas short hairpin RNA knockdown of DBH-AS1 caused an inhibition of cell proliferation. Mechanistically, overexpression of DBH-AS1 induced cell cycle progression by accelerating G1/S and G2/M transition concomitantly with upregulation of CDK6, CCND1, CCNE1 and downregulation of p16, p21 and p27. We also found that enhanced DBH-AS1 expression inhibited serum starvation-induced apoptosis of HCC cells. In contrast, suppressed DBH-AS1 expression had opposite effects. Furthermore, DBH-AS1 was shown to activate MAPK pathway. We also provide evidence that DBH-AS1 could be significantly induced by HBx protein and markedly down-regulated by p53. Thus, we concluded that DBH-AS1 can be induced by HBx and inactivated by p53, and consequently promote cell proliferation and cell survival through activation of MAPK signaling in HCC. Our study suggests that DBH-AS1 acts as an oncogene for HCC. PMID:26393879

  4. 肺腺癌组织中lncRNA CADM1-AS1表达及其临床意义%Expression and clinical significance of lncRNA CADM1-AS1 in lung adenocarcinoma

    Institute of Scientific and Technical Information of China (English)

    姚传山; 马磊; 赵旭林; 贺利民; 李醒亚

    2015-01-01

    目的:探讨长链非编码lncRNA CADM1⁃AS1在肺腺癌组织中的表达水平及其临床意义。方法收集于本院行手术切除的72例肺腺癌组织及对应癌旁组织,采用实时定量PCR( qPCR)法检测以上组织标本中的CADM1⁃AS1水平,分析CADM1⁃AS1水平与临床病理参数(性别、年龄、肿瘤大小、分化类型、临床分期、T分期、吸烟史和淋巴结转移)的关系,同时根据远期生存资料比较不同CADM1⁃AS1表达水平的中位总生存期( OS)。进一步采用qPCR法检测常见非小细胞肺癌株A549、SPC⁃A、NCI⁃H1650和NCI⁃H1299中的CADM1⁃AS1水平。采用受试者工作特征曲线( ROC)评价组织CADM1⁃AS1水平在肺腺癌早期诊断中的效能。结果肺腺癌组织中的CADM1⁃AS1水平低于癌旁组织,且与正常支气管上皮细胞株16HBE相比,非小细胞肺癌株的CADM1⁃AS1均为低表达,差异有统计学意义( P均<0�05),且按照由高至低依次为NCI⁃H1299>SPC⁃A>NCI⁃H1650>A549;CADM1⁃AS1表达与肺腺癌的TNM分期、分化类型、肿瘤大小、T分期及淋巴结转移有关,其中TNM Ⅱ、Ⅲ期、低未分化、肿瘤最大径>3 cm、T 分期 T3、T4期及有淋巴结转移组织的 CADM1⁃AS1水平均低于对应项( P 均<0�05);CADM1⁃AS1高水平者的中位OS为32�5个月,高于低水平者的16�0个月,差异有统计学意义( P均<0�05)。组织CADM1⁃AS1水平在肺腺癌早期诊断中的价值较好,其曲线下面积为0�874,灵敏度和特异度分别为87�8%和85�2%。结论 CADM1⁃AS1在肺腺癌组织及非小细胞肺癌细胞株中低表达,且与TNM分期、分化类型等临床病理参数及预后有关,可能在肺腺癌的发生发展中有一定作用,同时对于肺腺癌的早期诊断有较好价值。%Objective To explore the expression and clinical significance of lncRNA CADM1⁃AS1 in lung adenocarcinoma

  5. Long Noncoding RNA RGMB-AS1 Indicates a Poor Prognosis and Modulates Cell Proliferation, Migration and Invasion in Lung Adenocarcinoma.

    Science.gov (United States)

    Li, Ping; Zhang, Guojun; Li, Juan; Yang, Rui; Chen, Shanshan; Wu, Shujun; Zhang, Furui; Bai, Yong; Zhao, Huasi; Wang, Yuanyuan; Dun, Shaozhi; Chen, Xiaonan; Sun, Qianqian; Zhao, Guoqiang

    2016-01-01

    Lung cancer is the most common cause of cancer-related mortality worldwide. It is a complex disease involving multiple genetic and epigenetic alterations. The development of transcriptomics revealed the important role of long non-coding RNAs (lncRNAs) in lung cancer occurrence and development. Here, microarray analysis of lung adenocarcinoma tissues showed the abnormal expression of lncRNA RGMB-AS1. However, the role of lncRNA RGMB-AS1 in lung adenocarcinoma remains largely unknown. We showed that upregulation of lncRNA RGMB-AS1 was significantly correlated with differentiation, TNM stage, and lymph node metastasis. In lung adenocarcinoma cells, downregulation of lncRNA RGMB-AS1 inhibited cell proliferation, migration, invasion, and caused cell cycle arrest at the G1/G0 phase. In vivo experiments showed that lncRNA RGMB-AS1 downregulation significantly suppressed the growth of lung adenocarcinoma. The expression of lncRNA RGMB-AS1 was inversely correlated with that of repulsive guidance molecule b (RGMB) in lung adenocarcinoma tissues, and UCSC analysis and fluorescence detection assay indicated that lncRNA RGMB-AS1 may be involved in the development of human lung adenocarcinoma by regulating RGMB expression though exon2 of RGMB. In summary, our findings indicate that lncRNA RGMB-AS1 may play an important role in lung adenocarcinoma and may serve as a potential therapeutic target.

  6. Transitional cell carcinoma express vitamin D receptors

    DEFF Research Database (Denmark)

    Hermann, G G; Andersen, C B

    1997-01-01

    Recently, vitamin D analogues have shown antineoplastic effect in several diseases. Vitamin D analogues exert its effect by interacting with the vitamin D receptor (VDR). Studies of VDR in transitional cell carcinoma (TCC) have not been reported. The purpose of the present study was therefore...... to examine whether human bladder tumor cells express VDR. Tumor biopsies were obtained from 26 patients with TCC. Expression of VDR was examined by immunohistochemical experiments. All tumors expressed VDR. Biopsies from advanced disease contained more VDR positive cells than low stage disease (p ....05). Similarly, also tumor grade appeared to be related to the number of cells expressing the receptor. Normal urothlium also expressed VDR but only with low intensity. Our study shows that TCC cells possess the VDR receptor which may make them capable to respond to stimulation with vitamin D, but functional...

  7. Human Neuroepithelial Cells Express NMDA Receptors

    Directory of Open Access Journals (Sweden)

    Cappell B

    2003-11-01

    Full Text Available Abstract L-glutamate, an excitatory neurotransmitter, binds to both ionotropic and metabotropic glutamate receptors. In certain parts of the brain the BBB contains two normally impermeable barriers: 1 cerebral endothelial barrier and 2 cerebral epithelial barrier. Human cerebral endothelial cells express NMDA receptors; however, to date, human cerebral epithelial cells (neuroepithelial cells have not been shown to express NMDA receptor message or protein. In this study, human hypothalamic sections were examined for NMDA receptors (NMDAR expression via immunohistochemistry and murine neuroepithelial cell line (V1 were examined for NMDAR via RT-PCR and Western analysis. We found that human cerebral epithelium express protein and cultured mouse neuroepithelial cells express both mRNA and protein for the NMDA receptor. These findings may have important consequences for neuroepithelial responses during excitotoxicity and in disease.

  8. Rho GTPase expression in human myeloid cells.

    Directory of Open Access Journals (Sweden)

    Suzanne F G van Helden

    Full Text Available Myeloid cells are critical for innate immunity and the initiation of adaptive immunity. Strict regulation of the adhesive and migratory behavior is essential for proper functioning of these cells. Rho GTPases are important regulators of adhesion and migration; however, it is unknown which Rho GTPases are expressed in different myeloid cells. Here, we use a qPCR-based approach to investigate Rho GTPase expression in myeloid cells.We found that the mRNAs encoding Cdc42, RhoQ, Rac1, Rac2, RhoA and RhoC are the most abundant. In addition, RhoG, RhoB, RhoF and RhoV are expressed at low levels or only in specific cell types. More differentiated cells along the monocyte-lineage display lower levels of Cdc42 and RhoV, while RhoC mRNA is more abundant. In addition, the Rho GTPase expression profile changes during dendritic cell maturation with Rac1 being upregulated and Rac2 downregulated. Finally, GM-CSF stimulation, during macrophage and osteoclast differentiation, leads to high expression of Rac2, while M-CSF induces high levels of RhoA, showing that these cytokines induce a distinct pattern. Our data uncover cell type specific modulation of the Rho GTPase expression profile in hematopoietic stem cells and in more differentiated cells of the myeloid lineage.

  9. HLA expression in hepatocellular carcinoma cell lines.

    Science.gov (United States)

    Wadee, A A; Paterson, A; Coplan, K A; Reddy, S G

    1994-08-01

    The present study undertook to investigate the biological significance of human leucocyte antigen expression in hepatocellular carcinoma and to elucidate the role of potential modulating agents on human leucocyte antigen expression. These studies used several hepatic tumour-derived cell lines as in vitro model systems. The cell lines included PLC/PRF/5 (Alexander cell line), Hep3B, HepG2, TONG PHC, HA22T/VGH, HA59T/VGH and Mahlavu. The cell lines K562 and Raji were used as negative and positive controls, respectively. K562, a B lymphoid-derived cell line, was shown to express negligible amounts of human leucocyte antigens, while Raji, an erythromyeloid-derived cell line, expressed both class I and class II human leucocyte antigens as well as their respective invariant chains, beta 2-microglobulin and Ii. Using an ELISA, experiments performed on these cell lines confirmed the natural expression of class I and class II antigens by the HA22T/VGH and HA59T/VGH cell lines, whereas PLC/PRF/5 displayed class II surface antigens only. The effects of modulating agents such as interferon-gamma sodium butyrate and clofazimine on human leucocyte antigen expression were investigated using the HA22T/VGH, HA59T/VGH and TONG PHC cell lines. These agents increased class II and class II human leucocyte antigen expression on HA22T/VGH and TONG PHC cells, but had no effect on the HA59T/VGH cell line. The results suggest a potential use for these agents as modulators of human leucocyte antigen expression by human heptocellular cell lines.

  10. Foxp3 expression in human cancer cells

    Directory of Open Access Journals (Sweden)

    Gourgoulianis Konstantinos I

    2008-04-01

    Full Text Available Abstract Objective Transcription factor forkhead box protein 3 (Foxp3 specifically characterizes the thymically derived naturally occurring regulatory T cells (Tregs. Limited evidence indicates that it is also expressed, albeit to a lesser extent, in tissues other than thymus and spleen, while, very recently, it was shown that Foxp3 is expressed by pancreatic carcinoma. This study was scheduled to investigate whether expression of Foxp3 transcripts and mature protein occurs constitutively in various tumor types. Materials and methods Twenty five tumor cell lines of different tissue origins (lung cancer, colon cancer, breast cancer, melanoma, erythroid leukemia, acute T-cell leukemia were studied. Detection of Foxp3 mRNA was performed using both conventional RT-PCR and quantitative real-time PCR while protein expression was assessed by immunocytochemistry and flow cytometry, using different antibody clones. Results Foxp3 mRNA as well as Foxp3 protein was detected in all tumor cell lines, albeit in variable levels, not related to the tissue of origin. This expression correlated with the expression levels of IL-10 and TGFb1. Conclusion We offer evidence that Foxp3 expression, characterizes tumor cells of various tissue origins. The biological significance of these findings warrants further investigation in the context of tumor immune escape, and especially under the light of current anti-cancer efforts interfering with Foxp3 expression.

  11. Foxp3 expression in human cancer cells

    OpenAIRE

    Gourgoulianis Konstantinos I; Barda Angeliki K; Kerenidi Theodora; Loules Gedeon; Kalala Fani; Zamanakou Maria; Speletas Matthaios; Karanikas Vaios; Germenis Anastasios E

    2008-01-01

    Abstract Objective Transcription factor forkhead box protein 3 (Foxp3) specifically characterizes the thymically derived naturally occurring regulatory T cells (Tregs). Limited evidence indicates that it is also expressed, albeit to a lesser extent, in tissues other than thymus and spleen, while, very recently, it was shown that Foxp3 is expressed by pancreatic carcinoma. This study was scheduled to investigate whether expression of Foxp3 transcripts and mature protein occurs constitutively i...

  12. Fundamentals of Expression in Mammalian Cells.

    Science.gov (United States)

    Dyson, Michael R

    2016-01-01

    Expression of proteins in mammalian cells is a key technology important for many functional studies on human and higher eukaryotic genes. Studies include the mapping of protein interactions, solving protein structure by crystallization and X-ray diffraction or solution phase NMR and the generation of antibodies to enable a range of studies to be performed including protein detection in vivo. In addition the production of therapeutic proteins and antibodies, now a multi billion dollar industry, has driven major advances in cell line engineering for the production of grams per liter of active proteins and antibodies. Here the key factors that need to be considered for successful expression in HEK293 and CHO cells are reviewed including host cells, expression vector design, transient transfection methods, stable cell line generation and cultivation conditions. PMID:27165328

  13. CNPase Expression in Olfactory Ensheathing Cells

    Directory of Open Access Journals (Sweden)

    Christine Radtke

    2011-01-01

    Full Text Available A large body of work supports the proposal that transplantation of olfactory ensheathing cells (OECs into nerve or spinal cord injuries can promote axonal regeneration and remyelination. Yet, some investigators have questioned whether the transplanted OECs associate with axons and form peripheral myelin, or if they recruit endogenous Schwann cells that form myelin. Olfactory bulbs from transgenic mice expressing the enhanced green fluorescent protein (eGFP under the control of the 2-3-cyclic nucleotide 3-phosphodiesterase (CNPase promoter were studied. CNPase is expressed in myelin-forming cells throughout their lineage. We examined CNPase expression in both in situ in the olfactory bulb and in vitro to determine if OECs express CNPase commensurate with their myelination potential. eGFP was observed in the outer nerve layer of the olfactory bulb. Dissociated OECs maintained in culture had both intense eGFP expression and CNPase immunostaining. Transplantation of OECs into transected peripheral nerve longitudinally associated with the regenerated axons. These data indicate that OECs in the outer nerve layer of the olfactory bulb of CNPase transgenic mice express CNPase. Thus, while OECs do not normally form myelin on olfactory nerve axons, their expression of CNPase is commensurate with their potential to form myelin when transplanted into injured peripheral nerve.

  14. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available AS1CAMV S000023 16-Jan-1998 (last modified) kehi as-1 (activation sequence 1) in CaMV...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  15. Pitx2 expression promotes p21 expression and cell cycle exit in neural stem cells.

    Science.gov (United States)

    Heldring, Nina; Joseph, Bertrand; Hermanson, Ola; Kioussi, Chrissa

    2012-11-01

    Cortical development is a complex process that involves many events including proliferation, cell cycle exit and differentiation that need to be appropriately synchronized. Neural stem cells (NSCs) isolated from embryonic cortex are characterized by their ability of self-renewal under continued maintenance of multipotency. Cell cycle progression and arrest during development is regulated by numerous factors, including cyclins, cyclin dependent kinases and their inhibitors. In this study, we exogenously expressed the homeodomain transcription factor Pitx2, usually expressed in postmitotic progenitors and neurons of the embryonic cortex, in NSCs with low expression of endogenous Pitx2. We found that Pitx2 expression induced a rapid decrease in proliferation associated with an accumulation of NSCs in G1 phase. A search for potential cell cycle inhibitors responsible for such cell cycle exit of NSCs revealed that Pitx2 expression caused a rapid and dramatic (≉20-fold) increase in expression of the cell cycle inhibitor p21 (WAF1/Cip1). In addition, Pitx2 bound directly to the p21 promoter as assessed by chromatin immunoprecipitation (ChIP) in NSCs. Surprisingly, Pitx2 expression was not associated with an increase in differentiation markers, but instead the expression of nestin, associated with undifferentiated NSCs, was maintained. Our results suggest that Pitx2 promotes p21 expression and induces cell cycle exit in neural progenitors.

  16. Tissue factor expression by endothelial cells in sickle cell anemia.

    OpenAIRE

    Solovey, A; Gui, L; Key, N. S.; Hebbel, R.P.

    1998-01-01

    The role of the vascular endothelium in activation of the coagulation system, a fundamental homeostatic mechanism of mammalian biology, is uncertain because there is little evidence indicating that endothelial cells in vivo express tissue factor (TF), the system's triggering mechanism. As a surrogate for vessel wall endothelium, we examined circulating endothelial cells (CEC) from normals and patients with sickle cell anemia, a disease associated with activation of coagulation. We find that s...

  17. Dental enamel cells express functional SOCE channels.

    Science.gov (United States)

    Nurbaeva, Meerim K; Eckstein, Miriam; Concepcion, Axel R; Smith, Charles E; Srikanth, Sonal; Paine, Michael L; Gwack, Yousang; Hubbard, Michael J; Feske, Stefan; Lacruz, Rodrigo S

    2015-10-30

    Dental enamel formation requires large quantities of Ca(2+) yet the mechanisms mediating Ca(2+) dynamics in enamel cells are unclear. Store-operated Ca(2+) entry (SOCE) channels are important Ca(2+) influx mechanisms in many cells. SOCE involves release of Ca(2+) from intracellular pools followed by Ca(2+) entry. The best-characterized SOCE channels are the Ca(2+) release-activated Ca(2+) (CRAC) channels. As patients with mutations in the CRAC channel genes STIM1 and ORAI1 show abnormal enamel mineralization, we hypothesized that CRAC channels might be an important Ca(2+) uptake mechanism in enamel cells. Investigating primary murine enamel cells, we found that key components of CRAC channels (ORAI1, ORAI2, ORAI3, STIM1, STIM2) were expressed and most abundant during the maturation stage of enamel development. Furthermore, inositol 1,4,5-trisphosphate receptor (IP3R) but not ryanodine receptor (RyR) expression was high in enamel cells suggesting that IP3Rs are the main ER Ca(2+) release mechanism. Passive depletion of ER Ca(2+) stores with thapsigargin resulted in a significant raise in [Ca(2+)]i consistent with SOCE. In cells pre-treated with the CRAC channel blocker Synta-66 Ca(2+) entry was significantly inhibited. These data demonstrate that enamel cells have SOCE mediated by CRAC channels and implicate them as a mechanism for Ca(2+) uptake in enamel formation.

  18. Differential expression of cell adhesion genes

    DEFF Research Database (Denmark)

    Stein, Wilfred D; Litman, Thomas; Fojo, Tito;

    2005-01-01

    It is well known that tumors arising from tissues such as kidney, pancreas, liver and stomach are particularly refractory to treatment. Searching for new anticancer drugs using cells in culture has yielded some effective therapies, but these refractory tumors remain intractable. Studies that comp......It is well known that tumors arising from tissues such as kidney, pancreas, liver and stomach are particularly refractory to treatment. Searching for new anticancer drugs using cells in culture has yielded some effective therapies, but these refractory tumors remain intractable. Studies...... survival might, therefore, act through such a matrix-to-cell suppression of apoptosis. Indeed, correlative mining of gene expression and patient survival databases suggests that poor survival in patients with metastatic cancer correlates highly with tumor expression of a common theme: the genes involved...

  19. Cell cycle gene expression under clinorotation

    Science.gov (United States)

    Artemenko, Olga

    2016-07-01

    Cyclins and cyclin-dependent kinase (CDK) are main regulators of the cell cycle of eukaryotes. It's assumes a significant change of their level in cells under microgravity conditions and by other physical factors actions. The clinorotation use enables to determine the influence of gravity on simulated events in the cell during the cell cycle - exit from the state of quiet stage and promotion presynthetic phase (G1) and DNA synthesis phase (S) of the cell cycle. For the clinorotation effect study on cell proliferation activity is the necessary studies of molecular mechanisms of cell cycle regulation and development of plants under altered gravity condition. The activity of cyclin D, which is responsible for the events of the cell cycle in presynthetic phase can be controlled by the action of endogenous as well as exogenous factors, but clinorotation is one of the factors that influence on genes expression that regulate the cell cycle.These data can be used as a model for further research of cyclin - CDK complex for study of molecular mechanisms regulation of growth and proliferation. In this investigation we tried to summarize and analyze known literature and own data we obtained relatively the main regulators of the cell cycle in altered gravity condition.

  20. MEMBRANE LEc EXPRESSION IN BREAST CANCER CELLS

    Directory of Open Access Journals (Sweden)

    Ya. A. Udalova

    2009-01-01

    Full Text Available Affine chromatography was used to isolate Lec antibodies from the sera of a healthy female donor with the high titers of these anti- bodies, which were labeled with biotin. The study enrolled 51 patients with primary breast cancer (BC. Antigen expression was found by immunohistochemistry and flow cytometry. With these two techniques being used, the detection rate of Lec expression in BC cells was 65% (33/51; the antigen was most frequently found by flow cytometry as compared with immunohistochemistry: 72 and 58% of cases, respectively.

  1. Optogenetics for gene expression in mammalian cells.

    Science.gov (United States)

    Müller, Konrad; Naumann, Sebastian; Weber, Wilfried; Zurbriggen, Matias D

    2015-02-01

    Molecular switches that are controlled by chemicals have evolved as central research instruments in mammalian cell biology. However, these tools are limited in terms of their spatiotemporal resolution due to freely diffusing inducers. These limitations have recently been addressed by the development of optogenetic, genetically encoded, and light-responsive tools that can be controlled with the unprecedented spatiotemporal precision of light. In this article, we first provide a brief overview of currently available optogenetic tools that have been designed to control diverse cellular processes. Then, we focus on recent developments in light-controlled gene expression technologies and provide the reader with a guideline for choosing the most suitable gene expression system.

  2. Cholinergic regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan

    1997-01-01

    Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

  3. Expression of Cyclooxygenase-2 in Ovarian Cancer Cell Lines

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    To investigate the expression of cyclooxygenase-2 (COX-2) in ovarian cancer cell lines,RT-PCR and immunocytochemistry were used to detect the expression of COX-2 in 5 ovarian cancer cell lines. The expression of COX-2 mRNA and protein was detected in all 5 cell lines. It is suggested that COX-2 is expressed in ovarian cancer cell lines, which provides a basis for the chemoprevention of ovarian cancer.

  4. EXPRESSION OF Fas LIGAND IN HUMAN COLON CANCER CELL LINES

    Institute of Scientific and Technical Information of China (English)

    张建军; 丁尔迅; 王强; 陈学云; 付志仁

    2001-01-01

    To investigate the expression of Fas ligand in human colon carcinoma cell lines. Methods: A total of six human colon cancer cell lines were examined for the expression of Fas ligand mRNA and cell surface protein by using RT-PCR and flow cytometry respectively. Results: The results showed that Fas ligand mRNA was expressed in all of the six cancer cell lines and Fas ligand cell surface protein was expressed in part of them. Conclusion: These data suggest that Fas ligand was expressed, at least in part, in human colon cancer cell lines and might facilitate to escape from immune surveillance of the host.

  5. Direct cell lysis for single-cell gene expression profiling

    Directory of Open Access Journals (Sweden)

    David eSvec

    2013-11-01

    Full Text Available The interest to analyze single and few cell samples is rapidly increasing. Numerous extraction protocols to purify nucleic acids are available, but most of them compromise severely on yield to remove contaminants and are therefore not suitable for the analysis of samples containing small numbers of transcripts only. Here, we evaluate 17 direct cell lysis protocols for transcript yield and compatibility with downstream reverse transcription quantitative real-time PCR. Four endogenously expressed genes are assayed together with RNA and DNA spikes in the samples. We found bovine serum albumin (BSA to be the best lysis agent, resulting in efficient cell lysis, high RNA stability and enhanced reverse transcription efficiency. Furthermore, we found direct cell lysis with BSA superior to standard column based extraction methods, when analyzing from 1 up to 512 mammalian cells. In conclusion, direct cell lysis protocols based on BSA can be applied with most cell collection methods and are compatible with most analytical workflows to analyze single cells as well as samples composed of small numbers of cells.

  6. Gene expression profiles in irradiated cancer cells

    Science.gov (United States)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.

    2013-07-01

    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  7. Gene expression profiles in irradiated cancer cells

    International Nuclear Information System (INIS)

    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses

  8. Forced Expression of ZNF143 Restrains Cancer Cell Growth

    Directory of Open Access Journals (Sweden)

    Kimitoshi Kohno

    2011-10-01

    Full Text Available We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143 regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1, aurora kinase B (AURKB and some minichromosome maintenance complex components (MCM. However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.

  9. Forced Expression of ZNF143 Restrains Cancer Cell Growth

    Energy Technology Data Exchange (ETDEWEB)

    Izumi, Hiroto, E-mail: h-izumi@med.uoeh-u.ac.jp; Yasuniwa, Yoshihiro; Akiyama, Masaki; Yamaguchi, Takahiro; Kuma, Akihiro; Kitamura, Noriaki; Kohno, Kimitoshi [Department of Molecular Biology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu 807-8555 (Japan)

    2011-10-19

    We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143) regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1), aurora kinase B (AURKB) and some minichromosome maintenance complex components (MCM). However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells) and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.

  10. Gene expression profile of renal cell carcinoma clear cell type

    Directory of Open Access Journals (Sweden)

    Marcos F. Dall’Oglio

    2010-08-01

    Full Text Available PURPOSE: The determination of prognosis in patients with renal cell carcinoma (RCC is based, classically, on stage and histopathological aspects. The metastatic disease develops in one third of patients after surgery, even in localized tumors. There are few options for treating those patients, and even the new target designed drugs have shown low rates of success in controlling disease progression. Few studies used high throughput genomic analysis in renal cell carcinoma for determination of prognosis. This study is focused on the identification of gene expression signatures in tissues of low-risk, high-risk and metastatic RCC clear cell type (RCC-CCT. MATERIALS AND METHODS: We analyzed the expression of approximately 55,000 distinct transcripts using the Whole Genome microarray platform hybridized with RNA extracted from 19 patients submitted to surgery to treat RCC-CCT with different clinical outcomes. They were divided into three groups (1 low risk, characterized by pT1, Fuhrman grade 1 or 2, no microvascular invasion RCC; (2 high risk, pT2-3, Fuhrman grade 3 or 4 with, necrosis and microvascular invasion present and (3 metastatic RCC-CCT. Normal renal tissue was used as control. RESULTS: After comparison of differentially expressed genes among low-risk, high-risk and metastatic groups, we identified a group of common genes characterizing metastatic disease. Among them Interleukin-8 and Heat shock protein 70 were over-expressed in metastasis and validated by real-time polymerase chain reaction. CONCLUSION: These findings can be used as a starting point to generate molecular markers of RCC-CCT as well as a target for the development of innovative therapies.

  11. Haemopedia: An Expression Atlas of Murine Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    Carolyn A. de Graaf

    2016-09-01

    Full Text Available Hematopoiesis is a multistage process involving the differentiation of stem and progenitor cells into distinct mature cell lineages. Here we present Haemopedia, an atlas of murine gene-expression data containing 54 hematopoietic cell types, covering all the mature lineages in hematopoiesis. We include rare cell populations such as eosinophils, mast cells, basophils, and megakaryocytes, and a broad collection of progenitor and stem cells. We show that lineage branching and maturation during hematopoiesis can be reconstructed using the expression patterns of small sets of genes. We also have identified genes with enriched expression in each of the mature blood cell lineages, many of which show conserved lineage-enriched expression in human hematopoiesis. We have created an online web portal called Haemosphere to make analyses of Haemopedia and other blood cell transcriptional datasets easier. This resource provides simple tools to interrogate gene-expression-based relationships between hematopoietic cell types and genes of interest.

  12. Tetracycline regulator expression alters the transcriptional program of mammalian cells

    OpenAIRE

    Hackl, Hubert; Rommer, Anna; Konrad, Torsten A; Nassimbeni, Christine; Wieser, Rotraud

    2010-01-01

    Tetracycline regulated ectopic gene expression is a widely used tool to study gene function. However, the tetracycline regulator (tetR) itself has been reported to cause certain phenotypic changes in mammalian cells. We, therefore, asked whether human myeloid U937 cells expressing the tetR in an autoregulated manner would exhibit alterations in gene expression upon removal of tetracycline.

  13. Global gene expression analyses of hematopoietic stem cell-like cell lines with inducible Lhx2 expression

    Directory of Open Access Journals (Sweden)

    Lundeberg Joakim

    2006-04-01

    Full Text Available Abstract Background Expression of the LIM-homeobox gene Lhx2 in murine hematopoietic cells allows for the generation of hematopoietic stem cell (HSC-like cell lines. To address the molecular basis of Lhx2 function, we generated HSC-like cell lines where Lhx2 expression is regulated by a tet-on system and hence dependent on the presence of doxycyclin (dox. These cell lines efficiently down-regulate Lhx2 expression upon dox withdrawal leading to a rapid differentiation into various myeloid cell types. Results Global gene expression of these cell lines cultured in dox was compared to different time points after dox withdrawal using microarray technology. We identified 267 differentially expressed genes. The majority of the genes overlapping with HSC-specific databases were those down-regulated after turning off Lhx2 expression and a majority of the genes overlapping with those defined as late progenitor-specific genes were the up-regulated genes, suggesting that these cell lines represent a relevant model system for normal HSCs also at the level of global gene expression. Moreover, in situ hybridisations of several genes down-regulated after dox withdrawal showed overlapping expression patterns with Lhx2 in various tissues during embryonic development. Conclusion Global gene expression analysis of HSC-like cell lines with inducible Lhx2 expression has identified genes putatively linked to self-renewal / differentiation of HSCs, and function of Lhx2 in organ development and stem / progenitor cells of non-hematopoietic origin.

  14. High expression of markers of apoptosis in Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Petersen, Bodil Laub; Lundegaard, Pia Rengtved; Bank, M I;

    2003-01-01

    53 and the number of cells in apoptosis detected with TUNEL. Langerhans cell histiocytosis cells showed strong expression of p53 and in some cases co-expression of Fas and Fas-L. The expression of Fas-L was significantly higher in infiltrates from patients with single-system disease. The actual...... number of pathological Langerhans cells in apoptosis as estimated by TUNEL was low. CONCLUSIONS: The low number of TUNEL-reactive cells can be explained by the rapid turnover of apoptotic cells in the tissue, not leaving the apoptotic cells long enough in the tissue to be detected. The co......-expression of Fas and Fas-L in some Langerhans cells can lead to an autocrine apoptotic shortcut, mediating the death of the double-positive cells. Our findings suggest that apoptosis mediated through the Fas/Fas-L pathway may contribute to the spontaneous regression of lesions in single-system disease. A delicate...

  15. Renalase's expression and distribution in renal tissue and cells.

    Directory of Open Access Journals (Sweden)

    Feng Wang

    Full Text Available To study renalase's expression and distribution in renal tissues and cells, renalase coded DNA vaccine was constructed, and anti-renalase monoclonal antibodies were produced using DNA immunization and hybridoma technique, followed by further investigation with immunological testing and western blotting to detect the expression and distribution of renalase among the renal tissue and cells. Anti-renalase monoclonal antibodies were successfully prepared by using DNA immunization technique. Further studies with anti-renalase monoclonal antibody showed that renalase expressed in glomeruli, tubule, mesangial cells, podocytes, renal tubule epithelial cells and its cells supernatant. Renalase is wildly expressed in kidney, including glomeruli, tubule, mesangial cells, podocytes and tubule epithelial cells, and may be secreted by tubule epithelial cells primarily.

  16. Expression of HOX C homeobox genes in lymphoid cells.

    Science.gov (United States)

    Lawrence, H J; Stage, K M; Mathews, C H; Detmer, K; Scibienski, R; MacKenzie, M; Migliaccio, E; Boncinelli, E; Largman, C

    1993-08-01

    The class I homeobox genes located in four clusters in mammalian genomes (HOX A, HOX B, HOX C, and HOX D) appear to play a major role in fetal development. Previous surveys of homeobox gene expression in human leukemic cell lines have shown that certain HOX A genes are expressed only in myeloid cell lines, whereas HOX B gene expression is largely restricted to cells with erythroid potential. We now report a survey of the expression patterns of 9 homeobox genes from the HOX C locus in a panel of 24 human and 7 murine leukemic cell lines. The most striking observation is the lymphoid-specific pattern of expression of HOX C4, located at the 3' end of the locus. A major transcript of 1.9 kilobases is observed in both T-cell and B-cell lines. HOX C4 expression is also detected in normal human marrow and peripheral blood lymphocytes, but not in mature granulocytes or monocytes. HOX C8 is also expressed in human lymphoid cells but is expressed in other blood cell types as well. However, the HOX C8 transcript pattern is lineage specific. These data, in conjunction with earlier findings, suggest that homeobox gene expression influences lineage determination during hematopoiesis.

  17. Freedom of expression: cell-type-specific gene profiling.

    Science.gov (United States)

    Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H

    2014-01-01

    Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling.

  18. Robust Inference of Cell-to-Cell Expression Variations from Single- and K-Cell Profiling.

    Science.gov (United States)

    Narayanan, Manikandan; Martins, Andrew J; Tsang, John S

    2016-07-01

    Quantifying heterogeneity in gene expression among single cells can reveal information inaccessible to cell-population averaged measurements. However, the expression level of many genes in single cells fall below the detection limit of even the most sensitive technologies currently available. One proposed approach to overcome this challenge is to measure random pools of k cells (e.g., 10) to increase sensitivity, followed by computational "deconvolution" of cellular heterogeneity parameters (CHPs), such as the biological variance of single-cell expression levels. Existing approaches infer CHPs using either single-cell or k-cell data alone, and typically within a single population of cells. However, integrating both single- and k-cell data may reap additional benefits, and quantifying differences in CHPs across cell populations or conditions could reveal novel biological information. Here we present a Bayesian approach that can utilize single-cell, k-cell, or both simultaneously to infer CHPs within a single condition or their differences across two conditions. Using simulated as well as experimentally generated single- and k-cell data, we found situations where each data type would offer advantages, but using both together can improve precision and better reconcile CHP information contained in single- and k-cell data. We illustrate the utility of our approach by applying it to jointly generated single- and k-cell data to reveal CHP differences in several key inflammatory genes between resting and inflammatory cytokine-activated human macrophages, delineating differences in the distribution of 'ON' versus 'OFF' cells and in continuous variation of expression level among cells. Our approach thus offers a practical and robust framework to assess and compare cellular heterogeneity within and across biological conditions using modern multiplexed technologies. PMID:27438699

  19. Advantages and Applications of CAR-Expressing Natural Killer Cells

    Directory of Open Access Journals (Sweden)

    Wolfgang eGlienke

    2015-02-01

    Full Text Available In contrast to donor T cells, natural killer (NK cells are known to mediate anti-cancer effects without the risk of inducing graft-versus-host disease (GvHD. In order to improve cytotoxicity against resistant cancer cells, auspicious efforts have been made with chimeric antigen receptor (CAR expressing T- and NK cells. These CAR-modified cells express antigen receptors against tumor-associated surface antigens, thus redirecting the effector cells and enhancing tumor-specific immunosurveillance. However, many cancer antigens are also expressed on healthy tissues, potentially leading to off tumor/ on target toxicity by CAR-engineered cells. In order to control such potentially severe side effects, the insertion of suicide genes into CAR-modified effectors can provide a means for efficient depletion of these cells. While CAR-expressing T cells have entered successfully clinical trials, experience with CAR-engineered NK cells is mainly restricted to pre-clinical investigations and predominantly to NK cell lines. In this review we summarize the data on CAR expressing NK cells focusing on the possible advantage using these short-lived effector cells and discuss the necessity of suicide switches. Furthermore, we address the compliance of such modified NK cells with regulatory requirements as a new field in cellular immunotherapy.

  20. Chemokine receptor expression by inflammatory T cells in EAE.

    Science.gov (United States)

    Mony, Jyothi Thyagabhavan; Khorooshi, Reza; Owens, Trevor

    2014-01-01

    Chemokines direct cellular infiltration to tissues, and their receptors and signaling pathways represent targets for therapy in diseases such as multiple sclerosis (MS). The chemokine CCL20 is expressed in choroid plexus, a site of entry of T cells to the central nervous system (CNS). The CCL20 receptor CCR6 has been reported to be selectively expressed by CD4(+) T cells that produce the cytokine IL-17 (Th17 cells). Th17 cells and interferon-gamma (IFNγ)-producing Th1 cells are implicated in induction of MS and its animal model experimental autoimmune encephalomyelitis (EAE). We have assessed whether CCR6 identifies specific inflammatory T cell subsets in EAE. Our approach was to induce EAE, and then examine chemokine receptor expression by cytokine-producing T cells sorted from CNS at peak disease. About 7% of CNS-infiltrating CD4(+) T cells produced IFNγ in flow cytometric cytokine assays, whereas less than 1% produced IL-17. About 1% of CD4(+) T cells produced both cytokines. CCR6 was expressed by Th1, Th1+17 and by Th17 cells, but not by CD8(+) T cells. CD8(+) T cells expressed CXCR3, which was also expressed by CD4(+) T cells, with no correlation to cytokine profile. Messenger RNA for IFNγ, IL-17A, and the Th1 and Th17-associated transcription factors T-bet and RORγt was detected in both CCR6(+) and CXCR3(+) CD4(+) T cells. IFNγ, but not IL-17A mRNA expression was detected in CD8(+) T cells in CNS. CCR6 and CD4 were co-localized in spinal cord infiltrates by double immunofluorescence. Consistent with flow cytometry data some but not all CD4(+) T cells expressed CCR6 within infiltrates. CD4-negative CCR6(+) cells included macrophage/microglial cells. Thus we have for the first time directly studied CD4(+) and CD8(+) T cells in the CNS of mice with peak EAE, and determined IFNγ and IL17 expression by cells expressing CCR6 and CXCR3. We show that neither CCR6 or CXCR3 align with CD4 T cell subsets, and Th1 or mixed Th1+17 predominate in EAE.

  1. Chemokine receptor expression by inflammatory T cells in EAE

    Directory of Open Access Journals (Sweden)

    Jyothi Thyagabhavan Mony

    2014-07-01

    Full Text Available Chemokines direct cellular infiltration to tissues, and their receptors and signaling pathways represent targets for therapy in diseases such as multiple sclerosis (MS. The chemokine CCL20 is expressed in choroid plexus, a site of entry of T cells to the central nervous system (CNS. The CCL20 receptor CCR6 has been reported to be selectively expressed by CD4+ T cells that produce the cytokine IL-17 (Th17 cells. Th17 cells and interferon-gamma (IFNγ-producing Th1 cells are implicated in induction of MS and its animal model experimental autoimmune encephalomyelitis (EAE. We have assessed whether CCR6 identifies specific inflammatory T cell subsets in EAE. Our approach was to induce EAE, and then examine chemokine receptor expression by cytokine-producing T cells sorted from CNS at peak disease. About 7% of CNS-infiltrating CD4+ T cells produced IFNγ in flow cytometric cytokine assays, whereas less than 1% produced IL-17. About 7.7% of CD4+ T cells produced both cytokines. CCR6 was expressed by Th1, Th1+17 and by Th17 cells, but not by CD8+ T cells. CD8+ T cells expressed CXCR3, which was also expressed by CD4+ T cells, with no correlation to cytokine profile. Messenger RNA for IFNγ, IL-17A, and the Th1 and Th17-associated transcription factors T-bet and RORγt was detected in both CCR6+ and CXCR3+ CD4+ T cells. IFNγ, but not IL-17A mRNA expression was detected in CD8+ T cells in CNS. CCR6 and CD4 were co-localized in spinal cord infiltrates by double immunofluorescence. Consistent with flow cytometry data some but not all CD4+ T cells expressed CCR6 within infiltrates. CD4-negative CCR6+ cells included macrophage/microglial cells. Thus we have for the first time directly studied CD4+ and CD8+ T cells in the CNS of mice with peak EAE, and determined IFNγ and IL17 expression by cells expressing CCR6 and CXCR3. We show that neither CCR6 or CXCR3 align with CD4 T cell subsets, and Th1 or mixed Th1+17 predominate in EAE.

  2. Geometry of the Gene Expression Space of Individual Cells.

    Directory of Open Access Journals (Sweden)

    Yael Korem

    2015-07-01

    Full Text Available There is a revolution in the ability to analyze gene expression of single cells in a tissue. To understand this data we must comprehend how cells are distributed in a high-dimensional gene expression space. One open question is whether cell types form discrete clusters or whether gene expression forms a continuum of states. If such a continuum exists, what is its geometry? Recent theory on evolutionary trade-offs suggests that cells that need to perform multiple tasks are arranged in a polygon or polyhedron (line, triangle, tetrahedron and so on, generally called polytopes in gene expression space, whose vertices are the expression profiles optimal for each task. Here, we analyze single-cell data from human and mouse tissues profiled using a variety of single-cell technologies. We fit the data to shapes with different numbers of vertices, compute their statistical significance, and infer their tasks. We find cases in which single cells fill out a continuum of expression states within a polyhedron. This occurs in intestinal progenitor cells, which fill out a tetrahedron in gene expression space. The four vertices of this tetrahedron are each enriched with genes for a specific task related to stemness and early differentiation. A polyhedral continuum of states is also found in spleen dendritic cells, known to perform multiple immune tasks: cells fill out a tetrahedron whose vertices correspond to key tasks related to maturation, pathogen sensing and communication with lymphocytes. A mixture of continuum-like distributions and discrete clusters is found in other cell types, including bone marrow and differentiated intestinal crypt cells. This approach can be used to understand the geometry and biological tasks of a wide range of single-cell datasets. The present results suggest that the concept of cell type may be expanded. In addition to discreet clusters in gene-expression space, we suggest a new possibility: a continuum of states within a

  3. Human thymic epithelial cells express functional HLA-DP molecules

    DEFF Research Database (Denmark)

    Jørgensen, A; Röpke, C; Nielsen, M;

    1996-01-01

    T lymphocytes, we examined whether human thymic epithelial cells (TEC) expressed HLA-DP molecules. We present evidence that TEC obtained from short time culture express low but significant levels of HLA-DP molecules. The expression of HLA-DP molecules was comparable to or higher than the expression...... of HLA-DP allospecific primed lymphocyte typing (PLT) CD4 T cell lines. IFN-gamma treatment strongly upregulated the HLA-DP allospecific PLT responses whereas other PLT responses remained largely unchanged. In conclusion, these data indicate that human thymus epithelial cells express significant levels......HLA-DP molecules function as restriction elements in the presentation of foreign antigens to T cells by antigen presenting cells and certain HLA-DP molecules confer susceptibility to autoimmune disease. Because HLA molecules play an essential role in thymic selection and elimination of autoreactive...

  4. Differential expression and function of CD27 in chronic lymphocytic leukemia cells expressing ZAP-70.

    Science.gov (United States)

    Lafarge, Sandrine T; Hou, Sen; Pauls, Samantha D; Johnston, James B; Gibson, Spencer B; Marshall, Aaron J

    2015-07-01

    Chronic lymphocytic leukemia is a malignancy driven by abberant B cell signaling and survival. Leukemic B cells accumulate in the peripheral blood and the lymphoid organs where contact with stromal cells and T cells provide critical survival signals. Clinical severity of CLL is associated with several prognostic markers including expression of the kinase ZAP-70. ZAP-70 expression enhances signaling via the B cell antigen receptor and is associated with increased cell adhesion and migration capacity. Here we report that ZAP-70-positive CLL patients display significantly higher expression of the TNF superfamily receptor and memory marker CD27 than do ZAP-70 negative patients. CD27 expression by CLL was acutely elevated upon BCR cross-linking, or upon ectopic expression of ZAP-70. CD27 expression correlated with functional capacity to adhere to stromal cells and antibody blockade of CD27 impaired CLL binding to stroma. These results provide the first evidence for differential expression of CD27 among CLL prognostic groups, suggest a role for ZAP-70 dependent signaling in CD27 induction and implicate CD27 in cell-cell interactions with the lymphoid tissue microenvironment.

  5. Calreticulin: Roles in Cell-Surface Protein Expression

    Directory of Open Access Journals (Sweden)

    Yue Jiang

    2014-09-01

    Full Text Available In order to perform their designated functions, proteins require precise subcellular localizations. For cell-surface proteins, such as receptors and channels, they are able to transduce signals only when properly targeted to the cell membrane. Calreticulin is a multi-functional chaperone protein involved in protein folding, maturation, and trafficking. However, evidence has been accumulating that calreticulin can also negatively regulate the surface expression of certain receptors and channels. In these instances, depletion of calreticulin enhances cell-surface expression and function. In this review, we discuss the role of calreticulin with a focus on its negative effects on the expression of cell-surface proteins.

  6. Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

    Science.gov (United States)

    Moignard, Victoria; Göttgens, Berthold; Adryan, Boris

    2016-01-01

    Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete pipeline for the analysis of single cell qPCR data that uses the mathematics behind bursty expression to develop more accurate and robust algorithms for analyzing the origin of heterogeneity in experimental samples, specifically an algorithm for clustering cells by their bursting behavior (Simulated Annealing for Bursty Expression Clustering, SABEC) and a statistical tool for comparing the kinetic parameters of bursty expression across populations of cells (Estimation of Parameter changes in Kinetics, EPiK). We applied these methods to hematopoiesis, including a new single cell dataset in which transcription factors (TFs) involved in the earliest branchpoint of blood differentiation were individually up- and down-regulated. We could identify two unique sub-populations within a seemingly homogenous group of hematopoietic stem cells. In addition, we could predict regulatory mechanisms controlling the expression levels of eighteen key hematopoietic transcription factors throughout differentiation. Detailed information about gene regulatory mechanisms can therefore be obtained simply from high throughput single cell gene expression data, which should be widely applicable given the rapid expansion of single cell genomics. PMID:27551778

  7. Intraclonal protein expression heterogeneity in recombinant CHO cells.

    Directory of Open Access Journals (Sweden)

    Warren Pilbrough

    Full Text Available Therapeutic glycoproteins have played a major role in the commercial success of biotechnology in the post-genomic era. But isolating recombinant mammalian cell lines for large-scale production remains costly and time-consuming, due to substantial variation and unpredictable stability of expression amongst transfected cells, requiring extensive clone screening to identify suitable high producers. Streamlining this process is of considerable interest to industry yet the underlying phenomena are still not well understood. Here we examine an antibody-expressing Chinese hamster ovary (CHO clone at single-cell resolution using flow cytometry and vectors, which couple light and heavy chain transcription to fluorescent markers. Expression variation has traditionally been attributed to genetic heterogeneity arising from random genomic integration of vector DNA. It follows that single cell cloning should yield a homogeneous cell population. We show, in fact, that expression in a clone can be surprisingly heterogeneous (standard deviation 50 to 70% of the mean, approaching the level of variation in mixed transfectant pools, and each antibody chain varies in tandem. Phenotypic variation is fully developed within just 18 days of cloning, yet is not entirely explained by measurement noise, cell size, or the cell cycle. By monitoring the dynamic response of subpopulations and subclones, we show that cells also undergo slow stochastic fluctuations in expression (half-life 2 to 11 generations. Non-genetic diversity may therefore play a greater role in clonal variation than previously thought. This also has unexpected implications for expression stability. Stochastic gene expression noise and selection bias lead to perturbations from steady state at the time of cloning. The resulting transient response as clones reestablish their expression distribution is not ordinarily accounted for but can contribute to declines in median expression over timescales of up to 50

  8. Fibronectin induces MMP2 expression in human prostate cancer cells.

    Science.gov (United States)

    Moroz, Andrei; Delella, Flávia K; Lacorte, Lívia M; Deffune, Elenice; Felisbino, Sérgio L

    2013-01-25

    High-grade prostate cancers express high levels of matrix metalloproteinases (MMPs), major enzymes involved in tumor invasion and metastasis. However, the tumor cell lines commonly employed for prostate cancer research express only small amounts of MMPs when cultivated as monolayer cultures, in common culture media. The present study was conducted to ascertain whether culture conditions that include fibronectin can alter MMP2 and MMP9 expression by the human prostatic epithelial cell lines RWPE-1, LNCaP and PC-3. These cells were individually seeded at 2×10(4) cells/cm(2), cultivated until they reached 80% confluence, and then exposed for 4h to fibronectin, after which the conditioned medium was analyzed by gelatin zymography. Untreated cells were given common medium. Only RWPE-1 cells express detectable amounts of MMP9 when cultivated in common medium, whereas the addition of fibronectin induced high expression levels of pro and active forms of MMP2 in all tested cell lines. Our findings demonstrate that normal and tumor prostate cell lines express MMP2 activity when in contact with extracellular matrix components or blood plasma proteins such as fibronectin. Future studies of transcriptomes and proteomes in prostate cancer research using these cell lines should not neglect these important conclusions.

  9. Cyclin Dl expression in B-cell non Hodgkin lymphoma.

    Science.gov (United States)

    Aref, Salah; Mossad, Y; El-Khodary, T; Awad, M; El-Shahat, E

    2006-10-01

    Disorders of the cell cycle regulatory machinery play a key role in the pathogenesis of cancer. Over-expression of cyclin D1 protein has been reported in several solid tumors and certain lymphoid malignancies, but little is known about the effect of its expression on clinical behavior and outcome in B-cell Non-Hodgkin lymphoma (NHL). In this study, we investigated the expression of cyclin Dl in group of patients with NHL and correlated the results with the clinical and laboratory data. The degree of expression of cyclin Dl protein was evaluated by flow cytometry in a group of NHL patients (n = 46) and in normal control group (n = 10). Cyclin Dl over expression was detected in 10 out of 46 (21.7%) patients; they were 5/5-mantle cell lymphoma (MCL) (100%) and 5/28 large B-cell lymphoma (17.8%). All other NHL subtypes showed normal cyclin D1 expression. The clinical signs (hepatomegaly, splenomegaly and B-symptoms, clinical staging) and laboratory data (hemoglobin, white cell count (WBCs), platelet count, and bone marrow infiltration) were not significantly different between NHL subgroup with cyclin Dl over expression and that with normal cyclin Dl expression. Serum lactic dehydrogenase (LDH) levels and lymphadenopathy were significantly higher in NHL group with cyclin D1 over expression as compared to those without. Also, cyclin D1 over expression is associated with poor outcome of NHL patients. Cyclin Dl over expression was evident among all cases of MCL and few cases of large B-cell lymphoma. Cyclin Dl over expression might be used as adjuvant tool for diagnosis of MCL; has role in NHL biology and is bad prognostic index in NHL. PMID:17607588

  10. Neurohypophysial Receptor Gene Expression by Thymic T Cell Subsets and Thymic T Cell Lymphoma Cell Lines

    Directory of Open Access Journals (Sweden)

    I. Hansenne

    2004-01-01

    transcribed in thymic epithelium, while immature T lymphocytes express functional neurohypophysial receptors. Neurohypophysial receptors belong to the G protein-linked seven-transmembrane receptor superfamily and are encoded by four distinct genes, OTR, V1R, V2R and V3R. The objective of this study was to identify the nature of neurohypophysial receptor in thymic T cell subsets purified by immunomagnetic selection, as well as in murine thymic lymphoma cell lines RL12-NP and BW5147. OTR is transcribed in all thymic T cell subsets and T cell lines, while V3R transcription is restricted to CD4+ CD8+ and CD8+ thymic cells. Neither V1R nor V2R transcripts are detected in any kind of T cells. The OTR protein was identified by immunocytochemistry on thymocytes freshly isolated from C57BL/6 mice. In murine fetal thymic organ cultures, a specific OTR antagonist does not modify the percentage of T cell subsets, but increases late T cell apoptosis further evidencing the involvement of OT/OTR signaling in the control of T cell proliferation and survival. According to these data, OTR and V3R are differentially expressed during T cell ontogeny. Moreover, the restriction of OTR transcription to T cell lines derived from thymic lymphomas may be important in the context of T cell leukemia pathogenesis and treatment.

  11. HCMV Infection Depress NGF Expression in Human Glioma Cells

    Institute of Scientific and Technical Information of China (English)

    Hai-tao WANG; Bin WANG; Zhi-jun LIU; Zhi-qiang BAI; Ling LI; Dong-meng QIAN; Zhi-yong YAN; Xu-xia SONG

    2009-01-01

    Human cytomegalovirus (HCMV) is the most common cause of congenital infection, resulting in birth defects such as microcephaly. In this study, RT-PCR and Western Blotting were performed to quantify the regulation of endogenic nerve growth factor expression in neuroglia cells by HCMV infection. The results showed that basal, endogenous NGF expression in U251 was unchanged during early HCMV infection. NGF expression is strongly down-regulated during the latent phase of infection. These results suggest that HCMV can depress the NGF expression in U251 cells.

  12. CellMontage: similar expression profile search server.

    Science.gov (United States)

    Fujibuchi, Wataru; Kiseleva, Larisa; Taniguchi, Takeaki; Harada, Hajime; Horton, Paul

    2007-11-15

    The establishment and rapid expansion of microarray databases has created a need for new search tools. Here we present CellMontage, the first server for expression profile similarity search over a large database-69 000 microarray experiments derived from NCBI's; GEO site. CellMontage provides a novel, content-based search engine for accessing gene expression data. Microarray experiments with similar overall expression to a user-provided expression profile (e.g. microarray experiment) are computed and displayed-usually within 20 s. The core search engine software is downloadable from the site. PMID:17895274

  13. Regulated expression of erythropoietin by two human hepatoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Goldberg, M.A.; Glass, G.A.; Cunningham, J.M.; Bunn, H.F.

    1987-11-01

    The development of a cell culture system that produces erythropoietin (Epo) in a regulated manner has been the focus of much effort. The authors have screened multiple renal and hepatic cell lines for either constitutive or regulated expression of Epo. Only the human hepatoma cell lines, Hep3B and HepG2, made significant amounts of Epo as measured both by radioimmunoassay and in vitro bioassay (as much as 330 milliunits per 10/sup 6/ cells in 24 hr). The constitutive production of Epo increased dramatically as a function of cell density in both cell lines. At cell densities < 3.3 x 10/sup 5/ cells per cm/sup 2/, there was little constitutive release of Epo in the medium. With Hep3B cells grown at low cell densities, a mean 18-fold increase in Epo expression was seen in response to hypoxia and a 6-fold increase was observed in response to incubation in medium containing 50 ..mu..M cobalt(II) chloride. At similar low cell densities, Epo production in HepG2 cells could be enhanced an average of about 3-fold by stimulation with either hypoxia or cobalt(II) chloride. Upon such stimulation, both cell lines demonstrated markedly elevated levels of Epo mRNA. Hence, both Hep3B and HepG2 cell lines provide an excellent in vitro system in which to study the physiological regulation of Epo expression.

  14. MicroRNA expression profiles in avian haemopoietic cells

    Directory of Open Access Journals (Sweden)

    Yongxiu eYao

    2013-08-01

    Full Text Available MicroRNAs (miRNAs are small, abundant, non-coding RNAs that modulate gene expression by interfering with translation or stability of mRNA transcripts in a sequence-specific manner. A total of 734 precursor and 996 mature miRNAs have so far been identified in the chicken genome. A number of these miRNAs are expressed in a cell type-specific manner, and understanding their function requires detailed examination of their expression in different cell types. We carried out deep sequencing of small RNA populations isolated from stimulated or transformed avian haemopoietic cell lines to determine the changes in the expression profiles of these important regulatory molecules during these biological events. There were significant changes in the expression of a number of miRNAs, including miR-155, in chicken B cells stimulated with CD40 ligand. Similarly, avian leukosis virus (ALV-transformed DT40 cells also showed changes in miRNA expression in relation to the naïve cells. Embryonic stem cell line BP25 demonstrated a distinct cluster of upregulated miRNAs, many of which were shown previously to be involved in embryonic stem cell development. Finally, chicken macrophage cell line HD11 showed changes in miRNA profiles, some of which are thought to be related to the transformation by v-myc transduced by the virus. This work represents the first publication of a catalog of microRNA expression in a range of important avian cells and provides insights into the potential roles of miRNAs in the hematopoietic lineages of cells in a model non-mammalian species.

  15. Expression of CD44 in Cultured Human Trabecular Meshwork Cells

    Institute of Scientific and Technical Information of China (English)

    Zhongguo Li; Hong Zhang

    2004-01-01

    Purpose:To determine whether cultured human trabecular meshwork cells express CD44 and to discuss their possible relationship with primary open angle glaucoma.Methods:Human trabecular meshwork cells were cultured in DMEM/F12 media. Total RNAs from the cells were extracted with Trizol reagent. Messenger RNA expression of CD44 in human trabecular meshwork cells was examined by using reverse transcriptasepolymerase chain reaction ( RT-PCR ) analysis. Expression of CD44 was confirmed by Western-blotting and immunofiuorescent microscopy. Effect of CD44-specific antisense oligonucleotide on adhesion of trabecular meshwork cells to hyaluronate was determined by MTT assay.Results:A single RT-PCR product whose size was 471bp was obtained.A band about 80kD was stained by Western-blot. Immunofiuorescent examination of expression of CD44 on the cell surface was positive and reactions were mainly localized in cell membranes.Adhesion of trabecular meshwork cells to hyaluronate was inhibited by CD44-specific antisense oligonucleotide.Conclusions: Cultured human trabecular meshwork cells express CD44. CD44 may play a role in pathogenesis of primary open angle glaucoma. Eye Science 2004;20:52-56.

  16. Modulation of Vascular Cell Function by Bim Expression

    Directory of Open Access Journals (Sweden)

    Margaret E. Morrison

    2013-01-01

    Full Text Available Apoptosis of vascular cells, including pericytes and endothelial cells, contributes to disease pathogenesis in which vascular rarefaction plays a central role. Bim is a proapoptotic protein that modulates not only apoptosis but also cellular functions such as migration and extracellular matrix (ECM protein expression. Endothelial cells and pericytes each make a unique contribution to vascular formation and function although the details require further delineation. Here we set out to determine the cell autonomous impact of Bim expression on retinal endothelial cell and pericyte function using cells prepared from Bim deficient (Bim−/− mice. Bim−/− endothelial cells displayed an increased production of ECM proteins, proliferation, migration, adhesion, and VEGF expression but, a decreased eNOS expression and nitric oxide production. In contrast, pericyte proliferation decreased in the absence of Bim while migration, adhesion, and VEGF expression were increased. In addition, we demonstrated that the coculturing of either wild-type or Bim−/− endothelial cells with Bim−/− pericytes diminished their capillary morphogenesis. Thus, our data further emphasizes the importance of vascular cell autonomous regulatory mechanisms in modulation of vascular function.

  17. Estrogen regulation of TRPM8 expression in breast cancer cells

    Directory of Open Access Journals (Sweden)

    Sevestre Henri

    2010-05-01

    Full Text Available Abstract Background The calcium-permeable cation channel TRPM8 (melastatin-related transient receptor potential member 8 is over-expressed in several cancers. The present study aimed at investigating the expression, function and potential regulation of TRPM8 channels by ER alpha (estrogen receptor alpha in breast cancer. Methods RT-PCR, Western blot, immuno-histochemical, and siRNA techniques were used to investigate TRPM8 expression, its regulation by estrogen receptors, and its expression in breast tissue. To investigate the channel activity in MCF-7 cells, we used the whole cell patch clamp and the calcium imaging techniques. Results TRPM8 channels are expressed at both mRNA and protein levels in the breast cancer cell line MCF-7. Bath application of the potent TRPM8 agonist Icilin (20 μM induced a strong outwardly rectifying current at depolarizing potentials, which is associated with an elevation of cytosolic calcium concentration, consistent with established TRPM8 channel properties. RT-PCR experiments revealed a decrease in TRPM8 mRNA expression following steroid deprivation for 48 and 72 hours. In steroid deprived medium, addition of 17-beta-estradiol (E2, 10 nM increased both TRPM8 mRNA expression and the number of cells which respond to Icilin, but failed to affect the Ca2+ entry amplitude. Moreover, silencing ERα mRNA expression with small interfering RNA reduced the expression of TRPM8. Immuno-histochemical examination of the expression of TRPM8 channels in human breast tissues revealed an over-expression of TRPM8 in breast adenocarcinomas, which is correlated with estrogen receptor positive (ER+ status of the tumours. Conclusion Taken together, these results show that TRPM8 channels are expressed and functional in breast cancer and that their expression is regulated by ER alpha.

  18. Expression and clinical significance of sulfiredoxin expression in cervical squamous cell carcinoma tissue

    Directory of Open Access Journals (Sweden)

    Xiao-yan CHEN

    2015-10-01

    Full Text Available Objective To inquire into the expression and its clinical significance of sulfiredoxin (Srx in cervical squamous cell carcinoma tissue. Methods SABC immunohistochemical method was used to detect the expression levels of Srx in specimens of 104 cervical squamous cell carcinoma and the corresponding adjacent tissues, 15 cervical intraepithelial neoplasm (CIN Ⅲ, and 20 normal cervical squamous cell epithelium tissue. The relationship between the expression of Srx protein and clinical pathological parameters of the cancer was also analyzed. Results The positive expression rates of Srx in CIN Ⅲ and cervical squamous cell carcinoma [73.3%(11/15 and 82.7%(86/104, respectively] were significantly higher than that in normal cervical tissue [35.0%(7/20, χ2=17.778, P=0.000]. Meanwhile, Srx expression in cervical cancer specimens was significantly higher than that in normal adjacent tissues (χ2=56.224, P=0.000. The positive expression of Srx in cervical squamous cell carcinoma was significantly correlated with lymph node metastasis, the depth of cancer invasion, and the infiltration of blood vessels (P0.05. Conclusion The higher expression of Srx protein might be a valuable marker for the early diagnosis and evaluation of prognosis in patients with cervical squamous cell carcinoma. DOI: 10.11855/j.issn.0577-7402.2015.08.11

  19. Expression of heparanase in basal cell carcinoma and squamous cell carcinoma*

    Science.gov (United States)

    Pinhal, Maria Aparecida Silva; Almeida, Maria Carolina Leal; Costa, Alessandra Scorse; Theodoro, Thérèse Rachell; Serrano, Rodrigo Lorenzetti; Machado Filho, Carlos D'Apparecida Santos

    2016-01-01

    Background Heparanase is an enzyme that cleaves heparan sulfate chains. Oligosaccharides generated by heparanase induce tumor progression. Basal cell carcinoma and squamous cell carcinoma comprise types of nonmelanoma skin cancer. Objectives Evaluate the glycosaminoglycans profile and expression of heparanase in two human cell lines established in culture, immortalized skin keratinocyte (HaCaT) and squamous cell carcinoma (A431) and also investigate the expression of heparanase in basal cell carcinoma, squamous cell carcinoma and eyelid skin of individuals not affected by the disease (control). Methods Glycosaminoglycans were quantified by electrophoresis and indirect ELISA method. The heparanase expression was analyzed by quantitative RT-PCR (qRTPCR). Results The A431 strain showed significant increase in the sulfated glycosaminoglycans, increased heparanase expression and decreased hyaluronic acid, comparing to the HaCaT lineage. The mRNA expression of heparanase was significantly higher in Basal cell carcinoma and squamous cell carcinoma compared with control skin samples. It was also observed increased heparanase expression in squamous cell carcinoma compared to the Basal cell carcinoma. Conclusion The glycosaminoglycans profile, as well as heparanase expression are different between HaCaT and A431 cell lines. The increased expression of heparanase in Basal cell carcinoma and squamous cell carcinoma suggests that this enzyme could be a marker for the diagnosis of such types of non-melanoma cancers, and may be useful as a target molecule for future alternative treatment.

  20. Adrenomedullin Expression by Gastric Epithelial Cells in Response to Infection

    OpenAIRE

    Robert P. Allaker; Kapas, Supriya

    2003-01-01

    Many surface epithelial cells express adrenomedullin, a multifunctional peptide found in a wide number of body and cell systems. Recently, we and others have proposed that adrenomedullin has an important novel role in host defense. This peptide has many properties in common with other cationic antimicrobial peptides, including the human β-defensins. Upon exposure of human gastric epithelial cells to viable cells of invasive or noninvasive strains of Helicobacter pylori, Escherichia coli, Salm...

  1. Salmonella induces PD-L1 expression in B cells.

    Science.gov (United States)

    Lopez-Medina, Marcela; Perez-Lopez, Araceli; Alpuche-Aranda, Celia; Ortiz-Navarrete, Vianney

    2015-10-01

    Salmonella persists for a long time in B cells; however, the mechanism(s) through which infected B cells avoid effector CD8 T cell responses has not been characterized. In this study, we show that Salmonella infects and survives within all B1 and B2 cell subpopulations. B cells are infected with a Salmonella typhimurium strain expressing an ovalbumin (OVA) peptide (SIINFEKL) to evaluate whether B cells process and present Salmonella antigens in the context of MHC-I molecules. Our data showed that OVA peptides are presented by MHC class I K(b)-restricted molecules and the presented antigen is generated through proteasomal degradation and vacuolar processing. In addition, Salmonella-infected B cells express co-stimulatory molecules such as CD40, CD80, and CD86 as well as inhibitory molecules such as PD-L1. Thus, the cross-presentation of Salmonella antigens and the expression of activation molecules suggest that infected B cells are able to prime and activate specific CD8(+) T cells. However, the Salmonella infection-stimulated expression of PD-L1 suggests that the PD-1/PD-L1 pathway may be involved in turning off the cytotoxic effector response during Salmonella persistent infection, thereby allowing B cells to become a reservoir for the bacteria.

  2. Expression of Bcl-2 in cells with different telomerase activities

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Both telomerase and Bcl-2 are important genes in controlling apoptosis. The activation of telomerase and the abnormal regulation of Bcl-2 are also closely related to carcinogenesis. However, little is known about the linkage between telomerase and Bcl-2. The effect of activated telomerase on the expression of Bcl-2 has been investigated. It is demonstrated that in tumor and transformed cells with higher telomerase activity, Bcl-2 expression is significantly lower than that in telomerase negative or less telomerose activity cells. Further study showed that in the telomerase gene-transformed 2BS-fibroblasts, Bcl-2 expression is inhibited significantly while the exogenous telomerase catalytic subunit gene is re-expressed in fibroblasts. Results indicated that there might be a certain linkage between the expression of telomerase and Bcl-2, and overexpression of exogenous telomerase gene might down regulate the expression of Bcl-2.

  3. Expression of aquaporin-1 in SMMC-7221 liver carcinoma cells promotes cell migration

    Institute of Scientific and Technical Information of China (English)

    LI Yongming; FENG Xuechao; YANG Hong; MA Tonghui

    2006-01-01

    Migration of tumor cells is a crucial step in tumor invasion and metastasis. Here we provide evidence that aquaporin expression is involved in tumor cell migration. RT-PCR, immunofluorescence and Western blot analysis demonstrated the AQP1 protein expression on the plasma membrane of SMMC-7221 human hepatoma cells. SMMC-7221 cell clones with high (SMMC-7221hPf) and low (SMMC-7221/Pf) water permeability were identified by functional assays with corresponding high and low AQP1 expression. Cell migration rate was remarkably higher in SMMC-7221hPf cells than SMMC-7221/Pf cells, assessed by Boyden chamber and wound healing assays, whereas cell growth and adhesion were not different. Adenovirus-mediated AQP1 expression in SMMC-7221/Pf cells increased their water permeability and migration rate. These results provide the first evidence that aquaporin-mediated membrane water permeability enhances tumor cell migration and may be associated with tumor invasion and metastasis.

  4. Expression of EPO Receptor in Pancreatic Cells and Its Effect on Cell Apoptosis

    Institute of Scientific and Technical Information of China (English)

    Hongxia SHUAI; Ji ZHANG; Yikai YU; Muxun ZHANG

    2008-01-01

    In order to explore the expression of erythropoietin receptor (EPOR) in pancreatic cell ine NIT-1 and its effect on cell apoptosis after binding with erythropoietin (EPO), NIT-1 cells were cultured and expanded. The expression of EPOR was detected using electrophoresis. NIT-1 apoptosis was induced by cytokines and their effects on cell apoptosis and cell insulin secretion were assayed after binding of EPO to EPOR. The results showed that EPOR was expressed in NIT-1 cells. Recom- binant human EPO (rHuEPO) had no effect on cell apoptosis but significantly inhibited apoptosis in- duced by cytokines, rHuEPO had no effect on cell insulin secretion but significantly improved insulin secretion inhibited by cytokines. From these findings, it was concluded that EPOR was expressed in NIT-1 cells and EPO could protect N1T-1 cells from apoptosis induced by cytokines.

  5. Cytokine Expression in Homozygous Sickle Cell Anaemia

    Directory of Open Access Journals (Sweden)

    Nnodim Johnkennedy

    2015-01-01

    Full Text Available Background: Sickle cell anaemia is an inherited disease in which the red blood cells become rigid and sticky, and change from being disc-shaped to being crescent-shaped. The change in shape is due to the presence of an abnormal form of haemoglobin. This results in severe pain and damage to some organs. Aim and Objective: The study was carried out to determine the levels of cytokine in sickle cell anemia. Material and Methods: Thirty confirmed sickle cell patients in steady state (HbSS-SS and thirty persons with normal haemoglobin (HbAA as well as sixteen sickle cell disease in crises (HbSS-cr between the ages of 15 to 30 years were selected in this study. Cytokines including interleukin 1 beta (IL- 1β, interleukin 2 (IL- 2, interleukin (IL-6, tumour necrosis factor alpha (TNF-α, and interferon gamma (IFN- λ were measured by commercially available ELISA kits. Results: The results obtained showed that the levels of TNF-α and IL-6 in sickle cell anaemia patients in crisis were significantly elevated when compared with sickle cell in steady state (P<0.05. Similarly, the levels of IL-1β, IL-6, and IFN- λ were significantly increased in sickle cell anaemia stable state when compared to HbAA subjects (P<0.05. Conclusion: This may probably implies that cytokine imbalance is implicated in the pathogenesis of sickle cell crisis. Also, cytokines could be used as an inflammatory marker as well as related marker in disease severity and hence therapeutic intervention.

  6. Ectopic ERK Expression Induces Phenotypic Conversion of C10 Cells and Alters DNA Methyltransferase Expression

    Energy Technology Data Exchange (ETDEWEB)

    Sontag, Ryan L.; Weber, Thomas J.

    2012-05-04

    In some model systems constitutive extracellular signal regulated kinase (ERK) activation is sufficient to promote an oncogenic phenotype. Here we investigate whether constitutive ERK expression influences phenotypic conversion in murine C10 type II alveolar epithelial cells. C10 cells were stably transduced with an ERK1-green fluorescent protein (ERK1-GFP) chimera or empty vector and ectopic ERK expression was associated with the acquisition of soft agar focus-forming potential in late passage, but not early passage cells. Late passage ERK1-GFP cells exhibited a significant increase in the expression of DNA methyl transferases (DNMT1 and 3b) and a marked increase in sensitivity to 5-azacytidine (5-azaC)-mediated toxicity, relative to early passage ERK1-GFP cells and vector controls. The expression of xeroderma pigmentosum complementation group A (XPA) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) were significantly increased in late passage cells, suggesting enhanced DNA damage recognition and repair activity which we interpret as a reflection of genomic instability. Phospho-ERK levels were dramatically decreased in late passage ERK1-GFP cells, relative to early passage and vector controls, and phospho-ERK levels were restored by treatment with sodium orthovanadate, indicating a role for phosphatase activity in this response. Collectively these observations suggest that ectopic ERK expression promotes phenotypic conversion of C10 cells that is associated with latent effects on epigenetic programming and phosphatase activities.

  7. Recombinant cells that highly express chromosomally-integrated heterologous gene

    Science.gov (United States)

    Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

    2007-03-20

    Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

  8. Gene expression analysis of in vivo fluorescent cells.

    Directory of Open Access Journals (Sweden)

    Konstantin Khodosevich

    Full Text Available BACKGROUND: The analysis of gene expression for tissue homogenates is of limited value because of the considerable cell heterogeneity in tissues. However, several methods are available to isolate a cell type of interest from a complex tissue, the most reliable one being Laser Microdissection (LMD. Cells may be distinguished by their morphology or by specific antigens, but the obligatory staining often results in RNA degradation. Alternatively, particular cell types can be detected in vivo by expression of fluorescent proteins from cell type-specific promoters. METHODOLOGY/PRINCIPAL FINDINGS: We developed a technique for fixing in vivo fluorescence in brain cells and isolating them by LMD followed by an optimized RNA isolation procedure. RNA isolated from these cells was of equal quality as from unfixed frozen tissue, with clear 28S and 18S rRNA bands of a mass ratio of approximately 2ratio1. We confirmed the specificity of the amplified RNA from the microdissected fluorescent cells as well as its usefulness and reproducibility for microarray hybridization and quantitative real-time PCR (qRT-PCR. CONCLUSIONS/SIGNIFICANCE: Our technique guarantees the isolation of sufficient high quality RNA obtained from specific cell populations of the brain expressing soluble fluorescent marker, which is a critical prerequisite for subsequent gene expression studies by microarray analysis or qRT-PCR.

  9. Expression and function of nicotinic acetylcholine receptors in stem cells

    Directory of Open Access Journals (Sweden)

    Carlos M. Carballosa

    2016-07-01

    Full Text Available Nicotinic acetylcholine receptors are prototypical ligand gated ion channels typically found in muscular and neuronal tissues. Functional nicotinic acetylcholine receptors, however, have also recently been identified on other cell types, including stem cells. Activation of these receptors by the binding of agonists like choline, acetylcholine, or nicotine has been implicated in many cellular changes. In regards to stem cell function, nicotinic acetylcholine receptor activation leads to changes in stem cell proliferation, migration and differentiation potential. In this review we summarize the expression and function of known nicotinic acetylcholine receptors in different classes of stem cells including: pluripotent stem cells, mesenchymal stem cells, periodontal ligament derived stem cells, and neural progenitor cells and discuss the potential downstream effects of receptor activation on stem cell function.

  10. HIV-1 induces DCIR expression in CD4+ T cells.

    Directory of Open Access Journals (Sweden)

    Alexandra A Lambert

    Full Text Available The C-type lectin receptor DCIR, which has been shown very recently to act as an attachment factor for HIV-1 in dendritic cells, is expressed predominantly on antigen-presenting cells. However, this concept was recently challenged by the discovery that DCIR can also be detected in CD4(+ T cells found in the synovial tissue from rheumatoid arthritis (RA patients. Given that RA and HIV-1 infections share common features such as a chronic inflammatory condition and polyclonal immune hyperactivation status, we hypothesized that HIV-1 could promote DCIR expression in CD4(+ T cells. We report here that HIV-1 drives DCIR expression in human primary CD4(+ T cells isolated from patients (from both aviremic/treated and viremic/treatment naive persons and cells acutely infected in vitro (seen in both virus-infected and uninfected cells. Soluble factors produced by virus-infected cells are responsible for the noticed DCIR up-regulation on uninfected cells. Infection studies with Vpr- or Nef-deleted viruses revealed that these two viral genes are not contributing to the mechanism of DCIR induction that is seen following acute infection of CD4(+ T cells with HIV-1. Moreover, we report that DCIR is linked to caspase-dependent (induced by a mitochondria-mediated generation of free radicals and -independent intrinsic apoptotic pathways (involving the death effector AIF. Finally, we demonstrate that the higher surface expression of DCIR in CD4(+ T cells is accompanied by an enhancement of virus attachment/entry, replication and transfer. This study shows for the first time that HIV-1 induces DCIR membrane expression in CD4(+ T cells, a process that might promote virus dissemination throughout the infected organism.

  11. Expression of cadherin and NCAM in human small cell lung cancer cell lines and xenografts

    DEFF Research Database (Denmark)

    Rygaard, K; Møller, C; Bock, E;

    1992-01-01

    Tumour cell adhesion, detachment and aggregation seem to play an important part in tumour invasion and metastasis, and numerous cell adhesion molecules are expressed by tumour cells. Several families of cell-cell adhesion molecules have been described, of which two groups are particularly well...... characterised, the cadherin family and the Ig superfamily member, neural cell adhesion molecule (NCAM). We investigated expression of these two adhesion molecule families in small cell lung cancer (SCLC) cell lines and xenografts by immunoblotting. Nineteen tumours established from 15 patients with SCLC were...... embryonic development, which may play a role in connection with tumour invasion and metastasis, was found in 14/18 NCAM expressing SCLC tumours. Individual tumours grown as cell lines and as nude mouse xenografts showed no qualitative differences in cadherin or NCAM expression....

  12. CellCODE: a robust latent variable approach to differential expression analysis for heterogeneous cell populations

    OpenAIRE

    Chikina, Maria; Zaslavsky, Elena; Sealfon, Stuart C.

    2015-01-01

    Motivation: Identifying alterations in gene expression associated with different clinical states is important for the study of human biology. However, clinical samples used in gene expression studies are often derived from heterogeneous mixtures with variable cell-type composition, complicating statistical analysis. Considerable effort has been devoted to modeling sample heterogeneity, and presently, there are many methods that can estimate cell proportions or pure cell-type expression from m...

  13. Microarray gene expression profiling and analysis in renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Sadhukhan Provash

    2004-06-01

    Full Text Available Abstract Background Renal cell carcinoma (RCC is the most common cancer in adult kidney. The accuracy of current diagnosis and prognosis of the disease and the effectiveness of the treatment for the disease are limited by the poor understanding of the disease at the molecular level. To better understand the genetics and biology of RCC, we profiled the expression of 7,129 genes in both clear cell RCC tissue and cell lines using oligonucleotide arrays. Methods Total RNAs isolated from renal cell tumors, adjacent normal tissue and metastatic RCC cell lines were hybridized to affymatrix HuFL oligonucleotide arrays. Genes were categorized into different functional groups based on the description of the Gene Ontology Consortium and analyzed based on the gene expression levels. Gene expression profiles of the tissue and cell line samples were visualized and classified by singular value decomposition. Reverse transcription polymerase chain reaction was performed to confirm the expression alterations of selected genes in RCC. Results Selected genes were annotated based on biological processes and clustered into functional groups. The expression levels of genes in each group were also analyzed. Seventy-four commonly differentially expressed genes with more than five-fold changes in RCC tissues were identified. The expression alterations of selected genes from these seventy-four genes were further verified using reverse transcription polymerase chain reaction (RT-PCR. Detailed comparison of gene expression patterns in RCC tissue and RCC cell lines shows significant differences between the two types of samples, but many important expression patterns were preserved. Conclusions This is one of the initial studies that examine the functional ontology of a large number of genes in RCC. Extensive annotation, clustering and analysis of a large number of genes based on the gene functional ontology revealed many interesting gene expression patterns in RCC. Most

  14. Expression of stromelysin 3 in basal cell carcinomas.

    Science.gov (United States)

    Cribier, B; Noacco, G; Peltre, B; Grosshans, E

    2001-01-01

    Stromelysin 3 is a member of the metalloproteinase family, which is expressed in various remodelling processes. The prognosis of breast cancers and squamous cell carcinomas is correlated to the level of expression of this protein. The purpose of the present work was to evaluate the expression of stromelysin 3 in the major types of basal cell carcinomas. We selected cases of primary tumours that were fully excised, without previous biopsy: 40 Pinkus tumors, 40 superficial, 40 nodular, 38 morpheiform basal cell carcinomas and 10 cases showing deep subcutaneous or muscular invasion. Immunohistochemistry was carried out using monoclonal anti-ST3 antibodies (MC Rio, IGBMC Strasbourg), and evaluated on a semi-quantitative scale from 0 to 3. Positively stained cells were restricted to the periphery of the epithelial cells, which, by contrast, never expressed stromelysin 3. The global rate of expression was 27% in Pinkus tumors, 65% in superficial, 72.5% in nodular, 87% in morpheiform and 100% in deeply invasive carcinomas. The rates of tumours showing the highest number of positively stained cells (class 2 or 3) were respectively 7.5%, 20%, 45%, 63% and 100%. This systematic study of stromelysin3 expression in basal cell carcinomas confirms that it is a marker of poor prognosis, because the rate of positive tumours was much higher in aggressive carcinomas. Moreover, the majority of tumours showing an intense expression (i.e. the highest number of positively stained cells in their stroma) were of the morpheiform and deeply invasive types, which are of poor prognosis. Altogether, the studies performed on cutaneous tumours are consistent with the theory of stromelysin 3 playing an active role in tumour progression.

  15. Expression of GABAergic receptors in mouse taste receptor cells.

    Directory of Open Access Journals (Sweden)

    Margaret R Starostik

    Full Text Available BACKGROUND: Multiple excitatory neurotransmitters have been identified in the mammalian taste transduction, with few studies focused on inhibitory neurotransmitters. Since the synthetic enzyme glutamate decarboxylase (GAD for gamma-aminobutyric acid (GABA is expressed in a subset of mouse taste cells, we hypothesized that other components of the GABA signaling pathway are likely expressed in this system. GABA signaling is initiated by the activation of either ionotropic receptors (GABA(A and GABA(C or metabotropic receptors (GABA(B while it is terminated by the re-uptake of GABA through transporters (GATs. METHODOLOGY/PRINCIPAL FINDINGS: Using reverse transcriptase-PCR (RT-PCR analysis, we investigated the expression of different GABA signaling molecules in the mouse taste system. Taste receptor cells (TRCs in the circumvallate papillae express multiple subunits of the GABA(A and GABA(B receptors as well as multiple GATs. Immunocytochemical analyses examined the distribution of the GABA machinery in the circumvallate papillae. Both GABA(A-and GABA(B- immunoreactivity were detected in the peripheral taste receptor cells. We also used transgenic mice that express green fluorescent protein (GFP in either the Type II taste cells, which can respond to bitter, sweet or umami taste stimuli, or in the Type III GAD67 expressing taste cells. Thus, we were able to identify that GABAergic receptors are expressed in some Type II and Type III taste cells. Mouse GAT4 labeling was concentrated in the cells surrounding the taste buds with a few positively labeled TRCs at the margins of the taste buds. CONCLUSIONS/SIGNIFICANCE: The presence of GABAergic receptors localized on Type II and Type III taste cells suggests that GABA is likely modulating evoked taste responses in the mouse taste bud.

  16. Regulation of osteoprotegerin expression by Notch signaling in human oral squamous cell carcinoma cell line

    Institute of Scientific and Technical Information of China (English)

    Jeeranan Manokawinchoke; Thanaphum Osathanon; Prasit Pavasant

    2016-01-01

    Objective: To investigate the influence of Notch signaling on osteoprotegerin (OPG) expression in a human oral squamous cell carcinoma cell line. Methods: Activation of Notch signaling was performed by seeding cells on Jagged1 immobilized surfaces. In other experiments, a γ-secretase inhibitor was added to the culture medium to inhibit intracellular Notch signaling. OPG mRNA and protein were determined by real-time PCR and ELISA, respectively. Finally, publicly available microarray database analysis was performed using connection up- or down-regulation expression analysis of microarrays software. Results: Jagged1-treatment of HSC-4 cells enhanced HES1 and HEY1 mRNA expres-sion, confirming the intracellular activation of Notch signaling. OPG mRNA and protein levels were significantly suppressed upon Jagged1 treatment. Correspondingly, HSC-4 cells treated with a γ-secretase inhibitor resulted in a significant reduction of HES1 and HEY1 mRNA levels, and a marked increase in OPG protein expression was observed. These results implied that Notch signaling regulated OPG expression in HSC-4 cells. However, Jagged1 did not alter OPG expression in another human oral squamous cell carcinoma cell line (HSC-5) or a human head and neck squamous cell carcinoma cell line (HN22). Conclusions: Notch signaling regulated OPG expression in an HSC-4 cell line and this mechanism could be cell line specific.

  17. Tff3 is Expressed in Neurons and Microglial Cells

    Directory of Open Access Journals (Sweden)

    Ting Fu

    2014-11-01

    Full Text Available Background/Aims: The trefoil factor family (TFF peptide TFF3 is typically secreted by mucous epithelia, but is also expressed in the immune system and the brain. It was the aim of this study to determine the cerebral cell types which express Tff3. Methods: Primary cultures from rat embryonic or neonatal cerebral cortex and hippocampus, respectively, were studied by means of RT-PCR and immunofluorescence. Moreover, Tff3 expression was localized by immunocytochemistry in sections of adult rat cerebellum. Results: Tff3 transcripts were detectable in neural cultures of both the cortex and the hippocampus as well as in glial cell-enriched cultures. Tff3 peptide co-localized with Map2 indicating an expression in neurons in vitro. The neuronal expression was confirmed by immunofluorescence studies of adult rat cerebellum. Furthermore, Tff3 peptide showed also a clear co-localization with Iba-1 in vitro typical of activated microglial cells. Conclusion: The neuronal expression of Tff3 is in line with a function of a typical neuropeptide influencing, e.g., fear, memory, depression and motoric skills. The expression in activated microglial cells, which is demonstrated here for the first time, points towards a possible function for Tff3 in immune reactions in the CNS. This opens a plethora of additional possible functions for Tff3 including synaptic plasticity and cognition as well as during neuroinflammatory diseases and psychiatric disorders.

  18. Cell-specific expression of TLR9 isoforms in inflammation.

    Science.gov (United States)

    McKelvey, Kelly J; Highton, John; Hessian, Paul A

    2011-02-01

    Toll-like receptors (TLRs) are key pattern recognition receptors during an immune response. With five isoforms of human TLR9 described, we hypothesised that differential expression of TLR9 isoforms in different cell types would result in variable contributions to the overall input from TLR9 during inflammation. We assessed the molecular expression of the TLR9 isoforms, TLR9-A, -C and -D. In normal peripheral blood mononuclear cells, B-lymphocytes express ∼100-fold more TLR9-A transcript than monocytes or T-lymphocytes, which predominantly express the TLR9-C transcript. Switches in isoform predominance accompany B-lymphocyte development. TLR9 protein expression in rheumatoid inflammatory lesions reflected the TLR9 isoform expression by immune cells. Herein we suggest that B-lymphocytes and plasmacytoid dendritic cells contribute the ∼3-fold higher TLR9-A transcript levels observed in inflamed synovium when compared to subcutaneous rheumatoid nodules. In contrast, macrophages and T-lymphocytes contribute the ∼4-fold higher TLR9-C transcript levels seen in nodules, compared to synovia. From protein sequence, predictions of subcellular localisation suggest TLR9-B may locate to the mitochondria, whereas TLR9-D adopts an opposing orientation in the endoplasmic reticulum. Consistent with this, structure models raise the possibility of alternative ligands for the TLR9-B and TLR9-D variants. Our results highlight differences in the expression of human TLR9 isoforms in normal and inflamed tissues, with differing contributions to inflammation.

  19. CD44 variant expression in cutaneous T-cell lymphoma.

    Science.gov (United States)

    Orteu, C H; Li, W; Allen, M H; Smith, N P; Barker, J N; Whittaker, S J

    1997-07-01

    Expression of the lymphocyte homing receptor CD44 and its splice variants have been linked to tumour dissemination and poor prognosis in non-Hodgkin's lymphoma. Specifically, the in vitro expression of variant exon V6 confers metastatic potential in rat pancreatic carcinoma cell lines. In this study, we investigated the expression of CD44 splice variants in cutaneous T-cell lymphomas, including patients with mycosis fungoides (MF), Sezary syndrome (SS), large-cell anaplastic lymphoma (LCAL) and HTLV1-associated cutaneous lymphoma. In addition, 4 involved lymph nodes from 2 patients with MF and 1 patient with SS were examined. Inflammatory dermatoses, lichen planus and psoriasis, and normal skin were also studied. Immunohistochemistry was performed using a panel of monoclonal antibodies, including those with specificity for CD44H (standard isoform) and variant exons V3, V6 and V8-9. Normal epidermal keratinocytes were consistently CD44H and CD44 V3, V6 and V8-9 positive. In all the different clinicopathological subtypes and stages of cutaneous T-cell lymphomas, including involved lymph nodes, tumour cells consistently expressed CD44H, but were CD44 V3 and V6 negative. CD44 V8-9 was expressed on a majority of tumour cells in 2/5 LCAL and on occasional tumour cells in 2/5 LCAL. Occasional V8-9 positive tumour cells were also identified in 6/13 MF, 1/4 SS and 3/4 HTLV1. In 2/3 lymph node samples from 2 patients with tumour-stage MF, CD44 V8-9 expression was found on a small percentage of atypical mononuclear cells. Scattered V8-9 positive dermal mononuclear cells were present in sections of lichen planus and psoriasis. We have found no evidence to suggest that the metastasis-associated CD44 variant exon (V6) is expressed in cutaneous T-cell lymphoma, or that CD44H expression is associated with an adverse prognostic group. It is not clear whether the strong expression of CD44 V8-9 in 2 patients with CD30 positive LCAL reflects activation status or metastatic potential.

  20. Estrogen induces Vav1 expression in human breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Ming-juan Du

    Full Text Available Vav1, a guanine nucleotide exchange factor (GEF for Rho family GTPases, is a hematopoietic protein involved in a variety of cellular events. In recent years, aberrant expression of Vav1 has been reported in non-hematopoietic cancers including human breast cancer. It remains to be answered how Vav1 is expressed and what Vav1 does in its non-resident tissues. In this study, we aimed to explore the mechanism for Vav1 expression in breast cancer cells in correlation with estrogen-ER pathway. We not only verified the ectopic expression of Vav1 in human breast cancer cell lines, but also observed that Vav1 expression was induced by 17β-estradiol (E2, a typical estrogen receptor (ER ligand, in ER-positive cell lines. On the other hand, Tamoxifen, a selective estrogen receptor modulator (SERM, and ICI 182,780, an ER antagonist, suppressed the expression of Vav1. The estrogen receptor modulating Vav1 expression was identified to be α form, not β. Furthermore, treatment of E2 increased the transcription of vav1 gene by enhancing the promoter activity, though there was no recognizable estrogen response element (ERE. Nevertheless, two regions at the vav1 gene promoter were defined to be responsible for E2-induced activation of vav1 promoter. Chromatin immunoprecipitation (ChIP and co-immunoprecipitation (Co-IP analyses suggested that ERα might access to the vav1 promoter via interacting with transcription factors, c-Myb and ELF-1. Consequently, the enhanced expression of Vav1 led to the elevation of Cyclin D1 and the progression of cell cycle. The present study implies that estrogen-ER modulates the transcription and expression of Vav1, which may contribute to the proliferation of cancerous cells.

  1. Expression of Hepatitis B Surface Antigen Gene in Ginseng Cells

    Institute of Scientific and Technical Information of China (English)

    YU Hai-peng; XUE Yan; AN Wei; LIU Dan; HAO Shu-mei; SHENG Jun

    2009-01-01

    The recombinant plasmid pBIBSa containing the HBsAg DNA fragment was transferred into Agrobacte-rium tumefaciens strain LBA4404 directly. Ginseng cells were transfected with A. Tumefaciens carrying pBIBSa and the ginseng cell lines carrying HBsAg-S gene were obtained. The presence of target gene in the transfect cells was confirmed by PCR and RT-PCR. A clear band at the site of 700 bp was observed by agarose electrophoresis analysis of the samples containing the target gene. HBsAg expressed by the transgenic ginseng cells was detected by Western blot. Maximum expression levels of 184 ng HBsAg/g FW and 0. 009% of the total soluble proteins were observed by ELISA. HBsAg in ginseng cells was located both on the cell membrane and in the nuclei.

  2. SPARC expression induces cell cycle arrest via STAT3 signaling pathway in medulloblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Chetty, Chandramu [Department of Cancer Biology and Pharmacology, University of Illinois College of Medicine at Peoria, One Illini Drive, Peoria, IL-61605 (United States); Dontula, Ranadheer [Section of Hematology/Oncology, Department of Medicine, University of Illinois College of Medicine at Chicago, 840 South Wood Street, Suite 820-E, Chicago, IL-60612 (United States); Ganji, Purnachandra Nagaraju [Department of Cancer Biology and Pharmacology, University of Illinois College of Medicine at Peoria, One Illini Drive, Peoria, IL-61605 (United States); Gujrati, Meena [Department of Pathology, University of Illinois College of Medicine at Peoria, One Illini Drive, Peoria, IL-61605 (United States); Lakka, Sajani S., E-mail: slakka@uic.edu [Section of Hematology/Oncology, Department of Medicine, University of Illinois College of Medicine at Chicago, 840 South Wood Street, Suite 820-E, Chicago, IL-60612 (United States)

    2012-01-13

    Highlights: Black-Right-Pointing-Pointer Ectopic expression of SPARC impaired cell proliferation in medulloblastoma cells. Black-Right-Pointing-Pointer SPARC expression induces STAT3 mediated cell cycle arrest in medulloblastoma cells. Black-Right-Pointing-Pointer SPARC expression significantly inhibited pre-established tumor growth in nude-mice. -- Abstract: Dynamic cell interaction with ECM components has profound influence in cancer progression. SPARC is a component of the ECM, impairs the proliferation of different cell types and modulates tumor cell aggressive features. We previously reported that SPARC expression significantly impairs medulloblastoma tumor growth in vivo. In this study, we demonstrate that expression of SPARC inhibits medulloblastoma cell proliferation. MTT assay indicated a dose-dependent reduction in tumor cell proliferation in adenoviral mediated expression of SPARC full length cDNA (Ad-DsRed-SP) in D425 and UW228 cells. Flow cytometric analysis showed that Ad-DsRed-SP-infected cells accumulate in the G2/M phase of cell cycle. Further, immunoblot and immunoprecipitation analyses revealed that SPARC induced G2/M cell cycle arrest was mediated through inhibition of the Cyclin-B-regulated signaling pathway involving p21 and Cdc2 expression. Additionally, expression of SPARC decreased STAT3 phosphorylation at Tyr-705; constitutively active STAT3 expression reversed SPARC induced G2/M arrest. Ad-DsRed-SP significantly inhibited the pre-established orthotopic tumor growth and tumor volume in nude-mice. Immunohistochemical analysis of tumor sections from mice treated with Ad-DsRed-SP showed decreased immunoreactivity for pSTAT3 and increased immunoreactivity for p21 compared to tumor section from mice treated with mock and Ad-DsRed. Taken together our studies further reveal that STAT3 plays a key role in SPARC induced G2/M arrest in medulloblastoma cells. These new findings provide a molecular basis for the mechanistic understanding of the

  3. HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    OpenAIRE

    Huang, Jin-Lan; Ren, Ting-yu; Cao, Shun-wang; Zheng, Shi-hao; Hu, Xiu-mei; Hu, Yan-Wei; Lin, Li; Chen, Jing; Zheng, Lei; Wang, Qian

    2015-01-01

    Accumulating evidence supports an important role for the hepatitis B virus x protein (HBx) in the pathogenesis of hepatitis B virus (HBV)-induced hepatocellular carcinoma (HCC), but the underlying mechanisms are not entirely clear. Here, we identified a novel long noncoding RNA (lncRNA) DBH-AS1 involved in the HBx-mediated hepatocarcinogenesis. The levels of DBH-AS1 were positively correlated with hepatitis B surface antigen (HBsAg) and tumor size in HCC tissues. Functionally, transgenic expr...

  4. The regulation of CD5 expression in murine T cells

    Directory of Open Access Journals (Sweden)

    Herzenberg Leonard A

    2001-05-01

    Full Text Available Abstract Background CD5 is a pan-T cell surface marker that is also present on a subset of B cells, B-1a cells.Functional and developmental subsets of T cells express characteristic CD5 levels that vary over roughly a 30-fold range. Previous investigators have cloned a 1.7 Kb fragment containing the CD5 promoter and showed that it can confer similar lymphocyte-specific expression pattern as observed for endogenous CD5 expression. Results We further characterize the CD5 promoter and identify minimal and regulatory regions on the CD5 promoter. Using a luciferase reporter system, we show that a 43 bp region on the CD5 promoter regulates CD5 expression in resting mouse thymoma EL4 T cells and that an Ets binding site within the 43 bp region mediates the CD5 expression. In addition, we show that Ets-1, a member of the Ets family of transcription factors, recognizes the Ets binding site in the electrophoretic mobility shift assay (EMSA. This Ets binding site is directly responsible for the increase in reporter activity when co-transfected with increasing amounts of Ets-1 expression plasmid. We also identify two additional evolutionarily-conserved regions in the CD5 promoter (CD5X and CD5Y and demonstrate the respective roles of the each region in the regulation of CD5 transcription. Conclusion Our studies define a minimal and regulatory promoter for CD5 and show that the CD5 expression level in T cells is at least partially dependent on the level of Ets-1 protein. Based on the findings in this report, we propose a model of CD5 transcriptional regulation in T cells.

  5. Sex-Dependent Gene Expression in Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Daniel Ronen

    2014-08-01

    Full Text Available Males and females have a variety of sexually dimorphic traits, most of which result from hormonal differences. However, differences between male and female embryos initiate very early in development, before hormonal influence begins, suggesting the presence of genetically driven sexual dimorphisms. By comparing the gene expression profiles of male and X-inactivated female human pluripotent stem cells, we detected Y-chromosome-driven effects. We discovered that the sex-determining gene SRY is expressed in human male pluripotent stem cells and is induced by reprogramming. In addition, we detected more than 200 differentially expressed autosomal genes in male and female embryonic stem cells. Some of these genes are involved in steroid metabolism pathways and lead to sex-dependent differentiation in response to the estrogen precursor estrone. Thus, we propose that the presence of the Y chromosome and specifically SRY may drive sex-specific differences in the growth and differentiation of pluripotent stem cells.

  6. Heterogeneous Expression of Drosophila Gustatory Receptors in Enteroendocrine Cells

    OpenAIRE

    Jeong-Ho Park; Jae Young Kwon

    2011-01-01

    The gastrointestinal tract is emerging as a major site of chemosensation in mammalian studies. Enteroendocrine cells are chemosensory cells in the gut which produce regulatory peptides in response to luminal contents to regulate gut physiology, food intake, and glucose homeostasis, among other possible functions. Increasing evidence shows that mammalian taste receptors and taste signaling molecules are expressed in enteroendocrine cells in the gut. Invertebrate models such as Drosophila can p...

  7. Adipose tissue-derived stromal cells express neuronal phenotypes

    Institute of Scientific and Technical Information of China (English)

    杨立业; 刘相名; 孙兵; 惠国桢; 费俭; 郭礼和

    2004-01-01

    Background Adipose tissue-derived stromal cells (ADSCs) can be greatly expanded in vitro, and induced to differentiate into multiple mesenchymal cell types, including osteogenic, chondrogenic, myogenic, and adipogenic cells. This study was designed to investigate the possibility of ADSCs differentiating into neurons.Methods Adipose tissue from rats was digested with collagenase, and adherent stromal cells were cultured. A medium containing a low concentration of fetal bovine serum was adopted to induce the cells to differentiate. ADSCs were identified by immunocytochemistry, and semi-quantitative RT-PCR was applied to detect mRNA expression of neurofilament 1 (NF1), nestin, and neuron-specific enolase (NSE).Results Nestin-positive cells were found occasionally among ADSCs. ADSCs were found to express NSE mRNA and nestin mRNA, but not NF1 mRNA. ADSCs could differentiate into neuron-like cells in a medium composed of a low concentration of fetal bovine serum, and these differentiated cells displayed complicated neuron-like morphologies.Conclusions The data support the hypothesis that adipose tissue contains stem cells capable of differentiating into neurons. These stem cells can overcome their mesenchymal commitment, and may represent an alternative autologous stem cell source for CNS cell transplantation.

  8. Human respiratory epithelial cells from nasal turbinate expressed stem cell genes even after serial passaging.

    Science.gov (United States)

    Ruszymah, B H I; Izham, B A Azrul; Heikal, M Y Mohd; Khor, S F; Fauzi, M B; Aminuddin, B S

    2011-12-01

    Current development in the field of tissue engineering led to the idea of repairing and regenerating the respiratory airway through in vitro reconstruction using autologous respiratory epithelial (RE). To ensure the capability of proliferation, the stem cell property of RE cells from the nasal turbinate should be evaluated. Respiratory epithelial cells from six human nasal turbinates were harvested and cultured in vitro. The gene expression of FZD-9 and BST-1 were expressed in passage 2 (P2) and passage 4 (P4). The levels of expression were not significant between both passages. The RE cells exhibit the stem cell properties, which remains even after serial passaging.

  9. High epitope expression levels increase competition between T cells.

    Directory of Open Access Journals (Sweden)

    Almut Scherer

    2006-08-01

    Full Text Available Both theoretical predictions and experimental findings suggest that T cell populations can compete with each other. There is some debate on whether T cells compete for aspecific stimuli, such as access to the surface on antigen-presenting cells (APCs or for specific stimuli, such as their cognate epitope ligand. We have developed an individual-based computer simulation model to study T cell competition. Our model shows that the expression level of foreign epitopes per APC determines whether T cell competition is mainly for specific or aspecific stimuli. Under low epitope expression, competition is mainly for the specific epitope stimuli, and, hence, different epitope-specific T cell populations coexist readily. However, if epitope expression levels are high, aspecific competition becomes more important. Such between-specificity competition can lead to competitive exclusion between different epitope-specific T cell populations. Our model allows us to delineate the circumstances that facilitate coexistence of T cells of different epitope specificity. Understanding mechanisms of T cell coexistence has important practical implications for immune therapies that require a broad immune response.

  10. Changes of TIZ expression in epithelial ovarian cancer cells

    Institute of Scientific and Technical Information of China (English)

    Huan-Yu Zheng; Hong-Yu Zheng; Yun-Tao Zhou; En-Ling Liu; Jie Li; Yan-Mei Zhang

    2015-01-01

    Objective:To study the change ofTIZ expression in epithelial ovarian cancer cells.Methods:HO8910 cells were transinfected with siRNA to inhibit the expression ofTIZ. pcDNA3.1-TIZ vectors were combined to increase theTIZ expression level.The cell viability, colony forming efficiency and cycle distribution ofHO8910,HO8910/NC,HO8910/pcDNA3.1-NC,HO8910/TIZ-573 andHO8910/pcDNA3.1-TIZ were compared, and the invasion rate, migration rate and adhesion rate between5 groups of cells were compared.Results:Compared with those ofHO8910,HO8910/NC andHO8910/pcDNA3.1-NC, the cell viability, colony forming efficiency and cell cycle distribution ofHO8910/TIZ-573 were increased, while the indexes ofHO8910/pcDNA3.1-NC were decreased with statistical significant difference(P0.05). Conclusions:The expression ofTIZ can inhibit the proliferation of epithelial ovarian cancer cells.

  11. Cardiomyocyte expression and cell-specific processing of procholecystokinin

    DEFF Research Database (Denmark)

    Gøtze, Jens P.; Johnsen, Anders H.; Kistorp, Caroline;

    2015-01-01

    Heart muscle cells produce peptide hormones such as natriuretic peptides. Developing hearts also express the gene for the classic intestinal hormone cholecystokinin (CCK) in amounts similar to those in the intestine and brain. However, cardiac expression of peptides other than natriuretic peptides...... has only been suggested using transcriptional measures or methods, with the post-translational phase of gene expression unaddressed. In this study, we examined the cardiac expression of the CCK gene in adult mammals and its expression at the protein level. Using quantitative PCR, a library of sequence......-specific pro-CCK assays, peptide purification, and mass spectrometry, we demonstrate that the mammalian heart expresses pro-CCK in amounts comparable to natriuretic prohormones and processes it to a unique, triple-sulfated, and N-terminally truncated product distinct from intestinal and cerebral CCK peptides...

  12. Melatonin modulates aromatase activity and expression in endothelial cells.

    Science.gov (United States)

    Alvarez-García, Virginia; González, Alicia; Martínez-Campa, Carlos; Alonso-González, Carolina; Cos, Samuel

    2013-05-01

    Melatonin is known to suppress the development of endocrine-responsive breast cancers by interacting with the estrogen signaling pathways. Paracrine interactions between malignant epithelial cells and proximal stromal cells are responsible for local estrogen biosynthesis. In human breast cancer cells and peritumoral adipose tissue, melatonin downregulates aromatase, which transforms androgens into estrogens. The presence of aromatase on endothelial cells indicates that endothelial cells may contribute to tumor growth by producing estrogens. Since human umbilical vein endothelial cells (HUVECs) express both aromatase and melatonin receptors, the aim of the present study was to evaluate the ability of melatonin to regulate the activity and expression of aromatase on endothelial cells, thus, modulating local estrogen biosynthesis. In the present study, we demonstrated that melatonin inhibits the growth of HUVECs and reduces the local biosynthesis of estrogens through the downregulation of aromatase. These results are supported by three lines of evidence. Firstly, 1 mM of melatonin counteracted the testosterone-induced cell proliferation of HUVECs, which is dependent on the local biosynthesis of estrogens from testosterone by the aromatase activity of the cells. Secondly, we found that 1 mM of melatonin reduced the aromatase activity of HUVECs. Finally, by real‑time RT-PCR, we demonstrated that melatonin significantly downregulated the expression of aromatase as well as its endothelial-specific aromatase promoter region I.7. We conclude that melatonin inhibits aromatase activity and expression in HUVECs by regulating gene expression of specific aromatase promoter regions, thereby reducing the local production of estrogens. PMID:23450505

  13. Fractalkine expression induces endothelial progenitor cell lysis by natural killer cells.

    Directory of Open Access Journals (Sweden)

    Dilyana Todorova

    Full Text Available BACKGROUND: Circulating CD34(+ cells, a population that includes endothelial progenitors, participate in the maintenance of endothelial integrity. Better understanding of the mechanisms that regulate their survival is crucial to improve their regenerative activity in cardiovascular and renal diseases. Chemokine-receptor cross talk is critical in regulating cell homeostasis. We hypothesized that cell surface expression of the chemokine fractalkine (FKN could target progenitor cell injury by Natural Killer (NK cells, thereby limiting their availability for vascular repair. METHODOLOGY/PRINCIPAL FINDINGS: We show that CD34(+-derived Endothelial Colony Forming Cells (ECFC can express FKN in response to TNF-α and IFN-γ inflammatory cytokines and that FKN expression by ECFC stimulates NK cell adhesion, NK cell-mediated ECFC lysis and microparticles release in vitro. The specific involvement of membrane FKN in these processes was demonstrated using FKN-transfected ECFC and anti-FKN blocking antibody. FKN expression was also evidenced on circulating CD34(+ progenitor cells and was detected at higher frequency in kidney transplant recipients, when compared to healthy controls. The proportion of CD34(+ cells expressing FKN was identified as an independent variable inversely correlated to CD34(+ progenitor cell count. We further showed that treatment of CD34(+ circulating cells isolated from adult blood donors with transplant serum or TNF-α/IFN-γ can induce FKN expression. CONCLUSIONS: Our data highlights a novel mechanism by which FKN expression on CD34(+ progenitor cells may target their NK cell mediated killing and participate to their immune depletion in transplant recipients. Considering the numerous diseased contexts shown to promote FKN expression, our data identify FKN as a hallmark of altered progenitor cell homeostasis with potential implications in better evaluation of vascular repair in patients.

  14. Pax4 Expression does not Transduce Pancreatic Alpha Cells to Beta Cells

    Directory of Open Access Journals (Sweden)

    Ling Chen

    2015-07-01

    Full Text Available Background/Aims: The lack of available beta cells greatly limits the use of beta cell transplantation as a therapy for diabetes. Thus, generation of beta cells from other sources is substantially required. Pax4 has been shown to induce reprograming of alpha cells into beta cells during embryogenesis. Nevertheless, whether expression of Pax4 in adult alpha cells could trigger this alpha-to-beta cell reprogramming is unknown. Methods: Here we generated an adeno-associated virus carrying Pax4 and GFP under a CMV promoter (AAV-Pax4. We used AAV-Pax4 to transduce a mouse alpha cell line in vitro, and to transduce primary alpha cells in diabetic mice. Reprogramming was examined by double immunostaining and by changes in beta cell number. The effects on blood glucose were evaluated by fasting blood glucose and glucose response. Results: In vitro, Pax4 overexpression neither induced insulin expression, nor suppressed glucagon expression in alpha cells. In vivo, Pax4 overexpression failed to increase beta cell number, and did not alter hyperglycemia and glucose response in diabetic mice. Conclusion: Pax4 expression is not sufficient to transduce pancreatic alpha cells into beta cells. Overexpression of Pax4 in alpha cells may not increase functional beta cell number in diabetic patients.

  15. Expression and Fuactional Role of HERG1, K+ Channels in Leukemic Cells and Leukemic Stem Cells

    Institute of Scientific and Technical Information of China (English)

    LI Huiyu; LIU Liqiong; GUO Tiannan; ZHANG Jiahua; LI Xiaoqing; DU Wen; LIU Wei; CHEN Xiangjun; HUANG Shi'ang

    2007-01-01

    In order to investigate the expression and functional role of HERG1 K+ channels in leukemic cells and leukemic stem cells (LSCs), RT-PCR was used to detect the HERG1 K+ channels expression in leukemic cells and LSCs. The functional role of HERG1 K+ channels in leukemic cell proliferation was measured by MTT assay, and cell cycle and apoptosis were analyzed by flow cytometry. The results showed that herg mRNA was expressed in CD34+/CD38-, CD123+ LSCs but not in circulating CD34+ cells. Herg mRNA was also up-regulated in leukemia cell lines K562 and HL60 as well as almost all the primary leukemic cells while not in normal peripheral blood mononuclear cells (PBMNCs) and the expression of herg mRNA was not associated with the clinical and cytogenetic features of leukemia. In addition, leukemic cell proliferation was dramatically inhibited by HERG K+ channel special inhibitor E-4031. Moreover, E-4031 suppressed the cell growth by inducing a specific block at the G1/S transition phase of the cell cycle but had no effect on apoptosis in leukemic cells. The results suggested that HERG1 K+ channels could regulate leukemic cells proliferation and were necessary for leukemic cells to proceed with the cell cycle. HERG1 K+ channels may also have oncogenic potential and may be a biomarker for diagnosis of leukemia and a novel potential pharmacological target for leukemia therapy.

  16. Dynamic distribution and stem cell characteristics of Sox1-expressing cells in the cerebellar cortex

    Institute of Scientific and Technical Information of China (English)

    Joelle Alcock; Virginie Sottile

    2009-01-01

    Bergmann glia cells are a discrete radial glia population surrounding Purkinje cells in the cerebellar cortex. Al-though Bergmann glia are essential for the development and correct arborization of Purkinje cells, little is known about the regulation of this cell population after the developmental phase. In an effort to characterize this population at the molecular level, we have analyzed marker expression and established that adult Bergmann glia express Soxl, Sox2 and Sox9, a feature otherwise associated with neural stem cells (NSCs). In the present study, we have further analyzed the developmental pattern of Soxl-expressing cells in the developing cerebellum. We report that before be-coming restricted to the Purkinje cell layer, Soxl-positive cells are present throughout the immature tissue, and that these cells show characteristics of Bergmann glia progenitors. Our study shows that these progenitors express Soxl, Sox2 and Sox9, a signature maintained throughout cerebellar maturation into adulthood. When isolated in culture, the Soxl-expressing cerebellar population exhibited neurosphere-forming ability, NSC-marker characteristics, and demonstrated multipotency at the clonal level. Our results show that the Bergmann glia population expresses Soxl during cerebellar development, and that these cells can be isolated and show stem cell characteristics in vitro, sug-gesting that they could hold a broader potential than previously thought.

  17. Connexin expression and gap-junctional intercellular communication in ES cells and iPS cells

    Directory of Open Access Journals (Sweden)

    Masahito eOyamada

    2013-07-01

    Full Text Available Pluripotent stem cells, i.e., embryonic stem (ES and induced pluripotent stem (iPS cells, can indefinitely proliferate without commitment and differentiate into all cell lineages. ES cells are derived from the inner cell mass of the preimplantation blastocyst, whereas iPS cells are generated from somatic cells by overexpression of a few transcription factors. Many studies have demonstrated that mouse and human iPS cells are highly similar but not identical to their respective ES cell counterparts. The potential to generate basically any differentiated cell types from these cells offers the possibility to establish new models of mammalian development and to create new sources of cells for regenerative medicine. ES cells and iPS cells also provide useful models to study connexin expression and gap-junctional intercellular communication (GJIC during cell differentiation and reprogramming. In 1996, we reported connexin expression and GJIC in mouse ES cells. Because a substantial number of papers on these subjects have been published since our report, this Mini Review summarizes currently available data on connexin expression and GJIC in ES cells and iPS cells during undifferentiated state, differentiation, and reprogramming.

  18. Regulation of cell-to-cell variability in divergent gene expression

    Science.gov (United States)

    Yan, Chao; Wu, Shuyang; Pocetti, Christopher; Bai, Lu

    2016-03-01

    Cell-to-cell variability (noise) is an important feature of gene expression that impacts cell fitness and development. The regulatory mechanism of this variability is not fully understood. Here we investigate the effect on gene expression noise in divergent gene pairs (DGPs). We generated reporters driven by divergent promoters, rearranged their gene order, and probed their expressions using time-lapse fluorescence microscopy and single-molecule fluorescence in situ hybridization (smFISH). We show that two genes in a co-regulated DGP have higher expression covariance compared with the separate, tandem and convergent configurations, and this higher covariance is caused by more synchronized firing of the divergent transcriptions. For differentially regulated DGPs, the regulatory signal of one gene can stochastically `leak' to the other, causing increased gene expression noise. We propose that the DGPs' function in limiting or promoting gene expression noise may enhance or compromise cell fitness, providing an explanation for the conservation pattern of DGPs.

  19. Patterns of expression of cell wall related genes in sugarcane

    Directory of Open Access Journals (Sweden)

    Lima D.U.

    2001-01-01

    Full Text Available Our search for genes related to cell wall metabolism in the sugarcane expressed sequence tag (SUCEST database (http://sucest.lbi.dcc.unicamp.br resulted in 3,283 reads (1% of the total reads which were grouped into 459 clusters (potential genes with an average of 7.1 reads per cluster. To more clearly display our correlation coefficients, we constructed surface maps which we used to investigate the relationship between cell wall genes and the sugarcane tissues libraries from which they came. The only significant correlations that we found between cell wall genes and/or their expression within particular libraries were neutral or synergetic. Genes related to cellulose biosynthesis were from the CesA family, and were found to be the most abundant cell wall related genes in the SUCEST database. We found that the highest number of CesA reads came from the root and stem libraries. The genes with the greatest number of reads were those involved in cell wall hydrolases (e.g. beta-1,3-glucanases, xyloglucan endo-beta-transglycosylase, beta-glucosidase and endo-beta-mannanase. Correlation analyses by surface mapping revealed that the expression of genes related to biosynthesis seems to be associated with the hydrolysis of hemicelluloses, pectin hydrolases being mainly associated with xyloglucan hydrolases. The patterns of cell wall related gene expression in sugarcane based on the number of reads per cluster reflected quite well the expected physiological characteristics of the tissues. This is the first work to provide a general view on plant cell wall metabolism through the expression of related genes in almost all the tissues of a plant at the same time. For example, developing flowers behaved similarly to both meristematic tissues and leaf-root transition zone tissues. Besides providing a basis for future research on the mechanisms of plant development which involve the cell wall, our findings will provide valuable tools for plant engineering in the

  20. Human retinal pigment epithelial cells inhibit proliferation and IL2R expression of activated T cells

    DEFF Research Database (Denmark)

    Kaestel, Charlotte G; Jørgensen, Annette; Nielsen, Mette;

    2002-01-01

    The purpose of this study was to characterize the effects of human retinal pigment epithelial (RPE) cells on activated T cells. Activated T cells were cocultured with adult and foetal human RPE cells whereafter apoptosis and proliferation were determined by flow cytometry and (3)H......-Thymidine incorporation assay, respectively. T cells and RPE cells were cultured directly together or in a transwell system for determination of the effect of cell contact. The importance of cell surface molecules was examined by application of a panel of blocking antibodies (CD2, CD18, CD40, CD40L, CD54, CD58......) in addition to use of TCR negative T cell lines. The expression of IL2R-alpha -beta and -gamma chains of activated T cells was analysed by flow cytometry after incubation of T cells alone or with RPE cells. Human RPE cells were found to inhibit the proliferation of activated T cells by a cell contact...

  1. Connective Tissue Growth Factor Expression in Human Bronchial Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    Amrita DOSANJH

    2006-01-01

    Connective tissue growth factor (CTGF) is a cysteine-rich protein that promotes extracellular matrix deposition. CTGF is selectively induced by transforming growth factor β and des-Arg kallidin in lung fibroblasts and increases steady-state mRNA levels of α type I collagen, 5α-integrin and fibronectin in fibroblasts. Bronchial epithelial cells have been proposed to functionally interact with lung fibroblasts. We therefore investigated if bronchial epithelial cells are able to synthesize CTGF. Human bronchial epithelial cells were grown to subconfluence in standard growth media. Proliferating cells grown in small airway growth media were harvested following starvation for up to 24 h. Expression of CTGF transcripts was measured by PCR. Immunocytochemistry was also completed using a commercially available antibody.The cells expressed readily detectable CTGF transcripts. Starvation of these cells resulted in a quantitative decline of CTGF transcripts. Direct sequencing of the PCR product identified human CTGF. Immunocytochemistry confirmed intracellular CTGF in the cells and none in negative control cells. We conclude that bronchial epithelial cells could be a novel source of CTGF. Bronchial epithelial cell-derived CTGF could thus directly influence the deposition of collagen in certain fibrotic lung diseases.

  2. Cell-specific information processing in segregating populations of Eph receptor ephrin-expressing cells

    DEFF Research Database (Denmark)

    Jørgensen, Claus; Sherman, Andrew; Chen, Ginny I;

    2009-01-01

    information is processed in two interacting cell types remains a challenge. We implemented a proteomic strategy to systematically determine cell-specific signaling networks underlying EphB2- and ephrin-B1-controlled cell sorting. Quantitative mass spectrometric analysis of mixed populations of EphB2...... revealed that signaling between mixed EphB2- and ephrin-B1-expressing cells is asymmetric and that the distinct cell types use different tyrosine kinases and targets to process signals induced by cell-cell contact. We provide systems- and cell-specific network models of contact-initiated signaling between......- and ephrin-B1-expressing cells that were labeled with different isotopes revealed cell-specific tyrosine phosphorylation events. Functional associations between these phosphotyrosine signaling networks and cell sorting were established with small interfering RNA screening. Data-driven network modeling...

  3. Expression of cyclooxygenase-2 in human esophageal squamous cell carcinomas

    Institute of Scientific and Technical Information of China (English)

    Jian-Gang Jiang; Dao-Wen Wang; Jiang-Bo Tang; Chun-Lian Chen; Bao-Xing Liu; Xiang-Ning Fu; Zhi-Hui Zhu; Wei Qu; Katherine Cianflone; Michael P. Waalkes

    2004-01-01

    AIM: To determine whether cyclooxygenase-2 (COX-2) was expressed in human esophageal squamous cell carcinoma.METHODS: Quantitative reverse transcription-polymerase chain reaction (RT-PCR), western blotting, immunohistochemistry and immunofluorescence were used to assess the expression level of COX-2 in esophageal tissue.RESULTS: COX-2 mRNA levels were increased by >80-fold in esophageal squamous cell carcinoma when compared to adjacent noncancerous tissue. COX-2 protein was present in 21 of 30 cases of esophageal squamous cell carcinoma tissues, but was undetectable in noncancerous tissue. Immunohistochemistry was performed to directly show expression of COX-2 in tumor tissue.CONCLUSION: These results suggest that COX-2 may be an important factor for esophageal cancer and inhibition of COX-2 may be helpful for prevention and possibly treatment of this cancer.

  4. Human Neural Cells Transiently Express Reelin during Olfactory Placode Development

    Science.gov (United States)

    Antal, M. Cristina; Samama, Brigitte; Ghandour, M. Said; Boehm, Nelly

    2015-01-01

    Reelin, an extracellular glycoprotein is essential for migration and correct positioning of neurons during development. Since the olfactory system is known as a source of various migrating neuronal cells, we studied Reelin expression in the two chemosensory olfactory systems, main and accessory, during early developmental stages of human foetuses/embryos from Carnegie Stage (CS) 15 to gestational week (GW) 14. From CS 15 to CS 18, but not at later stages, a transient expression of Reelin was detected first in the presumptive olfactory and then in the presumptive vomeronasal epithelium. During the same period, Reelin-positive cells detach from the olfactory/vomeronasal epithelium and migrate through the mesenchyme beneath the telencephalon. Dab 1, an adaptor protein of the Reelin pathway, was simultaneously expressed in the migratory mass from CS16 to CS17 and, at later stages, in the presumptive olfactory ensheathing cells. Possible involvements of Reelin and Dab 1 in the peripheral migrating stream are discussed. PMID:26270645

  5. Expression of ICAM-1 in colon epithelial cells

    DEFF Research Database (Denmark)

    Vainer, Ben; Sørensen, Susanne; Seidelin, Jakob;

    2003-01-01

    Studies have suggested that in ulcerative colitis (UC), intercellular adhesion molecule-1 (ICAM-1) is involved in migration of leukocytes toward the colonic epithelium. A suitable in vitro model of chronic colonic inflammation does not exist, and the role of the epithelium is based on monolayers...... of cancer cells. Conflicting results exist on epithelial ICAM-1 expression, and the aim of this study was to compare the expression in various models of colonic epithelium....

  6. Cloning and expression of human colon mast cell carboxypeptidase

    Institute of Scientific and Technical Information of China (English)

    Zhang-Quan Chen; Shao-Heng He

    2004-01-01

    AIM: To clone and express the human colon mast cell METHODS: Total RNA was extracted from colon tissue, and the cDNA encoding human colon mast cell carboxypeptidase was amplified by reverse-transcription PCR (RT-PCR). The product cDNA was subcloned into the prokaryotic expression vector pMAL-c2x and eukaryotic expression vector pPIC9K to conrtruct prokaryotic expression vector pMAL/human MC-CP (hMC-CP) and eukaryotic pPIC9K/hMC-CP. The recombinant fusion protein expressed in E.coli was induced with IPTG and purified by amylose affinity chromatography. After digestion with factor Xa, recombinant hMC-CP was purified by heparin agarose chromatography. The recombinant hMC-CP expressed in Pichia pastoris (P.pastoris) was induced with methanol and analyzed by SDS-PAGE, Western blot, N-terminal amino acid RESULTS: The cDNA encoding the human colon mast cell carboxypeptidase was cloned, which had five nucleotide variations compared with skin MC-CP cDNA. The recombinant hMC-CP protein expressed in E.coli was purified with amylose affinity chromatography and heparin agarose chromatogphy.SDS-PAGE and Western blot analysis showed that the recombinant protein expressed by E. coli had a molecular weight of 36 kDa and reacted to the anti-native hMC-CP monoclonal antibody (CA5). The N-terminal amino acid sequence confirmed further the product was hMC-CP. E. coli generated hMC-CP showed a very low level of enzymatic activity, but P. pastoris produced hMC-CP had a relatively high enzymatic activity towards a synthetic substrate hippuryl-L-phenylalanine.carboxypeptidase can be successfully cloned and expressed in E.coli and P. pastoris, which will contribute greatly to the fonctional study on hMC-CP.

  7. From single-cell to cell-pool transcriptomes: stochasticity in gene expression and RNA splicing.

    Science.gov (United States)

    Marinov, Georgi K; Williams, Brian A; McCue, Ken; Schroth, Gary P; Gertz, Jason; Myers, Richard M; Wold, Barbara J

    2014-03-01

    Single-cell RNA-seq mammalian transcriptome studies are at an early stage in uncovering cell-to-cell variation in gene expression, transcript processing and editing, and regulatory module activity. Despite great progress recently, substantial challenges remain, including discriminating biological variation from technical noise. Here we apply the SMART-seq single-cell RNA-seq protocol to study the reference lymphoblastoid cell line GM12878. By using spike-in quantification standards, we estimate the absolute number of RNA molecules per cell for each gene and find significant variation in total mRNA content: between 50,000 and 300,000 transcripts per cell. We directly measure technical stochasticity by a pool/split design and find that there are significant differences in expression between individual cells, over and above technical variation. Specific gene coexpression modules were preferentially expressed in subsets of individual cells, including one enriched for mRNA processing and splicing factors. We assess cell-to-cell variation in alternative splicing and allelic bias and report evidence of significant differences in splice site usage that exceed splice variation in the pool/split comparison. Finally, we show that transcriptomes from small pools of 30-100 cells approach the information content and reproducibility of contemporary RNA-seq from large amounts of input material. Together, our results define an experimental and computational path forward for analyzing gene expression in rare cell types and cell states.

  8. Immunglobulin Expression and Its Biological Significance in Cancer Cells

    Institute of Scientific and Technical Information of China (English)

    Duosha Hu; Hui Zheng; Haidan Liu; Ming Li; Wei Ren; Wei Liao; Zhi Duan; Lili Li; Ya Cao

    2008-01-01

    It is generally believed that the expression of a gene iS restricted "within the right place and at the right time".This principle has long been considered applicable as well to the expression of immunoglobulin(Ig)lymphocytes of B cell lineage.However,increasing evidence has shown Ig "paradoxically" expressed in malignant tumors of epitheliaI origin.We reviewed the recent progress in the study of cancer-derived Ig,and also discussed its mechanisms and possible functions,trying to arouse interest and attention to those working in the field of immunology and oncology.

  9. Analysis of expression profiles of MAGE-A antigens in oral squamous cell carcinoma cell lines

    Directory of Open Access Journals (Sweden)

    Reichert Torsten E

    2009-04-01

    Full Text Available Abstract Background The immunological response to solid tumours is insufficient. Therefore, tumour specific antigens have been explored to facilitate the activation of the immune system. The cancer/testis antigen class of MAGE-A antigens is a possible target for vaccination. Their differential expression profiles also modulate the course of the cancer disease and its response to antineoplastic drugs. Methods The expression profiles of MAGE-A2, -A3, -A4, -A6 and -A10 in five own oral squamous cell carcinoma cell lines were characterised by rt-PCR, qrt-PCR and immunocytochemistry with a global MAGE-A antibody (57B and compared with those of an adult keratinocyte cell line (NHEK. Results All tumour cell lines expressed MAGE-A antigens. The antigens were expressed in groups with different preferences. The predominant antigens expressed were MAGE-A2, -A3 and -A6. MAGE-A10 was not expressed in the cell lines tested. The MAGE-A gene products detected in the adult keratinocyte cell line NHEK were used as a reference. Conclusion MAGE-A antigens are expressed in oral squamous cell carcinomas. The expression profiles measured facilitate distinct examinations in forthcoming studies on responses to antineoplastic drugs or radiation therapy. MAGE-A antigens are still an interesting aim for immunotherapy.

  10. Polyclonal T-Cells Express CD1a in Langerhans Cell Histiocytosis (LCH) Lesions

    Science.gov (United States)

    West, Jennifer A.; Olsen, Sharon L.; Mitchell, Jenée M.; Priddle, Ross E.; Luke, Jennifer M.; Åkefeldt, Selma Olsson; Henter, Jan-Inge; Turville, Christopher; Kannourakis, George

    2014-01-01

    Langerhans cell histiocytosis (LCH) is a complex and poorly understood disorder that has characteristics of both inflammatory and neoplastic disease. By using eight-colour flow cytometry, we have identified a previously unreported population of CD1a+/CD3+ T-cells in LCH lesions. The expression of CD1a is regarded as a hallmark of this disease; however, it has always been presumed that it was only expressed by pathogenic Langerhans cells (LCs). We have now detected CD1a expression by a range of T-cell subsets within all of the LCH lesions that were examined, establishing that CD1a expression in these lesions is no longer restricted to pathogenic LCs. The presence of CD1a+ T-cells in all of the LCH lesions that we have studied to date warrants further investigation into their biological function to determine whether these cells are important in the pathogenesis of LCH. PMID:25343480

  11. Polyclonal T-cells express CD1a in Langerhans cell histiocytosis (LCH lesions.

    Directory of Open Access Journals (Sweden)

    Jennifer A West

    Full Text Available Langerhans cell histiocytosis (LCH is a complex and poorly understood disorder that has characteristics of both inflammatory and neoplastic disease. By using eight-colour flow cytometry, we have identified a previously unreported population of CD1a(+/CD3(+ T-cells in LCH lesions. The expression of CD1a is regarded as a hallmark of this disease; however, it has always been presumed that it was only expressed by pathogenic Langerhans cells (LCs. We have now detected CD1a expression by a range of T-cell subsets within all of the LCH lesions that were examined, establishing that CD1a expression in these lesions is no longer restricted to pathogenic LCs. The presence of CD1a(+ T-cells in all of the LCH lesions that we have studied to date warrants further investigation into their biological function to determine whether these cells are important in the pathogenesis of LCH.

  12. Expression of Neural Markers by Undifferentiated Rat Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Dana Foudah

    2012-01-01

    Full Text Available The spontaneous expression of neural markers by mesenchymal stem cells (MSCs has been considered to be a demonstration of MSCs’ predisposition to differentiate towards neural lineages. In view of their application in cell therapy for neurodegenerative diseases, it is very important to deepen the knowledge about this distinctive biological property of MSCs. In this study, we evaluated the expression of neuronal and glial markers in undifferentiated rat MSCs (rMSCs at different culture passages (from early to late. rMSCs spontaneously expressed neural markers depending on culture passage, and they were coexpressed or not with the neural progenitor marker nestin. In contrast, the number of rMSCs expressing mesengenic differentiation markers was very low or even completely absent. Moreover, rMSCs at late culture passages were not senescent cells and maintained the MSC immunophenotype. However, their differentiation capabilities were altered. In conclusion, our results support the concept of MSCs as multidifferentiated cells and suggest the existence of immature and mature neurally fated rMSC subpopulations. A possible correlation between specific MSC subpopulations and specific neural lineages could optimize the use of MSCs in cell transplantation therapy for the treatment of neurological diseases.

  13. Gene expression profiling of chicken primordial germ cell ESTs

    Directory of Open Access Journals (Sweden)

    Lim Dajeong

    2006-08-01

    Full Text Available Abstract Background Germ cells are the only cell type that can penetrate from one generation to next generation. At the early embryonic developmental stages, germ cells originally stem from primordial germ cells, and finally differentiate into functional gametes, sperm in male or oocyte in female, after sexual maturity. This study was conducted to investigate a large-scale expressed sequence tag (EST analysis in chicken PGCs and compare the expression of the PGC ESTs with that of embryonic gonad. Results We constructed 10,851 ESTs from a chicken cDNA library of a collection of highly separated embryonic PGCs. After chimeric and problematic sequences were filtered out using the chicken genomic sequences, there were 5,093 resulting unique sequences consisting of 156 contigs and 4,937 singlets. Pearson chi-square tests of gene ontology terms in the 2nd level between PGC and embryonic gonad set showed no significance. However, digital gene expression profiling using the Audic's test showed that there were 2 genes expressed significantly with higher number of transcripts in PGCs compared with the embryonic gonads set. On the other hand, 17 genes in embryonic gonads were up-regulated higher than those in the PGC set. Conclusion Our results in this study contribute to knowledge of mining novel transcripts and genes involved in germline cell proliferation and differentiation at the early embryonic stages.

  14. Progesterone Upregulates Gene Expression in Normal Human Thyroid Follicular Cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Santin Bertoni

    2015-01-01

    Full Text Available Thyroid cancer and thyroid nodules are more prevalent in women than men, so female sex hormones may have an etiological role in these conditions. There are no data about direct effects of progesterone on thyroid cells, so the aim of the present study was to evaluate progesterone effects in the sodium-iodide symporter NIS, thyroglobulin TG, thyroperoxidase TPO, and KI-67 genes expression, in normal thyroid follicular cells, derived from human tissue. NIS, TG, TPO, and KI-67 mRNA expression increased significantly after TSH 20 μUI/mL, respectively: 2.08 times, P<0.0001; 2.39 times, P=0.01; 1.58 times, P=0.0003; and 1.87 times, P<0.0001. In thyroid cells treated with 20 μUI/mL TSH plus 10 nM progesterone, RNA expression of NIS, TG, and KI-67 genes increased, respectively: 1.78 times, P<0.0001; 1.75 times, P=0.037; and 1.95 times, P<0.0001, and TPO mRNA expression also increased, though not significantly (1.77 times, P=0.069. These effects were abolished by mifepristone, an antagonist of progesterone receptor, suggesting that genes involved in thyroid cell function and proliferation are upregulated by progesterone. This work provides evidence that progesterone has a direct effect on thyroid cells, upregulating genes involved in thyroid function and growth.

  15. Single-cell PCR profiling of gene expression in hematopoiesis.

    Science.gov (United States)

    Teles, José; Enver, Tariq; Pina, Cristina

    2014-01-01

    Single-cell analysis of gene expression offers the possibility of exploring cellular and molecular heterogeneity in stem and developmental cell systems, including cancer, to infer routes of cellular specification and their respective gene regulatory modules. PCR-based technologies, although limited to the analysis of a predefined set of genes, afford a cost-effective balance of throughput and biological information and have become a method of choice in stem cell laboratories. Here we describe an experimental and analytical protocol based on the Fluidigm microfluidics platform for the simultaneous expression analysis of 48 or 96 genes in multiples of 48 or 96 cells. We detail wet laboratory procedures and describe clustering, principal component analysis, correlation, and classification tools for the inference of cellular pathways and gene networks. PMID:25062620

  16. Regulation of cholesterol 25-hydroxylase expression by vitamin D3 metabolites in human prostate stromal cells

    International Nuclear Information System (INIS)

    Vitamin D3 plays an important role in the control of cell proliferation and differentiation. Cholesterol 25-hydroxylase (CH25H) is an enzyme converting cholesterol into 25-hydroxycholesterol. Vitamin D3 as well as 25-hydroxycholesterol has been shown to inhibit cell growth and induce cell apoptosis. Here we show that 10 nM 1α,25(OH)2D3 and 500 nM 25OHD3 upregulate CH25H mRNA expression in human primary prostate stromal cells (P29SN). Protein synthesis inhibitor cycloheximide does not block 1α,25(OH)2D3 mediated upregulation of CH25H mRNA. Transcription inhibitor actinomycin D blocks basal level as well as 1α,25(OH)2D3 induced CH25H mRNA expression. 1α,25(OH)2D3 has no effect on CH25H mRNA stability. 25-Hydroxycholesterol significantly decreased the P29SN cell number. A CH25H enzyme inhibitor, desmosterol, increases basal cell number but has no significant effect on vitamin D3 treated cells. Our data suggest that ch25h could be a vitamin D3 target gene and may partly mediate anti-proliferative action of vitamin D3 in human primary prostate stromal cells

  17. Expression changes of cell-cell adhesion-related genes in colorectal tumors

    OpenAIRE

    Bujko, Mateusz; KOBER, PAULINA; Mikula, Michal; Ligaj, Marcin; Ostrowski, Jerzy; Siedlecki, Janusz Aleksander

    2015-01-01

    Epithelial tissues achieve a highly organized structure due to cell-cell junction complexes. Carcinogenesis is accompanied by changes in cell interactions and tissue morphology, which appear in the early stages of benign tumors and progress along with invasive potential. The aim of the present study was to analyze the changes in expression levels of genes encoding intercellular junction proteins that have been previously identified to be differentially expressed in colorectal tumors compared ...

  18. IL-35 over-expression increases apoptosis sensitivity and suppresses cell growth in human cancer cells.

    Science.gov (United States)

    Long, Jun; Zhang, Xulong; Wen, Mingjie; Kong, Qingli; Lv, Zhe; An, Yunqing; Wei, Xiao-Qing

    2013-01-01

    Interleukin (IL)-35 is a novel heterodimeric cytokine in the IL-12 family and is composed of two subunits: Epstein-Barr virus-induced gene 3 (EBI3) and IL-12p35. IL-35 is expressed in T regulatory (Treg) cells and contributes to the immune suppression function of these cells. In contrast, we found that both IL-35 subunits were expressed concurrently in most human cancer cell lines compared to normal cell lines. In addition, we found that TNF-α and IFN-γ stimulation led to increased IL-35 expression in human cancer cells. Furthermore, over-expression of IL-35 in human cancer cells suppressed cell growth in vitro, induced cell cycle arrest at the G1 phase, and mediated robust apoptosis induced by serum starvation, TNF-α, and IFN-γ stimulation through the up-regulation of Fas and concurrent down-regulation of cyclinD1, survivin, and Bcl-2 expression. In conclusion, our results reveal a novel functional role for IL-35 in suppressing cancer activity, inhibiting cancer cell growth, and increasing the apoptosis sensitivity of human cancer cells through the regulation of genes related to the cell cycle and apoptosis. Thus, this research provides new insights into IL-35 function and presents a possible target for the development of novel cancer therapies.

  19. Intraclonal Protein Expression Heterogeneity in Recombinant CHO Cells

    OpenAIRE

    Pilbrough, Warren; Munro, Trent P.; Gray, Peter

    2009-01-01

    Therapeutic glycoproteins have played a major role in the commercial success of biotechnology in the post-genomic era. But isolating recombinant mammalian cell lines for large-scale production remains costly and time-consuming, due to substantial variation and unpredictable stability of expression amongst transfected cells, requiring extensive clone screening to identify suitable high producers. Streamlining this process is of considerable interest to industry yet the underlying phenomena are...

  20. Glucocorticoids Enhance CD163 Expression in Placental Hofbauer Cells

    OpenAIRE

    Tang, Zhonghua; Niven-Fairchild, Tracy; Tadesse, Serkalem; Errol R Norwitz; Buhimschi, Catalin S; Buhimschi, Irina A.; Guller, Seth

    2012-01-01

    Periplacental levels of glucocorticoid (GC) peak at parturition, and synthetic GC is administered to women at risk for preterm delivery. However, little is known concerning cell-type-specific effects of GC in placenta. Hofbauer cells (HBCs) are fetal macrophages that are located adjacent to fetal capillaries in placenta. The goal of the current study was to determine whether GC treatment altered HBC gene expression and function. Western blotting and flow cytometry revealed CD163 and folate re...

  1. Effects of Trichostatin A on HDAC8 Expression, Proliferation and Cell Cycle of Molt-4 Cells

    Institute of Scientific and Technical Information of China (English)

    HE Jing; LIU Hongli; CHEN Yan

    2006-01-01

    The effects of Trichostatin A (TSA) on histone deacetylase 8 (HDAC8) expression, proliferation and cell cycle arrest in T-lymphoblastic leukemia cell line Molt-4 cells in vitro were investigated. The effect of TSA on the growth of Molt-4 cells was studied by MTT assay. Flow cytometry was used to examine the cell cycle. The expression of HDAC8 was detected by using immunocytochemistry and Western blot. The results showed that proliferation of Molt-4 cells was inhibited in TSA-treated group in a time- and dose-dependent manner. The IC50 of TSA exposures for 24 h and 36 h were 254.3236 and 199.257 μg/L respectively. The cell cycle analysis revealed that Molt-4 was mostly in G0/G1 phase, and after treatment with TSA from 50 to 400 μg/L for 24 h, the percents of G0/G1 cells were decreased and cells were arrested in G2/M phase. Treatment of TSA for 24 h could significantly inhibit the expression of HDAC8 protein in Molt-4 cells (P<0.01). It was concluded that TSA could decrease the expression of HDAC8 in Molt-4 cells, which contributed to the inhibition of proliferation and induction of cell cycle arrest in Molt-4 cells.

  2. Interleukin 21-induced granzyme B-expressing B cells infiltrate tumors and regulate T cells.

    Science.gov (United States)

    Lindner, Stefanie; Dahlke, Karen; Sontheimer, Kai; Hagn, Magdalena; Kaltenmeier, Christof; Barth, Thomas F E; Beyer, Thamara; Reister, Frank; Fabricius, Dorit; Lotfi, Ramin; Lunov, Oleg; Nienhaus, G Ulrich; Simmet, Thomas; Kreienberg, Rolf; Möller, Peter; Schrezenmeier, Hubert; Jahrsdörfer, Bernd

    2013-04-15

    The pathogenic impact of tumor-infiltrating B cells is unresolved at present, however, some studies suggest that they may have immune regulatory potential. Here, we report that the microenvironment of various solid tumors includes B cells that express granzyme B (GrB, GZMB), where these B cells can be found adjacent to interleukin (IL)-21-secreting regulatory T cells (Treg) that contribute to immune tolerance of tumor antigens. Because Tregs and plasmacytoid dendritic cells are known to modulate T-effector cells by a GrB-dependent mechanism, we hypothesized that a similar process may operate to modulate regulatory B cells (Breg). IL-21 induced outgrowth of B cells expressing high levels of GrB, which thereby limited T-cell proliferation by a GrB-dependent degradation of the T-cell receptor ζ-chain. Mechanistic investigations into how IL-21 induced GrB expression in B cells to confer Breg function revealed a CD19(+)CD38(+)CD1d(+)IgM(+)CD147(+) expression signature, along with expression of additional key regulatory molecules including IL-10, CD25, and indoleamine-2,3-dioxygenase. Notably, induction of GrB by IL-21 integrated signals mediated by surface immunoglobulin M (B-cell receptor) and Toll-like receptors, each of which were enhanced with expression of the B-cell marker CD5. Our findings show for the first time that IL-21 induces GrB(+) human Bregs. They also establish the existence of human B cells with a regulatory phenotype in solid tumor infiltrates, where they may contribute to the suppression of antitumor immune responses. Together, these findings may stimulate novel diagnostic and cell therapeutic approaches to better manage human cancer as well as autoimmune and graft-versus-host pathologies. PMID:23384943

  3. Improved expression systems for regulated expression in Salmonella infecting eukaryotic cells.

    Directory of Open Access Journals (Sweden)

    Carlos Medina

    Full Text Available In this work we describe a series of improvements to the Salmonella-based salicylate-inducible cascade expression system comprised of a plasmid-borne expression module, where target gene expression is driven by the P(m promoter governed by the XylS2 regulator, and a genome-integrated regulatory module controlled by the nahR/P(sal system. We have constructed a set of high and low-copy number plasmids bearing modified versions of the expression module with a more versatile multiple cloning site and different combinations of the following elements: (i the nasF transcriptional attenuator, which reduces basal expression levels, (ii a strong ribosome binding site, and (iii the Type III Secretion System (TTSS signal peptide from the effector protein SspH2 to deliver proteins directly to the eukaryotic cytosol following bacterial infection of animal cells. We show that different expression module versions can be used to direct a broad range of protein production levels. Furthermore, we demonstrate that the efficient reduction of basal expression by the nasF attenuator allows the cloning of genes encoding highly cytotoxic proteins such as colicin E3 even in the absence of its immunity protein. Additionally, we show that the Salmonella TTSS is able to translocate most of the protein produced by this regulatory cascade to the cytoplasm of infected HeLa cells. Our results indicate that these vectors represent useful tools for the regulated overproduction of heterologous proteins in bacterial culture or in animal cells, for the cloning and expression of genes encoding toxic proteins and for pathogenesis studies.

  4. Improved Expression Systems for Regulated Expression in Salmonella Infecting Eukaryotic Cells

    Science.gov (United States)

    Medina, Carlos; Camacho, Eva María; Flores, Amando; Mesa-Pereira, Beatriz; Santero, Eduardo

    2011-01-01

    In this work we describe a series of improvements to the Salmonella-based salicylate-inducible cascade expression system comprised of a plasmid-borne expression module, where target gene expression is driven by the Pm promoter governed by the XylS2 regulator, and a genome-integrated regulatory module controlled by the nahR/Psal system. We have constructed a set of high and low-copy number plasmids bearing modified versions of the expression module with a more versatile multiple cloning site and different combinations of the following elements: (i) the nasF transcriptional attenuator, which reduces basal expression levels, (ii) a strong ribosome binding site, and (iii) the Type III Secretion System (TTSS) signal peptide from the effector protein SspH2 to deliver proteins directly to the eukaryotic cytosol following bacterial infection of animal cells. We show that different expression module versions can be used to direct a broad range of protein production levels. Furthermore, we demonstrate that the efficient reduction of basal expression by the nasF attenuator allows the cloning of genes encoding highly cytotoxic proteins such as colicin E3 even in the absence of its immunity protein. Additionally, we show that the Salmonella TTSS is able to translocate most of the protein produced by this regulatory cascade to the cytoplasm of infected HeLa cells. Our results indicate that these vectors represent useful tools for the regulated overproduction of heterologous proteins in bacterial culture or in animal cells, for the cloning and expression of genes encoding toxic proteins and for pathogenesis studies. PMID:21829692

  5. Improved expression systems for regulated expression in Salmonella infecting eukaryotic cells.

    Science.gov (United States)

    Medina, Carlos; Camacho, Eva María; Flores, Amando; Mesa-Pereira, Beatriz; Santero, Eduardo

    2011-01-01

    In this work we describe a series of improvements to the Salmonella-based salicylate-inducible cascade expression system comprised of a plasmid-borne expression module, where target gene expression is driven by the P(m) promoter governed by the XylS2 regulator, and a genome-integrated regulatory module controlled by the nahR/P(sal) system. We have constructed a set of high and low-copy number plasmids bearing modified versions of the expression module with a more versatile multiple cloning site and different combinations of the following elements: (i) the nasF transcriptional attenuator, which reduces basal expression levels, (ii) a strong ribosome binding site, and (iii) the Type III Secretion System (TTSS) signal peptide from the effector protein SspH2 to deliver proteins directly to the eukaryotic cytosol following bacterial infection of animal cells. We show that different expression module versions can be used to direct a broad range of protein production levels. Furthermore, we demonstrate that the efficient reduction of basal expression by the nasF attenuator allows the cloning of genes encoding highly cytotoxic proteins such as colicin E3 even in the absence of its immunity protein. Additionally, we show that the Salmonella TTSS is able to translocate most of the protein produced by this regulatory cascade to the cytoplasm of infected HeLa cells. Our results indicate that these vectors represent useful tools for the regulated overproduction of heterologous proteins in bacterial culture or in animal cells, for the cloning and expression of genes encoding toxic proteins and for pathogenesis studies. PMID:21829692

  6. PRL-3 expression in nasal sinus squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    Zi-Hui Chen; Min-Ying Li

    2016-01-01

    Objective:To investigate the relationship between liver regeneration phosphatase-3 (PRL-3) with differentiation extent of nasal sinus squamous cell carcinoma, and molecular biological effects on the pathogenesis of nasal sinus squamous cell carcinoma to comprehend its relevance, so as to make early diagnosis of patients, and to give guidance to the prognosis. Methods:Immunohistochemistry was used to detect PRL-3 in 30 cases of different degrees of sinus nasal squamous cell carcinoma. 20 cases of normal nasal cavity of mucosa tissues were set as control. Results:The PRL-3 in all levels of sinonasal squamous cell carcinoma tissues, there was a significant difference compared with the normal nasal mucosa (P<0.05), squamous cell carcinoma and its expression increased with the grade with enhanced trend. Conclusions:PRL-3 expression increased significantly in sinonasal squamous cell carcinoma than in nasal polyp tissue, showed that it may be associated with squamous cell carcinoma of nasal sinus squamous cell carcinoma, may be the early event.

  7. Endothelial cells downregulate apolipoprotein D expression in mural cells through paracrine secretion and Notch signaling.

    Science.gov (United States)

    Pajaniappan, Mohanasundari; Glober, Nancy K; Kennard, Simone; Liu, Hua; Zhao, Ning; Lilly, Brenda

    2011-09-01

    Endothelial and mural cell interactions are vitally important for proper formation and function of blood vessels. These two cell types communicate to regulate multiple aspects of vessel function. In studying genes regulated by this interaction, we identified apolipoprotein D (APOD) as one gene that is downregulated in mural cells by coculture with endothelial cells. APOD is a secreted glycoprotein that has been implicated in governing stress response, lipid metabolism, and aging. Moreover, APOD is known to regulate smooth muscle cells and is found in abundance within atherosclerotic lesions. Our data show that the regulation of APOD in mural cells is bimodal. Paracrine secretion by endothelial cells causes partial downregulation of APOD expression. Additionally, cell contact-dependent Notch signaling plays a role. NOTCH3 on mural cells promotes the downregulation of APOD, possibly through interaction with the JAGGED-1 ligand on endothelial cells. Our results show that NOTCH3 contributes to the downregulation of APOD and by itself is sufficient to attenuate APOD transcript expression. In examining the consequence of decreased APOD expression in mural cells, we show that APOD negatively regulates cell adhesion. APOD attenuates adhesion by reducing focal contacts; however, it has no effect on stress fiber formation. These data reveal a novel mechanism in which endothelial cells control neighboring mural cells through the downregulation of APOD, which, in turn, influences mural cell function by modulating adhesion.

  8. Expression of caspase-3 gene in apoptotic HL-60 cell and different human tumor cell lines

    International Nuclear Information System (INIS)

    Objective: To research the expression of caspase-3 gene in the apoptotic and the control HL-60 cells and in the different human tumor cell lines. Methods: Caspase-3 mRNA in the control and γ-radiation-induced apoptotic HL-60 cells, and in the 6 types of human tumor cell lines, was analysed by Northern blot. Results: The caspase-3 gene transcript was more highly expressed in leukemia cells HL-60, CEM, K562 and neuroblastoma SH-SY5Y than in cervical adenocarcinoma HeLa and breast carcinoma MCF7, and more highly in the radiation-induced apoptotic HL-60 than in the control HL-60 cells. Conclusion: The high level of expression of caspase-3 may aid the efforts to understand the tumor cell sensitivity to radiation, apoptosis and its inherent ability to survive

  9. Impaired cell surface expression of HLA-B antigens on mesenchymal stem cells and muscle cell progenitors

    DEFF Research Database (Denmark)

    Isa, Adiba; Nehlin, Jan; Sabir, Hardee Jawad;

    2010-01-01

    HLA class-I expression is weak in embryonic stem cells but increases rapidly during lineage progression. It is unknown whether all three classical HLA class-I antigens follow the same developmental program. In the present study, we investigated allele-specific expression of HLA-A, -B, and -C...... at the mRNA and protein levels on human mesenchymal stem cells from bone marrow and adipose tissue as well as striated muscle satellite cells and lymphocytes. Using multicolour flow cytometry, we found high cell surface expression of HLA-A on all stem cells and PBMC examined. Surprisingly, HLA-B was either...... undetectable or very weakly expressed on all stem cells protecting them from complement-dependent cytotoxicity (CDC) using relevant human anti-B and anti-Cw sera. IFNgamma stimulation for 48-72 h was required to induce full HLA-B protein expression. Quantitative real-time RT-PCR showed that IFNgamma induced...

  10. Immune Killing Activity of Lymphocytes on Hela Cells Expressing Interleukin-12 In Vitro

    Institute of Scientific and Technical Information of China (English)

    Huiyan WANG; Suhua CHEN

    2008-01-01

    The killing effects of lymphocytes on Hela cells expressing intedeukin-12 (IL-12) in vitro were explored. By using gene transfection technique, full length IL-12 gene was transfected into Hela cells. The expression of IL-12 in Hela cells was detected quantitatively by ELISA; Changes in killing effects of lymphocytes on Hela cells expressing IL-12 were observed by MTT. It was found that Hela cells could express IL-12 between 24h and 72h after transfection. Killing activity of lymphocytes on Hela cells expressing IL-12 was significantly enhanced. It was concluded by cell transfection technique, Hela cells could express IL-12 and were more easily killed by lymphocytes.

  11. Enhancement of endothelial cell migration by constitutively active LPA{sub 1}-expressing tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kitayoshi, Misaho; Kato, Kohei; Tanabe, Eriko; Yoshikawa, Kyohei; Fukui, Rie [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Fukushima, Nobuyuki [Division of Molecular Neurobiology, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Tsujiuchi, Toshifumi, E-mail: ttujiuch@life.kindai.ac.jp [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan)

    2012-06-01

    Highlights: Black-Right-Pointing-Pointer Mutated LPA{sub 1} stimulates cell migration of endothelial cells. Black-Right-Pointing-Pointer VEGF expressions are increased by mutated LPA{sub 1}. Black-Right-Pointing-Pointer LPA signaling via mutated LPA{sub 1} is involved in angiogenesis. Black-Right-Pointing-Pointer Mutated LPA{sub 1} promotes cancer cell progression. -- Abstract: Lysophosphatidic acid (LPA) receptors belong to G protein-coupled transmembrane receptors (LPA receptors; LPA{sub 1} to LPA{sub 6}). They indicate a variety of cellular response by the interaction with LPA, including cell proliferation, migration and differentiation. Recently, we have reported that constitutive active mutated LPA{sub 1} induced the strong biological effects of rat neuroblastoma B103 cells. In the present study, we examined the effects of mutated LPA{sub 1} on the interaction between B103 cells and endothelial F-2 cells. Each LPA receptor expressing B103 cells were maintained in serum-free DMEM and cell motility assay was performed with a Cell Culture Insert. When F-2 cells were cultured with conditioned medium from Lpar1 and Lpar3-expressing cells, the cell motility of F-2 cells was significantly higher than control cells. Interestingly, the motile activity of F-2 cells was strongly induced by mutated LPA{sub 1} than other cells, correlating with the expression levels of vascular endothelial growth factor (Vegf)-A and Vegf-C. Pretreatment of LPA signaling inhibitors inhibited F-2 cell motility stimulated by mutated LPA{sub 1}. These results suggest that activation of LPA signaling via mutated LPA{sub 1} may play an important role in the promotion of angiogenesis in rat neuroblastoma cells.

  12. Human dental pulp stem cells express many pluripotency regulators and differentiate into neuronal cells

    Institute of Scientific and Technical Information of China (English)

    Behnam Ebrahimi; Mohammad Mehdi Yaghoobi; Ali Mohammadi Kamal-abadi; Maryam Raoof

    2011-01-01

    Stem cells were isolated from human dental pulp using an optimized method, in which pulp pieces were digested by enzymes and immobilized to enhance cell outgrowth. Stem cell marker expression was detected by reverse transcription-PCR (RT-PCR), and differentiation markers were detected by real-time quantitative RT-PCR and immunocytochemistry. Results showed that dental pulp stem cells actively expressed nanog, oct4, nucleostemin slain-1, jmjd1a, jmjd2c, and cyclin D1. When stem cells were induced to differentiate into neurons, nucleostemin, nanog, and cyclin D1 expres-sion significantly decreased, whereas expression of neuronal markers, such as microtubule asso-ciated protein-2 and neurofilament-heavy, significantly increased. These results suggested that stem cells exited a pluripotent state and entered a neuronal differentiation pathway. In addition, results demonstrated that human dental pulp serves as a reservoir of stem cells that express defined stem cell markers; these cells were easily isolated and were induced to differentiate towards a desired cell lineage.

  13. Gene expression analysis of dendritic/Langerhans cells and Langerhans cell histiocytosis

    NARCIS (Netherlands)

    Rust, Renata; Kluiver, J.; Visser, Lydia; Harms, G.; Blokzijl, T.; Kamps, W.A.; Poppema, Sibrand; van den Berg, Anke

    2006-01-01

    Langerhans cell histiocytosis (LCH) is a neoplastic disorder that results in clonal proliferation of cells with a Langerhans cell (LQ phenotype. The pathogenesis of LCH is still poorly understood. In the present study, serial analysis of gene expression (SAGE) was applied to LCs generated from umbil

  14. LIF Upregulates Expression of NK-1R in NHBE Cells

    Directory of Open Access Journals (Sweden)

    Cheng-Ping Hu

    2006-01-01

    Full Text Available Leukemia inhibitory factor (LIF, a cytokine at the interface between neurobiology and immunology, is mainly mediated through JAK/STAT pathway and MAPK/ERK pathway. Evidence suggested LIF is related to the higher expression of neurokinin-1 receptor (NK-1R in asthma. In this study, the immunohistochemistry stain showed the expressions of NK-1R, LIF, p-STAT3, and p-ERK1/2 in the lung tissues of allergic rats were increased compared with the controls, and the main positive cell type was airway epithelial cell. Normal human bronchial epithelial cells were treated with LIF in the presence or absence of AG490 (JAK2 inhibitor, PD98059 (MEK inhibitor, and the siRNA against STAT3. Western blot and RT-PCR indicated that LIF induced the expression of NK-1R, which was inhibited by the inhibitors mentioned above. No significant interaction was found between JAK/STAT pathway and MAPK/ERK pathway. In summary, bronchial epithelial cell changes in asthma are induced by LIF which promotes the expression of NK-1R, and JAK/STAT pathway and MAPK/ERK pathway may participate in this process.

  15. Expression of Bacterial β-Galactosidase in Animal Cells

    OpenAIRE

    An, Gynheung; Hidaka, Katsuhiko; Siminovitch, Louis

    1982-01-01

    A recombinant plasmid containing the gene for bacterial β-galactosidase, situated close to the simian virus 40 early promoter, has been constructed. Transfection of CHO, L, and COS-1 cells with this plasmid led to the expression and appearance of the enzyme. Using this system, we have developed a series of promoter cloning vehicles capable of accepting promoter signals for animal genes.

  16. Reduced expression of Slit2 in renal cell carcinoma.

    Science.gov (United States)

    Ma, Wei-Jie; Zhou, Yu; Lu, Dan; Dong, Dong; Tian, Xiao-Jun; Wen, Jie-Xi; Zhang, Jun

    2014-01-01

    Slit2, initially identified as an important axon guidance molecule in the nervous system, was suggested to be involved in multiple cellular processes. Recently, Slit2 was reported to function as a potential tumor suppressor in diverse tumors. In this study, we systematically analyzed the expression level of Slit2 in renal cell carcinoma. Compared to paired adjacent non-malignant tissues, both Slit2 mRNA and protein expression were significantly down-regulated in renal cell carcinoma (RCC). Methylation-specific PCR showed that Slit2 promoter was methylated in two renal carcinoma cell lines. Pharmacologic demethylation dramatically induced Slit2 expression in cancer cell lines with weak expression of Slit2. Besides, bisulfite genomic sequencing confirmed that dense methylation existed in Slit2 promoter. Furthermore, in paired RCC samples, Slit2 methylation was observed in 8 out of 38 patients (21.1 %), which was well correlated with the down-regulation of Slit2 in RCC. Therefore, Slit2 may also be a potential tumor suppressor in RCC, which is down-regulated in RCC partially due to promoter methylation.

  17. PROFILES OF GENE EXPRESSION ASSOCIATED WITH TETRACYCLINE OVER EXPRESSION OF HSP70 IN MCF-7 BREAST CANCER CELLS

    Science.gov (United States)

    Profiles of gene expression associated with tetracycline over expression of HSP70 in MCF-7 breast cancer cells. Heat shock proteins (HSPs) protect cells from damage through their function as molecular chaperones. Some cancers reveal high levels of HSP70 expression in asso...

  18. Target cell lysis by natural killer cells is influenced by beta 2-microglobulin expression.

    Science.gov (United States)

    Müllbacher, A; King, N J

    1989-07-01

    Natural killer (NK) cells form part of the vertebrate defence against viruses and tumours, but show only limited specificity. The molecule(s) recognized by NK cells on target cells are at present unknown. Major histocompatibility complex (MHC) class I antigen concentration on target cells is inversely correlated with NK cell lysis. Here we show that MHC class I-unassociated beta 2-microglobulin (beta 2-m) expression is involved in NK cell-target cell interaction. Two human MHC class I negative cell lines, Daudi and K562, are differentially susceptible to NK cell lysis. Daudi cells are beta 2-m-negative and resistant to NK lysis, K562 are beta 2-m-positive and highly susceptible to lysis by NK cells. Interferon (IFN) treatment augments beta 2-m expression and NK lysis of K562, but not in Daudi cells. NK cell lysis of K562, but not YAC-1 cells, can be inhibited by monoclonal anti-human beta 2-m antibody. Furthermore, susceptibility of mouse embryo fibroblasts (MEF) to NK lysis can be increased by infection with recombinant vaccinia virus expressing the human beta 2-m gene.

  19. Isolation of genes predominantly expressed in guard cells and epidermal cells of Nicotiana glauca.

    Science.gov (United States)

    Smart, L B; Cameron, K D; Bennett, A B

    2000-04-01

    Guard cells are specialized and metabolically active cells which arise during the differentiation of the epidermis. Using Nicotiana glauca epidermal peels as a source of purified guard cells, we have constructed a cDNA library from guard cell RNA. In order to isolate genes that are predominantly expressed in guard cells, we performed a differential screen of this library, comparing the hybridization of a radiolabeled cDNA probe synthesized from guard cell RNA to that from a mesophyll cell cDNA probe. Sixteen clones were isolated based on their greater level of hybridization with the guard cell probe. Of these, eight had high homology to lipid transfer protein (LTP), two were similar to glycine-rich protein (GRP), and one displayed high homology to proline-rich proteins from Arabidopsis thaliana (AtPRP2, AtPRP4) and from potato guard cells (GPP). Northern analysis confirmed that one or more NgLTP genes, NgGRP1, and NgGPP1 are all differentially expressed, with highest levels in guard cells, and low or undetectable levels in mesophyll cells and in roots. In addition, all are induced to some degree in drought-stressed guard cells. NgLTP and NgGRP1 expression was localized by in situ hybridization to the guard cells and pavement cells in the epidermis. NgGRP1 expression was also detected in cells of the vasculature. Genomic Southern analysis indicated that LTP is encoded by a family of highly similar genes in N. glauca. This work has identified members of a subset of epidermis- and guard cell-predominant genes, whose protein products are likely to contribute to the unique properties acquired by guard cells and pavement cells during differentiation. PMID:10890533

  20. Sequential Notch signalling at the boundary of fringe expressing and non-expressing cells.

    Directory of Open Access Journals (Sweden)

    Tobias Troost

    Full Text Available Wing development in Drosophila requires the activation of Wingless (Wg in a small stripe along the boundary of Fringe (Fng expressing and non-expressing cells (FB, which coincides with the dorso-ventral (D/V boundary of the wing imaginal disc. The expression of Wg is induced by interactions between dorsal and ventral cells mediated by the Notch signalling pathway. It appears that mutual signalling from dorsal to ventral and ventral to dorsal cells by the Notch ligands Serrate (Ser and Delta (Dl respectively establishes a symmetric domain of Wg that straddles the D/V boundary. The directional signalling of these ligands requires the modification of Notch in dorsal cells by the glycosyltransferase Fng and is based on the restricted expression of the ligands with Ser expression to the dorsal and that of Dl to the ventral side of the wing anlage. In order to further investigate the mechanism of Notch signalling at the FB, we analysed the function of Fng, Ser and Dl during wing development at an ectopic FB and at the D/V boundary. We find that Notch signalling is initiated in an asymmetric fashion on only one side of the FB. During this initial asymmetric phase, only one ligand is required, with Ser initiating Notch-signalling at the D/V and Dl at the ectopic FB. Furthermore, our analysis suggests that Fng has also a positive effect on Ser signalling. Because of these additional properties, differential expression of the ligands, which has been a prerequisite to restrict Notch activation to the FB in the current model, is not required to restrict Notch signalling to the FB.

  1. Expression of Connexin43 in Rat Epithelial Cells and Fibroblasts

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    To explore the role of connexin43 (Cx43) in gap junctional intercellular communication (GJIC) and propagated sensation along meridians, the expression of Cx43 in the rat epithelial cells and fibroblasts was studied both in vitro and in vivo. With the in vitro study, the rat epithelial cells and fibroblasts were cultured together, and the localization of Cx43 was detected by immunohistochemistry and indirect immunofluorescent cytochemistry and under confocal microscopy . And the expression of Cx43 on the surface of the cells was examined by flow cytometry. With the in vivo examination, 20 SD rats were randomized into control group (n = 10) and electrical acupuncture group (EAgroup, n=10). EA ( 0.5-1.5 V, 4-16 Hz , 30 min) was applied to"Zusanli"acupoint for 30 min at rat's hind paw, the localization of Cx43 was immunohistochemically detected.The immunohistochemical staining and indirect immunfluorescent cytochemistry showed that Cx43was localized on the surface of the cells and in the cytoplasm. The relative expression level of Cx43on the cellular membrane surfaces of the rat epithelial cells and fibroblasts, as determined by FACS, were 13.91 % and 29.53 % respectively. Our studied suggested that Cx43 might be involved in GJIC and propagated sensation along meridians.

  2. Expression of TIA-1 and TIA-2 in T cell malignancies and T cell lymphocytosis.

    Science.gov (United States)

    Matutes, E; Coelho, E; Aguado, M J; Morilla, R; Crawford, A; Owusu-Ankomah, K; Catovsky, D

    1996-01-01

    OBJECTIVE: To investigate the reactivity with TIA-1 and TIA-2, two monoclonal antibodies that recognise, respectively, granular structures in T lymphocytes and the T cell receptor chain in cells from a variety of T cell disorders. METHODS: Cytoplasmic staining with TIA-1 and TIA-2 was carried out by the immunoalkaline phosphatase anti-alkaline phosphatase technique in 67 cases with a T cell disorder: 31 large granular lymphocyte (LGL) leukaemia, nine T-prolymphocytic leukaemia (T-PLL), five Sezary syndrome, four peripheral T cell lymphoma (PTCL), 13 T cell lymphocytosis, and five T-acute lymphoblastic leukaemia (T-ALL). All had over 75% abnormal T cells which were CD2+, CD3+, CD5+, CD7+, and negative with B cell markers. RESULTS: TIA-1 was positive in 77% cases of LGL leukaemia and half of the PTCL and T-ALL, whereas it was negative in all Sezary syndrome and most T-PLL (8/9) and reactive T-lymphocytosis (10/13). In LGL leukaemia, TIA-1 was positive irrespective of the membrane phenotype, whether CD8+, CD4- or CD4+, CD8-, and was more often positive in cases where cells were CD16+, CD56+, or CD57+. TIA-2 was positive in 60% of cases encompassing all diagnostic types of T cell disorder. There was no correlation between TIA-2 expression and that of other T cell markers, activation antigens, and natural killer markers. CONCLUSIONS: The pattern of TIA-1 expression in T cell malignancies may help in the differential diagnosis among LGL leukaemia (high expression), T cell lymphocytosis and other T cell diseases (low expression). As TIA-2 is expressed in over 95% mature T lymphocytes and thymic cells, its assessment may be useful to demonstrate aberrant phenotypes which can be exploited for detecting minimal residual disease. Images PMID:8655683

  3. Hypertonic saline impedes tumor cell-endothelial cell interaction by reducing adhesion molecule and laminin expression.

    LENUS (Irish Health Repository)

    Shields, Conor J

    2012-02-03

    BACKGROUND: Hypertonic saline infusion dampens inflammatory responses and suppresses neutrophil-endothelial interaction by reducing adhesion molecule expression. This study tested the hypothesis that hypertonic saline attenuates tumor cell adhesion to the endothelium through a similar mechanism. METHODS: Human colon cancer cells (LS174T) were transfected with green fluorescent protein and exposed to lipopolysaccharide, tumor necrosis factor-alpha, and interleukin-6 under hypertonic and isotonic conditions for 1 and 4 hours. Confluent human umbilical vein endothelial cells were similarly exposed. Cellular apoptosis and expression of adhesion molecules and laminin were measured by flow cytometry. Tumor cell adhesion to endothelium and laminin was assessed with fluorescence microscopy. Data are represented as mean +\\/- standard error of mean, and an ANOVA test was performed to gauge statistical significance, with P <.05 considered significant. RESULTS: Hypertonic exposure significantly reduced tumor cell adhesion despite the presence of the perioperative cell stressors (42 +\\/- 2.9 vs 172.5 +\\/- 12.4, P <.05), attenuated tumor cell beta-1 integrin (14.43 vs 23.84, P <.05), and endothelial cell laminin expression (22.78 +\\/- 2.2 vs 33.74 +\\/- 2.4, P <.05), but did not significantly alter cell viability. CONCLUSION: Hypertonic saline significantly attenuates tumor cell adhesion to endothelium by inhibiting adhesion molecule and laminin expression. This may halt the metastatic behavior of tumor cells shed at surgery.

  4. 'Fluorescent Cell Chip' for immunotoxicity testing: Development of the c-fos expression reporter cell lines

    International Nuclear Information System (INIS)

    The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals

  5. Expression of myc family oncoproteins in small-cell lung-cancer cell lines and xenografts

    DEFF Research Database (Denmark)

    Rygaard, K; Vindeløv, L L; Spang-Thomsen, M

    1993-01-01

    . WE examined the expression of myc proto-oncogenes at the mRNA and protein level in 23 cell lines or xenografts. In the cell lines, the doubling time and the cell-cycle distribution, as determined by flow-cytometric DNA analysis, were examined to establish whether the level of myc......A number of genes have altered activity in small-cell lung cancer (SCLC), but especially genes of the myc family (c-myc, L-myc and N-myc) are expressed at high levels in SCLC. Most studies have explored expression at the mRNA level, whereas studies of myc family oncoprotein expression are sparse......-gene-family expression correlated with proliferative parameters. All tumours expressed at least one myc family member at the mRNA level. Exclusive c-myc mRNA expression was demonstrated in 8 tumours, L-myc in 7 and N-myc in I. Five tumours expressed both c-myc and L-myc, and 2 tumours expressed both c-myc and N-myc...

  6. Cell-surface expression of Hsp70 on hematopoietic cancer cells after inhibition of HDAC activity

    DEFF Research Database (Denmark)

    Jensen, Helle; Andresen, Lars; Hansen, Karen Aagaard;

    2009-01-01

    We show that inhibition of HDAC activity leads to surface expression of Hsp70 on various hematopoietic cancer cells, an occurance that was not observed on naïve or activated peripheral blood cells. HDAC inhibitor-mediated Hsp70 surface expression was confined to the apoptotic Annexin V-positive c......We show that inhibition of HDAC activity leads to surface expression of Hsp70 on various hematopoietic cancer cells, an occurance that was not observed on naïve or activated peripheral blood cells. HDAC inhibitor-mediated Hsp70 surface expression was confined to the apoptotic Annexin V......-positive cells and blocked by inhibition of apoptosis. Other chemotherapeutic inducers of apoptosis such as etoposide and camptothecin also led to a robust induction of Hsp70 surface expression. Hsp70 expression was, however, not caused by induction of apoptosis per se, as activated CD4 T cells remained Hsp70...... surface-negative despite effective induction of apoptosis. Interestingly, inhibition of endolysosomes or normal ER/Golgi transport did not affect Hsp70 surface expression. Intracellular calcium and the transcription factor Sp1, which has been shown previously to be important for the intracellular stress...

  7. Expression of Hyaluronidase by Tumor Cells Induces Angiogenesis in vivo

    Science.gov (United States)

    Liu, Dacai; Pearlman, Eric; Diaconu, Eugenia; Guo, Kun; Mori, Hiroshi; Haqqi, Tariq; Markowitz, Sanford; Willson, James; Sy, Man-Sun

    1996-07-01

    Hyaluronic acid is a proteoglycan present in the extracellular matrix and is important for the maintenance of tissue architecture. Depolymerization of hyaluronic acid may facilitate tumor invasion. In addition, oligosaccharides of hyaluronic acid have been reported to induce angiogenesis. We report here that a hyaluronidase similar to the one on human sperm is expressed by metastatic human melanoma, colon carcinoma, and glioblastoma cell lines and by tumor biopsies from patients with colorectal carcinomas, but not by tissues from normal colon. Moreover, angiogenesis is induced by hyaluronidase+ tumor cells but not hyaluronidase- tumor cells and can be blocked by an inhibitor of hyaluronidase. Tumor cells thus use hyaluronidase as one of the ``molecular saboteurs'' to depolymerize hyaluronic acid to facilitate invasion. As a consequence, breakdown products of hyaluronic acid can further promote tumor establishment by inducing angiogenesis. Hyaluronidase on tumor cells may provide a target for anti-neoplastic drugs.

  8. Expression of Aquaporin-6 in Rat Retinal Ganglion Cells.

    Science.gov (United States)

    Jang, Sun Young; Lee, Eung Suk; Ohn, Young-Hoon; Park, Tae Kwann

    2016-08-01

    Several aquaporins (AQPs) have been identified to be present in the eyes, and it has been suggested that they are involved in the movement of water and small solutes. AQP6, which has low water permeability and transports mainly anions, was recently discovered in the eyes. In the present study, we investigate the localization of AQP6 in the rat retina and show that AQP6 is selectively localized to the ganglion cell layer and the outer plexiform layer. Along with the gradual decrease in retinal ganglion cells after a crushing injury of optic nerve, immunofluorescence signals of AQP6 gradually decreased. Confocal microscope images confirmed AQP6 expression in retinal ganglion cells and Müller cells in vitro. Therefore, AQP6 might participate in water and anion transport in these cells. PMID:26526333

  9. Boswellic acid inhibits expression of acid sphingomyelinase in intestinal cells

    Directory of Open Access Journals (Sweden)

    Duan Rui-Dong

    2009-12-01

    Full Text Available Abstract Background Boswellic acid is a type of triterpenoids with antiinflammatory and antiproliferative properties. Sphingomyelin metabolism generates multiple lipid signals affecting cell proliferation, inflammation, and apoptosis. Upregulation of acid sphingomyelinase (SMase has been found in several inflammation-related diseases such as inflammatory bowel diseases, atherosclerosis, and diabetes. Methods The present study is to examine the effect of 3-acetyl-11-keto-β-boswellic acids (AKBA, a potent boswellic acid, on acid SMase activity and expression in intestinal cells. Both transformed Caco-2 cells and non-transformed Int407 cells were incubated with AKBA. After incubation, the change of acid SMase activity was assayed biochemically, the enzyme protein was examined by Western blot, and acid SMase mRNA was quantified by qPCR. Results We found that AKBA decreased acid SMase activity in both intestinal cell lines in dose and time dependent manners without affecting the secretion of the enzyme to the cell culture medium. The effect of AKBA was more effective in the fetal bovine serum-free culture medium. Among different types of boswellic acid, AKBA was the most potent one. The inhibitory effect on acid SMase activity occurred only in the intact cells but not in cell-free extract in the test tubes. At low concentration, AKBA only decreased the acid SMase activity but not the quantity of the enzyme protein. However, at high concentration, AKBA decreased both the mass of acid SMase protein and the mRNA levels of acid SMase in the cells, as demonstrated by Western blot and qPCR, respectively. Under the concentrations decreasing acid SMase activity, AKBA significantly inhibited cell proliferation. Conclusion We identified a novel inhibitory effect of boswellic acids on acid SMase expression, which may have implications in human diseases and health.

  10. Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Gehrau, Ricardo C.; D' Astolfo, Diego S.; Andreoli, Veronica [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Bocco, Jose L., E-mail: jbocco@fcq.unc.edu.ar [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Koritschoner, Nicolas P. [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina)

    2011-02-10

    The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC{sub 50}). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p < 0.0001) in KLF6 mRNA levels were observed depending on the cellular p53 status upon cell damage. KLF6 expression was significantly increased in 63% of p53-deficient cells (122/195). Conversely, KLF6 mRNA level decreased nearly 4 fold in more than 70% of p53+/+ cells. In addition, klf6 gene promoter activity was down-regulated by DNA damaging agents in cells expressing the functional p53 protein whereas it was moderately increased in the absence of functional p53. Consistent results were obtained for the endogenous KLF6 protein level. Results indicate that human klf6 gene expression is responsive to external cell damage mediated by IC{sub 50} concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable

  11. Behavioral experience induces zif268 expression in mature granule cells but suppresses its expression in immature granule cells

    Directory of Open Access Journals (Sweden)

    Kylie A. Huckleberry

    2015-08-01

    Full Text Available Thousands of neurons are born each day in the dentate gyrus (DG, but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in DG. The immediate-early gene (IEG zif268 is an important mediator of these effects, as its expression is induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Veyrac et al., 2013. Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs. In the general granule cell population, zif268 expression peaked 1 hour after novel environment exposure and returned to baseline by 8 hours post-exposure. However, in the doublecortin-positive (DCX+ immature neurons, zif268 expression was suppressed relative to home cage for at least 8 hours post-exposure. We next determined that exposure to water maze training, an enriched environment, or a novel environment caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 in the general DGC population and in 6-week-old adult-born neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. Novel environment exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly suppressed zif268 expression in 3-week-old neurons. In summary, behavioral experience transiently activated expression of zif268 in mature DGCs but caused a more long-lasting suppression of zif268 expression in immature, adult-born DGCs. We hypothesize that zif268 suppression inhibits memory-related synaptic plasticity in immature DGCs or mediates learning-induced apoptosis of immature adult

  12. Cell-free protein expression based on extracts from CHO cells.

    Science.gov (United States)

    Brödel, Andreas K; Sonnabend, Andrei; Kubick, Stefan

    2014-01-01

    Protein expression systems are widely used in biotechnology and medicine for the efficient and economic production of therapeutic proteins. Today, cultivated Chinese hamster ovary (CHO) cells are the market dominating mammalian cell-line for the production of complex therapeutic proteins. Despite this outstanding potential of CHO cells, no high-yield cell-free system based on translationally active lysates from these cells has been reported so far. To date, CHO cell extracts have only been used as a foundational research tool for understanding mRNA translation (Lodish et al., 1974; McDowell et al., 1972). In the present study, we address this fact by establishing a novel cell-free protein expression system based on extracts from cultured CHO cells. Lysate preparation, adaptation of in vitro reaction conditions and the construction of particular expression vectors are considered for high-yield protein production. A specific in vitro expression vector, which includes an internal ribosome entry site (IRES) from the intergenic region (IGR) of the Cricket paralysis virus (CrPV), has been constructed in order to obtain optimal performance. The IGR IRES is supposed to bind directly to the eukaryotic 40S ribosomal subunit thereby bypassing the process of translation initiation, which is often a major bottleneck in cell-free systems. The combination of expression vector and optimized CHO cell extracts enables the production of approximately 50 µg/mL active firefly luciferase within 4 h. The batch-type cell-free coupled transcription-translation system has the potential to perform post-translational modifications, as shown by the glycosylation of erythropoietin. Accordingly, the system contains translocationally active endogenous microsomes, enabling the co-translational incorporation of membrane proteins into biological membranes. Hence, the presented in vitro translation system is a powerful tool for the fast and convenient optimization of expression constructs, the

  13. Characterization of cell subpopulations expressing progenitor cell markers in porcine cardiac valves.

    Directory of Open Access Journals (Sweden)

    Huan Wang

    Full Text Available Valvular interstitial cells (VICs are the main population of cells found in cardiac valves. These resident fibroblastic cells play important roles in maintaining proper valve function, and their dysregulation has been linked to disease progression in humans. Despite the critical functions of VICs, their cellular composition is still not well defined for humans and other mammals. Given the limited availability of healthy human valves and the similarity in valve structure and function between humans and pigs, we characterized porcine VICs (pVICs based on expression of cell surface proteins and sorted a specific subpopulation of pVICs to study its functions. We found that small percentages of pVICs express the progenitor cell markers ABCG2 (~5%, NG2 (~5% or SSEA-4 (~7%, whereas another subpopulation (~5% expresses OB-CDH, a type of cadherin expressed by myofibroblasts or osteo-progenitors. pVICs isolated from either aortic or pulmonary valves express most of these protein markers at similar levels. Interestingly, OB-CDH, NG2 and SSEA-4 all label distinct valvular subpopulations relative to each other; however, NG2 and ABCG2 are co-expressed in the same cells. ABCG2(+ cells were further characterized and found to deposit more calcified matrix than ABCG2(- cells upon osteogenic induction, suggesting that they may be involved in the development of osteogenic VICs during valve pathology. Cell profiling based on flow cytometry and functional studies with sorted primary cells provide not only new and quantitative information about the cellular composition of porcine cardiac valves, but also contribute to our understanding of how a subpopulation of valvular cells (ABCG2(+ cells may participate in tissue repair and disease progression.

  14. Resveratrol Represses Pokemon Expression in Human Glioma Cells.

    Science.gov (United States)

    Yang, Yutao; Cui, Jiajun; Xue, Feng; Overstreet, Anne-Marie; Zhan, Yiping; Shan, Dapeng; Li, Hui; Li, Hui; Wang, Yongjun; Zhang, Mengmeng; Yu, Chunjiang; Xu, Zhi-Qing David

    2016-03-01

    POK erythroid myeloid ontogenic factor (Pokemon), an important proto-oncoprotein, is a transcriptional repressor that regulates the expression of many genes and plays an important role in tumorigenesis. Resveratrol (RSV), a natural polyphenolic compound, has many beneficial biological effects on health. In this study, we investigated the role of Pokemon in RSV-induced biological effects and the effect of RSV on the expression of Pokemon in glioma cells. We found that overexpression of Pokemon decreased RSV-induced cell apoptosis, senescence, and anti-proliferative effects. Moreover, we showed that RSV could efficiently decrease the activity of the Pokemon promoter and the expression of Pokemon. Meanwhile, RSV also inhibited Sp1 DNA binding activity to the Pokemon promoter; whereas, it did not influence the expression and nuclear translocation of Sp1. In addition, we found that RSV could increase the recruitment of HDAC1, but decreased p300 to the Pokemon promoter. Taken together, all these results extended our understanding on the anti-cancer mechanism of RSV in glioma cells. PMID:25875864

  15. CD117 expression on blast cells in acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Goryainova N.V.

    2015-09-01

    Full Text Available The aim of the present work was to analyze the frequency of CD117 (c-KIT antigen expression on the blast cells in acute myeloid leukemia (AML, evaluation of the presence of the relationship between the expression of the c-KIT and leukemia according to the FAB classification and definition of co-expression of the antigen CD117, antigens CD33 and CD34. The data of 47 patients with AML were diagnosed. M0 AML variant was established in 3 (6% patients, M1 – in 2 (4%, M2 – in 9 (20%, M4 – in 22 (47% and M5 – in 11 (23%. For immunophenotypic stu¬dies monoclonal antibodies (mAb that detect antigens of anti-CD34, anti-CD33 and anti-CD117 (Becton Dickinson, USA were used. The presence of the antigen CD117 was detected in 39 people, accounting for 83% of all surveyed. Antigen c-KIT was present in 48.117.0% cells on average: in all 3 cases – AML M0, in2 cases of AML M1, in 6 cases – AML M2, 20 of 22 cases – AML M4 and in 8 of 11 AML M5 cases. Average levels of CD117 in investigated leukemia cases statistically differed significantly (p=0.0067. Among 39 CD117- positive patients in 25 (53% co-expression of CD117+/CD34+ was revealed. Expression of CD117+/CD34- was observed in 14 cases (30%, CD117-/CD34+ – in 4 cases (8,5%, CD117-/CD34- – in 4 cases (8.5%. CD34 had of 64% of cells of myeloid origin. A high positive cor¬relation between expression of CD117 and CD34 (r=+0,5169 was determined, being statistically significant (p0,0067.

  16. Exogenous Expression of N-Cadherin in Breast Cancer Cells Induces Cell Migration, Invasion, and Metastasis

    OpenAIRE

    Hazan, Rachel B.; Phillips, Greg R.; Qiao, Rui Fang; Norton, Larry; Aaronson, Stuart A.

    2000-01-01

    E- and N-cadherin are calcium-dependent cell adhesion molecules that mediate cell–cell adhesion and also modulate cell migration and tumor invasiveness. The loss of E-cadherin–mediated adhesion has been shown to play an important role in the transition of epithelial tumors from a benign to an invasive state. However, recent evidence indicates that another member of the cadherin family, N-cadherin, is expressed in highly invasive tumor cell lines that lacked E-cadherin expression. These findin...

  17. Use of RUNX2 Expression to Identify Osteogenic Progenitor Cells Derived from Human Embryonic Stem Cells

    OpenAIRE

    Li Zou; Fahad K. Kidwai; Ross A. Kopher; Jason Motl; Cory A. Kellum; Jennifer J. Westendorf; Dan S. Kaufman

    2015-01-01

    Summary We generated a RUNX2-yellow fluorescent protein (YFP) reporter system to study osteogenic development from human embryonic stem cells (hESCs). Our studies demonstrate the fidelity of YFP expression with expression of RUNX2 and other osteogenic genes in hESC-derived osteoprogenitor cells, as well as the osteogenic specificity of YFP signal. In vitro studies confirm that the hESC-derived YFP+ cells have similar osteogenic phenotypes to osteoprogenitor cells generated from bone-marrow me...

  18. Gene Expression Profiling Predicts Survival in Conventional Renal Cell Carcinoma.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available BACKGROUND: Conventional renal cell carcinoma (cRCC accounts for most of the deaths due to kidney cancer. Tumor stage, grade, and patient performance status are used currently to predict survival after surgery. Our goal was to identify gene expression features, using comprehensive gene expression profiling, that correlate with survival. METHODS AND FINDINGS: Gene expression profiles were determined in 177 primary cRCCs using DNA microarrays. Unsupervised hierarchical clustering analysis segregated cRCC into five gene expression subgroups. Expression subgroup was correlated with survival in long-term follow-up and was independent of grade, stage, and performance status. The tumors were then divided evenly into training and test sets that were balanced for grade, stage, performance status, and length of follow-up. A semisupervised learning algorithm (supervised principal components analysis was applied to identify transcripts whose expression was associated with survival in the training set, and the performance of this gene expression-based survival predictor was assessed using the test set. With this method, we identified 259 genes that accurately predicted disease-specific survival among patients in the independent validation group (p < 0.001. In multivariate analysis, the gene expression predictor was a strong predictor of survival independent of tumor stage, grade, and performance status (p < 0.001. CONCLUSIONS: cRCC displays molecular heterogeneity and can be separated into gene expression subgroups that correlate with survival after surgery. We have identified a set of 259 genes that predict survival after surgery independent of clinical prognostic factors.

  19. Multiple melanocortin receptors are expressed in bone cells

    Science.gov (United States)

    Zhong, Qing; Sridhar, Supriya; Ruan, Ling; Ding, Ke-Hong; Xie, Ding; Insogna, Karl; Kang, Baolin; Xu, Jianrui; Bollag, Roni J.; Isales, Carlos M.

    2005-01-01

    Melanocortin receptors belong to the seven transmembrane domain, G-protein coupled family of receptors. There are five members of this receptor family labeled MC1R-MC5R. These receptors are activated by fragments derived from a larger molecule, proopiomelanocortin (POMC) and include ACTH, alpha beta and gamma-MSH and beta-endorphin. Because of in vitro and in vivo data suggesting direct effects of these POMC molecules on bone and bone turnover, we examined bone and bone derived cells for the presence of the various members of the melanocortin receptor family. We report that the five known melanocortin receptors are expressed to varying degrees in osteoblast-like and osteoclastic cells. POMC fragments increased proliferation and expression of a variety of genes in osteoblastic cells. Furthermore, POMC mRNA was detected in osteoclastic cells. These data demonstrate that POMC-derived peptide hormones acting through high affinity melanocortin receptors have specific effects on bone cells. Thus, in addition to the indirect effects of POMC-derived hormones on bone turnover through their modulation of steroid hormone secretion, POMC fragments may have direct and specific effects on bone cell subpopulations.

  20. Chondrogenic differentiation and lubricin expression of caprine infraspinatus tendon cells.

    Science.gov (United States)

    Funakoshi, Tadanao; Spector, Myron

    2010-06-01

    Reparative strategies for the treatment of injuries to tendons, including those of the rotator cuff of the shoulder, need to address the formation of the cartilage which serves as the attachment apparatus to bone and which forms at regions undergoing compressive loading. Moreover, recent work indicates that cells employed for rotator cuff repair may need to synthesize a lubricating glycoprotein, lubricin, which has recently been found to play a role in tendon tribology. The objective of the present study was to investigate the chondrogenic differentiation and lubricin expression of caprine infraspinatus tendon cells in monolayer and three-dimensional culture, and to compare the behavior with bone marrow-derived mesenchymal stem cells (MSCs). The results demonstrated that while tendon cells in various media, including chondrogenic medium, expressed lubricin, virtually none of the MSCs synthesized this important lubricating molecule. Also of interest was that the cartilage formation capacity of the tendon cells grown in pellet culture in chondrogenic medium was comparable with MSCs. These data inform the use of tendon cells for rotator cuff repair, including for fibrocartilaginous zones.

  1. Heterogeneous expression of Drosophila gustatory receptors in enteroendocrine cells.

    Science.gov (United States)

    Park, Jeong-Ho; Kwon, Jae Young

    2011-01-01

    The gastrointestinal tract is emerging as a major site of chemosensation in mammalian studies. Enteroendocrine cells are chemosensory cells in the gut which produce regulatory peptides in response to luminal contents to regulate gut physiology, food intake, and glucose homeostasis, among other possible functions. Increasing evidence shows that mammalian taste receptors and taste signaling molecules are expressed in enteroendocrine cells in the gut. Invertebrate models such as Drosophila can provide a simple and genetically tractable system to study the chemosensory functions of enteroendocrine cells in vivo. To establish Drosophila enteroendocrine cells as a model for studying gut chemosensation, we used the GAL4/UAS system to examine the expression of all 68 Gustatory receptors (Grs) in the intestine. We find that 12 Gr-GAL4 drivers label subsets of enteroendocrine cells in the midgut, and examine colocalization of these drivers with the regulatory peptides neuropeptide F (NPF), locustatachykinin (LTK), and diuretic hormone 31 (DH31). RT-PCR analysis provides additional evidence for the presence of Gr transcripts in the gut. Our results suggest that the Drosophila Grs have chemosensory roles in the intestine to regulate physiological functions such as food uptake, nutrient absorption, or sugar homeostasis. PMID:22194978

  2. Heterogeneous expression of Drosophila gustatory receptors in enteroendocrine cells.

    Directory of Open Access Journals (Sweden)

    Jeong-Ho Park

    Full Text Available The gastrointestinal tract is emerging as a major site of chemosensation in mammalian studies. Enteroendocrine cells are chemosensory cells in the gut which produce regulatory peptides in response to luminal contents to regulate gut physiology, food intake, and glucose homeostasis, among other possible functions. Increasing evidence shows that mammalian taste receptors and taste signaling molecules are expressed in enteroendocrine cells in the gut. Invertebrate models such as Drosophila can provide a simple and genetically tractable system to study the chemosensory functions of enteroendocrine cells in vivo. To establish Drosophila enteroendocrine cells as a model for studying gut chemosensation, we used the GAL4/UAS system to examine the expression of all 68 Gustatory receptors (Grs in the intestine. We find that 12 Gr-GAL4 drivers label subsets of enteroendocrine cells in the midgut, and examine colocalization of these drivers with the regulatory peptides neuropeptide F (NPF, locustatachykinin (LTK, and diuretic hormone 31 (DH31. RT-PCR analysis provides additional evidence for the presence of Gr transcripts in the gut. Our results suggest that the Drosophila Grs have chemosensory roles in the intestine to regulate physiological functions such as food uptake, nutrient absorption, or sugar homeostasis.

  3. Identifying cell types from spatially referenced single-cell expression datasets.

    Directory of Open Access Journals (Sweden)

    Jean-Baptiste Pettit

    2014-09-01

    Full Text Available Complex tissues, such as the brain, are composed of multiple different cell types, each of which have distinct and important roles, for example in neural function. Moreover, it has recently been appreciated that the cells that make up these sub-cell types themselves harbour significant cell-to-cell heterogeneity, in particular at the level of gene expression. The ability to study this heterogeneity has been revolutionised by advances in experimental technology, such as Wholemount in Situ Hybridizations (WiSH and single-cell RNA-sequencing. Consequently, it is now possible to study gene expression levels in thousands of cells from the same tissue type. After generating such data one of the key goals is to cluster the cells into groups that correspond to both known and putatively novel cell types. Whilst many clustering algorithms exist, they are typically unable to incorporate information about the spatial dependence between cells within the tissue under study. When such information exists it provides important insights that should be directly included in the clustering scheme. To this end we have developed a clustering method that uses a Hidden Markov Random Field (HMRF model to exploit both quantitative measures of expression and spatial information. To accurately reflect the underlying biology, we extend current HMRF approaches by allowing the degree of spatial coherency to differ between clusters. We demonstrate the utility of our method using simulated data before applying it to cluster single cell gene expression data generated by applying WiSH to study expression patterns in the brain of the marine annelid Platynereis dumereilii. Our approach allows known cell types to be identified as well as revealing new, previously unexplored cell types within the brain of this important model system.

  4. Transglutaminase 2 Expression and Its Prognostic Significance in Clear Cell Renal Cell Carcinoma

    OpenAIRE

    Park, Min Jee; Baek, Hae Woon; Rhee, Ye-Young; Lee, Cheol; Park, Jeong Whan; Kim, Hwal Woong; Moon, Kyung Chul

    2015-01-01

    Background: A few recent studies have demonstrated a possible role of transglutaminase 2 (TG2) in tumorigenesis or progression of renal cell carcinoma (RCC). The aim of this study was to examine TG2 expression and its clinicopathologic significance in a large number of human clear cell RCCs (CCRCCs). Methods: We analyzed 638 CCRCC patients who underwent partial or radical nephrectomy between 1995 and 2005. The expression of TG2 was determined by immunohistochemistry and categorized into four ...

  5. Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

    OpenAIRE

    Moussalli, Micheline J.; Wu, Yuanqing; Zuo, Xiangsheng; Yang, Xiu L.; Wistuba, Ignacio Ivan; Raso, Maria G.; Morris, Jeffrey S.; Bowser, Jessica L.; Minna, John D.; Lotan, Reuben; SHUREIQI, IMAD

    2011-01-01

    Loss of terminal cell differentiation promotes tumorigenesis. 15-LOX-1 contributes to terminal cell differentiation in normal cells. The mechanistic significance of 15-LOX-1 expression loss in human cancers to terminal cell differentiation suppression is unknown. In a screen of 128 cancer cell lines representing more than 20 types of human cancer, we found that 15-LOX-1 mRNA expression levels were markedly lower than levels in terminally differentiated cells. Relative expression levels of 15-...

  6. ELK3 Expression Correlates With Cell Migration, Invasion, and Membrane Type 1-Matrix Metalloproteinase Expression in MDA-MB-231 Breast Cancer Cells.

    Science.gov (United States)

    Heo, Sun-Hee; Lee, Je-Yong; Yang, Kyung-Min; Park, Kyung-Soon

    2015-01-01

    ELK3 is a member of the Ets family of transcription factors. Its expression is associated with angiogenesis, vasculogenesis, and chondrogenesis. ELK3 inhibits endothelial migration and tube formation through the regulation of MT1-MMP transcription. This study assessed the function of ELK3 in breast cancer (BC) cells by comparing its expression between basal and luminal cells in silico and in vitro. In silico analysis showed that ELK3 expression was higher in the more aggressive basal BC cells than in luminal BC cells. Similarly, in vitro analysis showed that ELK3 mRNA and protein expression was higher in basal BC cells than in normal cells and luminal BC cells. To investigate whether ELK3 regulates basal cell migration or invasion, knockdown was achieved by siRNA in the basal BC cell line MDA-MB-231. Inhibition of ELK3 expression decreased cell migration and invasion and downregulated MT1-MMP, the expression of which is positively correlated with tumor cell invasion. In silico analysis revealed that ELK3 expression was associated with that of MT1-MMP in several BC cell lines (0.98 Pearson correlation coefficient). Though MT1-MMP expression was upregulated upon ELK3 nuclear translocation, ELK3 did not directly bind to the 1.3-kb promoter region of the MT1-MMP gene. These results suggest that ELK3 plays a positive role in the metastasis of BC cells by indirectly regulating MT1-MMP expression. PMID:26637400

  7. Malignant T cells express lymphotoxin alpha and drive endothelial activation in cutaneous T cell lymphoma

    DEFF Research Database (Denmark)

    Lauenborg, Britt; Christensen, Louise; Ralfkiaer, Ulrik;

    2015-01-01

    Lymphotoxin α (LTα) plays a key role in the formation of lymphatic vasculature and secondary lymphoid structures. Cutaneous T cell lymphoma (CTCL) is the most common primary lymphoma of the skin and in advanced stages, malignant T cells spreads through the lymphatic to regional lymph nodes...... to internal organs and blood. Yet, little is known about the mechanism of the CTCL dissemination. Here, we show that CTCL cells express LTα in situ and that LTα expression is driven by aberrantly activated JAK3/STAT5 pathway. Importantly, via TNF receptor 2, LTα functions as an autocrine factor by stimulating...... expression of IL-6 in the malignant cells. LTα and IL-6, together with VEGF promote angiogenesis by inducing endothelial cell sprouting and tube formation. Thus, we propose that LTα plays a role in malignant angiogenesis and disease progression in CTCL and may serve as a therapeutic target in this disease....

  8. Cambogin is preferentially cytotoxic to cells expressing PDGFR.

    Directory of Open Access Journals (Sweden)

    Ze Tian

    Full Text Available Platelet-derived growth factor receptors (PDGFRs have been implicated in a wide array of human malignancies, including medulloblastoma (MB, the most common brain tumor of childhood. Although significant progress in MB biology and therapeutics has been achieved during the past decades, MB remains a horrible challenge to the physicians and researchers. Therefore, novel inhibitors targeting PDGFR signaling pathway may offer great promise for the treatment of MB. In the present study, we investigated the cytotoxicity and mechanisms of cambogin in Daoy MB cells. Our results show that cambogin triggers significant S phase cell cycle arrest and apoptosis via down regulation of cyclin A and E, and activation of caspases. More importantly, further mechanistic studies demonstrated that cambogin inhibits PDGFR signaling in Daoy and genetically defined mouse embryo fibroblast (MEF cell lines. These results suggest that cambogin is preferentially cytotoxic to cells expressing PDGFR. Our findings may provide a novel approach by targeting PDGFR signaling against MB.

  9. Arsenic trioxide inhibits cell proliferation and human papillomavirus oncogene expression in cervical cancer cells

    International Nuclear Information System (INIS)

    Highlights: • As2O3 inhibits growth of cervical cancer cells and expression of HPV oncogenes in these cells. • HPV-negative cervical cancer cells are more sensitive to As2O3 than HPV-positive cervical cancer cells. • HPV-18 positive cervical cancer cells are more sensitive to As2O3 than HPV-16 positive cancer cells. • Down-regulation of HPV oncogenes by As2O3 is partially due to the diminished AP-1 binding. - Abstract: Arsenic trioxide (As2O3) has shown therapeutic effects in some leukemias and solid cancers. However, the molecular mechanisms of its anticancer efficacy have not been clearly elucidated, particularly in solid cancers. Our previous data showed that As2O3 induced apoptosis of human papillomavirus (HPV) 16 DNA-immortalized human cervical epithelial cells and cervical cancer cells and inhibited the expression of HPV oncogenes in these cells. In the present study, we systemically examined the effects of As2O3 on five human cervical cancer cell lines and explored the possible molecular mechanisms. MTT assay showed that HPV-negative C33A cells were more sensitive to growth inhibition induced by As2O3 than HPV-positive cervical cancer cells, and HPV 18-positive HeLa and C4-I cells were more sensitive to As2O3 than HPV 16-positive CaSki and SiHa cells. After As2O3 treatment, both mRNA and protein levels of HPV E6 and E7 obviously decreased in all HPV positive cell lines. In contrast, p53 and Rb protein levels increased in all tested cell lines. Transcription factor AP-1 protein expression decreased significantly in HeLa, CaSki and C33A cells with ELISA method. These results suggest that As2O3 is a potential anticancer drug for cervical cancer

  10. Liver-specific gene expression in mesenchymal stem cells is induced by liver cells

    Institute of Scientific and Technical Information of China (English)

    Claudia Lange; Philipp Bassler; Michael V. Lioznov; Helge Bruns; Dietrich Kluth; Axel R. Zander; Henning C. Fiegel

    2005-01-01

    AIM: The origin of putative liver cells from distinct bone marrow stem cells, e.g. hematopoietic stem cells or multipotent adult progenitor cells was found in recent in vitro studies. Cell culture experiments revealed a key role of growth factors for the induction of liver-specific genes in stem cell cultures. We investigated the potential of rat mesenchymal stem cells (MSC) from bone marrow to differentiate into hepatocytic cells in vitro. Furthermore,we assessed the influence of cocultured liver cells on induction of liver-specific gene expression.METHODS: Mesenchymal stem cells were marked with green fluorescent protein (GFP) by retroviral gene transduction. Clonal marked MSC were either cultured under liver stimulating conditions using fibronectin-coated culture dishes and medium supplemented with SCF, HGF,EGF, and FGF-4 alone, or in presence of freshly isolated rat liver cells. Cells in cocultures were harvested and GFP+ or GFP- cells were separated using fluorescence activated cell sorting. RT-PCR analysis for the stem cell marker Thy1 and the hepatocytic markers CK-18, albumin, CK-19,and AFP was performed in the different cell populations.RESULTS: Under the specified culture conditions, rat MSC cocultured with liver cells expressed albumin-, CK-18,CK-19, and AFP-RNA over 3 weeks, whereas MSC cultured alone did not show liver specific gene expression.CONCLUSION: The results indicate that (1) rat MSC from bone marrow can differentiate towards hepatocytic lineage in vitro, and (2) that the microenvironment plays a decisive role for the induction of hepatic differentiation of rMSC.

  11. Gene expression profiles of human bone marrow derived mesenchymal stem cells and tendon cells

    Institute of Scientific and Technical Information of China (English)

    胡庆柳; 朴英杰; 邹飞

    2003-01-01

    Objective To study the gene expression profiles of human bone marrow derived mesenchymal stem cells and tendon cells.Methods Total RNA extracted from human bone marrow derived mesenchymal stem cells and tendon cells underwent reverse transcription, and the products were labeled with α-32P dCTP. The cDNA probes of total RNA were hybridized to cDNA microarray with 1176 genes, and then the signals were analyzed by AtlasImage analysis software Version 1.01a.Results Fifteen genes associated with cell proliferation and signal transduction were up-regulated, and one gene that takes part in cell-to-cell adhesion was down-regulated in tendon cells.Conclusion The 15 up-regulated and one down-regulated genes may be beneficial to the orientational differentiation of mesenchymal stem cells into tendon cells.

  12. Trichostatin A Regulates hGCN5 Expression and Cell Cycle on Daudi Cells in vitro

    Institute of Scientific and Technical Information of China (English)

    LIU Hongli; CHEN Yan; CUI Guohui; WU Gang; WANG Tao; HU Jianli

    2006-01-01

    The expression of human general control of amino acid synthesis protein 5 (hGCN5) in human Burkitt's lymphoma Daudi cells in vitro, effects of Trichostatin A (TSA) on cell proliferation and apoptosis and the molecular mechanism of TSA inhibiting proliferation of Daudi cells were investigated. The effects of TSA on the growth of Daudi cells were studied by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium (MTT) assay. The effect of TSA on the cell cycle of Daudi cells was assayed by a propidium iodide method. Immunochemistry and Western blot were used to detect the expression of hGCN5. The proliferation of Daudi cells was decreased in TSA-treated group with a 24 h IC50 value of 415.3979 μg/L. TSA induced apoptosis of Daudi cells in a time- and dose-dependent manner. Treatment with TSA (200 and 400 μg/L) for 24 h, the apoptosis rates of Daudi cells were (14.74±2.04) % and (17.63±1.25) %, respectively. The cell cycle was arrested in G0/G1 phase (50, 100 μtg/L) and in G2/M phase (200 μg/L) by treatment with TSA for 24 h.The expression of hGCN5 protein in Daudi cells was increased in 24 h TSA-treated group by immunochemistry and Western blot (P<0.05). It was suggested that TSA as HDACIs could increase the expression of hGCN5 in Daudi cells, and might play an important role in regulating the proliferation and apoptosis of B-NHL cell line Daudi cells.

  13. cDNA expression cloning in mammalian cells.

    Science.gov (United States)

    Hoffman, B J

    2001-05-01

    This unit contains protocols for expression cloning in mammalian cells. Either calcium phosphate- or liposome-mediated transfection of mammalian cells, or virus infection and liposome-mediated transfection are used to screen pools derived from a cDNA library. cDNA pools are prepared for cloning from library-transformed E. coli grown in liquid culture medium or on antibiotic-containing selection plates. Results of screening assays for expression can be detected using autoradiography of dishes of cultured cells to identify clones, direct visualization of radiolabeled cells on emulsion-coated and developed chamber slides, detection and quantification of gene activity by a functional (transport) assay with scintillation counting, or detection using a filter-based assay for binding of radioligand to membranes or whole cells. The most critical step of any cDNA cloning project is the establishment of the screening protocol. Therefore, the bioassay for the gene product must be established prior to executing any of these protocols, including construction of the cDNA library. PMID:18428491

  14. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Gorman, C.M.; Moffat, L.F.; Howard, B.H.

    1982-09-01

    The authors constructed a series of recombinant genomes which directed expression of the enzyme chloramphenicol acetyltransferase (CAT) in mammalian cells. The prototype recombinant in this series, pSV2-cat, consisted of the beta-lactamase gene and origin of replication from pBR322 coupled to a simian virus 40 (SV40) early transcription region into which CAT coding sequences were inserted. Readily measured levels of CAT accumulated within 48 h after the introduction of pSV2-cat DNA into African green monkey kidney CV-1 cells. Because endogenous CAT activity is not present in CV-1 or other mammalian cells, and because rapid, sensitive assays for CAT activity are available, these recombinants provided a uniquely convenient system for monitoring the expression of foreign DNAs in tissue culture cells. To demonstrate the usefulness of this system, we constructed derivatives of pSV2-cat from which part or all of the SV 40 promoter region was removed. Deletion of one copy of the 72-base-pair repeat sequence in the SV40 promoter caused no significant decrease in CAT synthesis in monkey kidney CV-1 cells; however, an additional deletion of 50 base pairs from the second copy of the repeats reduced CAT synthesis to 11% of its level in the wild type. They also constructed a recombinant, pSVO-cat, in which the entire SV40 promoter region was removed and a unique HindIII site was substituted for the insertion of other promoter sequences.

  15. Impact of methoxyacetic acid on mouse Leydig cell gene expression

    Directory of Open Access Journals (Sweden)

    Waxman David J

    2010-06-01

    Full Text Available Abstract Background Methoxyacetic acid (MAA is the active metabolite of the widely used industrial chemical ethylene glycol monomethyl ether, which is associated with various developmental and reproductive toxicities, including neural toxicity, blood and immune disorders, limb degeneration and testicular toxicity. Testicular toxicity is caused by degeneration of germ cells in association with changes in gene expression in both germ cells and Sertoli cells of the testis. This study investigates the impact of MAA on gene expression in testicular Leydig cells, which play a critical role in germ cell survival and male reproductive function. Methods Cultured mouse TM3 Leydig cells were treated with MAA for 3, 8, and 24 h and changes in gene expression were monitored by genome-wide transcriptional profiling. Results A total of 3,912 MAA-responsive genes were identified. Ingenuity Pathway analysis identified reproductive system disease, inflammatory disease and connective tissue disorder as the top biological functions affected by MAA. The MAA-responsive genes were classified into 1,366 early responders, 1,387 mid-responders, and 1,138 late responders, based on the time required for MAA to elicit a response. Analysis of enriched functional clusters for each subgroup identified 106 MAA early response genes involved in transcription regulation, including 32 genes associated with developmental processes. 60 DNA-binding proteins responded to MAA rapidly but transiently, and may contribute to the downstream effects of MAA seen for many mid and late response genes. Genes within the phosphatidylinositol/phospholipase C/calcium signaling pathway, whose activity is required for potentiation of nuclear receptor signaling by MAA, were also enriched in the set of early MAA response genes. In contrast, many of the genes responding to MAA at later time points encode membrane proteins that contribute to cell adhesion and membrane signaling. Conclusions These findings

  16. Classification of dendritic cell phenotypes from gene expression data

    Directory of Open Access Journals (Sweden)

    Zolezzi Francesca

    2011-08-01

    Full Text Available Abstract Background The selection of relevant genes for sample classification is a common task in many gene expression studies. Although a number of tools have been developed to identify optimal gene expression signatures, they often generate gene lists that are too long to be exploited clinically. Consequently, researchers in the field try to identify the smallest set of genes that provide good sample classification. We investigated the genome-wide expression of the inflammatory phenotype in dendritic cells. Dendritic cells are a complex group of cells that play a critical role in vertebrate immunity. Therefore, the prediction of the inflammatory phenotype in these cells may help with the selection of immune-modulating compounds. Results A data mining protocol was applied to microarray data for murine cell lines treated with various inflammatory stimuli. The learning and validation data sets consisted of 155 and 49 samples, respectively. The data mining protocol reduced the number of probe sets from 5,802 to 10, then from 10 to 6 and finally from 6 to 3. The performances of a set of supervised classification models were compared. The best accuracy, when using the six following genes --Il12b, Cd40, Socs3, Irgm1, Plin2 and Lgals3bp-- was obtained by Tree Augmented Naïve Bayes and Nearest Neighbour (91.8%. Using the smallest set of three genes --Il12b, Cd40 and Socs3-- the performance remained satisfactory and the best accuracy was with Support Vector Machine (95.9%. These data mining models, using data for the genes Il12b, Cd40 and Socs3, were validated with a human data set consisting of 27 samples. Support Vector Machines (71.4% and Nearest Neighbour (92.6% gave the worst performances, but the remaining models correctly classified all the 27 samples. Conclusions The genes selected by the data mining protocol proposed were shown to be informative for discriminating between inflammatory and steady-state phenotypes in dendritic cells. The

  17. Gene expression profiles identify inflammatory signatures in dendritic cells.

    Directory of Open Access Journals (Sweden)

    Anna Torri

    Full Text Available Dendritic cells (DCs constitute a heterogeneous group of antigen-presenting leukocytes important in activation of both innate and adaptive immunity. We studied the gene expression patterns of DCs incubated with reagents inducing their activation or inhibition. Total RNA was isolated from DCs and gene expression profiling was performed with oligonucleotide microarrays. Using a supervised learning algorithm based on Random Forest, we generated a molecular signature of inflammation from a training set of 77 samples. We then validated this molecular signature in a testing set of 38 samples. Supervised analysis identified a set of 44 genes that distinguished very accurately between inflammatory and non inflammatory samples. The diagnostic performance of the signature genes was assessed against an independent set of samples, by qRT-PCR. Our findings suggest that the gene expression signature of DCs can provide a molecular classification for use in the selection of anti-inflammatory or adjuvant molecules with specific effects on DC activity.

  18. Expression of hyaluronidase by tumor cells induces angiogenesis in vivo.

    OpenAIRE

    D. Liu; Pearlman, E.; Diaconu, E.; Guo, K.; Mori, H.; Haqqi, T; Markowitz, S; Willson, J; Sy, M S

    1996-01-01

    Hyaluronic acid is a proteoglycan present in the extracellular matrix and is important for the maintenance of tissue architecture. Depolymerization of hyaluronic acid may facilitate tumor invasion. In addition, oligosaccharides of hyaluronic acid have been reported to induce angiogenesis. We report here that a hyaluronidase similar to the one on human sperm is expressed by metastatic human melanoma, colon carcinoma, and glioblastoma cell lines and by tumor biopsies from patients with colorect...

  19. Developmental expression of BK channels in chick cochlear hair cells

    Directory of Open Access Journals (Sweden)

    Tong Mingjie

    2009-12-01

    Full Text Available Abstract Background Cochlear hair cells are high-frequency sensory receptors. At the onset of hearing, hair cells acquire fast, calcium-activated potassium (BK currents, turning immature spiking cells into functional receptors. In non-mammalian vertebrates, the number and kinetics of BK channels are varied systematically along the frequency-axis of the cochlea giving rise to an intrinsic electrical tuning mechanism. The processes that control the appearance and heterogeneity of hair cell BK currents remain unclear. Results Quantitative PCR results showed a non-monotonic increase in BK α subunit expression throughout embryonic development of the chick auditory organ (i.e. basilar papilla. Expression peaked near embryonic day (E 19 with six times the transcript level of E11 sensory epithelia. The steady increase in gene expression from E11 to E19 could not explain the sudden acquisition of currents at E18-19, implicating post-transcriptional mechanisms. Protein expression also preceded function but progressed in a sequence from diffuse cytoplasmic staining at early ages to punctate membrane-bound clusters at E18. Electrophysiology data confirmed a continued refinement of BK trafficking from E18 to E20, indicating a translocation of BK clusters from supranuclear to subnuclear domains over this critical developmental age. Conclusions Gene products encoding BK α subunits are detected up to 8 days before the acquisition of anti-BK clusters and functional BK currents. Therefore, post-transcriptional mechanisms seem to play a key role in the delayed emergence of calcium-sensitive currents. We suggest that regulation of translation and trafficking of functional α subunits, near voltage-gated calcium channels, leads to functional BK currents at the onset of hearing.

  20. Construction of Eukaryotic Expression Plasmid of Human PRX3 and Its Expression in HEK-293FT Cells

    Institute of Scientific and Technical Information of China (English)

    冯艳; 刘钊; 曹慧青; 孟宪敏; 瞿智玲; 熊密; 邓仲端

    2004-01-01

    To construct the eukaryotic expression plasmid of human PRX3 and measure its expression in the HEK-293FT cells, the full-length coding region of human PRX3 was cloned by PCR and inserted into the eukaryotic expression vector pcDNA4-Xpress (A). HEK-293FT cells were transiently transfected with the recombinant plasmid. Western blot and immuofluorescence were used to detect the expression of the fusion protein. In the experiment, restriction analysis identified the construction of the recombinant plasmid and the inserted sequence was identical with that published on GenBank. Western blot and immunofluorescence confirmed the expression of the recombinant protein in transfected HEK-293FT cells. It was concluded that the eukaryotic expression plasmid of human PRX3 was constructed successfully and the recombinant could be expressed efficiently in HEK-293FT cells, which provides a sound basis for the further study on human PRX3.

  1. Interfacial polymerization for colorimetric labeling of protein expression in cells.

    Directory of Open Access Journals (Sweden)

    Jacob L Lilly

    Full Text Available Determining the location of rare proteins in cells typically requires the use of on-sample amplification. Antibody based recognition and enzymatic amplification is used to produce large amounts of visible label at the site of protein expression, but these techniques suffer from the presence of nonspecific reactivity in the biological sample and from poor spatial control over the label. Polymerization based amplification is a recently developed alternative means of creating an on-sample amplification for fluorescence applications, while not suffering from endogenous labels or loss of signal localization. This manuscript builds upon polymerization based amplification by developing a stable, archivable, and colorimetric mode of amplification termed Polymer Dye Labeling. The basic concept involves an interfacial polymer grown at the site of protein expression and subsequent staining of this polymer with an appropriate dye. The dyes Evans Blue and eosin were initially investigated for colorimetric response in a microarray setting, where both specifically stained polymer films on glass. The process was translated to the staining of protein expression in human dermal fibroblast cells, and Polymer Dye Labeling was specific to regions consistent with desired protein expression. The labeling is stable for over 200 days in ambient conditions and is also compatible with modern mounting medium.

  2. Interfacial polymerization for colorimetric labeling of protein expression in cells.

    Science.gov (United States)

    Lilly, Jacob L; Sheldon, Phillip R; Hoversten, Liv J; Romero, Gabriela; Balasubramaniam, Vivek; Berron, Brad J

    2014-01-01

    Determining the location of rare proteins in cells typically requires the use of on-sample amplification. Antibody based recognition and enzymatic amplification is used to produce large amounts of visible label at the site of protein expression, but these techniques suffer from the presence of nonspecific reactivity in the biological sample and from poor spatial control over the label. Polymerization based amplification is a recently developed alternative means of creating an on-sample amplification for fluorescence applications, while not suffering from endogenous labels or loss of signal localization. This manuscript builds upon polymerization based amplification by developing a stable, archivable, and colorimetric mode of amplification termed Polymer Dye Labeling. The basic concept involves an interfacial polymer grown at the site of protein expression and subsequent staining of this polymer with an appropriate dye. The dyes Evans Blue and eosin were initially investigated for colorimetric response in a microarray setting, where both specifically stained polymer films on glass. The process was translated to the staining of protein expression in human dermal fibroblast cells, and Polymer Dye Labeling was specific to regions consistent with desired protein expression. The labeling is stable for over 200 days in ambient conditions and is also compatible with modern mounting medium.

  3. Expression

    Directory of Open Access Journals (Sweden)

    Wang-Xia Wang

    2014-02-01

    Full Text Available The miR-15/107 family comprises a group of 10 paralogous microRNAs (miRNAs, sharing a 5′ AGCAGC sequence. These miRNAs have overlapping targets. In order to characterize the expression of miR-15/107 family miRNAs, we employed customized TaqMan Low-Density micro-fluid PCR-array to investigate the expression of miR-15/107 family members, and other selected miRNAs, in 11 human tissues obtained at autopsy including the cerebral cortex, frontal cortex, primary visual cortex, thalamus, heart, lung, liver, kidney, spleen, stomach and skeletal muscle. miR-103, miR-195 and miR-497 were expressed at similar levels across various tissues, whereas miR-107 is enriched in brain samples. We also examined the expression patterns of evolutionarily conserved miR-15/107 miRNAs in three distinct primary rat brain cell preparations (enriched for cortical neurons, astrocytes and microglia, respectively. In primary cultures of rat brain cells, several members of the miR-15/107 family are enriched in neurons compared to other cell types in the central nervous system (CNS. In addition to mature miRNAs, we also examined the expression of precursors (pri-miRNAs. Our data suggested a generally poor correlation between the expression of mature miRNAs and their precursors. In summary, we provide a detailed study of the tissue and cell type-specific expression profile of this highly expressed and phylogenetically conserved family of miRNA genes.

  4. Prostate stromal cells express the progesterone receptor to control cancer cell mobility.

    Directory of Open Access Journals (Sweden)

    Yue Yu

    Full Text Available BACKGROUND: Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood. METHODS: Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels. RESULTS: Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1 and interlukin-6 (IL-6 by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion. CONCLUSIONS: Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.

  5. Alterations in integrin expression modulates invasion of pancreatic cancer cells.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2009-01-01

    BACKGROUND: Factors mediating the invasion of pancreatic cancer cells through the extracellular matrix (ECM) are not fully understood. METHODS: In this study, sub-populations of the human pancreatic cancer cell line, MiaPaCa-2 were established which displayed differences in invasion, adhesion, anoikis, anchorage-independent growth and integrin expression. RESULTS: Clone #3 displayed higher invasion with less adhesion, while Clone #8 was less invasive with increased adhesion to ECM proteins compared to MiaPaCa-2. Clone #8 was more sensitive to anoikis than Clone #3 and MiaPaCa-2, and displayed low colony-forming efficiency in an anchorage-independent growth assay. Integrins beta 1, alpha 5 and alpha 6 were over-expressed in Clone #8. Using small interfering RNA (siRNA), integrin beta1 knockdown in Clone #8 cells increased invasion through matrigel and fibronectin, increased motility, decreased adhesion and anoikis. Integrin alpha 5 and alpha 6 knockdown also resulted in increased motility, invasion through matrigel and decreased adhesion. CONCLUSION: Our results suggest that altered expression of integrins interacting with different extracellular matrixes may play a significant role in suppressing the aggressive invasive phenotype. Analysis of these clonal populations of MiaPaCa-2 provides a model for investigations into the invasive properties of pancreatic carcinoma.

  6. Effect of Cell Adhesion Molecule 1 Expression on Intracellular Granule Movement in Pancreatic α Cells.

    Science.gov (United States)

    Yokawa, Satoru; Furuno, Tadahide; Suzuki, Takahiro; Inoh, Yoshikazu; Suzuki, Ryo; Hirashima, Naohide

    2016-09-01

    Although glucagon secreted from pancreatic α cells plays a role in increasing glucose concentrations in serum, the mechanism regulating glucagon secretion from α cells remains unclear. Cell adhesion molecule 1 (CADM1), identified as an adhesion molecule in α cells, has been reported not only to communicate among α cells and between nerve fibers, but also to prevent excessive glucagon secretion from α cells. Here, we investigated the effect of CADM1 expression on the movement of intracellular secretory granules in α cells because the granule transport is an important step in secretion. Spinning disk microscopic analysis showed that granules moved at a mean velocity of 0.236 ± 0.010 μm/s in the mouse α cell line αTC6 that expressed CADM1 endogenously. The mean velocity was significantly decreased in CADM1-knockdown (KD) cells (mean velocity: 0.190 ± 0.016 μm/s). The velocity of granule movement decreased greatly in αTC6 cells treated with the microtubule-depolymerizing reagent nocodazole, but not in αTC6 cells treated with the actin-depolymerizing reagent cytochalasin D. No difference in the mean velocity was observed between αTC6 and CADM1-KD cells treated with nocodazole. These results suggest that intracellular granules in pancreatic α cells move along the microtubule network, and that CADM1 influences their velocity. PMID:27262873

  7. Short-chain ceramides depress integrin cell surface expression and function in colorectal cancer cells.

    Science.gov (United States)

    Morad, Samy A F; Bridges, Lance C; Almeida Larrea, Alex D; Mayen, Anthony L; MacDougall, Matthew R; Davis, Traci S; Kester, Mark; Cabot, Myles C

    2016-07-01

    Colorectal cancer (CRC) is highly metastatic, significantly so to liver, a characteristic that embodies one of the most challenging aspects of treatment. The integrin family of cell-cell and cell-matrix adhesion receptors plays a central role in migration and invasion, functions that underlie metastatic potential. In the present work we sought to determine the impact of ceramide, which plays a key modulatory role in cancer suppression, on integrin cell surface expression and function in CRC cells in order to reveal possible ceramide-centric effects on tumor cell motility. Human CRC cells LoVo, HT-29, and HCT-116 were employed, which represent lines established from primary and metastatic sites. A cell-permeable, short-chain analog, C6-ceramide, was used as ceramide mimic. Exposure of cells to C6-ceramide (24 h) promoted a dose-dependent (2.5-10 µM) decrease in the expression of cell surface β1 and β4 integrin subunits in all cell lines; at 10 µM C6-ceramide, the decreases ranged from 30 to 50% of the control. Expression of cell surface αVβ6 integrin, which is associated with advanced invasion in CRC, was also suppressed by C6-ceramide. Decreases in integrin expression translated to diminished cellular adhesion, 50% of the control at 5 µM C6-ceramide, and markedly reduced cellular migration, approximately 30-40% of the control in all cell lines. Physicochemical examination revealed potent efficacy of nano-formulated C6-ceramide, but inferior activity of dihydro-C6-ceramide and L-C6-ceramide, compared to the unsaturated counterpart and the natural d-enantiomer, respectively. These studies demonstrate novel actions of ceramides that may have application in suppression of tumor metastasis, in addition to their known tumor suppressor effects. PMID:27045476

  8. Expression of cell cycle regulating factor mRNA in small cell lung cancer xenografts

    DEFF Research Database (Denmark)

    Krarup, M; Poulsen, H S; Spang-Thomsen, M

    1998-01-01

    and CDK6 when in vitro and in vivo data were compared. Two of the cell lines that express the retinoblastoma (Rb) protein had no sign of a deregulated Rb pathway but further studies at the protein level are necessary to demonstrate whether these two cell lines should have a normal Rb pathway or whether...

  9. Main: AS1LIKECSHPRA [PLACE

    Lifescience Database Archive (English)

    Full Text Available AS1LIKECSHPRA S000260 14-Oct-1999 (last modified) kehi as-1-like motif found in cuc...umber (C.s.) hydroxypyruvate reductase (hprA) gene; Required for cytokinin responsiveness; Also see S000261 (CYTOSITECSHPRA

  10. Simvastatin modulates mesenchymal stromal cell proliferation and gene expression.

    Directory of Open Access Journals (Sweden)

    Dalila Lucíola Zanette

    Full Text Available Statins are widely used hypocholesterolemic drugs that block the mevalonate pathway, responsible for the biosysnthesis of cholesterol. However, statins also have pleiotropic effects that interfere with several signaling pathways. Mesenchymal stromal cells (MSC are a heterogeneous mixture of cells that can be isolated from a variety of tissues and are identified by the expression of a panel of surface markers and by their ability to differentiate in vitro into osteocytes, adipocytes and chondrocytes. MSC were isolated from amniotic membranes and bone marrows and characterized based on ISCT (International Society for Cell Therapy minimal criteria. Simvastatin-treated cells and controls were directly assayed by CFSE (Carboxyfluorescein diacetate succinimidyl ester staining to assess their cell proliferation and their RNA was used for microarray analyses and quantitative PCR (qPCR. These MSC were also evaluated for their ability to inhibit PBMC (peripheral blood mononuclear cells proliferation. We show here that simvastatin negatively modulates MSC proliferation in a dose-dependent way and regulates the expression of proliferation-related genes. Importantly, we observed that simvastatin increased the percentage of a subset of smaller MSC, which also were actively proliferating. The association of MSC decreased size with increased pluripotency and the accumulating evidence that statins may prevent cellular senescence led us to hypothesize that simvastatin induces a smaller subpopulation that may have increased ability to maintain the entire pool of MSC and also to protect them from cellular senescence induced by long-term cultures/passages in vitro. These results may be important to better understand the pleiotropic effects of statins and its effects on the biology of cells with regenerative potential.

  11. Expression of subtypes of somatostatin receptors in hepatic stellate cells

    Institute of Scientific and Technical Information of China (English)

    Sheng-Han Song; Xi-Sheng Leng; Tao Li; Zhi-Zhong Qin; Ji-Run Peng; Li Zhao; Yu-Hua Wei; Xin Yu

    2004-01-01

    AIM: To elucidate the mechanism by which somatostatin and its analogue exert the influence on liver fibrosis, and to investigate the mRNA expression of somatostatin receptors subtypes (SSTRs) and the distribution of somatostatin analogue octreotide in rat hepatic stellate cells (HSCs).METHODS: HSCs were isolated from Sprague Dawley (SD)rats byin situ perfusion and density gradient centrifugation.After several passages, the mRNA expression of 5 subtypes of SSTRs were assessed by reverse transcription-polymerase chain reaction (RT-PCR). HSCs were planted on coverslip and co-cultured with octreotide tagged by FITC. Then the distribution of FITC fluorescence was observed under laser scanning confocal microscope (LSCM) in 12-24 h.RESULTS: There were mRNA expression of SSTR2, SSTR3and SSTR5 but not SSTR1 and SSTR4 in SD rat HSCs. The mRNA expression level of SSTR2 was significantly higher than that of other subtypes (P<0.01). FITC fluorescence of octreotide was clearly observed on the surface and in the cytoplasm, but not in the nuclei of HSCs under LSCM.CONCLUSION: The effect exerted by somatostatin and its analogues on HSCs may mainly depend on the expression of SSTR2, SSTR3 and SSTR5. Octreotide can perfectly combine with HSCs, and thereby exerts its biological activity on regulating the characters of active HSCs. This provides a potential prevention and management against liver fibrosis.

  12. Expression of T cell factor-4 in non-small-cell lung cancer

    Institute of Scientific and Technical Information of China (English)

    LI Chun-yan; WANG Yan; CUI Ze-shi; WANG En-hua

    2005-01-01

    Background T cell factor- 4 (TCF- 4) plays an important role in development and carcinogenesis. Recently, the role of TCF- 4 has been described in colon cancer and other cancers. However, whether TCF- 4 plays a similar role in lung cancer is unknown. To answer this question, we studied the expression of TCF- 4 protein and mRNA in non-small-cell lung cancer (NSCLC) and the relation of TCF- 4 expression pattern to histological type and cell differentiation. Methods Tissue samples from sixty cases of pathologically diagnosed NSCLC and eight normal tissue samples were obtained between September 2001 and March 2003. Immunohistochemistry was used to investigate the distribution of TCF- 4 protein. The staining patterns of the tumors were divided into 4 categories: nuclear staining alone or nuclear staining greater than cytoplasmic staining; cytoplasmic staining or cytoplasmic staining greater than nuclear staining; equal nuclear and cytoplasmic staining; no nuclear staining or cytoplasmic staining. The integrated optical density (OD) values of all sections were analyzed by UIC MetaMorph image analysis software. The expression of TCF- 4 mRNA was detected by one-step reverse transcription-polymerase chain reaction (RT-PCR). The integrated density values of the PCR products were analyzed semi-quantitatively.Results Immunohistochemistry showed that there was no expression of TCF- 4 in normal tissue. However, TCF- 4 was expressed in 86.7% (52/60) of NSCLC samples, mainly in the nuclei of tumor cells. Furthermore, there was a significant difference in TCF- 4 localization patterns between squamous cell carcinomas and adenocarcinomas (P<0.05). The integrated OD values of TCF- 4 expression was significantly higher in tumors with moderate-poor cell differentiation than in well differentiated tumors (51.63±6.67 vs 46.13±12.31, P<0.01). There was no TCF- 4 mRNA expression in normal tissue. However, 63.9% (23/36) of carcinoma samples expressed TCF- 4 mRNA. TCF- 4 mRNA expression was

  13. Expression of stem cell markers in the human fetal kidney.

    Directory of Open Access Journals (Sweden)

    Sally Metsuyanim

    Full Text Available In the human fetal kidney (HFK self-renewing stem cells residing in the metanephric mesenchyme (MM/blastema are induced to form all cell types of the nephron till 34(th week of gestation. Definition of useful markers is crucial for the identification of HFK stem cells. Because wilms' tumor, a pediatric renal cancer, initiates from retention of renal stem cells, we hypothesized that surface antigens previously up-regulated in microarrays of both HFK and blastema-enriched stem-like wilms' tumor xenografts (NCAM, ACVRIIB, DLK1/PREF, GPR39, FZD7, FZD2, NTRK2 are likely to be relevant markers. Comprehensive profiling of these putative and of additional stem cell markers (CD34, CD133, c-Kit, CD90, CD105, CD24 in mid-gestation HFK was performed using immunostaining and FACS in conjunction with EpCAM, an epithelial surface marker that is absent from the MM and increases along nephron differentiation and hence can be separated into negative, dim or bright fractions. No marker was specifically localized to the MM. Nevertheless, FZD7 and NTRK2 were preferentially localized to the MM and emerging tubules (50% of HFK cells and predominantly co-express EpCAM(bright, indicating they are mostly markers of differentiation. Furthermore, localization of NCAM exclusively in the MM and in its nephron progenitor derivatives but also in stroma and the expression pattern of significantly elevated renal stem/progenitor genes Six2, Wt1, Cited1, and Sall1 in NCAM(+EpCAM(- and to a lesser extent in NCAM(+EpCAM(+ fractions confirmed regional identity of cells and assisted us in pinpointing the presence of subpopulations that are putative MM-derived progenitor cells (NCAM(+EpCAM(+FZD7(+, MM stem cells (NCAM(+EpCAM(-FZD7(+ or both (NCAM(+FZD7(+. These results and concepts provide a framework for developing cell selection strategies for human renal cell-based therapies.

  14. A Progenitor Cell Expressing Transcription Factor RORγt Generates All Human Innate Lymphoid Cell Subsets.

    Science.gov (United States)

    Scoville, Steven D; Mundy-Bosse, Bethany L; Zhang, Michael H; Chen, Li; Zhang, Xiaoli; Keller, Karen A; Hughes, Tiffany; Chen, Luxi; Cheng, Stephanie; Bergin, Stephen M; Mao, Hsiaoyin C; McClory, Susan; Yu, Jianhua; Carson, William E; Caligiuri, Michael A; Freud, Aharon G

    2016-05-17

    The current model of murine innate lymphoid cell (ILC) development holds that mouse ILCs are derived downstream of the common lymphoid progenitor through lineage-restricted progenitors. However, corresponding lineage-restricted progenitors in humans have yet to be discovered. Here we identified a progenitor population in human secondary lymphoid tissues (SLTs) that expressed the transcription factor RORγt and was unique in its ability to generate all known ILC subsets, including natural killer (NK) cells, but not other leukocyte populations. In contrast to murine fate-mapping data, which indicate that only ILC3s express Rorγt, these human progenitor cells as well as human peripheral blood NK cells and all mature ILC populations expressed RORγt. Thus, all human ILCs can be generated through an RORγt(+) developmental pathway from a common progenitor in SLTs. These findings help establish the developmental signals and pathways involved in human ILC development.

  15. Gene Expression Music Algorithm-Based Characterization of the Ewing Sarcoma Stem Cell Signature

    OpenAIRE

    Staege, Martin Sebastian

    2016-01-01

    Gene Expression Music Algorithm (GEMusicA) is a method for the transformation of DNA microarray data into melodies that can be used for the characterization of differentially expressed genes. Using this method we compared gene expression profiles from endothelial cells (EC), hematopoietic stem cells, neuronal stem cells, embryonic stem cells (ESC), and mesenchymal stem cells (MSC) and defined a set of genes that can discriminate between the different stem cell types. We analyzed the behavior ...

  16. Retinoic acid promotes the development of Arg1-expressing dendritic cells for the regulation of T-cell differentiation

    OpenAIRE

    Chang, Jinsam; Thangamani, Shankar; Kim, Myung H.; Ulrich, Benjamin; Morris, Sidney M.; Chang H Kim

    2013-01-01

    Arginase I (Arg1), an enzyme expressed by many cell types including myeloid cells, can regulate immune responses. Expression of Arg1 in myeloid cells is regulated by a number of cytokines and tissue factors that influence cell development and activation. Retinoic acid, produced from vitamin A, regulates the homing and differentiation of lymphocytes and plays important roles in the regulation of immunity and immune tolerance. We report here that optimal expression of Arg1 in dendritic cells re...

  17. Regulation of. beta. -cell glucose transporter gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ling; Alam, Tausif; Johnson, J.H.; Unger, R.H. (Univ. of Texas Southwestern Medical Center, Dallas (USA) Department of Veterans Affairs Medical Center, Dallas, TX (USA)); Hughes, S.; Newgard, C.B. (Univ. of Texas Southwestern Medical Center, Dallas (USA))

    1990-06-01

    It has been postulated that a glucose transporter of {beta} cells (GLUT-2) may be important in glucose-stimulated insulin secretion. To determine whether this transporter is constitutively expressed or regulated, the authors subjected conscious unrestrained Wistar rats to perturbations in glucose homeostasis and quantitated {beta}-cell GLUT-2 mRNA by in situ hybridization. After 3 hr of hypoglycemia, GLUT-2 and proinsulin mRNA signal densities were reduced by 25% of the level in control rats. After 4 days, GLUT-2 and proinsulin mRNA densities were reduced by 85% and 65%, respectively. After 12 days of hypoglycemia, the K{sub m} for 3-O-methyl-D-glucose transport in isolated rat islets, normally 18-20 mM, was 2.5 mM. This provides functional evidence of a profound reduction of high K{sub m} glucose transporter in {beta} cells. In contrast, GLUT-2 was only slightly reduced by hypoglycemia in liver. To determine the effect of prolonged hyperglycemia, they also infused animals with 50% (wt/vol) glucose for 5 days. Hyperglycemic clamping increased GLUT-2 mRNA by 46% whereas proinsulin mRNA doubled. They conclude that GLUT-2 expression in {beta} cells, but not liver, is subject to regulation by certain perturbations in blood glucose homeostasis.

  18. Regulation of β-cell glucose transporter gene expression

    International Nuclear Information System (INIS)

    It has been postulated that a glucose transporter of β cells (GLUT-2) may be important in glucose-stimulated insulin secretion. To determine whether this transporter is constitutively expressed or regulated, the authors subjected conscious unrestrained Wistar rats to perturbations in glucose homeostasis and quantitated β-cell GLUT-2 mRNA by in situ hybridization. After 3 hr of hypoglycemia, GLUT-2 and proinsulin mRNA signal densities were reduced by 25% of the level in control rats. After 4 days, GLUT-2 and proinsulin mRNA densities were reduced by 85% and 65%, respectively. After 12 days of hypoglycemia, the Km for 3-O-methyl-D-glucose transport in isolated rat islets, normally 18-20 mM, was 2.5 mM. This provides functional evidence of a profound reduction of high Km glucose transporter in β cells. In contrast, GLUT-2 was only slightly reduced by hypoglycemia in liver. To determine the effect of prolonged hyperglycemia, they also infused animals with 50% (wt/vol) glucose for 5 days. Hyperglycemic clamping increased GLUT-2 mRNA by 46% whereas proinsulin mRNA doubled. They conclude that GLUT-2 expression in β cells, but not liver, is subject to regulation by certain perturbations in blood glucose homeostasis

  19. Co-Expression of Cancer Stem Cell Markers Corresponds to a Pro-Tumorigenic Expression Profile in Pancreatic Adenocarcinoma

    Science.gov (United States)

    Skoda, Jan; Hermanova, Marketa; Loja, Tomas; Nemec, Pavel; Neradil, Jakub; Karasek, Petr; Veselska, Renata

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDAC) remains one of the most lethal malignancies. Its dismal prognosis is often attributed to the presence of cancer stem cells (CSCs) that have been identified in PDAC using various markers. However, the co-expression of all of these markers has not yet been evaluated. Furthermore, studies that compare the expression levels of CSC markers in PDAC tumor samples and in cell lines derived directly from those tumors are lacking. Here, we analyzed the expression of putative CSC markers—CD24, CD44, epithelial cell adhesion molecule (EpCAM), CD133, and nestin—by immunofluorescence, flow cytometry and quantitative PCR in 3 PDAC-derived cell lines and by immunohistochemistry in 3 corresponding tumor samples. We showed high expression of the examined CSC markers among all of the cell lines and tumor samples, with the exception of CD24 and CD44, which were enriched under in vitro conditions compared with tumor tissues. The proportions of cells positive for the remaining markers were comparable to those detected in the corresponding tumors. Co-expression analysis using flow cytometry revealed that CD24+/CD44+/EpCAM+/CD133+ cells represented a significant population of the cells (range, 43 to 72%) among the cell lines. The highest proportion of CD24+/CD44+/EpCAM+/CD133+ cells was detected in the cell line derived from the tumor of a patient with the shortest survival. Using gene expression profiling, we further identified the specific pro-tumorigenic expression profile of this cell line compared with the profiles of the other two cell lines. Together, CD24+/CD44+/EpCAM+/CD133+ cells are present in PDAC cell lines derived from primary tumors, and their increased proportion corresponds with a pro-tumorigenic gene expression profile. PMID:27414409

  20. Co-Expression of Cancer Stem Cell Markers Corresponds to a Pro-Tumorigenic Expression Profile in Pancreatic Adenocarcinoma.

    Science.gov (United States)

    Skoda, Jan; Hermanova, Marketa; Loja, Tomas; Nemec, Pavel; Neradil, Jakub; Karasek, Petr; Veselska, Renata

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDAC) remains one of the most lethal malignancies. Its dismal prognosis is often attributed to the presence of cancer stem cells (CSCs) that have been identified in PDAC using various markers. However, the co-expression of all of these markers has not yet been evaluated. Furthermore, studies that compare the expression levels of CSC markers in PDAC tumor samples and in cell lines derived directly from those tumors are lacking. Here, we analyzed the expression of putative CSC markers-CD24, CD44, epithelial cell adhesion molecule (EpCAM), CD133, and nestin-by immunofluorescence, flow cytometry and quantitative PCR in 3 PDAC-derived cell lines and by immunohistochemistry in 3 corresponding tumor samples. We showed high expression of the examined CSC markers among all of the cell lines and tumor samples, with the exception of CD24 and CD44, which were enriched under in vitro conditions compared with tumor tissues. The proportions of cells positive for the remaining markers were comparable to those detected in the corresponding tumors. Co-expression analysis using flow cytometry revealed that CD24+/CD44+/EpCAM+/CD133+ cells represented a significant population of the cells (range, 43 to 72%) among the cell lines. The highest proportion of CD24+/CD44+/EpCAM+/CD133+ cells was detected in the cell line derived from the tumor of a patient with the shortest survival. Using gene expression profiling, we further identified the specific pro-tumorigenic expression profile of this cell line compared with the profiles of the other two cell lines. Together, CD24+/CD44+/EpCAM+/CD133+ cells are present in PDAC cell lines derived from primary tumors, and their increased proportion corresponds with a pro-tumorigenic gene expression profile. PMID:27414409

  1. Restoration of p53 Expression in Human Cancer Cell Lines Upregulates the Expression of Notch1: Implications for Cancer Cell Fate Determination after Genotoxic Stress

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-05-01

    Full Text Available Following genotoxic stress, transcriptional activation of target genes by p53 tumor suppressor is critical in cell fate determination. Here we report that the restoration of p53 function in human cancer cell lines that are deficient in p53 function upregulated the expression of Notch1. Interestingly, the expression of wild-type p53 in human prostate and breast cancer cell lines correlated well with increased expression of Notch1. Furthermore, knockdown of p53 expression in cancer cells that express wild-type p53 resulted in reduced expression of Notch1. Importantly, genotoxic stress to cancer cells that resulted in activation of p53 also upregulated the expression of Notch1. Moreover, p53mediated induction of Notch1 expression was associated with stimulation of the activity of Notch-responsive reporters. Notably, p53 differentially regulated the expression of Notch family members: expression of Notch2 and Notch4 was not induced by p53. Significantly, treatment of cells with gamma secretase inhibitor, an inhibitor of Notch signaling, increased susceptibility to apoptosis in response to genotoxic stress. Together, our observations suggest that p53mediated upregulation of Notch1 expression in human cancer cell lines contributes to cell fate determination after genotoxic stress.

  2. Impaired cell surface expression of HLA-B antigens on mesenchymal stem cells and muscle cell progenitors.

    Directory of Open Access Journals (Sweden)

    Adiba Isa

    Full Text Available HLA class-I expression is weak in embryonic stem cells but increases rapidly during lineage progression. It is unknown whether all three classical HLA class-I antigens follow the same developmental program. In the present study, we investigated allele-specific expression of HLA-A, -B, and -C at the mRNA and protein levels on human mesenchymal stem cells from bone marrow and adipose tissue as well as striated muscle satellite cells and lymphocytes. Using multicolour flow cytometry, we found high cell surface expression of HLA-A on all stem cells and PBMC examined. Surprisingly, HLA-B was either undetectable or very weakly expressed on all stem cells protecting them from complement-dependent cytotoxicity (CDC using relevant human anti-B and anti-Cw sera. IFNgamma stimulation for 48-72 h was required to induce full HLA-B protein expression. Quantitative real-time RT-PCR showed that IFNgamma induced a 9-42 fold increase of all six HLA-A,-B,-C gene transcripts. Interestingly, prior to stimulation, gene transcripts for all but two alleles were present in similar amounts suggesting that post-transcriptional mechanisms regulate the constitutive expression of HLA-A,-B, and -C. Locus-restricted expression of HLA-A, -B and -C challenges our current understanding of the function of these molecules as regulators of CD8(+ T-cell and NK-cell function and should lead to further inquiries into their expression on other cell types.

  3. Tetrahydrouridine inhibits cell proliferation through cell cycle regulation regardless of cytidine deaminase expression levels.

    Directory of Open Access Journals (Sweden)

    Naotake Funamizu

    Full Text Available Tetrahydrouridine (THU is a well characterized and potent inhibitor of cytidine deaminase (CDA. Highly expressed CDA catalyzes and inactivates cytidine analogues, ultimately contributing to increased gemcitabine resistance. Therefore, a combination therapy of THU and gemcitabine is considered to be a potential and promising treatment for tumors with highly expressed CDA. In this study, we found that THU has an alternative mechanism for inhibiting cell growth which is independent of CDA expression. Three different carcinoma cell lines (MIAPaCa-2, H441, and H1299 exhibited decreased cell proliferation after sole administration of THU, while being unaffected by knocking down CDA. To investigate the mechanism of THU-induced cell growth inhibition, cell cycle analysis using flow cytometry was performed. This analysis revealed that THU caused an increased rate of G1-phase occurrence while S-phase occurrence was diminished. Similarly, Ki-67 staining further supported that THU reduces cell proliferation. We also found that THU regulates cell cycle progression at the G1/S checkpoint by suppressing E2F1. As a result, a combination regimen of THU and gemcitabine might be a more effective therapy than previously believed for pancreatic carcinoma since THU works as a CDA inhibitor, as well as an inhibitor of cell growth in some types of pancreatic carcinoma cells.

  4. Performance benchmarking of four cell-free protein expression systems.

    Science.gov (United States)

    Gagoski, Dejan; Polinkovsky, Mark E; Mureev, Sergey; Kunert, Anne; Johnston, Wayne; Gambin, Yann; Alexandrov, Kirill

    2016-02-01

    Over the last half century, a range of cell-free protein expression systems based on pro- and eukaryotic organisms have been developed and have found a range of applications, from structural biology to directed protein evolution. While it is generally accepted that significant differences in performance among systems exist, there is a paucity of systematic experimental studies supporting this notion. Here, we took advantage of the species-independent translation initiation sequence to express and characterize 87 N-terminally GFP-tagged human cytosolic proteins of different sizes in E. coli, wheat germ (WGE), HeLa, and Leishmania-based (LTE) cell-free systems. Using a combination of single-molecule fluorescence spectroscopy, SDS-PAGE, and Western blot analysis, we assessed the expression yields, the fraction of full-length translation product, and aggregation propensity for each of these systems. Our results demonstrate that the E. coli system has the highest expression yields. However, we observe that high expression levels are accompanied by production of truncated species-particularly pronounced in the case of proteins larger than 70 kDa. Furthermore, proteins produced in the E. coli system display high aggregation propensity, with only 10% of tested proteins being produced in predominantly monodispersed form. The WGE system was the most productive among eukaryotic systems tested. Finally, HeLa and LTE show comparable protein yields that are considerably lower than the ones achieved in the E. coli and WGE systems. The protein products produced in the HeLa system display slightly higher integrity, whereas the LTE-produced proteins have the lowest aggregation propensity among the systems analyzed. The high quality of HeLa- and LTE-produced proteins enable their analysis without purification and make them suitable for analysis of multi-domain eukaryotic proteins.

  5. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    Directory of Open Access Journals (Sweden)

    Alberto Miranda

    Full Text Available Cellular prion protein (PRNP is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs. Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB differentiation in mouse Prnp-null (KO and WT embryonic stem cell (ESC lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5 in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel and SPRN (Shadoo, whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  6. Aquaporin-1 Expressed in Cultured Human Trabecular Meshwork Cells

    Institute of Scientific and Technical Information of China (English)

    Mingkai Lin; Jian Ge; Yehong Zhuo; Yuqing Lan; Keming Yu; Jianliang Zheng

    2002-01-01

    Objective:To determine if aquaporin-1 could be detected in cultures of human trabecularshwork cells. Methods: Using primers specific for aquaporin-1, reverse transcription combined withpolymerase chain reaction (RT-PCR) yielded a product and its size with total RNAprepared from the human trabecular meshwork cells. SDS-PAGE and immunoblottingwere also used in this study to detect the specific water channel.Results: The presence of this product and its size (298 base pairs) are consistent withthat of an aquaporin-1 message in these cells. A band of 28 kD in agreement with themolecular size of aquaporin-1 was showed in a film by immunoblotting.Conclusion: The presence of aquaporin-1 in human trabecular meshwork cells, thepredominant cell-type of the primary outflow region of the human eye, suggests that waterchannels may be involved in the movement of aqueous fluid out of the eye. In addition,the existence of aquaporin-1 on cultures of human trabecular meshwork cells provides anin vitro model to study the endogenous expression of aquaporin-1 and its possible role inthe regulation of aqueous outflow.

  7. Expression of lactoperoxidase in differentiated mouse colon epithelial cells.

    Science.gov (United States)

    Kim, Byung-Wook; Esworthy, R Steven; Hahn, Maria A; Pfeifer, Gerd P; Chu, Fong-Fong

    2012-05-01

    Lactoperoxidase (LPO) is known to be present in secreted fluids, such as milk and saliva. Functionally, LPO teams up with dual oxidases (DUOXs) to generate bactericidal hypothiocyanite in the presence of thiocyanate. DUOX2 is expressed in intestinal epithelium, but there is little information on LPO expression in this tissue. To fill the gap of knowledge, we have analyzed Lpo gene expression and its regulation in mouse intestine. In wild-type (WT) C57BL/6 (B6) mouse intestine, an appreciable level of mouse Lpo gene expression was detected in the colon, but not the ileum. However, in B6 mice deficient in glutathione peroxidase (GPx)-1 and -2, GPx1/2-double-knockout (DKO), which had intestinal pathology, the colon Lpo mRNA levels increased 5- to 12-fold depending on mouse age. The Lpo mRNA levels in WT and DKO 129S1/SvlmJ (129) colon were even higher, 9- and 5-fold, than in B6 DKO colon. Higher levels of Lpo protein and enzymatic activity were also detected in the 129 mouse colon compared to B6 colon. Lpo protein was expressed in the differentiated colon epithelial cells, away from the crypt base, as shown by immunohistochemistry. Similar to human LPO mRNA, mouse Lpo mRNA had multiple spliced forms, although only the full-length variant 1 was translated. Higher methylation was found in the 129 than in the B6 strain, in DKO than in control colon, and in older than in juvenile mice. However, methylation of the Lpo intragenic CpG island was not directly induced by inflammation, because dextran sulfate sodium-induced colitis did not increase DNA methylation in B6 DKO colon. Also, Lpo DNA methylation is not correlated with gene expression.

  8. Consolidated pretreatment and hydrolysis of plant biomass expressing cell wall degrading enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Raab, R. Michael; Zhang, Dongcheng; Bougri, Oleg

    2016-02-02

    Methods for consolidated pretreatment and hydrolysis of genetically engineered plants expressing cell wall degrading enzymes are provided. Expression cassettes and vectors for making transgenic plants are described. Plants engineered to express one or more cell wall degrading enzymes using expression cassettes and vectors of the invention are also provided.

  9. Neuritin is expressed in Schwann cells and down-regulated in apoptotic Schwann cells under hyperglycemia.

    Science.gov (United States)

    Min, Shi; Jian-bo, Li; Hong-man, Zhang; Ling-fei, Yan; Min, Xie; Jia-wei, Chen

    2012-11-01

    We aimed to explore neuritin expression in Schwann cells under different glucose conditions. Expression of neuritin at the levels of transcription and translation in purified Schwann cells was detected and measured using reverse transcriptase (RT) (quantitative) polymerase chain reaction (PCR) and western blot. Apoptosis of Schwann cells was measured by flow cytometry using Fluorescence Activated Cell Sorter (FACS) analysis and caspase fluorometric assay. Neuritin mRNA and protein were detected in cultured primary Schwann cells. Neuritin was identified as cell membrane form of protein and predominately as secreted or solube form of protein. Neuritin was significantly lower in 150 mM glucose condition, and more significantly lower in 300 mM glucose, than 5.6 mM glucose condition at 36 hours and especially at 48 hours of the culture, respectively (P Neuritin and apoptosis were correlated in a power regression (P neuritin mRNA and protein were expressed and down-regulated in Schwann cells under high-glucose concentration and the down-regulation may contribute to apopotosis of Schwann cells. PMID:22782233

  10. RASSF1A expression inhibits cell growth and enhances cell chemosensitivity to mitomycin in BEL-7402 hepatocellular carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    GUAN Hong-geng; XUE Wan-jiang; QIAN Hai-xin; ZHOU Xiao-jun; QIN Lei; LAN Jing

    2009-01-01

    Background The antitumor role of Ras association domain family 1A (RASSFIA) gene and its potential molecular mechanisms are not well understood. The objective of this study was to observe the antitumor ability of RASSFIA in hepatoceliular carcinoma, and study the mechanisms of cell apoptosis induced by RASSFIA.Methods After stably transfecting a RASSF1A (wild-type or mutant) expression vector into the BEL-7402 hepatocellular carcinoma cell line, RT-PCR and Westem blotting was used to detect the RASSF1A expression levels in recombinant cells. The effects of wild-type RASSF1A on cell growth were observed in vitro by analyzing cell proliferation rate, cell colony formation, and in vivo by analyzing tumorigenesis in nude mice. In addition, the effect of RASSF1A gene expression on the chemosensitivity of human hepatocellular carcinoma cells to antitumor drugs was examined by inhibition of cell proliferation and the percentage of apoptotic cells.Results Wild-type RASSF1A, not the mutant, suppressed cell growth in vitro and in vivo. Re-expression of wild-type RASSF1A could enhance the inhibition of cell proliferation and the percentage of apoptotic cells following cell treatment with mitomycin, but had no significant effect when combined with adriamycin, etoposide, 5-fluorouracil and cisplatJn treatment.Conclusion Wild-type RASSF1A inhibits cell growth and enhances cell chemosensitivity to mitomycin in hepatocellular carcinoma, suggesting that RASSF1A may serve as a new target for gene therapy in hepatocellular carcinoma patients.

  11. MicroRNA Expression in Alzheimer Blood Mononuclear Cells

    Directory of Open Access Journals (Sweden)

    Hyman M. Schipper

    2007-01-01

    Full Text Available Various coding genes representing multiple functional categories are downregulated in blood mononuclear cells (BMC of patients with sporadic Alzheimer disease (AD. Noncoding microRNAs (miRNA regulate gene expression by degrading messages or inhibiting translation. Using BMC as a paradigm for the study of systemic alterations in AD, we investigated whether peripheral miRNA expression is altered in this condition. MicroRNA levels were assessed using the microRNA microarray (MMChip containing 462 human miRNA, and the results validated by real time PCR. Sixteen AD patients and sixteen normal elderly controls (NEC were matched for ethnicity, age, gender and education. The expression of several BMC miRNAs was found to increase in AD relative to NEC levels, and may differ between AD subjects bearing one or two APOE4 alleles. As compared to NEC, miRNAs signifi cantly upregulated in AD subjects and confi rmed by qPCR were miR-34a and 181b. Predicted target genes downregulated in Alzheimer BMC that correlated with the upregulated miRNAs were largely represented in the functional categories of Transcription/Translation and Synaptic Activity. Several miRNAs targeting the same genes were within the functional category of Injury response/Redox homeostasis. Taken together, induction of microRNA expression in BMC may contribute to the aberrant systemic decline in mRNA levels in sporadic AD.

  12. Novel method for isolation of murine clara cell secretory protein-expressing cells with traces of stemness.

    Directory of Open Access Journals (Sweden)

    Xiao-Yang Wang

    Full Text Available Clara cells are non-ciliated, secretory bronchiolar epithelial cells that serve to detoxify harmful inhaled substances. Clara cells also function as stem/progenitor cells for repair in the bronchioles. Clara cell secretory protein (CCSP is specifically expressed in pulmonary Clara cells and is widely used as a Clara cell marker. In addition CCSP promoter is commonly used to direct gene expression into the lung in transgenic models. The discovery of CCSP immunoreactivity in plasma membranes of airway lining cells prompted us to explore the possibility of enriching Clara cells by flow cytometry. We established a novel and simple method for the isolation of CCSP-expressing cell Clara cells using a combination of mechanical and enzymatic dissociation followed by flow cytometry sorting technology. We showed that ∼25% of dissociated cells from whole lung expressed CCSP. In the resulting preparation, up to 98% of cells expressed CCSP. Notably, we found that several common stem cell markers including CD44, CD133, Sca-1 and Sox2 were expressed in CCSP(+ cells. Moreover, CCSP(+ cells were able to form spheroid colonies in vitro with 0.97‰ efficiency. Parallel studies in vivo confirmed that a small population of CCSP(-expressing cells in mouse airways also demonstrates stem cell-like properties such as label retention and harboring rare bronchioalveolar stem cells (BASCs in terminal bronchioles (TBs. We conclude that CCSP(+ cells exhibit a number of stem cell-like features including stem cell marker expression, bronchosphere colony formation and self-renewal ability. Clara cell isolation by flow cytometry sorting is a useful method for investigating the function of primary Clara cells in stem cell research and mouse models.

  13. Sustained Arc expression in adult-generated granule cells.

    Science.gov (United States)

    Meconi, Alicia; Lui, Erika; Marrone, Diano F

    2015-08-31

    The dentate gyrus (DG) plays a critical role in memory formation and maintenance. Fitting this specialized role, the DG has many unique characteristics. In addition to being one of the few places in which new neurons are continually added in adulthood, the region also shows a unique long-term sustained transcriptional response of the immediate-early gene Arc to sensory input. Although we know that adult-generated granule cells are reliably recruited into behaviorally-driven neuronal network, it remains unknown whether they display robust late-phase sustained transcription in response to activity like their developmentally-generated counterparts. Since this late-phase of transcription is required for enduring plasticity, knowing if sustained transcription appears as soon as these cells are incorporated provides information on their potential for plasticity. To address this question, adult F344 rats were injected with BrdU (50mg/kg/day for 5 days) and 4 weeks later explored a novel environment. Arc expression in both BrdU- and BrdU+ neurons was determined 0.5h, 1h, 2h, 6h, 8h, 12h, or 24h following this behavior. Recently-generated granule cells showed a robust sustained Arc expression following a discrete behavioral experience. These data provide information on a potential mechanism to sculpt the representations of events occurring within hours of each other to create uncorrelated representations of episodes despite a highly excitable population of neurons. PMID:26219984

  14. cDNA Expression Array Analysis of Gene Expression in Human Hepatocarcinoma Hep3B Cells Induced By BNIPL-1

    Institute of Scientific and Technical Information of China (English)

    Li XIE; Wen-Xin QIN; Jin-Jun LI; Xiang-Huo HE; Hui-Qun SHU; Gen-Fu YAO; Da-Fang WAN; Jian-Ren GU

    2005-01-01

    Bcl-2/adenovirus E1B 19 kDa interacting protein 2 like-1 (BNIPL-1) is a novel human protein identified in our laboratory, which can interact with Bcl-2 and Cdc42GAP and induce apoptosis via the BNIP-2 and Cdc42GAP homology (BCH) domain. In the present study, we established the Hep3B-Tet-on stable cell line in which expression of BNIPL-1 can be induced by doxycycline. The cell proliferation activity assay showed that the overexpression of BNIPL-1 suppresses Hep3B cell growth in vitro. The differential expression profiles of 588 known genes from BNIPL-1-transfected Hep3B-Tet-on and vector control cells were determined using the Atlas human cDNA expression array. Fifteen genes were differentially expressed between these two cell lines, among which seven genes were up-regulated and eight genes were down-regulated by BINPL-1. Furthermore, the differential expression result was confirmed by semiquantitative RT-PCR. Among these differentially expressed genes, p16INK4, IL-12, TRAIL and the lymphotoxin β gene involved in growth suppression or cell apoptosis were up-regulated, and PTEN involved in cell proliferation was down-regulated by BNIPL-1. These results suggest that BNIPL-1 might inhibit cell growth though cell cycle arrest and/or apoptotic cell death pathway(s).

  15. Efflux protein expression in human stem cell-derived retinal pigment epithelial cells.

    Directory of Open Access Journals (Sweden)

    Kati Juuti-Uusitalo

    Full Text Available Retinal pigment epithelial (RPE cells in the back of the eye nourish photoreceptor cells and form a selective barrier that influences drug transport from the blood to the photoreceptor cells. At the molecular level, ATP-dependent efflux transporters have a major role in drug delivery in human RPE. In this study, we assessed the relative expression of several ATP-dependent efflux transporter genes (MRP1, -2, -3, -4, -5, -6, p-gp, and BCRP, the protein expression and localization of MRP1, MRP4, and MRP5, and the functionality of MRP1 efflux pumps at different maturation stages of undifferentiated human embryonic stem cells (hESC and RPE derived from the hESC (hESC-RPE. Our findings revealed that the gene expression of ATP-dependent efflux transporters MRP1, -3, -4, -5, and p-gp fluctuated during hESC-RPE maturation from undifferentiated hESC to fusiform, epithelioid, and finally to cobblestone hESC-RPE. Epithelioid hESC-RPE had the highest expression of MRP1, -3, -4, and P-gp, whereas the most mature cobblestone hESC-RPE had the highest expression of MRP5 and MRP6. These findings indicate that a similar efflux protein profile is shared between hESC-RPE and the human RPE cell line, ARPE-19, and suggest that hESC-RPE cells are suitable in vitro RPE models for drug transport studies. Embryonic stem cell model might provide a novel tool to study retinal cell differentiation, mechanisms of RPE-derived diseases, drug testing and targeted drug therapy.

  16. Expression of ICAM-1 in colon epithelial cells

    DEFF Research Database (Denmark)

    Vainer, Ben; Sørensen, Susanne; Seidelin, Jakob;

    2003-01-01

    Studies have suggested that in ulcerative colitis (UC), intercellular adhesion molecule-1 (ICAM-1) is involved in migration of leukocytes toward the colonic epithelium. A suitable in vitro model of chronic colonic inflammation does not exist, and the role of the epithelium is based on monolayers ...... of cancer cells. Conflicting results exist on epithelial ICAM-1 expression, and the aim of this study was to compare the expression in various models of colonic epithelium.......Studies have suggested that in ulcerative colitis (UC), intercellular adhesion molecule-1 (ICAM-1) is involved in migration of leukocytes toward the colonic epithelium. A suitable in vitro model of chronic colonic inflammation does not exist, and the role of the epithelium is based on monolayers...

  17. Caspases regulate VAMP-8 expression and phagocytosis in dendritic cells.

    Science.gov (United States)

    Ho, Yong Hou Sunny; Cai, Deyu Tarika; Huang, Dachuan; Wang, Cheng Chun; Wong, Siew Heng

    2009-09-18

    During an inflammation and upon encountering pathogens, immature dendritic cells (DC) undergo a maturation process to become highly efficient in presenting antigens. This transition from immature to mature state is accompanied by various physiological, functional and morphological changes including reduction of caspase activity and inhibition of phagocytosis in the mature DC. Caspases are cysteine proteases which play essential roles in apoptosis, necrosis and inflammation. Here, we demonstrate that VAMP-8, (a SNARE protein of the early/late endosomes) which has been shown previously to inhibit phagocytosis in DC, is a substrate of caspases. Furthermore, we identified two putative conserved caspase recognition/cleavage sites on the VAMP-8 protein. Consistent with the up-regulation of VAMP-8 expression upon treatment with caspase inhibitor (CI), immature DC treated with CI exhibits lower phagocytosis activity. Thus, our results highlight the role of caspases in regulating VAMP-8 expression and subsequently phagocytosis during maturation of DC.

  18. MicroRNA expression profiling identifies activated B cell status in chronic lymphocytic leukemia cells.

    Directory of Open Access Journals (Sweden)

    Shuqiang Li

    Full Text Available Chronic lymphocytic leukemia (CLL is thought to be a disease of resting lymphocytes. However, recent data suggest that CLL cells may more closely resemble activated B cells. Using microRNA (miRNA expression profiling of highly-enriched CLL cells from 38 patients and 9 untransformed B cells from normal donors before acute CpG activation and 5 matched B cells after acute CpG activation, we demonstrate an activated B cell status for CLL. Gene set enrichment analysis (GSEA identified statistically-significant similarities in miRNA expression between activated B cells and CLL cells including upregulation of miR-34a, miR-155, and miR-342-3p and downregulation of miR-103, miR-181a and miR-181b. Additionally, decreased levels of two CLL signature miRNAs miR-29c and miR-223 are associated with ZAP70(+ and IgV(H unmutated status and with shorter time to first therapy. These data indicate an activated B cell status for CLL cells and suggest that the direction of change of individual miRNAs may predict clinical course in CLL.

  19. Cancer cells: novel expression systems in pharmaceutical biotechnology

    Directory of Open Access Journals (Sweden)

    Sayed Shahabuddin Hoseini

    2010-10-01

    Full Text Available "nEvery day, numerous medications are used worldwide to treat different kinds of diseases. A huge part of drug manufacturing - is done in pharmaceutical biotechnology companies. Scientists have developed a variety of methods to synthesize these substances. They can insert the gene or the cDNA of a desired protein into special expression systems and extract the resulted products using different methods. The paraneoplastic syndromes are signs and symptoms originated from cancer cell derived products and not because of direct invasion of tumor cells or metastasis. Cancer cells can secret a wide variety of products such as growth hormones, antibodies and so on. In an innovative route, these products may be processed further and eventually be used as useful biologic substances. In this manuscript, we described a process by which scientists can use cancer cells in order to produce various types of biological substances which can be used as medications, diagnostic substances and research materials. Our hypothesis has been inspired from autonomous production of biologic substances from those cancer cells that are responsible for manifestations of paraneoplastic syndromes.

  20. Expression of the human interleukin-2 receptor gamma chain in insect cells using a baculovirus expression vector.

    Science.gov (United States)

    Raivio, E; Oetken, C; Oker-Blom, C; Engberg, C; Akerman, K; Lindqvist, C

    1995-04-01

    The gene encoding the gamma-chain of the human Interleukin-2 receptor was expressed in lepidopteran insect cells using the baculovirus expression vector system. The corresponding gene was inserted under the polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus and expressed in the Spodoptera frugiperda insect cell line Sf9 during viral infection. The recombinant receptor protein was identified by immunoblotting in cell lysates, prepared from insect cells infected with the recombinant virus. At 40 h post infection the corresponding protein was detected as two major bands with apparent molecular weights of 50-60 kDa using a rabbit anti-human IL-2R gamma-receptor specific antiserum. Metabolic labelling with [35S]-methionine and SDS-PAGE analysis of the recombinant baculovirus infected insect cells verified the immunoblotting data. The expressed IL-2R gamma- protein could also be determined on the surface of infected insect cells by flow cytometer analysis. PMID:7899821

  1. Gene expression pattern of functional neuronal cells derived from human bone marrow mesenchymal stromal cells

    Directory of Open Access Journals (Sweden)

    Bron Dominique

    2008-04-01

    Full Text Available Abstract Background Neuronal tissue has limited potential to self-renew or repair after neurological diseases. Cellular therapies using stem cells are promising approaches for the treatment of neurological diseases. However, the clinical use of embryonic stem cells or foetal tissues is limited by ethical considerations and other scientific problems. Thus, bone marrow mesenchymal stomal cells (BM-MSC could represent an alternative source of stem cells for cell replacement therapies. Indeed, many studies have demonstrated that MSC can give rise to neuronal cells as well as many tissue-specific cell phenotypes. Methods BM-MSC were differentiated in neuron-like cells under specific induction (NPBM + cAMP + IBMX + NGF + Insulin. By day ten, differentiated cells presented an expression profile of real neurons. Functionality of these differentiated cells was evaluated by calcium influx through glutamate receptor AMPA3. Results Using microarray analysis, we compared gene expression profile of these different samples, before and after neurogenic differentiation. Among the 1943 genes differentially expressed, genes down-regulated are involved in osteogenesis, chondrogenesis, adipogenesis, myogenesis and extracellular matrix component (tuftelin, AGC1, FADS3, tropomyosin, fibronectin, ECM2, HAPLN1, vimentin. Interestingly, genes implicated in neurogenesis are increased. Most of them are involved in the synaptic transmission and long term potentialisation as cortactin, CASK, SYNCRIP, SYNTL4 and STX1. Other genes are involved in neurite outgrowth, early neuronal cell development, neuropeptide signaling/synthesis and neuronal receptor (FK506, ARHGAP6, CDKRAP2, PMCH, GFPT2, GRIA3, MCT6, BDNF, PENK, amphiregulin, neurofilament 3, Epha4, synaptotagmin. Using real time RT-PCR, we confirmed the expression of selected neuronal genes: NEGR1, GRIA3 (AMPA3, NEF3, PENK and Epha4. Functionality of these neuron-like cells was demonstrated by Ca2+ influx through glutamate

  2. Germ Cell Nuclear Factor (GCNF) Represses Oct4 Expression and Globally Modulates Gene Expression in Human Embryonic Stem (hES) Cells.

    Science.gov (United States)

    Wang, Hongran; Wang, Xiaohong; Xu, Xueping; Kyba, Michael; Cooney, Austin J

    2016-04-15

    Oct4 is considered a key transcription factor for pluripotent stem cell self-renewal. It binds to specific regions within target genes to regulate their expression and is downregulated upon induction of differentiation of pluripotent stem cells; however, the mechanisms that regulate the levels of human Oct4 expression remain poorly understood. Here we show that expression of human Oct4 is directly repressed by germ cell nuclear factor (GCNF), an orphan nuclear receptor, in hES cells. Knockdown of GCNF by siRNA resulted in maintenance of Oct4 expression during RA-induced hES cell differentiation. While overexpression of GCNF promoted repression of Oct4 expression in both undifferentiated and differentiated hES cells. The level of Oct4 repression was dependent on the level of GCNF expression in a dose-dependent manner. mRNA microarray analysis demonstrated that overexpression of GCNF globally regulates gene expression in undifferentiated and differentiated hES cells. Within the group of altered genes, GCNF down-regulated 36% of the genes, and up-regulated 64% in undifferentiated hES cells. In addition, GCNF also showed a regulatory gene pattern that is different from RA treatment during hES cell differentiation. These findings increase our understanding of the mechanisms that maintain hES cell pluripotency and regulate gene expression during the differentiation process.

  3. HIPSTR and thousands of lncRNAs are heterogeneously expressed in human embryos, primordial germ cells and stable cell lines

    Science.gov (United States)

    Yunusov, Dinar; Anderson, Leticia; Dasilva, Lucas Ferreira; Wysocka, Joanna; Ezashi, Toshihiko; Roberts, R. Michael; Verjovski-Almeida, Sergio

    2016-09-01

    Eukaryotic genomes are transcribed into numerous regulatory long non-coding RNAs (lncRNAs). Compared to mRNAs, lncRNAs display higher developmental stage-, tissue-, and cell-subtype-specificity of expression, and are generally less abundant in a population of cells. Despite the progress in single-cell-focused research, the origins of low population-level expression of lncRNAs in homogeneous populations of cells are poorly understood. Here, we identify HIPSTR (Heterogeneously expressed from the Intronic Plus Strand of the TFAP2A-locus RNA), a novel lncRNA gene in the developmentally regulated TFAP2A locus. HIPSTR has evolutionarily conserved expression patterns, its promoter is most active in undifferentiated cells, and depletion of HIPSTR in HEK293 and in pluripotent H1BP cells predominantly affects the genes involved in early organismal development and cell differentiation. Most importantly, we find that HIPSTR is specifically induced and heterogeneously expressed in the 8-cell-stage human embryos during the major wave of embryonic genome activation. We systematically explore the phenomenon of cell-to-cell variation of gene expression and link it to low population-level expression of lncRNAs, showing that, similar to HIPSTR, the expression of thousands of lncRNAs is more highly heterogeneous than the expression of mRNAs in the individual, otherwise indistinguishable cells of totipotent human embryos, primordial germ cells, and stable cell lines.

  4. HIPSTR and thousands of lncRNAs are heterogeneously expressed in human embryos, primordial germ cells and stable cell lines

    Science.gov (United States)

    Yunusov, Dinar; Anderson, Leticia; DaSilva, Lucas Ferreira; Wysocka, Joanna; Ezashi, Toshihiko; Roberts, R. Michael; Verjovski-Almeida, Sergio

    2016-01-01

    Eukaryotic genomes are transcribed into numerous regulatory long non-coding RNAs (lncRNAs). Compared to mRNAs, lncRNAs display higher developmental stage-, tissue-, and cell-subtype-specificity of expression, and are generally less abundant in a population of cells. Despite the progress in single-cell-focused research, the origins of low population-level expression of lncRNAs in homogeneous populations of cells are poorly understood. Here, we identify HIPSTR (Heterogeneously expressed from the Intronic Plus Strand of the TFAP2A-locus RNA), a novel lncRNA gene in the developmentally regulated TFAP2A locus. HIPSTR has evolutionarily conserved expression patterns, its promoter is most active in undifferentiated cells, and depletion of HIPSTR in HEK293 and in pluripotent H1BP cells predominantly affects the genes involved in early organismal development and cell differentiation. Most importantly, we find that HIPSTR is specifically induced and heterogeneously expressed in the 8-cell-stage human embryos during the major wave of embryonic genome activation. We systematically explore the phenomenon of cell-to-cell variation of gene expression and link it to low population-level expression of lncRNAs, showing that, similar to HIPSTR, the expression of thousands of lncRNAs is more highly heterogeneous than the expression of mRNAs in the individual, otherwise indistinguishable cells of totipotent human embryos, primordial germ cells, and stable cell lines. PMID:27605307

  5. PD-1 expression on dendritic cells suppresses CD8+ T cell function and antitumor immunity

    OpenAIRE

    Lim, Tong Seng; Chew, Valerie; Sieow, Je Lin; Goh, Siting; Yeong, Joe Poh-Sheng; Soon, Ai Ling; Ricciardi-Castagnoli, Paola

    2015-01-01

    Programmed death one (PD-1) is a well-established co-inhibitory regulator that suppresses proliferation and cytokine production of T cells. Despite remarkable progress in delineating the functional roles of PD-1 on T lymphocytes, little is known about the regulatory role of PD-1 expressed on myeloid cells such as dendritic cells (DCs). Here, we show that CD8+ T cells can be more potently activated to secrete IL-2 and IFNγ by PD-1-deficient DCs compared to wild-type DCs. Adoptive transfer of P...

  6. Runx-CBFβ complexes control Foxp3 expression in regulatory T cells

    OpenAIRE

    Rudra, Dipayan; Egawa, Takeshi; Chong, Mark M.W.; Treuting, Piper; Dan R. Littman; Rudensky, Alexander Y.

    2009-01-01

    Foxp3 plays an indispensable role in establishing stable transcriptional and functional programs of regulatory T (Treg) cells. Loss of Foxp3 expression in mature Treg cells results in a failure of suppressor function, yet the molecular mechanisms ensuring steady heritable Foxp3 expression in the Treg cell lineage remain unknown. Using Treg cell-specific gene targeting we found that Runx-CBFβ complexes were required for maintenance of Foxp3 mRNA and protein expression in Treg cells. Consequent...

  7. Novel insights of the gastric gland organization revealed by chief cell specific expression of moesin

    OpenAIRE

    Zhu, Lixin; Hatakeyama, Jason; Zhang, Bing; Makdisi, Joy; Ender, Cody; Forte, John G.

    2008-01-01

    ERM (ezrin, radixin, and moesin) proteins play critical roles in epithelial and endothelial cell polarity, among other functions. In gastric glands, ezrin is mainly expressed in acid-secreting parietal cells, but not in mucous neck cells or zymogenic chief cells. In looking for other ERM proteins, moesin was found lining the lumen of much of the gastric gland, but it was not expressed in parietal cells. No significant radixin expression was detected in the gastric glands. Moesin showed an inc...

  8. Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells

    International Nuclear Information System (INIS)

    Mesenchymal stem cells (MSC) from mouse bone marrow were shown to adopt a pancreatic endocrine phenotype in vitro and to reverse diabetes in an animal model. MSC from human bone marrow and adipose tissue represent very similar cell populations with comparable phenotypes. Adipose tissue is abundant and easily accessible and could thus also harbor cells with the potential to differentiate in insulin producing cells. We isolated human adipose tissue-derived MSC from four healthy donors. During the proliferation period, the cells expressed the stem cell markers nestin, ABCG2, SCF, Thy-1 as well as the pancreatic endocrine transcription factor Isl-1. The cells were induced to differentiate into a pancreatic endocrine phenotype by defined culture conditions within 3 days. Using quantitative PCR a down-regulation of ABCG2 and up-regulation of pancreatic developmental transcription factors Isl-1, Ipf-1, and Ngn3 were observed together with induction of the islet hormones insulin, glucagon, and somatostatin

  9. Analysis of LINE-1 expression in human pluripotent cells.

    Science.gov (United States)

    Muñoz-Lopez, Martin; Garcia-Cañadas, Marta; Macia, Angela; Morell, Santiago; Garcia-Perez, Jose L

    2012-01-01

    Half of the human genome is composed of repeated DNA, and some types are mobile within our genome (transposons and retrotransposons). Despite their abundance, only a small fraction of them are currently active in our genome (Long Interspersed Element-1 (LINE-1), Alu, and SVA elements). LINE-1 or L1 elements are a family of active non-LTR retrotransposons, the ongoing mobilization of which still impacts our genome. As selfish DNA elements, L1 activity is more prominent in early human development, where new insertions would be transmitted to the progeny. Here, we describe the conventional methods aimed to determine the expression level of LINE-1 elements in pluripotent human cells.

  10. Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells.

    Science.gov (United States)

    Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

    Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes.

  11. Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes

    International Nuclear Information System (INIS)

    The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g) with induced diabetes (alloxan, 37 mg/kg) on the 8th gestational day (gd 8). At gd 15, rats from control (n=5) and diabetic (n=5) groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05), CCR2 (P<0.001), and OCT3/4 (P<0.01), and significantly increased expression of CD90 (P<0.05), CD117 (P<0.01), and CD14 (P<0.05) were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers

  12. Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes

    Directory of Open Access Journals (Sweden)

    M.B. Aires

    2015-08-01

    Full Text Available The function of the visceral yolk sac (VYS is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g with induced diabetes (alloxan, 37 mg/kg on the 8th gestational day (gd 8. At gd 15, rats from control (n=5 and diabetic (n=5 groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05, CCR2 (P<0.001, and OCT3/4 (P<0.01, and significantly increased expression of CD90 (P<0.05, CD117 (P<0.01, and CD14 (P<0.05 were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers.

  13. Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes

    Energy Technology Data Exchange (ETDEWEB)

    Aires, M.B. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, J.R.A. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Souza, K.S.; Farias, P.S. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, A.C.V. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Fioretto, E.T. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Maria, D.A. [Laboratório de Bioquímica e Biofísica, Instituto Butantan, São Paulo, SP (Brazil)

    2015-07-10

    The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g) with induced diabetes (alloxan, 37 mg/kg) on the 8th gestational day (gd 8). At gd 15, rats from control (n=5) and diabetic (n=5) groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05), CCR2 (P<0.001), and OCT3/4 (P<0.01), and significantly increased expression of CD90 (P<0.05), CD117 (P<0.01), and CD14 (P<0.05) were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers.

  14. Glioblastoma formation from cell population depleted of Prominin1-expressing cells.

    Directory of Open Access Journals (Sweden)

    Kenji Nishide

    Full Text Available Prominin1 (Prom1, also known as CD133 in human has been widely used as a marker for cancer stem cells (CSCs, which self-renew and are tumorigenic, in malignant tumors including glioblastoma multiforme (GBM. However, there is other evidence showing that Prom1-negative cancer cells also form tumors in vivo. Thus it remains controversial whether Prom1 is a bona fide marker for CSCs. To verify if Prom1-expressing cells are essential for tumorigenesis, we established a mouse line, whose Prom1-expressing cells can be eliminated conditionally by a Cre-inducible DTA gene on the Prom1 locus together with a tamoxifen-inducible CreER(TM, and generated glioma-initiating cells (GICs-LD by overexpressing both the SV40 Large T antigen and an oncogenic H-Ras(L61 in neural stem cells of the mouse line. We show here that the tamoxifen-treated GICs-LD (GICs-DTA form tumor-spheres in culture and transplantable GBM in vivo. Thus, our studies demonstrate that Prom1-expressing cells are dispensable for gliomagenesis in this mouse model.

  15. PD-1 expression on dendritic cells suppresses CD8+ T cell function and antitumor immunity

    Science.gov (United States)

    Lim, Tong Seng; Chew, Valerie; Sieow, Je Lin; Goh, Siting; Yeong, Joe Poh-Sheng; Soon, Ai Ling; Ricciardi-Castagnoli, Paola

    2016-01-01

    ABSTRACT Programmed death one (PD-1) is a well-established co-inhibitory regulator that suppresses proliferation and cytokine production of T cells. Despite remarkable progress in delineating the functional roles of PD-1 on T lymphocytes, little is known about the regulatory role of PD-1 expressed on myeloid cells such as dendritic cells (DCs). Here, we show that CD8+ T cells can be more potently activated to secrete IL-2 and IFNγ by PD-1-deficient DCs compared to wild-type DCs. Adoptive transfer of PD-1-deficient DCs demonstrated their superior capabilities in inducing antigen-specific CD8+ T cell proliferation in vivo. In addition, we provide first evidence demonstrating the existence of peripheral blood DCs and CD11c+ tumor-infiltrating myeloid cells that co-express PD-1 in patients with hepatocellular carcinoma (HCC). The existence of PD-1-expressing HCC-infiltrating DCs (HIDCs) was further supported in a mouse model of HCC. Intratumoral transfer of PD-1-deficient DCs rendered recipient mice resistant to the growth of HCC by promoting tumor-infiltrating CD8+ effector T cells to secrete perforin and granzyme B. This novel finding provides a deeper understanding of the role of PD-1 in immune regulation and has significant implications for cancer immunotherapies targeting PD-1. PMID:27141339

  16. Embryo quality predictive models based on cumulus cells gene expression

    Directory of Open Access Journals (Sweden)

    Devjak R

    2016-07-01

    Full Text Available Since the introduction of in vitro fertilization (IVF in clinical practice of infertility treatment, the indicators for high quality embryos were investigated. Cumulus cells (CC have a specific gene expression profile according to the developmental potential of the oocyte they are surrounding, and therefore, specific gene expression could be used as a biomarker. The aim of our study was to combine more than one biomarker to observe improvement in prediction value of embryo development. In this study, 58 CC samples from 17 IVF patients were analyzed. This study was approved by the Republic of Slovenia National Medical Ethics Committee. Gene expression analysis [quantitative real time polymerase chain reaction (qPCR] for five genes, analyzed according to embryo quality level, was performed. Two prediction models were tested for embryo quality prediction: a binary logistic and a decision tree model. As the main outcome, gene expression levels for five genes were taken and the area under the curve (AUC for two prediction models were calculated. Among tested genes, AMHR2 and LIF showed significant expression difference between high quality and low quality embryos. These two genes were used for the construction of two prediction models: the binary logistic model yielded an AUC of 0.72 ± 0.08 and the decision tree model yielded an AUC of 0.73 ± 0.03. Two different prediction models yielded similar predictive power to differentiate high and low quality embryos. In terms of eventual clinical decision making, the decision tree model resulted in easy-to-interpret rules that are highly applicable in clinical practice.

  17. Differences in CART expression and cell cycle behavior discriminate sympathetic neuroblast from chromaffin cell lineages in mouse sympathoadrenal cells.

    Science.gov (United States)

    Chan, Wing Hei; Gonsalvez, David G; Young, Heather M; Southard-Smith, E Michelle; Cane, Kylie N; Anderson, Colin R

    2016-02-01

    Adrenal medullary chromaffin cells and peripheral sympathetic neurons originate from a common sympathoadrenal (SA) progenitor cell. The timing and phenotypic changes that mark this lineage diversification are not fully understood. The present study investigated the expression patterns of phenotypic markers, and cell cycle dynamics, in the adrenal medulla and the neighboring suprarenal ganglion of embryonic mice. The noradrenergic marker, tyrosine hydroxylase (TH), was detected in both presumptive adrenal medulla and sympathetic ganglion cells, but with significantly stronger immunostaining in the former. There was intense cocaine and amphetamine-regulated transcript (CART) peptide immunostaining in most neuroblasts, whereas very few adrenal chromaffin cells showed detectable CART immunostaining. This phenotypic segregation appeared as early as E12.5, before anatomical segregation of the two cell types. Cell cycle dynamics were also examined. Initially, 88% of Sox10 positive (+) neural crest progenitors were proliferating at E10.5. Many SA progenitor cells withdrew from the cell cycle at E11.5 as they started to express TH. Whereas 70% of neuroblasts (TH+/CART+ cells) were back in the cell cycle at E12.5, only around 20% of chromaffin (CART negative) cells were in the cell cycle at E12.5 and subsequent days. Thus, chromaffin cell and neuroblast lineages showed differences in proliferative behavior from their earliest appearance. We conclude that the intensity of TH immunostaining and the expression of CART permit early discrimination of chromaffin cells and sympathetic neuroblasts, and that developing chromaffin cells exhibit significantly lower proliferative activity relative to sympathetic neuroblasts.

  18. Effect of Interaction between Chromatin Loops on Cell-to-Cell Variability in Gene Expression.

    Directory of Open Access Journals (Sweden)

    Tuoqi Liu

    2016-05-01

    Full Text Available According to recent experimental evidence, the interaction between chromatin loops, which can be characterized by three factors-connection pattern, distance between regulatory elements, and communication form, play an important role in determining the level of cell-to-cell variability in gene expression. These quantitative experiments call for a corresponding modeling effect that addresses the question of how changes in these factors affect variability at the expression level in a systematic rather than case-by-case fashion. Here we make such an effort, based on a mechanic model that maps three fundamental patterns for two interacting DNA loops into a 4-state model of stochastic transcription. We first show that in contrast to side-by-side loops, nested loops enhance mRNA expression and reduce expression noise whereas alternating loops have just opposite effects. Then, we compare effects of facilitated tracking and direct looping on gene expression. We find that the former performs better than the latter in controlling mean expression and in tuning expression noise, but this control or tuning is distance-dependent, remarkable for moderate loop lengths, and there is a limit loop length such that the difference in effect between two communication forms almost disappears. Our analysis and results justify the facilitated chromatin-looping hypothesis.

  19. Growth hormone increases vascular cell adhesion molecule 1 expression

    DEFF Research Database (Denmark)

    Hansen, Troels Krarup; Fisker, Sanne; Dall, Rolf;

    2004-01-01

    We investigated the impact of GH administration on endothelial adhesion molecules, vascular cell adhesion molecule-1 (VCAM-1) and E-selectin, in vivo and in vitro. Soluble VCAM-1, E-selectin, and C-reactive protein concentrations were measured before and after treatment in 25 healthy subjects...... and 25 adult GH-deficient (GHD) patients randomized to GH treatment or placebo. Furthermore, we studied the direct effect of GH and IGF-I and serum from GH-treated subjects on basal and TNF alpha-stimulated expression of VCAM-1 and E-selectin on cultured human umbilical vein endothelial cells. Baseline...... levels of VCAM-1, but not E-selectin, were significantly lower in GHD patients than in healthy subjects (362 +/- 15 microg/liter vs. 516 +/- 21 microg/liter, P treatment, compared with placebo [net difference between groups 151.8 microg/liter (95...

  20. NOTCH3 expression is induced in mural cells through an autoregulatory loop that requires endothelial-expressed JAGGED1.

    Science.gov (United States)

    Liu, Hua; Kennard, Simone; Lilly, Brenda

    2009-02-27

    Endothelial cells and mural cells (smooth muscle cells, pericytes, or fibroblasts) are known to communicate with one another. Their interactions not only serve to support fully functional blood vessels but also can regulate vessel assembly and differentiation or maturation. In an effort to better understand the molecular components of this heterotypic interaction, we used a 3D model of angiogenesis and screened for genes, which were modulated by coculturing of these 2 different cell types. In doing so, we discovered that NOTCH3 is one gene whose expression is robustly induced in mural cells by coculturing with endothelial cells. Knockdown by small interfering RNA revealed that NOTCH3 is necessary for endothelial-dependent mural cell differentiation, whereas overexpression of NOTCH3 is sufficient to promote smooth muscle gene expression. Moreover, NOTCH3 contributes to the proangiogenic abilities of mural cells cocultured with endothelial cells. Interestingly, we found that the expression of NOTCH3 is dependent on Notch signaling, because the gamma-secretase inhibitor DAPT blocked its upregulation. Furthermore, in mural cells, a dominant-negative Mastermind-like1 construct inhibited NOTCH3 expression, and endothelial-expressed JAGGED1 was required for its induction. Additionally, we demonstrated that NOTCH3 could promote its own expression and that of JAGGED1 in mural cells. Taken together, these data provide a mechanism by which endothelial cells induce the differentiation of mural cells through activation and induction of NOTCH3. These findings also suggest that NOTCH3 has the capacity to maintain a differentiated phenotype through a positive-feedback loop that includes both autoregulation and JAGGED1 expression.

  1. Influence of X-rays on early response gene expression in rat astrocytes and brain tumour cell lines

    International Nuclear Information System (INIS)

    The effects of ionizing radiation on c-fos, c-jun and jun-B mRNA levels were determined in cultures of rat perinatal type 1 astrocytes and two rat brain tumour cell lines, 175A and 9L. In astrocyte cultures X-ray doses as low as 1 Gy induced the expression of c-fos and jun-B but had essentially no effect on c-jun. The maximum increase in expression was found 1 h after irradiation, which then rapidly returned to control levels. These findings suggest that astrocytes may play a role in mediating the radiation response of the central nervous system via X-ray-induced changes in gene expression. In contrast, doses of up to 20 Gy had no effect on c-fos, c-jun and jun-B mRNA levels in the two brain tumour cell lines. In addition, whereas 12-0-tetradecanoylphorbol-13-acetate induced the expression of these genes in astrocytes, it had little or no effect on fos or jun expression in 9L or 175A cells. These results suggest that the signal transduction pathways mediating radiation-induced genes expression may be different in normal astrocytes and brain tumour cells. (author)

  2. Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying Ying; Zhu, Jin Yong; Chan, King Ming, E-mail: kingchan@cuhk.edu.hk

    2014-12-15

    Highlights: • Cd stimulated ZFL cell proliferation with decreasing apoptotic cell numbers. • Cd down regulated p53 and RAD51. • Cd up regulated immediate early cancer genes of GADD45 and growth factors. • Cd promoted tumorigenic effects in ZFL cells. - Abstract: Cadmium (Cd) is one of the major transitional metal that has toxic effects in aquatic organisms and their associated ecosystem; however, its hepatic toxicity and carcinogenicity are not very well characterized. We used a zebrafish liver (ZFL) cell line as a model to investigate the mechanism of Cd-induced toxicity on hepatocytes. Our results showed that Cd can be effectively accumulated in ZFL cells in our exposure experiments. Cell cytotoxicity assays and flow cytometer measurements revealed that Cd{sup 2+} stimulated ZFL cell proliferation with decreasing apoptotic cell numbers indicating potentially tumorigenic effects of Cd in ZFL cells. Gene expression profiles also indicated that Cd downregulated oncogenes p53 and rad51 and upregulated immediate response oncogenes, growth arrest and DNA damage-inducible (gadd45) genes, and growth factors. We also found dramatic changes in the gene expression of c-jun and igf1rb at different exposure time points, supporting the notion that potentially tumorigenic of Cd-is involved in the activation of immediate early genes or genes related to apoptosis in cancer promotion.

  3. Gene expression profile of HIV-1 Tat expressing cells: a close interplay between proliferative and differentiation signals

    Directory of Open Access Journals (Sweden)

    Wu Kaili

    2002-06-01

    Full Text Available Abstract Background Expression profiling holds great promise for rapid host genome functional analysis. It is plausible that host expression profiling in an infection could serve as a universal phenotype in virally infected cells. Here, we describe the effect of one of the most critical viral activators, Tat, in HIV-1 infected and Tat expressing cells. We utilized microarray analysis from uninfected, latently HIV-1 infected cells, as well as cells that express Tat, to decipher some of the cellular changes associated with this viral activator. Results Utilizing uninfected, HIV-1 latently infected cells, and Tat expressing cells, we observed that most of the cellular host genes in Tat expressing cells were down-regulated. The down-regulation in Tat expressing cells is most apparent on cellular receptors that have intrinsic receptor tyrosine kinase (RTK activity and signal transduction members that mediate RTK function, including Ras-Raf-MEK pathway. Co-activators of transcription, such as p300/CBP and SRC-1, which mediate gene expression related to hormone receptor genes, were also found to be down-regulated. Down-regulation of receptors may allow latent HIV-1 infected cells to either hide from the immune system or avoid extracellular differentiation signals. Some of the genes that were up-regulated included co-receptors for HIV-1 entry, translation machinery, and cell cycle regulatory proteins. Conclusions We have demonstrated, through a microarray approach, that HIV-1 Tat is able to regulate many cellular genes that are involved in cell signaling, translation and ultimately control the host proliferative and differentiation signals.

  4. Deficient Fas expression by CD4+ CCR5+ T cells in multiple sclerosis

    DEFF Research Database (Denmark)

    Julià, Eva; Montalban, Xavier; Al-Zayat, Hammad;

    2006-01-01

    OBJECTIVE: To evaluate whether T cells expressing CCR5 and CXCR3 from multiple sclerosis (MS) patients are more resistant to apoptosis. METHODS: Expression of CD69, TNF-R1, Fas, FasL, bcl-2, and bax was investigated in 41 MS patients and 12 healthy controls by flow cytometry in CD4+ and CD8+ T...... cells expressing CCR5 and CXCR3. RESULTS: In MS patients, the percentage of CD69 was increased and Fas expression decreased in CD4+ CCR5+ T cells. INTERPRETATION: The lower Fas expression in activated CD4+ CCR5+ T cells might contribute to disease pathogenesis by prolonging cell survival and favoring...

  5. Arsenic trioxide inhibits cell proliferation and human papillomavirus oncogene expression in cervical cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hongtao [Department of Pathology, School of Medicine, Southeast University, Nanjing 210009 (China); Gao, Peng [Department of Internal Medicine, University of Iowa, Iowa City, IA 52242 (United States); Zheng, Jie, E-mail: jiezheng54@126.com [Department of Pathology, School of Medicine, Southeast University, Nanjing 210009 (China)

    2014-09-05

    Highlights: • As{sub 2}O{sub 3} inhibits growth of cervical cancer cells and expression of HPV oncogenes in these cells. • HPV-negative cervical cancer cells are more sensitive to As{sub 2}O{sub 3} than HPV-positive cervical cancer cells. • HPV-18 positive cervical cancer cells are more sensitive to As{sub 2}O{sub 3} than HPV-16 positive cancer cells. • Down-regulation of HPV oncogenes by As{sub 2}O{sub 3} is partially due to the diminished AP-1 binding. - Abstract: Arsenic trioxide (As{sub 2}O{sub 3}) has shown therapeutic effects in some leukemias and solid cancers. However, the molecular mechanisms of its anticancer efficacy have not been clearly elucidated, particularly in solid cancers. Our previous data showed that As{sub 2}O{sub 3} induced apoptosis of human papillomavirus (HPV) 16 DNA-immortalized human cervical epithelial cells and cervical cancer cells and inhibited the expression of HPV oncogenes in these cells. In the present study, we systemically examined the effects of As{sub 2}O{sub 3} on five human cervical cancer cell lines and explored the possible molecular mechanisms. MTT assay showed that HPV-negative C33A cells were more sensitive to growth inhibition induced by As{sub 2}O{sub 3} than HPV-positive cervical cancer cells, and HPV 18-positive HeLa and C4-I cells were more sensitive to As{sub 2}O{sub 3} than HPV 16-positive CaSki and SiHa cells. After As{sub 2}O{sub 3} treatment, both mRNA and protein levels of HPV E6 and E7 obviously decreased in all HPV positive cell lines. In contrast, p53 and Rb protein levels increased in all tested cell lines. Transcription factor AP-1 protein expression decreased significantly in HeLa, CaSki and C33A cells with ELISA method. These results suggest that As{sub 2}O{sub 3} is a potential anticancer drug for cervical cancer.

  6. Analysis of cell growth and gene expression of porcine adipose tissue-derived mesenchymal stem cells as nuclear donor cell.

    Science.gov (United States)

    Oh, Hyun Ju; Park, Jung Eun; Park, Eun Jung; Kim, Min Jung; Kim, Geon A; Rhee, Sang Ho; Lim, Sang Hyun; Kang, Sung Keun; Lee, Byeong Chun

    2014-12-01

    In several laboratory animals and humans, adipose tissue-derived mesenchymal stem cells (ASC) are of considerable interest because they are easy to harvest and can generate a huge proliferation of cells from a small quantity of fat. In this study, we investigated: (i) the expression patterns of reprogramming-related genes in porcine ASC; and (ii) whether ASC can be a suitable donor cell type for generating cloned pigs. For these experiments, ASC, adult skin fibroblasts (AF) and fetal fibroblasts (FF) were derived from a 4-year-old female miniature pig. The ASC expressed cell-surface markers characteristic of stem cells, and underwent in vitro differentiation when exposed to specific differentiation-inducing conditions. Expression of DNA methyltransferase (DNMT)1 in ASC was similar to that in AF, but the highest expression of the DNMT3B gene was observed in ASC. The expression of OCT4 was significantly higher in FF and ASC than in AF (P development rate of cloned embryos derived from ASC was comparable to the development of those derived using FF. Total cell numbers of blastocysts derived using ASC and FF were significantly higher than in embryos made with AF. The results demonstrated that ASC used for SCNT have a potential comparable to those of AF and FF in terms of embryo in vitro development and blastocyst formation.

  7. IL-17A is not expressed by CD207+ cells in Langerhans Cell Histiocytosis lesions

    OpenAIRE

    Allen, Carl E.; McClain, Kenneth L.

    2009-01-01

    Interleukin-17 (IL-17A) is a pro-inflammatory cytokine that has recently been implicated in pathogenesis of Langerhans Cell Histiocytosis (LCH), a potentially fatal disease characterized by lesions including CD207+ (langerin +) histiocytes. However, in this study we were unable to identify IL-17A gene expression in Langerhans cell lesions, and plasma levels of IL-17A did not correlate with disease activity. Therefore, this study does not support a central role for IL-17A in LCH pathogenesis.

  8. Gene transfer and expression of enhanced green fluorescent protein in variant HT-29c cells

    Institute of Scientific and Technical Information of China (English)

    Min Wang; Lars Boenicke; Bradley D. Howard; Ilka Vogel; Hoiger Kalthoff

    2003-01-01

    AIM: To study the expression of enhanced green fluorescent protein (EGFP) gene in retrovirally transduced variant HT29 cells.METHODS: The retroviral vector prkat EGFP/neo was constructed and transfected into the 293T cell using a standard calcium phosphate precipitation method. HT-29c cells (selected from HT-29 cells) were transduced by a retroviral vector encoding the GEFP gene. The fluorescence intensity of colorectal carcinoma HT-29c cells after transduced with the EGFP bearing retrovirus was visualized using fluorescence microscope and fluorescence activated cell sorter (FACS) analysis. Multiple biological behaviors of transduced cells such as the proliferating potential and the expression of various antigens were comparatively analyzed between untransduced and transduced cells in vitro. EGFP expression of the fresh tumor tissue was assessed in vivo.RESULTS: After transduced, HT-29c cells displayed a stable and long-term EGFP expression under the nonselective conditionsin vitro. After cells were successively cultured to passage 50 in vitro, EGFP expression was still at a high level. Their biological behaviors, such as expression of tumor antigens, proliferation rate and aggregation capability were not different compared to untransduced parental cells in vitro. In subcutaneous tumors, EGFP was stable and highly expressed.CONCLUSION: An EGFP expressing retroviral vector was used to transduce HT-29c cells. The transduced cells show a stable and long-term EGFP expression in vitro and in vivo.These cells with EGFP are a valuable tool forin vivo research of tumor metastatic spread.

  9. Gum mastic increases maspin expression in prostate cancer cells

    Institute of Scientific and Technical Information of China (English)

    Mei-lan HE; Wei-wen CHEN; Peng-ju ZHANG; An-li JIANG; Wei FAN; Hui-qing YUAN; Wen-wen LIU; Jian-ye ZHANG

    2007-01-01

    Aim: To study whether gum mastic, a natural resin, can regulate maspin expres-sion in prostate cancer cells, and further investigate the mechanisms involved in this regulatory system. Methods: RT-PCR and Western blotting were used to detect maspin expression at the transcriptional and translational levels. Reporter gene assay was used to investigate the effect of gum mastic on the maspin promoter.The binding activity of negative androgen-responsive element (ARE) and posi-tive Sp1 element in the maspin promoter were studied by electrophoretic mobility shift assay. Results: Gum mastic induced maspin mRNA and protein expression,and the maspin promoter activity was enhanced with gum mastic treatment. Finally,gum mastic inhibited the ARE binding activity and increased the Sp1 binding activity in the maspin promoter. Conclusion: Gum mastic enhances maspin pro-moter activity by suppressing ARE binding activity and enhancing Sp1 binding activity, and the increased activity in the maspin promoter finally leads to the up-regulation of both its mRNA and protein levels.

  10. Ectopic expression of B-lymphoid kinase in cutaneous T-cell lymphoma

    DEFF Research Database (Denmark)

    Krejsgaard, Thorbjørn; Vetter-Kauczok, Claudia S; Woetmann, Anders;

    2009-01-01

    B-lymphoid kinase (Blk) is exclusively expressed in B cells and thymocytes. Interestingly, transgenic expression of a constitutively active form of Blk in the T-cell lineage of mice results in the development of T-lymphoid lymphomas. Here, we demonstrate nuclear factor-kappa B (NF......-kappaB)-mediated ectopic expression of Blk in malignant T-cell lines established from patients with cutaneous T-cell lymphoma (CTCL). Importantly, Blk is also expressed in situ in lesional tissue specimens from 26 of 31 patients with CTCL. Already in early disease the majority of epidermotropic T cells express Blk...... phosphorylated in malignant CTCL cell lines and spontaneously active in kinase assays. Furthermore, targeting Blk activity and expression by Src kinase inhibitors and small interfering RNA (siRNA) inhibit the proliferation of the malignant T cells. In conclusion, this is the first report of Blk expression...

  11. Sequence and expression analyses of ethylene response factors highly expressed in latex cells from Hevea brasiliensis.

    Directory of Open Access Journals (Sweden)

    Piyanuch Piyatrakul

    Full Text Available The AP2/ERF superfamily encodes transcription factors that play a key role in plant development and responses to abiotic and biotic stress. In Hevea brasiliensis, ERF genes have been identified by RNA sequencing. This study set out to validate the number of HbERF genes, and identify ERF genes involved in the regulation of latex cell metabolism. A comprehensive Hevea transcriptome was improved using additional RNA reads from reproductive tissues. Newly assembled contigs were annotated in the Gene Ontology database and were assigned to 3 main categories. The AP2/ERF superfamily is the third most represented compared with other transcription factor families. A comparison with genomic scaffolds led to an estimation of 114 AP2/ERF genes and 1 soloist in Hevea brasiliensis. Based on a phylogenetic analysis, functions were predicted for 26 HbERF genes. A relative transcript abundance analysis was performed by real-time RT-PCR in various tissues. Transcripts of ERFs from group I and VIII were very abundant in all tissues while those of group VII were highly accumulated in latex cells. Seven of the thirty-five ERF expression marker genes were highly expressed in latex. Subcellular localization and transactivation analyses suggested that HbERF-VII candidate genes encoded functional transcription factors.

  12. FcRn expression, ligands binding properties and its regulation in human immune cells and hepatocytes

    OpenAIRE

    2007-01-01

    ABSTRACT Expression and diverse functions of MHC class I related neonatal Fc receptor in different tissues is continually reported. To contribute to the understanding of how the receptor functions according to cell type, we investigated the expression and ligands binding properties of FcRn in human immune cells and hepatocytes. Here, we report that heterodimeric FcRn is expressed in these cells as evidenced by RT-PCR, Western immunoblottting and flow cytometry. The receptor expression i...

  13. Enhanced cell-free protein expression by fusion with immunoglobulin Cκ domain

    OpenAIRE

    Palmer, Elizabeth; Liu, Hong; Khan, Farid; Taussig, Michael J; He, Mingyue

    2006-01-01

    While cell-free systems are increasingly used for protein expression in structural and functional studies, several proteins are difficult to express or expressed only at low levels in cell-free lysates. Here, we report that fusion of the human immunoglobulin κ light chain constant domain (Cκ) at the C terminus of four representative proteins dramatically improved their production in the Escherichia coli S30 system, suggesting that enhancement of cell-free protein expression by Cκ fusion will ...

  14. Increased T cell expression of CD154 (CD40-ligand) in multiple sclerosis

    DEFF Research Database (Denmark)

    Jensen, J; Krakauer, M; Sellebjerg, F

    2001-01-01

    CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients with sec......CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients...

  15. Forced expression of OCT4 influences the expression of pluripotent genes in human mesenchymal stem cells and fibroblasts.

    Science.gov (United States)

    Palma, C S; Tannous, M A; Malta, T M; Russo, E M S; Covas, D T; Picanço-Castro, V

    2013-04-02

    Genetic reprogramming of adult cells to generate induced pluripotent stem (iPS) cells is a new and important step in sidestepping some of the ethical issues and risks involved in the use of embryonic stem cells. iPS cells can be generated by introduction of transcription factors, such as OCT4, SOX2, KLF4, and CMYC. iPS cells resemble embryonic stem cells in their properties and differentiation potential. The mechanisms that lead to induced pluripotency and the effect of each transcription factor are not completely understood. We performed a critical evaluation of the effect of overexpressing OCT4 in mesenchymal stem cells and fibroblasts and found that OCT4 can activate the expression of other stemness genes, such as SOX2, NANOG, CMYC, FOXD3, KLF4, and βCATENIN, which are not normally or are very weakly expressed in mesenchymal stem cells. Transient expression of OCT4 was also performed to evaluate whether these genes are affected by its overexpression in the first 48 h. Transfected fibroblast cells expressed around 275-fold more OCT4 than non-transfected cells. In transient expression, in which cells were analyzed after 48 h, we detected only the up-regulation of FOXD3, SOX2, and KLF4 genes, suggesting that these genes are the earlier targets of OCT4 in this cellular type. We conclude that forced expression of OCT4 can alter cell status and activate the pluripotent network. Knowledge gained through study of these systems may help us to understand the kinetics and mechanism of cell reprogramming.

  16. CD11b expression as a marker to distinguish between recently activated effector CD8(+) T cells and memory cells

    DEFF Research Database (Denmark)

    Christensen, Jeanette Erbo; Ørding Andreasen, Susanne; Christensen, Jan Pravsgaard;

    2001-01-01

    subset. Polyclonal virus-specific effector and memory CD8(+) T cells from lymphocytic choriomeningitis- and vesicular stomatitis virus-infected mice were visualized through staining for intracellular IFN-gamma or binding of MHC-peptide tetramers, and Mac-1 expression was evaluated. Naive T cells and most......CD8(+) T cells in different activation states have been difficult to identify phenotypically. In this study we have investigated whether Mac-1 (CD11b) expression can be used as a criterion to distinguish between recently activated effector cells and memory cells belonging to the CD8(+) T cell...... virus-specific memory CD8(+) T cells express little or no Mac-1 independent of the virus model employed. In contrast, the majority of CD8(+) T cells present during acute infection express a significant level of Mac-1 and, similarly, Mac-1 expression is found on secondary effectors generated in response...

  17. Retinal pigment epithelial cells upregulate expression of complement factors after co-culture with activated T cells

    DEFF Research Database (Denmark)

    Juel, Helene Bæk; Kaestel, Charlotte; Folkersen, Lasse;

    2011-01-01

    In this study we examined the effect of T cell-derived cytokines on retinal pigment epithelial (RPE) cells with respect to expression of complement components. We used an in vitro co-culture system in which CD3/CD28-activated human T cells were separated from the human RPE cell line (ARPE-19......) by a membrane. Differential gene expression in the RPE cells of complement factor genes was identified using gene arrays, and selected gene transcripts were validated by q-RT-PCR. Protein expression was determined by ELISA and immunoblotting. Co-culture with activated T cells increased RPE mRNA and/or protein...... expression of complement components C3, factors B, H, H-like 1, CD46, CD55, CD59, and clusterin, in a dose-dependent manner. Soluble factors derived from activated T cells are capable of increasing expression of complement components in RPE cells. This is important for the further understanding...

  18. The Expression of p53 and Cox-2 in Basal Cell Carcinoma, Squamous Cell Carcinoma and Actinic Keratosis Cases

    Directory of Open Access Journals (Sweden)

    Ülker KARAGECE YALÇIN

    2012-05-01

    Full Text Available Objective: The aim of this study was to investigate p53 and COX-2 expressions in basal cell carcinoma, squamous cell carcinoma and actinic keratoses, and to determine a possible relationship.Material and Method: 50 basal cell carcinoma, 45 squamous cell carcinoma and 45 actinic keratosis cases were evaluated. The type of tumor in basal cell carcinoma and tumor differentiation in squamous cell carcinoma were noted and the paraffin block that best represented the tumor was chosen. Immunostaining by p53 and COX-2 was performed on sections of the paraffin blocks.Results: p53 expression was observed in 98% of basal cell carcinoma, 88.9% of squamous cell carcinoma and all actinic keratosis cases. p53 expression was also noted in non-dysplastic appearing epithelium in actinic keratosis cases. COX-2 expression was seen in 90, 100 and 88.9% of the basal cell carcinoma, squamous cell carcinoma and actinic keratosis groups, respectively. Skin appendages, inflammatory cells and vascular structures were also stained by COX-2 besides tumor tissue. COX-2 expression increased by the p53 expression increase in basal cell carcinoma and squamous cell carcinoma. p53 and COX-2 expressions were not related in terms of tumor type in the BCC and were not related in terms of differentiation in SCC.Conclusion: The existence of p53 expression in actinic keratosis cases has supported the idea that p53 plays a role in the early steps of carcinogenesis in skin cancers. The fact that the expression of COX-2 increases in line with the increase of p53 expression in basal cell carcinoma and squamous cell carcinoma cases indicates that COX-2 expression may be affected by p53

  19. Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

    Science.gov (United States)

    A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

  20. Carbon Ion Irradiation Inhibits Glioma Cell Migration Through Downregulation of Integrin Expression

    International Nuclear Information System (INIS)

    Purpose: To investigate the effect of carbon ion irradiation on glioma cell migration. Methods and Materials: U87 and Ln229 glioma cells were irradiated with photons and carbon ions. Migration was analyzed 24 h after irradiation. Fluorescence-activated cell sorting analysis was performed in order to quantify surface expression of integrins. Results: Single photon doses of 2 Gy and 10 Gy enhanced ανβ3 and ανβ5 integrin expression and caused tumor cell hypermigration on both vitronectin (Vn) and fibronectin (Fn). Compared to integrin expression in unirradiated cells, carbon ion irradiation caused decreased integrin expression and inhibited cell migration on both Vn and Fn. Conclusion: Photon radiotherapy (RT) enhances the risk of tumor cell migration and subsequently promotes locoregional spread via photon induction of integrin expression. In contrast to photon RT, carbon ion RT causes decreased integrin expression and suppresses glioma cell migration on both Vn and Fn, thus promising improved local control.

  1. Chemokine Expression in Retinal Pigment Epithelial ARPE-19 Cells in Response to Coculture with Activated T Cells

    DEFF Research Database (Denmark)

    Juel, Helene Bæk; Faber, Carsten; Udsen, Maja;

    2012-01-01

    Purpose. To investigate the effects of T-cell–derived cytokines on gene and protein expression of chemokines in a human RPE cell line (ARPE-19). Methods. We used an in vitro coculture system in which the RPE and CD3/CD28–activated T-cells were separated by a membrane. RPE cell expression of chemo...

  2. Altered expression of epithelial cell surface glycoconjugates and intermediate filaments at the margins of mucosal wounds

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Grøn, B; Mandel, U;

    1998-01-01

    Alterations in cell to cell adhesion are necessary to enable the type of cell movements that are associated with epithelial wound healing and malignant invasion. Several studies of transformed cells have related epithelial cell movement to changes in the cell surface expression of the carbohydrat...

  3. Differential expression of neural cell adhesion molecule and cadherins in pancreatic islets, glucagonomas, and insulinomas

    DEFF Research Database (Denmark)

    Møller, C J; Christgau, S; Williamson, M R;

    1992-01-01

    The endocrine cells of the pancreas develop from the endoderm and yet display several characteristics of a neuronal phenotype. During embryonic life, ductal epithelial cells give rise to first the glugagon-producing cells (alpha-cells) and then cells that express insulin (beta-cells), somatostati...

  4. Beta-Adrenergic Receptor Expression in Muscle Cells

    Science.gov (United States)

    Young, Ronald B.; Bridge, K.; Vaughn, J. R.

    1999-01-01

    beta-adrenergic receptor (bAR) agonists presumably exert their physiological action on skeletal muscle cells through the bAR. Since the signal generated by the bAR is cyclic AMP (cAMP), experiments were initiated in primary chicken muscle cell cultures to determine if artificial elevation of intracellular cAMP by treatment with forskolin would alter the population of bAR expressed on the surface of muscle cells. Chicken skeletal muscle cells after 7 days in culture were employed for the experiments because muscle cells have attained a steady state with respect to muscle protein metabolism at this stage. Cells were treated with 0-10 uM forskolin for a total of three days. At the end of the 1, 2, and 3 day treatment intervals, the concentration of cAMP and the bAR population were measured. Receptor population was measured in intact muscle cell cultures as the difference between total binding of [H-3]CGP-12177 and non-specific binding of [H-3]CGP-12177 in the presence of 1 uM propranolol. Intracellular cAMP concentration was measured by radioimmunoassay. The concentration of cAMP in forskolin-treated cells increased up to 10-fold in a dose dependent manner. Increasing concentrations of forskolin also led to an increase in (beta)AR population, with a maximum increase of approximately 50% at 10 uM. This increase in (beta)AR population was apparent after only 1 day of treatment, and the pattern of increase was maintained for all 3 days of the treatment period. Thus, increasing the intracellular concentration of cAMP leads to up-regulation of (beta)AR population. Clenbuterol and isoproterenol gave similar effects on bAR population. The effect of forskolin on the quantity and apparent synthesis rate of the heavy chain of myosin (mhc) were also investigated. A maximum increase of 50% in the quantity of mhc was observed at 0.2 UM forskolin, but higher concentrations of forskolin reduced the quantity of mhc back to control levels.

  5. Characterization of TLX Expression in Neural Stem Cells and Progenitor Cells in Adult Brains

    OpenAIRE

    Shengxiu Li; Guoqiang Sun; Kiyohito Murai; Peng Ye; Yanhong Shi

    2012-01-01

    TLX has been shown to play an important role in regulating the self-renewal and proliferation of neural stem cells in adult brains. However, the cellular distribution of endogenous TLX protein in adult brains remains to be elucidated. In this study, we used immunostaining with a TLX-specific antibody to show that TLX is expressed in both neural stem cells and transit-amplifying neural progenitor cells in the subventricular zone (SVZ) of adult mouse brains. Then, using a double thymidine analo...

  6. Expression of soluble triggering receptor expression on myeloid cells-1 in pleural effusion

    Institute of Scientific and Technical Information of China (English)

    HUANG Lu-ying; SHI Huan-zhong; LIANG Qiu-li; WU Yan-bin; QIN Xue-jun; CHEN Yi-qiang

    2008-01-01

    Background Tdggedng receptors expressed on myeloid cells(TREM)proteins are a family of cell surface receptors expressed broadly by cells of the myeloid lineage.The aim of this study was to investigate the clinical significance of soluble TREM-1(sTREM-1)in pleural effusions,and to determine the effects of pneumonia on pleural sTREM-1 concentrations.Methods PleuraI fluid was collected from 109 patients who presented to the respiratory institute (35 with malignant pleural effusion,31 with tuberculous pleural effusion,21 with bacteriaI pleural effusion,and 22 with transudate).The concentrations of sTREM-1,tumor necrosis factor-o(TNF-α)and interleukin-1β(IL-1β)were determined jn effusion and serum samples by enzyme Iinked immunosorbent assay(ELISA).Results The concentrations of sTREM-1 in bacterial pleural effusion were significantly higher than those in malignant.tuberculous,and transudative groups(all P<0.001).An sTREM-1 cutoff value of 768.1 ng/L had a sensitivity of 86%and a specificity of 93%.Pleural sTREM-1 Ievels were positively correlated with Ievels of TNF-α and IL-1β.Patients with complicating bacterial pneumonia did not have elevated concentration of STREM-1 jn pleural effusion when compared with patients without pneumonia.Conclusions Determination of pleural sTREM-1 may improve the ability of clinicians to differentiate pleural effusion patients of bacterial origin from those with other etiologies.The occurrence of bacterial pneumonia did not affect pleural sTREM-1 concentrations.

  7. TCR repertoire and Foxp3 expression define functionally distinct subsets of CD4+ Treg cells1

    OpenAIRE

    Kuczma, Michal; Pawlikowska, Iwona; Kopij, Magdalena; Podolsky, Robert; Rempala, Grzegorz A.; Kraj, Piotr

    2009-01-01

    Despite extensive research efforts to characterize peripheral regulatory T cells (Treg) expressing transcription factor Foxp3, their subset complexity, phenotypic characteristics, TCR repertoire and antigen specificities remain ambiguous. Here, we identify and define two subsets of peripheral Treg cells differing in Foxp3 expression level and TCR repertoires. Treg cells expressing a high level of Foxp3 and TCRs not utilized by naive CD4+ T cells present a stable suppressor phenotype and domin...

  8. Estradiol Receptors Regulate Differential Connexin 43 Expression in F98 and C6 Glioma Cell Lines.

    Directory of Open Access Journals (Sweden)

    Zahra Moinfar

    Full Text Available Glioma is the most common malignant primary brain tumour with male preponderance and poor prognosis. Glioma cells express variable amounts of connexin 43 (Cx43 and estrogen receptors (ERs. Both, Cx43 and ERs, play important roles in cell proliferation and migration. Therefore, we investigated the effects of 17-ß estradiol (E2 on Cx43 expression in two glioma cell lines with variable native expression of Cx43.F98 and C6 rat glioma cells were cultured for 24 h in the presence of 10 nM or 100 nM E2, and the E2-antagonist, Fulvestrant. An MTT assay was performed to evaluate cell viability. ERα, ERβ and Cx43 protein expressions were analysed by western blotting and Cx43 mRNA expression was analysed by real-time polymerase chain reaction. To quantify cell migration, an exclusive zone migration assay was used. Functional coupling of cells via gap junctions was examined using whole-cell patch-clamp technique.E2 reduced Cx43 expression in C6 cells, but increased Cx43 expression in F98 cultures. These effects were mediated via ERs. Moreover, E2 promoted C6 cell migration, but it did not affect F98 cell migration. The expression level of ERα was found to be high in C6, but low in F98 cells. ERβ was exclusively expressed in C6 cells. In addition, E2 treatment induced a significant decrease of ERβ in C6 cultures, while it decreased ERα expression in F98 glioma cells.These findings show that E2 differentially modulates Cx43 expression in F98 and C6 glioma cells, likely due to the differential expression of ERs in each of these cell lines. Our findings point to the molecular mechanisms that might contribute to the gender-specific differences in the malignancy of glioma and could have implications for therapeutic strategies against glioma.

  9. Aristaless related homeobox gene, Arx, is implicated in mouse fetal Leydig cell differentiation possibly through expressing in the progenitor cells.

    Directory of Open Access Journals (Sweden)

    Kanako Miyabayashi

    Full Text Available Development of the testis begins with the expression of the SRY gene in pre-Sertoli cells. Soon after, testis cords containing Sertoli and germ cells are formed and fetal Leydig cells subsequently develop in the interstitial space. Studies using knockout mice have indicated that multiple genes encoding growth factors and transcription factors are implicated in fetal Leydig cell differentiation. Previously, we demonstrated that the Arx gene is implicated in this process. However, how ARX regulates Leydig cell differentiation remained unknown. In this study, we examined Arx KO testes and revealed that fetal Leydig cell numbers largely decrease throughout the fetal life. Since our study shows that fetal Leydig cells rarely proliferate, this decrease in the KO testes is thought to be due to defects of fetal Leydig progenitor cells. In sexually indifferent fetal gonads of wild type, ARX was expressed in the coelomic epithelial cells and cells underneath the epithelium as well as cells at the gonad-mesonephros border, both of which have been described to contain progenitors of fetal Leydig cells. After testis differentiation, ARX was expressed in a large population of the interstitial cells but not in fetal Leydig cells, raising the possibility that ARX-positive cells contain fetal Leydig progenitor cells. When examining marker gene expression, we observed cells as if they were differentiating into fetal Leydig cells from the progenitor cells. Based on these results, we propose that ARX acts as a positive factor for differentiation of fetal Leydig cells through functioning at the progenitor stage.

  10. Ghrelin regulates cell cycle-related gene expression in cultured hippocampal neural stem cells.

    Science.gov (United States)

    Chung, Hyunju; Park, Seungjoon

    2016-08-01

    We have previously demonstrated that ghrelin stimulates the cellular proliferation of cultured adult rat hippocampal neural stem cells (NSCs). However, little is known about the molecular mechanisms by which ghrelin regulates cell cycle progression. The purpose of this study was to investigate the potential effects of ghrelin on cell cycle regulatory molecules in cultured hippocampal NSCs. Ghrelin treatment increased proliferation assessed by CCK-8 proliferation assay. The expression levels of proliferating cell nuclear antigen and cell division control 2, well-known cell-proliferating markers, were also increased by ghrelin. Fluorescence-activated cell sorting analysis revealed that ghrelin promoted progression of cell cycle from G0/G1 to S phase, whereas this progression was attenuated by the pretreatment with specific inhibitors of MEK/extracellular signal-regulated kinase 1/2, phosphoinositide 3-kinase/Akt, mammalian target of rapamycin, and janus kinase 2/signal transducer and activator of transcription 3. Ghrelin-induced proliferative effect was associated with increased expression of E2F1 transcription factor in the nucleus, as determined by Western blotting and immunofluorescence. We also found that ghrelin caused an increase in protein levels of positive regulators of cell cycle, such as cyclin A and cyclin-dependent kinase (CDK) 2. Moreover, p27(KIP1) and p57(KIP2) protein levels were reduced when cell were exposed to ghrelin, suggesting downregulation of CDK inhibitors may contribute to proliferative effect of ghrelin. Our data suggest that ghrelin targets both cell cycle positive and negative regulators to stimulate proliferation of cultured hippocampal NSCs. PMID:27325242

  11. Cell-surface expression of Hsp70 on hematopoietic cancer cells after inhibition of HDAC activity

    DEFF Research Database (Denmark)

    Jensen, Helle; Andresen, Lars; Hansen, Karen Aagaard;

    small HSPs). Hsp70 belongs to the HSP70 family and is expressed at low levels in normal non-stressed cells. Its expression is however induced by different cellular stresses, such as heat shock and oxidative stress. The function of Hsp70 depends on its cellular location: Intracellular it has...... normal ER/Golgi transport did not affect Hsp70 surface expression. Intracellular Calcium and the transcription factor Sp1, that has previously been shown to be important for the intracellular stress mediated by HDAC-inhibitors, were not involved in Hsp70 surface expression. We also found that HDAC...... cytoprotective and anti-apoptotic functions, whereas it exerts immunostimulatory functions extracellularly. Secreted Hsp70 is for example involved in cross-presentation of cancer-derived antigenic peptides, a function which is currently explored in immunotherapeutic approaches against cancer. Additionally...

  12. Loss of glucocorticoid receptor expression by DNA methylation prevents glucocorticoid induced apoptosis in human small cell lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Paul Kay

    Full Text Available Human small cell lung cancer (SCLC is highly aggressive, and quickly develops resistance to therapy. SCLC cells are typically insensitive to glucocorticoids due to impaired glucocorticoid receptor (GR expression. This is important as we have previously shown that expression of a GR transgene induces cell death in-vitro, and inhibits tumor growth in-vivo. However, the underlying mechanism for loss of GR expression is unknown. The SCLC cell line, DMS79, has low GR expression, compared to non-SCLC cell lines and normal bronchial epithelial cells. Retroviral GR expression in DMS79 cells caused activation of the apoptotic pathway as evidenced by marked induction of caspase-3 activity. Methylation analysis of the GR promoter revealed some methylation in the 1D, and 1E promoters of the GR gene, however the ubiquitous constitutively active 1C promoter was heavily methylated. In the 1C promoter there was a highly significant increase in DNA methylation in a panel of 14 human SCLC cell lines compared to a mixed panel of GR expressing, and non-expressing cell lines, and to peripheral blood mononuclear cells. Furthermore, within the panel of SCLC cell lines there was a significant negative correlation seen between methylation of the 1C promoter, and GR protein expression. Reversal of GR gene methylation with DNA methyltransferase inhibition caused increased GR mRNA and protein expression in SCLC but not non-SCLC cells. This resulted in increased Gc sensitivity, decreased Bcl-2 expression and increased caspase-3 activity in SCLC cells. These data suggest that DNA methylation decreases GR gene expression in human SCLC cells, in a similar manner to that for conventional tumor suppressor genes.

  13. Expression of Telomerase Activity in Gastric Cancer Cells

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Objective To study the relationship between telomerase activity and biological behavior in human gastric cells and appraise the clinical significance of detecting telomerase activity. Methods The telomerase activity in 47 gastric cancer tissue samples,their matched nomal tissues,7 gastric ulcer and 2 gastric cancer cell lines was detected using a PCR-based non-radioisotopic telomeric repeat amplification protocol(TRAP) assay. Results None of the 47 samples from normal gastric tissues expressed telomerase activity.The 41 of 47 cases of gastric cancer presented telomerase activity with an 87.2% positive rate (P<0.001). 2/2 gastric cancer cell lines and 0/7 gastric ulcer line were also positive for telmerase activity.The activity of telomerase was associated with the pathological differentiation of gastric cancer. Conclusion Telomerase activity may be related to the biological behavior of gastric cancer and can help in assessing the malignant poten-tial of gastric cancer.Telomerase activity will be a good diagnostic marker for the detection of gastric cancer.

  14. Heterogeneity of aberrant immunoglobulin expression in cancer cells

    Institute of Scientific and Technical Information of China (English)

    Duosha Hu; Ya Cao; Zhi Duan; Ming Li; Yiqun Jiang; Haidan Liu; Hui Zheng; Lili Li; Ann M Bode; Zigang Dong

    2011-01-01

    Accumulating evidence has shown that immunoglobulin (Ig) is 'unexpectedly' expressed by epithelial cancer cells and that it can promote tumor growth.The main purpose of this study was to explore the components of the cancerous Ig and its possible function.The presence of cancerous Ig in the Golgi apparatus was confirmed by immunofluorescence,indirectly suggesting that the cancerous Ig was processed and packaged in cancer cells.Western blot analysis and ELISA results indicated that cancer cells produced membrane Ig and secreted Ig into the supernatant fraction.The cancerous Ig consists of an α heavy chain and a κ light chain.Finally,by analyzing the Ig components pulled down by protein A beads,the cancerous Ig was found to be structurally distinct from normal Ig.The cancerous Ig was truncated or aberrant.Although the underlying mechanism that causes the abnormalities has not been determined,our current discoveries strengthen our previous findings and promise fruitful future explorations.

  15. Use of RUNX2 Expression to Identify Osteogenic Progenitor Cells Derived from Human Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Li Zou

    2015-02-01

    Full Text Available We generated a RUNX2-yellow fluorescent protein (YFP reporter system to study osteogenic development from human embryonic stem cells (hESCs. Our studies demonstrate the fidelity of YFP expression with expression of RUNX2 and other osteogenic genes in hESC-derived osteoprogenitor cells, as well as the osteogenic specificity of YFP signal. In vitro studies confirm that the hESC-derived YFP+ cells have similar osteogenic phenotypes to osteoprogenitor cells generated from bone-marrow mesenchymal stem cells. In vivo studies demonstrate the hESC-derived YFP+ cells can repair a calvarial defect in immunodeficient mice. Using the engineered hESCs, we monitored the osteogenic development and explored the roles of osteogenic supplements BMP2 and FGF9 in osteogenic differentiation of these hESCs in vitro. Taken together, this reporter system provides a novel system to monitor the osteogenic differentiation of hESCs and becomes useful to identify soluble agents and cell signaling pathways that mediate early stages of human bone development.

  16. Gene Cloning of Murine α-Fetoprotein Gene and Construction of Its Eukaryotic Expression Vector and Expression in CHO Cells

    Institute of Scientific and Technical Information of China (English)

    易继林; 田耕

    2003-01-01

    To clone the murine α-fetoprotein (AFP) gene, construct the eukaryotic expression vector of AFP and express in CHO cells, total RNA were extracted from Hepa 1-6 cells, and then the murine α-fetoprotein gene was amplified by RT-PCR and cloned into the eukaryotic expression vector pcDNA3.1. The recombinant of vector was identified by restriction enzyme analysis and sequencing. A fter transient transfection of CHO cells with the vector, Western blotting was used to detect the expression of AFP. It is concluded that the 1.8kb murine α-fetoprotein gene was successfully cloned and its eukaryotic expression vector was successfully constructed.

  17. Effect of Dexamethasone on Expression of Glucocorticoid Receptor in Human Monocyte Cell Line THP-1

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The effect of dexamethasone with differentconcentrations and different stimulating periods on the expression of glucocorticoid receptors (GRα, GRβ) protein was investigated in human monocyte cell line THP-1. The cultured human monocyte line THP-1 cells were stimulated by dexamethasone with different concentrations and different periods. The expression of GRα and GRβ protein was detected by Western blotting. The results showed that the expression of GRα and GRβ was detected in the THP-1 cells. The quantity of GRα expression was reduced by dexamethasone under the same concentration with the prolongation of the stimulating periods. The quantity of GRβ expression was increased by dexamethasone treatment in a time- and dose-dependent manner. It was concluded that dexamethasone stimulation time-dependently reduced the GRα expression in THP-1 cells. Dexamethasone stimulation time- and dose-dependently increased the GRβ expression in THP1 cells. The expression of GRα and GRβ was regulated by glucocorticoid.

  18. Forced expression of the Oct-4 gene influences differentiation of embryonic stem cells

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    By transfecting an Oct-4 expression plasmid into embryonic stem cells (ES cells), the ES-O cell line was constructed, which sustained the expression of Oct-4 gene when induced by retinoic acid. Forced expression of Oct-4 gene could not sustain the stem property of ES-O cells without the differentiation inhibiting factor LIF, but if LIF exists,forced expression of Oct-4 gene could enhance the ability to sustain the undifferentiation state and inhibit cell differentiation induced by retinoic acid. It was indicated that Oct-4 must cooperate with LIF to sustain the undifferentiation state of ES cells. During the cell differentiation, ES-O cells tend to differentiate into neural cells, suggesting that forced expression of Oct-4 gene may be in relation with the differentiation of neuroderm.

  19. Construction of antisense Bmi-1 expression plasmid and its inhibitory effect on K562 cells proliferation

    Institute of Scientific and Technical Information of China (English)

    MENG Xiu-xiang; LIU Wei-hong; LIU Dan-dan; ZHAO Xin-yu; SU Ben-li

    2005-01-01

    Background Bmi-1 gene determines the proliferative capacity of normal and leukemia stem cells. Expression of Bmi-1 has been found in all types of myeloid leukemia cells in both humans and mice. This study aimed at assessing the effect of antisense Bmi-1 expression on K562 cells proliferation and p16 protein (p16) expression.Results K562 cells transfected with antisense Bmi-1 plasmid grew significantly slower than that of controls (the parental K562 and cells transfected with empty plasmid). The colony forming ability of antisense Bmi-1 plasmid transfected cells decreased significantly (P<0.01) compared with controls. The p16 expression of cells transfected with antisense Bmi-1 was upgraded more apparently than that of controls.Conclusion The antisense Bmi-1 gene can inhibit the growth of K562 cell and upgrade expression of p16 in K562 cells.

  20. Persistent donor cell gene expression among human induced pluripotent stem cells contributes to differences with human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Zhumur Ghosh

    Full Text Available Human induced pluripotent stem cells (hiPSCs generated by de-differentiation of adult somatic cells offer potential solutions for the ethical issues surrounding human embryonic stem cells (hESCs, as well as their immunologic rejection after cellular transplantation. However, although hiPSCs have been described as "embryonic stem cell-like", these cells have a distinct gene expression pattern compared to hESCs, making incomplete reprogramming a potential pitfall. It is unclear to what degree the difference in tissue of origin may contribute to these gene expression differences. To answer these important questions, a careful transcriptional profiling analysis is necessary to investigate the exact reprogramming state of hiPSCs, as well as analysis of the impression, if any, of the tissue of origin on the resulting hiPSCs. In this study, we compare the gene profiles of hiPSCs derived from fetal fibroblasts, neonatal fibroblasts, adipose stem cells, and keratinocytes to their corresponding donor cells and hESCs. Our analysis elucidates the overall degree of reprogramming within each hiPSC line, as well as the "distance" between each hiPSC line and its donor cell. We further identify genes that have a similar mode of regulation in hiPSCs and their corresponding donor cells compared to hESCs, allowing us to specify core sets of donor genes that continue to be expressed in each hiPSC line. We report that residual gene expression of the donor cell type contributes significantly to the differences among hiPSCs and hESCs, and adds to the incompleteness in reprogramming. Specifically, our analysis reveals that fetal fibroblast-derived hiPSCs are closer to hESCs, followed by adipose, neonatal fibroblast, and keratinocyte-derived hiPSCs.

  1. Establishment of a pig fibroblast-derived cell line for locus-directed transgene expression in cell cultures and blastocysts

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Li, Juan; Moldt, Brian;

    2011-01-01

    We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon...... transfer. PFV cells supported Flp mediated cassette exchange for transgene substitution of eGFP with dsRED, and the dsRED transgenic PFV cells generated blastocysts with transgene expression. Hence, the PFV cell line constitutes a valuable pig equivalent to transformed cell lines from other mammalian......-based docking vector harbouring a selection gene, an eGFP reporter gene, and an Flp recombinase site for locus-directed gene insertion. PFV cells have insertion of a single docking vector with stable eGFP expression and generated phenotypic normal blastocysts with transgene expression after somatic cell nuclear...

  2. HMGB4 is expressed by neuronal cells and affects the expression of genes involved in neural differentiation

    Science.gov (United States)

    Rouhiainen, Ari; Zhao, Xiang; Vanttola, Päivi; Qian, Kui; Kulesskiy, Evgeny; Kuja-Panula, Juha; Gransalke, Kathleen; Grönholm, Mikaela; Unni, Emmanual; Meistrich, Marvin; Tian, Li; Auvinen, Petri; Rauvala, Heikki

    2016-09-01

    HMGB4 is a new member in the family of HMGB proteins that has been characterized in sperm cells, but little is known about its functions in somatic cells. Here we show that HMGB4 and the highly similar rat Transition Protein 4 (HMGB4L1) are expressed in neuronal cells. Both proteins had slow mobility in nucleus of living NIH-3T3 cells. They interacted with histones and their differential expression in transformed cells of the nervous system altered the post-translational modification statuses of histones in vitro. Overexpression of HMGB4 in HEK 293T cells made cells more susceptible to cell death induced by topoisomerase inhibitors in an oncology drug screening array and altered variant composition of histone H3. HMGB4 regulated over 800 genes in HEK 293T cells with a p-value ≤0.013 (n = 3) in a microarray analysis and displayed strongest association with adhesion and histone H2A -processes. In neuronal and transformed cells HMGB4 regulated the expression of an oligodendrocyte marker gene PPP1R14a and other neuronal differentiation marker genes. In conclusion, our data suggests that HMGB4 is a factor that regulates chromatin and expression of neuronal differentiation markers.

  3. Poor prognostic clinicopathologic features correlate with VEGF expression but not with PTEN expression in squamous cell carcinoma of the larynx

    Directory of Open Access Journals (Sweden)

    Karagoz Filiz

    2010-06-01

    Full Text Available Abstract Background The aim of this study was to assess the relationship between expression of vascular endothelial growth factor (VEGF and phosphatase and tensin homolog deleted in chromosome ten (PTEN, angiogenesis and clinicopathological parameters of squamous cell carcinoma of the larynx. Methods We examined immunohistochemical expression of VEGF and PTEN and CD34 for microvessel density (MVD in sections of formalin-fixed, paraffin embedded tissue blocks of 140 patients with squamous cell carcinoma of the larynx. The intensity of VEGF and PTEN staining and the proportion of cells staining were scored. Results The tumor grade was not significantly related to PTEN expression, but it was to VEGF expression (p = 0.400; p = 0.015, respectively. While there was no significant relationship between PTEN expression and tumor size and cartilage invasion (p = 0.311, p = 0.128, there was a significant relationship between the severity of VEGF expression and tumor size (p = 0.006 and lymph node metastasis (p = 0.048 but not cartilage invasion (p = 0.129. MVD was significantly higher in high-grade tumors (p = 0.003 but had no significant relationship between MVD, lymph node metastasis, and cartilage invasion (p = 0.815, p = 0.204. There was also no significant relationship between PTEN and VEGF expression (p = 0.161 and between PTEN and VEGF expression and the MVD (p = 0.120 and p = 0.175, respectively. Conclusions Increased VEGF expression may play an important role in the outcome of squamous cell carcinoma of the larynx. PTEN expression was not related to VEGF expression and clinicopathological features of squamous cell carcinoma of the larynx.

  4. Loss of DNAM-1 ligand expression by acute myeloid leukemia cells renders them resistant to NK cell killing.

    Science.gov (United States)

    Kearney, Conor J; Ramsbottom, Kelly M; Voskoboinik, Ilia; Darcy, Phillip K; Oliaro, Jane

    2016-08-01

    Acute myeloid leukemia (AML) is associated with poor natural killer (NK) cell function through aberrant expression of NK-cell-activating receptors and their ligands on tumor cells. These alterations are thought to promote formation of inhibitory NK-target cell synapses, in which killer cell degranulation is attenuated. Allogeneic stem cell transplantation can be effective in treating AML, through restoration of NK cell lytic activity. Similarly, agents that augment NK-cell-activating signals within the immunological synapse may provide some therapeutic benefit. However, the receptor-ligand interactions that critically dictate NK cell function in AML remain undefined. Here, we demonstrate that CD112/CD155 expression is required for DNAM-1-dependent killing of AML cells. Indeed, the low, or absent, expression of CD112/CD155 on multiple AML cell lines resulted in failure to stimulate optimal NK cell function. Importantly, isolated clones with low CD112/155 expression were resistant to NK cell killing while those expressing abundant levels of CD112/155 were highly susceptible. Attenuated NK cell killing in the absence of CD112/CD155 originated from decreased NK-target cell conjugation. Furthermore, we reveal by time-lapse microscopy, a significant increase in NK cell 'failed killing' in the absence of DNAM-1 ligands. Consequently, NK cells preferentially lysed ligand-expressing cells within heterogeneous populations, driving clonal selection of CD112/CD155-negative blasts upon NK cell attack. Taken together, we identify reduced CD155 expression as a major NK cell escape mechanism in AML and an opportunity for targeted immunotherapy. PMID:27622064

  5. MicroRNA (miRNA) expression is regulated by butyrate induced epigenetic modulation of gene expression in bovine cells

    Science.gov (United States)

    We present evidence that butyrate induced histone acetylation regulates miRNA expression. MicroRNA expression microarray profiling revealed that 35 miRNA transcripts are significantly (p cells were treated with 10 mM butyrate. Among them, 11 transcripts are dif...

  6. Gene expression in epithelial cells in response to pneumovirus infection

    Directory of Open Access Journals (Sweden)

    Rosenberg Helene F

    2001-05-01

    Full Text Available Abstract Respiratory syncytial virus (RSV and pneumonia virus of mice (PVM are viruses of the family Paramyxoviridae, subfamily pneumovirus, which cause clinically important respiratory infections in humans and rodents, respectively. The respiratory epithelial target cells respond to viral infection with specific alterations in gene expression, including production of chemoattractant cytokines, adhesion molecules, elements that are related to the apoptosis response, and others that remain incompletely understood. Here we review our current understanding of these mucosal responses and discuss several genomic approaches, including differential display reverse transcription-polymerase chain reaction (PCR and gene array strategies, that will permit us to unravel the nature of these responses in a more complete and systematic manner.

  7. Controlled expression of enhanced green fluorescent protein and hepatitis B virus precore protein in mammalian cells

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A novel tetracycline regulation expression system was used to regulate the expression of enhanced green fluorescent protein (EGFP) and hepatitis B virus precore protein in the mammalian cell lines with lipofectAMINE. Flow cytometry assays showed that application of the system resulted in about 18-fold induction of EGFP expression in CHO cell lines and 5-fold induction in SSMC-7721 cells and about 2-fold in the HEK293 cells. Furthermore, the effective use of this system for the controlled expression of HBV precore protein gene in hepatocellular carcinoma cells was tested.

  8. miR-150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely.

    Science.gov (United States)

    Zhou, Beiyan; Wang, Stephanie; Mayr, Christine; Bartel, David P; Lodish, Harvey F

    2007-04-24

    MicroRNAs (miRNAs) are a family of approximately 22-nt noncoding RNAs that can posttranscriptionally regulate gene expression. Several miRNAs are specifically expressed in hematopoietic cells. Here we show that one such miRNA, miR-150, is mainly expressed in the lymph nodes and spleen and is highly up-regulated during the development of mature T and B cells; expression of miR-150 is sharply up-regulated at the immature B cell stage. Overexpression of miR-150 in hematopoietic stem cells, followed by bone marrow transplantation, had little effect on the formation of either mature CD8- and CD4-positive T cells or granulocytes or macrophages, but the formation of mature B cells was greatly impaired. Furthermore, premature expression of miR-150 blocked the transition from the pro-B to the pre-B stage. Our results indicate that miR-150 most likely down-regulates mRNAs that are important for pre- and pro-B cell formation or function, and its ectopic expression in these cells blocks further development of B cells.

  9. Expression of cell cycle related genes in HL60 cells undergoing apoptosis by X-irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Hee [College of Medicine, Keimyung Univ., Taegu (Korea, Republic of); Park, In Kyu [College of Medicine, Kyungpook National Univ., Taegu (Korea, Republic of)

    1998-12-01

    To evaluate changes in expression of cell cycle related genes during apoptosis induced in HL60 cells by X-irradiation to understand molecular biologic aspects in mechanism of radiation therapy. HL-60 cell line (promyelocytic leukemia cell line was grown in culture media and irradiated with 8 Gy by linear accelerator (6 MV X-ray). At various times after irradiation, ranging from 3 to 48 hours were analyzed apoptotic DNA fragmentation assay for apoptosis and by western blot analysis and semi-quantitative RT-PCR for expression of cell cycle related genes (cyclin A, cyclin B, cyclin C, cyclin D1, cyclin E, cdc2, CDK2, CDK4, p16{sup INK4a}, p21{sup WAF1}, p27K{sup IP1}, E2F, PCNA and Rb). X-irradiation (8 Gy) induced apoptosis in HL-60 cell line. Cycline A protein increased after reaching its peak 48 h after radiation delivery and cyclin E, E2F, CDK2 and RB protein increased then decreased after radiation. Radiation induced up-regulation of the expression of E2F is due to mostly increase of phosphorylated retinoblastoma proteins (ppRb). Cyclin D1, PCNA, CDC1, CDK4 and p16{sup INK4a} protein underwent no significant change at any times after irradiation. There was not detected p21{sup WAF1} and p27{sup KIP1} protein. Cyclin A, B, C, mRNA decreased immediately after radiation and then increased at 12 h after radiation. Cyclin D1 mRNA increased immediately and then decreased with the lapse of time. CDK2 mRNA decreased at 3 h and increased at 6 h after radiation. CDK4 mRNA rapidly increased at 6 to 12 h after radiation. There was no change of expression of p16{sup INK4a} and not detected in expressin of p21{sup WAF1} and p27{sup KIP1} mRNA. We suggest that entry into S phaso may contribute to apoptosis of HL60 cells induced by irradiation. Increase of ppRb and decrease of pRb protein are related with radiation induced apoptosis of HL60 cells and tosis of HL60 cells induced by irradiation. Increase of ppRb and decrease of pRb protein are related with radiation induced

  10. Inferring single-cell gene expression mechanisms using stochastic simulation

    Science.gov (United States)

    Daigle, Bernie J.; Soltani, Mohammad; Petzold, Linda R.; Singh, Abhyudai

    2015-01-01

    Motivation: Stochastic promoter switching between transcriptionally active (ON) and inactive (OFF) states is a major source of noise in gene expression. It is often implicitly assumed that transitions between promoter states are memoryless, i.e. promoters spend an exponentially distributed time interval in each of the two states. However, increasing evidence suggests that promoter ON/OFF times can be non-exponential, hinting at more complex transcriptional regulatory architectures. Given the essential role of gene expression in all cellular functions, efficient computational techniques for characterizing promoter architectures are critically needed. Results: We have developed a novel model reduction for promoters with arbitrary numbers of ON and OFF states, allowing us to approximate complex promoter switching behavior with Weibull-distributed ON/OFF times. Using this model reduction, we created bursty Monte Carlo expectation-maximization with modified cross-entropy method (‘bursty MCEM2’), an efficient parameter estimation and model selection technique for inferring the number and configuration of promoter states from single-cell gene expression data. Application of bursty MCEM2 to data from the endogenous mouse glutaminase promoter reveals nearly deterministic promoter OFF times, consistent with a multi-step activation mechanism consisting of 10 or more inactive states. Our novel approach to modeling promoter fluctuations together with bursty MCEM2 provides powerful tools for characterizing transcriptional bursting across genes under different environmental conditions. Availability and implementation: R source code implementing bursty MCEM2 is available upon request. Contact: absingh@udel.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573914

  11. Effects of resistin-like molecule β over-expression on gastric cancer cells in vitro

    Institute of Scientific and Technical Information of China (English)

    Li-Duan Zheng; Chun-Lei Yang; Teng Qi; Meng Qi; Ling Tong; Qiang-Song Tong

    2012-01-01

    AIM:To investigate the effects of resistin-like molecule β (RELMβ) over-expression on the invasion,metastasis and angiogenesis of gastric cancer cells.METHODS:Human RELMβ encoding expression vector was constructed and transfected into the RELMβ lowly-expressed gastric cancer cell lines SGC-7901 and MKN-45.Gene expression was measured by Western blotting,reverse transcription polymerase chain reaction (PCR) and real-time quantitative PCR.Cell proliferation was measured by 2-(4,5-dimethyltriazol-2-yl)-2,5-diphenyl tetrazolium bromide colorimetry,colony formation and 5-ethynyl-20-deoxyuridine incorporation assays.The in vitro migration,invasion and metastasis of cancer cells were measured by cell adhesion assay,scratch assay and matrigel invasion assay.The angiogenic capabilities of cancer cells were measured by tube formation of endothelial cells.RESULTS:Transfection of RELMβ vector into SGC-7901 and MKN-45 cells resulted in over-expression of RELMβ,which did not influence the cellular proliferation.However,over-expression of RELMβ suppressed the in vitro adhesion,invasion and metastasis of cancer cells,accompanied by decreased expression of matrix metalloproteinase-2 (MMP-2) and MMP-9.Moreover,transfection of RELMβ attenuated the expression of vascular endothelial growth factor and in vitro angiogenic capabilities of cancer cells.CONCLUSION:Over-expression of RELMβ abolishes the invasion,metastasis and angiogenesis of gastric cancer cells in vitro,suggesting its potentials as a novel therapeutic target for gastric cancer.

  12. Lineage-specific expression of bestrophin-2 and bestrophin-4 in human intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Go Ito

    Full Text Available Intestinal epithelial cells (IECs regulate the absorption and secretion of anions, such as HCO3(- or Cl(-. Bestrophin genes represent a newly identified group of calcium-activated Cl(- channels (CaCCs. Studies have suggested that, among the four human bestrophin-family genes, bestrophin-2 (BEST2 and bestrophin-4 (BEST4 might be expressed within the intestinal tissue. Consistently, a study showed that BEST2 is expressed by human colonic goblet cells. However, their precise expression pattern along the gastrointestinal tract, or the lineage specificity of the cells expressing these genes, remains largely unknown. Here, we show that BEST2 and BEST4 are expressed in vivo, each in a distinct, lineage-specific manner, in human IECs. While BEST2 was expressed exclusively in colonic goblet cells, BEST4 was expressed in the absorptive cells of both the small intestine and the colon. In addition, we found that BEST2 expression is significantly down-regulated in the active lesions of ulcerative colitis, where goblet cells were depleted, suggesting that BEST2 expression is restricted to goblet cells under both normal and pathologic conditions. Consistently, the induction of goblet cell differentiation by a Notch inhibitor, LY411575, significantly up-regulated the expression of not BEST4 but BEST2 in MUC2-positive HT-29 cells. Conversely, the induction of absorptive cell differentiation up-regulated the expression of BEST4 in villin-positive Caco-2 cells. In addition, we found that the up- or down-regulation of Notch activity leads to the preferential expression of either BEST4 or BEST2, respectively, in LS174T cells. These results collectively confirmed that BEST2 and BEST4 could be added to the lineage-specific genes of humans IECs due to their abilities to clearly identify goblet cells of colonic origin and a distinct subset of absorptive cells, respectively.

  13. Induction of pancreatic β cell gene expression in mesenchymal stem cells.

    Science.gov (United States)

    Mehrfarjam, Zahra; Esmaeili, Fariba; Shabani, Leila; Ebrahimie, Esmaeil

    2016-05-01

    Transdifferentiattion potential of mesenchymal stem cells (MSCs) into insulin-producing cells (IPCs) has been suggested recently. In our recent works, we demonstrated the high performance of mouse neonate pancreas extract (MPE) in the production of functional IPCs from carcinoma stem cells. In this study, MPE was used to generate IPCs from MSCs without any genetic manipulation. To this end, bone marrow MSCs were isolated and characterized. In order to differentiate, MSCs were induced by selection of nestin-expressing cells and treatment with 100 μg/mL MPE. Morphological features of the differenti-ated cells were confirmed by dithizone staining. Immunoreactivity to insulin receptor beta, proinsulin, insulin, and C-peptide was observed by immunoflourescence. We also quantified glucose-dependent insulin production and secretion by ELISA. Real-time PCR indicated the expressions of β cell-related genes, PDX-1, INS1, INS2, EP300, and CREB1, in IPC cells. Possible pathways governed by CREB1, EP300, and PDX-1 transcription factors in differentiation of MSCs to IPCs were determined based on Gene Set Enrichment (GSE) approach at P = 0.05. Pathway discovery highlighted the negative regulatory effects of MIR124-2, HDAC5 protein, REST, and NR0B2 transcription factors on expression of CREB1, EP300, and PDX-1 and inhabitation of IPC differentiations. In contrast, a crosstalk between FOXA2 and TCF7L2 transcription factors, DNA-PK complex, KAT2B protein positively interacting with PDX-1, CREB1, EP300 resulted in the induction of IPC and following insulin production. In conclusion, we report an efficient, simple, and easy method for production of functional IPCs from MSCs by MPE treatment. PMID:26634639

  14. Altered Gene Expressions and Cytogenetic Repair Efficiency in Cells with Suppressed Expression of XPA after Proton Exposure

    Science.gov (United States)

    Zhang, Ye; Rohde, Larry H.; Gridley, Daila S.; Mehta, Satish K.; Pierson, Duane L.; Wu, Honglu

    2009-01-01

    Cellular responses to damages from ionizing radiation (IR) exposure are influenced not only by the genes involved in DNA double strand break (DSB) repair, but also by non- DSB repair genes. We demonstrated previously that suppressed expression of several non-DSB repair genes, such as XPA, elevated IR-induced cytogenetic damages. In the present study, we exposed human fibroblasts that were treated with control or XPA targeting siRNA to 250 MeV protons (0 to 4 Gy), and analyzed chromosome aberrations and expressions of genes involved in DNA repair. As expected, after proton irradiation, cells with suppressed expression of XPA showed a significantly elevated frequency of chromosome aberrations compared with control siRNA treated (CS) cells. Protons caused more severe DNA damages in XPA knock-down cells, as 36% cells contained multiple aberrations compared to 25% in CS cells after 4Gy proton irradiation. Comparison of gene expressions using the real-time PCR array technique revealed that expressions of p53 and its regulated genes in irradiated XPA suppressed cells were altered similarly as in CS cells, suggesting that the impairment of IR induced DNA repair in XPA suppressed cells is p53-independent. Except for XPA, which was more than 2 fold down regulated in XPA suppressed cells, several other DNA damage sensing and repair genes (GTSE1, RBBP8, RAD51, UNG and XRCC2) were shown a more than 1.5 fold difference between XPA knock-down cells and CS cells after proton exposure. The possible involvement of these genes in the impairment of DNA repair in XPA suppressed cells will be further investigated.

  15. Elucidating the Kinetics of Expression and Immune Cell Infiltration Resulting from Plasmid Gene Delivery Enhanced by Surface Dermal Electroporation

    Directory of Open Access Journals (Sweden)

    Kate E. Broderick

    2013-08-01

    Full Text Available The skin is an attractive tissue for vaccination in a clinical setting due to the accessibility of the target, the ease of monitoring and most importantly the immune competent nature of the dermal tissue. While skin electroporation offers an exciting and novel future methodology for the delivery of DNA vaccines in the clinic, little is known about the actual mechanism of the approach and the elucidation of the resulting immune responses. To further understand the mechanism of this platform, the expression kinetics and localization of a reporter plasmid delivered via a surface dermal electroporation (SEP device as well as the effect that this treatment would have on the resident immune cells in that tissue was investigated. Initially a time course (day 0 to day 21 of enhanced gene delivery with electroporation (EP was performed to observe the localization of green fluorescent protein (GFP expression and the kinetics of its appearance as well as clearance. Using gross imaging, GFP expression was not detected on the surface of the skin until 8 h post treatment. However, histological analysis by fluorescent microscopy revealed GFP positive cells as early as 1 h after plasmid delivery and electroporation. Peak GFP expression was observed at 24 h and the expression was maintained in skin for up to seven days. Using an antibody specific for a keratinocyte cell surface marker, reporter gene positive keratinocytes in the epidermis were identified. H&E staining of treated skin sections demonstrated an influx of monocytes and granulocytes at the EP site starting at 4 h and persisting up to day 14 post treatment. Immunological staining revealed a significant migration of lymphocytic cells to the EP site, congregating around cells expressing the delivered antigen. In conclusion, this study provides insights into the expression kinetics following EP enhanced DNA delivery targeting the dermal space. These findings may have implications in the future to design

  16. High expression of hTERT and stemness genes in BORIS/CTCFL positive cells isolated from embryonic cancer cells.

    Directory of Open Access Journals (Sweden)

    Loredana Alberti

    Full Text Available BORIS/CTCFL is a member of cancer testis antigen family normally expressed in germ cells. In tumors, it is aberrantly expressed although its functions are not completely well-defined. To better understand the functions of BORIS in cancer, we selected the embryonic cancer cells as a model. Using a molecular beacon, which specifically targets BORIS mRNA, we demonstrated that BORIS positive cells are a small subpopulation of tumor cells (3-5% of total. The BORIS-positive cells isolated using BORIS-molecular beacon, expressed higher telomerase hTERT, stem cell (NANOG, OCT4, SOX2 and cancer stem cell marker genes (CD44 and ALDH1 compared to the BORIS-negative tumor cells. In order to define the functional role of BORIS, stable BORIS-depleted embryonic cancer cells were generated. BORIS silencing strongly down-regulated the expression of hTERT, stem cell and cancer stem cell marker genes. Moreover, the BORIS knockdown increased cellular senescence in embryonic cancer cells, revealing a putative role of BORIS in the senescence biological program. Our data indicate an association of BORIS expressing cells subpopulation with the expression of stemness genes, highlighting the critical role played by BORIS in embryonic neoplastic disease.

  17. Ezh2 Expression in Astrocytes Induces Their Dedifferentiation Toward Neural Stem Cells

    NARCIS (Netherlands)

    Sher, Falak; Boddeke, Erik; Copray, Sjef

    2011-01-01

    Recently, we have demonstrated the expression of the polycomb group protein Ezh2 in embryonic and adult neural stem cells. Although Ezh2 remained highly expressed when neural stem cells differentiate into oligodendrocyte precursor cells, it is downregulated during the differentiation into neurons or

  18. Single-cell differences in matrix gene expression do not predict matrix deposition

    OpenAIRE

    Cote, Allison J.; McLeod, Claire M.; Farrell, Megan J.; McClanahan, Patrick D.; Dunagin, Margaret C.; Raj, Arjun; Mauck, Robert L.

    2016-01-01

    Mesenchymal stem cells (MSCs) display substantial cell-to-cell heterogeneity, complicating their use in regenerative medicine. However, conventional bulk assays mask this variability. Here we show that both chondrocytes and chondrogenically induced MSCs exhibit substantial mRNA expression heterogeneity. Single-molecule RNA FISH to measure mRNA expression of differentiation markers in single cells reveals that sister cell pairs have high levels of mRNA variability, suggesting that marker expre...

  19. Tracking neuronal marker expression inside living differentiating cells using molecular beacons

    DEFF Research Database (Denmark)

    Ilieva, Mirolyuba; Della Vedova, Paolo; Hansen, Ole;

    2013-01-01

    Monitoring gene expression is an important tool for elucidating mechanisms of cellular function. In order to monitor gene expression during nerve cell development, molecular beacon (MB) probes targeting markers representing different stages of neuronal differentiation were designed and synthesized...

  20. Strong Expression of Chemokine Receptor CXCR4 by Renal Cell Carcinoma Correlates with Advanced Disease

    Directory of Open Access Journals (Sweden)

    Thomas C. Wehler

    2008-01-01

    Full Text Available Diverse chemokines and their receptors have been associated with tumor growth, tumor dissemination, and local immune escape. In different tumor entities, the level of chemokine receptor CXCR4 expression has been linked with tumor progression and decreased survival. The aim of this study was to evaluate the influence of CXCR4 expression on the progression of human renal cell carcinoma. CXCR4 expression of renal cell carcinoma was assessed by immunohistochemistry in 113 patients. Intensity of CXCR4 expression was correlated with both tumor and patient characteristics. Human renal cell carcinoma revealed variable intensities of CXCR4 expression. Strong CXCR4 expression of renal cell carcinoma was significantly associated with advanced T-status (P=.039, tumor dedifferentiation (P = .0005, and low hemoglobin (P = .039. In summary, strong CXCR4 expression was significantly associated with advanced dedifferentiated renal cell carcinoma.

  1. Gene expression profiling in multipotent DFAT cells derived from mature adipocytes

    International Nuclear Information System (INIS)

    Highlights: → Adipocyte dedifferentiation is evident in a significant decrease in typical genes. → Cell proliferation is strongly related to adipocyte dedifferentiation. → Dedifferentiated adipocytes express several lineage-specific genes. → Comparative analyses using publicly available datasets boost the interpretation. -- Abstract: Cellular dedifferentiation signifies the withdrawal of cells from a specific differentiated state to a stem cell-like undifferentiated state. However, the mechanism of dedifferentiation remains obscure. Here we performed comparative transcriptome analyses during dedifferentiation in mature adipocytes (MAs) to identify the transcriptional signatures of multipotent dedifferentiated fat (DFAT) cells derived from MAs. Using microarray systems, we explored similarly expressed as well as significantly differentially expressed genes in MAs during dedifferentiation. This analysis revealed significant changes in gene expression during this process, including a significant reduction in expression of genes for lipid metabolism concomitantly with a significant increase in expression of genes for cell movement, cell migration, tissue developmental processes, cell growth, cell proliferation, cell morphogenesis, altered cell shape, and cell differentiation. Our observations indicate that the transcriptional signatures of DFAT cells derived from MAs are summarized in terms of a significant decrease in functional phenotype-related genes and a parallel increase in cell proliferation, altered cell morphology, and regulation of the differentiation of related genes. A better understanding of the mechanisms involved in dedifferentiation may enable scientists to control and possibly alter the plasticity of the differentiated state, which may lead to benefits not only in stem cell research but also in regenerative medicine.

  2. Gene expression profiling in multipotent DFAT cells derived from mature adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ono, Hiromasa [Laboratory of Cell and Tissue Biology, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510 (Japan); Database Center for Life Science (DBCLS), Research Organization of Information and Systems (ROIS), Faculty of Engineering Bldg.12 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Oki, Yoshinao [Laboratory of Cell and Tissue Biology, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510 (Japan); Bono, Hidemasa [Database Center for Life Science (DBCLS), Research Organization of Information and Systems (ROIS), Faculty of Engineering Bldg.12 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Kano, Koichiro, E-mail: kkano@brs.nihon-u.ac.jp [Laboratory of Cell and Tissue Biology, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510 (Japan)

    2011-04-15

    Highlights: {yields} Adipocyte dedifferentiation is evident in a significant decrease in typical genes. {yields} Cell proliferation is strongly related to adipocyte dedifferentiation. {yields} Dedifferentiated adipocytes express several lineage-specific genes. {yields} Comparative analyses using publicly available datasets boost the interpretation. -- Abstract: Cellular dedifferentiation signifies the withdrawal of cells from a specific differentiated state to a stem cell-like undifferentiated state. However, the mechanism of dedifferentiation remains obscure. Here we performed comparative transcriptome analyses during dedifferentiation in mature adipocytes (MAs) to identify the transcriptional signatures of multipotent dedifferentiated fat (DFAT) cells derived from MAs. Using microarray systems, we explored similarly expressed as well as significantly differentially expressed genes in MAs during dedifferentiation. This analysis revealed significant changes in gene expression during this process, including a significant reduction in expression of genes for lipid metabolism concomitantly with a significant increase in expression of genes for cell movement, cell migration, tissue developmental processes, cell growth, cell proliferation, cell morphogenesis, altered cell shape, and cell differentiation. Our observations indicate that the transcriptional signatures of DFAT cells derived from MAs are summarized in terms of a significant decrease in functional phenotype-related genes and a parallel increase in cell proliferation, altered cell morphology, and regulation of the differentiation of related genes. A better understanding of the mechanisms involved in dedifferentiation may enable scientists to control and possibly alter the plasticity of the differentiated state, which may lead to benefits not only in stem cell research but also in regenerative medicine.

  3. Molecular mechanisms involved in casein gene expression and secretion in mouse mammary epithelial cells

    International Nuclear Information System (INIS)

    Mouse mammary epithelial cells (MMEC) secrete a group of milk-specific proteins including various caseins and whey proteins. Dissociated mammary epithelial cells maintain expression of most of their differentiated functions only if cells are plated on a suitable substratum. Casein production and section, cell morphology, and production of α-lactalbumin have been used as markers to assess the degree of differentiation of mammary cells in culture. The general consensus is that cells express their differentiated properties at high levels and for longer periods of time on such substrata. In this paper, the authors demonstrate that modulation of the expression of caseins by floating collagen gels is manifested at several regulatory points

  4. Microarray Gene Expression Analysis to Evaluate Cell Type Specific Expression of Targets Relevant for Immunotherapy of Hematological Malignancies

    Science.gov (United States)

    Honders, M. W.; Kremer, A. N.; van Kooten, C.; Out, C.; Hiemstra, P. S.; de Boer, H. C.; Jager, M. J.; Schmelzer, E.; Vries, R. G.; Al Hinai, A. S.; Kroes, W. G.; Monajemi, R.; Goeman, J. J.; Böhringer, S.; Marijt, W. A. F.; Falkenburg, J. H. F.; Griffioen, M.

    2016-01-01

    Cellular immunotherapy has proven to be effective in the treatment of hematological cancers by donor lymphocyte infusion after allogeneic hematopoietic stem cell transplantation and more recently by targeted therapy with chimeric antigen or T-cell receptor-engineered T cells. However, dependent on the tissue distribution of the antigens that are targeted, anti-tumor responses can be accompanied by undesired side effects. Therefore, detailed tissue distribution analysis is essential to estimate potential efficacy and toxicity of candidate targets for immunotherapy of hematological malignancies. We performed microarray gene expression analysis of hematological malignancies of different origins, healthy hematopoietic cells and various non-hematopoietic cell types from organs that are often targeted in detrimental immune responses after allogeneic stem cell transplantation leading to graft-versus-host disease. Non-hematopoietic cells were also cultured in the presence of IFN-γ to analyze gene expression under inflammatory circumstances. Gene expression was investigated by Illumina HT12.0 microarrays and quality control analysis was performed to confirm the cell-type origin and exclude contamination of non-hematopoietic cell samples with peripheral blood cells. Microarray data were validated by quantitative RT-PCR showing strong correlations between both platforms. Detailed gene expression profiles were generated for various minor histocompatibility antigens and B-cell surface antigens to illustrate the value of the microarray dataset to estimate efficacy and toxicity of candidate targets for immunotherapy. In conclusion, our microarray database provides a relevant platform to analyze and select candidate antigens with hematopoietic (lineage)-restricted expression as potential targets for immunotherapy of hematological cancers. PMID:27171398

  5. Microarray Gene Expression Analysis to Evaluate Cell Type Specific Expression of Targets Relevant for Immunotherapy of Hematological Malignancies.

    Directory of Open Access Journals (Sweden)

    M J Pont

    Full Text Available Cellular immunotherapy has proven to be effective in the treatment of hematological cancers by donor lymphocyte infusion after allogeneic hematopoietic stem cell transplantation and more recently by targeted therapy with chimeric antigen or T-cell receptor-engineered T cells. However, dependent on the tissue distribution of the antigens that are targeted, anti-tumor responses can be accompanied by undesired side effects. Therefore, detailed tissue distribution analysis is essential to estimate potential efficacy and toxicity of candidate targets for immunotherapy of hematological malignancies. We performed microarray gene expression analysis of hematological malignancies of different origins, healthy hematopoietic cells and various non-hematopoietic cell types from organs that are often targeted in detrimental immune responses after allogeneic stem cell transplantation leading to graft-versus-host disease. Non-hematopoietic cells were also cultured in the presence of IFN-γ to analyze gene expression under inflammatory circumstances. Gene expression was investigated by Illumina HT12.0 microarrays and quality control analysis was performed to confirm the cell-type origin and exclude contamination of non-hematopoietic cell samples with peripheral blood cells. Microarray data were validated by quantitative RT-PCR showing strong correlations between both platforms. Detailed gene expression profiles were generated for various minor histocompatibility antigens and B-cell surface antigens to illustrate the value of the microarray dataset to estimate efficacy and toxicity of candidate targets for immunotherapy. In conclusion, our microarray database provides a relevant platform to analyze and select candidate antigens with hematopoietic (lineage-restricted expression as potential targets for immunotherapy of hematological cancers.

  6. Light induces Fos expression via extracellular signal-regulated kinases 1/2 in melanopsin-expressing PC12 cells

    DEFF Research Database (Denmark)

    Moldrup, Marie-Louise Bülow; Georg, Birgitte; Falktoft, Birgitte;

    2010-01-01

    The photopigment melanopsin is expressed in a subtype of mammalian ganglion cells in the retina that project to the circadian clock in the hypothalamic suprachiasmatic nucleus to mediate non-visual light information. Melanopsin renders these retinal ganglion cells intrinsically photosensitive and...

  7. Expression of Podoplanin in Different Grades of Oral Squamous Cell Carcinoma

    OpenAIRE

    PRASAD, B.; Kashyap, B; Babu, GS; Kumar, GR; Manyam, R

    2015-01-01

    Background: The expression of podoplanin is up-regulated in a number of different human cancers, including squamous cell carcinoma of the oral cavity and its relationship with tumor invasion raises the possibility that podoplanin expression could be used as a biomarker for diagnosis and prognosis. Aim: The aim of the present study is to evaluate the expression of podoplanin in different grades of squamous cell carcinoma (SCC) and to correlate the expression of podoplanin with relevant clinica...

  8. Construction and identification of eukaryotic eukaryotic expression plasmid pcdna3.1-bace and its transient expression in cells

    Institute of Scientific and Technical Information of China (English)

    Huilin Gong; Guanjun Zhang; Weijiang Dong

    2006-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3.1-BACE and obtain its transient expression in COS-7 cells and high expression in the neuroblastoma SK-N-SH cells. Methods: A 1503 bp cDNA fragment was amplified from the total RNA of human neuroblastoma by RT-PCR method and cloned into plasmid pcDNA3.1. The vector was identified by digestion with restriction enzymes BamHI and XhoI and sequenced by Sanger-dideoxy-mediated chain termination. The expression of BACE gene was detected by immunocytochemistry method. Results: The results showed that the cDNAfragment included 1503 bp total coding region. The recombinant eukaryotic cell expression vector of pcDNA3.1-BACE was constructed successfully,and the sequence of insert was identical to the published sequence. The COS-7 cells and the neuroblastoma SK-N-SH cells transfected with the pcDNA3.1-BACE plasmid expressed high level of BACE protein in cytoplasm. Conclusion: The recombinant plasmid pcDNA3.1-BACE can provide very useful tool for researching the reason of Alzheimer's disease and lays the important foundation for preventing the AD laterly.

  9. Putative cis-regulatory elements in genes highly expressed in rice sperm cells

    Directory of Open Access Journals (Sweden)

    Singh Mohan B

    2011-09-01

    Full Text Available Abstract Background The male germ line in flowering plants is initiated within developing pollen grains via asymmetric division. The smaller cell then becomes totally encased within a much larger vegetative cell, forming a unique "cell within a cell structure". The generative cell subsequently divides to give rise to two non-motile diminutive sperm cells, which take part in double fertilization and lead to the seed set. Sperm cells are difficult to investigate because of their presence within the confines of the larger vegetative cell. However, recently developed techniques for the isolation of rice sperm cells and the fully annotated rice genome sequence have allowed for the characterization of the transcriptional repertoire of sperm cells. Microarray gene expression data has identified a subset of rice genes that show unique or highly preferential expression in sperm cells. This information has led to the identification of cis-regulatory elements (CREs, which are conserved in sperm-expressed genes and are putatively associated with the control of cell-specific expression. Findings We aimed to identify the CREs associated with rice sperm cell-specific gene expression data using in silico prediction tools. We analyzed 1-kb upstream regions of the top 40 sperm cell co-expressed genes for over-represented conserved and novel motifs. Analysis of upstream regions with the SIGNALSCAN program with the PLACE database, MEME and the Mclip tool helped to find combinatorial sets of known transcriptional factor-binding sites along with two novel motifs putatively associated with the co-expression of sperm cell-specific genes. Conclusions Our data shows the occurrence of novel motifs, which are putative CREs and are likely targets of transcriptional factors regulating sperm cell gene expression. These motifs can be used to design the experimental verification of regulatory elements and the identification of transcriptional factors that regulate sperm cell

  10. NKT cell-TCR expression activates conventional T cells in vivo, but is largely dispensable for mature NKT cell biology.

    Directory of Open Access Journals (Sweden)

    J Christoph Vahl

    Full Text Available Natural killer T (NKT cell development depends on recognition of self-glycolipids via their semi-invariant Vα14i-TCR. However, to what extent TCR-mediated signals determine identity and function of mature NKT cells remains incompletely understood. To address this issue, we developed a mouse strain allowing conditional Vα14i-TCR expression from within the endogenous Tcrα locus. We demonstrate that naïve T cells are activated upon replacement of their endogenous TCR repertoire with Vα14i-restricted TCRs, but they do not differentiate into NKT cells. On the other hand, induced TCR ablation on mature NKT cells did not affect their lineage identity, homeostasis, or innate rapid cytokine secretion abilities. We therefore propose that peripheral NKT cells become unresponsive to and thus are independent of their autoreactive TCR.

  11. Expression of hepatitis C virus envelope protein 2 induces apoptosis in cultured mammalian cells

    Institute of Scientific and Technical Information of China (English)

    Li-Xin Zhu; Jing Liu; You-Hua Xie; Yu-Ying Kong; Ye Ye; Chun-Lin Wang; Guang-Di Li; Yuan Wang

    2004-01-01

    AIM: To explore the role of hepatitis C virus (HCV) envelope protein 2 (E2) in the induction of apoptosis.METHODS: A carboxyterminal truncated E2 (E2-661) was transiently expressed in several cultured mammalian cell lines or stably expressed in Chinese hamster ovary (CHO)cell line. Cell proliferation was assessed by 3H thymidine uptake. Apoptosis was examined by Hoechst 33258staining, flow cytometry and DNA fragmentation analysis.RESULTS: Reduced proliferation was readily observed in the E2-661 expressing cells. These cells manifested the typical features of apoptosis, including cell shrinkage,chromatin condensation and hypodiploid genomic DNA content. Similar apoptotic cell death was observed in an E2-661 stably expressing cell line.CONCLUSION: HCV E2 can induce apoptosis in cultured mammalian cells.

  12. Tat protein expression in MDBK cells does not confer susceptibility to bovine immunodeficiency virus.

    Science.gov (United States)

    Kempster, S; Collins, M E; Brownlie, J

    2002-03-01

    The ability of BIV strain R29 to infect bovine cell lines in the presence or absence of a functional lentiviral Tat protein is described. Jembrana disease virus (JDV) Tat protein was stably expressed in MDBK cells. No viral replication could be detected in this cell line after infection with BIV R29. Transfection of MDBK cells and MDBK Tat expressing cells with BIV R29 proviral DNA established that BIV R29 could not replicate in MDBK cells. Whether viral entry into MDBK cells is also a block to BIV R29 infection of MDBK cells has yet to be established.

  13. Cell-surface expression of Hsp70 on hematopoietic cancer cells after inhibition of HDAC activity

    DEFF Research Database (Denmark)

    Jensen, Helle

    The function of Hsp70 depends on its cellular location: When located intracellularly it exerts cytoprotective and anti-apoptotic functions, whereas it exerts immunostimulatory functions when located extracellularly. Secreted Hsp70 is for example involved in cross-presentation of cancer-derived an......The function of Hsp70 depends on its cellular location: When located intracellularly it exerts cytoprotective and anti-apoptotic functions, whereas it exerts immunostimulatory functions when located extracellularly. Secreted Hsp70 is for example involved in cross-presentation of cancer......-derived antigenic peptides, a function which is currently explored in immunotherapeutic approaches against cancer. Additionally, membrane-bound Hsp70 can stimulate antigen presenting cells to release proinflammatory cytokines and can provide a target structure for NK cell-mediated lysis. Human cancer cells...... frequently express Hsp70 on their cell surface, whereas the corresponding normal tissues do not. In addition, several clinically applied reagents, such as alkyl-lysophospholipides, chemotherapeutic agents, and anti-inflammatory reagents, have been found to enhance Hsp70 cell surface expression on cancer...

  14. Apposition of iroquois expressing and non-expressing cells leads to cell sorting and fold formation in the Drosophila imaginal wing disc

    Directory of Open Access Journals (Sweden)

    González-Pérez Esther

    2007-09-01

    Full Text Available Abstract Background The organization of the different tissues of an animal requires mechanisms that regulate cell-cell adhesion to promote and maintain the physical separation of adjacent cell populations. In the Drosophila imaginal wing disc the iroquois homeobox genes are expressed in the notum anlage and contribute to the specification of notum identity. These genes are not expressed in the adjacent wing hinge territory. These territories are separated by an approximately straight boundary that in the mature disc is associated with an epithelial fold. The mechanism by which these two cell populations are kept separate is unclear. Results Here we show that the Iro-C genes participate in keeping the notum and wing cell populations separate. Indeed, within the notum anlage, cells not expressing Iro-C tend to join together and sort out from their Iro-C expressing neighbours. We also show that apposition of Iro-C expressing and non-expressing cells induces invagination and apico-basal shortening of the Iro-C- cells. This effect probably underlies formation of the fold that separates the notum and wing hinge territories. In addition, cells overexpressing a member of the Iro-C contact one another and become organized in a network of thin strings that surrounds and isolates large groups of non-overexpressing cells. The strings appear to exert a pulling force along their longitudinal axis. Conclusion Apposition of cells expressing and non-expressing the Iro-C, as it occurs in the notum-wing hinge border of the Drosophila wing disc, influences cell behaviour. It leads to cell sorting, and cellular invagination and apical-basal shortening. These effects probably account for keeping the prospective notum and wing hinge cell populations separate and underlie epithelial fold formation. Cells that overexpress a member of the Iro-C and that confront non-expressing cells establish contacts between themselves and become organized in a network of thin strings

  15. Novel insights of the gastric gland organization revealed by chief cell specific expression of moesin

    Science.gov (United States)

    Zhu, Lixin; Hatakeyama, Jason; Zhang, Bing; Makdisi, Joy; Ender, Cody; Forte, John G.

    2009-01-01

    ERM (ezrin, radixin, and moesin) proteins play critical roles in epithelial and endothelial cell polarity, among other functions. In gastric glands, ezrin is mainly expressed in acid-secreting parietal cells, but not in mucous neck cells or zymogenic chief cells. In looking for other ERM proteins, moesin was found lining the lumen of much of the gastric gland, but it was not expressed in parietal cells. No significant radixin expression was detected in the gastric glands. Moesin showed an increased gradient of expression from the neck to the base of the glands. In addition, the staining pattern of moesin revealed a branched morphology for the gastric lumen. This pattern of short branches extending from the glandular lumen was confirmed by using antibody against zonula occludens-1 (ZO-1) to stain tight junctions. With a mucous neck cell probe (lectin GSII, from Griffonia simplicifolia) and a chief cell marker (pepsinogen C), immunohistochemistry revealed that the mucous neck cells at the top of the glands do not express moesin, but, progressing toward the base, mucous cells showing decreased GSII staining had low or moderate level of moesin expression. The level of moesin expression continued to increase toward the base of the glands and reached a plateau in the base where chief cells and parietal cells abound. The level of pepsinogen expression also increased toward the base. Pepsinogen C was located on cytoplasmic granules and/or more generally distributed in chief cells, whereas moesin was exclusively expressed on the apical membrane. This is a clear demonstration of distinctive cellular expression of two ERM family members in the same tissue. The results provide the first evidence that moesin is involved in the cell biology of chief cells. Novel insights on gastric gland morphology revealed by the moesin and ZO-1 staining provide the basis for a model of cell maturation and migration within the gland. PMID:19074636

  16. Novel insights of the gastric gland organization revealed by chief cell specific expression of moesin.

    Science.gov (United States)

    Zhu, Lixin; Hatakeyama, Jason; Zhang, Bing; Makdisi, Joy; Ender, Cody; Forte, John G

    2009-02-01

    ERM (ezrin, radixin, and moesin) proteins play critical roles in epithelial and endothelial cell polarity, among other functions. In gastric glands, ezrin is mainly expressed in acid-secreting parietal cells, but not in mucous neck cells or zymogenic chief cells. In looking for other ERM proteins, moesin was found lining the lumen of much of the gastric gland, but it was not expressed in parietal cells. No significant radixin expression was detected in the gastric glands. Moesin showed an increased gradient of expression from the neck to the base of the glands. In addition, the staining pattern of moesin revealed a branched morphology for the gastric lumen. This pattern of short branches extending from the glandular lumen was confirmed by using antibody against zonula occludens-1 (ZO-1) to stain tight junctions. With a mucous neck cell probe (lectin GSII, from Griffonia simplicifolia) and a chief cell marker (pepsinogen C), immunohistochemistry revealed that the mucous neck cells at the top of the glands do not express moesin, but, progressing toward the base, mucous cells showing decreased GSII staining had low or moderate level of moesin expression. The level of moesin expression continued to increase toward the base of the glands and reached a plateau in the base where chief cells and parietal cells abound. The level of pepsinogen expression also increased toward the base. Pepsinogen C was located on cytoplasmic granules and/or more generally distributed in chief cells, whereas moesin was exclusively expressed on the apical membrane. This is a clear demonstration of distinctive cellular expression of two ERM family members in the same tissue. The results provide the first evidence that moesin is involved in the cell biology of chief cells. Novel insights on gastric gland morphology revealed by the moesin and ZO-1 staining provide the basis for a model of cell maturation and migration within the gland. PMID:19074636

  17. Inhibition of LINE-1 retrotransposon-encoded reverse transcriptase modulates the expression of cell differentiation genes in breast cancer cells.

    Science.gov (United States)

    Patnala, Radhika; Lee, Sung-Hun; Dahlstrom, Jane E; Ohms, Stephen; Chen, Long; Dheen, S Thameem; Rangasamy, Danny

    2014-01-01

    Long Interspersed Elements (L1 elements) are biologically active retrotransposons that are capable of autonomous replication using their own reverse transcriptase (RT) enzyme. Expression of the normally repressed RT has been implicated in cancer cell growth. However, at present, little is known about the expression of L1-encoded RT activity or the molecular changes that are associated with RT activity in the development of breast cancer. Here, we report that RT activity is widespread in breast cancer cells. The expression of RT protein decreased markedly in breast cancer cells after treatment with the antiretroviral drug, efavirenz. While the majority of cells showed a significant reduction in proliferation, inhibition of RT was also accompanied by cell-specific differences in morphology. MCF7 cells displayed elongated microtubule extensions that adhered tightly to their substrate, while a large fraction of the T47D cells that we studied formed long filopodia projections. These morphological changes were reversible upon cessation of RT inhibition, confirming their dependence on RT activity. We also carried out gene expression profiling with microarrays and determined the genes that were differentially expressed during the process of cellular differentiation. Genes involved in proliferation, cell migration, and invasive activity were repressed in RT-inhibited cells. Concomitantly, genes involved in cell projection, formation of vacuolar membranes, and cell-to-cell junctions were significantly upregulated in RT-inhibited cells. qRT-PCR examination of the mRNA expression of these genes in additional cell lines yielded close correlation between their differential expression and the degree of cellular differentiation. Our study demonstrates that the inhibition of L1-encoded RT can reduce the rate of proliferation and promote differentiation of breast cancer cells. Together, these results provide a direct functional link between the expression of L1 retrotransposons and

  18. Terpinolene, a component of herbal sage, downregulates AKT1 expression in K562 cells

    OpenAIRE

    Okumura, Naoko; Yoshida, Hitomi; Nishimura, Yuri; Kitagishi, Yasuko; Matsuda, Satoru

    2011-01-01

    Protein kinase AKT mediates cell proliferation and survival signals, and also contributes to cancer progression. Increased expression and/or activation of AKT is involved in a variety of human cancers. In cells treated with sage or rosemary extract, mRNA and protein expression levels of AKT1 were reduced compared with those of the control cells 48 h after the herbal treatments. We found that terpinolene, a common component of sage and rosemary, markedly reduced the protein expression of AKT1 ...

  19. Expression of a human placental alkaline phosphatase gene in transfected cells: Use as a reporter for studies of gene expression

    International Nuclear Information System (INIS)

    The human placental alkaline phosphatase gene has been cloned and reintroduced into mammalian cells. When a plasmid carrying the gene under control of the simian virus 40 early promoter (pSV2Apap) is transfected into a variety of different cell types, placental alkaline phosphatase activity can readily be detected by using whole cell suspensions or cell lysates. Alkaline phosphatase activity can also be visualized directly in individual transfected cells by histochemical staining. The gene is appropriate for use as a reporter in studies of gene regulation since its expression is dependent on the presence of exogenous transcription control elements. The overall assay to detect the expression of the gene is quantitative, very rapid, and inexpensive. Cotransfections of cells with pSV2Apap and a related plasmid carrying the bacterial chloramphenicol acetyltransferase gene (pSV2Acat) indicate that transcription of these two genes is detected with roughly the same sensitivity

  20. Neuroblastoma and pre-B lymphoma cells share expression of key transcription factors but display tissue restricted target gene expression

    International Nuclear Information System (INIS)

    Transcription factors are frequently involved in the process of cellular transformation, and many malignancies are characterized by a distinct genetic event affecting a specific transcription factor. This probably reflects a tissue specific ability of transcription factors to contribute to the generation of cancer but very little is known about the precise mechanisms that governs these restricted effects. To investigate this selectivity in target gene activation we compared the overall gene expression patterns by micro-array analysis and expression of target genes for the transcription factor EBF in lymphoma and neuroblastoma cells by RT-PCR. The presence of transcription factors in the different model cell lines was further investigated by EMSA analysis. In pre-B cells mb-1 and CD19 are regulate by EBF-1 in collaboration with Pax-5 and E-proteins. We here show that neuroblastoma cells express these three, for B cell development crucial transcription factors, but nevertheless fail to express detectable levels of their known target genes. Expression of mb-1 could, however, be induced in neuroblastoma cells after disruption of the chromatin structure by treatment with 5-azacytidine and Trichostatin A. These data suggest that transcription factors are able to selectively activate target genes in different tissues and that chromatin structure plays a key role in the regulation of this activity

  1. Construction and characteristics of a transformed lepidopteran cell clone expressing baculovirus p35

    Institute of Scientific and Technical Information of China (English)

    ZHENG Guiling; LI Changyou; LI Guoxun; WANG Ping; Robert R. Granados

    2005-01-01

    A transformed cell line was constructed from Mythimna separata cells Ms7311 by lipofection method. TMs7311 cells were generated using a double selection technique involving a selection in the antibiotic Zeocin, followed by a second round of selection by exhibiting cell characterization. A cell clone expressing p35 was obtained with high level of AcMNPV and recombinant proteins. Compared with wild type Ms7311 cells, the cell clone showed increased resistance to Actinamycin D-induced apoptosis and a profound resistance to nutrient development (PBS). When the cell clone was infected with recombinant baculoviruses expressing secreted alkaline phosphatase (SEAP) and β-galactosi- dase, expression of the recombinant proteins from TMs7311 cells exceeded that from parental Ms7311 cells. Production of budded virus and occlusion body was significantly higher than that from parental cells Ms7311.

  2. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M;

    1992-01-01

    demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  3. Changes of PIG3 Expression and Cell Cycle of AHH-1 Cells Induced by Fast Neutrons

    Institute of Scientific and Technical Information of China (English)

    SUI; Li; MA; Nan-ru; KONG; Fu-quan; WANG; Xiao; ZHANG; Xiao-ling; CHEN; Hong-tao

    2013-01-01

    Biological dosimeter has unique advantages for the detection of human body damage induced by nuclear radiation.PIG3 is DNA damage inducible gene located downstream of the p53(tumor suppressor gene),which appears at the early stage after radiation and is associated with cell apoptosis.PIG3expression can be measured by modern molecular biological technology and is suitable for quick doses

  4. Production of Antibodies against Multipass Membrane Proteins Expressed in Human Tumor Cells Using Dendritic Cell Immunization

    OpenAIRE

    Takahiko Tamura; Joe Chiba

    2009-01-01

    Antibody mediated therapeutic strategies against human malignant tumors have been widely authorized and clinically applied to cancer patients. In order to develop methods to generate antibodies reactive to the extracellular domains of multipass plasma membrane proteins specifically expressed in malignant tumors, we examined the use of dendritic cells (DCs) for immunization. DCs were transduced with genes encoding the human six transmembrane epithelial antigen of prostate 1 (STEAP1), STEAP4, a...

  5. Lack of FasL expression in cultured human retinal pigment epithelial cells

    DEFF Research Database (Denmark)

    Kaestel, C G; Madsen, H O; Prause, J U;

    2001-01-01

    Retinal pigment epithelial (RPE) cells have been proposed to play a part in maintaining the eye as an immune privileged organ. However, our knowledge of the implicated mechanism is still sparse. Fas ligand (FasL) expression of RPE cells is generally recognized to be essential for the immune...... privilege of the eye, but due to contradictory published results, it is unclear whether RPE cells express this molecule. The purpose of this study was to investigate the expression of FasL in RPE cells in vitro and in vivo. Cultured human fetal and adult RPE cells were examined by flow cytometry, Western...... blotting, RT-PCR and RNase Protection assay for FasL expression. Additionally, sections of ocular tissue were stained for FasL by immunohistochemistry. None of the used methods indicated FasL expression in cultured fetal or adult RPE cells of various passages. However, RPE cells in vivo, as judged from...

  6. The Expression of p53 and Cox-2 in Basal Cell Carcinoma, Squamous Cell Carcinoma and Actinic Keratosis Cases

    OpenAIRE

    Ülker KARAGECE YALÇIN; Selda SEÇKİN

    2012-01-01

    Objective: The aim of this study was to investigate p53 and COX-2 expressions in basal cell carcinoma, squamous cell carcinoma and actinic keratoses, and to determine a possible relationship.Material and Method: 50 basal cell carcinoma, 45 squamous cell carcinoma and 45 actinic keratosis cases were evaluated. The type of tumor in basal cell carcinoma and tumor differentiation in squamous cell carcinoma were noted and the paraffin block that best represented the tumor was chosen. Immunostainin...

  7. Expression of nucleostemin in prostate cancer and its effect on the proliferation of PC-3 cells

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Background Nucleostemin is essential for the proliferation and survival of stem and cancer cells,but it is unknown whether this newly identified molecule is involved in prostate cancer pathogenesis.Methods Total RNA and protein were extracted from prostate cancer tissues and PC-3,LNCap and DU145 cell lines.The nucleostemin mRNA and protein expression were measured by RT-PCR and Western blot.Immunohistochemistry was also used to detect the nucleostemin protein expression in prostate cancer tissues and PC-3 cells.A nucleostemin specific,short hairpin RNA,expression plasmid was used to transfect PC-3 cells.The changes of nucleostemin gene were detected and the proliferative capacity of the cells was determined.Results Nucleostemin was highly expressed in prostate cancer tissues and cell lines.Nucleostemin expression level in the silencer group PC-3 cells remarkably reduced.The proliferation rate of silencer group PC-3 cells decreased and the percentage of G1 stage cells increased.The neoplasm forming capacity in nude mice of the silencer group PC-3 cells decreased significantly.Conclusions Nucleostemin is highly expressed in prostate cancer tissues and cell lines.The proliferative capacity of PC-3 cells is remarkably reduced after silencing nucleostemin gene expression.

  8. Upregulation of HYAL1 expression in breast cancer promoted tumor cell proliferation, migration, invasion and angiogenesis.

    Directory of Open Access Journals (Sweden)

    Jin-Xiang Tan

    Full Text Available Hyaluronic acid (HA is a component of the Extra-cellular matrix (ECM, it is closely correlated with tumor cell growth, proliferation, metastasis and angiogenesis, etc. Hyaluronidase (HAase is a HA-degrading endoglycosidase, levels of HAase are elevated in many cancers. Hyaluronidase-1 (HYAL1 is the major tumor-derived HAase. We previously demonstrated that HYAL1 were overexpression in human breast cancer. Breast cancer cells with higher HAase expression, exhibited significantly higher invasion ability through matrigel than those cells with lower HAase expression, and knockdown of HYAL1 expression in breast cancer cells resulted in decreased cell growth, adhesion, invasion and angiogenesis. Here, to further elucidate the function of HYAL1 in breast cancer, we investigated the consequences of forcing HYAL1 expression in breast cancer cells by transfection of expression plasmid. Compared with control, HYAL1 up-regulated cells showed increased the HAase activity, and reduced the expression of HA in vitro. Meantime, upregulation of HYAL1 promoted the cell growth, migration, invasion and angiogenesis in vitro. Moreover, in nude mice model, forcing HYAL1 expression induced breast cancer cell xenograft tumor growth and angiogenesis. Interestingly, the HA expression was upregulated by forcing HYAL1 expression in vivo. These findings suggested that HYAL1-HA system is correlated with the malignant behavior of breast cancer.

  9. Expression of PTPeta in human hepatocellular carcinoma tissue and SMMC7721 cells and its significance

    OpenAIRE

    Xu, Xiao-Bing; Zhang, Xiao-Hua; Yang, Miao-Fang; Min-li LI; Zhu, Ren-Min

    2012-01-01

    Objective To investigate the expression of protein tyrosine phosphatase eta (PTPeta) in hepatocellular carcinoma tissue and SMMC-7721 cells, and observe the effects of SMMC7721 cell density on PTPeta expression. Methods  Immunohistochemistry method was used to detect the protein expression of PTPeta in hepatocellular carcinoma tissues and SMMC-7721 cells. RT-PCR was employed to detect the mRNA expression of PTPeta in different growth density of SMMC-7721 cells (1×103, 5×103, 1×104, 5×104/cm2)...

  10. β-catenin expression pattern in primary oral squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    CAI Zhi-gang; SHI Xiao-jian; GAO Yan; WEI Ming-jie; WANG Cun-yu; YU Guang-yan

    2008-01-01

    Background β-catenin, a 92 kDa protein that binds to the cytoplasmic tail of E-cadherin, has an essential role in intercellular adhesion and signal transduction. Aberrant expression of β-catenin has been associated with progression and metastasis of various human cancers. The aim of this study was to elucidate the expression pattem of β-catenin in primary oral squamous cell carcinoma and examine the correlation between β-catenin expression and tumor differentiation, histological grade and lymph node status as well as its clinical significances.Methods Seventy-six patients with oral squamous cell carcinoma and sixteen metastatic lymph nodes were studied.The β-catenin expression was determined by immunohistochemical staining. The correlation with clinical, histological data was analyzed statistically.Results Normal oral epithelium showed strong β-catenin expression at the cell membrane, but no cytoplasmic or nuclear expression. Different degrees of reduced expression of β-catenin at the cell membrane were found in 54 cases with squamous cell carcinoma (71%). Cytoplasmic β-catenin expression was found in 17 tumors (22.4%). Three caseswere found with nuclear β-catenin expression. In sixteen lymph nodes with metastatic squamous cell carcinoma,negative β-catenin expression at the cell membrane was seen in 13 tumors (81.2%) and weak expression in 3 tumors (18.8%). Statistical analysis showed that there was an inverse correlation between β-catenin expression and lymph node status and histological grade of tumors.Conclusions Reduced β-catenin expression at the cell membrane is clearly associated with lymph node metastasis. A reduced expression of β-catenin may constitute a hallmark of aggressive biological behavior of squamous cell carcinoma.

  11. Silibinin inhibits triple negative breast cancer cell motility by suppressing TGF-β2 expression.

    Science.gov (United States)

    Kim, Sangmin; Han, Jeonghun; Jeon, Myeongjin; You, Daeun; Lee, Jeongmin; Kim, Hee Jung; Bae, Sarang; Nam, Seok Jin; Lee, Jeong Eon

    2016-08-01

    Transforming growth factor-beta (TGF-β) is a multifunctional cytokine that regulates many biological events including cell motility and angiogenesis. Here, we investigated the role of elevated TGF-β2 level in triple negative breast cancer (TNBC) cells and the inhibitory effect of silibinin on TGF-β2 action in TNBC cells. Breast cancer patients with high TGF-β2 expression have a poor prognosis. The levels of TGF-β2 expression increased significantly in TNBC cells compared with those in non-TNBC cells. In addition, cell motility-related genes such as fibronectin (FN) and matrix metalloproteinase-2 (MMP-2) expression also increased in TNBC cells. Basal FN, MMP-2, and MMP-9 expression levels decreased in response to LY2109761, a dual TGF-β receptor I/II inhibitor, in TNBC cells. TNBC cell migration also decreased in response to LY2109761. Furthermore, we observed that TGF-β2 augmented the FN, MMP-2, and MMP-9 expression levels in a time- and dose-dependent manner. In contrast, TGF-β2-induced FN, MMP-2, and MMP-9 expression levels decreased significantly in response to LY2109761. Interestingly, we found that silibinin decreased TGF-β2 mRNA expression level but not that of TGF-β1 in TNBC cells. Cell migration as well as basal FN and MMP-2 expression levels decreased in response to silibinin. Furthermore, silibinin significantly decreased TGF-β2-induced FN, MMP-2, and MMP-9 expression levels and suppressed the lung metastasis of TNBC cells. Taken together, these results suggest that silibinin suppresses metastatic potential of TNBC cells by inhibiting TGF-β2 expression in TNBC cells. Thus, silibinin may be a promising therapeutic drug to treat TNBC.

  12. Differences in integrin expression and signaling within human breast cancer cells

    Directory of Open Access Journals (Sweden)

    Liu Yongqing

    2011-07-01

    Full Text Available Abstract Background Integrins are used as prognostic indicators in breast cancer. Following engagement with extracellular matrix proteins, their signaling influences numerous cellular processes including migration, proliferation, and death. Integrin signaling varies between cell types through differential expression of integrin subunits, and changes within a given cell upon exposure to a cell agonist or through changes in its surroundings. These variations in signaling can profoundly affect the phenotypic, tumorogenecity and metastatic properties of cancer cells. In the present study, we investigated if there were differences in the expression of integrins, integrin structures, and integrin co-receptors within three breast cancer cells and if these differences effected integrin signaling. Methods Expression of integrins, urokinase receptor and vascular endothelial cell growth factor receptor (VEGFR in metastatic MDA-MB-435 and MDA-MB-231, non-metastatic MCF7 and non-breast cancer Hek-293 cells was measured by flow cytometry. Cell adhesion was assessed using collagen, fibrinogen, fibronectin and vitronectin coated plates. Changes in kinase levels following PMA stimulation, and cell adhesion-induced activation of kinases were determined by western blot analysis. Distribution of actin stress fibers and focal adhesions was assessed by immunocytochemistry. Results All cells expressed αv integrins, while high β5 and αvβ5 expression was restricted to the cancer cells and high β3 and αvβ3 expression was restricted to MDA-MB-435 cells. The two metastatic cells were the least adhesive, but all cells adhered well to most proteins in the absence of PMA. All proliferating cells expressed activated pSrc, but only proliferating metastatic cells expressed high pMEK levels. PMA treatment resulted in time-dependent changes in activated kinase levels, and only MDA-MB-231 cells constitutively expressed high levels of activated pMEK. MDA-MB-435 cells formed

  13. Intraepithelial p63-dependent expression of distinct components of cell adhesion complexes in normal esophageal mucosa and squamous cell carcinoma.

    Science.gov (United States)

    Thépot, Amélie; Hautefeuille, Agnès; Cros, Marie-Pierre; Abedi-Ardekani, Behnoush; Pétré, Aurélia; Damour, Odile; Krutovskikh, Vladimir; Hainaut, Pierre

    2010-11-01

    TP63 gene is a member of TP53 tumor suppressor gene family that encodes several protein isoforms involved in the process of epithelial stratification and in epithelial-mesenchyme interactions. TP63 is amplified in a significant proportion of squamous cell carcinoma of the esophagus (ESCC), resulting in the hyper-expression of DeltaNp63 as the major p63 isoform. To better understand the contribution of this high expression to tumorigenesis, we have analyzed the impact of intraepithelial p63 expression on the expression of cell adhesion complexes in normal esophagus and in ESCC cell lines. Cells expressing p63 showed an adhesion pattern characterized by lack of tight junctions and presence of adherens junctions. Cell differentiation was accompanied by a decrease in p63 and by a shift to adhesion patterns involving tight junctions. Silencing of p63 mRNA in ESCC cell lines resulted in a similar shift, characterized by increased expression of component of tight junctions, decreased cell-to-cell communication and downregulation of cell proliferation. These results indicate that DeltaNp63 may contribute to esophageal squamous carcinogenesis by maintaining cell adhesion patterns compatible with cell proliferation. PMID:20127860

  14. PD-L1 Expression on Retrovirus-Infected Cells Mediates Immune Escape from CD8+ T Cell Killing

    Science.gov (United States)

    Neff, C. Preston; Gibbert, Kathrin; Dietze, Kirsten K.; Werner, Tanja; Liu, Jia; Chen, Lieping; Lang, Karl S.; Palmer, Brent E.; Dittmer, Ulf; Zelinskyy, Gennadiy

    2015-01-01

    Cytotoxic CD8+ T Lymphocytes (CTL) efficiently control acute virus infections but can become exhausted when a chronic infection develops. Signaling of the inhibitory receptor PD-1 is an important mechanism for the development of virus-specific CD8+ T cell dysfunction. However, it has recently been shown that during the initial phase of infection virus-specific CD8+ T cells express high levels of PD-1, but are fully competent in producing cytokines and killing virus-infected target cells. To better understand the role of the PD-1 signaling pathway in CD8+ T cell cytotoxicity during acute viral infections we analyzed the expression of the ligand on retrovirus-infected cells targeted by CTLs. We observed increased levels of PD-L1 expression after infection of cells with the murine Friend retrovirus (FV) or with HIV. In FV infected mice, virus-specific CTLs efficiently eliminated infected target cells that expressed low levels of PD-L1 or that were deficient for PD-L1 but the population of PD-L1high cells escaped elimination and formed a reservoir for chronic FV replication. Infected cells with high PD-L1 expression mediated a negative feedback on CD8+ T cells and inhibited their expansion and cytotoxic functions. These findings provide evidence for a novel immune escape mechanism during acute retroviral infection based on PD-L1 expression levels on virus infected target cells. PMID:26484769

  15. PD-L1 Expression on Retrovirus-Infected Cells Mediates Immune Escape from CD8+ T Cell Killing.

    Directory of Open Access Journals (Sweden)

    Ilseyar Akhmetzyanova

    2015-10-01

    Full Text Available Cytotoxic CD8+ T Lymphocytes (CTL efficiently control acute virus infections but can become exhausted when a chronic infection develops. Signaling of the inhibitory receptor PD-1 is an important mechanism for the development of virus-specific CD8+ T cell dysfunction. However, it has recently been shown that during the initial phase of infection virus-specific CD8+ T cells express high levels of PD-1, but are fully competent in producing cytokines and killing virus-infected target cells. To better understand the role of the PD-1 signaling pathway in CD8+ T cell cytotoxicity during acute viral infections we analyzed the expression of the ligand on retrovirus-infected cells targeted by CTLs. We observed increased levels of PD-L1 expression after infection of cells with the murine Friend retrovirus (FV or with HIV. In FV infected mice, virus-specific CTLs efficiently eliminated infected target cells that expressed low levels of PD-L1 or that were deficient for PD-L1 but the population of PD-L1high cells escaped elimination and formed a reservoir for chronic FV replication. Infected cells with high PD-L1 expression mediated a negative feedback on CD8+ T cells and inhibited their expansion and cytotoxic functions. These findings provide evidence for a novel immune escape mechanism during acute retroviral infection based on PD-L1 expression levels on virus infected target cells.

  16. PKCeta enhances cell cycle progression, the expression of G1 cyclins and p21 in MCF-7 cells.

    Science.gov (United States)

    Fima, E; Shtutman, M; Libros, P; Missel, A; Shahaf, G; Kahana, G; Livneh, E

    2001-10-11

    Protein kinase C encodes a family of enzymes implicated in cellular differentiation, growth control and tumor promotion. However, not much is known with respect to the molecular mechanisms that link protein kinase C to cell cycle control. Here we report that the expression of PKCeta in MCF-7 cells, under the control of a tetracycline-responsive inducible promoter, enhanced cell growth and affected the cell cycle at several points. The induced expression of another PKC isoform, PKCdelta, in MCF-7 cells had opposite effects and inhibited their growth. PKCeta expression activated cellular pathways in these cells that resulted in the increased expression of the G1 phase cyclins, cyclin D and cyclin E. Expression of the cyclin-dependent kinase inhibitor p21(WAF1) was also specifically elevated in PKCeta expressing cells, but its overall effects were not inhibitory. Although, the protein levels of the cyclin-dependent kinase inhibitor p27(KIP1) were not altered by the induced expression of PKCeta, the cyclin E associated Cdk2 kinase activity was in correlation with the p27(KIP1) bound to the cyclin E complex and not by p21(WAF1) binding. PKCeta expression enhanced the removal of p27(KIP1) from this complex, and its re-association with the cyclin D/Cdk4 complex. Reduced binding of p27(KIP1) to the cyclin D/Cdk4 complex at early time points of the cell cycle also enhanced the activity of this complex, while at later time points the decrease in bound p21(WAF1) correlated with its increased activity in PKCeta-expressing cells. Thus, PKCeta induces altered expression of several cell cycle functions, which may contribute to its ability to affect cell growth.

  17. Analysis of gene expression in prostate cancer epithelial and interstitial stromal cells using laser capture microdissection

    Directory of Open Access Journals (Sweden)

    Mintz Eric M

    2010-04-01

    Full Text Available Abstract Background The prostate gland represents a multifaceted system in which prostate epithelia and stroma have distinct physiological roles. To understand the interaction between stroma and glandular epithelia, it is essential to delineate the gene expression profiles of these two tissue types in prostate cancer. Most studies have compared tumor and normal samples by performing global expression analysis using a mixture of cell populations. This report presents the first study of prostate tumor tissue that examines patterns of differential expression between specific cell types using laser capture microdissection (LCM. Methods LCM was used to isolate distinct cell-type populations and identify their gene expression differences using oligonucleotide microarrays. Ten differentially expressed genes were then analyzed in paired tumor and non-neoplastic prostate tissues by quantitative real-time PCR. Expression patterns of the transcription factors, WT1 and EGR1, were further compared in established prostate cell lines. WT1 protein expression was also examined in prostate tissue microarrays using immunohistochemistry. Results The two-step method of laser capture and microarray analysis identified nearly 500 genes whose expression levels were significantly different in prostate epithelial versus stromal tissues. Several genes expressed in epithelial cells (WT1, GATA2, and FGFR-3 were more highly expressed in neoplastic than in non-neoplastic tissues; conversely several genes expressed in stromal cells (CCL5, CXCL13, IGF-1, FGF-2, and IGFBP3 were more highly expressed in non-neoplastic than in neoplastic tissues. Notably, EGR1 was also differentially expressed between epithelial and stromal tissues. Expression of WT1 and EGR1 in cell lines was consistent with these patterns of differential expression. Importantly, WT1 protein expression was demonstrated in tumor tissues and was absent in normal and benign tissues. Conclusions The prostate

  18. Human cancer cells express Slug-based epithelial-mesenchymal transition gene expression signature obtained in vivo

    Directory of Open Access Journals (Sweden)

    Anastassiou Dimitris

    2011-12-01

    Full Text Available Abstract Background The biological mechanisms underlying cancer cell motility and invasiveness remain unclear, although it has been hypothesized that they involve some type of epithelial-mesenchymal transition (EMT. Methods We used xenograft models of human cancer cells in immunocompromised mice, profiling the harvested tumors separately with species-specific probes and computationally analyzing the results. Results Here we show that human cancer cells express in vivo a precise multi-cancer invasion-associated gene expression signature that prominently includes many EMT markers, among them the transcription factor Slug, fibronectin, and α-SMA. We found that human, but not mouse, cells express the signature and Slug is the only upregulated EMT-inducing transcription factor. The signature is also present in samples from many publicly available cancer gene expression datasets, suggesting that it is produced by the cancer cells themselves in multiple cancer types, including nonepithelial cancers such as neuroblastoma. Furthermore, we found that the presence of the signature in human xenografted cells was associated with a downregulation of adipocyte markers in the mouse tissue adjacent to the invasive tumor, suggesting that the signature is triggered by contextual microenvironmental interactions when the cancer cells encounter adipocytes, as previously reported. Conclusions The known, precise and consistent gene composition of this cancer mesenchymal transition signature, particularly when combined with simultaneous analysis of the adjacent microenvironment, provides unique opportunities for shedding light on the underlying mechanisms of cancer invasiveness as well as identifying potential diagnostic markers and targets for metastasis-inhibiting therapeutics.

  19. Expression of goose parvovirus whole VP3 protein and its epitopes in Escherichia coli cells.

    Science.gov (United States)

    Tarasiuk, K; Woźniakowski, G; Holec-Gąsior, L

    2015-01-01

    The aim of this study was the expression of goose parvovirus capsid protein (VP3) and its epitopes in Escherichia coli cells. Expression of the whole VP3 protein provided an insufficient amount of protein. In contrast, the expression of two VP3 epitopes (VP3ep4, VP3ep6) in E. coli, resulted in very high expression levels. This may suggest that smaller parts of the GPV antigenic determinants are more efficiently expressed than the complete VP3 gene.

  20. Differential expression of epithelial cell adhesion molecule in salivary gland neoplasms.

    Science.gov (United States)

    Phattarataratip, Ekarat; Masorn, Marisa; Jarupoonphol, Werapong; Supatthanayut, Sirinpaporn; Saeoweiang, Pichanee

    2016-10-01

    Epithelial cell adhesion molecule (EpCAM) is the epithelial-specific molecule expressed on various epithelial cell types. The function of EpCAM involves cellular adhesion, proliferation, and signaling in both normal tissues and cancers. The purposes of this study were to investigate the EpCAM expression in salivary gland neoplasms and examine its relationship with pathologic characteristics. Forty-two cases of salivary gland neoplasms, including 20 mucoepidermoid carcinomas (MECs), 11 adenoid cystic carcinomas (ACCs), 9 pleomorphic adenomas (PAs), and 2 polymorphous low-grade adenocarcinomas (PLGAs) were enrolled. Epithelial cell adhesion molecule expression was analyzed immunohistochemically using MOC-31 and BerEP4 antibodies. Results showed that the majority of MECs and all PLGAs showed EpCAM expression in more than 50% of neoplastic cells, whereas most PAs and ACCs did not express this protein. In MECs, most EpCAM-positive neoplastic cells were clear cells, glandular epithelial cells, and intermediate cells, whereas squamous cells and mucous cells were largely negative. The expression was limited to ductal epithelium in EpCAM-positive PAs and ACCs. The decreased EpCAM expression in MECs was significantly associated with microscopically diminished cystic components, the presence of small nest invasion at invasive front, cellular anaplasia, vascular invasion, and high pathologic grade. These data suggested that EpCAM showed different expression pattern among salivary gland neoplasms and in different grades of MECs. PMID:27649957

  1. Lineage Tracing and Cell Ablation Identify a Post-Aire-Expressing Thymic Epithelial Cell Population

    Directory of Open Access Journals (Sweden)

    Todd C. Metzger

    2013-10-01

    Full Text Available Thymic epithelial cells in the medulla (mTECs play a critical role in enforcing central tolerance through expression and presentation of tissue-specific antigens (TSAs and deletion of autoreactive thymocytes. TSA expression requires autoimmune regulator (Aire, a transcriptional activator present in a subset of mTECs characterized by high CD80 and major histocompatibility complex II expression and a lack of potential for differentiation or proliferation. Here, using an Aire-DTR transgenic line, we show that short-term ablation specifically targets Aire+ mTECs, which quickly undergo RANK-dependent recovery. Repeated ablation also affects Aire− mTECs, and using an inducible Aire-Cre fate-mapping system, we find that this results from the loss of a subset of mTECs that showed prior expression of Aire, maintains intermediate TSA expression, and preferentially migrates toward the center of the medulla. These results clearly identify a distinct stage of mTEC development and underscore the diversity of mTECs that play a key role in maintaining tolerance.

  2. Characterization of Cardiac-Resident Progenitor Cells Expressing High Aldehyde Dehydrogenase Activity

    Directory of Open Access Journals (Sweden)

    Marc-Estienne Roehrich

    2013-01-01

    Full Text Available High aldehyde dehydrogenase (ALDH activity has been associated with stem and progenitor cells in various tissues. Human cord blood and bone marrow ALDH-bright (ALDHbr cells have displayed angiogenic activity in preclinical studies and have been shown to be safe in clinical trials in patients with ischemic cardiovascular disease. The presence of ALDHbr cells in the heart has not been evaluated so far. We have characterized ALDHbr cells isolated from mouse hearts. One percent of nonmyocytic cells from neonatal and adult hearts were ALDHbr. ALDHvery-br cells were more frequent in neonatal hearts than adult. ALDHbr cells were more frequent in atria than ventricles. Expression of ALDH1A1 isozyme transcripts was highest in ALDHvery-br cells, intermediate in ALDHbr cells, and lowest in ALDHdim cells. ALDH1A2 expression was highest in ALDHvery-br cells, intermediate in ALDHdim cells, and lowest in ALDHbr cells. ALDH1A3 and ALDH2 expression was detectable in ALDHvery-br and ALDHbr cells, unlike ALDHdim cells, albeit at lower levels compared with ALDH1A1 and ALDH1A2. Freshly isolated ALDHbr cells were enriched for cells expressing stem cell antigen-1, CD34, CD90, CD44, and CD106. ALDHbr cells, unlike ALDHdim cells, could be grown in culture for more than 40 passages. They expressed sarcomeric α-actinin and could be differentiated along multiple mesenchymal lineages. However, the proportion of ALDHbr cells declined with cell passage. In conclusion, the cardiac-derived ALDHbr population is enriched for progenitor cells that exhibit mesenchymal progenitor-like characteristics and can be expanded in culture. The regenerative potential of cardiac-derived ALDHbr cells remains to be evaluated.

  3. Comparison of gene expression profiles in chromate transformed BEAS-2B cells.

    Directory of Open Access Journals (Sweden)

    Hong Sun

    Full Text Available BACKGROUND: Hexavalent chromium [Cr(VI] is a potent human carcinogen. Occupational exposure has been associated with increased risk of respiratory cancer. Multiple mechanisms have been shown to contribute to Cr(VI induced carcinogenesis, including DNA damage, genomic instability, and epigenetic modulation, however, the molecular mechanism and downstream genes mediating chromium's carcinogenicity remain to be elucidated. METHODS/RESULTS: We established chromate transformed cell lines by chronic exposure of normal human bronchial epithelial BEAS-2B cells to low doses of Cr(VI followed by anchorage-independent growth. These transformed cell lines not only exhibited consistent morphological changes but also acquired altered and distinct gene expression patterns compared with normal BEAS-2B cells and control cell lines (untreated that arose spontaneously in soft agar. Interestingly, the gene expression profiles of six Cr(VI transformed cell lines were remarkably similar to each other yet differed significantly from that of either control cell lines or normal BEAS-2B cells. A total of 409 differentially expressed genes were identified in Cr(VI transformed cells compared to control cells. Genes related to cell-to-cell junction were upregulated in all Cr(VI transformed cells, while genes associated with the interaction between cells and their extracellular matrices were down-regulated. Additionally, expression of genes involved in cell proliferation and apoptosis were also changed. CONCLUSION: This study is the first to report gene expression profiling of Cr(VI transformed cells. The gene expression changes across individual chromate exposed clones were remarkably similar to each other but differed significantly from the gene expression found in anchorage-independent clones that arose spontaneously. Our analysis identified many novel gene expression changes that may contribute to chromate induced cell transformation, and collectively this type of

  4. Environmental alkylphenols modulate cytokine expression in plasmacytoid dendritic cells.

    Directory of Open Access Journals (Sweden)

    Chih-Hsing Hung

    Full Text Available BACKGROUND: Alkylphenols, such as nonylphenol (NP and 4-octylphenol (4-OP, have the potential to disturb immune system due to their weak estrogen-like activity, an effect with potential serious public health impact due to the worldwide distribution of these substances. Plasmacytoid dendritic cells (PDCs can secrete large amounts of type I IFNs and are critical in immune regulation. However, there has been limited study about the influence of alkylphenols on the function of pDCs. OBJECTIVE: The aim of this study was to examine the effect of alkylphenols on pDC functions in vitro and in vivo and then further explored the involved signaling pathways and epigenetic changes. METHODS: Circulating pDCs from human peripheral blood mononuclear cells were treated with alkylphenols with or without CpG stimulation. Alkylphenol-associated cytokine responses, signaling events, histone modifications and viral activity were further examined. In NP-exposed mice, the effect of NP on splenic pDC function and allergic lung inflammation were also assessed. RESULTS: The results showed that NP increased the expression of TNF-α, but suppressed IL-10 production in the range of physiological doses, concomitant with activation of the MKK3/6-p38 signaling pathway and enhanced levels of acetylated histone 3 as well as histone 4 at the TNFA gene locus. Further, in CpG-stimulated pDCs, NP suppressed type I IFNs production, associated with down-regulation of IRF-7 and MKK1/2-ERK-Elk-1 pathways and led to the impaired anti-enterovirus 71 activity in vitro. Additionally, splenic pDCs from NP-exposed mice showed similar cytokine changes upon CpG stimulation under conditions relevant to route and level of exposure in humans. NP treatment also enhanced allergic lung inflammation in vivo. CONCLUSION: Alkylphenols may influence pDCs' functions via their abilities to induce expression of a pro-inflammatory cytokine, TNF-α, and to suppress regulatory cytokines, including IL-10, IFN

  5. Cell Cycle-dependent Expression of Thyroid Hormone Receptor-β Is a Mechanism for Variable Hormone SensitivityD⃞

    OpenAIRE

    Maruvada, Padma; Dmitrieva, Natalia I.; East-Palmer, Joyce; Yen, Paul M.

    2004-01-01

    Thyroid hormone receptors (TRs) are ligand-regulatable transcription factors. Currently, little is known about the expression of TRs or other nuclear hormone receptors during the cell cycle. We thus developed a stable expression system to express green fluorescent protein-TRβ in HeLa cells under tetracycline regulation, and studied TR expression during the cell cycle by laser scanning cytometry. Only ∼9-15% of the nonsynchronized cell population expressed TR because the majority of cells were...

  6. Gene cloning of human soluble CD14 and its expression in eucaryotic cells

    Institute of Scientific and Technical Information of China (English)

    荫俊; 白洁; 王威; 宋伟; 王忠泽

    2002-01-01

    To express human soluble CD14 (sCD14) in eukaryotic cells. Methods: Human sCD14 cDNA was amplified from U937 cells with RT-PCR method. The recombinant expression plasmid pEF1/HisC/sCD14348aa was constructed and the expression in COS-7 cells was carried out using liposome transfection method. The yield was examined with scanning map identification. The expressed product was purified by immuno-affinity chromatography. Results: Sequence analysis demonstrated that the amplified gene sequence and those reported by documents were completely identical. sCD14 was expressed with high-yield. The expressed product was purified to above 90%. Recombinant sCD14, specifically combinable with endotoxins, had a natural biological activity. Conclusions: Human sCD14 was expressed in COS-7 cells, which laid a foundation for further study.

  7. Intercellular Cell Adhesion Molecule-1, Vascular Cell Adhesion Molecule-1, and Regulated on Activation Normal T Cell Expressed and Secreted Are Expressed by Human Breast Carcinoma Cells and Support Eosinophil Adhesion and Activation

    OpenAIRE

    Ali, Shahina; Kaur, Jaswinder; Patel, Kamala D.

    2000-01-01

    Eosinophils are usually associated with parasitic and allergic diseases; however, eosinophilia is also observed in several types of human tumors, including breast carcinomas. In this study we examined several human breast carcinoma cell lines for adhesion molecule expression and the ability to bind and activate eosinophils. MDA-MB-435S and MDA-MB-468 cells constitutively expressed both intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) and this expressio...

  8. Melanoma Cell Expression of CD200 Inhibits Tumor Formation and Lung Metastasis via Inhibition of Myeloid Cell Functions

    OpenAIRE

    Talebian, Fatemeh; Liu, Jin-Qing; Liu, Zhenzhen; Khattabi, Mazin; He, Yukai; Ganju, Ramesh; Bai, Xue-feng

    2012-01-01

    CD200 is a cell surface glycoprotein that functions through engaging CD200 receptor on cells of the myeloid lineage and inhibits their functions. Expression of CD200 has been implicated in a variety of human cancer cells including melanoma cells and has been thought to play a protumor role. To investigate the role of cancer cell expression of CD200 in tumor formation and metastasis, we generated CD200-positive and CD200-negative B16 melanoma cells. Subcutaneous injection of CD200-positive B16...

  9. Increasing RpoS expression causes cell death in Borrelia burgdorferi.

    Directory of Open Access Journals (Sweden)

    Linxu Chen

    Full Text Available RpoS, one of the two alternative σ factors in Borrelia burgdorferi, is tightly controlled by multiple regulators and, in turn, determines expression of many critical virulence factors. Here we show that increasing RpoS expression causes cell death. The immediate effect of increasing RpoS expression was to promote bacterial division and as a consequence result in a rapid increase in cell number before causing bacterial death. No DNA fragmentation or degradation was observed during this induced cell death. Cryo-electron microscopy showed induced cells first formed blebs, which were eventually released from dying cells. Apparently blebbing initiated cell disintegration leading to cell death. These findings led us to hypothesize that increasing RpoS expression triggers intracellular programs and/or pathways that cause spirochete death. The potential biological significance of induced cell death may help B. burgdorferi regulate its population to maintain its life cycle in nature.

  10. Dissecting the heterogeneity of gene expressions in mouse embryonic stem cells

    Science.gov (United States)

    Zou, Ling-Nan; Thomson, Matt; Liu, S. John; Ramanathan, Sharad

    2011-03-01

    A population of genetically identical cells, of the same nominal cell type, and cultured in the same petri dish, will nevertheless often exhibit varying patterns of gene expression. Taking mouse embryonic stem (ES) cells as a model system, we use immunofluorescence and flow cytometry to examine in detail the distribution of expression levels for various transcription factors key to the maintenance of the ES cell identity. We find the population-level distribution of many proteins, once rescaled by the average expression level, have very similar shapes. This suggest the largest component of observed heterogeneity comes from a single source. More subtly, we find the expression many of genes appears to modulate with the cell cycle. This may suggest that the program for maintaining ES cell identity is tightly coupled to the cell cycle machinery. This work is supported by the Harvard Stem Cell Institute and the Jane Coffin Childs Memorial Fund for Medical Research.

  11. Effect of Human Cytomegalovirus Infection on Nerve Growth Factor Expression in Human Glioma U251 Cells

    Institute of Scientific and Technical Information of China (English)

    HAI-TAO WANG; BIN WANG; ZHI-JUN LIU; ZHI-QIANG BAI; LING LI; HAI-YAN LIU; DONG-MENG QIAN; ZHI-YONG YAN; XU-XIA SONG

    2009-01-01

    Objectives To explore the change of endogenic nerve growth factor (NGF) expression in human glioma cells infected with human cytomegalovirus (HCMV). Methods U251 cells were cultured in RPMI 1640 culture medium and infected with HCMV AD169 strain in vitro to establish a cell model of viral infection. Morphologic changes of U251 cells were observed under inverted microscope before and after infection with HCMV. Expression of NGF gene and protein of cells was detected by RT-PCR and Western blotting before and after infection with HCMV. Results The cytopathic effects of HCMV-infected cells appeared on day 5 after infection. However, differential NGF expression was evident on day 7. NGF expression was decreased significantly in U251 cells on day 7 after infection in comparison with control group (P<0.05). Conclusion HCMV can down-regulate endogenous NGF levels in human glioma cell line U251.

  12. Blood cell gene expression profiling in subjects with aggressive periodontitis and chronic arthritis

    DEFF Research Database (Denmark)

    Sørensen, Lars K; Poulsen, Anne Havemose; Sønder, Søren U;

    2008-01-01

    BACKGROUND: Microarray analysis of local and peripheral cells in subjects with immune-inflammatory diseases may identify candidate genes associated with these diseases. The present study identified differentially expressed genes in peripheral blood mononuclear cells (PBMCs) from subjects with unt...

  13. T cells expressing VHH-directed oligoclonal chimeric HER2 antigen receptors

    DEFF Research Database (Denmark)

    Jamnani, Fatemeh Rahimi; Rahbarizadeh, Fatemeh; Shokrgozar, Mohammad Ali;

    2014-01-01

    Adoptive cell therapy with engineered T cells expressing chimeric antigen receptors (CARs) originated from antibodies is a promising strategy in cancer immunotherapy. Several unsuccessful trials, however, highlight the need for alternative conventional binding domains and the better combination...

  14. The expression of P63 protein in some keratinocyte original tissues and cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective:To examine the expression patterns of p63 in tissues of particular keratinocyte original hyperproliferate diseases and variety cell types for determining if P63 is the marker of proliferative potential keratinocytes.Methods:P63 protein Was detected and analyzed by immunoreacdvity method and Western blot in biopsy specimens of keratinocyte original disorders including squamous cell carcinomas SCC,basal cell carcinomas BCC,Bowen's disease and other tissues or cells,such as psoriasis vulgaris,normal skin tissues,primary cultured keratinocytes,immortal HaCaT cells,and epidermoid carcinoma cells A431.Results:P63 protein was expressed in the nuclei of basal and suprabasal layer of the epidermis,germinative cells of sebaceous glands in normal epidermal.P63 was strongly and diffusely detected in the majority of tumor cells in BCC and poorly-differentiated SCC.In Bowen's disease,p63expresses are remarkable in all cell layers.In the psoriasis plaque epidermal,p63 expressed mainly in basal cells and part of spinous cells.P63 expressed more strongly in primary cultured keratinocytes than in A431 cells or HaCaT cells.Conclusion:P63 is a nuclei marker of undifferentiated keratinocytes with the proliferative potential and may disrupt the terminal differentiation.The overexpression of p63 reflects immaturity of the tumor cells.The immunohistochemical staining of p63 may be useful for investigating the origin and differentiation of tumor cells.

  15. Functional expression of mammalian receptors and membrane channels in different cells.

    Science.gov (United States)

    Eifler, Nora; Duckely, Myriam; Sumanovski, Lazar T; Egan, Terrance M; Oksche, Alexander; Konopka, James B; Lüthi, Anita; Engel, Andreas; Werten, Paul J L

    2007-08-01

    In native tissues, the majority of medically important membrane proteins is only present at low concentrations, making their overexpression in recombinant systems a prerequisite for structural studies. Here, we explore the commonly used eukaryotic expression systems-yeast, baculovirus/insect cells (Sf9) and Semliki Forest Virus (SFV)/mammalian cells-for the expression of seven different eukaryotic membrane proteins from a variety of protein families. The expression levels, quality, biological activity, localization and solubility of all expressed proteins are compared in order to identify the advantages of one system over the other. SFV-transfected mammalian cell lines provide the closest to native environment for the expression of mammalian membrane proteins, and they exhibited the best overall performance. But depending on the protein, baculovirus-infected Sf9 cells performed almost as well as mammalian cells. The lowest expression levels for the proteins tested here were obtained in yeast.

  16. Screening of differentially expressed genes related to differentiation and proliferation by gene expression profiling of different grade astrocytoma cell lines

    Institute of Scientific and Technical Information of China (English)

    Yi Zeng; Zhong Yang; Yangyun Han; Chao You

    2008-01-01

    BACKGROUND: The detection of differential gene expression in brain is possible by cDNA microarray technology, and the screening of differentially expressed genes might provide a biological basis for gene-targeted therapy for tumors. OBJECTIVE: To detect the differential expression of genes among astrocytoma SHG-44 (WHO grade IV), CHG-5 (WHO grade II), and ATRA-treated SHG-44 cell lines by cDNA microarray. DESIGN: Laboratory experiments in vitro.SETTING: Department of Neurobiology, the Third Military Medical University. MATERIALS: The experiment was performed at the Department of Neurobiology in the Third Military Medical University of the Chinese PLA from January to October 2007. The SHG-44 cell line (WHO grade Ⅳ) was established by Prof. Ziwei Du, and the CHG-5 cell line (WHO grade II) was set up by Prof. Xiuwu Bian from the Third Military Medical University of the Chinese PLA. The cDNA microarray containing 9182 known genes was prepared and provided by Dr. Yang Zhong at the City University of Hong Kong. MAIN OUTCOME MEASURES: The identification of genes that were similarly regulated (overlapping) during tumor progression and differentiation, by comparison of gene expression profiles between CHG-5 and SHG-44 cells, and between SHG-44 cells with or without treatment with ATRA. RESULTS: Thirty-one overlapping genes were found to have similar regulatory effects on astrocytomas; among them, twenty genes were up-regulated and eleven were down-regulated in both comparisons between CHG-5 and SHG-44 cells, and between SHG-44 cells with or without treatment with ATRA. The four reported genes, SERPINF1, MAPK11, HIF1A and SOD2, were up-regulated in this study.CONCLUSION: The differentially expressed genes in different grade astrocytoma cell lines were revealed primarily by cDNA microarray; among them, five identified overlapping genes, SERPINF1, MAPK11, DCTN2, HIF1A and SOD2, were related to the malignant progression of astrocytoma cells.

  17. Interferon-alpha induces transient suppressors of cytokine signalling expression in human T cells

    DEFF Research Database (Denmark)

    Brender, C; Nielsen, M; Röpke, C;

    2001-01-01

    The suppressors of cytokine signalling (SOCS) proteins comprise a newly identified family of negative feedback regulators of cytokine signalling. SOCS expression is differentially induced upon cytokine stimulation in different cell types. Here we show that interferon-alpha (IFNalpha) is a potent...... inducer of SOCS expression in human T cells, as high expression of CIS, SOCS-1, SOCS-2, and SOCS-3 was detectable after IFNalpha stimulation. After 4 h of stimulation, CIS, SOCS-1, and SOCS-3 expression had returned to baseline levels, whereas SOCS-2 expression had not declined. In contrast, after IL-2...... induction neither CIS, SOCS-1, nor SOCS-2 expression levels declined after 6 h. In conclusion, we provide the first evidence that IFNalpha induces SOCS expression in human T cells. Moreover, we show that IFNalpha and IL-2 induce distinct patterns of expression kinetics, suggesting that dynamic changes...

  18. Low microRNA-199a expression in human amniotic epithelial cell feeder layers maintains human-induced pluripotent stem cell pluripotency via increased leukemia inhibitory factor expression

    Institute of Scientific and Technical Information of China (English)

    Te Liu; Qing Chen; Yongyi Huang; Qin Huang; Lizhen Jiang; Lihe Guo

    2012-01-01

    Human-induced pluripotent stem (iPS) cells share the same key properties as embryonic stem cells,and may be generated from patient- or disease-specific sources,which makes them attractive for personalized medicine,drug screens,or cellular therapy.Long-term cultivation and maintenance of normal iPS cells in an undifferentiated self-renewing state is a major challenge.Our previous studies have shown that human amniotic epithelial cells (HuAECs) could provide a good source of feeder cells for mouse and human embryonic stem cells,or spermatogonial stem cells,as they express endogenous leukemia inhibitory factor (LIF) at high levels.Here,we examined the effect of exogenous microRNA-199a regulation on endogenous LIF expression in HuAECs,and in torn on human iPS cell pluripotency.We found that HuAECs feeder cells transfected with microRNA-199a mutant expressed LIF at high levels,allowing iPS to maintain a high level of alkaline phosphatase activity in longterm culture and form teratomas in severe combined immunodeficient mice.The expression of stem cell markers was increased in iPS cultured on HuAECs feeder cells transfected with the microRNA-199a mutant,compared with iPS cultured on HuAECs transfected with microRNA-199a or mouse embryo fibroblasts.Taken together,these results suggested that LIF expression might be regulated by microRNA-199a,and LIF was a crucial component in feeder cells,and also was required for maintenance of human iPS cells in an undifferentiated,proliferative state capable of self-renewal.

  19. Quantum dots-based multiplexed immunohistochemistry of protein expression in human prostate cancer cells

    Directory of Open Access Journals (Sweden)

    C Shi

    2008-06-01

    Full Text Available Semiconductor quantum dots (QDs are bright fluorescent nanoparticles that have been successfully used for the detection of biomarker expression in cells. The objective of the present study is to use this technology in a multiplexing manner to determine at a single cell level the expression of a cell-specific bio-marker, prostate-specific antigen (PSA expressed by human prostate cancer LNCaP and ARCaP cell lines. Here we compared the sensitivity of immunohistochemistry (IHC and QD-based detection of AR and PSA expression in these cell lines. Further, we conducted multiplexing QD-based detection of PSA and androgen receptor (AR expression in LNCaP cells subjecting to androgen (R1881 stimulation. The involvement of AR in PSA regulation in LNCaP cells, at a single cell level, was confirmed by the co-incubation of LNCaP cells in the presence of both R1881 and its receptor antagonist, bicalutamide (Casodex. We showed here the superior quality of QDs, in comparison to IHC, for the detection of AR and PSA in cultured LNCaP and ARCaP cells. Multiplexing QDs technique can be used to detect simultaneously AR and PSA expression induced by R1881 which promoted AR translocation from its cytosolic to the nuclear compartment.We observed AR antagonist, bicalutamide, inhibited AR nuclear translocation and PSA, but not AR expression in LNCaP cells.

  20. Interleukin-1 receptors are differentially expressed in normal and psoriatic T cells.

    Science.gov (United States)

    Bebes, Attila; Kovács-Sólyom, Ferenc; Prihoda, Judit; Kui, Róbert; Kemény, Lajos; Gyulai, Rolland

    2014-01-01

    This study was carried out to examine the possible role of interleukin-1 (IL-1) in the functional insufficiency of regulatory T cells in psoriasis, by comparing the expression of IL-1 receptors on healthy control and psoriatic T cells. Patients with moderate-to-severe chronic plaque psoriasis and healthy volunteers, matched in age and sex, were selected for all experiments. CD4(+)CD25(-) effector and CD4(+)CD25(+)CD127(low) regulatory T cells were separated and used for the experiments. Expression of the mRNA of IL-1 receptors (IL-1R1, IL-1R2, and sIL-1R2) was determined by quantitative real-time RT-PCR. Cell surface IL-1 receptor expression was assessed by flow cytometry. Relative expression of the signal transmitting IL-1 receptor type 1 (IL-1R1) mRNA is higher in resting psoriatic effector and regulatory T cells, and activation induces higher IL-1R1 protein expression in psoriatic T cells than in healthy cells. Psoriatic regulatory and effector T cells express increased mRNA levels of the decoy IL-1 receptors (IL-1R2 and sIL-1R2) upon activation compared to healthy counterparts. Psoriatic T cells release slightly more sIL-1R2 into their surrounding than healthy T cells. In conclusion, changes in the expression of IL-1 receptors in psoriatic regulatory and effector T cells could contribute to the pathogenesis of psoriasis.

  1. Construction and expression of a Rev-dependent TNF-R1 expressing HIV-infected-cell injurious vectors

    Institute of Scientific and Technical Information of China (English)

    SHI Wei-min; Dean Baylis; Damian Purcell; Paul U Cameron

    2005-01-01

    Background Rev is necessary for exporting unspliced and incompletely spliced intron containing HIV mRNAs and for HIV replication. The aim of this study is to develop a kind of selective suicide construct that can specifically and directly induce HIV infected cells into apoptosis based on the high affinity of Rev and Rev response element (RRE). Methods Molecular-cloning technique was used to synthesis Rev dependent TNF-R1 expression construct pDM128-TNF-R1 (pT128) that contains RRE and TNFR1 gene. Restriction digestion, Polymerase Chain Reaction (PCR) and DNA sequencing were processed and the exactness and correctness of the inserted TNF-R1 gene in pT128 were confirmed repeatedly. The expression of pT128 co-transfected with different combination of other plasmids by calcium phosphate-DNA co-precipitation in Helas and by gene gun transfection in keratinocytes was further tested by flow-cytometry and cell counted under microscope. Results The new plasmid specifically expressed TNF-R1 in Helas when co-transfected with pRev but did not when without pRev. Indirect expression of TNF-R1 from pT128 was slower than the direct expression of that from Hu p60 TNFR1 in pDC302 (pT60), but all those pT60 or pT128 transfected cells showed apoptosis at last while TNF-R1 was sufficiently expressed. Other kinds of Rev expression construct such as pAD8 and a chimeric HIV vaccine also can switched on the selective expression of pT128. Not only Rev-dependent expression in Helas, pT128 also normally expressed its TNF-R1 in keratinocytes. Co-transfected with pRev or pAD8 that expressed Rev, pT128 expressed TNF-R1 and induced apoptosis of green fluorescent keratinocytes in skin explant. The number of green fluorescent keratinocytes co-transfected by pT128 plus pRev or pAD8 was gradually outnumbered by that co-transfected by pT128 only. The difference was more significant after culturing for 72 hours. Conclusions Rev dependent pT128 is able to selectively induce apoptosis of HIV-infected or

  2. RNA interference by expression of short hairpin RNAs suppresses bcl-xL gene expression in nasopharyngeal carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    Fang LIU; Cheng-wei HE; Yue-fei ZHANG; Ke-yuan ZHOU

    2005-01-01

    Aim: To evaluate a new plasmid mediated RNA interference (RNAi) system and investigate whether knock-down of bcl-xL by short hairpin RNA (shRNA) can induce apoptosis of human nasopharyngeal carcinoma (NPC) cell line CNE-2Z in vitro. Methods: The plasmid containing mU6 promoter was subcloned to yield the pmU6 plasmid, recombinant plasmid expressing shRNA targeting bcl-xL gene was designed and constructed, and were co-transfected cells with green fluorescence protein expressing plasmid. Flow cytometry was used to evaluate transfection efficiency, and RT-PCR and Western blot were applied to analyze bcl-xL mRNA and protein levels, respectively. Results: The shRNA expressed by the recombi nant plasmid efficiently suppressed bcl-xL gene expression and induced apoptosis .of NPC cells in vitro. Conclusion: The recombinant plasmid can sufficiently mediate RNAi in CNE-2Z cells, and knock-down of the bcl-xL expression by shRNA significantly induced apoptosis in CNE-2Z cells. The results suggest this new system, mediated RNAi can be used as a tool for the study of gene function and gene therapy.

  3. NRP-1 gene expression in nasopharyngeal carcinoma tissue and regulating effect of targeted inhibition of gene expression on cell function

    Institute of Scientific and Technical Information of China (English)

    Xin-Ming Ma

    2016-01-01

    Objective:To studyNRP-1 gene expression in nasopharyngeal carcinoma tissue and the regulating effect of targeted inhibition of gene expression on cell function.Methods:Nasopharyngeal carcinoma tissue, adjacent tissue and normal tissue were collected, and NRP-1 expression levels were detected; nasopharyngeal carcinoma CNE-2 cells were cultured and transfected with NRP-1 siRNA and negative control (NC) siRNA, and the contents of angiogenesis molecules, proliferation-related proteins and invasion-related proteins were detected.Results:NRP-1 protein content, positive cell rate, staining intensity and IHC score in nasopharyngeal carcinoma tissue were higher than those in adjacent tissue and normal tissue; VEGF, bFGF, EGF and ANG-1 contents in culture medium of NRP1-siRNA group were lower than those in NC-siRNA group; Tie-2, EGFR, Livin, Bmi-1, CDK6, CDK4, CCND1, E2F1, LMP1, FN1, MT1-MMP and Fascin expression levels in cells of NRP1-siRNA group were lower than those in NC-siRNA group.Conclusions:NRP-1 expression level significantly increases in nasopharyngeal carcinoma tissue, and NRP-1 can promote nasopharyngeal carcinoma angiogenesis, cell proliferation and invasion.

  4. Cancer cell sensitivity to bortezomib is associated with survivin expression and p53 status but not cancer cell types

    Directory of Open Access Journals (Sweden)

    Chanan-Khan Asher A

    2010-01-01

    Full Text Available Abstract Background Survivin is known playing a role in drug resistance. However, its role in bortezomib-mediated inhibition of growth and induction of apoptosis is unclear. There are conflicting reports for the effect of bortezomib on survivin expression, which lacks of a plausible explanation. Methods: In this study, we tested cancer cells with both p53 wild type and mutant/null background for the relationship of bortezomib resistance with survivin expression and p53 status using MTT assay, flow cytometry, DNA fragmentation, caspase activation, western blots and RNAi technology. Results We found that cancer cells with wild type p53 show a low level expression of survivin and are sensitive to treatment with bortezomib, while cancer cells with a mutant or null p53 show a high level expression of survivin and are resistant to bortezomib-mediated apoptosis induction. However, silencing of survivin expression utilizing survivin mRNA-specific siRNA/shRNA in p53 mutant or null cells sensitized cancer cells to bortezomib mediated apoptosis induction, suggesting a role for survivin in bortezomib resistance. We further noted that modulation of survivin expression by bortezomib is dependent on p53 status but independent of cancer cell types. In cancer cells with mutated p53 or p53 null, bortezomib appears to induce survivin expression, while in cancer cells with wild type p53, bortezomib downregulates or shows no significant effect on survivin expression, which is dependent on the drug concentration, cell line and exposure time. Conclusions Our findings, for the first time, unify the current inconsistent findings for bortezomib treatment and survivin expression, and linked the effect of bortezomib on survivin expression, apoptosis induction and bortezomib resistance in the relationship with p53 status, which is independent of cancer cell types. Further mechanistic studies along with this line may impact the optimal clinical application of bortezomib in

  5. Dynamic expression of T-bet and GATA3 by regulatory T cells maintains immune tolerance

    OpenAIRE

    Yu, Fang; Sharma, Suveena; Edwards, Julie; Feigenbaum, Lionel; Zhu, Jinfang

    2014-01-01

    Regulatory T (Treg) cells can express the transcription factors T-bet and GATA3 but the function of this expression and whether such cells represent stable subsets is still unknown. By using multiple reporter tools, we show that the expression of T-bet and GATA3 in Treg cells is dynamically influenced by the cytokine environment. Treg cell-specific deletion of either Tbx21 or Gata3 genes singly did not result in loss of Treg cell functions; however, mice with combined deficiency of both genes...

  6. Enhancing Protein Expression in HEK-293 Cells by Lowering Culture Temperature

    OpenAIRE

    Lin, Chi-Yen; Huang, Zhen; Wen, Wei; Wu, Andrew; Wang, Congzhou; Niu, Li

    2015-01-01

    Animal cells and cell lines, such as HEK-293 cells, are commonly cultured at 37°C. These cells are often used to express recombinant proteins. Having a higher expression level or a higher protein yield is generally desirable. As we demonstrate in this study, dropping culture temperature to 33°C, but not lower, 24 hours after transient transfection in HEK-293S cells will give rise to ~1.5-fold higher expression of green fluorescent protein (GFP) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropio...

  7. Comparative identification of Ca2+ channel expression in INS-1 and rat pancreatic β cells

    Institute of Scientific and Technical Information of China (English)

    Fei Li; Zong-Ming Zhang

    2009-01-01

    AIM: To identify and compare the profile of Ca2+ channel subunit expression in INS-1 and rat pancreatic β cells. METHODS: The rat insulin-secreting INS-1 cell line was cultured in RPMI-1640 with Wistar rats employed as islet donors. Ca2+ channel subunit expression in INS-1 and isolated rat β cells were examined by reverse transcription polymerase chain reaction (RT-PCR). Absolute real-time quantitative PCR was performed in a Bio-Rad iQ5 Gradient Real Time PCR system and the data analyzed using an iQ5 system to identify the expression level of the Ca2+ channel subunits. RESULTS: In INS-1 cells, the L-type Ca2+ channel 1C subunit had the highest expression level and the TPRM2 subunit had the second highest expression. In rat β cells, the TPRC4β subunit expression was dominant and the expression of the L-type 1C subunit exceeded the 1D subunit expression about two-fold. This result agreed with other studies, confirming the important role of the L-type 1C subunit in insulinsecreting cells, and suggested that non-voltageoperated Ca2+ channels may have an important role in biphasic insulin secretion. CONCLUSION: Twelve major Ca2+ channel subunit types were identified in INS-1 and rat β cells and significant differences were observed in the expression of certain subunits between these cells.

  8. Correlation between Twist expression and multidrug resistance of breast cancer cell lines

    Institute of Scientific and Technical Information of China (English)

    Yue-Xi Wang; Xiao-Mei Chen; Jun Yan; Zhi-Ping Li

    2016-01-01

    Objective:To study the correlation between Twist expression and multidrug resistance of breast cancer cell lines. Methods:Human breast cancer cell lines MCF-7, cisplatin-resistant human breast cancer cell lines MCF-7/DDP, doxorubicin-resistant human breast cancer cell lines MCF-7/Adr and taxol-resistant human breast cancer cell lines MCF/PTX were cultured, Twist in human breast cancer cell lines MCF-7 was overexpressed and treated with doxorubicin, and then cell viability and expression levels of EMT marker molecules and related signaling pathway molecules were detected. Results:mRNA contents and protein contents of Twist in drug-resistant breast cancer cell lines MCF-7/DDP, MCF-7/Adr and MCF/PTX were higher than those in MCF-7 cell lines;after doxorubicin treatment, inhibitory rates of cell viability in MCF-7 cell lines were higher than those in MCF-7/Adr and MCF-7/Twist cell lines;E-cadherin expression levels in MCF-7/Adr cell lines and MCF-7/Twist cell lines were lower than those in MCF-7 cell lines, and mRNA contents and protein contents of N-cadherin, Vimentin, TGF-β, Smad, Wnt,β-catenin, TNF-αand NF-kB were higher than those in MCF-7 cell lines. Conclusion:Increased expression of Twist is associated with the occurrence of drug resistance in breast cancer cells.

  9. Human herpesvirus 6 infects cervical epithelial cells and transactivates human papillomavirus gene expression.

    OpenAIRE

    Chen, M.; Popescu, N; Woodworth, C; Berneman, Z; M. Corbellino; Lusso, P.; Ablashi, D V; Dipaolo, J. A.

    1994-01-01

    To examine whether human herpesvirus 6 (HHV-6) is capable of infecting human cervical epithelial cells and altering expression of human papillomavirus (HPV) genes, HPV-immortalized or -transformed carcinoma cell lines were infected with HHV-6 variant A. No cytopathic effect was observed in infected cervical cells. However, immunofluorescence indicated that infected cells expressed early-late proteins of HHV-6 by day 3 postinfection. HHV-6 DNA was also detected by Southern blot hybridization a...

  10. Expression of TMPRSS4 in non-small cell lung cancer and its modulation by hypoxia

    OpenAIRE

    NGUYEN, TRI-HUNG; WEBER, WILLIAM; HAVARI, EVIS; CONNORS, TIMOTHY; BAGLEY, REBECCA G.; McLAREN, RAJASHREE; Nambiar, Prashant R; Madden, Stephen L.; Teicher, Beverly A.; Roberts, Bruce; Kaplan, Johanne; SHANKARA, SRINIVAS

    2012-01-01

    Overexpression of TMPRSS4, a cell surface-associated transmembrane serine protease, has been reported in pancreatic, colorectal and thyroid cancers, and has been implicated in tumor cell migration and metastasis. Few reports have investigated both TMPRSS4 gene expression levels and the protein products. In this study, quantitative RT-PCR and protein staining were used to assess TMPRSS4 expression in primary non-small cell lung carcinoma (NSCLC) tissues and in lung tumor cell lines. At the tra...

  11. Glioma Cell Proliferation Controlled by ERK Activity-Dependent Surface Expression of PDGFRA

    OpenAIRE

    Dongfeng Chen; Duo Zuo; Cheng Luan; Min Liu; Manli Na; Liang Ran; Yingyu Sun; Annette Persson; Elisabet Englund; Leif G Salford; Erik Renström; Xiaolong Fan; Enming Zhang

    2014-01-01

    Increased PDGFRA signaling is an essential pathogenic factor in many subtypes of gliomas. In this context the cell surface expression of PDGFRA is an important determinant of ligand sensing in the glioma microenvironment. However, the regulation of spatial distribution of PDGFRA in glioma cells remains poorly characterized. Here, we report that cell surface PDGFRA expression in gliomas is negatively regulated by an ERK-dependent mechanism, resulting in reduced proliferation of glioma cells. G...

  12. CD133-expressing thyroid cancer cells are undifferentiated, radioresistant and survive radioiodide therapy

    Energy Technology Data Exchange (ETDEWEB)

    Ke, Chien-Chih [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); Liu, Ren-Shyan [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); NRPGM, Molecular and Genetic Imaging Core, Taipei (China); National Yang-Ming University, School of Medicine, Taipei (China); Taipei Veterans General Hospital, National PET/Cyclotron Center, Taipei (China); National Yang-Ming University, Department of Biomedical Imaging and Radiological Sciences, Taipei (China); Yang, An-Hang [Taipei Veterans General Hospital, Department of Pathology and Laboratory Medicine, Taipei (China); National Yang-Ming University, Department of Pathology, School of Medicine, Taipei (China); Liu, Ching-Sheng [National Yang-Ming University Medical School, Department of Nuclear Medicine, School of Medicine, Taipei (China); Chi, Chin-Wen [National Yang-Ming University, Institute of Pharmacology, School of Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Medical Research and Education, Taipei (China); Tseng, Ling-Ming [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Tsai, Yi-Fan [Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Ho, Jennifer H. [Taipei Medical University, Graduate Institute of Clinical Medicine, Taipei (China); Taipei Medical University-Wan Fang Medical Center, Department of Ophthalmology, Taipei (China); Taipei Medical University-Wan Fang Medical Center, Center for Stem Cell Research, Taipei (China); Lee, Chen-Hsen [NRPGM, Molecular and Genetic Imaging Core, Taipei (China); National Yang-Ming University, School of Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Lee, Oscar K. [Taipei Veterans General Hospital, Department of Orthopedics, Taipei (China); National Yang-Ming University, Stem Cell Research Center, Taipei (China); Taipei Veterans General Hospital, Department of Medical Research and Education, Taipei (China)

    2013-01-15

    {sup 131}I therapy is regularly used following surgery as a part of thyroid cancer management. Despite an overall relatively good prognosis, recurrent or metastatic thyroid cancer is not rare. CD133-expressing cells have been shown to mark thyroid cancer stem cells that possess the characteristics of stem cells and have the ability to initiate tumours. However, no studies have addressed the influence of CD133-expressing cells on radioiodide therapy of the thyroid cancer. The aim of this study was to investigate whether CD133{sup +} cells contribute to the radioresistance of thyroid cancer and thus potentiate future recurrence and metastasis. Thyroid cancer cell lines were analysed for CD133 expression, radiosensitivity and gene expression. The anaplastic thyroid cancer cell line ARO showed a higher percentage of CD133{sup +} cells and higher radioresistance. After {gamma}-irradiation of the cells, the CD133{sup +} population was enriched due to the higher apoptotic rate of CD133{sup -} cells. In vivo {sup 131}I treatment of ARO tumour resulted in an elevated expression of CD133, Oct4, Nanog, Lin28 and Glut1 genes. After isolation, CD133{sup +} cells exhibited higher radioresistance and higher expression of Oct4, Nanog, Sox2, Lin28 and Glut1 in the cell line or primarily cultured papillary thyroid cancer cells, and lower expression of various thyroid-specific genes, namely NIS, Tg, TPO, TSHR, TTF1 and Pax8. This study demonstrates the existence of CD133-expressing thyroid cancer cells which show a higher radioresistance and are in an undifferentiated status. These cells possess a greater potential to survive radiotherapy and may contribute to the recurrence of thyroid cancer. A future therapeutic approach for radioresistant thyroid cancer may focus on the selective eradication of CD133{sup +} cells. (orig.)

  13. CD133-expressing thyroid cancer cells are undifferentiated, radioresistant and survive radioiodide therapy

    International Nuclear Information System (INIS)

    131I therapy is regularly used following surgery as a part of thyroid cancer management. Despite an overall relatively good prognosis, recurrent or metastatic thyroid cancer is not rare. CD133-expressing cells have been shown to mark thyroid cancer stem cells that possess the characteristics of stem cells and have the ability to initiate tumours. However, no studies have addressed the influence of CD133-expressing cells on radioiodide therapy of the thyroid cancer. The aim of this study was to investigate whether CD133+ cells contribute to the radioresistance of thyroid cancer and thus potentiate future recurrence and metastasis. Thyroid cancer cell lines were analysed for CD133 expression, radiosensitivity and gene expression. The anaplastic thyroid cancer cell line ARO showed a higher percentage of CD133+ cells and higher radioresistance. After γ-irradiation of the cells, the CD133+ population was enriched due to the higher apoptotic rate of CD133- cells. In vivo 131I treatment of ARO tumour resulted in an elevated expression of CD133, Oct4, Nanog, Lin28 and Glut1 genes. After isolation, CD133+ cells exhibited higher radioresistance and higher expression of Oct4, Nanog, Sox2, Lin28 and Glut1 in the cell line or primarily cultured papillary thyroid cancer cells, and lower expression of various thyroid-specific genes, namely NIS, Tg, TPO, TSHR, TTF1 and Pax8. This study demonstrates the existence of CD133-expressing thyroid cancer cells which show a higher radioresistance and are in an undifferentiated status. These cells possess a greater potential to survive radiotherapy and may contribute to the recurrence of thyroid cancer. A future therapeutic approach for radioresistant thyroid cancer may focus on the selective eradication of CD133+ cells. (orig.)

  14. Distinct gene expression signatures in human embryonic stem cells differentiated towards definitive endoderm at single-cell level

    DEFF Research Database (Denmark)

    Norrman, Karin; Strömbeck, Anna; Semb, Henrik;

    2013-01-01

    of anterior definitive endoderm (DE). Here, we differentiated human embryonic stem cells towards DE using three different activin A based treatments. Differentiation efficiencies were evaluated by gene expression profiling over time at cell population level. A panel of key markers was used to study DE...... for the three activin A based protocols applied. Our data provide novel insights in DE gene expression at the cellular level of in vitro differentiated human embryonic stem cells, and illustrate the power of using single-cell gene expression profiling to study differentiation heterogeneity and to characterize......Characterization of directed differentiation of pluripotent stem cells towards therapeutically relevant cell types, including pancreatic beta-cells and hepatocytes, depends on molecular markers and assays that resolve the signature of individual cells. Pancreas and liver both have a common origin...

  15. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

  16. Plasma cell toll-like receptor (TLR) expression differs from that of B cells, and plasma cell TLR triggering enhances immunoglobulin production

    Science.gov (United States)

    Dorner, Marcus; Brandt, Simone; Tinguely, Marianne; Zucol, Franziska; Bourquin, Jean-Pierre; Zauner, Ludwig; Berger, Christoph; Bernasconi, Michele; Speck, Roberto F; Nadal, David

    2009-01-01

    Toll-like receptors (TLRs) are key receptors of the innate immune system and show cell subset-specific expression. We investigated the messenger RNA (mRNA) expression of TLR genes in human haematopoietic stem cells (HSC), in naïve B cells, in memory B cells, in plasma cells from palatine tonsils and in plasma cells from peripheral blood. HSC and plasma cells showed unrestricted expression of TLR1–TLR9, in contrast to B cells which lacked TLR3, TLR4 and TLR8 but expressed mRNA of all other TLRs. We demonstrated, for the first time, that TLR triggering of terminally differentiated plasma cells augments immunoglobulin production. Thus, boosting the immediate antibody response by plasma cells upon pathogen recognition may point to a novel role of TLRs. PMID:19950420

  17. Differential expression profiles of glycosphingolipids in human breast cancer stem cells vs. cancer non-stem cells

    DEFF Research Database (Denmark)

    Liang, Yuh-Jin; Ding, Yao; Levery, Steven B;

    2013-01-01

    Previous studies demonstrated that certain glycosphingolipids (GSLs) are involved in various cell functions, such as cell growth and motility. Recent studies showed changes in GSL expression during differentiation of human embryonic stem cells; however, little is known about expression profiles...... of GSLs in cancer stem cells (CSCs). CSCs are a small subpopulation in cancer and are proposed as cancer-initiating cells, have been shown to be resistant to numerous chemotherapies, and may cause cancer recurrence. Here, we analyzed GSLs expressed in human breast CSCs by applying a CSC model induced...... significantly reduced the expression of GD2 and GD3 and caused a phenotype change from CSC to a non-CSC, which was detected by reduced mammosphere formation and cell motility. Our results provide insight into GSL profiles in human breast CSCs, indicate a functional role of GD2 and GD3 in CSCs, and suggest...

  18. Development of early PCLP1-expressing haematopoietic cells within the avian dorsal aorta.

    Science.gov (United States)

    Suonpää, P; Kohonen, P; Koskela, K; Koskiniemi, H; Salminen-Mankonen, H; Lassila, O

    2005-09-01

    The first haematopoietic stem cells (HSC) develop in the dorsal aorta as haematopoietic intra-aortic clusters (HIAC). To evaluate the initial steps of definitive haematopoiesis, we have studied the emergence and the expression profile of podocalyxin-like protein 1 (PCLP1)-expressing cells in early chick embryos. Here we demonstrate that at embryonic day 2 (E2), the PCLP1+ cells are present in the splanchnic mesoderm and in the ventral lining of the paired dorsal aorta. Following aortic fusion at E3, the PCLP1-expressing cells are exclusively found in the aortic floor and as the development proceeds, both the haematopoietic clusters and the aortic endothelial cells express PCLP1. In parallel with the early PCLP1 expression, bone morphogenetic protein 4 (BMP4) expression was detected in the splanchnopleura and thereafter in the densely packed mesenchymal cells beneath the HIAC. The microarray analyses of early E3 PCLP1+ cells revealed elevated expression of genes known to be involved in the stem cell function. These data suggest that splanchnopleura-derived PCLP1-expressing cells give rise to the earliest definitive haematopoietic progenitors. PMID:16179008

  19. Generation of functional CD8+ T Cells by human dendritic cells expressing glypican-3 epitopes

    Directory of Open Access Journals (Sweden)

    Farzaneh Farzin

    2010-05-01

    Full Text Available Abstract Background Glypican 3 (GPC-3 is an oncofoetal protein that is expressed in most hepatocellular carcinomas (HCC. Since it is a potential target for T cell immunotherapy, we investigated the generation of functional, GPC-3 specific T cells from peripheral blood mononuclear cells (PBMC. Methods Dendritic cells (DC were derived from adherent PBMC cultured at 37°C for 7 days in X-Vivo, 1% autologous plasma, and 800 u/ml GM-CSF plus 500 u/ml IL-4. Immature DC were transfected with 20 μg of in vitro synthesised GPC-3 mRNA by electroporation using the Easy-ject plus system (Equibio, UK (300 V, 150 μF and 4 ms pulse time, or pulsed with peptide, and subsequently matured with lipopolysaccharide (LPS. Six predicted GPC-3 peptide epitopes were synthesized using standard f-moc technology and tested for their binding affinity to HLA-A2.1 molecules using the cell line T2. Results DC transfected with GPC-3 mRNA but not control DC demonstrated strong intracellular staining for GPC-3 and in vitro generated interferon-gamma expressing T cells from autologous PBMC harvested from normal subjects. One peptide, GPC-3522-530 FLAELAYDL, fulfilled our criteria as a naturally processed, HLA-A2-restricted cytotoxic T lymphocyte (CTL epitope: i it showed high affinity binding to HLA-A2, in T2 cell binding assay; ii it was generated by the MHC class I processing pathway in DC transfected with GPC-3 mRNA, and iii HLA-A2 positive DC loaded with the peptide stimulated proliferation in autologous T cells and generated CTL that lysed HLA-A2 and GPC-3 positive target cells. Conclusions These findings demonstrate that electroporation of GPC-3 mRNA is an efficient method to load human monocyte-derived DC with antigen because in vitro they generated GPC-3-reactive T cells that were functional, as shown by interferon-gamma production. Furthermore, this study identified a novel naturally processed, HLA-A2-restricted CTL epitope, GPC-3522-530 FLAELAYDL, which can be used to

  20. Regulation of the cell cycle via mitochondrial gene expression and energy metabolism in HeLa cells

    Institute of Scientific and Technical Information of China (English)

    Wei Xiong; Yang Jiao; Weiwei Huang; Mingxing Ma; Min Yu; Qinghua Cui; Deyong Tan

    2012-01-01

    Human cervical cancer HeLa cells have functional mitochondria.Recent studies have suggested that mitochondrial metabolism plays an essential role in tumor cell proliferation.Nevertheless,how cells coordinate mitochondrial dynamics and cell cycle progression remains to be clarified.To investigate the relationship between mitochondrial function and cell cycle regulation,the mitochondrial gene expression profile and cellular ATP levels were determined by cell cycle progress analysis in the present study.HeLa cells were synchronized in the G0/G1 phase by serum starvation,and re-entered cell cycle by restoring serum culture,time course experiment was performed to analyze the expression of mitochondrial transcription regulators and mitochondrial genes,mitochondrial membrane potential (MMP),cellular ATP levels,and cell cycle progression.The results showed that when arrested G0/G1 cells were stimulated in serum-containing medium,the amount of DNA and the expression levels of both mRNA and proteins in mitochondria started to increase at 2 h time point,whereas the MMP and ATP level elevated at 4 h.Furthermore,the cyclin D1 expression began to increase at 4 h after serum triggered cell cycle.ATP synthesis inhibitor-oligomycintreatment suppressed the cyclin D1 and cyclin B1 expression levels and blocked cell cycle progression.Taken together,our results suggested that increased mitochondrial gene expression levels,oxidative phosphorylation activation,and cellular ATP content increase are important events for triggering cell cycle.Finally,we demonstrated that mitochondrial gene expression levels and cellular ATP content are tightly regulated and might play a central role in regulating cell proliferation.

  1. Expression profile of microRNAs regulating proliferation and differentiation in mouse adult cardiac stem cells.

    Directory of Open Access Journals (Sweden)

    Luis Brás-Rosário

    Full Text Available The identification of cardiac cells with stem cell properties changed the paradigm of the heart as a post mitotic organ. These cells proliferate and differentiate into cardiomyocytes, endothelial and vascular smooth muscle cells, providing for cardiac cell homeostasis and regeneration. microRNAs are master switches controlling proliferation and differentiation, in particular regulating stem cell biology and cardiac development. Modulation of microRNAs -regulated gene expression networks holds the potential to control cell fate and proliferation, with predictable biotechnologic and therapeutic applications. To obtain insights into the regulatory networks active in cardiac stem cells, we characterized the expression profile of 95 microRNAs with reported functions in stem cell and tissue differentiation in mouse cardiac stem cells, and compared it to that of mouse embryonic heart and mesenchymal stem cells. The most highly expressed microRNAs identified in cardiac stem cells are known to target key genes involved in the control of cell proliferation and adhesion, vascular function and cardiomyocyte differentiation. We report a subset of differentially expressed microRNAs that are proposed to act as regulators of differentiation and proliferation of adult cardiac stem cells, providing novel insights into active gene expression networks regulating their biological properties.

  2. Co-regulation of pituitary tumor cell adhesion and prolactin gene expression by glucocorticoid.

    Science.gov (United States)

    Spangler, P R; Delidow, B C

    1998-01-01

    Rat 235-1 pituitary tumor cells are lactotrophs producing high levels of prolactin (PRL). Dexamethasone (Dex, 100 nM) inhibits PRL gene expression in 235-1 cells by 50%, while simultaneously decreasing cell replication and cell-cell aggregation. To determine the time course of Dex action, we used a quantitative assay for cell-cell interaction, based on the number of single cells present before and after re-aggregation of dispersed cells. 235-1 cells were cultured in growth medium or medium plus 100 nM Dex for 1-4 days before assay. Control cells had 90% re-aggregation on all days of assay. Aggregation of Dex-treated cells decreased to 55% by day 4. Dex treatment also reduced cell numbers by 40%, but this decrease did not contribute to reduced aggregation. To determine the mechanism of Dex-inhibited cell-cell adhesion, we examined the expression of cadherins and catenins. Cadherin-related mRNAs (P- and N-cadherin probes) were detectable in 235-1 cells, but their levels were unchanged by Dex. A pancadherin antibody was unable to detect classical cadherins in these cells. Both alpha- and beta-catenins were detected by Western blotting and their levels were decreased by Dex. Unlike control aggregates, aggregates of Dex-treated cells were able to inhibit expression of PRL mRNA when added to monolayers of 235-1 cells. These data suggest that Dex influences cadherin function by inhibiting catenin expression and that this has the functional consequence of altering 235-1 cell-cell interactions. Overall the data show that Dex affects important aspects of lactotroph function other than PRL gene expression. These changes may include physical alterations in pituitary cell contacts that further support a change in functional state. PMID:9397162

  3. Granulosa cells and retinoic acid co-treatment enrich potential germ cells from manually selected Oct4-EGFP expressing human embryonic stem cells.

    Science.gov (United States)

    Chen, Hsin-Fu; Jan, Pey-Shynan; Kuo, Hung-Chih; Wu, Fang-Chun; Lan, Chen-Wei; Huang, Mei-Chi; Chien, Chung-Liang; Ho, Hong-Nerng

    2014-09-01

    Differentiation of human embryonic stem (HES) cells to germ cells may become clinically useful in overcoming diseases related to germ-cell development. Niches were used to differentiate HES cell lines, NTU1 and H9 Oct4-enhanced green fluorescence protein (EGFP), including laminin, granulosa cell co-culture or conditioned medium, ovarian stromal cell co-culture or conditioned medium, retinoic acid, stem cell factor (SCF) and BMP4-BMP7-BMP8b treatment. Flow cytometry showed that granulosa cell co-culture (P cells expressing early germ cell marker stage-specific embryonic antigen 1(SSEA1); sorted SSEA1[+] cells did not express higher levels of germ cell gene VASA and GDF9. Manually collected H9 Oct4-EGFP[+] cells expressed significantly higher levels of VASA (P = 0.005) and GDF9 (P = 0.001). H9 Oct4-EGFP[+] cells developed to ovarian follicle-like structures after culture for 28 days but with low efficiency. Unlike SCF and BMP4, retinoic acid co-treatment enhanced VASA, GDF9 and SCP3 expression. A protocol is recommended to enrich differentiated HES cells with germ-cell potential by culture with granulosa cells, conditioned medium or retinoic acid, manual selection of Oct4-EGFP[+] cells, and analysis of VASA, GDF9 expression, or both.

  4. Nocodazole treatment decreases expression of pluripotency markers Nanog and Oct4 in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Ade Kallas

    Full Text Available Nocodazole is a known destabiliser of microtubule dynamics and arrests cell-cycle at the G2/M phase. In the context of the human embryonic stem cell (hESC it is important to understand how this arrest influences the pluripotency of cells. Here we report for the first time the changes in the expression of transcription markers Nanog and Oct4 as well as SSEA-3 and SSEA-4 in human embryonic cells after their treatment with nocodazole. Multivariate permeabilised-cell flow cytometry was applied for characterising the expression of Nanog and Oct4 during different cell cycle phases. Among untreated hESC we detected Nanog-expressing cells, which also expressed Oct4, SSEA-3 and SSEA-4. We also found another population expressing SSEA-4, but without Nanog, Oct4 and SSEA-3 expression. Nocodazole treatment resulted in a decrease of cell population positive for all four markers Nanog, Oct4, SSEA-3, SSEA-4. Nocodazole-mediated cell-cycle arrest was accompanied by higher rate of apoptosis and upregulation of p53. Twenty-four hours after the release from nocodazole block, the cell cycle of hESC normalised, but no increase in the expression of transcription markers Nanog and Oct4 was detected. In addition, the presence of ROCK-2 inhibitor Y-27632 in the medium had no effect on increasing the expression of pluripotency markers Nanog and Oct4 or decreasing apoptosis or the level of p53. The expression of SSEA-3 and SSEA-4 increased in Nanog-positive cells after wash-out of nocodazole in the presence and in the absence of Y-27632. Our data show that in hESC nocodazole reversible blocks cell cycle, which is accompanied by irreversible loss of expression of pluripotency markers Nanog and Oct4.

  5. Regulation of ADAM12 cell-surface expression by protein kinase C epsilon

    DEFF Research Database (Denmark)

    Sundberg, Christina; Thodeti, Charles Kumar; Kveiborg, Marie;

    2004-01-01

    constitutively active protein. However, little is known about the regulation of ADAM12 cell-surface translocation. Here, we used human RD rhabdomyosarcoma cells, which express ADAM12 at the cell surface, in a temporal pattern. We report that protein kinase C (PKC) epsilon induces ADAM12 translocation to the cell......The ADAM (a disintegrin and metalloprotease) family consists of multidomain cell-surface proteins that have a major impact on cell behavior. These transmembrane-anchored proteins are synthesized as proforms that have (from the N terminus): a prodomain; a metalloprotease-, disintegrin......-immunoprecipitated from membrane-enriched fractions of PMA-treated cells, 3) RD cells transfected with EGFP-tagged, myristoylated PKCepsilon expressed more ADAM12 at the cell surface than did non-transfected cells, and 4) RD cells transfected with a kinase-inactive PKCepsilon mutant did not exhibit ADAM12 cell...

  6. Expression of Hyaluronan and the Hyaluronan-Binding Proteoglycans Neurocan, Aggrecan and Versican by Neural Stem Cells and Neural Cells Derived from Embryonic Stem Cells

    OpenAIRE

    Abaskharoun, Mary; Bellemare, Marie; Lau, Elizabeth; Margolis, Richard U

    2010-01-01

    We have examined the expression and localization patterns of hyaluronan and hyaluronan-binding chondroitin sulfate proteoglycans in neural stem cells and differentiated neural cells derived from mouse embryonic stem cells. Expression of proteoglycans and hyaluronan was weak in the SSEA1-positive embryonic stem cells but increased noticeably after retinoic acid induction to nestin-positive neural stem cells. After subsequent plating, the hyaluronan-binding chondroitin sulfate proteoglycans agg...

  7. Lineage relationship of prostate cancer cell types based on gene expression

    Directory of Open Access Journals (Sweden)

    Ware Carol B

    2011-05-01

    Full Text Available Abstract Background Prostate tumor heterogeneity is a major factor in disease management. Heterogeneity could be due to multiple cancer cell types with distinct gene expression. Of clinical importance is the so-called cancer stem cell type. Cell type-specific transcriptomes are used to examine lineage relationship among cancer cell types and their expression similarity to normal cell types including stem/progenitor cells. Methods Transcriptomes were determined by Affymetrix DNA array analysis for the following cell types. Putative prostate progenitor cell populations were characterized and isolated by expression of the membrane transporter ABCG2. Stem cells were represented by embryonic stem and embryonal carcinoma cells. The cancer cell types were Gleason pattern 3 (glandular histomorphology and pattern 4 (aglandular sorted from primary tumors, cultured prostate cancer cell lines originally established from metastatic lesions, xenografts LuCaP 35 (adenocarcinoma phenotype and LuCaP 49 (neuroendocrine/small cell carcinoma grown in mice. No detectable gene expression differences were detected among serial passages of the LuCaP xenografts. Results Based on transcriptomes, the different cancer cell types could be clustered into a luminal-like grouping and a non-luminal-like (also not basal-like grouping. The non-luminal-like types showed expression more similar to that of stem/progenitor cells than the luminal-like types. However, none showed expression of stem cell genes known to maintain stemness. Conclusions Non-luminal-like types are all representatives of aggressive disease, and this could be attributed to the similarity in overall gene expression to stem and progenitor cell types.

  8. In vitro invasion of small-cell lung cancer cell lines correlates with expression of epidermal growth factor receptor

    DEFF Research Database (Denmark)

    Damstrup, L; Rude Voldborg, B; Spang-Thomsen, M;

    1998-01-01

    % of the cells added to the upper chamber were able to traverse the Matrigel membrane. Expression of several matrix metalloproteases (MMP), of tissue inhibitor of MMP (TIMP) and of cathepsin B was evaluated by immunoprecipitation, Western blot analysis and reverse transcriptase polymerase chain reaction (RT-PCR...... receptor (EGFR) in a panel of 21 small-cell lung cancer (SCLC) cell lines. We have previously reported that ten of these cell lines expressed EGFR protein detected by radioreceptor and affinity labelling assays. In 11 small-cell lung cancer (SCLC) cell lines, EGFR mRNA was detected by Northern blot...... analysis. In vitro invasion in a Boyden chamber assay was found in all EGFR-positive cell lines, whereas no invasion was detected in the EGFR-negative cell lines. Quantification of the in vitro invasion in 12 selected SCLC cell lines demonstrated that, in the EGFR-positive cell lines, between 5% and 16...

  9. An in situ hybridization-based screen for heterogeneously expressed genes in mouse ES cells.

    Science.gov (United States)

    Carter, Mark G; Stagg, Carole A; Falco, Geppino; Yoshikawa, Toshiyuki; Bassey, Uwem C; Aiba, Kazuhiro; Sharova, Lioudmila V; Shaik, Nabeebi; Ko, Minoru S H

    2008-02-01

    We previously reported that Zscan4 showed heterogeneous expression patterns in mouse embryonic stem (ES) cells. To identify genes that show similar expression patterns, we carried out high-throughput in situ hybridization assays on ES cell cultures for 244 genes. Most of the genes are involved in transcriptional regulation, and were selected using microarray-based comparisons of gene expression profiles in ES and embryonal carcinoma (EC) cells versus differentiated cell types. Pou5f1 (Oct4, Oct3/4) and Krt8 (EndoA) were used as controls. Hybridization signals were detected on ES cell colonies for 147 genes (60%). The majority (136 genes) of them showed relatively homogeneous expression in ES cell colonies. However, we found that two genes unequivocally showed Zscan4-like spotted expression pattern (spot-in-colony pattern; Whsc2 and Rhox9). We also found that nine genes showed relatively heterogeneous expression pattern (mosaic-in-colony pattern: Zfp42/Rex1, Rest, Atf4, Pa2g4, E2f2, Nanog, Dppa3/Pgc7/Stella, Esrrb, and Fscn1). Among these genes, Zfp42/Rex1 showed unequivocally heterogeneous expression in individual ES cells prepared by the CytoSpin. These results show the presence of different types or states of cells within ES cell cultures otherwise thought to be undifferentiated and homogeneous, suggesting a previously unappreciated complexity in ES cell cultures.

  10. Gene expression profiling bovine ovarian follicular and luteal cells provides insight into cellular identities and functions

    Science.gov (United States)

    After ovulation, somatic cells of the ovarian follicle (theca and granulosa cells) become the small and large luteal cells of the corpus luteum. Aside from known cell type-specific receptors and steroidogenic enzymes, little is known about the differences in the gene expression profiles of these fou...

  11. Cancer-testis antigen expression in digestive tract carcinomas: frequent expression in esophageal squamous cell carcinoma and its precursor lesions.

    Science.gov (United States)

    Chen, Yao-Tseng; Panarelli, Nicole C; Piotti, Kathryn C; Yantiss, Rhonda K

    2014-05-01

    Cancer-testis (CT) antigens are attractive tumor antigens for cancer immunotherapy. They comprise a group of proteins normally expressed in germ cells and aberrantly activated in a variety of human cancers. The protein expression of eight cancer-testis antigens [MAGEA, NY-ESO-1, GAGE, MAGEC1 (CT7), MAGEC2 (CT10), CT45, SAGE1, and NXF2] was evaluated by immunohistochemistry in 61 esophageal carcinomas (40 adenocarcinoma and 21 squamous cell carcinoma), 50 gastric carcinomas (34 diffuse and 16 intestinal type), and 141 colorectal carcinomas. The highest frequency of expression was found in esophageal squamous cell carcinomas: Positive staining for MAGEA, CT45, CT7, SAGE1, GAGE, NXF2, NY-ESO-1, and CT10 was observed in 57%, 38%, 33%, 33%, 29%, 29%, 19%, and 14% of squamous cell carcinomas, respectively. Similar staining patterns were observed in squamous dysplasias. Expression frequencies of cancer-testis antigens were seen in 2% to 24% of gastroesophageal adenocarcinomas and were not significantly different between adenocarcinomas of the stomach versus the esophagus, or between diffuse and intestinal types of gastric adenocarcinomas. Colorectal cancers did not express NY-ESO-1, CT7, CT10, or GAGE, and only infrequently expressed SAGE1 (0.7%) MAGEA (1.4%), CT45 (3.5%), and NXF2 (8.5%). We conclude that cancer-testis antigens are frequently expressed in esophageal squamous neoplasms. Although cancer-testis antigens are generally considered to be expressed later in tumor progression, they are found in squamous dysplasias, suggesting a potential diagnostic role for cancer-testis antigens in the evaluation of premalignant squamous lesions.

  12. Expression of members of immunoglobulin gene family in somatic cell hybrids between human B and T cells

    Energy Technology Data Exchange (ETDEWEB)

    Kozbor, D.; Burioni, R.; Ar-Rushdi, A.; Zmijewski, C.; Croce, C.M.

    1987-07-01

    Somatic cell hybrids were obtained between human T and B cells and tested for the expression of differentiated traits of both cell lineages. The T-cell parent SUP-T1 is CD3/sup -/, CD4/sup +/, CD1/sup +/, CD8/sup +/, is weakly positive for HLA class I determinants, and has an inversion of chromosome 14 due to a site-specific recombination event between an immunoglobulin heavy-chain variable gene and the joining segment of the T-cell receptor ..cap alpha.. chain. The B-cell parent, the 6-thioguanine- and ouabain-resistant mutant GM1500, is a lymphoblastoid cell line that secretes IgG2, K chains, and expresses B1, B532, and HLA class I and II antigens. All hybrids expressed characteristics of B cells (Ig/sup +/, B1/sup +/, B532/sup +/, EBNA/sup +/, HLA antigens), whereas only CD4 among the T-cell markers was expressed. The level of T-cell receptor ..beta..-chain transcript was greatly reduced and no RNA of the chimeric T-cell receptor ..cap alpha..-chain joining segment-immunoglobulin heavy-chain variable region was detected. Southern blot analysis indicated that absence of T-cell differentiation markers in the hybrids was not due to chromosomal loss. Rather, some B-cell-specific factor present in the hybrids may account for the suppression.

  13. Expression of members of immunoglobulin gene family in somatic cell hybrids between human B and T cells

    International Nuclear Information System (INIS)

    Somatic cell hybrids were obtained between human T and B cells and tested for the expression of differentiated traits of both cell lineages. The T-cell parent SUP-T1 is CD3-, CD4+, CD1+, CD8+, is weakly positive for HLA class I determinants, and has an inversion of chromosome 14 due to a site-specific recombination event between an immunoglobulin heavy-chain variable gene and the joining segment of the T-cell receptor α chain. The B-cell parent, the 6-thioguanine- and ouabain-resistant mutant GM1500, is a lymphoblastoid cell line that secretes IgG2, K chains, and expresses B1, B532, and HLA class I and II antigens. All hybrids expressed characteristics of B cells (Ig+, B1+, B532+, EBNA+, HLA antigens), whereas only CD4 among the T-cell markers was expressed. The level of T-cell receptor β-chain transcript was greatly reduced and no RNA of the chimeric T-cell receptor α-chain joining segment-immunoglobulin heavy-chain variable region was detected. Southern blot analysis indicated that absence of T-cell differentiation markers in the hybrids was not due to chromosomal loss. Rather, some B-cell-specific factor present in the hybrids may account for the suppression

  14. Cell cycle and anti-estrogen effects synergize to regulate cell proliferation and ER target gene expression.

    Directory of Open Access Journals (Sweden)

    Mathieu Dalvai

    Full Text Available Antiestrogens are designed to antagonize hormone induced proliferation and ERalpha target gene expression in mammary tumor cells. Commonly used drugs such as OH-Tamoxifen and ICI 182780 (Fulvestrant block cell cycle progression in G0/G1. Inversely, the effect of cell cycle stage on ER regulated gene expression has not been tested directly. We show that in ERalpha-positive breast cancer cells (MCF-7 the estrogen receptor gene and downstream target genes are cell cycle regulated with expression levels varying as much as three-fold between phases of the cell cycle. Steroid free culture conditions commonly used to assess the effect of hormones or antiestrogens on gene expression also block MCF-7 cells in G1-phase when several ERalpha target genes are overexpressed. Thus, cell cycle effects have to be taken into account when analyzing the impact of hormonal treatments on gene transcription. We found that antiestrogens repress transcription of several ERalpha target genes specifically in S phase. This observation corroborates the more rapid and strong impact of antiestrogen treatments on cell proliferation in thymidine, hydroxyurea or aphidicolin arrested cells and correlates with an increase of apoptosis compared to similar treatments in lovastatin or nocodazol treated cells. Hence, cell cycle effects synergize with the action of antiestrogens. An interesting therapeutic perspective could be to enhance the action of anti-estrogens by associating hormone-therapy with specific cell cycle drugs.

  15. Differential expression of nanog1 and nanogp8 in colon cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ishiguro, Tatsuya; Sato, Ai; Ohata, Hirokazu; Sakai, Hiroaki [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Nakagama, Hitoshi, E-mail: hnakagam@ncc.go.jp [Division of Cancer Development System, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Okamoto, Koji, E-mail: kojokamo@ncc.go.jo [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan)

    2012-02-10

    Highlights: Black-Right-Pointing-Pointer Nanog is expressed in a majority of colon cancer cell lines examined. Black-Right-Pointing-Pointer Both nanog1 and nanogp8 are expressed in colon cancer cells with varying ratios. Black-Right-Pointing-Pointer Nanog mediates cell proliferation of colon cancer cells. Black-Right-Pointing-Pointer Nanog predominantly localizes in cytoplasm of colon cancer cells. -- Abstract: Nanog, a homeodomain transcription factor, is an essential regulator for promotion of self-renewal of embryonic stem cells and inhibition of their differentiation. It has been demonstrated that nanog1 as well as nanogp8, a retrogene of nanog1, is preferentially expressed in advanced stages of several types of cancer, suggesting their involvement during cancer progression. Here, we investigated the expression of Nanog in well-characterized colon cancer cell lines. Expression of Nanog was detectable in 5 (HCT116, HT29, RKO, SW48, SW620) out of seven cell lines examined. RNA expression analyses of nanog1 and nanogp8 indicated that, while nanog1 was a major form in SW620 as well as in teratoma cells Tera-2, nanogp8 was preferentially expressed in HT29 and HCT116. In accordance with this, shRNA-mediated knockdown of nanog1 caused the reduction of Nanog in SW620 but not in HT29. Inhibition of Nanog in SW620 cells negatively affected cell proliferation and tumor formation in mouse xenograft. Biochemical subcellular fractionation and immunostaining analyses revealed predominant localization of Nanog in cytoplasm in SW620 and HT29, while it was mainly localized in nucleus in Tera-2. Our data indicate that nanog1 and nanogp8 are differentially expressed in colon cancer cells, and suggest that their expression contributes to proliferation of colon cancer cells.

  16. Intracellular expression of toll-like receptor 4 in neuroblastoma cells and their unresponsiveness to lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    Mori Isamu

    2006-12-01

    Full Text Available Abstract Background Recently it has been reported that, toll-like receptors (TLRs are expressed on a series of tumor cells, such as colon cancer, breast cancer, prostate cancer, melanoma and lung cancer. Although some cancer cells like melanoma cells are known to respond to lipopolysaccharide (LPS via TLR4, not all cancer cells are positive for TLR4. There is little information on the expression and function of TLR4 in neuroblastoma cells. In this study, we investigated the expression of TLR4 in human neuroblastoma NB-1 cell line. Methods Expression and localization of TLR4 were detected by reverse transcription-polymerase chain reaction (RT-PCR and flow cytometric analysis, respectively. Activation of nuclear factor (NF-κB by LPS was detected by degradation of IκB-α and NF-κB luciferase assay. Activation and expression of mitogen-activated protein (MAP kinase and interferon regulatory factor (IRF-3 was detected by immunoblot analysis. Results Human NB-1 neuroblastoma cells expressed intracellular form of TLR4, but not the cell surface form. Further, NB-1 cells express CD14, MD2 and MyD88, which are required for LPS response. However, LPS did not significantly induce NF-κB activation in NB-1 cells although it slightly degraded IκB-α. NB-1 cells expressed no IRF-3, which plays a pivotal role on the MyD88-independent pathway of LPS signaling. Collectively, NB-1 cells are capable to avoid their response to LPS. Conclusion Although human NB-1 neuroblastoma cells possessed all the molecules required for LPS response, they did not respond to LPS. It might be responsible for intracellular expression of TLR4 or lack of IRF-3.

  17. Variability of gene expression profiles in human blood and lymphoblastoid cell lines

    Directory of Open Access Journals (Sweden)

    Taylor Jennifer M

    2010-02-01

    Full Text Available Abstract Background Readily accessible samples such as peripheral blood or cell lines are increasingly being used in large cohorts to characterise gene expression differences between a patient group and healthy controls. However, cell and RNA isolation procedures and the variety of cell types that make up whole blood can affect gene expression measurements. We therefore systematically investigated global gene expression profiles in peripheral blood from six individuals collected during two visits by comparing five of the following cell and RNA isolation methods: whole blood (PAXgene, peripheral blood mononuclear cells (PBMCs, lymphoblastoid cell lines (LCLs, CD19 and CD20 specific B-cell subsets. Results Gene expression measurements were clearly discriminated by isolation method although the reproducibility was high for all methods (range ρ = 0.90-1.00. The PAXgene samples showed a decrease in the number of expressed genes (P -16 with higher variability (P -16 compared to the other methods. Differentially expressed probes between PAXgene and PBMCs were correlated with the number of monocytes, lymphocytes, neutrophils or erythrocytes. The correlations (ρ = 0.83; ρ = 0.79 of the expression levels of detected probes between LCLs and B-cell subsets were much lower compared to the two B-cell isolation methods (ρ = 0.98. Gene ontology analysis of detected genes showed that genes involved in inflammatory responses are enriched in B-cells CD19 and CD20 whereas genes involved in alcohol metabolic process and the cell cycle were enriched in LCLs. Conclusion Gene expression profiles in blood-based samples are strongly dependent on the predominant constituent cell type(s and RNA isolation method. It is crucial to understand the differences and variability of gene expression measurements between cell and RNA isolation procedures, and their relevance to disease processes, before application in large clinical studies.

  18. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

    Science.gov (United States)

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  19. Identification of Functional Human Splenic Memory B Cells by Expression of CD148 and CD27

    OpenAIRE

    Tangye, Stuart G.; Liu, Yong-Jun; Aversa, Gregorio; Phillips, Joseph H.; Vries, Jan E. de

    1998-01-01

    Memory B cells isolated from human tonsils are characterized by an activated cell surface phenotype, localization to mucosal epithelium, expression of somatically mutated immunoglobulin (Ig) variable (V) region genes, and a preferential differentiation into plasma cells in vitro. In spleens of both humans and rodents, a subset of memory B cells is believed to reside in the marginal zone of the white pulp. Similar to tonsil-derived memory B cells, splenic marginal zone B cells can be distingui...

  20. Comprehensive qPCR profiling of gene expression in single neuronal cells

    OpenAIRE

    Citri, Ami; Pang, Zhiping P.; Sudhof, Thomas C.; Wernig, Marius; Malenka, Robert C.

    2011-01-01

    A major challenge in neuronal stem cell biology lies in characterization of lineage-specific reprogrammed human neuronal cells, a process that necessitates the use of an assay sensitive to the single-cell level. Single-cell gene profiling can provide definitive evidence regarding the conversion of one cell type into another at a high level of resolution. The protocol we describe employs Fluidigm Biomark dynamic arrays for high-throughput expression profiling from single neuronal cells, assayi...

  1. Expression Profile of microRNAs Regulating Proliferation and Differentiation in Mouse Adult Cardiac Stem Cells

    OpenAIRE

    Brás-Rosário, Luis; Matsuda, Alex; Pinheiro, Ana Isabel; Gardner, Rui; Lopes, Telma; Amaral, Andreia; Gama-Carvalho, Margarida

    2013-01-01

    The identification of cardiac cells with stem cell properties changed the paradigm of the heart as a post mitotic organ. These cells proliferate and differentiate into cardiomyocytes, endothelial and vascular smooth muscle cells, providing for cardiac cell homeostasis and regeneration. microRNAs are master switches controlling proliferation and differentiation, in particular regulating stem cell biology and cardiac development. Modulation of microRNAs -regulated gene expression networks holds...

  2. Virus-activated T cells regulate expression of adhesion molecules on endothelial cells in sites of infection

    DEFF Research Database (Denmark)

    Marker, O; Scheynius, A; Christensen, Jan Pravsgaard;

    1995-01-01

    inflammatory cells were strongly positive for LFA-1, VLA-4, Pgp-1 and ICAM-1. Expression of ICAM-1 and VCAM-1 was upregulated on the endothelial cells in immunocompetent mice, but not in T-cell deficient nude mice. Analysis of mice deficient in either CD4+ or CD8+ T cells, revealed that not only...... was the inflammatory reaction dependent on the presence of CD8+ cells, but these cells also appeared to be required for maximal upregulation of ICAM-1 and VCAM-1 on the endothelial cells. These results indicate that virus-specific CD8+ T cells are crucially involved in regulating the inflammatory reaction through...

  3. Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Schuller Hildegard M

    2005-08-01

    Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein

  4. Expression of G-protein inwardly rectifying potassium channels (GIRKs) in lung cancer cell lines

    International Nuclear Information System (INIS)

    Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1) in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR) and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU) assay. GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC) cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM) daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM) decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM) also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2) was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4) mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4) mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein expression was not seen in any non-SCLC cells

  5. Protein expression of G-protein inwardly rectifying potassium channels (GIRK in breast cancer cells

    Directory of Open Access Journals (Sweden)

    Plummer Howard K

    2006-08-01

    Full Text Available Abstract Background Previous data from our laboratory has indicated that a functional link exists between the G-protein-coupled inwardly rectifying potassium (GIRK channel and the beta-adrenergic receptor pathway in breast cancer cell lines, and these pathways were involved in growth regulation of these cells. Alcohol is an established risk factor for breast cancer and has been found to open GIRK. In order to further investigate GIRK channels in breast cancer and possible alteration by ethanol, we identified GIRK channel protein expression in breast cancer cells. Results Cell pellets were collected and membrane protein was isolated to determine GIRK protein expression. GIRK protein was also analyzed by immuno-precipitation. GIRK protein was over-expressed in cells by transfection of GIRK plasmids. Gene expression studies were done by real-time RT-PCR. GIRK protein expression was identified in breast cancer cell lines. Expression of GIRK1 at the indicated molecular weight (MW (62 kDa was seen in cell lines MDA-MB-453 and ZR-75-1. In addition, GIRK1 expression was seen at a lower MW (40–42 kDa in MDA-MB-361, MDA-MB-468, MCF-7, ZR-75-1, and MDA-MB-453 cell lines. To prove the lower MW protein was GIRK1, MDA-MB-453 cells were immuno-precipitated. GIRK2 expression was seen in MDA-MB-468, MCF-7, and ZR-75-1 and was variable in MDA-MB-453, while GIRK4 protein expression was seen in all six cell lines tested. This is the first report indicating GIRK protein expression in breast cancer cells. To determine functionality, MDA-MB-453 cells were stimulated with ethanol. Decreased GIRK1 protein expression levels were seen after treatment with 0.12% ethanol in MDA-MB-453 breast cancer cells. Serum-free media decreased GIRK protein expression, possibly due to lack of estrogen in the media. Transfection of GIRK1 or GIRK4 plasmids increased GIRK1 protein expression and decreased gene expression in MDA-MB-453 breast cancer cells. Conclusion Our data indicates

  6. Different Effects of BORIS/CTCFL on Stemness Gene Expression, Sphere Formation and Cell Survival in Epithelial Cancer Stem Cells.

    Directory of Open Access Journals (Sweden)

    Loredana Alberti

    Full Text Available Cancer stem cells are cancer cells characterized by stem cell properties and represent a small population of tumor cells that drives tumor development, progression, metastasis and drug resistance. To date, the molecular mechanisms that generate and regulate cancer stem cells are not well defined. BORIS (Brother of Regulator of Imprinted Sites or CTCFL (CTCF-like is a DNA-binding protein that is expressed in normal tissues only in germ cells and is re-activated in tumors. Recent evidences have highlighted the correlation of BORIS/CTCFL expression with poor overall survival of different cancer patients. We have previously shown an association of BORIS-expressing cells with stemness gene expression in embryonic cancer cells. Here, we studied the role of BORIS in epithelial tumor cells. Using BORIS-molecular beacon that was already validated, we were able to show the presence of BORIS mRNA in cancer stem cell-enriched populations (side population and spheres of cervical, colon and breast tumor cells. BORIS silencing studies showed a decrease of sphere formation capacity in breast and colon tumor cells. Importantly, BORIS-silencing led to down-regulation of hTERT, stem cell (NANOG, OCT4, SOX2 and BMI1 and cancer stem cell markers (ABCG2, CD44 and ALDH1 genes. Conversely, BORIS-induction led to up-regulation of the same genes. These phenotypes were observed in cervical, colon and invasive breast tumor cells. However, a completely different behavior was observed in the non-invasive breast tumor cells (MCF7. Indeed, these cells acquired an epithelial mesenchymal transition phenotype after BORIS silencing. Our results demonstrate that BORIS is associated with cancer stem cell-enriched populations of several epithelial tumor cells and the different phenotypes depend on the origin of tumor cells.

  7. Expression of mesenchymal stem cell marker CD90 on dermal sheath cells of the anagen hair follicle in canine species

    OpenAIRE

    Gargiulo, A.M.; Pedini, V.; C. Dall’Aglio; Ceccarelli, P.; L. Pascucci; F Mercati

    2009-01-01

    The dermal sheath (DS) of the hair follicle is comprised by fibroblast-like cells and extends along the follicular epithelium, from the bulb up to the infundibulum. From this structure, cells with stem characteristics were isolated: they have a mesenchymal origin and express CD90 protein, a typical marker of mesenchymal stem cells. It is not yet really clear in which region of hair follicle these cells are located but some experimental evidence suggests that dermal stem cells are localized pr...

  8. Spontaneously immortalised bovine mammary epithelial cells exhibit a distinct gene expression pattern from the breast cancer cells

    Directory of Open Access Journals (Sweden)

    Li Qianqian

    2010-10-01

    Full Text Available Abstract Background Spontaneous immortalisation of cultured mammary epithelial cells (MECs is an extremely rare event, and the molecular mechanism behind spontaneous immortalisation of MECs is unclear. Here, we report the establishment of a spontaneously immortalised bovine mammary epithelial cell line (BME65Cs and the changes in gene expression associated with BME65Cs cells. Results BME65Cs cells maintain the general characteristics of normal mammary epithelial cells in morphology, karyotype and immunohistochemistry, and are accompanied by the activation of endogenous bTERT (bovine Telomerase Reverse Transcriptase and stabilisation of the telomere. Currently, BME65Cs cells have been passed for more than 220 generations, and these cells exhibit non-malignant transformation. The expression of multiple genes was investigated in BME65Cs cells, senescent BMECs (bovine MECs cells, early passage BMECs cells and MCF-7 cells (a human breast cancer cell line. In comparison with early passage BMECs cells, the expression of senescence-relevant apoptosis-related gene were significantly changed in BME65Cs cells. P16INK4a was downregulated, p53 was low expressed and Bax/Bcl-2 ratio was reversed. Moreover, a slight upregulation of the oncogene c-Myc, along with an undetectable level of breast tumor-related gene Bag-1 and TRPS-1, was observed in BME65Cs cells while these genes are all highly expressed in MCF-7. In addition, DNMT1 is upregulated in BME65Cs. These results suggest that the inhibition of both senescence and mitochondrial apoptosis signalling pathways contribute to the immortality of BME65Cs cells. The expression of p53 and p16INK4a in BME65Cs was altered in the pattern of down-regulation but not "loss", suggesting that this spontaneous immortalization is possibly initiated by other mechanism rather than gene mutation of p53 or p16INK4a. Conclusions Spontaneously immortalised BME65Cs cells maintain many characteristics of normal BMEC cells and

  9. High Expression of the RECK Gene in Breast Cancer Cells is Related to Low Invasive Capacity

    Institute of Scientific and Technical Information of China (English)

    Tao Sun; Daqing Jiang; Jinming Li; Dongyun Han; Zhiguo Song

    2006-01-01

    OBJECTIVE To investigate the expression of the RECK gene in human breast (cancer) cell lines, and to determine the relationship between RECK gene expression and the invasive capacity of the breast cancer cell lines.METHODS The invasive capacity of breast (cancer) cell lines including HBL-100, MCF-7 and MDA-MB-435S were determined by the Transwell method. The protein expression levels of RECK, MMP-2 and MMP- 9 genes in these three cell lines were measured by immunocytochemical methods. The expressions of the RECK gene and protein level were measured by RT-PCR and Western blots in the cell lines respectively.RESULTS The order of the invasive capacity of the breast (cancer) cell lines was MDA-MB-435S, being the highest, and HBL-100, being the lowest. The invasive capacity difference between any two groups among the three groups was significant (P<0.01). The protein expression level of the RECK gene in the HBL-100 cell line was highest, and no expression was detected in MDA-MB-435S cells. Moreover, the expression of the RECK gene was negatively correlated with the expression of the MMP-2 and MMP-9 genes. The mRNA level of the RECK gene in HBL-100 cells was the highest, but no expression was found in the MDA-MB-435S cells (P<0.001).CONCLUSION There was a significant negative correlation between the expression level of the RECK gene and invasive capacity in vitro, and the RECK gene expression showed an inverse proportion to that of the MMP-2, MMP-9 genes.

  10. RASSF1C modulates the expression of a stem cell renewal gene, PIWIL1

    Directory of Open Access Journals (Sweden)

    Reeves Mark E

    2012-05-01

    Full Text Available Abstract Background RASSF1A and RASSF1C are two major isoforms encoded by the Ras association domain family 1 (RASSF1 gene through alternative promoter selection and mRNA splicing. RASSF1A is a well established tumor suppressor gene. Unlike RASSF1A, RASSF1C appears to have growth promoting actions in lung cancer. In this article, we report on the identification of novel RASSF1C target genes in non small cell lung cancer (NSCLC. Methods Over-expression and siRNA techniques were used to alter RASSF1C expression in human lung cancer cells, and Affymetrix-microarray study was conducted using NCI-H1299 cells over-expressing RASSF1C to identify RASSF1C target genes. Results The microarray study intriguingly shows that RASSF1C modulates the expression of a number of genes that are involved in cancer development, cell growth and proliferation, cell death, and cell cycle. We have validated the expression of some target genes using qRT-PCR. We demonstrate that RASSF1C over-expression increases, and silencing of RASSF1C decreases, the expression of PIWIL1 gene in NSCLC cells using qRT-PCR, immunostaining, and Western blot analysis. We also show that RASSF1C over-expression induces phosphorylation of ERK1/2 in lung cancer cells, and inhibition of the MEK-ERK1/2 pathway suppresses the expression of PIWIL1 gene expression, suggesting that RASSF1C may exert its activities on some target genes such as PIWIL1 through the activation of the MEK-ERK1/2 pathway. Also, PIWIL1 expression is elevated in lung cancer cell lines compared to normal lung epithelial cells. Conclusions Taken together, our findings provide significant data to propose a model for investigating the role of RASSF1C/PIWIL1 proteins in initiation and progression of lung cancer.

  11. Expression of p63 in anaplastic large cell lymphoma but not in classical Hodgkin's lymphoma.

    Science.gov (United States)

    Gualco, Gabriela; Weiss, Lawrence M; Bacchi, Carlos E

    2008-10-01

    Immunohistochemical determination of p63 protein is frequently used in the pathologic diagnosis of nonhematological solid tumors. In malignant hematological disease, p63 expression has been reported in 22% of follicular lymphoma, about 35% of diffuse large B-cell lymphoma, 23% of chronic lymphocytic leukemia, and in some cases of blast crisis of chronic myelogenous leukemia. Anaplastic large cell lymphoma is a rare disease that accounts for less than 5% of all cases of non-Hodgkin's lymphoma. There is little information concerning p63 expression in this specific type of lymphoma. In some cases, the morphological and phenotypic features between anaplastic large cell lymphoma and classical Hodgkin's lymphoma are similar, making this differential diagnosis challenging. We studied p63 expression using a tissue microarray approach in 154 cases of anaplastic large cell lymphoma, including 38% anaplastic large cell kinase positive and 62% anaplastic large cell kinase negative, and 58 Hodgkin's lymphoma cases. Sixty-eight cases of anaplastic large cell lymphoma (44%) showed p63 nuclear positivity (41% of anaplastic large cell kinase positive and 47% of anaplastic large cell kinase negative). Of 130 cases of systemic-anaplastic large cell lymphoma, 42% showed p63 positivity. The neoplastic cells expressed p63 in 38% of the cases of CD45-negative/anaplastic large cell kinase-negative null cell-type anaplastic large cell lymphoma, a subgroup that offers the most difficulties in the differential diagnosis with classical Hodgkin's lymphoma. In contrast, none of the cases of classical Hodgkin's lymphoma demonstrated any p63 expression. These results demonstrate that p63 protein expression is frequently expressed in a subset of anaplastic large cell lymphoma cases and may be used as a potential tool in the differential diagnosis between anaplastic large cell lymphoma and classical Hodgkin's lymphoma.

  12. Expression of chicken CTCF gene in COS-1 cells and partial purification of CTCF protein.

    Science.gov (United States)

    Kotova, E S; Sorokina, I V; Akopov, S B; Nikolaev, L G; Sverdlov, E D

    2013-08-01

    The chicken gene for transcription factor CTCF was expressed in COS-1 mammalian cells. The CTCF protein containing polyhistidine tag was partially purified using metallo-affinity and ion-exchange chromatography. The expressed protein localized in the cell nucleus and was shown to be functionally active in the electrophoretic mobility shift assay and specifically interacted with anti-CTCF antibodies. PMID:24228875

  13. RNA interference inhibits expression of vascular endothelial growth factor (VEGF) in human retinal pigment epithelial cells

    Institute of Scientific and Technical Information of China (English)

    CAI Chun-mei; SUN Bao-chen; LIU Xu-yang; WANG Jin-jin; LI Jun-fa; HAN Song; WANG Ning-li; LU Qing-jun

    2005-01-01

    @@ Choroidal neovascularization (CNV), a major cause of vision loss, is the result of the increased vascular endothelial growth factor (VEGF) expression in human retinal pigment epithelial (RPE) cells. It is important to inhibit the expression of VEGF protein in RPE cells.

  14. Expression and purification of recombinant vesicular glutamate transporter VGLUT1 using PC12 cells and High Five insect cells

    Directory of Open Access Journals (Sweden)

    Andersen Søren S.L.

    2004-01-01

    Full Text Available In synaptic vesicles, the estimated concentration of the excitatory amino acid glutamate is 100-150 mM. It was recently discovered that VGLUT1, previously characterized as an inorganic phosphate transporter (BNPI with 9-11 predicted transmembrane spanning domains, is capable of transporting glutamate. The expression and His-tag based purification of recombinant VGLUT1 from PC12 cells and High Five insect cells is described. Significantly better virus and protein expression was obtained using High Five rather than Sf9 insect cells. PC12 cell expressed VGLUT1 is functional but not the Baculovirus expressed protein. The lack of functionality of the Baculovirus expressed VGLUT1 is discussed. The data indicate that VGLUT1 readily oligomerizes/dimerizes. The data are discussed in the context of developing this system further in order to reconstitute vesicular glutamate uptake in vitro using lipid-detergent vesicles.

  15. Jasmonates induce nonapoptotic death in high-resistance mutant p53-expressing B-lymphoma cells

    OpenAIRE

    Fingrut, Orit; Reischer, Dorit; Rotem, Ronit; Goldin, Natalia; Altboum, Irit; Zan-Bar, Israel; Flescher, Eliezer

    2005-01-01

    Mutations in p53, a tumor suppressor gene, occur in more than half of human cancers. Therefore, we tested the hypothesis that jasmonates (novel anticancer agents) can induce death in mutated p53-expressing cells.Two clones of B-lymphoma cells were studied, one expressing wild-type (wt) p53 and the other expressing mutated p53.Jasmonic acid and methyl jasmonate (0.25–3 mM) were each equally cytotoxic to both clones, whereas mutant p53-expressing cells were resistant to treatment with the radio...

  16. Chemokine receptor expression on B cells and effect of interferon-beta in multiple sclerosis

    DEFF Research Database (Denmark)

    Sørensen, Torben Lykke; Roed, Hanne; Sellebjerg, Finn

    2002-01-01

    We investigated the B-cell expression of chemokine receptors CXCR3, CXCR5 and CCR5 in the blood and cerebrospinal fluid (CSF) from patients in relapse of multiple sclerosis (MS) and in neurological controls. Chemokine receptor expression was also studied in interferon-beta-treated patients...... with relapsing-remitting or secondary progressive MS. We observed significantly higher expression of CXCR3 on B cells in the CSF in active MS than in controls. Patients with active MS also had higher B-cell expression of CCR5 in blood. No major differences between RRMS and SPMS patients were detected...

  17. Butyrate stimulates IL-32α expression in human intestinal epithelial cell lines

    Institute of Scientific and Technical Information of China (English)

    Ayako; Kobori; Shigeki; Bamba; Hirotsugu; Imaeda; Hiromitsu; Ban; Tomoyuki; Tsujikawa; Yasuharu; Saito; Yoshihide; Fujiyama; Akira; Andoh

    2010-01-01

    AIM: To investigate the effects of butyrate on interleukin (IL)-32α expression in epithelial cell lines. METHODS: The human intestinal epithelial cell lines HT-29, SW480, and T84 were used. Intracellular IL- 32α was determined by Western blotting analyses. IL- 32α mRNA expression was analyzed by real-time poly-merase chain reaction. RESULTS: Acetate and propionate had no effects on IL-32α mRNA expression. Butyrate significantly enhanced IL-32α expression in all cell lines. Butyrate also up-regulated IL-1β-i...

  18. Glioma cell proliferation controlled by ERK activity-dependent surface expression of PDGFRA.

    Science.gov (United States)

    Chen, Dongfeng; Zuo, Duo; Luan, Cheng; Liu, Min; Na, Manli; Ran, Liang; Sun, Yingyu; Persson, Annette; Englund, Elisabet; Salford, Leif G; Renström, Erik; Fan, Xiaolong; Zhang, Enming

    2014-01-01

    Increased PDGFRA signaling is an essential pathogenic factor in many subtypes of gliomas. In this context the cell surface expression of PDGFRA is an important determinant of ligand sensing in the glioma microenvironment. However, the regulation of spatial distribution of PDGFRA in glioma cells remains poorly characterized. Here, we report that cell surface PDGFRA expression in gliomas is negatively regulated by an ERK-dependent mechanism, resulting in reduced proliferation of glioma cells. Glioma tumor tissues and their corresponding cell lines were isolated from 14 patients and analyzed by single-cell imaging and flow cytometry. In both cell lines and their corresponding tumor samples, glioma cell proliferation correlated with the extent of surface expression of PDGFRA. High levels of surface PDGFRA also correlated to high tubulin expression in glioma tumor tissue in vivo. In glioma cell lines, surface PDGFRA declined following treatment with inhibitors of tubulin, actin and dynamin. Screening of a panel of small molecule compounds identified the MEK inhibitor U0126 as a potent inhibitor of surface PDGFRA expression. Importantly, U0126 inhibited surface expression in a reversible, dose- and time-dependent manner, without affecting general PDGFRA expression. Treatment with U0126 resulted in reduced co-localization between PDGFRA and intracellular trafficking molecules e.g. clathrin, RAB11 and early endosomal antigen-1, in parallel with enhanced co-localization between PDGFRA and the Golgi cisternae maker, Giantin, suggesting a deviation of PDGFRA from the endosomal trafficking and recycling compartment, to the Golgi network. Furthermore, U0126 treatment in glioma cells induced an initial inhibition of ERK1/2 phosphorylation, followed by up-regulated ERK1/2 phosphorylation concomitant with diminished surface expression of PDGFRA. Finally, down-regulation of surface PDGFRA expression by U0126 is concordant with reduced glioma cell proliferation. These findings

  19. Glioma cell proliferation controlled by ERK activity-dependent surface expression of PDGFRA.

    Directory of Open Access Journals (Sweden)

    Dongfeng Chen

    Full Text Available Increased PDGFRA signaling is an essential pathogenic factor in many subtypes of gliomas. In this context the cell surface expression of PDGFRA is an important determinant of ligand sensing in the glioma microenvironment. However, the regulation of spatial distribution of PDGFRA in glioma cells remains poorly characterized. Here, we report that cell surface PDGFRA expression in gliomas is negatively regulated by an ERK-dependent mechanism, resulting in reduced proliferation of glioma cells. Glioma tumor tissues and their corresponding cell lines were isolated from 14 patients and analyzed by single-cell imaging and flow cytometry. In both cell lines and their corresponding tumor samples, glioma cell proliferation correlated with the extent of surface expression of PDGFRA. High levels of surface PDGFRA also correlated to high tubulin expression in glioma tumor tissue in vivo. In glioma cell lines, surface PDGFRA declined following treatment with inhibitors of tubulin, actin and dynamin. Screening of a panel of small molecule compounds identified the MEK inhibitor U0126 as a potent inhibitor of surface PDGFRA expression. Importantly, U0126 inhibited surface expression in a reversible, dose- and time-dependent manner, without affecting general PDGFRA expression. Treatment with U0126 resulted in reduced co-localization between PDGFRA and intracellular trafficking molecules e.g. clathrin, RAB11 and early endosomal antigen-1, in parallel with enhanced co-localization between PDGFRA and the Golgi cisternae maker, Giantin, suggesting a deviation of PDGFRA from the endosomal trafficking and recycling compartment, to the Golgi network. Furthermore, U0126 treatment in glioma cells induced an initial inhibition of ERK1/2 phosphorylation, followed by up-regulated ERK1/2 phosphorylation concomitant with diminished surface expression of PDGFRA. Finally, down-regulation of surface PDGFRA expression by U0126 is concordant with reduced glioma cell proliferation

  20. Modulation of SOCS protein expression influences the interferon responsiveness of human melanoma cells

    International Nuclear Information System (INIS)

    Endogenously produced interferons can regulate the growth of melanoma cells and are administered exogenously as therapeutic agents to patients with advanced cancer. We investigated the role of negative regulators of interferon signaling known as suppressors of cytokine signaling (SOCS) in mediating interferon-resistance in human melanoma cells. Basal and interferon-alpha (IFN-α) or interferon-gamma (IFN-γ)-induced expression of SOCS1 and SOCS3 proteins was evaluated by immunoblot analysis in a panel of n = 10 metastatic human melanoma cell lines, in human embryonic melanocytes (HEM), and radial or vertical growth phase melanoma cells. Over-expression of SOCS1 and SOCS3 proteins in melanoma cells was achieved using the PINCO retroviral vector, while siRNA were used to inhibit SOCS1 and SOCS3 expression. Tyr701-phosphorylated STAT1 (P-STAT1) was measured by intracellular flow cytometry and IFN-stimulated gene expression was measured by Real Time PCR. SOCS1 and SOCS3 proteins were expressed at basal levels in melanocytes and in all melanoma cell lines examined. Expression of the SOCS1 and SOCS3 proteins was also enhanced following stimulation of a subset of cell lines with IFN-α or IFN-γ. Over-expression of SOCS proteins in melanoma cell lines led to significant inhibition of Tyr701-phosphorylated STAT1 (P-STAT1) and gene expression following stimulation with IFN-α (IFIT2, OAS-1, ISG-15) or IFN-γ (IRF1). Conversely, siRNA inhibition of SOCS1 and SOCS3 expression in melanoma cells enhanced their responsiveness to interferon stimulation. These data demonstrate that SOCS proteins are expressed in human melanoma cell lines and their modulation can influence the responsiveness of melanoma cells to IFN-α and IFN-γ

  1. Ectopic expression of telomerase enhances osteopontin and osteocalcin expression during osteogenic differentiation of human mesenchymal stem cells from elder donors

    Directory of Open Access Journals (Sweden)

    Machado CB

    2009-01-01

    Full Text Available Age related bone loss is one of the most prevalent diseases in the elder population. The osteoblasts are the effectors cells of bone formation and regeneration. With the aging the osteoblasts become senescent reducing their ability to produce bone. Cellular replicative senescence is triggered by telomers shortening. Telomerase elongate the telomers length and maintain the cell proliferative capacity. Here, we demonstrated that the expression of human telomerase reverse transcriptase mediated by an adenovirus vector increases the levels of osteopontin and osteocalcin mRNA during the in vitro osteogenic differentiation of elderly human mesenchymal stem cells. Bone marrow human mesenchymal stem cells were obtained from old donors (>65 years and induced to differentiate into osteoblasts for 14 days. The levels of mRNA of human telomerase reverse transcriptase, osteopontin and osteocalcin during the differentiation were assessed by semi-quantitative PCR before and during the differentiation on days 7 and 14. Infected cells showed 1.5 fold increase in telomerase expression. Also telomerized cells exhibit 1.5 fold increase in osteopontin and 0.5 fold increase in osteocalcin expression compared to primary osteoblasts isolated from the same donors. The transformed cells were not able to form tumours in NUDE mice.

  2. T-Cadherin Expression in Melanoma Cells Stimulates Stromal Cell Recruitment and Invasion by Regulating the Expression of Chemokines, Integrins and Adhesion Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Rubina, Kseniya A., E-mail: rkseniya@mail.ru; Surkova, Ekaterina I.; Semina, Ekaterina V.; Sysoeva, Veronika Y.; Kalinina, Natalia I. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation); Poliakov, Alexei A. [Division of Developmental Neurobiology, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA (United Kingdom); Treshalina, Helena M. [Federal State Budgetary Scietific Institution «N.N. Blokhin Russian Cancer Research Center» (FSBSI “N.N.Blokhin RCRC”), Kashirskoe Shosse 24, Moscow 115478 (Russian Federation); Tkachuk, Vsevolod A. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation)

    2015-07-21

    T-cadherin is a glycosyl-phosphatidylinositol (GPI) anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate that T-cadherin overexpression leads to the increase in the expression of anti-angiogenic molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells.

  3. Dual-function vector for protein expression in both mammalian cells and Xenopus laevis oocytes

    DEFF Research Database (Denmark)

    Jespersen, Thomas; Grunnet, M; Angelo, K;

    2002-01-01

    will often engage both oocytes and mammalian cells. Efficient expression of a protein in both systems have thus far only been possible by subcloning the cDNA into two different vectors because several different molecular requirements should be fulfilled to obtain a high protein level in both mammalian cells...... and oocytes. To address this problem, we have constructed a plasmid vector, pXOOM, that can function as a template for expression in both oocytes and mammalian cells. By including all the necessary RNA stability elements for oocyte expression in a standard mammalian expression vector, we have obtained a dual......-function vector capable of supporting protein production in both Xenopus oocytes and CHO-K1 cells at an expression level equivalent to the levels obtained with vectors optimized for either oocyte or mammalian expression. Our functional studies have been performed with hERGI, KCNQ4, and Kv1.3 potassium channels....

  4. Light induces Fos expression via extracellular signal-regulated kinases 1/2 in melanopsin-expressing PC12 cells

    DEFF Research Database (Denmark)

    Moldrup, Marie-Louise Bülow; Georg, Birgitte; Falktoft, Birgitte;

    2010-01-01

    -regulated protein kinase 1/2 (ERK1/2) was found as pharmacological blockage of this kinase suppressed the light-induced Fos expression. Illumination increased the inositol phosphate turnover and induced phosphorylation of ERK1/2 and p38 but not the c-Jun N-terminal kinase. The Galpha(q/11) protein inhibitor YM......254890 attenuated these intracellular light responses. Our data strongly indicate that Galpha(q/11)-mediated ERK1/2 activation is essential for expression of Fos upon illumination of melanopsin-expressing PC12 cells....

  5. Activation of TIM1 induces colon cancer cell apoptosis via modulating Fas ligand expression.

    Science.gov (United States)

    Wang, Hao; Zhang, Xueyan; Sun, Wenjing; Hu, Xiaocui; Li, Xiaolin; Fu, Songbin; Liu, Chen

    2016-04-29

    The pathogenesis of colon cancer is unclear. It is proposed that TIM1 has an association with human cancer. The present study aims to investigate the role of TIM1 activation in the inhibition of human colon cancer cells. In this study, human colon cancer cell line, HT29 and T84 cells were cultured. The expression of TIM1 was assessed by real time RT-PCR and Western blotting. The TIM1 on the cancer cells was activated in the culture by adding recombinant TIM4. The chromatin structure at the FasL promoter locus was assessed by chromatin immunoprecipitation. The apoptosis of the cancer cells was assessed by flow cytometry. The results showed that human colon cancer cell lines, HT29 cells and T84 cells, expressed TIM1. Activation of TIM1 by exposing the cells to TIM4 significantly increased the frequency of apoptotic colon cancer cells. The expression of FasL was increased in the cancer cells after treating by TIM4. Blocking Fas or FasL abolished the exposure to TIM4-induced T84 cell apoptosis. In conclusion, HT29 cells and T84 cells express TIM1; activation TIM1 can induce the cancer cell apoptosis. TIM1 may be a novel therapeutic target of colon cancer.

  6. Wnt5a attenuates Wnt3a-induced alkaline phosphatase expression in dental follicle cells

    Energy Technology Data Exchange (ETDEWEB)

    Sakisaka, Yukihiko [Department of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Tsuchiya, Masahiro [Department of Oral Diagnosis, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Tohoku Fukushi University, Sendai 989-3201 (Japan); Nakamura, Takashi [Department of Pediatric Dentistry, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Liason Center for Innovative Dentistry, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Tamura, Masato [Department of Biochemistry and Molecular Biology, Hokkaido University Graduate School of Dentistry, Sapporo 060-8586 (Japan); Shimauchi, Hidetoshi [Department of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Nemoto, Eiji, E-mail: e-nemoto@dent.tohoku.ac.jp [Department of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)

    2015-08-01

    Wnt signaling regulates multiple cellular events such as cell proliferation, differentiation, and apoptosis through β-catenin-dependent canonical and β-catenin-independent noncanonical pathways. Canonical Wnt/β-catenin signaling can promote the differentiation of dental follicle cells, putative progenitor cells for cementoblasts, osteoblasts, and periodontal ligament cells, toward a cementoblast/osteoblast phenotype during root formation, but little is known about the biological significance of noncanonical Wnt signaling in this process. We identified the expression of Wnt5a, a representative noncanonical Wnt ligand, in tooth root lining cells (i.e. precementoblasts/cementoblasts) and dental follicle cells during mouse tooth root development, as assessed by immunohistochemistry. Silencing expression of the Wnt5a gene in a dental follicle cell line resulted in enhancement of the Wnt3a (a representative canonical Wnt ligand)-mediated increase in alkaline phosphatase (ALP) expression. Conversely, treatment with recombinant Wnt5a inhibited the increase in ALP expression, suggesting that Wnt5a signaling functions as a negative regulator of canonical Wnt-mediated ALP expression of dental follicle cells. Wnt5a did not affect the nuclear translocation of β-catenin as well as β-catenin-mediated transcriptional activation of T-cell factor (Tcf) triggered by Wnt3a, suggesting that Wnt5a inhibits the downstream part of the β-catenin-Tcf pathway. These findings suggest the existence of a feedback mechanism between canonical and noncanonical Wnt signaling during the differentiation of dental follicle cells. - Highlights: • Dental follicle cells express Wnt5a during tooth root development. • Silencing of Wnt5a enhances Wnt3a-mediated ALP expression of dental follicle cells. • Conversely, treatment with rWnt5a inhibited the increase in ALP expression. • Wnt5a functions as a negative regulator of Wnt3a-mediated ALP expression.

  7. Construction of Porcine CCK pDNA and Its Expression in COS-7 Cells

    Institute of Scientific and Technical Information of China (English)

    BAI Jigang; L(U) Yi; BAI Qiaoling

    2007-01-01

    CCK correlates with the generation and progression of pancreatic cancer. The research aims to construct eukaryotic expression plasmid pIRES2-EGFP/CCK (CCK pDNA) and transiently express it in COS-7 cells. Total RNA was extracted from porcine intestinal mucosa. RT-PCR was used to amplify the aimed segments CCKcDNA which was then digested with EcoR1 and BamH1 and inserted into a eukaryotic expression plasmid pIRES2-EGFP to construct CCK pDNA. The constructed plasmid was transfected into COS-7 cells by lepofectamine TM2000-mediated transfer method.The expression of CCK in transfected COS-7 cells was detected 24, 48 and 72 h post-transfection with fluorescence microscopy and the expression level of CCK mRNA in transfected COS-7 cells was assayed by using RT-PCR. The results showed CCK pDNA was successfully constructed and expressed transiently in COS-7 cells. Green fluorescent protein could be detected in the COS-7 cells transfected with porcine CCK pDNA 24 h post-transfection. At 48th h post-transfection, the number of positive cells was increased significantly and much brighter green fluorescence could be detected.And 72 h post-transfection, the green fluorescence of positive cells became even stronger, while no green fluorescence was detected in the control group. The expression of CCK mRNA in the cells was detectable by using RT-PCR. In COS-7 cells transfected with CCK pDNA a high level of porcine CCK mRNA was detected while no expression of porcine CCKmRNA was found in the cells transfected with null plasmid. It was concluded CCK pDNA was expressed successfully in COS-7 cells,which lays a foundation for further research on the relationship between CCK and tumor.

  8. Expression of a hyperactive androgen receptor leads to androgen-independent growth of prostate cancer cells.

    Science.gov (United States)

    Hsieh, Chen-Lin; Cai, Changmeng; Giwa, Ahmed; Bivins, Aaronica; Chen, Shao-Yong; Sabry, Dina; Govardhan, Kumara; Shemshedini, Lirim

    2008-07-01

    Cellular changes that affect the androgen receptor (AR) can cause prostate cancer to transition from androgen dependent to androgen independent, which is usually lethal. One common change in prostate tumors is overexpression of the AR, which has been shown to lead to androgen-independent growth of prostate cancer cells. This led us to hypothesize that expression of a hyperactive AR would be sufficient for androgen-independent growth of prostate cancer cells. To test this hypothesis, stable lune cancer prostate (LNCaP) cell lines were generated, which express a virion phosphoprotein (VP)16-AR hybrid protein that contains full-length AR fused to the strong viral transcriptional activation domain VP16. This fusion protein elicited as much as a 20-fold stronger transcriptional activity than the natural AR. Stable expression of VP16-AR in LNCaP cells yielded androgen-independent cell proliferation, while under the same growth conditions the parental LNCaP cells exhibited only androgen-dependent growth. These results show that expression of a hyperactive AR is sufficient for androgen-independent growth of prostate cancer cells. To study the molecular basis of this enhanced growth, we measured the expression of soluble guanylyl cyclase-alpha1 (sGCalpha1), a subunit of the sGC, an androgen-regulated gene that has been shown to be involved in prostate cancer cell growth. Interestingly, the expression of sGCalpha1 is androgen independent in VP16-AR-expressing cells, in contrast to its androgen-induced expression in control LNCaP cells. RNA(I)-dependent inhibition of sGCalpha1 expression resulted in significantly reduced proliferation of VP16-AR cells, implicating an important role for sGCalpha1 in the androgen-independent growth of these cells. PMID:18469090

  9. Wnt5a attenuates Wnt3a-induced alkaline phosphatase expression in dental follicle cells

    International Nuclear Information System (INIS)

    Wnt signaling regulates multiple cellular events such as cell proliferation, differentiation, and apoptosis through β-catenin-dependent canonical and β-catenin-independent noncanonical pathways. Canonical Wnt/β-catenin signaling can promote the differentiation of dental follicle cells, putative progenitor cells for cementoblasts, osteoblasts, and periodontal ligament cells, toward a cementoblast/osteoblast phenotype during root formation, but little is known about the biological significance of noncanonical Wnt signaling in this process. We identified the expression of Wnt5a, a representative noncanonical Wnt ligand, in tooth root lining cells (i.e. precementoblasts/cementoblasts) and dental follicle cells during mouse tooth root development, as assessed by immunohistochemistry. Silencing expression of the Wnt5a gene in a dental follicle cell line resulted in enhancement of the Wnt3a (a representative canonical Wnt ligand)-mediated increase in alkaline phosphatase (ALP) expression. Conversely, treatment with recombinant Wnt5a inhibited the increase in ALP expression, suggesting that Wnt5a signaling functions as a negative regulator of canonical Wnt-mediated ALP expression of dental follicle cells. Wnt5a did not affect the nuclear translocation of β-catenin as well as β-catenin-mediated transcriptional activation of T-cell factor (Tcf) triggered by Wnt3a, suggesting that Wnt5a inhibits the downstream part of the β-catenin-Tcf pathway. These findings suggest the existence of a feedback mechanism between canonical and noncanonical Wnt signaling during the differentiation of dental follicle cells. - Highlights: • Dental follicle cells express Wnt5a during tooth root development. • Silencing of Wnt5a enhances Wnt3a-mediated ALP expression of dental follicle cells. • Conversely, treatment with rWnt5a inhibited the increase in ALP expression. • Wnt5a functions as a negative regulator of Wnt3a-mediated ALP expression

  10. Vagaries of fluorochrome reporter gene expression in Foxp3+ regulatory T cells.

    Directory of Open Access Journals (Sweden)

    Sonja Schallenberg

    Full Text Available CD4(+CD25(+ regulatory T (Treg cell lineage commitment and expression of the transcription factor Foxp3 can be induced at the CD4(+CD8(+ double-positive (DP and CD4(+CD8(? single-positive stages of thymic development, as well as in postthymic CD4(+ T cells in peripheral lymphoid tissues. The availability of transgenic mice with Foxp3-dependent fluorochrome reporter gene expression has greatly facilitated studies on the intra- and extrathymic generation of murine Foxp3(+ Treg cells. Here, we performed a comparative analysis of thymic Treg cell development and peripheral compartments of mature Treg cells in various transgenic strains with gene targeted and bacterial artificial chromosome (BAC-driven Foxp3-fluorochrome expression. These studies revealed a relative deficiency of Foxp3(+ DP thymocytes selectively in mice with targeted insertion of the fluorochrome reporter gene coding sequence into the endogenous Foxp3 gene. While Foxp3 BAC-driven fluorochrome expression in ex vivo CD4(+ T cells was found to faithfully reflect Foxp3 protein expression, we provide evidence that Foxp3 BAC transgenesis can result in sizable populations of Foxp3(+ Treg cells that lack fluorochrome reporter expression. This could be attributed to both timely delayed up-regulation of BAC expression in developing Treg cells and the accumulation of peripheral Foxp3(+ Treg cells with continuous transcriptional inactivity of the Foxp3 BAC transgene.

  11. [Effect of Siwu decoction on function and expression of P-glycoprotein in Caco-2 cells].

    Science.gov (United States)

    Jiang, Yi; Ma, Zeng-chun; Huang, Xian-ju; You, Qing; Tan, Hong-ling; Wang, Yu-guang; Liang, Qian-de; Tang, Xiang-lin; Xiao, Cheng-rong; Gao, Yue

    2015-03-01

    To study the effect of Siwu decoction on the function and expression of P-glycoprotein (P-gp) in Caco-2 cells. The Real-time quantitative poly-merase chain reaction (Q-PCR) was used to analyze the mRNA expression of MDR1 gene in Caco-2 cells. Flow cytometer was used to study the effect of Siwu decoction on the uptake of Rhodamine 123 in Caco-2 cells, in order to evaluate the efflux function of P-gp. Western blotting method was used to detect the effect of Siwu decoction on the P-gp protein expression of Caco-2 cells. Compared with the blank control group, after Caco-2 incubation with Siwu decoction at concentrations of 3.3, 5.0, 10.0 g x L(-1) for 24, 48, 72 h, the mRNA expression of MDR1 was up-regulated, suggesting the effect of Siwu decoction in inducing the expression of MDR1. After the administration with Siwu decoction in Caco-2 cells for 48 h, the uptake of Rhodamine 123 in Caco-2 cells decreased by respectively 16.6%, 22.1% (P P P-gp efflux function of Caco-2 cells. After the incubation of Caco-2 cells with Siwu decoction for 48 h, the P-gp protein expression on Caco-2 cell emebranes, demonstrating the effect of Siwu decoction in inducing the protein expression of P-gp.

  12. Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri

    Directory of Open Access Journals (Sweden)

    Hallmann Armin

    2006-12-01

    Full Text Available Abstract Background The multicellular alga Volvox carteri possesses only two cell types: mortal, motile somatic cells and potentially immortal, immotile reproductive cells. It is therefore an attractive model system for studying how cell-autonomous cytodifferentiation is programmed within a genome. Moreover, there are ongoing genome projects both in Volvox carteri and in the closely related unicellular alga Chlamydomonas reinhardtii. However, gene sequencing is only the beginning. To identify cell-type specific expression and to determine relative expression rates, we evaluate the potential of real-time RT-PCR for quantifying gene transcript levels. Results Here we analyze a diversified pool of 39 target genes by real-time RT-PCR for each cell type. This gene pool contains previously known genes with unknown localization of cellular expression, 28 novel genes which are described in this study for the first time, and a few known, cell-type specific genes as a control. The respective gene products are, for instance, part of photosynthesis, cellular regulation, stress response, or transport processes. We provide expression data for all these genes. Conclusion The results show that quantitative real-time RT-PCR is a favorable approach to analyze cell-type specific gene expression in Volvox, which can be extended to a much larger number of genes or to developmental or metabolic mutants. Our expression data also provide a basis for a detailed analysis of individual, previously unknown, cell-type specifically expressed genes.

  13. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    International Nuclear Information System (INIS)

    Runt-related transcription factor 3 (RUNX3) is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC). RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. RUNX3 protein expression was frequently inactivated in the HCC cell lines (91%) and tissues (90%). RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis

  14. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    Directory of Open Access Journals (Sweden)

    Nakamura Shinichiro

    2011-01-01

    Full Text Available Abstract Background Runt-related transcription factor 3 (RUNX3 is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC. Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91% and tissues (90%. RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis.

  15. Interleukin-2 expression and glioma cell proliferation following Vaceinia vector gene transfection in vivo

    Institute of Scientific and Technical Information of China (English)

    Xiaogang Wang; Xuezhong Wei; Jiangqiu Liu

    2008-01-01

    BACKGROUND: The effectiveness of gene therapy is closely related to the efficiency of vector transfection and expression.OBJECTIVE: This study was designed to transfect a human brain glioma cell line with recombinant Vaccinia virus expressing the interleukin-2 (rVV-IL-2) gene, and to observe IL-2 expression and glioma cell proliferation potential after transfection. DESIGN: Experimental observation. SETTING: Department of Neurosurgery, Shenyang Military Area Command of Chinese PLA. MATERIALS: The rVV-IL-2 vectors were obtained through homologous recombination and screening in the Second Military Medical University of Chinese PLA. The human brain glioma cell line and IL-2-dependent cells were produced by the Second Military Medical University of Chinese PLA. Human IL-2 was produced by Genzyme Corporation. MAIN OUTCOME MEASURES: IL-2 expression at different time points after transfection of human brain glioma cells with varying MOI of Vaccinia viral vectors; in vitro proliferation capacity of human brain glioma cells among the 4 groups. RESULTS: IL-2 expression was detectable 4 hours after Vaccinia viral vector transfection and reached 300 kU/L by 8 hours. There was no significant difference in the proliferating rate of human brain glioma cells among the 4 groups (P > 0.05).CONCLUSION: Vaccinia viral vectors can transfect human brain glioma cells in vitro and express high levels of IL-2. Vaccinia virus and high IL-2 expression do not influence the proliferation rate of human brain glioma cells in vitro.

  16. Differentiation factors that influence neuronal markers expression in vitro from human amniotic epithelial cells

    Directory of Open Access Journals (Sweden)

    H Niknejad

    2010-01-01

    Full Text Available The differentiation of neural cells from embryonic stem cells is influenced by several growth factors. Amniotic epithelial cells (AECs share many of the same characteristics as embryonic stem cells, and therefore those factors may similarly affect the derivation of neural cells from AECs. In this study, we examined the differentiation of neural cells in vitro from AECs following AECs treatment with retinoic acid (RA, basic fibroblast growth factor (bFGF as well as investigation of bFGF withdrawal on neuronal differentiation. We also studied whether blocking bone morphogenetic protein (BMP signaling using its antagonist, noggin, affects the derivation of neuronal cells from AECs. The effects of serum on the rate of neural markers expression were also examined. Analysis of AECs derived neurons was performed at some neural markers expression level by immunocytochemistry. All cultures treated with noggin showed the higher levels of neural markers expression than noggin free cultures. Combined treatment with bFGF and RA showed the highest level of neural markers in all treatment groups with or without noggin. bFGF withdrawal did not promote expression of neural markers, while its maintenance increased the expression of these markers. Serum-free condition decreased the viability of cells but increased the rate of neural markers expression. These results show the capability of AECs to express neural cell markers and this ability is affected by some factors including serum, noggin, bFGF and RA.

  17. The ectopic expression of Pax4 in the mouse pancreas converts progenitor cells into alpha and subsequently beta cells

    DEFF Research Database (Denmark)

    Collombat, Patrick; Xu, Xiaobo; Ravassard, Philippe;

    2009-01-01

    We have previously reported that the loss of Arx and/or Pax4 gene activity leads to a shift in the fate of the different endocrine cell subtypes in the mouse pancreas, without affecting the total endocrine cell numbers. Here, we conditionally and ectopically express Pax4 using different cell-spec...

  18. PU.1 Expression in T Follicular Helper Cells Limits CD40L-Dependent Germinal Center B Cell Development.

    Science.gov (United States)

    Awe, Olufolakemi; Hufford, Matthew M; Wu, Hao; Pham, Duy; Chang, Hua-Chen; Jabeen, Rukhsana; Dent, Alexander L; Kaplan, Mark H

    2015-10-15

    PU.1 is an ETS family transcription factor that is important for the development of multiple hematopoietic cell lineages. Previous work demonstrated a critical role for PU.1 in promoting Th9 development and in limiting Th2 cytokine production. Whether PU.1 has functions in other Th lineages is not clear. In this study, we examined the effects of ectopic expression of PU.1 in CD4(+) T cells and observed decreased expression of genes involved with the function of T follicular helper (Tfh) cells, including Il21 and Tnfsf5 (encoding CD40L). T cells from conditional mutant mice that lack expression of PU.1 in T cells (Sfpi1(lck-/-)) demonstrated increased production of CD40L and IL-21 in vitro. Following adjuvant-dependent or adjuvant-independent immunization, we observed that Sfpi1(lck-/-) mice had increased numbers of Tfh cells, increased germinal center B cells (GCB cells), and increased Ab production in vivo. This correlated with increased expression of IL-21 and CD40L in Tfh cells from Sfpi1(lck-/-) mice compared with control mice. Finally, although blockade of IL-21 did not affect GCB cells in Sfpi1(lck-/-) mice, anti-CD40L treatment of immunized Sfpi1(lck-/-) mice decreased GCB cell numbers and Ag-specific Ig concentrations. Together, these data indicate an inhibitory role for PU.1 in the function of Tfh cells, germinal centers, and Tfh-dependent humoral immunity.

  19. Upregulation of T-Cell-Specific Transcription Factor Expression in Pediatric T-Cell Acute Lymphoblastic Leukemia (T-ALL

    Directory of Open Access Journals (Sweden)

    Müge Sayitoğlu

    2012-12-01

    Full Text Available OBJECTIVE: T-cell acute lymphoblastic leukemia (T-ALL is associated with recurrent chromosomal aberrations and abnormal ectopic gene expression during T-cell development. In order to gain insight into the pathogenesis of T-ALL this study aimed to measure the level of expression of 7 T-cell oncogenes (LMO2, LYL1, TAL1, TLX1, TLX3, BMI1, and CALM-AF10 in pediatric T-ALL patients. METHODS: LMO2, LYL1, TLX1, TLX3, BMI1, TAL1, and CALM-AF10 expression was measured using quantitative real-time PCR in 43 pediatric T-ALL patients. RESULTS: A high level of expression of LMO2, LYL1, TAL1, and BMI1 genes was observed in a large group of T-ALL. Several gene expression signatures indicative of leukemic arrest at specific stages of normal thymocyte development (LYL1 and LMO2 were highly expressed during the cortical and mature stages of T-cell development. Furthermore, upregulated TAL1 and BMI1 expression was observed in all phenotypic subgroups. In all, 6 of the patients had TLX1 and TLX3 proto-oncogene expression, which does not occur in normal cells, and none of the patients had CALM-AF10 fusion gene transcription. Expression of LYL1 alone and LMO2-LYL1 co-expression were associated with mediastinal involvement; however, high-level oncogene expression was not predictive of outcome in the present pediatric T-ALL patient group, but there was a trend towards a poor prognostic impact of TAL1 and/or LMO2 and/or LYL1 protooncogene expression. CONCLUSION: Poor prognostic impact of TAL1 and/or LMO2 and/or LYL1 proto-oncogene expression indicate the need for extensive study on oncogenic rearrangement and immunophenotypic markers in T-ALL, and their relationship to treatment outcome.

  20. Tumor Lymphangiogenesis and Metastasis to Lymph Nodes Induced by Cancer Cell Expression of Podoplanin

    OpenAIRE

    Cueni, Leah N.; Hegyi, Ivan; Shin, Jay W.; Albinger-Hegyi, Andrea; Gruber, Silke; Kunstfeld, Rainer; Moch, Holger; Detmar, Michael

    2010-01-01

    The membrane glycoprotein podoplanin is expressed by several types of human cancers and might be associated with their malignant progression. Its exact biological function and molecular targets are unclear, however. Here, we assessed the relevance of tumor cell expression of podoplanin in cancer metastasis to lymph nodes, using a human MCF7 breast carcinoma xenograft model. We found that podoplanin expression promoted tumor cell motility in vitro and, unexpectedly, increased tumor lymphangiog...

  1. Differential Expression of Neurokinin-1 Receptor by Human Mucosal and Peripheral Lymphoid Cells

    OpenAIRE

    Goode, Triona; O'Connell, Joe; HO, WEN-ZHE; O'Sullivan, Gerald C.; Collins, J. Kevin; Douglas, Steven D.; Shanahan, Fergus

    2000-01-01

    Substance P (SP) has been implicated in peripheral and mucosal neuroimmunoregulation. However, confusion remains regarding immunocyte expression of the receptor for SP, neurokinin-1 receptor (NK-1R), and whether there is differential NK-1R expression in the mucosal versus the peripheral immune system. In the same assay systems, we examined the expression of NK-1R in human lamina propria mononuclear cells (LPMC), peripheral blood mononuclear cells (PBMC), peripheral blood lymphocytes (PBL), mo...

  2. Validation of cell-free culture using scanning electron microscopy (SEM) and gene expression studies.

    Science.gov (United States)

    Yang, R; Elankumaran, Y; Hijjawi, N; Ryan, U

    2015-06-01

    A cell-free culture system for Cryptosporidium parvum was analysed using scanning electron microscopy (SEM) to characterise life cycle stages and compare gene expression in cell-free culture and cell culture using HCT-8 cells. Cryptosporidium parvum samples were harvested at 2 h, 8 h, 14 h, 26 h, 50 h, 74 h, 98 h, 122 h and 170 h, chemically fixed and specimens were observed using a Zeiss 1555 scanning electron microscope. The presence of sporozoites, trophozoites and type I merozoites were identified by SEM. Gene expression in cell culture and cell-free culture was studied using reverse transcriptase quantitative PCR (RT-qPCR) of the sporozoite surface antigen protein (cp15), the glycoprotein 900 (gp900), the Cryptosporidium oocyst wall protein (COWP) and 18S ribosomal RNA (rRNA) genes in both cell free and conventional cell culture. In cell culture, cp15 expression peaked at 74 h, gp900 expression peaked at 74 h and 98 h and COWP expression peaked at 50 h. In cell-free culture, CP15 expression peaked at 98 h, gp900 expression peaked at 74 h and COWP expression peaked at 122 h. The present study is the first to compare gene expression of C. parvum in cell culture and cell-free culture and to characterise life cycle stages of C. parvum in cell-free culture using SEM. Findings from this study showed that gene expression patterns in cell culture and cell-free culture were similar but in cell-free culture, gene expression was delayed for CP15 and COWP in cell free culture compared with the cell culture system and was lower. Although three life cycle stageswere conclusively identified, improvements in SEM methodology should lead to the detection of more life cycle stages.

  3. Protein hairy enhancer of split-1 expression during differentiation of muscle-derived stem cells into neuron-like cells

    Institute of Scientific and Technical Information of China (English)

    Mina Huang; Zhanpeng Guo; Kun Liu; Xifan Mei; Shiqiang Fang; Jinhao Zeng; Yansong Wang; Yajiang Yuan

    2012-01-01

    Muscle-derived stem cells were isolated from the skeletal muscle of Sprague-Dawley neonatal rats aged 3 days old.Cells at passage 5 were incubated in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum,20 μg/L nerve growth factor,20 μg/L basic fibroblast growth factor and 1% (v/v) penicillin for 6 days.Cells presented with long processes, similar to nerve cells.Connections were formed between cell processes.Immunocytochemical staining with neuron specific enolase verified that cells differentiated into neuron-like cells. Immunofluorescence cytochemistry and western blot results revealed that the expression of protein hairy enhancer of split-1 was significantly reduced.These results indicate that low expression of protein hairy enhancer of split-1 participates in the differentiation of muscle-derived stem cells into neuron-like cells.

  4. Nestin expression in osteosarcomas and derivation of nestin/CD133 positive osteosarcoma cell lines

    International Nuclear Information System (INIS)

    Nestin was originally identified as a class VI intermediate filament protein that is expressed in stem cells and progenitor cells in the mammalian CNS during development. This protein is replaced in the adult organism by other intermediate filament proteins; however, nestin may be re-expressed under certain pathological conditions such as ischemia, inflammation, brain injury, and neoplastic transformation. Nestin has been detected in many kinds of tumors, especially in tumors derived from the CNS. Co-expression of nestin and the CD133 surface molecule is considered to be a marker for cancer stem cells in neurogenic tumors. Our work was aimed at a detailed study of nestin expression in osteosarcomas and osteosarcoma-derived cell lines. Using immunodetection methods, we examined nestin in tumor tissue samples from 18 patients with osteosarcomas. We also successfully established permanent cell lines from the tumor tissue of 4 patients and immunodetection of nestin and CD133 was performed on these cell lines. Nestin-positive tumor cells were immunohistochemically detected in all of the examined osteosarcomas, but the proportion of these cells that were positively stained as well as the intensity of staining varied. Nestin-positive cells were rarely observed in 2 tumor samples, and the remaining 16 tumor samples showed various nestin expression patterns ranging from very sporadic occurrence to an overwhelming proportion of cells with strong positive staining. Three of the established osteosarcoma cell lines were demonstrated to be nestin-positive, and only one cell line showed no expression of nestin; this finding corresponds with the rare occurrence of nestin-positive cells in the respective tumor sample. Moreover, three of these osteosarcoma cell lines were undoubtedly proven to be Nes+/CD133+. Our results represent the first evidence of nestin expression in osteosarcomas and suggest the possible occurrence of cells with a stem-like phenotype in these tumors

  5. Expression of nestin by neural cells in the adult rat and human brain.

    Directory of Open Access Journals (Sweden)

    Michael L Hendrickson

    Full Text Available Neurons and glial cells in the developing brain arise from neural progenitor cells (NPCs. Nestin, an intermediate filament protein, is thought to be expressed exclusively by NPCs in the normal brain, and is replaced by the expression of proteins specific for neurons or glia in differentiated cells. Nestin expressing NPCs are found in the adult brain in the subventricular zone (SVZ of the lateral ventricle and the subgranular zone (SGZ of the dentate gyrus. While significant attention has been paid to studying NPCs in the SVZ and SGZ in the adult brain, relatively little attention has been paid to determining whether nestin-expressing neural cells (NECs exist outside of the SVZ and SGZ. We therefore stained sections immunocytochemically from the adult rat and human brain for NECs, observed four distinct classes of these cells, and present here the first comprehensive report on these cells. Class I cells are among the smallest neural cells in the brain and are widely distributed. Class II cells are located in the walls of the aqueduct and third ventricle. Class IV cells are found throughout the forebrain and typically reside immediately adjacent to a neuron. Class III cells are observed only in the basal forebrain and closely related areas such as the hippocampus and corpus striatum. Class III cells resemble neurons structurally and co-express markers associated exclusively with neurons. Cell proliferation experiments demonstrate that Class III cells are not recently born. Instead, these cells appear to be mature neurons in the adult brain that express nestin. Neurons that express nestin are not supposed to exist in the brain at any stage of development. That these unique neurons are found only in brain regions involved in higher order cognitive function suggests that they may be remodeling their cytoskeleton in supporting the neural plasticity required for these functions.

  6. Human CD4+ CD25+ Foxp3+ regulatory T cells do not constitutively express IL-35.

    Science.gov (United States)

    Bardel, Emilie; Larousserie, Frédérique; Charlot-Rabiega, Pascaline; Coulomb-L'Herminé, Aurore; Devergne, Odile

    2008-11-15

    EBV-induced gene 3 (EBI3) can associate with p28 to form the heterodimeric cytokine IL-27, or with the p35 subunit of IL-12 to form the EBI3/p35 heterodimer, recently named IL-35. In mice, IL-35 has been shown to be constitutively expressed by CD4(+)CD25(+)Foxp3(+) regulatory T cells (Treg cells) and suggested to contribute to their suppressive activity. In this study, we investigated whether human Treg cells express IL-35. Double-staining analysis of human thymuses showed that neither Foxp3(+) nor CD25(+) cells coexpressed EBI3. Similarly, Foxp3(+) cells present in human lymph nodes, tonsils, spleens, and intestines did not express EBI3. Consistent with these in situ observations, Treg cells purified from blood or tonsils were negative for EBI3 by immunoblotting. Other human T cell subsets, including effector T cells, naive and memory CD4(+) T cells, CD8(+) and gammadelta T cells also did not constitutively express EBI3, which contrasts with IL-35 expression observed in murine CD8(+) and gammadelta T cells. Furthermore, although CD3/CD28 stimulation consistently induced low levels of EBI3 in various CD4(+) T cell subsets, no EBI3 could be detected in CD3/CD28-stimulated Treg cells. RT-PCR analysis showed that, whereas p35 transcripts were detected in both Teff and Treg cells, EBI3 transcripts were detected only in activated Teff cells, but not in resting or activated Treg cells. Thus, in contrast to their murine counterpart, human Treg cells do not express detectable amounts of IL-35.

  7. Notch signalling inhibits CD4 expression during initiation and differentiation of human T cell lineage.

    Directory of Open Access Journals (Sweden)

    Stephen M Carlin

    Full Text Available The Delta/Notch signal transduction pathway is central to T cell differentiation from haemopoietic stem cells (HSCs. Although T cell development is well characterized using expression of cell surface markers, the detailed mechanisms driving differentiation have not been established. This issue becomes central with observations that adult HSCs exhibit poor differentiation towards the T cell lineage relative to neonatal or embryonic precursors. This study investigates the contribution of Notch signalling and stromal support cells to differentiation of adult and Cord Blood (CB human HSCs, using the Notch signalling OP9Delta co-culture system. Co-cultured cells were assayed at weekly intervals during development for phenotype markers using flow cytometry. Cells were also assayed for mRNA expression at critical developmental stages. Expression of the central thymocyte marker CD4 was initiated independently of Notch signalling, while cells grown with Notch signalling had reduced expression of CD4 mRNA and protein. Interruption of Notch signalling in partially differentiated cells increased CD4 mRNA and protein expression, and promoted differentiation to CD4(+ CD8(+ T cells. We identified a set of genes related to T cell development that were initiated by Notch signalling, and also a set of genes subsequently altered by Notch signal interruption. These results demonstrate that while Notch signalling is essential for establishment of the T cell lineage, at later stages of differentiation, its removal late in differentiation promotes more efficient DP cell generation. Notch signalling adds to signals provided by stromal cells to allow HSCs to differentiate to T cells via initiation of transcription factors such as HES1, GATA3 and TCF7. We also identify gene expression profile differences that may account for low generation of T cells from adult HSCs.

  8. Inhibition of Ly-6A antigen expression prevents T cell activation

    OpenAIRE

    1990-01-01

    Antisense oligonucleotides complementary to the 5' end of the mRNA encoding the Ly-6A protein were used to block the expression of that protein. Using this approach we could inhibit the expression of Ly-6A by 60-80% in antigen-primed lymph node (LN) T cells as well as in the D10 T cell clone. Inhibition of Ly-6 expression resulted in the inability to restimulate in vitro, antigen-primed T cells. It also blocked the activation of normal spleen cells by Con A, monoclonal antibody (mAb) to CD3, ...

  9. Validation of endogenous normalizing genes for expression analyses in adult human testis and germ cell neoplasms

    DEFF Research Database (Denmark)

    Svingen, T; Jørgensen, Anne; Rajpert-De Meyts, E

    2014-01-01

    expressed across the samples analysed: a so-called normalizing or housekeeping gene. Although this is a valid strategy, the identification of stable normalizing genes has proved challenging and a gene showing stable expression across all cells or tissues is unlikely to exist. Therefore, it is necessary...... and associated testicular pathologies. OCT4 and SALL4 can be used with caution as second-tier normalizers when determining changes in gene expression in germ cells and germ cell tumour components, but the relative transcript abundance appears variable between different germ cell tumour types. We further...

  10. Systemic Sclerosis Patients Present Alterations in the Expression of Molecules Involved in B-Cell Regulation

    Science.gov (United States)

    Soto, Lilian; Ferrier, Ashley; Aravena, Octavio; Fonseca, Elianet; Berendsen, Jorge; Biere, Andrea; Bueno, Daniel; Ramos, Verónica; Aguillón, Juan Carlos; Catalán, Diego

    2015-01-01

    The activation threshold of B cells is tightly regulated by an array of inhibitory and activator receptors in such a way that disturbances in their expression can lead to the appearance of autoimmunity. The aim of this study was to evaluate the expression of activating and inhibitory molecules involved in the modulation of B cell functions in transitional, naive, and memory B-cell subpopulations from systemic sclerosis patients. To achieve this, blood samples were drawn from 31 systemic sclerosis patients and 53 healthy individuals. Surface expression of CD86, MHC II, CD19, CD21, CD40, CD22, Siglec 10, CD35, and FcγRIIB was determined by flow cytometry. IL-10 production was evaluated by intracellular flow cytometry from isolated B cells. Soluble IL-6 and IL-10 levels were measured by ELISA from supernatants of stimulated B cells. Systemic sclerosis patients exhibit an increased frequency of transitional and naive B cells related to memory B cells compared with healthy controls. Transitional and naive B cells from patients express higher levels of CD86 and FcγRIIB than healthy donors. Also, B cells from patients show high expression of CD19 and CD40, whereas memory cells from systemic sclerosis patients show reduced expression of CD35. CD19 and CD35 expression levels associate with different autoantibody profiles. IL-10+ B cells and secreted levels of IL-10 were markedly reduced in patients. In conclusion, systemic sclerosis patients show alterations in the expression of molecules involved in B-cell regulation. These abnormalities may be determinant in the B-cell hyperactivation observed in systemic sclerosis. PMID:26483788

  11. Activated vascular endothelia regulate invasion of glioma cells through expression of fibronectin

    Institute of Scientific and Technical Information of China (English)

    LIN Zhi-xiong; YANG Li-juan; HUANG Qiang; FU Jin

    2010-01-01

    Background Previous researches have indicated that glioma invasion may occur within a tumor-host microecology, and that fibronectin may be involved in glioma invasion as an important component of the extracellular matrix. However, how the interaction between tumor cells and vascular endothelial cells affects glioma invasion is poorly understood. The aim of this study was to investigate the effects of the interaction between tumor cells and vascular endothelial cells on glioma invasion, and the relationship of this interaction to fibronectin.Methods The localization of fibronectin in different brain astrocytoma tissues was determined by immunohistochemistry. Then, vascular endothelial cells and glioma cells were co-cultured in a Transwell co-culturing system. Fibronectin expression was detected by reverse transcriptase-polymerase chain reaction, immunocytochemistry, and enzyme-linked immunosorbent assay. Additionally, the influence of the interaction between tumor cells and vascular endothelial cells on glioma cell invasion was determined by an in vitro rapid invasion test.Results In brain astrocytoma tissues, fibronectin was present on the endothelial