WorldWideScience

Sample records for as1 cells expressing

  1. Highly expressed long non-coding RNA FOXD2-AS1 promotes non-small cell lung cancer progression via Wnt/β-catenin signaling.

    Science.gov (United States)

    Rong, Lin; Zhao, Ruixing; Lu, Jinxiu

    2017-03-11

    Non-small cell lung cancer (NSCLC) is one of the most common and aggressive tumors around the world. Long-noncoding RNAs (lncRNAs) have been recently shown to play important roles in regulating numerous biological processes including tumor progression. However, the role of lncRNA FOXD2-AS1 in NSCLC remains unclear. In this study, we found that lncRNA FOXD2-AS1 is significantly up-regulated in NSCLC tissues. Loss- and gain-function assays revealed that FOXD2-AS1 promotes NSCLC cell growth and NSCLC tumor progression. Furthermore, we also revealed that FOXD2-AS1 modulates Wnt/β-catenin signaling in NSCLC cells. Taken together, we conclude that lncRNA FOXD2-AS1 promotes NSCLC progression though Wnt/β-catenin signaling. These results suggest that lncRNA FOXD2-AS1 might act as a novel therapeutic target for NSCLC treatment.

  2. [Expression of the apomictic potential and selection for apomixis in sorghum line AS-1a].

    Science.gov (United States)

    El'konin, L A; Beliaeva, E V; Fadeeva, I Iu

    2012-01-01

    Expression of elements of apomixis was studied for ten seasons in sorghum line AS-la and its backcross hybrids on the 9E and A3 sterile cytoplasms. Cytoembryological analysis revealed aposporous embryo sacks (apo-ESs), their initial cells, and, rare, parthenogeneic proembryos in ovules of line AS-la and its BC2 and BC3 hybrids on the 9E cytoplasm. The A3 sterile cytoplasm suppressed the development of parthenogenetic proembryos, but did not affect the apo-ES formation. The frequency of apomictic elements increased in seasons with high daily temperatures and total precipitation deficiency in the period when the ovule and megagametophyte developed (r = -0.805, P anthocyan color of coleoptyles and leaves in seedlings. Plants of the maternal type were found in the progenies of these crosses at a frequency of 1.4-28.1%. The genetic structure of the endosperm in grains with maternal-type seedlings was inferred from the electrophoretic patterns of storage proteins (kafirins). The kafirin spectra of grains producing maternal-type seedlings was similar to the spectrum of line AS-la and differed from the spectra of grains producing hybrid seedlings, indicating that the endosperm developed independently when apomictic grains formed in line AS-1a. The results showed that lines with facultative apomixis can be constructed in functionally diploid plants.

  3. 肺腺癌组织中lncRNA CADM1-AS1表达及其临床意义%Expression and clinical significance of lncRNA CADM1-AS1 in lung adenocarcinoma

    Institute of Scientific and Technical Information of China (English)

    姚传山; 马磊; 赵旭林; 贺利民; 李醒亚

    2015-01-01

    目的:探讨长链非编码lncRNA CADM1⁃AS1在肺腺癌组织中的表达水平及其临床意义。方法收集于本院行手术切除的72例肺腺癌组织及对应癌旁组织,采用实时定量PCR( qPCR)法检测以上组织标本中的CADM1⁃AS1水平,分析CADM1⁃AS1水平与临床病理参数(性别、年龄、肿瘤大小、分化类型、临床分期、T分期、吸烟史和淋巴结转移)的关系,同时根据远期生存资料比较不同CADM1⁃AS1表达水平的中位总生存期( OS)。进一步采用qPCR法检测常见非小细胞肺癌株A549、SPC⁃A、NCI⁃H1650和NCI⁃H1299中的CADM1⁃AS1水平。采用受试者工作特征曲线( ROC)评价组织CADM1⁃AS1水平在肺腺癌早期诊断中的效能。结果肺腺癌组织中的CADM1⁃AS1水平低于癌旁组织,且与正常支气管上皮细胞株16HBE相比,非小细胞肺癌株的CADM1⁃AS1均为低表达,差异有统计学意义( P均<0�05),且按照由高至低依次为NCI⁃H1299>SPC⁃A>NCI⁃H1650>A549;CADM1⁃AS1表达与肺腺癌的TNM分期、分化类型、肿瘤大小、T分期及淋巴结转移有关,其中TNM Ⅱ、Ⅲ期、低未分化、肿瘤最大径>3 cm、T 分期 T3、T4期及有淋巴结转移组织的 CADM1⁃AS1水平均低于对应项( P 均<0�05);CADM1⁃AS1高水平者的中位OS为32�5个月,高于低水平者的16�0个月,差异有统计学意义( P均<0�05)。组织CADM1⁃AS1水平在肺腺癌早期诊断中的价值较好,其曲线下面积为0�874,灵敏度和特异度分别为87�8%和85�2%。结论 CADM1⁃AS1在肺腺癌组织及非小细胞肺癌细胞株中低表达,且与TNM分期、分化类型等临床病理参数及预后有关,可能在肺腺癌的发生发展中有一定作用,同时对于肺腺癌的早期诊断有较好价值。%Objective To explore the expression and clinical significance of lncRNA CADM1⁃AS1 in lung adenocarcinoma

  4. Human Neuroepithelial Cells Express NMDA Receptors

    Directory of Open Access Journals (Sweden)

    Cappell B

    2003-11-01

    Full Text Available Abstract L-glutamate, an excitatory neurotransmitter, binds to both ionotropic and metabotropic glutamate receptors. In certain parts of the brain the BBB contains two normally impermeable barriers: 1 cerebral endothelial barrier and 2 cerebral epithelial barrier. Human cerebral endothelial cells express NMDA receptors; however, to date, human cerebral epithelial cells (neuroepithelial cells have not been shown to express NMDA receptor message or protein. In this study, human hypothalamic sections were examined for NMDA receptors (NMDAR expression via immunohistochemistry and murine neuroepithelial cell line (V1 were examined for NMDAR via RT-PCR and Western analysis. We found that human cerebral epithelium express protein and cultured mouse neuroepithelial cells express both mRNA and protein for the NMDA receptor. These findings may have important consequences for neuroepithelial responses during excitotoxicity and in disease.

  5. Rho GTPase expression in human myeloid cells.

    Directory of Open Access Journals (Sweden)

    Suzanne F G van Helden

    Full Text Available Myeloid cells are critical for innate immunity and the initiation of adaptive immunity. Strict regulation of the adhesive and migratory behavior is essential for proper functioning of these cells. Rho GTPases are important regulators of adhesion and migration; however, it is unknown which Rho GTPases are expressed in different myeloid cells. Here, we use a qPCR-based approach to investigate Rho GTPase expression in myeloid cells.We found that the mRNAs encoding Cdc42, RhoQ, Rac1, Rac2, RhoA and RhoC are the most abundant. In addition, RhoG, RhoB, RhoF and RhoV are expressed at low levels or only in specific cell types. More differentiated cells along the monocyte-lineage display lower levels of Cdc42 and RhoV, while RhoC mRNA is more abundant. In addition, the Rho GTPase expression profile changes during dendritic cell maturation with Rac1 being upregulated and Rac2 downregulated. Finally, GM-CSF stimulation, during macrophage and osteoclast differentiation, leads to high expression of Rac2, while M-CSF induces high levels of RhoA, showing that these cytokines induce a distinct pattern. Our data uncover cell type specific modulation of the Rho GTPase expression profile in hematopoietic stem cells and in more differentiated cells of the myeloid lineage.

  6. The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply.

    Science.gov (United States)

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari

    2012-09-28

    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.

  7. Human plasma cells express granzyme B.

    Science.gov (United States)

    Xu, Wei; Narayanan, Priya; Kang, Ning; Clayton, Sandra; Ohne, Yoichiro; Shi, Peiqing; Herve, Marie-Cecile; Balderas, Robert; Picard, Capucine; Casanova, Jean-Laurent; Gorvel, Jean-Pierre; Oh, Sangkon; Pascual, Virginia; Banchereau, Jacques

    2014-01-01

    While studying the plasma cell (PC) compartment in human tonsils, we identified that immunoglobulin kappa or lambda chain-expressing PCs are the main cells expressing granzyme B (GrzB). In vitro studies revealed that activated B cells differentiated into GrzB-expressing PCs when co-cultured with macrophages and follicular helper T cells. This effect could be reproduced on combined stimulation of IL-15 (produced by macrophages) and IL-21 (produced by T follicular helper cells) in a STAT3-dependent manner. Whereas IL-21 triggers the transcription of mRNA of GrzB, IL-15 synergizes the translation of GrzB proteins. The precise role of GrzB in PC biology remains to be understood and studies in mice will not help as their PCs do not express GrzB.

  8. Microanalysis of gene expression in cultured cells

    NARCIS (Netherlands)

    E. van der Veer (Eveliene)

    1982-01-01

    textabstractIn this thesis two aspects of gene expression in cultured cells have been studied: the heterogeneity in gene expression in relation with the development and application of microchemical techniques for the prenatal diagnosis of inborn errors of metabolism and the possibility of inducing g

  9. Differential expression of cell adhesion genes

    DEFF Research Database (Denmark)

    Stein, Wilfred D; Litman, Thomas; Fojo, Tito;

    2005-01-01

    that compare cells grown in suspension to similar cells grown attached to one another as aggregates have suggested that it is adhesion to the extracellular matrix of the basal membrane that confers resistance to apoptosis and, hence, resistance to cytotoxins. The genes whose expression correlates with poor...

  10. CNPase Expression in Olfactory Ensheathing Cells

    Directory of Open Access Journals (Sweden)

    Christine Radtke

    2011-01-01

    Full Text Available A large body of work supports the proposal that transplantation of olfactory ensheathing cells (OECs into nerve or spinal cord injuries can promote axonal regeneration and remyelination. Yet, some investigators have questioned whether the transplanted OECs associate with axons and form peripheral myelin, or if they recruit endogenous Schwann cells that form myelin. Olfactory bulbs from transgenic mice expressing the enhanced green fluorescent protein (eGFP under the control of the 2-3-cyclic nucleotide 3-phosphodiesterase (CNPase promoter were studied. CNPase is expressed in myelin-forming cells throughout their lineage. We examined CNPase expression in both in situ in the olfactory bulb and in vitro to determine if OECs express CNPase commensurate with their myelination potential. eGFP was observed in the outer nerve layer of the olfactory bulb. Dissociated OECs maintained in culture had both intense eGFP expression and CNPase immunostaining. Transplantation of OECs into transected peripheral nerve longitudinally associated with the regenerated axons. These data indicate that OECs in the outer nerve layer of the olfactory bulb of CNPase transgenic mice express CNPase. Thus, while OECs do not normally form myelin on olfactory nerve axons, their expression of CNPase is commensurate with their potential to form myelin when transplanted into injured peripheral nerve.

  11. Pitx2 expression promotes p21 expression and cell cycle exit in neural stem cells.

    Science.gov (United States)

    Heldring, Nina; Joseph, Bertrand; Hermanson, Ola; Kioussi, Chrissa

    2012-11-01

    Cortical development is a complex process that involves many events including proliferation, cell cycle exit and differentiation that need to be appropriately synchronized. Neural stem cells (NSCs) isolated from embryonic cortex are characterized by their ability of self-renewal under continued maintenance of multipotency. Cell cycle progression and arrest during development is regulated by numerous factors, including cyclins, cyclin dependent kinases and their inhibitors. In this study, we exogenously expressed the homeodomain transcription factor Pitx2, usually expressed in postmitotic progenitors and neurons of the embryonic cortex, in NSCs with low expression of endogenous Pitx2. We found that Pitx2 expression induced a rapid decrease in proliferation associated with an accumulation of NSCs in G1 phase. A search for potential cell cycle inhibitors responsible for such cell cycle exit of NSCs revealed that Pitx2 expression caused a rapid and dramatic (≉20-fold) increase in expression of the cell cycle inhibitor p21 (WAF1/Cip1). In addition, Pitx2 bound directly to the p21 promoter as assessed by chromatin immunoprecipitation (ChIP) in NSCs. Surprisingly, Pitx2 expression was not associated with an increase in differentiation markers, but instead the expression of nestin, associated with undifferentiated NSCs, was maintained. Our results suggest that Pitx2 promotes p21 expression and induces cell cycle exit in neural progenitors.

  12. Expression in aneuploid Drosophila S2 cells.

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2010-02-01

    Full Text Available Extensive departures from balanced gene dose in aneuploids are highly deleterious. However, we know very little about the relationship between gene copy number and expression in aneuploid cells. We determined copy number and transcript abundance (expression genome-wide in Drosophila S2 cells by DNA-Seq and RNA-Seq. We found that S2 cells are aneuploid for >43 Mb of the genome, primarily in the range of one to five copies, and show a male genotype ( approximately two X chromosomes and four sets of autosomes, or 2X;4A. Both X chromosomes and autosomes showed expression dosage compensation. X chromosome expression was elevated in a fixed-fold manner regardless of actual gene dose. In engineering terms, the system "anticipates" the perturbation caused by X dose, rather than responding to an error caused by the perturbation. This feed-forward regulation resulted in precise dosage compensation only when X dose was half of the autosome dose. Insufficient compensation occurred at lower X chromosome dose and excessive expression occurred at higher doses. RNAi knockdown of the Male Specific Lethal complex abolished feed-forward regulation. Both autosome and X chromosome genes show Male Specific Lethal-independent compensation that fits a first order dose-response curve. Our data indicate that expression dosage compensation dampens the effect of altered DNA copy number genome-wide. For the X chromosome, compensation includes fixed and dose-dependent components.

  13. Transitional cell carcinoma express vitamin D receptors

    DEFF Research Database (Denmark)

    Hermann, G G; Andersen, C B

    1997-01-01

    Recently, vitamin D analogues have shown antineoplastic effect in several diseases. Vitamin D analogues exert its effect by interacting with the vitamin D receptor (VDR). Studies of VDR in transitional cell carcinoma (TCC) have not been reported. The purpose of the present study was therefore.......05). Similarly, also tumor grade appeared to be related to the number of cells expressing the receptor. Normal urothlium also expressed VDR but only with low intensity. Our study shows that TCC cells possess the VDR receptor which may make them capable to respond to stimulation with vitamin D, but functional...... studies of vitamin D's effect on TCC cells in vitro are necessary before the efficacy of treatment with vitamin D analogues in TCC can be evaluated in patients....

  14. Melanopsin expressing human retinal ganglion cells

    DEFF Research Database (Denmark)

    Hannibal, Jens; Christensen, Anders Tolstrup; Heegaard, Steffen

    2017-01-01

    Intrinsically photosensitive retinal ganglion cells (ipRGCs) expressing the photopigment melanopsin belong to a heterogenic population of RGCs which regulate the circadian clock, masking behavior, melatonin suppression, the pupillary light reflex and sleep/wake cycles. The different functions seem...

  15. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available AS1CAMV S000023 16-Jan-1998 (last modified) kehi as-1 (activation sequence 1) in Ca...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ... ...MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea

  16. Dental enamel cells express functional SOCE channels.

    Science.gov (United States)

    Nurbaeva, Meerim K; Eckstein, Miriam; Concepcion, Axel R; Smith, Charles E; Srikanth, Sonal; Paine, Michael L; Gwack, Yousang; Hubbard, Michael J; Feske, Stefan; Lacruz, Rodrigo S

    2015-10-30

    Dental enamel formation requires large quantities of Ca(2+) yet the mechanisms mediating Ca(2+) dynamics in enamel cells are unclear. Store-operated Ca(2+) entry (SOCE) channels are important Ca(2+) influx mechanisms in many cells. SOCE involves release of Ca(2+) from intracellular pools followed by Ca(2+) entry. The best-characterized SOCE channels are the Ca(2+) release-activated Ca(2+) (CRAC) channels. As patients with mutations in the CRAC channel genes STIM1 and ORAI1 show abnormal enamel mineralization, we hypothesized that CRAC channels might be an important Ca(2+) uptake mechanism in enamel cells. Investigating primary murine enamel cells, we found that key components of CRAC channels (ORAI1, ORAI2, ORAI3, STIM1, STIM2) were expressed and most abundant during the maturation stage of enamel development. Furthermore, inositol 1,4,5-trisphosphate receptor (IP3R) but not ryanodine receptor (RyR) expression was high in enamel cells suggesting that IP3Rs are the main ER Ca(2+) release mechanism. Passive depletion of ER Ca(2+) stores with thapsigargin resulted in a significant raise in [Ca(2+)]i consistent with SOCE. In cells pre-treated with the CRAC channel blocker Synta-66 Ca(2+) entry was significantly inhibited. These data demonstrate that enamel cells have SOCE mediated by CRAC channels and implicate them as a mechanism for Ca(2+) uptake in enamel formation.

  17. Cell cycle gene expression under clinorotation

    Science.gov (United States)

    Artemenko, Olga

    2016-07-01

    Cyclins and cyclin-dependent kinase (CDK) are main regulators of the cell cycle of eukaryotes. It's assumes a significant change of their level in cells under microgravity conditions and by other physical factors actions. The clinorotation use enables to determine the influence of gravity on simulated events in the cell during the cell cycle - exit from the state of quiet stage and promotion presynthetic phase (G1) and DNA synthesis phase (S) of the cell cycle. For the clinorotation effect study on cell proliferation activity is the necessary studies of molecular mechanisms of cell cycle regulation and development of plants under altered gravity condition. The activity of cyclin D, which is responsible for the events of the cell cycle in presynthetic phase can be controlled by the action of endogenous as well as exogenous factors, but clinorotation is one of the factors that influence on genes expression that regulate the cell cycle.These data can be used as a model for further research of cyclin - CDK complex for study of molecular mechanisms regulation of growth and proliferation. In this investigation we tried to summarize and analyze known literature and own data we obtained relatively the main regulators of the cell cycle in altered gravity condition.

  18. Toward stable gene expression in CHO cells

    Science.gov (United States)

    Mariati; Koh, Esther YC; Yeo, Jessna HM; Ho, Steven CL; Yang, Yuansheng

    2014-01-01

    Maintaining high gene expression level during long-term culture is critical when producing therapeutic recombinant proteins using mammalian cells. Transcriptional silencing of promoters, most likely due to epigenetic events such as DNA methylation and histone modifications, is one of the major mechanisms causing production instability. Previous studies demonstrated that the core CpG island element (IE) from the hamster adenine phosphoribosyltransferase gene is effective to prevent DNA methylation. We generated one set of modified human cytomegalovirus (hCMV) promoters by insertion of one or two copies of IE in either forward or reverse orientations into different locations of the hCMV promoter. The modified hCMV with one copy of IE inserted between the hCMV enhancer and core promoter in reverse orientation (MR1) was most effective at enhancing expression stability in CHO cells without comprising expression level when compared with the wild type hCMV. We also found that insertion of IE into a chimeric murine CMV (mCMV) enhancer and human elongation factor-1α core (hEF) promoter in reverse orientation did not enhance expression stability, indicating that the effect of IE on expression stability is possibly promoter specific. PMID:25482237

  19. MEMBRANE LEc EXPRESSION IN BREAST CANCER CELLS

    Directory of Open Access Journals (Sweden)

    Ya. A. Udalova

    2009-01-01

    Full Text Available Affine chromatography was used to isolate Lec antibodies from the sera of a healthy female donor with the high titers of these anti- bodies, which were labeled with biotin. The study enrolled 51 patients with primary breast cancer (BC. Antigen expression was found by immunohistochemistry and flow cytometry. With these two techniques being used, the detection rate of Lec expression in BC cells was 65% (33/51; the antigen was most frequently found by flow cytometry as compared with immunohistochemistry: 72 and 58% of cases, respectively.

  20. Optogenetics for gene expression in mammalian cells.

    Science.gov (United States)

    Müller, Konrad; Naumann, Sebastian; Weber, Wilfried; Zurbriggen, Matias D

    2015-02-01

    Molecular switches that are controlled by chemicals have evolved as central research instruments in mammalian cell biology. However, these tools are limited in terms of their spatiotemporal resolution due to freely diffusing inducers. These limitations have recently been addressed by the development of optogenetic, genetically encoded, and light-responsive tools that can be controlled with the unprecedented spatiotemporal precision of light. In this article, we first provide a brief overview of currently available optogenetic tools that have been designed to control diverse cellular processes. Then, we focus on recent developments in light-controlled gene expression technologies and provide the reader with a guideline for choosing the most suitable gene expression system.

  1. Direct Cell Lysis for Single-Cell Gene Expression Profiling

    OpenAIRE

    David eSvec; Daniel eAndersson; Milos ePekny; Robert eSjöback; Mikael eKubista; Anders eStåhlberg

    2013-01-01

    The interest to analyze single and few cell samples is rapidly increasing. Numerous extraction protocols to purify nucleic acids are available, but most of them compromise severely on yield to remove contaminants and are therefore not suitable for the analysis of samples containing small numbers of transcripts only. Here, we evaluate 17 direct cell lysis protocols for transcript yield and compatibility with downstream reverse transcription quantitative real-time PCR. Four endogenously express...

  2. Cholinergic regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan

    1997-01-01

    Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

  3. Expression of Cyclooxygenase-2 in Ovarian Cancer Cell Lines

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    To investigate the expression of cyclooxygenase-2 (COX-2) in ovarian cancer cell lines,RT-PCR and immunocytochemistry were used to detect the expression of COX-2 in 5 ovarian cancer cell lines. The expression of COX-2 mRNA and protein was detected in all 5 cell lines. It is suggested that COX-2 is expressed in ovarian cancer cell lines, which provides a basis for the chemoprevention of ovarian cancer.

  4. EXPRESSION OF Fas LIGAND IN HUMAN COLON CANCER CELL LINES

    Institute of Scientific and Technical Information of China (English)

    张建军; 丁尔迅; 王强; 陈学云; 付志仁

    2001-01-01

    To investigate the expression of Fas ligand in human colon carcinoma cell lines. Methods: A total of six human colon cancer cell lines were examined for the expression of Fas ligand mRNA and cell surface protein by using RT-PCR and flow cytometry respectively. Results: The results showed that Fas ligand mRNA was expressed in all of the six cancer cell lines and Fas ligand cell surface protein was expressed in part of them. Conclusion: These data suggest that Fas ligand was expressed, at least in part, in human colon cancer cell lines and might facilitate to escape from immune surveillance of the host.

  5. Direct cell lysis for single-cell gene expression profiling

    Directory of Open Access Journals (Sweden)

    David eSvec

    2013-11-01

    Full Text Available The interest to analyze single and few cell samples is rapidly increasing. Numerous extraction protocols to purify nucleic acids are available, but most of them compromise severely on yield to remove contaminants and are therefore not suitable for the analysis of samples containing small numbers of transcripts only. Here, we evaluate 17 direct cell lysis protocols for transcript yield and compatibility with downstream reverse transcription quantitative real-time PCR. Four endogenously expressed genes are assayed together with RNA and DNA spikes in the samples. We found bovine serum albumin (BSA to be the best lysis agent, resulting in efficient cell lysis, high RNA stability and enhanced reverse transcription efficiency. Furthermore, we found direct cell lysis with BSA superior to standard column based extraction methods, when analyzing from 1 up to 512 mammalian cells. In conclusion, direct cell lysis protocols based on BSA can be applied with most cell collection methods and are compatible with most analytical workflows to analyze single cells as well as samples composed of small numbers of cells.

  6. Gene expression profiles in irradiated cancer cells

    Science.gov (United States)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.

    2013-07-01

    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  7. Gene expression profiles in irradiated cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C. [IBFM CNR - LATO, Cefalù, Segrate (Italy)

    2013-07-26

    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  8. Forced Expression of ZNF143 Restrains Cancer Cell Growth

    Directory of Open Access Journals (Sweden)

    Kimitoshi Kohno

    2011-10-01

    Full Text Available We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143 regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1, aurora kinase B (AURKB and some minichromosome maintenance complex components (MCM. However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.

  9. Forced Expression of ZNF143 Restrains Cancer Cell Growth

    Energy Technology Data Exchange (ETDEWEB)

    Izumi, Hiroto, E-mail: h-izumi@med.uoeh-u.ac.jp; Yasuniwa, Yoshihiro; Akiyama, Masaki; Yamaguchi, Takahiro; Kuma, Akihiro; Kitamura, Noriaki; Kohno, Kimitoshi [Department of Molecular Biology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu 807-8555 (Japan)

    2011-10-19

    We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143) regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1), aurora kinase B (AURKB) and some minichromosome maintenance complex components (MCM). However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells) and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.

  10. Expression of basal cell keratins in human prostate cancer metastases and cell lines.

    NARCIS (Netherlands)

    Leenders, G.J.L.H. van; Aalders, M.W.; Hulsbergen-van de Kaa, C.A.; Ruiter, D.J.; Schalken, J.A.

    2001-01-01

    Within normal human prostate epithelium, basal and luminal cells can be discriminated by their expression of keratins (K). While basal cells express K5/14, luminal cells show expression of K8/18 and an intermediate cell population can be identified by co-expression of K5/18. Prostate cancer is predo

  11. T cells stimulate catabolic gene expression by the stromal cells from giant cell tumor of bone

    Energy Technology Data Exchange (ETDEWEB)

    Cowan, Robert W. [Department of Pathology and Molecular Medicine, McMaster University, 1280 Main St. W., Hamilton, ON, Canada L8S 4L8 (Canada); Juravinski Cancer Centre, 699 Concession St., Hamilton, ON, Canada L8V 5C2 (Canada); Ghert, Michelle [Juravinski Cancer Centre, 699 Concession St., Hamilton, ON, Canada L8V 5C2 (Canada); Department of Surgery, McMaster University, 1280 Main St. W., Hamilton, ON, Canada L8S 4L8 (Canada); Singh, Gurmit, E-mail: gurmit.singh@jcc.hhsc.ca [Department of Pathology and Molecular Medicine, McMaster University, 1280 Main St. W., Hamilton, ON, Canada L8S 4L8 (Canada); Juravinski Cancer Centre, 699 Concession St., Hamilton, ON, Canada L8V 5C2 (Canada)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer Two T cell lines stimulate PTHrP, RANKL, MMP13 gene expression in GCT cell cultures. Black-Right-Pointing-Pointer CD40 expressed by stromal cells; CD40L detected in whole tumor but not cultures. Black-Right-Pointing-Pointer Effect of CD40L treatment on GCT cells increased PTHrP and MMP13 gene expression. Black-Right-Pointing-Pointer PTHrP treatment increased MMP13 expression, while inhibition decreased expression. Black-Right-Pointing-Pointer T cells may stimulate GCT stromal cells and promote the osteolysis of the tumor. -- Abstract: The factors that promote the localized bone resorption by giant cell tumor of bone (GCT) are not fully understood. We investigated whether T cells could contribute to bone resorption by stimulating expression of genes for parathyroid hormone-related protein (PTHrP), matrix metalloproteinase (MMP)-13, and the receptor activator of nuclear-factor {kappa}B ligand (RANKL). Two cell lines, Jurkat clone E6-1 and D1.1, were co-cultured with isolated GCT stromal cells. Real-time PCR analyses demonstrated a significant increase of all three genes following 48 h incubation, and PTHrP and MMP-13 gene expression was also increased at 24 h. Further, we examined the expression of CD40 ligand (CD40L), a protein expressed by activated T cells, and its receptor, CD40, in GCT. Immunohistochemistry results revealed expression of the CD40 receptor in both the stromal cells and giant cells of the tumor. RNA collected from whole GCT tissues showed expression of CD40LG, which was absent in cultured stromal cells, and suggests that CD40L is expressed within GCT. Stimulation of GCT stromal cells with CD40L significantly increased expression of the PTHrP and MMP-13 genes. Moreover, we show that inhibition of PTHrP with neutralizing antibodies significantly decreased MMP13 expression by the stromal cells compared to IgG-matched controls, whereas stimulation with PTHrP (1-34) increased MMP-13 gene expression. These

  12. Gene expression profile of renal cell carcinoma clear cell type

    Directory of Open Access Journals (Sweden)

    Marcos F. Dall’Oglio

    2010-08-01

    Full Text Available PURPOSE: The determination of prognosis in patients with renal cell carcinoma (RCC is based, classically, on stage and histopathological aspects. The metastatic disease develops in one third of patients after surgery, even in localized tumors. There are few options for treating those patients, and even the new target designed drugs have shown low rates of success in controlling disease progression. Few studies used high throughput genomic analysis in renal cell carcinoma for determination of prognosis. This study is focused on the identification of gene expression signatures in tissues of low-risk, high-risk and metastatic RCC clear cell type (RCC-CCT. MATERIALS AND METHODS: We analyzed the expression of approximately 55,000 distinct transcripts using the Whole Genome microarray platform hybridized with RNA extracted from 19 patients submitted to surgery to treat RCC-CCT with different clinical outcomes. They were divided into three groups (1 low risk, characterized by pT1, Fuhrman grade 1 or 2, no microvascular invasion RCC; (2 high risk, pT2-3, Fuhrman grade 3 or 4 with, necrosis and microvascular invasion present and (3 metastatic RCC-CCT. Normal renal tissue was used as control. RESULTS: After comparison of differentially expressed genes among low-risk, high-risk and metastatic groups, we identified a group of common genes characterizing metastatic disease. Among them Interleukin-8 and Heat shock protein 70 were over-expressed in metastasis and validated by real-time polymerase chain reaction. CONCLUSION: These findings can be used as a starting point to generate molecular markers of RCC-CCT as well as a target for the development of innovative therapies.

  13. Haemopedia: An Expression Atlas of Murine Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    Carolyn A. de Graaf

    2016-09-01

    Full Text Available Hematopoiesis is a multistage process involving the differentiation of stem and progenitor cells into distinct mature cell lineages. Here we present Haemopedia, an atlas of murine gene-expression data containing 54 hematopoietic cell types, covering all the mature lineages in hematopoiesis. We include rare cell populations such as eosinophils, mast cells, basophils, and megakaryocytes, and a broad collection of progenitor and stem cells. We show that lineage branching and maturation during hematopoiesis can be reconstructed using the expression patterns of small sets of genes. We also have identified genes with enriched expression in each of the mature blood cell lineages, many of which show conserved lineage-enriched expression in human hematopoiesis. We have created an online web portal called Haemosphere to make analyses of Haemopedia and other blood cell transcriptional datasets easier. This resource provides simple tools to interrogate gene-expression-based relationships between hematopoietic cell types and genes of interest.

  14. EXPRESSION OF IMMUNE-RELATED MOLECULES IN GLIOBLASTOMA MULTIFORM CELLS

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective: To investigate the expression of immune- related molecules in glioblastoma multiform(GBM) cells. Methods: The expression of major histocompatibility complex (MHC), β2-microglobulin, Fas, CD80 and CD86 molecules on the surface of GBM cells were evaluated by flow cytometry. The expression of TAP-1, TAP-2 and Tapasin in the GBM cells were evaluated by RT-PCR method. Results: MHC class Ⅰ, β2 microglobulin, TAP-1, TAP-2 and tapasin were expressed in most GBM cell lines. Except U87, there was no MHC class Ⅱ molecule expression on any of the other GBM cell lines. Fas was expressed on all the GBM cell lines examined. Conclusion: The mechanism by which GBM escapes immune surveillance may involve down regulation of expression of MHC class Ⅰ molecules and MHC class Ⅱ molecules. MHC class Ⅰpositive GBM may be the suitable target of immunotherapy.

  15. High expression of markers of apoptosis in Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Petersen, Bodil Laub; Lundegaard, Pia Rengtved; Bank, M I;

    2003-01-01

    53 and the number of cells in apoptosis detected with TUNEL. Langerhans cell histiocytosis cells showed strong expression of p53 and in some cases co-expression of Fas and Fas-L. The expression of Fas-L was significantly higher in infiltrates from patients with single-system disease. The actual...... number of pathological Langerhans cells in apoptosis as estimated by TUNEL was low. CONCLUSIONS: The low number of TUNEL-reactive cells can be explained by the rapid turnover of apoptotic cells in the tissue, not leaving the apoptotic cells long enough in the tissue to be detected. The co...

  16. Human thymic epithelial cells express functional HLA-DP molecules

    DEFF Research Database (Denmark)

    Jørgensen, A; Röpke, C; Nielsen, M

    1996-01-01

    T lymphocytes, we examined whether human thymic epithelial cells (TEC) expressed HLA-DP molecules. We present evidence that TEC obtained from short time culture express low but significant levels of HLA-DP molecules. The expression of HLA-DP molecules was comparable to or higher than the expression...... of HLA-DP allospecific primed lymphocyte typing (PLT) CD4 T cell lines. IFN-gamma treatment strongly upregulated the HLA-DP allospecific PLT responses whereas other PLT responses remained largely unchanged. In conclusion, these data indicate that human thymus epithelial cells express significant levels...

  17. Pharmacologic suppression of target cell recognition by engineered T cells expressing chimeric T-cell receptors.

    Science.gov (United States)

    Alvarez-Vallina, L; Yañez, R; Blanco, B; Gil, M; Russell, S J

    2000-04-01

    Adoptive therapy with autologous T cells expressing chimeric T-cell receptors (chTCRs) is of potential interest for the treatment of malignancy. To limit possible T-cell-mediated damage to normal tissues that weakly express the targeted tumor antigen (Ag), we have tested a strategy for the suppression of target cell recognition by engineered T cells. Jurkat T cells were transduced with an anti-hapten chTCR tinder the control of a tetracycline-suppressible promoter and were shown to respond to Ag-positive (hapten-coated) but not to Ag-negative target cells. The engineered T cells were then reacted with hapten-coated target cells at different effector to target cell ratios before and after exposure to tetracycline. When the engineered T cells were treated with tetracycline, expression of the chTCR was greatly decreased and recognition of the hapten-coated target cells was completely suppressed. Tetracycline-mediated suppression of target cell recognition by engineered T cells may be a useful strategy to limit the toxicity of the approach to cancer gene therapy.

  18. Expression of HOX C homeobox genes in lymphoid cells.

    Science.gov (United States)

    Lawrence, H J; Stage, K M; Mathews, C H; Detmer, K; Scibienski, R; MacKenzie, M; Migliaccio, E; Boncinelli, E; Largman, C

    1993-08-01

    The class I homeobox genes located in four clusters in mammalian genomes (HOX A, HOX B, HOX C, and HOX D) appear to play a major role in fetal development. Previous surveys of homeobox gene expression in human leukemic cell lines have shown that certain HOX A genes are expressed only in myeloid cell lines, whereas HOX B gene expression is largely restricted to cells with erythroid potential. We now report a survey of the expression patterns of 9 homeobox genes from the HOX C locus in a panel of 24 human and 7 murine leukemic cell lines. The most striking observation is the lymphoid-specific pattern of expression of HOX C4, located at the 3' end of the locus. A major transcript of 1.9 kilobases is observed in both T-cell and B-cell lines. HOX C4 expression is also detected in normal human marrow and peripheral blood lymphocytes, but not in mature granulocytes or monocytes. HOX C8 is also expressed in human lymphoid cells but is expressed in other blood cell types as well. However, the HOX C8 transcript pattern is lineage specific. These data, in conjunction with earlier findings, suggest that homeobox gene expression influences lineage determination during hematopoiesis.

  19. Freedom of expression: cell-type-specific gene profiling.

    Science.gov (United States)

    Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H

    2014-01-01

    Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling.

  20. Advantages and Applications of CAR-Expressing Natural Killer Cells

    Directory of Open Access Journals (Sweden)

    Wolfgang eGlienke

    2015-02-01

    Full Text Available In contrast to donor T cells, natural killer (NK cells are known to mediate anti-cancer effects without the risk of inducing graft-versus-host disease (GvHD. In order to improve cytotoxicity against resistant cancer cells, auspicious efforts have been made with chimeric antigen receptor (CAR expressing T- and NK cells. These CAR-modified cells express antigen receptors against tumor-associated surface antigens, thus redirecting the effector cells and enhancing tumor-specific immunosurveillance. However, many cancer antigens are also expressed on healthy tissues, potentially leading to off tumor/ on target toxicity by CAR-engineered cells. In order to control such potentially severe side effects, the insertion of suicide genes into CAR-modified effectors can provide a means for efficient depletion of these cells. While CAR-expressing T cells have entered successfully clinical trials, experience with CAR-engineered NK cells is mainly restricted to pre-clinical investigations and predominantly to NK cell lines. In this review we summarize the data on CAR expressing NK cells focusing on the possible advantage using these short-lived effector cells and discuss the necessity of suicide switches. Furthermore, we address the compliance of such modified NK cells with regulatory requirements as a new field in cellular immunotherapy.

  1. Expression of Pol(t) in tissues and cell lines of transitional cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective:To explore the expression of DNA polymerase iota in transitional cell carcinoma cells and tissues; Methods: RT-PCR was applie to detect the expression of polymerase iota in BIU87 and T24 cells, then the expression of polymerase iota was also detected in the same way in transitional cell carcinoma which was derived from clinical bladder carcinoma and renal pelvic carcinoma. Results: The expression of Polt was low in bladder normal membrana mucosa but significantly elevated in transitional cell carcinoma cells. Compared with the expression of polymerase iota in bladder normal mucous membranes, the expression of polymerase iota was significantly increased in transitional cell carcinoma tissue (P<0.01)and associated with the grade of transitional cell carcinoma. Conclusion: The significantly increased expression of polymerase iota may be associated with the generation and development of transitional cell carcinoma, even with its high heterogenicity.

  2. Chemokine receptor expression by inflammatory T cells in EAE.

    Science.gov (United States)

    Mony, Jyothi Thyagabhavan; Khorooshi, Reza; Owens, Trevor

    2014-01-01

    Chemokines direct cellular infiltration to tissues, and their receptors and signaling pathways represent targets for therapy in diseases such as multiple sclerosis (MS). The chemokine CCL20 is expressed in choroid plexus, a site of entry of T cells to the central nervous system (CNS). The CCL20 receptor CCR6 has been reported to be selectively expressed by CD4(+) T cells that produce the cytokine IL-17 (Th17 cells). Th17 cells and interferon-gamma (IFNγ)-producing Th1 cells are implicated in induction of MS and its animal model experimental autoimmune encephalomyelitis (EAE). We have assessed whether CCR6 identifies specific inflammatory T cell subsets in EAE. Our approach was to induce EAE, and then examine chemokine receptor expression by cytokine-producing T cells sorted from CNS at peak disease. About 7% of CNS-infiltrating CD4(+) T cells produced IFNγ in flow cytometric cytokine assays, whereas less than 1% produced IL-17. About 1% of CD4(+) T cells produced both cytokines. CCR6 was expressed by Th1, Th1+17 and by Th17 cells, but not by CD8(+) T cells. CD8(+) T cells expressed CXCR3, which was also expressed by CD4(+) T cells, with no correlation to cytokine profile. Messenger RNA for IFNγ, IL-17A, and the Th1 and Th17-associated transcription factors T-bet and RORγt was detected in both CCR6(+) and CXCR3(+) CD4(+) T cells. IFNγ, but not IL-17A mRNA expression was detected in CD8(+) T cells in CNS. CCR6 and CD4 were co-localized in spinal cord infiltrates by double immunofluorescence. Consistent with flow cytometry data some but not all CD4(+) T cells expressed CCR6 within infiltrates. CD4-negative CCR6(+) cells included macrophage/microglial cells. Thus we have for the first time directly studied CD4(+) and CD8(+) T cells in the CNS of mice with peak EAE, and determined IFNγ and IL17 expression by cells expressing CCR6 and CXCR3. We show that neither CCR6 or CXCR3 align with CD4 T cell subsets, and Th1 or mixed Th1+17 predominate in EAE.

  3. Differential expression and function of CD27 in chronic lymphocytic leukemia cells expressing ZAP-70.

    Science.gov (United States)

    Lafarge, Sandrine T; Hou, Sen; Pauls, Samantha D; Johnston, James B; Gibson, Spencer B; Marshall, Aaron J

    2015-07-01

    Chronic lymphocytic leukemia is a malignancy driven by abberant B cell signaling and survival. Leukemic B cells accumulate in the peripheral blood and the lymphoid organs where contact with stromal cells and T cells provide critical survival signals. Clinical severity of CLL is associated with several prognostic markers including expression of the kinase ZAP-70. ZAP-70 expression enhances signaling via the B cell antigen receptor and is associated with increased cell adhesion and migration capacity. Here we report that ZAP-70-positive CLL patients display significantly higher expression of the TNF superfamily receptor and memory marker CD27 than do ZAP-70 negative patients. CD27 expression by CLL was acutely elevated upon BCR cross-linking, or upon ectopic expression of ZAP-70. CD27 expression correlated with functional capacity to adhere to stromal cells and antibody blockade of CD27 impaired CLL binding to stroma. These results provide the first evidence for differential expression of CD27 among CLL prognostic groups, suggest a role for ZAP-70 dependent signaling in CD27 induction and implicate CD27 in cell-cell interactions with the lymphoid tissue microenvironment.

  4. Calreticulin: Roles in Cell-Surface Protein Expression

    Directory of Open Access Journals (Sweden)

    Yue Jiang

    2014-09-01

    Full Text Available In order to perform their designated functions, proteins require precise subcellular localizations. For cell-surface proteins, such as receptors and channels, they are able to transduce signals only when properly targeted to the cell membrane. Calreticulin is a multi-functional chaperone protein involved in protein folding, maturation, and trafficking. However, evidence has been accumulating that calreticulin can also negatively regulate the surface expression of certain receptors and channels. In these instances, depletion of calreticulin enhances cell-surface expression and function. In this review, we discuss the role of calreticulin with a focus on its negative effects on the expression of cell-surface proteins.

  5. Chemokine receptor expression by inflammatory T cells in EAE

    DEFF Research Database (Denmark)

    Mony, Jyothi Thyagabhavan; Khorooshi, Reza; Owens, Trevor

    2014-01-01

    Chemokines direct cellular infiltration to tissues, and their receptors and signaling pathways represent targets for therapy in diseases such as multiple sclerosis (MS). The chemokine CCL20 is expressed in choroid plexus, a site of entry of T cells to the central nervous system (CNS). The CCL20...... receptor CCR6 has been reported to be selectively expressed by CD4(+) T cells that produce the cytokine IL-17 (Th17 cells). Th17 cells and interferon-gamma (IFNγ)-producing Th1 cells are implicated in induction of MS and its animal model experimental autoimmune encephalomyelitis (EAE). We have assessed...... whether CCR6 identifies specific inflammatory T cell subsets in EAE. Our approach was to induce EAE, and then examine chemokine receptor expression by cytokine-producing T cells sorted from CNS at peak disease. About 7% of CNS-infiltrating CD4(+) T cells produced IFNγ in flow cytometric cytokine assays...

  6. Intraclonal protein expression heterogeneity in recombinant CHO cells.

    Directory of Open Access Journals (Sweden)

    Warren Pilbrough

    Full Text Available Therapeutic glycoproteins have played a major role in the commercial success of biotechnology in the post-genomic era. But isolating recombinant mammalian cell lines for large-scale production remains costly and time-consuming, due to substantial variation and unpredictable stability of expression amongst transfected cells, requiring extensive clone screening to identify suitable high producers. Streamlining this process is of considerable interest to industry yet the underlying phenomena are still not well understood. Here we examine an antibody-expressing Chinese hamster ovary (CHO clone at single-cell resolution using flow cytometry and vectors, which couple light and heavy chain transcription to fluorescent markers. Expression variation has traditionally been attributed to genetic heterogeneity arising from random genomic integration of vector DNA. It follows that single cell cloning should yield a homogeneous cell population. We show, in fact, that expression in a clone can be surprisingly heterogeneous (standard deviation 50 to 70% of the mean, approaching the level of variation in mixed transfectant pools, and each antibody chain varies in tandem. Phenotypic variation is fully developed within just 18 days of cloning, yet is not entirely explained by measurement noise, cell size, or the cell cycle. By monitoring the dynamic response of subpopulations and subclones, we show that cells also undergo slow stochastic fluctuations in expression (half-life 2 to 11 generations. Non-genetic diversity may therefore play a greater role in clonal variation than previously thought. This also has unexpected implications for expression stability. Stochastic gene expression noise and selection bias lead to perturbations from steady state at the time of cloning. The resulting transient response as clones reestablish their expression distribution is not ordinarily accounted for but can contribute to declines in median expression over timescales of up to 50

  7. Intraclonal Protein Expression Heterogeneity in Recombinant CHO Cells

    Science.gov (United States)

    Pilbrough, Warren; Munro, Trent P.; Gray, Peter

    2009-01-01

    Therapeutic glycoproteins have played a major role in the commercial success of biotechnology in the post-genomic era. But isolating recombinant mammalian cell lines for large-scale production remains costly and time-consuming, due to substantial variation and unpredictable stability of expression amongst transfected cells, requiring extensive clone screening to identify suitable high producers. Streamlining this process is of considerable interest to industry yet the underlying phenomena are still not well understood. Here we examine an antibody-expressing Chinese hamster ovary (CHO) clone at single-cell resolution using flow cytometry and vectors, which couple light and heavy chain transcription to fluorescent markers. Expression variation has traditionally been attributed to genetic heterogeneity arising from random genomic integration of vector DNA. It follows that single cell cloning should yield a homogeneous cell population. We show, in fact, that expression in a clone can be surprisingly heterogeneous (standard deviation 50 to 70% of the mean), approaching the level of variation in mixed transfectant pools, and each antibody chain varies in tandem. Phenotypic variation is fully developed within just 18 days of cloning, yet is not entirely explained by measurement noise, cell size, or the cell cycle. By monitoring the dynamic response of subpopulations and subclones, we show that cells also undergo slow stochastic fluctuations in expression (half-life 2 to 11 generations). Non-genetic diversity may therefore play a greater role in clonal variation than previously thought. This also has unexpected implications for expression stability. Stochastic gene expression noise and selection bias lead to perturbations from steady state at the time of cloning. The resulting transient response as clones reestablish their expression distribution is not ordinarily accounted for but can contribute to declines in median expression over timescales of up to 50 days. Noise

  8. TRPM5-expressing microvillous cells in the main olfactory epithelium

    Directory of Open Access Journals (Sweden)

    Liman Emily R

    2008-11-01

    Full Text Available Abstract Background The main olfactory epithelium (MOE in the nasal cavity detects a variety of air borne molecules that provide information regarding the presence of food, predators and other relevant social and environmental factors. Within the epithelium are ciliated sensory neurons, supporting cells, basal cells and microvillous cells, each of which is distinct in morphology and function. Arguably, the least understood, are the microvillous cells, a population of cells that are small in number and whose function is not known. We previously found that in a mouse strain in which the TRPM5 promoter drives expression of the green fluorescent protein (GFP, a population of ciliated olfactory sensory neurons (OSNs, as well as a population of cells displaying microvilli-like structures is labeled. Here we examined the morphology and immunocytochemical properties of these microvillous-like cells using immunocytochemical methods. Results We show that the GFP-positive microvillous cells were morphologically diversified and scattered throughout the entire MOE. These cells immunoreacted to an antibody against TRPM5, confirming the expression of this ion channel in these cells. In addition, they showed a Ca2+-activated non-selective cation current in electrophysiological recordings. They did not immunoreact to antibodies that label cell markers and elements of the transduction pathways from olfactory sensory neurons and solitary chemosensory cells of the nasal cavity. Further, the TRPM5-expressing cells did not display axon-like processes and were not labeled with a neuronal marker nor did trigeminal peptidergic nerve fibers innervate these cells. Conclusion We provide morphological and immunocytochemical characterization of the TRPM5-expressing microvillous cells in the main olfactory epithelium. Our data demonstrate that these cells are non-neuronal and in terms of chemosensory transduction do not resemble the TRPM5-expressing olfactory sensory neurons

  9. Lab-specific gene expression signatures in pluripotent stem cells.

    Science.gov (United States)

    Newman, Aaron M; Cooper, James B

    2010-08-06

    Pluripotent stem cells derived from both embryonic and reprogrammed somatic cells have significant potential for human regenerative medicine. Despite similarities in developmental potential, however, several groups have found fundamental differences between embryonic stem cell (ESC) and induced-pluripotent stem cell (iPSC) lines that may have important implications for iPSC-based medical therapies. Using an unsupervised clustering algorithm, we further studied the genetic homogeneity of iPSC and ESC lines by reanalyzing microarray gene expression data from seven different laboratories. Unexpectedly, this analysis revealed a strong correlation between gene expression signatures and specific laboratories in both ESC and iPSC lines. Nearly one-third of the genes with lab-specific expression signatures are also differentially expressed between ESCs and iPSCs. These data are consistent with the hypothesis that in vitro microenvironmental context differentially impacts the gene expression signatures of both iPSCs and ESCs.

  10. Oct-4 expression in pluripotent cells of the rhesus monkey.

    Science.gov (United States)

    Mitalipov, Shoukhrat M; Kuo, Hung-Chih; Hennebold, Jon D; Wolf, Don P

    2003-12-01

    The POU (Pit-Oct-Unc)-domain transcription factor, Oct-4, has become a useful marker of pluripotency in the mouse. It is found exclusively in mouse preimplantation-stage embryos after embryonic genome activation and is a characteristic of mouse embryonic stem (ES) cells, and its absence in knockout mice precludes inner cell mass (ICM) formation in blastocysts. Expression of Oct-4 has also been associated with pluripotency in primate cells. Here, we undertook a systematic study of Oct-4 expression in rhesus macaque preimplantation embryos produced by intracytoplasmic sperm injection and in ES cells before and after exposure to differentiating conditions in vitro. We also evaluated Oct-4 expression as a means of monitoring the extent of reprogramming following somatic cell nuclear transfer. Oct-4 was detected by reverse transcription-polymerase chain reaction and immunocytochemistry with a monoclonal antibody. Monkey pronuclear-stage zygotes and cleaving embryos up to the 8-cell stage showed no detectable Oct-4. Nuclear staining for Oct-4 first became obvious at the 16-cell stage, and a strong signal was observed in morula and compact morula stages. Both ICM and trophectodermal cell nuclei of monkey early blastocysts were positive for Oct-4. However, the signal was diminished in trophectodermal cells of expanded blastocysts, whereas expression remained high in ICM nuclei. Similar to the mouse, hatched monkey blastocysts showed strong Oct-4 expression in the ICM, with no detectable signal in the trophectoderm. Undifferentiated monkey ES cells derived from the ICM of in vitro-produced blastocysts expressed Oct-4, consistent with their pluripotent nature, whereas ES cell differentiation was associated with signal loss. Therefore, Oct-4 expression in the monkey, as in the mouse, provides a useful marker for pluripotency after activation of the embryonic genome. Finally, the observed lack or abnormal expression of Oct-4 in monkey nuclear transfer embryos suggests

  11. Neurohypophysial Receptor Gene Expression by Thymic T Cell Subsets and Thymic T Cell Lymphoma Cell Lines

    Directory of Open Access Journals (Sweden)

    I. Hansenne

    2004-01-01

    transcribed in thymic epithelium, while immature T lymphocytes express functional neurohypophysial receptors. Neurohypophysial receptors belong to the G protein-linked seven-transmembrane receptor superfamily and are encoded by four distinct genes, OTR, V1R, V2R and V3R. The objective of this study was to identify the nature of neurohypophysial receptor in thymic T cell subsets purified by immunomagnetic selection, as well as in murine thymic lymphoma cell lines RL12-NP and BW5147. OTR is transcribed in all thymic T cell subsets and T cell lines, while V3R transcription is restricted to CD4+ CD8+ and CD8+ thymic cells. Neither V1R nor V2R transcripts are detected in any kind of T cells. The OTR protein was identified by immunocytochemistry on thymocytes freshly isolated from C57BL/6 mice. In murine fetal thymic organ cultures, a specific OTR antagonist does not modify the percentage of T cell subsets, but increases late T cell apoptosis further evidencing the involvement of OT/OTR signaling in the control of T cell proliferation and survival. According to these data, OTR and V3R are differentially expressed during T cell ontogeny. Moreover, the restriction of OTR transcription to T cell lines derived from thymic lymphomas may be important in the context of T cell leukemia pathogenesis and treatment.

  12. Expression and function of FERMT genes in colon carcinoma cells.

    Science.gov (United States)

    Kiriyama, Kenji; Hirohashi, Yoshihiko; Torigoe, Toshihiko; Kubo, Terufumi; Tamura, Yasuaki; Kanaseki, Takayuki; Takahashi, Akari; Nakazawa, Emiri; Saka, Eri; Ragnarsson, Charlotte; Nakatsugawa, Munehide; Inoda, Satoko; Asanuma, Hiroko; Takasu, Hideo; Hasegawa, Tadashi; Yasoshima, Takahiro; Hirata, Koichi; Sato, Noriyuki

    2013-01-01

    Invasion into the matrix is one of hallmarks of malignant diseases and is the first step for tumor metastasis. Thus, analysis of the molecular mechanisms of invasion is essential to overcome tumor cell invasion. In the present study, we screened for colon carcinoma-specific genes using a cDNA microarray database of colon carcinoma tissues and normal colon tissues, and we found that fermitin family member-1 (FERMT1) is overexpressed in colon carcinoma cells. FRRMT1, FERMT2 and FERMT3 expression was investigated in colon carcinoma cells. Reverse transcription polymerase chain reaction (RT-PCR) analysis revealed that only FERMT1 had cancer cell-specific expression. Protein expression of FERMT1 was confirmed by western blotting and immunohistochemical staining. To address the molecular functions of FERMT genes in colon carcinoma cells, we established FERMT1-, FERMT2- and FERMT3-overexpressing colon carcinoma cells. FERMT1-overexpressing cells exhibited greater invasive ability than did FERMT2- and FERMT3-overexpressing cells. On the other hand, FERMT1-, FERMT2- and FERMT3-overexpressing cells exhibited enhancement of cell growth. Taken together, the results of this study indicate that FERMT1 is expressed specifically in colon carcinoma cells, and has roles in matrix invasion and cell growth. These findings indicate that FERMT1 is a potential molecular target for cancer therapy.

  13. [VEGF gene expression in transfected human multipotent stromal cells].

    Science.gov (United States)

    Smirnikhina, S A; Lavrov, A V; Bochkov, N P

    2011-01-01

    Dynamics of VEGF gene expression in transfected multipotent stromal cells from adipose tissue was examined using electroporation and lipofection. Differences in the potency and dynamics of plasmid elimination (up to day 9) between cell cultures were observed. All cultures were divided into fast and slow plasmid-eliminating ones. Interculture differences in VEGF expression were detected. The possibility of a 5-6-fold increase of VEGF expression was shown. There were no differences in transfection potency, plasmid elimination dynamics, and VEGF expression after transfection by both nonviral methods.

  14. HCMV Infection Depress NGF Expression in Human Glioma Cells

    Institute of Scientific and Technical Information of China (English)

    Hai-tao WANG; Bin WANG; Zhi-jun LIU; Zhi-qiang BAI; Ling LI; Dong-meng QIAN; Zhi-yong YAN; Xu-xia SONG

    2009-01-01

    Human cytomegalovirus (HCMV) is the most common cause of congenital infection, resulting in birth defects such as microcephaly. In this study, RT-PCR and Western Blotting were performed to quantify the regulation of endogenic nerve growth factor expression in neuroglia cells by HCMV infection. The results showed that basal, endogenous NGF expression in U251 was unchanged during early HCMV infection. NGF expression is strongly down-regulated during the latent phase of infection. These results suggest that HCMV can depress the NGF expression in U251 cells.

  15. Regulated expression of erythropoietin by two human hepatoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Goldberg, M.A.; Glass, G.A.; Cunningham, J.M.; Bunn, H.F.

    1987-11-01

    The development of a cell culture system that produces erythropoietin (Epo) in a regulated manner has been the focus of much effort. The authors have screened multiple renal and hepatic cell lines for either constitutive or regulated expression of Epo. Only the human hepatoma cell lines, Hep3B and HepG2, made significant amounts of Epo as measured both by radioimmunoassay and in vitro bioassay (as much as 330 milliunits per 10/sup 6/ cells in 24 hr). The constitutive production of Epo increased dramatically as a function of cell density in both cell lines. At cell densities < 3.3 x 10/sup 5/ cells per cm/sup 2/, there was little constitutive release of Epo in the medium. With Hep3B cells grown at low cell densities, a mean 18-fold increase in Epo expression was seen in response to hypoxia and a 6-fold increase was observed in response to incubation in medium containing 50 ..mu..M cobalt(II) chloride. At similar low cell densities, Epo production in HepG2 cells could be enhanced an average of about 3-fold by stimulation with either hypoxia or cobalt(II) chloride. Upon such stimulation, both cell lines demonstrated markedly elevated levels of Epo mRNA. Hence, both Hep3B and HepG2 cell lines provide an excellent in vitro system in which to study the physiological regulation of Epo expression.

  16. Gamma-irradiation enhances transgene expression in leukemic cells.

    Science.gov (United States)

    Vereecque, R; Saudemont, A; Wickham, T J; Gonzalez, R; Hetuin, D; Fenaux, P; Quesnel, B

    2003-02-01

    The majority of immunotherapy-based gene therapy protocols consist of ex vivo gene transfer in tumor cells. To prevent further in vivo growth, modified cells must be irradiated before reinjection into patients. The present study examines the effects of gamma-irradiation on transgene expression in transduced leukemic cells. Human and murine leukemic cells were transfected with retroviral vectors or plasmids carrying beta-galactosidase, GM-CSF or CD80 genes. Fresh leukemic cells from patients with acute myeloid leukemia (AML) were transfected with AdZ.F(pK7) adenoviral vector. gamma-irradiation at various lethal doses enhanced transgene expression in leukemic cell lines and fresh AML cells when the gene of interest was under CMV promoter but not when SV40 promoter was used. Oxidative stress also enhanced transgene expression and both irradiation and oxidative stress effects were inhibited by addition of N-acetyl-L-cysteine, a thiol anti-oxidant, indicating the involvement of reactive oxygen species. Transgene expression was also enhanced in vivo 48 and 120 h after subcutaneous injection of irradiated leukemic cells in syngeneic mice. These results show that a cell vaccine protocol using ex vivo gene transfer of transduced cells might be feasible in acute leukemia even if leukemic cells must be irradiated at lethal doses prior to reinjection to patients.

  17. MicroRNA expression profiles in avian haemopoietic cells

    Directory of Open Access Journals (Sweden)

    Yongxiu eYao

    2013-08-01

    Full Text Available MicroRNAs (miRNAs are small, abundant, non-coding RNAs that modulate gene expression by interfering with translation or stability of mRNA transcripts in a sequence-specific manner. A total of 734 precursor and 996 mature miRNAs have so far been identified in the chicken genome. A number of these miRNAs are expressed in a cell type-specific manner, and understanding their function requires detailed examination of their expression in different cell types. We carried out deep sequencing of small RNA populations isolated from stimulated or transformed avian haemopoietic cell lines to determine the changes in the expression profiles of these important regulatory molecules during these biological events. There were significant changes in the expression of a number of miRNAs, including miR-155, in chicken B cells stimulated with CD40 ligand. Similarly, avian leukosis virus (ALV-transformed DT40 cells also showed changes in miRNA expression in relation to the naïve cells. Embryonic stem cell line BP25 demonstrated a distinct cluster of upregulated miRNAs, many of which were shown previously to be involved in embryonic stem cell development. Finally, chicken macrophage cell line HD11 showed changes in miRNA profiles, some of which are thought to be related to the transformation by v-myc transduced by the virus. This work represents the first publication of a catalog of microRNA expression in a range of important avian cells and provides insights into the potential roles of miRNAs in the hematopoietic lineages of cells in a model non-mammalian species.

  18. Modulation of Vascular Cell Function by Bim Expression

    Directory of Open Access Journals (Sweden)

    Margaret E. Morrison

    2013-01-01

    Full Text Available Apoptosis of vascular cells, including pericytes and endothelial cells, contributes to disease pathogenesis in which vascular rarefaction plays a central role. Bim is a proapoptotic protein that modulates not only apoptosis but also cellular functions such as migration and extracellular matrix (ECM protein expression. Endothelial cells and pericytes each make a unique contribution to vascular formation and function although the details require further delineation. Here we set out to determine the cell autonomous impact of Bim expression on retinal endothelial cell and pericyte function using cells prepared from Bim deficient (Bim−/− mice. Bim−/− endothelial cells displayed an increased production of ECM proteins, proliferation, migration, adhesion, and VEGF expression but, a decreased eNOS expression and nitric oxide production. In contrast, pericyte proliferation decreased in the absence of Bim while migration, adhesion, and VEGF expression were increased. In addition, we demonstrated that the coculturing of either wild-type or Bim−/− endothelial cells with Bim−/− pericytes diminished their capillary morphogenesis. Thus, our data further emphasizes the importance of vascular cell autonomous regulatory mechanisms in modulation of vascular function.

  19. Modulation of vascular cell function by bim expression.

    Science.gov (United States)

    Morrison, Margaret E; Palenski, Tammy L; Jamali, Nasim; Sheibani, Nader; Sorenson, Christine M

    2013-01-01

    Apoptosis of vascular cells, including pericytes and endothelial cells, contributes to disease pathogenesis in which vascular rarefaction plays a central role. Bim is a proapoptotic protein that modulates not only apoptosis but also cellular functions such as migration and extracellular matrix (ECM) protein expression. Endothelial cells and pericytes each make a unique contribution to vascular formation and function although the details require further delineation. Here we set out to determine the cell autonomous impact of Bim expression on retinal endothelial cell and pericyte function using cells prepared from Bim deficient (Bim(-/-)) mice. Bim(-/-) endothelial cells displayed an increased production of ECM proteins, proliferation, migration, adhesion, and VEGF expression but, a decreased eNOS expression and nitric oxide production. In contrast, pericyte proliferation decreased in the absence of Bim while migration, adhesion, and VEGF expression were increased. In addition, we demonstrated that the coculturing of either wild-type or Bim(-/-) endothelial cells with Bim(-/-) pericytes diminished their capillary morphogenesis. Thus, our data further emphasizes the importance of vascular cell autonomous regulatory mechanisms in modulation of vascular function.

  20. Impact of Annexin A3 expression in gastric cancer cells.

    Science.gov (United States)

    Yu, S Y; Li, Y; Fan, L Q; Zhao, Q; Tan, B B; Liu, Y

    2014-01-01

    Annexin A3 participates in various biological processes, including tumorigenesis, drug resistance, and metastasis. The aim of this study was to investigate the expression of Annexin A3 in gastric cancer and its relationship with cell differentiation, migration, and invasion of gastric cancer cells. Annexin A3 expression in gastric cancer tissues was detected by quantitative real-time PCR and Western blotting. The proliferation of gastric cancer cells was measured by the MTT assay. Cell migration and invasion were determined via wound healing and transwell assays, respectively. Knock down of endogenous Annexin A3 in gastric cancer BGC823 cells was performed using siRNA technology. The expression of Annexin A3 was significantly upregulated in gastric cancer tissues, and negatively correlated with the differentiation degree. Silencing of endogenous Annexin A3 suppressed the proliferation, migration, and invasion of BGC823 cells. Additionally, the expression of p21, p27, TIMP-1, and TIMP-2 was upregulated, and the expression of PCNA, cyclin D1, MMP-1, and MMP-2 decreased in cells treated with Annexin A3-siRNA. Annexin A3 was upregulated in gastric cancer cells. Deletion of endogenous Annexin A3 significantly inhibited gastric cancer cell proliferation, migration, and invasion.

  1. Expression and clinical significance of sulfiredoxin expression in cervical squamous cell carcinoma tissue

    Directory of Open Access Journals (Sweden)

    Xiao-yan CHEN

    2015-10-01

    Full Text Available Objective To inquire into the expression and its clinical significance of sulfiredoxin (Srx in cervical squamous cell carcinoma tissue. Methods SABC immunohistochemical method was used to detect the expression levels of Srx in specimens of 104 cervical squamous cell carcinoma and the corresponding adjacent tissues, 15 cervical intraepithelial neoplasm (CIN Ⅲ, and 20 normal cervical squamous cell epithelium tissue. The relationship between the expression of Srx protein and clinical pathological parameters of the cancer was also analyzed. Results The positive expression rates of Srx in CIN Ⅲ and cervical squamous cell carcinoma [73.3%(11/15 and 82.7%(86/104, respectively] were significantly higher than that in normal cervical tissue [35.0%(7/20, χ2=17.778, P=0.000]. Meanwhile, Srx expression in cervical cancer specimens was significantly higher than that in normal adjacent tissues (χ2=56.224, P=0.000. The positive expression of Srx in cervical squamous cell carcinoma was significantly correlated with lymph node metastasis, the depth of cancer invasion, and the infiltration of blood vessels (P0.05. Conclusion The higher expression of Srx protein might be a valuable marker for the early diagnosis and evaluation of prognosis in patients with cervical squamous cell carcinoma. DOI: 10.11855/j.issn.0577-7402.2015.08.11

  2. Expression of heparanase in basal cell carcinoma and squamous cell carcinoma*

    Science.gov (United States)

    Pinhal, Maria Aparecida Silva; Almeida, Maria Carolina Leal; Costa, Alessandra Scorse; Theodoro, Thérèse Rachell; Serrano, Rodrigo Lorenzetti; Machado Filho, Carlos D'Apparecida Santos

    2016-01-01

    Background Heparanase is an enzyme that cleaves heparan sulfate chains. Oligosaccharides generated by heparanase induce tumor progression. Basal cell carcinoma and squamous cell carcinoma comprise types of nonmelanoma skin cancer. Objectives Evaluate the glycosaminoglycans profile and expression of heparanase in two human cell lines established in culture, immortalized skin keratinocyte (HaCaT) and squamous cell carcinoma (A431) and also investigate the expression of heparanase in basal cell carcinoma, squamous cell carcinoma and eyelid skin of individuals not affected by the disease (control). Methods Glycosaminoglycans were quantified by electrophoresis and indirect ELISA method. The heparanase expression was analyzed by quantitative RT-PCR (qRTPCR). Results The A431 strain showed significant increase in the sulfated glycosaminoglycans, increased heparanase expression and decreased hyaluronic acid, comparing to the HaCaT lineage. The mRNA expression of heparanase was significantly higher in Basal cell carcinoma and squamous cell carcinoma compared with control skin samples. It was also observed increased heparanase expression in squamous cell carcinoma compared to the Basal cell carcinoma. Conclusion The glycosaminoglycans profile, as well as heparanase expression are different between HaCaT and A431 cell lines. The increased expression of heparanase in Basal cell carcinoma and squamous cell carcinoma suggests that this enzyme could be a marker for the diagnosis of such types of non-melanoma cancers, and may be useful as a target molecule for future alternative treatment. PMID:27828631

  3. Salmonella induces PD-L1 expression in B cells.

    Science.gov (United States)

    Lopez-Medina, Marcela; Perez-Lopez, Araceli; Alpuche-Aranda, Celia; Ortiz-Navarrete, Vianney

    2015-10-01

    Salmonella persists for a long time in B cells; however, the mechanism(s) through which infected B cells avoid effector CD8 T cell responses has not been characterized. In this study, we show that Salmonella infects and survives within all B1 and B2 cell subpopulations. B cells are infected with a Salmonella typhimurium strain expressing an ovalbumin (OVA) peptide (SIINFEKL) to evaluate whether B cells process and present Salmonella antigens in the context of MHC-I molecules. Our data showed that OVA peptides are presented by MHC class I K(b)-restricted molecules and the presented antigen is generated through proteasomal degradation and vacuolar processing. In addition, Salmonella-infected B cells express co-stimulatory molecules such as CD40, CD80, and CD86 as well as inhibitory molecules such as PD-L1. Thus, the cross-presentation of Salmonella antigens and the expression of activation molecules suggest that infected B cells are able to prime and activate specific CD8(+) T cells. However, the Salmonella infection-stimulated expression of PD-L1 suggests that the PD-1/PD-L1 pathway may be involved in turning off the cytotoxic effector response during Salmonella persistent infection, thereby allowing B cells to become a reservoir for the bacteria.

  4. Expression of EPO Receptor in Pancreatic Cells and Its Effect on Cell Apoptosis

    Institute of Scientific and Technical Information of China (English)

    Hongxia SHUAI; Ji ZHANG; Yikai YU; Muxun ZHANG

    2008-01-01

    In order to explore the expression of erythropoietin receptor (EPOR) in pancreatic cell ine NIT-1 and its effect on cell apoptosis after binding with erythropoietin (EPO), NIT-1 cells were cultured and expanded. The expression of EPOR was detected using electrophoresis. NIT-1 apoptosis was induced by cytokines and their effects on cell apoptosis and cell insulin secretion were assayed after binding of EPO to EPOR. The results showed that EPOR was expressed in NIT-1 cells. Recom- binant human EPO (rHuEPO) had no effect on cell apoptosis but significantly inhibited apoptosis in- duced by cytokines, rHuEPO had no effect on cell insulin secretion but significantly improved insulin secretion inhibited by cytokines. From these findings, it was concluded that EPOR was expressed in NIT-1 cells and EPO could protect N1T-1 cells from apoptosis induced by cytokines.

  5. Expression of aquaporin-1 in SMMC-7221 liver carcinoma cells promotes cell migration

    Institute of Scientific and Technical Information of China (English)

    LI Yongming; FENG Xuechao; YANG Hong; MA Tonghui

    2006-01-01

    Migration of tumor cells is a crucial step in tumor invasion and metastasis. Here we provide evidence that aquaporin expression is involved in tumor cell migration. RT-PCR, immunofluorescence and Western blot analysis demonstrated the AQP1 protein expression on the plasma membrane of SMMC-7221 human hepatoma cells. SMMC-7221 cell clones with high (SMMC-7221hPf) and low (SMMC-7221/Pf) water permeability were identified by functional assays with corresponding high and low AQP1 expression. Cell migration rate was remarkably higher in SMMC-7221hPf cells than SMMC-7221/Pf cells, assessed by Boyden chamber and wound healing assays, whereas cell growth and adhesion were not different. Adenovirus-mediated AQP1 expression in SMMC-7221/Pf cells increased their water permeability and migration rate. These results provide the first evidence that aquaporin-mediated membrane water permeability enhances tumor cell migration and may be associated with tumor invasion and metastasis.

  6. Interdependence of cell growth and gene expression: origins and consequences.

    Science.gov (United States)

    Scott, Matthew; Gunderson, Carl W; Mateescu, Eduard M; Zhang, Zhongge; Hwa, Terence

    2010-11-19

    In bacteria, the rate of cell proliferation and the level of gene expression are intimately intertwined. Elucidating these relations is important both for understanding the physiological functions of endogenous genetic circuits and for designing robust synthetic systems. We describe a phenomenological study that reveals intrinsic constraints governing the allocation of resources toward protein synthesis and other aspects of cell growth. A theory incorporating these constraints can accurately predict how cell proliferation and gene expression affect one another, quantitatively accounting for the effect of translation-inhibiting antibiotics on gene expression and the effect of gratuitous protein expression on cell growth. The use of such empirical relations, analogous to phenomenological laws, may facilitate our understanding and manipulation of complex biological systems before underlying regulatory circuits are elucidated.

  7. Recombinant cells that highly express chromosomally-integrated heterologous gene

    Science.gov (United States)

    Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

    2007-03-20

    Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

  8. Inducible expression of endomorphins in murine dendritic cells.

    Science.gov (United States)

    Yang, Xiaohuai; Xia, Hui; Chen, Yong; Liu, Xiaofen; Zhou, Cheng; Gao, Qin; Li, Zhenghong

    2012-12-15

    Bone marrow precursor cells were extracted from C57BL/6J mice aged 7-8 weeks, and dendritic cells were purified using anti-CD11c (a specific marker for dendritic cells) antibody-coated magnetic beads. Immunofluorescence staining revealed that the expression levels of endomorphin-1 and endomorphin-2 were upregulated in dendritic cells activated by lipopolysaccharide. An enzyme immunoassay showed that lipopolysaccharide and other Toll-like receptor ligands promoted the secretion of endomorphin-1 and endomorphin-2 from activated dendritic cells. [(3)H]-thymidine incorporation demonstrated that endomorphin-1 and endomorphin-2 both inhibited the proliferation of T lymphocyte induced by activated dendritic cells. Furthermore, this immunosuppressive effect was blocked by CTOP, a specific antagonist of µ-opioid receptors. Our experimental findings indicate that activated dendritic cells can induce the expression and secretion of endomorphins, and that endomorphins suppress T lymphocyte proliferation through activation of µ-opioid receptors.

  9. Inducible expression of endomorphins in murine dendritic cells

    Institute of Scientific and Technical Information of China (English)

    Xiaohuai Yang; Hui Xia; Yong Chen; Xiaofen Liu; Cheng Zhou; Qin Gao; Zhenghong Li

    2012-01-01

    Bone marrow precursor cells were extracted from C57BL/6J mice aged 7–8 weeks, and dendritic cells were purified using anti-CD11c (a specific marker for dendritic cells) antibody-coated magnetic beads. Immunofluorescence staining revealed that the expression levels of endomorphin-1 and endomorphin-2 were upregulated in dendritic cells activated by lipopolysaccharide. An enzyme immunoassay showed that lipopolysaccharide and other Toll-like receptor ligands promoted the secretion of endomorphin-1 and endomorphin-2 from activated dendritic cells. [3H]-thymidine incorporation demonstrated that endomorphin-1 and endomorphin-2 both inhibited the proliferation of T lymphocyte induced by activated dendritic cells. Furthermore, this immunosuppressive effect was blocked by CTOP, a specific antagonist of μ-opioid receptors. Our experimental findings indicate that activated dendritic cells can induce the expression and secretion of endomorphins, and that endomorphins suppress T lymphocyte proliferation through activation of μ-opioid receptors.

  10. Gene expression analysis of in vivo fluorescent cells.

    Directory of Open Access Journals (Sweden)

    Konstantin Khodosevich

    Full Text Available BACKGROUND: The analysis of gene expression for tissue homogenates is of limited value because of the considerable cell heterogeneity in tissues. However, several methods are available to isolate a cell type of interest from a complex tissue, the most reliable one being Laser Microdissection (LMD. Cells may be distinguished by their morphology or by specific antigens, but the obligatory staining often results in RNA degradation. Alternatively, particular cell types can be detected in vivo by expression of fluorescent proteins from cell type-specific promoters. METHODOLOGY/PRINCIPAL FINDINGS: We developed a technique for fixing in vivo fluorescence in brain cells and isolating them by LMD followed by an optimized RNA isolation procedure. RNA isolated from these cells was of equal quality as from unfixed frozen tissue, with clear 28S and 18S rRNA bands of a mass ratio of approximately 2ratio1. We confirmed the specificity of the amplified RNA from the microdissected fluorescent cells as well as its usefulness and reproducibility for microarray hybridization and quantitative real-time PCR (qRT-PCR. CONCLUSIONS/SIGNIFICANCE: Our technique guarantees the isolation of sufficient high quality RNA obtained from specific cell populations of the brain expressing soluble fluorescent marker, which is a critical prerequisite for subsequent gene expression studies by microarray analysis or qRT-PCR.

  11. Expression and function of nicotinic acetylcholine receptors in stem cells

    Directory of Open Access Journals (Sweden)

    Herman S. Cheung

    2016-07-01

    Full Text Available Nicotinic acetylcholine receptors are prototypical ligand gated ion channels typically found in muscular and neuronal tissues. Functional nicotinic acetylcholine receptors, however, have also recently been identified on other cell types, including stem cells. Activation of these receptors by the binding of agonists like choline, acetylcholine, or nicotine has been implicated in many cellular changes. In regards to stem cell function, nicotinic acetylcholine receptor activation leads to changes in stem cell proliferation, migration and differentiation potential. In this review we summarize the expression and function of known nicotinic acetylcholine receptors in different classes of stem cells including: pluripotent stem cells, mesenchymal stem cells, periodontal ligament derived stem cells, and neural progenitor cells and discuss the potential downstream effects of receptor activation on stem cell function.

  12. HIV-1 induces DCIR expression in CD4+ T cells.

    Directory of Open Access Journals (Sweden)

    Alexandra A Lambert

    Full Text Available The C-type lectin receptor DCIR, which has been shown very recently to act as an attachment factor for HIV-1 in dendritic cells, is expressed predominantly on antigen-presenting cells. However, this concept was recently challenged by the discovery that DCIR can also be detected in CD4(+ T cells found in the synovial tissue from rheumatoid arthritis (RA patients. Given that RA and HIV-1 infections share common features such as a chronic inflammatory condition and polyclonal immune hyperactivation status, we hypothesized that HIV-1 could promote DCIR expression in CD4(+ T cells. We report here that HIV-1 drives DCIR expression in human primary CD4(+ T cells isolated from patients (from both aviremic/treated and viremic/treatment naive persons and cells acutely infected in vitro (seen in both virus-infected and uninfected cells. Soluble factors produced by virus-infected cells are responsible for the noticed DCIR up-regulation on uninfected cells. Infection studies with Vpr- or Nef-deleted viruses revealed that these two viral genes are not contributing to the mechanism of DCIR induction that is seen following acute infection of CD4(+ T cells with HIV-1. Moreover, we report that DCIR is linked to caspase-dependent (induced by a mitochondria-mediated generation of free radicals and -independent intrinsic apoptotic pathways (involving the death effector AIF. Finally, we demonstrate that the higher surface expression of DCIR in CD4(+ T cells is accompanied by an enhancement of virus attachment/entry, replication and transfer. This study shows for the first time that HIV-1 induces DCIR membrane expression in CD4(+ T cells, a process that might promote virus dissemination throughout the infected organism.

  13. Cell-surface expression of Hsp70 on hematopoietic cancer cells after inhibition of HDAC activity

    DEFF Research Database (Denmark)

    Jensen, Helle

    -derived antigenic peptides, a function which is currently explored in immunotherapeutic approaches against cancer. Additionally, membrane-bound Hsp70 can stimulate antigen presenting cells to release proinflammatory cytokines and can provide a target structure for NK cell-mediated lysis. Human cancer cells...... frequently express Hsp70 on their cell surface, whereas the corresponding normal tissues do not. In addition, several clinically applied reagents, such as alkyl-lysophospholipides, chemotherapeutic agents, and anti-inflammatory reagents, have been found to enhance Hsp70 cell surface expression on cancer...... cells. We have found that inhibition of histone deacetylase (HDAC) activity leads to surface expression of Hsp70 on various hematopoietic cancer cells, an occurance that was not observed on naïve or activated peripheral blood cells. HDAC-inhibitor mediated Hsp70 cell surface expression was confined...

  14. Expression of stromelysin 3 in basal cell carcinomas.

    Science.gov (United States)

    Cribier, B; Noacco, G; Peltre, B; Grosshans, E

    2001-01-01

    Stromelysin 3 is a member of the metalloproteinase family, which is expressed in various remodelling processes. The prognosis of breast cancers and squamous cell carcinomas is correlated to the level of expression of this protein. The purpose of the present work was to evaluate the expression of stromelysin 3 in the major types of basal cell carcinomas. We selected cases of primary tumours that were fully excised, without previous biopsy: 40 Pinkus tumors, 40 superficial, 40 nodular, 38 morpheiform basal cell carcinomas and 10 cases showing deep subcutaneous or muscular invasion. Immunohistochemistry was carried out using monoclonal anti-ST3 antibodies (MC Rio, IGBMC Strasbourg), and evaluated on a semi-quantitative scale from 0 to 3. Positively stained cells were restricted to the periphery of the epithelial cells, which, by contrast, never expressed stromelysin 3. The global rate of expression was 27% in Pinkus tumors, 65% in superficial, 72.5% in nodular, 87% in morpheiform and 100% in deeply invasive carcinomas. The rates of tumours showing the highest number of positively stained cells (class 2 or 3) were respectively 7.5%, 20%, 45%, 63% and 100%. This systematic study of stromelysin3 expression in basal cell carcinomas confirms that it is a marker of poor prognosis, because the rate of positive tumours was much higher in aggressive carcinomas. Moreover, the majority of tumours showing an intense expression (i.e. the highest number of positively stained cells in their stroma) were of the morpheiform and deeply invasive types, which are of poor prognosis. Altogether, the studies performed on cutaneous tumours are consistent with the theory of stromelysin 3 playing an active role in tumour progression.

  15. Microarray gene expression profiling and analysis in renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Sadhukhan Provash

    2004-06-01

    Full Text Available Abstract Background Renal cell carcinoma (RCC is the most common cancer in adult kidney. The accuracy of current diagnosis and prognosis of the disease and the effectiveness of the treatment for the disease are limited by the poor understanding of the disease at the molecular level. To better understand the genetics and biology of RCC, we profiled the expression of 7,129 genes in both clear cell RCC tissue and cell lines using oligonucleotide arrays. Methods Total RNAs isolated from renal cell tumors, adjacent normal tissue and metastatic RCC cell lines were hybridized to affymatrix HuFL oligonucleotide arrays. Genes were categorized into different functional groups based on the description of the Gene Ontology Consortium and analyzed based on the gene expression levels. Gene expression profiles of the tissue and cell line samples were visualized and classified by singular value decomposition. Reverse transcription polymerase chain reaction was performed to confirm the expression alterations of selected genes in RCC. Results Selected genes were annotated based on biological processes and clustered into functional groups. The expression levels of genes in each group were also analyzed. Seventy-four commonly differentially expressed genes with more than five-fold changes in RCC tissues were identified. The expression alterations of selected genes from these seventy-four genes were further verified using reverse transcription polymerase chain reaction (RT-PCR. Detailed comparison of gene expression patterns in RCC tissue and RCC cell lines shows significant differences between the two types of samples, but many important expression patterns were preserved. Conclusions This is one of the initial studies that examine the functional ontology of a large number of genes in RCC. Extensive annotation, clustering and analysis of a large number of genes based on the gene functional ontology revealed many interesting gene expression patterns in RCC. Most

  16. Regulation of osteoprotegerin expression by Notch signaling in human oral squamous cell carcinoma cell line

    Institute of Scientific and Technical Information of China (English)

    Jeeranan Manokawinchoke; Thanaphum Osathanon; Prasit Pavasant

    2016-01-01

    Objective: To investigate the influence of Notch signaling on osteoprotegerin (OPG) expression in a human oral squamous cell carcinoma cell line. Methods: Activation of Notch signaling was performed by seeding cells on Jagged1 immobilized surfaces. In other experiments, a γ-secretase inhibitor was added to the culture medium to inhibit intracellular Notch signaling. OPG mRNA and protein were determined by real-time PCR and ELISA, respectively. Finally, publicly available microarray database analysis was performed using connection up- or down-regulation expression analysis of microarrays software. Results: Jagged1-treatment of HSC-4 cells enhanced HES1 and HEY1 mRNA expres-sion, confirming the intracellular activation of Notch signaling. OPG mRNA and protein levels were significantly suppressed upon Jagged1 treatment. Correspondingly, HSC-4 cells treated with a γ-secretase inhibitor resulted in a significant reduction of HES1 and HEY1 mRNA levels, and a marked increase in OPG protein expression was observed. These results implied that Notch signaling regulated OPG expression in HSC-4 cells. However, Jagged1 did not alter OPG expression in another human oral squamous cell carcinoma cell line (HSC-5) or a human head and neck squamous cell carcinoma cell line (HN22). Conclusions: Notch signaling regulated OPG expression in an HSC-4 cell line and this mechanism could be cell line specific.

  17. Regulation of osteoprotegerin expression by Notch signaling in human oral squamous cell carcinoma cell line

    Institute of Scientific and Technical Information of China (English)

    Jeeranan Manokawinchoke; Thanaphum Osathanon; Prasit Pavasant

    2016-01-01

    Objective: To investigate the influence of Notch signaling on osteoprotegerin(OPG)expression in a human oral squamous cell carcinoma cell line.Methods: Activation of Notch signaling was performed by seeding cells on Jagged1 immobilized surfaces. In other experiments, a g-secretase inhibitor was added to the culture medium to inhibit intracellular Notch signaling. OPG m RNA and protein were determined by real-time PCR and ELISA, respectively. Finally, publicly available microarray database analysis was performed using connection up- or down-regulation expression analysis of microarrays software.Results: Jagged1-treatment of HSC-4 cells enhanced HES1 and HEY1 m RNA expression, confirming the intracellular activation of Notch signaling. OPG m RNA and protein levels were significantly suppressed upon Jagged1 treatment. Correspondingly, HSC-4 cells treated with a g-secretase inhibitor resulted in a significant reduction of HES1 and HEY1 m RNA levels, and a marked increase in OPG protein expression was observed.These results implied that Notch signaling regulated OPG expression in HSC-4 cells.However, Jagged1 did not alter OPG expression in another human oral squamous cell carcinoma cell line(HSC-5) or a human head and neck squamous cell carcinoma cell line(HN22).Conclusions: Notch signaling regulated OPG expression in an HSC-4 cell line and this mechanism could be cell line specific.

  18. Tff3 is Expressed in Neurons and Microglial Cells

    Directory of Open Access Journals (Sweden)

    Ting Fu

    2014-11-01

    Full Text Available Background/Aims: The trefoil factor family (TFF peptide TFF3 is typically secreted by mucous epithelia, but is also expressed in the immune system and the brain. It was the aim of this study to determine the cerebral cell types which express Tff3. Methods: Primary cultures from rat embryonic or neonatal cerebral cortex and hippocampus, respectively, were studied by means of RT-PCR and immunofluorescence. Moreover, Tff3 expression was localized by immunocytochemistry in sections of adult rat cerebellum. Results: Tff3 transcripts were detectable in neural cultures of both the cortex and the hippocampus as well as in glial cell-enriched cultures. Tff3 peptide co-localized with Map2 indicating an expression in neurons in vitro. The neuronal expression was confirmed by immunofluorescence studies of adult rat cerebellum. Furthermore, Tff3 peptide showed also a clear co-localization with Iba-1 in vitro typical of activated microglial cells. Conclusion: The neuronal expression of Tff3 is in line with a function of a typical neuropeptide influencing, e.g., fear, memory, depression and motoric skills. The expression in activated microglial cells, which is demonstrated here for the first time, points towards a possible function for Tff3 in immune reactions in the CNS. This opens a plethora of additional possible functions for Tff3 including synaptic plasticity and cognition as well as during neuroinflammatory diseases and psychiatric disorders.

  19. Cell-specific expression of TLR9 isoforms in inflammation.

    Science.gov (United States)

    McKelvey, Kelly J; Highton, John; Hessian, Paul A

    2011-02-01

    Toll-like receptors (TLRs) are key pattern recognition receptors during an immune response. With five isoforms of human TLR9 described, we hypothesised that differential expression of TLR9 isoforms in different cell types would result in variable contributions to the overall input from TLR9 during inflammation. We assessed the molecular expression of the TLR9 isoforms, TLR9-A, -C and -D. In normal peripheral blood mononuclear cells, B-lymphocytes express ∼100-fold more TLR9-A transcript than monocytes or T-lymphocytes, which predominantly express the TLR9-C transcript. Switches in isoform predominance accompany B-lymphocyte development. TLR9 protein expression in rheumatoid inflammatory lesions reflected the TLR9 isoform expression by immune cells. Herein we suggest that B-lymphocytes and plasmacytoid dendritic cells contribute the ∼3-fold higher TLR9-A transcript levels observed in inflamed synovium when compared to subcutaneous rheumatoid nodules. In contrast, macrophages and T-lymphocytes contribute the ∼4-fold higher TLR9-C transcript levels seen in nodules, compared to synovia. From protein sequence, predictions of subcellular localisation suggest TLR9-B may locate to the mitochondria, whereas TLR9-D adopts an opposing orientation in the endoplasmic reticulum. Consistent with this, structure models raise the possibility of alternative ligands for the TLR9-B and TLR9-D variants. Our results highlight differences in the expression of human TLR9 isoforms in normal and inflamed tissues, with differing contributions to inflammation.

  20. Gene expression markers for Caenorhabditis elegans vulval cells.

    Science.gov (United States)

    Inoue, Takao; Sherwood, David R; Aspöck, Gudrun; Butler, James A; Gupta, Bhagwati P; Kirouac, Martha; Wang, Minqin; Lee, Pei-Yun; Kramer, James M; Hope, Ian; Bürglin, Thomas R; Sternberg, Paul W

    2002-12-01

    The analysis of cell fate patterning during the vulval development of Caenorhabditis elegans has relied mostly on the direct observation of cell divisions and cell movements (cell lineage analysis). However, reconstruction of the developing vulva from EM serial sections has suggested seven different cell types (vulA, vulB1, vulB2, vulC, vulD, vulE, and vulF), many of which cannot be distinguished based on such observations. Here we report the vulval expression of seven genes, egl-17, cdh-3, ceh-2, zmp-1, B0034.1, T04B2.6 and F47B8.6 based on gfp, cfp and yfp (green fluorescent protein and color variants) reporter fusions. Each gene expresses in a specific subset of vulval cells, and is therefore useful as a marker for vulval cell fates. Together, expressions of markers distinguish six cell types, and reveal a strict temporal control of gene expression in the developing vulva.

  1. CD44 variant expression in cutaneous T-cell lymphoma.

    Science.gov (United States)

    Orteu, C H; Li, W; Allen, M H; Smith, N P; Barker, J N; Whittaker, S J

    1997-07-01

    Expression of the lymphocyte homing receptor CD44 and its splice variants have been linked to tumour dissemination and poor prognosis in non-Hodgkin's lymphoma. Specifically, the in vitro expression of variant exon V6 confers metastatic potential in rat pancreatic carcinoma cell lines. In this study, we investigated the expression of CD44 splice variants in cutaneous T-cell lymphomas, including patients with mycosis fungoides (MF), Sezary syndrome (SS), large-cell anaplastic lymphoma (LCAL) and HTLV1-associated cutaneous lymphoma. In addition, 4 involved lymph nodes from 2 patients with MF and 1 patient with SS were examined. Inflammatory dermatoses, lichen planus and psoriasis, and normal skin were also studied. Immunohistochemistry was performed using a panel of monoclonal antibodies, including those with specificity for CD44H (standard isoform) and variant exons V3, V6 and V8-9. Normal epidermal keratinocytes were consistently CD44H and CD44 V3, V6 and V8-9 positive. In all the different clinicopathological subtypes and stages of cutaneous T-cell lymphomas, including involved lymph nodes, tumour cells consistently expressed CD44H, but were CD44 V3 and V6 negative. CD44 V8-9 was expressed on a majority of tumour cells in 2/5 LCAL and on occasional tumour cells in 2/5 LCAL. Occasional V8-9 positive tumour cells were also identified in 6/13 MF, 1/4 SS and 3/4 HTLV1. In 2/3 lymph node samples from 2 patients with tumour-stage MF, CD44 V8-9 expression was found on a small percentage of atypical mononuclear cells. Scattered V8-9 positive dermal mononuclear cells were present in sections of lichen planus and psoriasis. We have found no evidence to suggest that the metastasis-associated CD44 variant exon (V6) is expressed in cutaneous T-cell lymphoma, or that CD44H expression is associated with an adverse prognostic group. It is not clear whether the strong expression of CD44 V8-9 in 2 patients with CD30 positive LCAL reflects activation status or metastatic potential.

  2. EOTAXIN AND EOTAXIN-2 EXPRESSION IN HUMAN BRONCHIAL EPITHELIAL CELL

    Institute of Scientific and Technical Information of China (English)

    TANG Wei; DENG Wei-wu; Albert CHAN; Stanley CHIK; Adrain WU

    2005-01-01

    Objective To study the role of eotaxin and eotaxin-2 expression by Th2 cytokine and analyze their relationship in normal human bronchial epithelial cell line-BEAS-2B cell. Methods Levels of eotaxin mRNA and protein expression in the bronchial epithelial cell line BEAS-2B cell were determined with RT-PCR and ELISA. We also used RT-PCR to evaluate eotaxin-2 expression under the regulation of Th2 cytokine IL-4 and IL-13 as well as proinflammatory agent-TNFα. Results Eotaxin mRNA expression was the highest at the time point of 12h under the stimulation of TNF-α. While Th2 cytokine IL-4 and IL-13 had the amplification effect on the expression. Eotaxin protein was also elevated with the combination stimulation of proinflammatory agent TNF-α and IL-4 in dose and time dependent manner(P<0.01). These results were also seen when the cells were stimulated by TNF-α and IL-13. Eotaxin-2 mRNA expression was the highest at the time point of 8h. The expression evaluated by semi-quantitative RT-PCR also elevated under the co-stimulation of TNF-α and IL-4 or TNF-α and IL-13 and it should significantly correlate with Eotaxin(P<0.05). Conclusion This study demonstrated that Th2 cytokine like IL-4 and IL-13 enhances eotaxin and eotaxin-2 expression when co-stimulated with proinflammatory agent TNF-α. These results showed that Th2 cytokines existence is the strong evidence for bronchial epithelial cells taking part in the allergic inflammation especially in eosinophils recruitment.

  3. Expression and purification of splicing proteins from mammalian cells.

    Science.gov (United States)

    Allemand, Eric; Hastings, Michelle L

    2014-01-01

    Pre-mRNA splicing is a complex process that is carried out by a large ribonucleoprotein enzyme, termed the spliceosome, which comprises up to 200 proteins. Despite this complexity, the role of individual spliceosomal proteins in the splicing reaction has been successfully investigated using cell-free assays. In many cases, the splicing factor of interest must be expressed and purified in order to study its function in vitro. Posttranslational modifications such as phosphorylation, methylation, acetylation, and ubiquitination of splicing factors are important for activity. Thus, their purification from mammalian cells presents numerous advantages. Here, we describe a method for expression and purification of splicing proteins from mammalian cells.

  4. Cell-surface expression of Hsp70 on hematopoietic cancer cells after inhibition of HDAC activity

    DEFF Research Database (Denmark)

    Jensen, Helle; Andresen, Lars; Hansen, Karen Aagaard

    , membrane-bound Hsp70 can stimulate antigen presenting cells (APCs) to release proinflammatory cytokines and can provide a target structure for NK cell-mediated lysis. Human cancer cells frequently express Hsp70 on their cell surface, whereas the corresponding normal tissues do not. In addition, several...... clinically applied reagents, such as alkyl-lysophospholipides, chemotherapeutic agents, and anti-inflammatory reagents, have been found to enhance Hsp70 surface expression on cancer cells. We have found that inhibition of histone deacetylase (HDAC) activity leads to surface expression of Hsp70 on various...... hematopoietic cancer cells, an occurance that was not observed on naïve or activated peripheral blood cells. HDAC-inhibitor mediated Hsp70 surface expression was confined to the apoptotic Annexin V positive cells and blocked by inhibition of apoptosis. Other chemotherapeutic inducers of apoptosis...

  5. Growth dynamics and cyclin expression in cutaneous T-cell lymphoma cell lines

    Directory of Open Access Journals (Sweden)

    Edyta Biskup

    2010-05-01

    Full Text Available We have investigated cell growth dynamics and cyclins B1 and E expression in cell lines derived from mycosis fungoides (MyLa, Sézary syndrome (SeAx, and CD30+ lympho-proliferative diseases (Mac1, Mac2a, JK. Mac1 and Mac2a had the highest growth rate (doubling time 18-28 h, >90% cycling cells whereas SeAx was proliferating slowly (doub-ling time 55 h, approximately 35% cycling cells. Expression of cyclin B1 correlated positively with doubling time whereas expression of cyclin E was unscheduled and constant across the investigated cell lines. All cell lines exhibited high expression of PCNA. Thus, we concluded that cyclin B1 could be used for rapid screening of cell proliferation in malignant lymphocytes derived from cutaneous T-cell lymphoma.

  6. The regulation of CD5 expression in murine T cells

    Directory of Open Access Journals (Sweden)

    Herzenberg Leonard A

    2001-05-01

    Full Text Available Abstract Background CD5 is a pan-T cell surface marker that is also present on a subset of B cells, B-1a cells.Functional and developmental subsets of T cells express characteristic CD5 levels that vary over roughly a 30-fold range. Previous investigators have cloned a 1.7 Kb fragment containing the CD5 promoter and showed that it can confer similar lymphocyte-specific expression pattern as observed for endogenous CD5 expression. Results We further characterize the CD5 promoter and identify minimal and regulatory regions on the CD5 promoter. Using a luciferase reporter system, we show that a 43 bp region on the CD5 promoter regulates CD5 expression in resting mouse thymoma EL4 T cells and that an Ets binding site within the 43 bp region mediates the CD5 expression. In addition, we show that Ets-1, a member of the Ets family of transcription factors, recognizes the Ets binding site in the electrophoretic mobility shift assay (EMSA. This Ets binding site is directly responsible for the increase in reporter activity when co-transfected with increasing amounts of Ets-1 expression plasmid. We also identify two additional evolutionarily-conserved regions in the CD5 promoter (CD5X and CD5Y and demonstrate the respective roles of the each region in the regulation of CD5 transcription. Conclusion Our studies define a minimal and regulatory promoter for CD5 and show that the CD5 expression level in T cells is at least partially dependent on the level of Ets-1 protein. Based on the findings in this report, we propose a model of CD5 transcriptional regulation in T cells.

  7. Expression of ICAM-1 in colon epithelial cells

    DEFF Research Database (Denmark)

    Vainer, Ben; Sørensen, Susanne; Seidelin, Jakob;

    2003-01-01

    on monolayers of cancer cells. Conflicting results exist on epithelial ICAM-1 expression, and the aim of this study was to compare the expression in various models of colonic epithelium. MATERIALS AND METHODS: Colonic biopsies from four UC patients and four controls were examined by cryoimmuno......-electron microscopy using ICAM-1-antibodies. In four other controls, the epithelium was isolated from colonic biopsies, embedded in collagen, and evaluated similarly. Isolated crypts and cultured cancer cells were stimulated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF-alpha). RESULTS: ICAM-1......, both colonocytes and HT29 cells were capable of expressing ICAM-1 on their apical membranes in response to supraphysiologic cytokine concentrations. These observations question the justification of extrapolating observations from colon cancer cell lines to in vivo inflammatory conditions....

  8. Adipose tissue-derived stromal cells express neuronal phenotypes

    Institute of Scientific and Technical Information of China (English)

    杨立业; 刘相名; 孙兵; 惠国桢; 费俭; 郭礼和

    2004-01-01

    Background Adipose tissue-derived stromal cells (ADSCs) can be greatly expanded in vitro, and induced to differentiate into multiple mesenchymal cell types, including osteogenic, chondrogenic, myogenic, and adipogenic cells. This study was designed to investigate the possibility of ADSCs differentiating into neurons.Methods Adipose tissue from rats was digested with collagenase, and adherent stromal cells were cultured. A medium containing a low concentration of fetal bovine serum was adopted to induce the cells to differentiate. ADSCs were identified by immunocytochemistry, and semi-quantitative RT-PCR was applied to detect mRNA expression of neurofilament 1 (NF1), nestin, and neuron-specific enolase (NSE).Results Nestin-positive cells were found occasionally among ADSCs. ADSCs were found to express NSE mRNA and nestin mRNA, but not NF1 mRNA. ADSCs could differentiate into neuron-like cells in a medium composed of a low concentration of fetal bovine serum, and these differentiated cells displayed complicated neuron-like morphologies.Conclusions The data support the hypothesis that adipose tissue contains stem cells capable of differentiating into neurons. These stem cells can overcome their mesenchymal commitment, and may represent an alternative autologous stem cell source for CNS cell transplantation.

  9. Human respiratory epithelial cells from nasal turbinate expressed stem cell genes even after serial passaging.

    Science.gov (United States)

    Ruszymah, B H I; Izham, B A Azrul; Heikal, M Y Mohd; Khor, S F; Fauzi, M B; Aminuddin, B S

    2011-12-01

    Current development in the field of tissue engineering led to the idea of repairing and regenerating the respiratory airway through in vitro reconstruction using autologous respiratory epithelial (RE). To ensure the capability of proliferation, the stem cell property of RE cells from the nasal turbinate should be evaluated. Respiratory epithelial cells from six human nasal turbinates were harvested and cultured in vitro. The gene expression of FZD-9 and BST-1 were expressed in passage 2 (P2) and passage 4 (P4). The levels of expression were not significant between both passages. The RE cells exhibit the stem cell properties, which remains even after serial passaging.

  10. Cell-surface expression of Hsp70 on hematopoietic cancer cells after inhibition of HDAC activity

    DEFF Research Database (Denmark)

    Jensen, Helle; Andresen, Lars; Hansen, Karen Aagaard

    2009-01-01

    We show that inhibition of HDAC activity leads to surface expression of Hsp70 on various hematopoietic cancer cells, an occurance that was not observed on naïve or activated peripheral blood cells. HDAC inhibitor-mediated Hsp70 surface expression was confined to the apoptotic Annexin V...... activity selectively induces surface expression of Hsp70 on hematopoietic cancer cells and that this may increase immunorecognition of these cells.......-positive cells and blocked by inhibition of apoptosis. Other chemotherapeutic inducers of apoptosis such as etoposide and camptothecin also led to a robust induction of Hsp70 surface expression. Hsp70 expression was, however, not caused by induction of apoptosis per se, as activated CD4 T cells remained Hsp70...

  11. Expression of cell cycle regulating factor mRNA in small cell lung cancer xenografts

    DEFF Research Database (Denmark)

    Krarup, M; Poulsen, H S; Spang-Thomsen, M

    1998-01-01

    We have investigated the expression of cyclins, cyclin dependent kinases (CDK), and CDK inhibitors (CKI) at the mRNA level in a panel of small-cell lung cancer (SCLC) cell lines in vitro and in vivo as xenografts in nude mice. The results showed that the cell lines expressed varying amounts of most...... cyclin and CDK's but only a few of the cell lines expressed cyclin D1 and/or D2 and some lacked expression of CDK6. Most cell lines expressed mRNA for the CKI's but two cell lines lacked expression of P15INK4B and p16INK4A. The mRNA expression differed for a few of the cell lines regarding cyclin D2...... and CDK6 when in vitro and in vivo data were compared. Two of the cell lines that express the retinoblastoma (Rb) protein had no sign of a deregulated Rb pathway but further studies at the protein level are necessary to demonstrate whether these two cell lines should have a normal Rb pathway or whether...

  12. Regulation of stem cell factor expression in inflammation and asthma

    Directory of Open Access Journals (Sweden)

    Carla A Da Silva

    2005-03-01

    Full Text Available Stem cell factor (SCF is a major mast cell growth factor, which could be involved in the local increase of mast cell number in the asthmatic airways. In vivo, SCF expression increases in asthmatic patients and this is reversed after treatment with glucocorticoids. In vitro in human lung fibroblasts in culture, IL-1beta, a pro-inflammatory cytokine, confirms this increased SCF mRNA and protein expression implying the MAP kinases p38 and ERK1/2 very early post-treatment, and glucocorticoids confirm this decrease. Surprisingly, glucocorticoids potentiate the IL-1beta-enhanced SCF expression at short term treatment, implying increased SCF mRNA stability and SCF gene transcription rate. This potentiation involves p38 and ERK1/2. Transfection experiments with the SCF promoter including intron1 also confirm this increase and decrease of SCF expression by IL-1beta and glucocorticoids, and the potentiation by glucocorticoids of the IL-1beta-induced SCF expression. Deletion of the GRE or kappaB sites abolishes this potentiation, and the effect of IL-1beta or glucocorticoids alone. DNA binding of GR and NF-kappaB are also demonstrated for these effects. In conclusion, this review concerns new mechanisms of regulation of SCF expression in inflammation that could lead to potential therapeutic strategy allowing to control mast cell number in the asthmatic airways.

  13. Main: AS1LIKECSHPRA [PLACE

    Lifescience Database Archive (English)

    Full Text Available AS1LIKECSHPRA S000260 14-Oct-1999 (last modified) kehi as-1-like motif found in cuc...umber (C.s.) hydroxypyruvate reductase (hprA) gene; Required for cytokinin responsiveness; Also see S000261 ...(CYTOSITECSHPRA); cytokinin; as-1; as-1 TGACG motif; cucumber (Cucumis sativus) AAATGACGAAAATGC ...

  14. Fractalkine expression induces endothelial progenitor cell lysis by natural killer cells.

    Directory of Open Access Journals (Sweden)

    Dilyana Todorova

    Full Text Available BACKGROUND: Circulating CD34(+ cells, a population that includes endothelial progenitors, participate in the maintenance of endothelial integrity. Better understanding of the mechanisms that regulate their survival is crucial to improve their regenerative activity in cardiovascular and renal diseases. Chemokine-receptor cross talk is critical in regulating cell homeostasis. We hypothesized that cell surface expression of the chemokine fractalkine (FKN could target progenitor cell injury by Natural Killer (NK cells, thereby limiting their availability for vascular repair. METHODOLOGY/PRINCIPAL FINDINGS: We show that CD34(+-derived Endothelial Colony Forming Cells (ECFC can express FKN in response to TNF-α and IFN-γ inflammatory cytokines and that FKN expression by ECFC stimulates NK cell adhesion, NK cell-mediated ECFC lysis and microparticles release in vitro. The specific involvement of membrane FKN in these processes was demonstrated using FKN-transfected ECFC and anti-FKN blocking antibody. FKN expression was also evidenced on circulating CD34(+ progenitor cells and was detected at higher frequency in kidney transplant recipients, when compared to healthy controls. The proportion of CD34(+ cells expressing FKN was identified as an independent variable inversely correlated to CD34(+ progenitor cell count. We further showed that treatment of CD34(+ circulating cells isolated from adult blood donors with transplant serum or TNF-α/IFN-γ can induce FKN expression. CONCLUSIONS: Our data highlights a novel mechanism by which FKN expression on CD34(+ progenitor cells may target their NK cell mediated killing and participate to their immune depletion in transplant recipients. Considering the numerous diseased contexts shown to promote FKN expression, our data identify FKN as a hallmark of altered progenitor cell homeostasis with potential implications in better evaluation of vascular repair in patients.

  15. Comprehensive Profiling of GPCR Expression in Ghrelin-Producing Cells.

    Science.gov (United States)

    Koyama, Hiroyuki; Iwakura, Hiroshi; Dote, Katsuko; Bando, Mika; Hosoda, Hiroshi; Ariyasu, Hiroyuki; Kusakabe, Toru; Son, Choel; Hosoda, Kiminori; Akamizu, Takashi; Kangawa, Kenji; Nakao, Kazuwa

    2016-02-01

    To determine the comprehensive G protein-coupled receptor (GPCR) expression profile in ghrelin-producing cells and to elucidate the role of GPCR-mediated signaling in the regulation of ghrelin secretion, we determined GPCR expression profiles by RNA sequencing in the ghrelin-producing cell line MGN3-1 and analyzed the effects of ligands for highly expressed receptors on intracellular signaling and ghrelin secretion. Expression of selected GPCRs was confirmed in fluorescence-activated cell-sorted fluorescently tagged ghrelin-producing cells from ghrelin-promoter CreERT2/Rosa-CAG-LSL-ZsGreen1 mice. Expression levels of GPCRs previously suggested to regulate ghrelin secretion including adrenergic-β1 receptor, GPR81, oxytocin receptor, GPR120, and somatostatin receptor 2 were high in MGN3-1 cells. Consistent with previous reports, isoproterenol and oxytocin stimulated the Gs and Gq pathways, respectively, whereas lactate, palmitate, and somatostatin stimulated the Gi pathway, confirming the reliability of current assays. Among other highly expressed GPCRs, prostaglandin E receptor 4 agonist prostaglandin E2 significantly stimulated the Gs pathway and ghrelin secretion. Muscarine, the canonical agonist of cholinergic receptor muscarinic 4, stimulated both the Gq and Gi pathways. Although muscarine treatment alone did not affect ghrelin secretion, it did suppress forskolin-induced ghrelin secretion, suggesting that the cholinergic pathway may play a role in counterbalancing the stimulation of ghrelin by Gs (eg, by adrenaline). In addition, GPR142 ligand tryptophan stimulated ghrelin secretion. In conclusion, we determined the comprehensive expression profile of GPCRs in ghrelin-producing cells and identified two novel ghrelin regulators, prostaglandin E2 and tryptophan. These results will lead to a greater understanding of the physiology of ghrelin and facilitate the development of ghrelin-modulating drugs.

  16. Expression and Fuactional Role of HERG1, K+ Channels in Leukemic Cells and Leukemic Stem Cells

    Institute of Scientific and Technical Information of China (English)

    LI Huiyu; LIU Liqiong; GUO Tiannan; ZHANG Jiahua; LI Xiaoqing; DU Wen; LIU Wei; CHEN Xiangjun; HUANG Shi'ang

    2007-01-01

    In order to investigate the expression and functional role of HERG1 K+ channels in leukemic cells and leukemic stem cells (LSCs), RT-PCR was used to detect the HERG1 K+ channels expression in leukemic cells and LSCs. The functional role of HERG1 K+ channels in leukemic cell proliferation was measured by MTT assay, and cell cycle and apoptosis were analyzed by flow cytometry. The results showed that herg mRNA was expressed in CD34+/CD38-, CD123+ LSCs but not in circulating CD34+ cells. Herg mRNA was also up-regulated in leukemia cell lines K562 and HL60 as well as almost all the primary leukemic cells while not in normal peripheral blood mononuclear cells (PBMNCs) and the expression of herg mRNA was not associated with the clinical and cytogenetic features of leukemia. In addition, leukemic cell proliferation was dramatically inhibited by HERG K+ channel special inhibitor E-4031. Moreover, E-4031 suppressed the cell growth by inducing a specific block at the G1/S transition phase of the cell cycle but had no effect on apoptosis in leukemic cells. The results suggested that HERG1 K+ channels could regulate leukemic cells proliferation and were necessary for leukemic cells to proceed with the cell cycle. HERG1 K+ channels may also have oncogenic potential and may be a biomarker for diagnosis of leukemia and a novel potential pharmacological target for leukemia therapy.

  17. Dynamic distribution and stem cell characteristics of Sox1-expressing cells in the cerebellar cortex

    Institute of Scientific and Technical Information of China (English)

    Joelle Alcock; Virginie Sottile

    2009-01-01

    Bergmann glia cells are a discrete radial glia population surrounding Purkinje cells in the cerebellar cortex. Al-though Bergmann glia are essential for the development and correct arborization of Purkinje cells, little is known about the regulation of this cell population after the developmental phase. In an effort to characterize this population at the molecular level, we have analyzed marker expression and established that adult Bergmann glia express Soxl, Sox2 and Sox9, a feature otherwise associated with neural stem cells (NSCs). In the present study, we have further analyzed the developmental pattern of Soxl-expressing cells in the developing cerebellum. We report that before be-coming restricted to the Purkinje cell layer, Soxl-positive cells are present throughout the immature tissue, and that these cells show characteristics of Bergmann glia progenitors. Our study shows that these progenitors express Soxl, Sox2 and Sox9, a signature maintained throughout cerebellar maturation into adulthood. When isolated in culture, the Soxl-expressing cerebellar population exhibited neurosphere-forming ability, NSC-marker characteristics, and demonstrated multipotency at the clonal level. Our results show that the Bergmann glia population expresses Soxl during cerebellar development, and that these cells can be isolated and show stem cell characteristics in vitro, sug-gesting that they could hold a broader potential than previously thought.

  18. Connexin expression and gap-junctional intercellular communication in ES cells and iPS cells.

    Science.gov (United States)

    Oyamada, Masahito; Takebe, Kumiko; Endo, Aya; Hara, Sachiko; Oyamada, Yumiko

    2013-01-01

    Pluripotent stem cells, i.e., embryonic stem (ES) and induced pluripotent stem (iPS) cells, can indefinitely proliferate without commitment and differentiate into all cell lineages. ES cells are derived from the inner cell mass of the preimplantation blastocyst, whereas iPS cells are generated from somatic cells by overexpression of a few transcription factors. Many studies have demonstrated that mouse and human iPS cells are highly similar but not identical to their respective ES cell counterparts. The potential to generate basically any differentiated cell types from these cells offers the possibility to establish new models of mammalian development and to create new sources of cells for regenerative medicine. ES cells and iPS cells also provide useful models to study connexin expression and gap-junctional intercellular communication (GJIC) during cell differentiation and reprogramming. In 1996, we reported connexin expression and GJIC in mouse ES cells. Because a substantial number of papers on these subjects have been published since our report, this Mini Review summarizes currently available data on connexin expression and GJIC in ES cells and iPS cells during undifferentiated state, differentiation, and reprogramming.

  19. Connexin expression and gap-junctional intercellular communication in ES cells and iPS cells

    Directory of Open Access Journals (Sweden)

    Masahito eOyamada

    2013-07-01

    Full Text Available Pluripotent stem cells, i.e., embryonic stem (ES and induced pluripotent stem (iPS cells, can indefinitely proliferate without commitment and differentiate into all cell lineages. ES cells are derived from the inner cell mass of the preimplantation blastocyst, whereas iPS cells are generated from somatic cells by overexpression of a few transcription factors. Many studies have demonstrated that mouse and human iPS cells are highly similar but not identical to their respective ES cell counterparts. The potential to generate basically any differentiated cell types from these cells offers the possibility to establish new models of mammalian development and to create new sources of cells for regenerative medicine. ES cells and iPS cells also provide useful models to study connexin expression and gap-junctional intercellular communication (GJIC during cell differentiation and reprogramming. In 1996, we reported connexin expression and GJIC in mouse ES cells. Because a substantial number of papers on these subjects have been published since our report, this Mini Review summarizes currently available data on connexin expression and GJIC in ES cells and iPS cells during undifferentiated state, differentiation, and reprogramming.

  20. Regulation of cell-to-cell variability in divergent gene expression

    Science.gov (United States)

    Yan, Chao; Wu, Shuyang; Pocetti, Christopher; Bai, Lu

    2016-03-01

    Cell-to-cell variability (noise) is an important feature of gene expression that impacts cell fitness and development. The regulatory mechanism of this variability is not fully understood. Here we investigate the effect on gene expression noise in divergent gene pairs (DGPs). We generated reporters driven by divergent promoters, rearranged their gene order, and probed their expressions using time-lapse fluorescence microscopy and single-molecule fluorescence in situ hybridization (smFISH). We show that two genes in a co-regulated DGP have higher expression covariance compared with the separate, tandem and convergent configurations, and this higher covariance is caused by more synchronized firing of the divergent transcriptions. For differentially regulated DGPs, the regulatory signal of one gene can stochastically `leak' to the other, causing increased gene expression noise. We propose that the DGPs' function in limiting or promoting gene expression noise may enhance or compromise cell fitness, providing an explanation for the conservation pattern of DGPs.

  1. Patterns of expression of cell wall related genes in sugarcane

    Directory of Open Access Journals (Sweden)

    Lima D.U.

    2001-01-01

    Full Text Available Our search for genes related to cell wall metabolism in the sugarcane expressed sequence tag (SUCEST database (http://sucest.lbi.dcc.unicamp.br resulted in 3,283 reads (1% of the total reads which were grouped into 459 clusters (potential genes with an average of 7.1 reads per cluster. To more clearly display our correlation coefficients, we constructed surface maps which we used to investigate the relationship between cell wall genes and the sugarcane tissues libraries from which they came. The only significant correlations that we found between cell wall genes and/or their expression within particular libraries were neutral or synergetic. Genes related to cellulose biosynthesis were from the CesA family, and were found to be the most abundant cell wall related genes in the SUCEST database. We found that the highest number of CesA reads came from the root and stem libraries. The genes with the greatest number of reads were those involved in cell wall hydrolases (e.g. beta-1,3-glucanases, xyloglucan endo-beta-transglycosylase, beta-glucosidase and endo-beta-mannanase. Correlation analyses by surface mapping revealed that the expression of genes related to biosynthesis seems to be associated with the hydrolysis of hemicelluloses, pectin hydrolases being mainly associated with xyloglucan hydrolases. The patterns of cell wall related gene expression in sugarcane based on the number of reads per cluster reflected quite well the expected physiological characteristics of the tissues. This is the first work to provide a general view on plant cell wall metabolism through the expression of related genes in almost all the tissues of a plant at the same time. For example, developing flowers behaved similarly to both meristematic tissues and leaf-root transition zone tissues. Besides providing a basis for future research on the mechanisms of plant development which involve the cell wall, our findings will provide valuable tools for plant engineering in the

  2. Connective Tissue Growth Factor Expression in Human Bronchial Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    Amrita DOSANJH

    2006-01-01

    Connective tissue growth factor (CTGF) is a cysteine-rich protein that promotes extracellular matrix deposition. CTGF is selectively induced by transforming growth factor β and des-Arg kallidin in lung fibroblasts and increases steady-state mRNA levels of α type I collagen, 5α-integrin and fibronectin in fibroblasts. Bronchial epithelial cells have been proposed to functionally interact with lung fibroblasts. We therefore investigated if bronchial epithelial cells are able to synthesize CTGF. Human bronchial epithelial cells were grown to subconfluence in standard growth media. Proliferating cells grown in small airway growth media were harvested following starvation for up to 24 h. Expression of CTGF transcripts was measured by PCR. Immunocytochemistry was also completed using a commercially available antibody.The cells expressed readily detectable CTGF transcripts. Starvation of these cells resulted in a quantitative decline of CTGF transcripts. Direct sequencing of the PCR product identified human CTGF. Immunocytochemistry confirmed intracellular CTGF in the cells and none in negative control cells. We conclude that bronchial epithelial cells could be a novel source of CTGF. Bronchial epithelial cell-derived CTGF could thus directly influence the deposition of collagen in certain fibrotic lung diseases.

  3. Expression of cyclooxygenase-2 in human esophageal squamous cell carcinomas

    Institute of Scientific and Technical Information of China (English)

    Jian-Gang Jiang; Dao-Wen Wang; Jiang-Bo Tang; Chun-Lian Chen; Bao-Xing Liu; Xiang-Ning Fu; Zhi-Hui Zhu; Wei Qu; Katherine Cianflone; Michael P. Waalkes

    2004-01-01

    AIM: To determine whether cyclooxygenase-2 (COX-2) was expressed in human esophageal squamous cell carcinoma.METHODS: Quantitative reverse transcription-polymerase chain reaction (RT-PCR), western blotting, immunohistochemistry and immunofluorescence were used to assess the expression level of COX-2 in esophageal tissue.RESULTS: COX-2 mRNA levels were increased by >80-fold in esophageal squamous cell carcinoma when compared to adjacent noncancerous tissue. COX-2 protein was present in 21 of 30 cases of esophageal squamous cell carcinoma tissues, but was undetectable in noncancerous tissue. Immunohistochemistry was performed to directly show expression of COX-2 in tumor tissue.CONCLUSION: These results suggest that COX-2 may be an important factor for esophageal cancer and inhibition of COX-2 may be helpful for prevention and possibly treatment of this cancer.

  4. Cloning and expression of human colon mast cell carboxypeptidase

    Institute of Scientific and Technical Information of China (English)

    Zhang-Quan Chen; Shao-Heng He

    2004-01-01

    AIM: To clone and express the human colon mast cell METHODS: Total RNA was extracted from colon tissue, and the cDNA encoding human colon mast cell carboxypeptidase was amplified by reverse-transcription PCR (RT-PCR). The product cDNA was subcloned into the prokaryotic expression vector pMAL-c2x and eukaryotic expression vector pPIC9K to conrtruct prokaryotic expression vector pMAL/human MC-CP (hMC-CP) and eukaryotic pPIC9K/hMC-CP. The recombinant fusion protein expressed in E.coli was induced with IPTG and purified by amylose affinity chromatography. After digestion with factor Xa, recombinant hMC-CP was purified by heparin agarose chromatography. The recombinant hMC-CP expressed in Pichia pastoris (P.pastoris) was induced with methanol and analyzed by SDS-PAGE, Western blot, N-terminal amino acid RESULTS: The cDNA encoding the human colon mast cell carboxypeptidase was cloned, which had five nucleotide variations compared with skin MC-CP cDNA. The recombinant hMC-CP protein expressed in E.coli was purified with amylose affinity chromatography and heparin agarose chromatogphy.SDS-PAGE and Western blot analysis showed that the recombinant protein expressed by E. coli had a molecular weight of 36 kDa and reacted to the anti-native hMC-CP monoclonal antibody (CA5). The N-terminal amino acid sequence confirmed further the product was hMC-CP. E. coli generated hMC-CP showed a very low level of enzymatic activity, but P. pastoris produced hMC-CP had a relatively high enzymatic activity towards a synthetic substrate hippuryl-L-phenylalanine.carboxypeptidase can be successfully cloned and expressed in E.coli and P. pastoris, which will contribute greatly to the fonctional study on hMC-CP.

  5. Expression pattern of embryonic stem cell markers in DFAT cells and ADSCs.

    Science.gov (United States)

    Gao, Qian; Zhao, Lili; Song, Ziyi; Yang, Gongshe

    2012-05-01

    Mature adipocytes can revert to a more primitive phenotype and gain cell proliferative ability under the condition of ceiling method, named dedifferentiated fat cells (DFAT cells). These cells exhibit multilineage potential as adipose tissue-derived stromal cells (ADSCs). However, the stem molecular signature of DFAT cells and the difference distinct from ADSCs are still not sure. To study the molecular signature of DFAT cells better, highly purified mature adipocytes were obtained from rats and the purity was more than 98%, and about 98.6% were monocytes. These mature adipocytes dedifferentiated into fibroblast-like cells spontaneously by the ceiling culture method, these cells proliferated rapidly in vitro, grew in the same direction and formed vertex, and expressed extensively embryonic stem cell markers such as Oct4, Sox2, c-Myc, and Nanog, surface antigen SSEA-1, CD105, and CD31, moreover, these cells possessed ALP and telomerase activity. The expression level was Oct4 1.3%, Sox2 1.3%, c-Myc 1.2%, Nanog 1.2%, CD105 0.6%, CD31 0.6% and SSEA-1 0.4%, respectively, which was lower than that in ADSCs, but the purity of DFAT cells was much higher than that of ADSCs. In conclusion, DFAT cells is a highly purified stem cell population, and expressed some embryonic stem cell markers like ADSCs, which seems to be a good candidate source of adult stem cells for the future cell replacement therapy.

  6. Expression of cadherin and NCAM in human small cell lung cancer cell lines and xenografts

    DEFF Research Database (Denmark)

    Rygaard, K; Møller, C; Bock, E

    1992-01-01

    characterised, the cadherin family and the Ig superfamily member, neural cell adhesion molecule (NCAM). We investigated expression of these two adhesion molecule families in small cell lung cancer (SCLC) cell lines and xenografts by immunoblotting. Nineteen tumours established from 15 patients with SCLC were...... embryonic development, which may play a role in connection with tumour invasion and metastasis, was found in 14/18 NCAM expressing SCLC tumours. Individual tumours grown as cell lines and as nude mouse xenografts showed no qualitative differences in cadherin or NCAM expression....

  7. Modulation of GLO1 Expression Affects Malignant Properties of Cells

    Science.gov (United States)

    Hutschenreuther, Antje; Bigl, Marina; Hemdan, Nasr Y. A.; Debebe, Tewodros; Gaunitz, Frank; Birkenmeier, Gerd

    2016-01-01

    The energy metabolism of most tumor cells relies on aerobic glycolysis (Warburg effect) characterized by an increased glycolytic flux that is accompanied by the increased formation of the cytotoxic metabolite methylglyoxal (MGO). Consequently, the rate of detoxification of this reactive glycolytic byproduct needs to be increased in order to prevent deleterious effects to the cells. This is brought about by an increased expression of glyoxalase 1 (GLO1) that is the rate-limiting enzyme of the MGO-detoxifying glyoxalase system. Here, we overexpressed GLO1 in HEK 293 cells and silenced it in MCF-7 cells using shRNA. Tumor-related properties of wild type and transformed cells were compared and key glycolytic enzyme activities assessed. Furthermore, the cells were subjected to hypoxic conditions to analyze the impact on cell proliferation and enzyme activities. Our results demonstrate that knockdown of GLO1 in the cancer cells significantly reduced tumor-associated properties such as migration and proliferation, whereas no functional alterations where found by overexpression of GLO1 in HEK 293 cells. In contrast, hypoxia caused inhibition of cell growth of all cells except of those overexpressing GLO1. Altogether, we conclude that GLO1 on one hand is crucial to maintaining tumor characteristics of malignant cells, and, on the other hand, supports malignant transformation of cells in a hypoxic environment when overexpressed. PMID:27999356

  8. Modulation of GLO1 Expression Affects Malignant Properties of Cells

    Directory of Open Access Journals (Sweden)

    Antje Hutschenreuther

    2016-12-01

    Full Text Available The energy metabolism of most tumor cells relies on aerobic glycolysis (Warburg effect characterized by an increased glycolytic flux that is accompanied by the increased formation of the cytotoxic metabolite methylglyoxal (MGO. Consequently, the rate of detoxification of this reactive glycolytic byproduct needs to be increased in order to prevent deleterious effects to the cells. This is brought about by an increased expression of glyoxalase 1 (GLO1 that is the rate-limiting enzyme of the MGO-detoxifying glyoxalase system. Here, we overexpressed GLO1 in HEK 293 cells and silenced it in MCF-7 cells using shRNA. Tumor-related properties of wild type and transformed cells were compared and key glycolytic enzyme activities assessed. Furthermore, the cells were subjected to hypoxic conditions to analyze the impact on cell proliferation and enzyme activities. Our results demonstrate that knockdown of GLO1 in the cancer cells significantly reduced tumor-associated properties such as migration and proliferation, whereas no functional alterations where found by overexpression of GLO1 in HEK 293 cells. In contrast, hypoxia caused inhibition of cell growth of all cells except of those overexpressing GLO1. Altogether, we conclude that GLO1 on one hand is crucial to maintaining tumor characteristics of malignant cells, and, on the other hand, supports malignant transformation of cells in a hypoxic environment when overexpressed.

  9. Cell Adhesion Regulates Expression of the Androgen Receptor and Coregulators in Different Prostate Cancer Cells

    Directory of Open Access Journals (Sweden)

    Sheng Li

    2007-02-01

    Full Text Available Prostate cancer cells adhere to a tumor basement membrane, while secretoryepithelial cells reside in a suprabasal cell compartment. Since tumor cells are derived fromsuprabasal epithelial cells, they experience de-novo substratum adhesion in the context ofoncogenesis. We therefore analyzed whether cell-matrix adhesion could affect the proteinexpression and activity of the AR. In this study, AR protein expression declined uponsuspension of BPH-1-AR cells, but not in PC-3-AR cells shown by Western blot. In a timecourse study, BPH-1 cell lost AR expression within 6 hours, and the synthetic androgen,R1881 reduced the loss of AR expression. We further explored the mechanism of AR loss insuspended BPH-1 cells. BPH-1-AR cells underwent apoptosis (anoikis when suspended for2 - 5 hours. Suspension did not induce significant apoptosis or decreasing of AR expressionin PC-3 cells. Inhibition of apoptosis in suspended BPH-1-AR cells, either by expression ofBcl-2 or Bcl-xl or by treatment with Z-VAD, a caspase inhibitor, prevented loss of ARprotein. In contrast, the calpain protease inhibitor , ALLN, accelerated the loss of AR proteinexpression. Additionally, cell-matrix adhesion changed the expression of coregulators of ARin the mRNA level of prostate cancer cells. Our results demonstrate that AR proteinexpression was reduced through activation of cell death pathways, and thus indirectly through cell suspension in BPH-AR cells. The activity of AR can also be regulated by adhesion in PC-3-AR and LNCaP cells through affecting the coregulators level.

  10. Regulation of gene expression in ovarian cancer cells by luteinizing hormone receptor expression and activation

    Directory of Open Access Journals (Sweden)

    Dam Phuongan

    2011-06-01

    Full Text Available Abstract Background Since a substantial percentage of ovarian cancers express gonadotropin receptors and are responsive to the relatively high concentrations of pituitary gonadotropins during the postmenopausal years, it has been suggested that receptor activation may contribute to the etiology and/or progression of the neoplasm. The goal of the present study was to develop a cell model to determine the impact of luteinizing hormone (LH receptor (LHR expression and LH-mediated LHR activation on gene expression and thus obtain insights into the mechanism of gonadotropin action on ovarian surface epithelial (OSE carcinoma cells. Methods The human ovarian cancer cell line, SKOV-3, was stably transfected to express functional LHR and incubated with LH for various periods of time (0-20 hours. Transcriptomic profiling was performed on these cells to identify LHR expression/activation-dependent changes in gene expression levels and pathways by microarray and qRT-PCR analyses. Results Through comparative analysis on the LHR-transfected SKOV-3 cells exposed to LH, we observed the differential expression of 1,783 genes in response to LH treatment, among which five significant families were enriched, including those of growth factors, translation regulators, transporters, G-protein coupled receptors, and ligand-dependent nuclear receptors. The most highly induced early and intermediate responses were found to occupy a network impacting transcriptional regulation, cell growth, apoptosis, and multiple signaling transductions, giving indications of LH-induced apoptosis and cell growth inhibition through the significant changes in, for example, tumor necrosis factor, Jun and many others, supportive of the observed cell growth reduction in in vitro assays. However, other observations, e.g. the substantial up-regulation of the genes encoding the endothelin-1 subtype A receptor, stromal cell-derived factor 1, and insulin-like growth factor II, all of which are

  11. Expression of CIDE proteins in clear cell renal cell carcinoma and their prognostic significance.

    Science.gov (United States)

    Yu, Ming; Wang, Hui; Zhao, Jun; Yuan, Yuan; Wang, Chao; Li, Jing; Zhang, Lijun; Zhang, Liying; Li, Qing; Ye, Jing

    2013-06-01

    Clear cell renal cell carcinoma (ccRCC) is the major and aggressive subtype of renal cell carcinoma. It is known to derive its histologic appearance from accumulation of abundant lipids and glycogens. The cell death-inducing DFF45-like effector (CIDE) family has been characterized as the lipid droplet proteins involved in the metabolism of lipid storage droplets. The purpose of this study was to evaluate the expression of CIDE proteins in ccRCC cells and to investigate their prognostic significance. We examined consecutive patients with sporadic ccRCC, who underwent nephrectomy, to measure their mRNA and protein expression of CIDE proteins. We found that Cidec and ADRP expression were significantly up-regulated in ccRCC, compared with normal kidney tissues. Cideb was down-regulated. We also found that Cideb was expressed more in low-grade ccRCC than in high-grade tumors. To further clarify the relationship between Cideb expression and patient prognosis, we evaluated 57 ccRCC patients followed up for 120 months. Reduced ccRCC Cideb expression was associated with a higher Fuhrman nuclear grade. Patients with high Cideb expression had better overall survival rate than those with low expression (p < 0.05). Cideb expression was an independent predictor of survival (p = 0.001). Although the biologic function of Cideb in ccRCC remains unknown, the expression level of Cideb might be a novel predictor of prognosis in ccRCC.

  12. From single-cell to cell-pool transcriptomes: stochasticity in gene expression and RNA splicing.

    Science.gov (United States)

    Marinov, Georgi K; Williams, Brian A; McCue, Ken; Schroth, Gary P; Gertz, Jason; Myers, Richard M; Wold, Barbara J

    2014-03-01

    Single-cell RNA-seq mammalian transcriptome studies are at an early stage in uncovering cell-to-cell variation in gene expression, transcript processing and editing, and regulatory module activity. Despite great progress recently, substantial challenges remain, including discriminating biological variation from technical noise. Here we apply the SMART-seq single-cell RNA-seq protocol to study the reference lymphoblastoid cell line GM12878. By using spike-in quantification standards, we estimate the absolute number of RNA molecules per cell for each gene and find significant variation in total mRNA content: between 50,000 and 300,000 transcripts per cell. We directly measure technical stochasticity by a pool/split design and find that there are significant differences in expression between individual cells, over and above technical variation. Specific gene coexpression modules were preferentially expressed in subsets of individual cells, including one enriched for mRNA processing and splicing factors. We assess cell-to-cell variation in alternative splicing and allelic bias and report evidence of significant differences in splice site usage that exceed splice variation in the pool/split comparison. Finally, we show that transcriptomes from small pools of 30-100 cells approach the information content and reproducibility of contemporary RNA-seq from large amounts of input material. Together, our results define an experimental and computational path forward for analyzing gene expression in rare cell types and cell states.

  13. Immunglobulin Expression and Its Biological Significance in Cancer Cells

    Institute of Scientific and Technical Information of China (English)

    Duosha Hu; Hui Zheng; Haidan Liu; Ming Li; Wei Ren; Wei Liao; Zhi Duan; Lili Li; Ya Cao

    2008-01-01

    It is generally believed that the expression of a gene iS restricted "within the right place and at the right time".This principle has long been considered applicable as well to the expression of immunoglobulin(Ig)lymphocytes of B cell lineage.However,increasing evidence has shown Ig "paradoxically" expressed in malignant tumors of epitheliaI origin.We reviewed the recent progress in the study of cancer-derived Ig,and also discussed its mechanisms and possible functions,trying to arouse interest and attention to those working in the field of immunology and oncology.

  14. Implication of expression of Nanog in prostate cancer cells and their stem cells.

    Science.gov (United States)

    Gong, Chen; Liao, Hui; Guo, Fengjin; Qin, Liang; Qi, Jun

    2012-04-01

    Recent studies suggested that the prostate cancer may arise from prostate cancer stem cells that share some same characteristics with normal stem cells. The purpose of this study was to detect the differences of Nanog expression between PC3 prostate cancer cell line and its tumor stem cells, and the relationship was preliminarily examined between Nanog and prostate cancer and its tumor stem cells. By using magnetic active cell sorting (MACS), we isolated a population of CD44(+)/CD133(+) prostate cancer cells that display stem cell characteristics from PC3 cell line. Immunohistochemistry revealed positive expressions of CD44, CD133 and α(2)β(1)-integin in the isolated cells. CCK-8 analysis showed that isolated cells had a strong proliferative ability. The formation of the cell spheres in serum-free medium and holoclones in serum-supplied medium showed that the cells were capable of self-renewing, indicating that the isolated cells were a population of cancer stem-like cells derived from PC3 cell line. Western blotting exhibited that the isolated cells had higher experession of Nanog, an embryonic stem marker, as compared with PC3 cells. Our study showed that Nanog might be helpful in sustaining the self-renewal and the undifferentiation of prostate cancer stem cells, and may serve as a marker for prostate cancer stem cells for isolation and identification.

  15. Polyclonal T-Cells Express CD1a in Langerhans Cell Histiocytosis (LCH) Lesions

    Science.gov (United States)

    West, Jennifer A.; Olsen, Sharon L.; Mitchell, Jenée M.; Priddle, Ross E.; Luke, Jennifer M.; Åkefeldt, Selma Olsson; Henter, Jan-Inge; Turville, Christopher; Kannourakis, George

    2014-01-01

    Langerhans cell histiocytosis (LCH) is a complex and poorly understood disorder that has characteristics of both inflammatory and neoplastic disease. By using eight-colour flow cytometry, we have identified a previously unreported population of CD1a+/CD3+ T-cells in LCH lesions. The expression of CD1a is regarded as a hallmark of this disease; however, it has always been presumed that it was only expressed by pathogenic Langerhans cells (LCs). We have now detected CD1a expression by a range of T-cell subsets within all of the LCH lesions that were examined, establishing that CD1a expression in these lesions is no longer restricted to pathogenic LCs. The presence of CD1a+ T-cells in all of the LCH lesions that we have studied to date warrants further investigation into their biological function to determine whether these cells are important in the pathogenesis of LCH. PMID:25343480

  16. Polyclonal T-cells express CD1a in Langerhans cell histiocytosis (LCH lesions.

    Directory of Open Access Journals (Sweden)

    Jennifer A West

    Full Text Available Langerhans cell histiocytosis (LCH is a complex and poorly understood disorder that has characteristics of both inflammatory and neoplastic disease. By using eight-colour flow cytometry, we have identified a previously unreported population of CD1a(+/CD3(+ T-cells in LCH lesions. The expression of CD1a is regarded as a hallmark of this disease; however, it has always been presumed that it was only expressed by pathogenic Langerhans cells (LCs. We have now detected CD1a expression by a range of T-cell subsets within all of the LCH lesions that were examined, establishing that CD1a expression in these lesions is no longer restricted to pathogenic LCs. The presence of CD1a(+ T-cells in all of the LCH lesions that we have studied to date warrants further investigation into their biological function to determine whether these cells are important in the pathogenesis of LCH.

  17. Iron increases HMOX1 and decreases hepatitis C viral expression in HCV-expressing cells

    Institute of Scientific and Technical Information of China (English)

    Wei-Hong Hou; Lisa Rossi; Ying Shan; Jian-Yu Zheng; Richard W Lambrecht; Herbert L Bonkovsky

    2009-01-01

    AIM: To investigate effects of iron on oxidative stress,heme oxygenase-1 (HMOX1) and hepatitis C viral (HCV) expression in human hepatoma cells stably expressing HCV proteins.METHODS: Effects of iron on oxidative stress, HMOX1,and HCV expression were assessed in CON1 cells.Measurements included mRNA by quantitative reverse transcription-polymerase chain reaction, and protein levels by Western blots.RESULTS: Iron, in the form of ferric nitrilotriacetate,increased oxidative stress and up-regulated HMOX1 gene expression. Iron did not affect mRNA or protein levels of Bach1, a repressor of HMOX1. Silencing the up-regulation of HMOX1 nuclear factor-erythroid 2-related factor 2 (Nrf2) by Nrf2-siRNA decreased FeNTA-mediated up-regulation of HMOX1 mRNA levels. These iron effects were completely blocked by deferoxamine (DFO). Iron also significantly decreased levels of HCV core mRNA and protein by 80%-90%,nonstructural 5A mRNA by 90% and protein by about 50% in the Con1 full length HCV replicon cells,whereas DFO increased them.CONCLUSION: Excess iron up-regulates HMOX1 and down-regulates HCV gene expression in hepatoma cells. This probably mitigates liver injury caused by combined iron overload and HCV infection.

  18. Progesterone Upregulates Gene Expression in Normal Human Thyroid Follicular Cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Santin Bertoni

    2015-01-01

    Full Text Available Thyroid cancer and thyroid nodules are more prevalent in women than men, so female sex hormones may have an etiological role in these conditions. There are no data about direct effects of progesterone on thyroid cells, so the aim of the present study was to evaluate progesterone effects in the sodium-iodide symporter NIS, thyroglobulin TG, thyroperoxidase TPO, and KI-67 genes expression, in normal thyroid follicular cells, derived from human tissue. NIS, TG, TPO, and KI-67 mRNA expression increased significantly after TSH 20 μUI/mL, respectively: 2.08 times, P<0.0001; 2.39 times, P=0.01; 1.58 times, P=0.0003; and 1.87 times, P<0.0001. In thyroid cells treated with 20 μUI/mL TSH plus 10 nM progesterone, RNA expression of NIS, TG, and KI-67 genes increased, respectively: 1.78 times, P<0.0001; 1.75 times, P=0.037; and 1.95 times, P<0.0001, and TPO mRNA expression also increased, though not significantly (1.77 times, P=0.069. These effects were abolished by mifepristone, an antagonist of progesterone receptor, suggesting that genes involved in thyroid cell function and proliferation are upregulated by progesterone. This work provides evidence that progesterone has a direct effect on thyroid cells, upregulating genes involved in thyroid function and growth.

  19. Gene expression profiling of chicken primordial germ cell ESTs

    Directory of Open Access Journals (Sweden)

    Lim Dajeong

    2006-08-01

    Full Text Available Abstract Background Germ cells are the only cell type that can penetrate from one generation to next generation. At the early embryonic developmental stages, germ cells originally stem from primordial germ cells, and finally differentiate into functional gametes, sperm in male or oocyte in female, after sexual maturity. This study was conducted to investigate a large-scale expressed sequence tag (EST analysis in chicken PGCs and compare the expression of the PGC ESTs with that of embryonic gonad. Results We constructed 10,851 ESTs from a chicken cDNA library of a collection of highly separated embryonic PGCs. After chimeric and problematic sequences were filtered out using the chicken genomic sequences, there were 5,093 resulting unique sequences consisting of 156 contigs and 4,937 singlets. Pearson chi-square tests of gene ontology terms in the 2nd level between PGC and embryonic gonad set showed no significance. However, digital gene expression profiling using the Audic's test showed that there were 2 genes expressed significantly with higher number of transcripts in PGCs compared with the embryonic gonads set. On the other hand, 17 genes in embryonic gonads were up-regulated higher than those in the PGC set. Conclusion Our results in this study contribute to knowledge of mining novel transcripts and genes involved in germline cell proliferation and differentiation at the early embryonic stages.

  20. Expression of Neural Markers by Undifferentiated Rat Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Dana Foudah

    2012-01-01

    Full Text Available The spontaneous expression of neural markers by mesenchymal stem cells (MSCs has been considered to be a demonstration of MSCs’ predisposition to differentiate towards neural lineages. In view of their application in cell therapy for neurodegenerative diseases, it is very important to deepen the knowledge about this distinctive biological property of MSCs. In this study, we evaluated the expression of neuronal and glial markers in undifferentiated rat MSCs (rMSCs at different culture passages (from early to late. rMSCs spontaneously expressed neural markers depending on culture passage, and they were coexpressed or not with the neural progenitor marker nestin. In contrast, the number of rMSCs expressing mesengenic differentiation markers was very low or even completely absent. Moreover, rMSCs at late culture passages were not senescent cells and maintained the MSC immunophenotype. However, their differentiation capabilities were altered. In conclusion, our results support the concept of MSCs as multidifferentiated cells and suggest the existence of immature and mature neurally fated rMSC subpopulations. A possible correlation between specific MSC subpopulations and specific neural lineages could optimize the use of MSCs in cell transplantation therapy for the treatment of neurological diseases.

  1. Detection of gene expression in an individual cell type within a cell mixture using microarray analysis.

    Directory of Open Access Journals (Sweden)

    Penelope A Bryant

    Full Text Available BACKGROUND: A central issue in the design of microarray-based analysis of global gene expression is the choice between using cells of single type and a mixture of cells. This study quantified the proportion of lipopolysaccharide (LPS induced differentially expressed monocyte genes that could be measured in peripheral blood mononuclear cells (PBMC, and determined the extent to which gene expression in the non-monocyte cell fraction diluted or obscured fold changes that could be detected in the cell mixture. METHODOLOGY/PRINCIPAL FINDINGS: Human PBMC were stimulated with LPS, and monocytes were then isolated by positive (Mono+ or negative (Mono- selection. The non-monocyte cell fraction (MonoD remaining after positive selection of monocytes was used to determine the effect of non-monocyte cells on overall expression. RNA from LPS-stimulated PBMC, Mono+, Mono- and MonoD samples was co-hybridised with unstimulated RNA for each cell type on oligonucleotide microarrays. There was a positive correlation in gene expression between PBMC and both Mono+ (0.77 and Mono- (0.61-0.67 samples. Analysis of individual genes that were differentially expressed in Mono+ and Mono- samples showed that the ability to detect expression of some genes was similar when analysing PBMC, but for others, differential expression was either not detected or changed in the opposite direction. As a result of the dilutional or obscuring effect of gene expression in non-monocyte cells, overall about half of the statistically significant LPS-induced changes in gene expression in monocytes were not detected in PBMC. However, 97% of genes with a four fold or greater change in expression in monocytes after LPS stimulation, and almost all (96-100% of the top 100 most differentially expressed monocyte genes were detected in PBMC. CONCLUSIONS/SIGNIFICANCE: The effect of non-responding cells in a mixture dilutes or obscures the detection of subtle changes in gene expression in an individual

  2. IL-35 over-expression increases apoptosis sensitivity and suppresses cell growth in human cancer cells.

    Science.gov (United States)

    Long, Jun; Zhang, Xulong; Wen, Mingjie; Kong, Qingli; Lv, Zhe; An, Yunqing; Wei, Xiao-Qing

    2013-01-01

    Interleukin (IL)-35 is a novel heterodimeric cytokine in the IL-12 family and is composed of two subunits: Epstein-Barr virus-induced gene 3 (EBI3) and IL-12p35. IL-35 is expressed in T regulatory (Treg) cells and contributes to the immune suppression function of these cells. In contrast, we found that both IL-35 subunits were expressed concurrently in most human cancer cell lines compared to normal cell lines. In addition, we found that TNF-α and IFN-γ stimulation led to increased IL-35 expression in human cancer cells. Furthermore, over-expression of IL-35 in human cancer cells suppressed cell growth in vitro, induced cell cycle arrest at the G1 phase, and mediated robust apoptosis induced by serum starvation, TNF-α, and IFN-γ stimulation through the up-regulation of Fas and concurrent down-regulation of cyclinD1, survivin, and Bcl-2 expression. In conclusion, our results reveal a novel functional role for IL-35 in suppressing cancer activity, inhibiting cancer cell growth, and increasing the apoptosis sensitivity of human cancer cells through the regulation of genes related to the cell cycle and apoptosis. Thus, this research provides new insights into IL-35 function and presents a possible target for the development of novel cancer therapies.

  3. Differentially expressed genes in giant cell tumor of bone.

    Science.gov (United States)

    Babeto, Erica; Conceição, André Luis Giacometti; Valsechi, Marina Curado; Peitl Junior, Paulo; de Campos Zuccari, Débora Aparecida Pires; de Lima, Luiz Guilherme Cernaglia Aureliano; Bonilha, Jane Lopes; de Freitas Calmon, Marília; Cordeiro, José Antônio; Rahal, Paula

    2011-04-01

    Giant cells tumors of bone (GCTB) are benign in nature but cause osteolytic destruction with a number of particular characteristics. These tumors can have uncertain biological behavior often contain a significant proportion of highly multinucleated cells, and may show aggressive behavior. We have studied differential gene expression in GCTB that may give a better understanding of their physiopathology, and might be helpful in prognosis and treatment. Rapid subtractive hybridization (RaSH) was used to identify and measure novel genes that appear to be differentially expressed, including KTN1, NEB, ROCK1, and ZAK using quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry in the samples of GCTBs compared to normal bone tissue. Normal bone was used in the methodology RaSH for comparison with the GCTB in identification of differentially expressed genes. Functional annotation indicated that these genes are involved in cellular processes related to their tumor phenotype. The differential expression of KTN1, ROCK1, and ZAK was independently confirmed by qRT-PCR and immunohistochemistry. The expression of the KTN1 and ROCK1 genes were increased in samples by qRT-PCR and immunohistochemistry, and ZAK had reduced expression. Since ZAK have CpG islands in their promoter region and low expression in tumor tissue, their methylation pattern was analyzed by MSP-PCR. The genes identified KTN1, ROCK1, and ZAK may be responsible for loss of cellular homeostasis in GCTB since they are responsible for various functions related to tumorigenesis such as cell migration, cytoskeletal organization, apoptosis, and cell cycle control and thus may contribute at some stage in the process of formation and development of GCTB.

  4. Effects of Trichostatin A on HDAC8 Expression, Proliferation and Cell Cycle of Molt-4 Cells

    Institute of Scientific and Technical Information of China (English)

    HE Jing; LIU Hongli; CHEN Yan

    2006-01-01

    The effects of Trichostatin A (TSA) on histone deacetylase 8 (HDAC8) expression, proliferation and cell cycle arrest in T-lymphoblastic leukemia cell line Molt-4 cells in vitro were investigated. The effect of TSA on the growth of Molt-4 cells was studied by MTT assay. Flow cytometry was used to examine the cell cycle. The expression of HDAC8 was detected by using immunocytochemistry and Western blot. The results showed that proliferation of Molt-4 cells was inhibited in TSA-treated group in a time- and dose-dependent manner. The IC50 of TSA exposures for 24 h and 36 h were 254.3236 and 199.257 μg/L respectively. The cell cycle analysis revealed that Molt-4 was mostly in G0/G1 phase, and after treatment with TSA from 50 to 400 μg/L for 24 h, the percents of G0/G1 cells were decreased and cells were arrested in G2/M phase. Treatment of TSA for 24 h could significantly inhibit the expression of HDAC8 protein in Molt-4 cells (P<0.01). It was concluded that TSA could decrease the expression of HDAC8 in Molt-4 cells, which contributed to the inhibition of proliferation and induction of cell cycle arrest in Molt-4 cells.

  5. Expression of cell cycle regulator cdk2ap1 suppresses tumor cell phenotype by non-cell autonomous mechanisms

    OpenAIRE

    Zolochevska, Olga; Figueiredo, Marxa L

    2009-01-01

    We evaluated the effect of expressing the cell cycle regulator cdk2ap1 in epithelial or stromal cell compartments to reduce SCC growth in vitro and in vivo. Cell autonomous and/or non-cell autonomous expression of cdk2ap1 reduced tumor growth and invasion and altered cell cycle, adhesion, invasion, angiogenesis, and apoptotic gene expression, as assessed by several in vitro phenotype assays, quantitative real time PCR, and in vivo molecular imaging using a novel three-way xenograft animal mod...

  6. Functional bitter taste receptors are expressed in brain cells.

    Science.gov (United States)

    Singh, Nisha; Vrontakis, Maria; Parkinson, Fiona; Chelikani, Prashen

    2011-03-04

    Humans are capable of sensing five basic tastes which are sweet, sour, salt, umami and bitter. Of these, bitter taste perception provides protection against ingestion of potentially toxic substances. Bitter taste is sensed by bitter taste receptors (T2Rs) that belong to the G-protein coupled receptors (GPCRs) superfamily. Humans have 25 T2Rs that are expressed in the oral cavity, gastrointestinal (GI) neuroendocrine cells and airway cells. Electrophysiological studies of the brain neurons show that the neurons are able to respond to different tastants. However, the presence of bitter taste receptors in brain cells has not been elucidated. In this report using RT-PCR, and immunohistochemistry analysis we show that T2Rs are expressed in multiple regions of the rat brain. RT-PCR analysis revealed the presence of T2R4, T2R107 and T2R38 transcripts in the brain stem, cerebellum, cortex and nucleus accumbens. The bitter receptor T2R4 was selected for further analysis at the transcript level by quantitative real time PCR and at the protein level by immunohistochemistry. To elucidate if the T2R4 expressed in these cells is functional, assays involving G-protein mediated calcium signaling were carried out. The functional assays showed an increase in intracellular calcium levels after the application of exogenous ligands for T2R4, denatonium benzoate and quinine to these cultured cells, suggesting that endogenous T2R4 expressed in these cells is functional. We discuss our results in terms of the physiological relevance of bitter receptor expression in the brain.

  7. Improved expression systems for regulated expression in Salmonella infecting eukaryotic cells.

    Directory of Open Access Journals (Sweden)

    Carlos Medina

    Full Text Available In this work we describe a series of improvements to the Salmonella-based salicylate-inducible cascade expression system comprised of a plasmid-borne expression module, where target gene expression is driven by the P(m promoter governed by the XylS2 regulator, and a genome-integrated regulatory module controlled by the nahR/P(sal system. We have constructed a set of high and low-copy number plasmids bearing modified versions of the expression module with a more versatile multiple cloning site and different combinations of the following elements: (i the nasF transcriptional attenuator, which reduces basal expression levels, (ii a strong ribosome binding site, and (iii the Type III Secretion System (TTSS signal peptide from the effector protein SspH2 to deliver proteins directly to the eukaryotic cytosol following bacterial infection of animal cells. We show that different expression module versions can be used to direct a broad range of protein production levels. Furthermore, we demonstrate that the efficient reduction of basal expression by the nasF attenuator allows the cloning of genes encoding highly cytotoxic proteins such as colicin E3 even in the absence of its immunity protein. Additionally, we show that the Salmonella TTSS is able to translocate most of the protein produced by this regulatory cascade to the cytoplasm of infected HeLa cells. Our results indicate that these vectors represent useful tools for the regulated overproduction of heterologous proteins in bacterial culture or in animal cells, for the cloning and expression of genes encoding toxic proteins and for pathogenesis studies.

  8. Improved Expression Systems for Regulated Expression in Salmonella Infecting Eukaryotic Cells

    Science.gov (United States)

    Medina, Carlos; Camacho, Eva María; Flores, Amando; Mesa-Pereira, Beatriz; Santero, Eduardo

    2011-01-01

    In this work we describe a series of improvements to the Salmonella-based salicylate-inducible cascade expression system comprised of a plasmid-borne expression module, where target gene expression is driven by the Pm promoter governed by the XylS2 regulator, and a genome-integrated regulatory module controlled by the nahR/Psal system. We have constructed a set of high and low-copy number plasmids bearing modified versions of the expression module with a more versatile multiple cloning site and different combinations of the following elements: (i) the nasF transcriptional attenuator, which reduces basal expression levels, (ii) a strong ribosome binding site, and (iii) the Type III Secretion System (TTSS) signal peptide from the effector protein SspH2 to deliver proteins directly to the eukaryotic cytosol following bacterial infection of animal cells. We show that different expression module versions can be used to direct a broad range of protein production levels. Furthermore, we demonstrate that the efficient reduction of basal expression by the nasF attenuator allows the cloning of genes encoding highly cytotoxic proteins such as colicin E3 even in the absence of its immunity protein. Additionally, we show that the Salmonella TTSS is able to translocate most of the protein produced by this regulatory cascade to the cytoplasm of infected HeLa cells. Our results indicate that these vectors represent useful tools for the regulated overproduction of heterologous proteins in bacterial culture or in animal cells, for the cloning and expression of genes encoding toxic proteins and for pathogenesis studies. PMID:21829692

  9. Endothelial cells downregulate apolipoprotein D expression in mural cells through paracrine secretion and Notch signaling.

    Science.gov (United States)

    Pajaniappan, Mohanasundari; Glober, Nancy K; Kennard, Simone; Liu, Hua; Zhao, Ning; Lilly, Brenda

    2011-09-01

    Endothelial and mural cell interactions are vitally important for proper formation and function of blood vessels. These two cell types communicate to regulate multiple aspects of vessel function. In studying genes regulated by this interaction, we identified apolipoprotein D (APOD) as one gene that is downregulated in mural cells by coculture with endothelial cells. APOD is a secreted glycoprotein that has been implicated in governing stress response, lipid metabolism, and aging. Moreover, APOD is known to regulate smooth muscle cells and is found in abundance within atherosclerotic lesions. Our data show that the regulation of APOD in mural cells is bimodal. Paracrine secretion by endothelial cells causes partial downregulation of APOD expression. Additionally, cell contact-dependent Notch signaling plays a role. NOTCH3 on mural cells promotes the downregulation of APOD, possibly through interaction with the JAGGED-1 ligand on endothelial cells. Our results show that NOTCH3 contributes to the downregulation of APOD and by itself is sufficient to attenuate APOD transcript expression. In examining the consequence of decreased APOD expression in mural cells, we show that APOD negatively regulates cell adhesion. APOD attenuates adhesion by reducing focal contacts; however, it has no effect on stress fiber formation. These data reveal a novel mechanism in which endothelial cells control neighboring mural cells through the downregulation of APOD, which, in turn, influences mural cell function by modulating adhesion.

  10. PRL-3 expression in nasal sinus squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    Zi-Hui Chen; Min-Ying Li

    2016-01-01

    Objective:To investigate the relationship between liver regeneration phosphatase-3 (PRL-3) with differentiation extent of nasal sinus squamous cell carcinoma, and molecular biological effects on the pathogenesis of nasal sinus squamous cell carcinoma to comprehend its relevance, so as to make early diagnosis of patients, and to give guidance to the prognosis. Methods:Immunohistochemistry was used to detect PRL-3 in 30 cases of different degrees of sinus nasal squamous cell carcinoma. 20 cases of normal nasal cavity of mucosa tissues were set as control. Results:The PRL-3 in all levels of sinonasal squamous cell carcinoma tissues, there was a significant difference compared with the normal nasal mucosa (P<0.05), squamous cell carcinoma and its expression increased with the grade with enhanced trend. Conclusions:PRL-3 expression increased significantly in sinonasal squamous cell carcinoma than in nasal polyp tissue, showed that it may be associated with squamous cell carcinoma of nasal sinus squamous cell carcinoma, may be the early event.

  11. Impaired cell surface expression of HLA-B antigens on mesenchymal stem cells and muscle cell progenitors

    DEFF Research Database (Denmark)

    Isa, Adiba; Nehlin, Jan; Sabir, Hardee Jawad;

    2010-01-01

    HLA class-I expression is weak in embryonic stem cells but increases rapidly during lineage progression. It is unknown whether all three classical HLA class-I antigens follow the same developmental program. In the present study, we investigated allele-specific expression of HLA-A, -B, and -C...... at the mRNA and protein levels on human mesenchymal stem cells from bone marrow and adipose tissue as well as striated muscle satellite cells and lymphocytes. Using multicolour flow cytometry, we found high cell surface expression of HLA-A on all stem cells and PBMC examined. Surprisingly, HLA-B was either...... undetectable or very weakly expressed on all stem cells protecting them from complement-dependent cytotoxicity (CDC) using relevant human anti-B and anti-Cw sera. IFNgamma stimulation for 48-72 h was required to induce full HLA-B protein expression. Quantitative real-time RT-PCR showed that IFNgamma induced...

  12. GLUT-1 Expression in Cutaneous Basal and Squamous Cell Carcinomas.

    Science.gov (United States)

    Abdou, Asmaa Gaber; Eldien, Marwa Mohammad Serag; Elsakka, Daliah

    2015-09-01

    Glucose uptake is a key regulating step in glucose metabolism and is mediated by facilitative glucose transporters (GLUTs), and GLUT-1 is the predominant glucose transporter in many types of human cells. Cutaneous basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) represent the most common skin cancer in Egypt. The present study aimed at evaluation of the pattern and distribution of GLUT-1 in cutaneous BCC (16 cases) and SCC (16 cases) by means of immunohistochemistry. GLUT-1 was expressed in all SCC (100%) and in 62.5% of BCC. Membranous pattern of GLUT-1 was seen in 62.5% of SCC and 31.25% of BCC. Positivity (P = .02) and percentage (P = .000) of GLUT-1 expression were in favor of SCC in comparison to BCC. The high percentage of GLUT-1 expression was associated with high grade in SCC (P = .03). The immunoreactivity for GLUT-1 was more in the periphery of malignant nests of SCC while it was more in the center of BCC nests. GLUT-1 is overexpressed in cutaneous non-melanoma skin cancer. Its expression in SCC is related to differentiation status, and its expression in BCC is intimately associated with squamous metaplastic areas.

  13. Enhancement of endothelial cell migration by constitutively active LPA{sub 1}-expressing tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kitayoshi, Misaho; Kato, Kohei; Tanabe, Eriko; Yoshikawa, Kyohei; Fukui, Rie [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Fukushima, Nobuyuki [Division of Molecular Neurobiology, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Tsujiuchi, Toshifumi, E-mail: ttujiuch@life.kindai.ac.jp [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan)

    2012-06-01

    Highlights: Black-Right-Pointing-Pointer Mutated LPA{sub 1} stimulates cell migration of endothelial cells. Black-Right-Pointing-Pointer VEGF expressions are increased by mutated LPA{sub 1}. Black-Right-Pointing-Pointer LPA signaling via mutated LPA{sub 1} is involved in angiogenesis. Black-Right-Pointing-Pointer Mutated LPA{sub 1} promotes cancer cell progression. -- Abstract: Lysophosphatidic acid (LPA) receptors belong to G protein-coupled transmembrane receptors (LPA receptors; LPA{sub 1} to LPA{sub 6}). They indicate a variety of cellular response by the interaction with LPA, including cell proliferation, migration and differentiation. Recently, we have reported that constitutive active mutated LPA{sub 1} induced the strong biological effects of rat neuroblastoma B103 cells. In the present study, we examined the effects of mutated LPA{sub 1} on the interaction between B103 cells and endothelial F-2 cells. Each LPA receptor expressing B103 cells were maintained in serum-free DMEM and cell motility assay was performed with a Cell Culture Insert. When F-2 cells were cultured with conditioned medium from Lpar1 and Lpar3-expressing cells, the cell motility of F-2 cells was significantly higher than control cells. Interestingly, the motile activity of F-2 cells was strongly induced by mutated LPA{sub 1} than other cells, correlating with the expression levels of vascular endothelial growth factor (Vegf)-A and Vegf-C. Pretreatment of LPA signaling inhibitors inhibited F-2 cell motility stimulated by mutated LPA{sub 1}. These results suggest that activation of LPA signaling via mutated LPA{sub 1} may play an important role in the promotion of angiogenesis in rat neuroblastoma cells.

  14. Immune Killing Activity of Lymphocytes on Hela Cells Expressing Interleukin-12 In Vitro

    Institute of Scientific and Technical Information of China (English)

    Huiyan WANG; Suhua CHEN

    2008-01-01

    The killing effects of lymphocytes on Hela cells expressing intedeukin-12 (IL-12) in vitro were explored. By using gene transfection technique, full length IL-12 gene was transfected into Hela cells. The expression of IL-12 in Hela cells was detected quantitatively by ELISA; Changes in killing effects of lymphocytes on Hela cells expressing IL-12 were observed by MTT. It was found that Hela cells could express IL-12 between 24h and 72h after transfection. Killing activity of lymphocytes on Hela cells expressing IL-12 was significantly enhanced. It was concluded by cell transfection technique, Hela cells could express IL-12 and were more easily killed by lymphocytes.

  15. Human dental pulp stem cells express many pluripotency regulators and differentiate into neuronal cells

    Institute of Scientific and Technical Information of China (English)

    Behnam Ebrahimi; Mohammad Mehdi Yaghoobi; Ali Mohammadi Kamal-abadi; Maryam Raoof

    2011-01-01

    Stem cells were isolated from human dental pulp using an optimized method, in which pulp pieces were digested by enzymes and immobilized to enhance cell outgrowth. Stem cell marker expression was detected by reverse transcription-PCR (RT-PCR), and differentiation markers were detected by real-time quantitative RT-PCR and immunocytochemistry. Results showed that dental pulp stem cells actively expressed nanog, oct4, nucleostemin slain-1, jmjd1a, jmjd2c, and cyclin D1. When stem cells were induced to differentiate into neurons, nucleostemin, nanog, and cyclin D1 expres-sion significantly decreased, whereas expression of neuronal markers, such as microtubule asso-ciated protein-2 and neurofilament-heavy, significantly increased. These results suggested that stem cells exited a pluripotent state and entered a neuronal differentiation pathway. In addition, results demonstrated that human dental pulp serves as a reservoir of stem cells that express defined stem cell markers; these cells were easily isolated and were induced to differentiate towards a desired cell lineage.

  16. Gene expression analysis of dendritic/Langerhans cells and Langerhans cell histiocytosis

    NARCIS (Netherlands)

    Rust, Renata; Kluiver, J.; Visser, Lydia; Harms, G.; Blokzijl, T.; Kamps, W.A.; Poppema, Sibrand; van den Berg, Anke

    2006-01-01

    Langerhans cell histiocytosis (LCH) is a neoplastic disorder that results in clonal proliferation of cells with a Langerhans cell (LQ phenotype. The pathogenesis of LCH is still poorly understood. In the present study, serial analysis of gene expression (SAGE) was applied to LCs generated from umbil

  17. Metastasis regulation by PPARD expression in cancer cells

    Science.gov (United States)

    Zuo, Xiangsheng; Xu, Weiguo; Xu, Min; Tian, Rui; Moussalli, Micheline J.; Mao, Fei; Zheng, Xiaofeng; Wang, Jing; Morris, Jeffrey S.; Eng, Cathy; Maru, Dipen M.; Rashid, Asif; Broaddus, Russell; Wei, Daoyan; Hung, Mien-Chie; Sood, Anil K.

    2017-01-01

    Peroxisome proliferator–activated receptor–δ (PPARD) is upregulated in many major human cancers, but the role that its expression in cancer cells has in metastasis remains poorly understood. Here, we show that specific PPARD downregulation or genetic deletion of PPARD in cancer cells significantly repressed metastasis in various cancer models in vivo. Mechanistically, PPARD promoted angiogenesis via interleukin 8 in vivo and in vitro. Analysis of transcriptome profiling of HCT116 colon cancer cells with or without genetic deletion of PPARD and gene expression patterns in The Cancer Genome Atlas colorectal adenocarcinoma database identified novel pro-metastatic genes (GJA1, VIM, SPARC, STC1, SNCG) as PPARD targets. PPARD expression in cancer cells drastically affected epithelial-mesenchymal transition, migration, and invasion, further underscoring its necessity for metastasis. Clinically, high PPARD expression in various major human cancers (e.g., colorectal, lung, breast) was associated with significantly reduced metastasis-free survival. Our results demonstrate that PPARD, a druggable protein, is an important molecular target in metastatic cancer. PMID:28097239

  18. Reduced expression of Slit2 in renal cell carcinoma.

    Science.gov (United States)

    Ma, Wei-Jie; Zhou, Yu; Lu, Dan; Dong, Dong; Tian, Xiao-Jun; Wen, Jie-Xi; Zhang, Jun

    2014-01-01

    Slit2, initially identified as an important axon guidance molecule in the nervous system, was suggested to be involved in multiple cellular processes. Recently, Slit2 was reported to function as a potential tumor suppressor in diverse tumors. In this study, we systematically analyzed the expression level of Slit2 in renal cell carcinoma. Compared to paired adjacent non-malignant tissues, both Slit2 mRNA and protein expression were significantly down-regulated in renal cell carcinoma (RCC). Methylation-specific PCR showed that Slit2 promoter was methylated in two renal carcinoma cell lines. Pharmacologic demethylation dramatically induced Slit2 expression in cancer cell lines with weak expression of Slit2. Besides, bisulfite genomic sequencing confirmed that dense methylation existed in Slit2 promoter. Furthermore, in paired RCC samples, Slit2 methylation was observed in 8 out of 38 patients (21.1 %), which was well correlated with the down-regulation of Slit2 in RCC. Therefore, Slit2 may also be a potential tumor suppressor in RCC, which is down-regulated in RCC partially due to promoter methylation.

  19. Cell-specific information processing in segregating populations of Eph receptor ephrin-expressing cells

    DEFF Research Database (Denmark)

    Jørgensen, Claus; Sherman, Andrew; Chen, Ginny I;

    2009-01-01

    Cells have self-organizing properties that control their behavior in complex tissues. Contact between cells expressing either B-type Eph receptors or their transmembrane ephrin ligands initiates bidirectional signals that regulate cell positioning. However, simultaneously investigating how...... information is processed in two interacting cell types remains a challenge. We implemented a proteomic strategy to systematically determine cell-specific signaling networks underlying EphB2- and ephrin-B1-controlled cell sorting. Quantitative mass spectrometric analysis of mixed populations of EphB2......- and ephrin-B1-expressing cells that were labeled with different isotopes revealed cell-specific tyrosine phosphorylation events. Functional associations between these phosphotyrosine signaling networks and cell sorting were established with small interfering RNA screening. Data-driven network modeling...

  20. Stem cell antigen 2 expression in adult and developing mice.

    Science.gov (United States)

    Antica, M; Wu, L; Scollay, R

    1997-01-01

    Stem cell antigen 2 (Sca-2) expression can distinguish the most immature T-lymphocyte precursors in the thymus from the hemopoietic stem cells. Sequence analysis of the Sca-2 protein showed that Sca-2 is a glycosylphosphatidylinositol (GPI) anchored molecule that shares some characteristics with the members of the Ly-6 multigene family, and that it is the same as the thymic shared antigen-1 (TSA-1). Here we extend these studies and critically reassess the expression of the Sca-2/TSA-1 antigen in hematopoietic tissues of adult and developing mice. With more sensitive methods we show that the distribution of Sca-2/TSA-1 differs from existing reports. We find especially high expression of Sca-2/TSA1 at day 14 of fetal development.

  1. B cell lymphomas express CX3CR1 a non-B cell lineage adhesion molecule

    DEFF Research Database (Denmark)

    Andreasson, U.; Ek, S.; Merz, H.

    2008-01-01

    To study the differential expression of cell membrane-bound receptors and their potential role in growth and/or survival of the tumor cells, highly purified follicular lymphoma cells were analyzed, using gene expression analysis, and compared to non-malignant B cell populations. Filtering...... the genome for overexpressed genes coding for cell membrane-bound proteins/receptors resulted in a hit list of 27 identified genes. Among these, we have focused on the aberrant over expression of CX3CR1, in different types of B cell lymphoma, as compared to non-malignant B cells. We show that CX3CR1, which...... normally is not expressed on B cells, is expressed both at the mRNA and protein level in several subtypes of lymphoma. CX3CR1 has also shown to be involved in the homing to specific tissues that express the ligand, CX3CL1, in breast and prostate cancer and may thus be involved in dissemination of lymphoma...

  2. Unusual patterns of immunoglobulin gene rearrangement and expression during human B cell ontogeny: human B cells can simultaneously express cell surface kappa and lambda light chains

    OpenAIRE

    1993-01-01

    Immunoglobulin gene rearrangement during mammalian B cell development generally follows an ordered progression, beginning with heavy (H) chain genes and proceeding through kappa and lambda light (L) chain genes. To determine whether the predicted kappa-->lambda hierarchy was occurring in vitro, we generated Epstein-Barr virus-transformed cell lines from cultures undergoing human pre-B cell differentiation. A total of 143 cell lines were established. 24 expressed cell surface mu/lambda by flow...

  3. Profiling helper T cell subset gene expression in deer mice

    Directory of Open Access Journals (Sweden)

    Hjelle Brian

    2006-08-01

    Full Text Available Abstract Background Deer mice (Peromyscus maniculatus are the most common mammals in North America and are reservoirs for several zoonotic agents, including Sin Nombre virus (SNV, the principal etiologic agent of hantavirus cardiopulmonary syndrome (HCPS in North America. Unlike human HCPS patients, SNV-infected deer mice show no overt pathological symptoms, despite the presence of virus in the lungs. A neutralizing IgG antibody response occurs, but the virus establishes a persistent infection. Limitations of detailed analysis of deer mouse immune responses to SNV are the lack of reagents and methods for evaluating such responses. Results We developed real-time PCR-based detection assays for several immune-related transcription factor and cytokine genes from deer mice that permit the profiling of CD4+ helper T cells, including markers of Th1 cells (T-bet, STAT4, IFNγ, TNF, LT, Th2 cells (GATA-3, STAT6, IL-4, IL-5 and regulatory T cells (Fox-p3, IL-10, TGFβ1. These assays compare the expression of in vitro antigen-stimulated and unstimulated T cells from individual deer mice. Conclusion We developed molecular methods for profiling immune gene expression in deer mice, including a multiplexed real-time PCR assay for assessing expression of several cytokine and transcription factor genes. These assays should be useful for characterizing the immune responses of experimentally- and naturally-infected deer mice.

  4. Expression of Connexin43 in Rat Epithelial Cells and Fibroblasts

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    To explore the role of connexin43 (Cx43) in gap junctional intercellular communication (GJIC) and propagated sensation along meridians, the expression of Cx43 in the rat epithelial cells and fibroblasts was studied both in vitro and in vivo. With the in vitro study, the rat epithelial cells and fibroblasts were cultured together, and the localization of Cx43 was detected by immunohistochemistry and indirect immunofluorescent cytochemistry and under confocal microscopy . And the expression of Cx43 on the surface of the cells was examined by flow cytometry. With the in vivo examination, 20 SD rats were randomized into control group (n = 10) and electrical acupuncture group (EAgroup, n=10). EA ( 0.5-1.5 V, 4-16 Hz , 30 min) was applied to"Zusanli"acupoint for 30 min at rat's hind paw, the localization of Cx43 was immunohistochemically detected.The immunohistochemical staining and indirect immunfluorescent cytochemistry showed that Cx43was localized on the surface of the cells and in the cytoplasm. The relative expression level of Cx43on the cellular membrane surfaces of the rat epithelial cells and fibroblasts, as determined by FACS, were 13.91 % and 29.53 % respectively. Our studied suggested that Cx43 might be involved in GJIC and propagated sensation along meridians.

  5. Sequential Notch signalling at the boundary of fringe expressing and non-expressing cells.

    Directory of Open Access Journals (Sweden)

    Tobias Troost

    Full Text Available Wing development in Drosophila requires the activation of Wingless (Wg in a small stripe along the boundary of Fringe (Fng expressing and non-expressing cells (FB, which coincides with the dorso-ventral (D/V boundary of the wing imaginal disc. The expression of Wg is induced by interactions between dorsal and ventral cells mediated by the Notch signalling pathway. It appears that mutual signalling from dorsal to ventral and ventral to dorsal cells by the Notch ligands Serrate (Ser and Delta (Dl respectively establishes a symmetric domain of Wg that straddles the D/V boundary. The directional signalling of these ligands requires the modification of Notch in dorsal cells by the glycosyltransferase Fng and is based on the restricted expression of the ligands with Ser expression to the dorsal and that of Dl to the ventral side of the wing anlage. In order to further investigate the mechanism of Notch signalling at the FB, we analysed the function of Fng, Ser and Dl during wing development at an ectopic FB and at the D/V boundary. We find that Notch signalling is initiated in an asymmetric fashion on only one side of the FB. During this initial asymmetric phase, only one ligand is required, with Ser initiating Notch-signalling at the D/V and Dl at the ectopic FB. Furthermore, our analysis suggests that Fng has also a positive effect on Ser signalling. Because of these additional properties, differential expression of the ligands, which has been a prerequisite to restrict Notch activation to the FB in the current model, is not required to restrict Notch signalling to the FB.

  6. Hypertonic saline impedes tumor cell-endothelial cell interaction by reducing adhesion molecule and laminin expression.

    LENUS (Irish Health Repository)

    Shields, Conor J

    2012-02-03

    BACKGROUND: Hypertonic saline infusion dampens inflammatory responses and suppresses neutrophil-endothelial interaction by reducing adhesion molecule expression. This study tested the hypothesis that hypertonic saline attenuates tumor cell adhesion to the endothelium through a similar mechanism. METHODS: Human colon cancer cells (LS174T) were transfected with green fluorescent protein and exposed to lipopolysaccharide, tumor necrosis factor-alpha, and interleukin-6 under hypertonic and isotonic conditions for 1 and 4 hours. Confluent human umbilical vein endothelial cells were similarly exposed. Cellular apoptosis and expression of adhesion molecules and laminin were measured by flow cytometry. Tumor cell adhesion to endothelium and laminin was assessed with fluorescence microscopy. Data are represented as mean +\\/- standard error of mean, and an ANOVA test was performed to gauge statistical significance, with P <.05 considered significant. RESULTS: Hypertonic exposure significantly reduced tumor cell adhesion despite the presence of the perioperative cell stressors (42 +\\/- 2.9 vs 172.5 +\\/- 12.4, P <.05), attenuated tumor cell beta-1 integrin (14.43 vs 23.84, P <.05), and endothelial cell laminin expression (22.78 +\\/- 2.2 vs 33.74 +\\/- 2.4, P <.05), but did not significantly alter cell viability. CONCLUSION: Hypertonic saline significantly attenuates tumor cell adhesion to endothelium by inhibiting adhesion molecule and laminin expression. This may halt the metastatic behavior of tumor cells shed at surgery.

  7. Tumor endothelial cells express high pentraxin 3 levels.

    Science.gov (United States)

    Hida, Kyoko; Maishi, Nako; Kawamoto, Taisuke; Akiyama, Kosuke; Ohga, Noritaka; Hida, Yasuhiro; Yamada, Kenji; Hojo, Takayuki; Kikuchi, Hiroshi; Sato, Masumi; Torii, Chisaho; Shinohara, Nobuo; Shindoh, Masanobu

    2016-12-01

    It has been described that tumor progression has many similarities to inflammation and wound healing in terms of the signaling processes involved. Among biological responses, angiogenesis, which is necessary for tumor progression and metastasis, is a common hallmark; therefore, tumor blood vessels have been considered as important therapeutic targets in anticancer therapy. We focused on pentraxin 3 (PTX3), which is a marker of cancer-related inflammation, but we found no reports on its expression and function in tumor blood vessels. Here we showed that PTX3 is expressed in mouse and human tumor blood vessels based on immunohistochemical analysis. We found that PTX3 is upregulated in primary mouse and human tumor endothelial cells compared to normal endothelial cells. We also showed that PTX3 plays an important role in the proliferation of the tumor endothelial cells. These results suggest that PTX3 is an important target for antiangiogenic therapy.

  8. Expression of myc family oncoproteins in small-cell lung-cancer cell lines and xenografts

    DEFF Research Database (Denmark)

    Rygaard, K; Vindeløv, L L; Spang-Thomsen, M

    1993-01-01

    A number of genes have altered activity in small-cell lung cancer (SCLC), but especially genes of the myc family (c-myc, L-myc and N-myc) are expressed at high levels in SCLC. Most studies have explored expression at the mRNA level, whereas studies of myc family oncoprotein expression are sparse....... WE examined the expression of myc proto-oncogenes at the mRNA and protein level in 23 cell lines or xenografts. In the cell lines, the doubling time and the cell-cycle distribution, as determined by flow-cytometric DNA analysis, were examined to establish whether the level of myc-gene-family...... expression correlated with proliferative parameters. All tumours expressed at least one myc family member at the mRNA level. Exclusive c-myc mRNA expression was demonstrated in 8 tumours, L-myc in 7 and N-myc in I. Five tumours expressed both c-myc and L-myc, and 2 tumours expressed both c-myc and N...

  9. Stem cell and neurogenic gene-expression profiles link prostate basal cells to aggressive prostate cancer.

    Science.gov (United States)

    Zhang, Dingxiao; Park, Daechan; Zhong, Yi; Lu, Yue; Rycaj, Kiera; Gong, Shuai; Chen, Xin; Liu, Xin; Chao, Hsueh-Ping; Whitney, Pamela; Calhoun-Davis, Tammy; Takata, Yoko; Shen, Jianjun; Iyer, Vishwanath R; Tang, Dean G

    2016-02-29

    The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features.

  10. Defining Developmental Potency and Cell Lineage Trajectories by Expression Profiling of Differentiating Mouse Embryonic Stem Cells

    Science.gov (United States)

    Aiba, Kazuhiro; Nedorezov, Timur; Piao, Yulan; Nishiyama, Akira; Matoba, Ryo; Sharova, Lioudmila V.; Sharov, Alexei A.; Yamanaka, Shinya; Niwa, Hitoshi; Ko, Minoru S. H.

    2009-01-01

    Biologists rely on morphology, function and specific markers to define the differentiation status of cells. Transcript profiling has expanded the repertoire of these markers by providing the snapshot of cellular status that reflects the activity of all genes. However, such data have been used only to assess relative similarities and differences of these cells. Here we show that principal component analysis of global gene expression profiles map cells in multidimensional transcript profile space and the positions of differentiating cells progress in a stepwise manner along trajectories starting from undifferentiated embryonic stem (ES) cells located in the apex. We present three ‘cell lineage trajectories’, which represent the differentiation of ES cells into the first three lineages in mammalian development: primitive endoderm, trophoblast and primitive ectoderm/neural ectoderm. The positions of the cells along these trajectories seem to reflect the developmental potency of cells and can be used as a scale for the potential of cells. Indeed, we show that embryonic germ cells and induced pluripotent cells are mapped near the origin of the trajectories, whereas mouse embryo fibroblast and fibroblast cell lines are mapped near the far end of the trajectories. We suggest that this method can be used as the non-operational semi-quantitative definition of cell differentiation status and developmental potency. Furthermore, the global expression profiles of cell lineages provide a framework for the future study of in vitro and in vivo cell differentiation. PMID:19112179

  11. Tangeretin induces cell cycle arrest and apoptosis through upregulation of PTEN expression in glioma cells.

    Science.gov (United States)

    Ma, Li-Li; Wang, Da-Wei; Yu, Xu-Dong; Zhou, Yan-Ling

    2016-07-01

    Tangeretin (TANG), present in peel of citrus fruits, has been shown to various medicinal properties such as chemopreventive and neuroprotective. However, the chemopreventive effect of TANG on glioblastoma cells has not been examined. The present study was designed to explore the anticancer potential of TANG in glioblastoma cells and to investigate the related mechanism. Human glioblastoma U-87MG and LN-18 cells were treated with 45μM concentration of TANG and cell growth was measured by MTT assay. The cell cycle distribution and cell death were measured by flow cytometry. The expression of cell cycle and apoptosis related genes were analyzed by quantitative RT-PCR and western blot. The cells treated with TANG were significantly increased cell growth suppression and cell death effects than vehicle treated cells. Further, TANG treatment increases G2/M arrest and apoptosis by modulating PTEN and cell-cycle regulated genes such as cyclin-D and cdc-2 mRNA and protein expressions. Moreover, the ability of TANG to decrease cell growth and to induce cell death was compromised when PTEN was knockdown by siRNA. Taken together, the chemopreventive effect of TANG is associated with regulation of cell-cycle and apoptosis in glioblastoma, thereby attenuating glioblastoma cell growth. Hence, the present findings suggest that TANG may be a therapeutic agent for glioblastoma treatment.

  12. Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Gehrau, Ricardo C.; D' Astolfo, Diego S.; Andreoli, Veronica [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Bocco, Jose L., E-mail: jbocco@fcq.unc.edu.ar [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Koritschoner, Nicolas P. [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina)

    2011-02-10

    The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC{sub 50}). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p < 0.0001) in KLF6 mRNA levels were observed depending on the cellular p53 status upon cell damage. KLF6 expression was significantly increased in 63% of p53-deficient cells (122/195). Conversely, KLF6 mRNA level decreased nearly 4 fold in more than 70% of p53+/+ cells. In addition, klf6 gene promoter activity was down-regulated by DNA damaging agents in cells expressing the functional p53 protein whereas it was moderately increased in the absence of functional p53. Consistent results were obtained for the endogenous KLF6 protein level. Results indicate that human klf6 gene expression is responsive to external cell damage mediated by IC{sub 50} concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable

  13. MHC-unrestricted lysis of MUC1-expressing cells by human peripheral blood mononuclear cells.

    Science.gov (United States)

    Wright, Stephen E; Rewers-Felkins, Kathleen A; Quinlin, Imelda S; Fogler, William E; Phillips, Catherine A; Townsend, Mary; Robinson, William; Philip, Ramila

    2008-01-01

    Many human adenocarcinomas can be killed in vitro by targeted cytotoxic T-lymphocytes (CTL); however, major histocompatibility complex (MHC)-restrictions are typically required. The MUC1 antigen is common in many human adenocarcinomas, and is associated with a variable number of tandem repeats. It has been proposed that antigens with such repeated epitopes may be vulnerable to cytotoxic T-lymphocyte killing without MHC-restriction. Therefore, it is possible that MUC1-expressing malignant cells may be killed by targeted cytotoxic T-lymphocyte in the absence of MHC-restriction. In this study, a human MUC1-expressing murine mammary carcinoma cell line was used to determine if cytotoxic T-lymphocyte killing of MUC1-expressing adenocarcinoma cells requires MHC-restriction. Specifically, MUC1-stimulated human mononuclear cells (M1SMC) were observed to kill human MUC1-transfected, MUC1-expressing murine mammary carcinoma cells, but not the mock-transfected, non-MUC1-expressing murine mammary carcinoma cells. Furthermore, the killing was blocked by antibody to MUC1, indicating MUC1-specific killing. In conclusion, cytotoxic T-lymphocyte killing of MUC1-expressing adenocarcinoma cells can be MHC-unrestricted.

  14. Differential gene expression in stromal cells of human giant cell tumor of bone.

    Science.gov (United States)

    Wuelling, M; Delling, G; Kaiser, E

    2004-12-01

    Giant cell tumor (GCT) offers a unique model for the hematopoietic-stromal cell interaction in human bone marrow. Evidence has been presented that GCT stromal cells (GCTSCs) promote accumulation, size and activity of the giant cells. Although GCTSCs are considered the neoplastic component of GCT, little is known about their genetic basis and, to date, a tumor-specific gene expression pattern has not been characterized. Mesenchymal stem cells (MSCs) have been identified as the origin of the GCT neoplastic stromal cell. Using state of the art array technology, expression profiling was applied to enriched stromal cell populations from five different GCTs and two primary MSCs as controls. Of the 29 differentially expressed genes found, 25 showed an increased expression. Differential mRNA expression was verified by real-time polymerase chain reaction analysis of 10 selected genes, supporting the validity of cDNA arrays as a tool to identify tumor-related genes in GCTSCs. Increased expression of two oncogenes, JUN and NME2, was substantiated at the protein level, utilizing immunohistochemical evaluation of GCT sections and Western-blot analysis. Increased phosphorylation of JUN Ser-63 was also found.

  15. Characterization of cell subpopulations expressing progenitor cell markers in porcine cardiac valves.

    Directory of Open Access Journals (Sweden)

    Huan Wang

    Full Text Available Valvular interstitial cells (VICs are the main population of cells found in cardiac valves. These resident fibroblastic cells play important roles in maintaining proper valve function, and their dysregulation has been linked to disease progression in humans. Despite the critical functions of VICs, their cellular composition is still not well defined for humans and other mammals. Given the limited availability of healthy human valves and the similarity in valve structure and function between humans and pigs, we characterized porcine VICs (pVICs based on expression of cell surface proteins and sorted a specific subpopulation of pVICs to study its functions. We found that small percentages of pVICs express the progenitor cell markers ABCG2 (~5%, NG2 (~5% or SSEA-4 (~7%, whereas another subpopulation (~5% expresses OB-CDH, a type of cadherin expressed by myofibroblasts or osteo-progenitors. pVICs isolated from either aortic or pulmonary valves express most of these protein markers at similar levels. Interestingly, OB-CDH, NG2 and SSEA-4 all label distinct valvular subpopulations relative to each other; however, NG2 and ABCG2 are co-expressed in the same cells. ABCG2(+ cells were further characterized and found to deposit more calcified matrix than ABCG2(- cells upon osteogenic induction, suggesting that they may be involved in the development of osteogenic VICs during valve pathology. Cell profiling based on flow cytometry and functional studies with sorted primary cells provide not only new and quantitative information about the cellular composition of porcine cardiac valves, but also contribute to our understanding of how a subpopulation of valvular cells (ABCG2(+ cells may participate in tissue repair and disease progression.

  16. Induction and selection of Sox17-expressing endoderm cells generated from murine embryonic stem cells.

    Science.gov (United States)

    Schroeder, Insa S; Sulzbacher, Sabine; Nolden, Tobias; Fuchs, Joerg; Czarnota, Judith; Meisterfeld, Ronny; Himmelbauer, Heinz; Wobus, Anna M

    2012-01-01

    Embryonic stem (ES) cells offer a valuable source for generating insulin-producing cells. However, current differentiation protocols often result in heterogeneous cell populations of various developmental stages. Here we show the activin A-induced differentiation of mouse ES cells carrying a homologous dsRed-IRES-puromycin knock-in within the Sox17 locus into the endoderm lineage. Sox17-expressing cells were selected by fluorescence-assisted cell sorting (FACS) and characterized at the transcript and protein level. Treatment of ES cells with high concentrations of activin A for 10 days resulted in up to 19% Sox17-positive cells selected by FACS. Isolated Sox17-positive cells were characterized by defini- tive endoderm-specific Sox17/Cxcr4/Foxa2 transcripts, but lacked pluripotency-associated Oct4 mRNA and protein. The Sox17-expressing cells showed downregulation of extraembryonic endoderm (Sox7, Afp, Sdf1)-, mesoderm (Foxf1, Meox1)- and ectoderm (Pax6, NeuroD6)-specific transcripts. The presence of Hnf4α, Hes1 and Pdx1 mRNA demonstrated the expression of primitive gut/foregut cell-specific markers. Ngn3, Nkx6.1 and Nkx2.2 transcripts in Sox17-positive cells were determined as properties of pancreatic endocrine progenitors. Immunocytochemistry of activin A-induced Sox17-positive embryoid bodies revealed coexpression of Cxcr4 and Foxa2. Moreover, the histochemical demonstration of E-cadherin-, Cxcr4-, Sox9-, Hnf1β- and Ngn3-positive epithelial-like structures underlined the potential of Sox17-positive cells to further differentiate into the pancreatic lineage. By reducing the heterogeneity of the ES cell progeny, Sox17-expressing cells are a suitable model to evaluate the effects of growth and differentiation factors and of culture conditions to delineate the differentiation process for the generation of pancreatic cells in vitro.

  17. ADAM17 deletion in thymic epithelial cells alters aire expression without affecting T cell developmental progression.

    Directory of Open Access Journals (Sweden)

    David M Gravano

    Full Text Available BACKGROUND: Cellular interactions between thymocytes and thymic stromal cells are critical for normal T cell development. Thymic epithelial cells (TECs are important stromal niche cells that provide essential growth factors, cytokines, and present self-antigens to developing thymocytes. The identification of genes that mediate cellular crosstalk in the thymus is ongoing. One candidate gene, Adam17, encodes a metalloprotease that functions by cleaving the ectodomain of several transmembrane proteins and regulates various developmental processes. In conventional Adam17 knockout mice, a non-cell autonomous role for ADAM17 in adult T cell development was reported, which strongly suggested that expression of ADAM17 in TECs was required for normal T cell development. However, knockdown of Adam17 results in multisystem developmental defects and perinatal lethality, which has made study of the role of Adam17 in specific cell types difficult. Here, we examined T cell and thymic epithelial cell development using a conditional knockout approach. METHODOLOGY/PRINCIPAL FINDINGS: We generated an Adam17 conditional knockout mouse in which floxed Adam17 is deleted specifically in TECs by Cre recombinase under the control of the Foxn1 promoter. Normal T cell lineage choice and development through the canonical αβ T cell stages was observed. Interestingly, Adam17 deficiency in TECs resulted in reduced expression of the transcription factor Aire. However, no alterations in the patterns of TEC phenotypic marker expression and thymus morphology were noted. CONCLUSIONS/SIGNIFICANCE: In contrast to expectation, our data clearly shows that absence of Adam17 in TECs is dispensable for normal T cell development. Differentiation of TECs is also unaffected by loss of Adam17 based on phenotypic markers. Surprisingly, we have uncovered a novel genetic link between Adam17and Aire expression in vivo. The cell type in which ADAM17 mediates its non-cell autonomous impact and

  18. Discrimination of meniscal cell phenotypes using gene expression profiles

    Directory of Open Access Journals (Sweden)

    M Son

    2012-03-01

    Full Text Available The lack of quantitative and objective metrics to assess cartilage and meniscus cell phenotypes contributes to the challenges in fibrocartilage tissue engineering. Although functional assessment of the final resulting tissue is essential, initial characterization of cell sources and quantitative description of their progression towards the natural, desired cell phenotype would provide an effective tool in optimizing cell-based tissue engineering strategies. The purpose of this study was to identify quantifiable characteristics of meniscal cells and thereby find phenotypical markers that could effectively categorize cells based on their tissue of origin (cartilage, inner, middle, and outer meniscus. The combination of gene expression ratios collagen VI/collagen II, ADAMTS-5/collagen II, and collagen I/collagen II was the most effective indicator of variation among different tissue regions. We additionally demonstrate a possible application of these quantifiable metrics in evaluating the use of serially passaged chondrocytes as a possible cell source in fibrocartilage engineering. Comparing the ratios of the passaged chondrocytes and the native meniscal cells may provide direction to optimize towards the desired cell phenotype. We have thus shown that measurable markers defining the characteristics of the native meniscus can establish a standard by which different tissue engineering strategies can be objectively assessed. Such metrics could additionally be useful in exploring the different stages of meniscal degradation in osteoarthritis and provide some insight in the disease progression.

  19. Expression of cubilin in mouse testes and Leydig cells.

    Science.gov (United States)

    Oh, Y S; Seo, J T; Ahn, H S; Gye, M C

    2016-04-01

    Cubilin (cubn) is a receptor for vitamins and various protein ligands. Cubn lacks a transmembrane domain but anchors to apical membranes by forming complexes with Amnionless or Megalin. In an effort to better understand the uptake of nutrients in testis, we analysed cubn expression in the developing mice testes. In testes, cubn mRNA increased from birth to adulthood. In the inter-stitium and isolated seminiferous tubules, neonatal increase in cubn mRNA until 14 days post-partum (pp) was followed by a marked increase at puberty (28 days pp). Cubn was found in the gonocytes, spermatogonia, spermatocytes and spermatids in the developing testes. In adult testes, strong Cubn immunoreactivity was found in the elongating spermatids, suggesting the role of Cubn in endocytosis during early spermiogenesis. In Sertoli cells and peritubular cells, Cubn immunoreactivity was weak throughout the testis development. In the inter-stitium, Cubn immunoreactivity was found in foetal Leydig cells, was weak to negligible in the stem cells and progenitor Leydig cells and was strong in immature and adult Leydig cells, demonstrating a positive association between Cubn and steroidogenic activity of Leydig cells. Collectively, these results suggest that Cubn may participate in the endocytotic uptake of nutrients in germ cells and somatic cells, supporting the spermatogenesis and steroidogenesis in mouse testes.

  20. Expression of activated Ras during Dictyostelium development alters cell localization and changes cell fate.

    Science.gov (United States)

    Jaffer, Z M; Khosla, M; Spiegelman, G B; Weeks, G

    2001-03-01

    There is now a body of evidence to indicate that Ras proteins play important roles in development. Dictyostelium expresses several ras genes and each appears to perform a distinct function. Previous data had indicated that the overexpression of an activated form of the major developmentally regulated gene, rasD, caused a major aberration in morphogenesis and cell type determination. We now show that the developmental expression of an activated rasG gene under the control of the rasD promoter causes a similar defect. Our results indicate that the expression of activated rasG in prespore cells results in their transdifferentiation into prestalk cells, whereas activated rasG expression in prestalk causes gross mislocalization of the prestalk cell populations.

  1. Chondrogenic differentiation and lubricin expression of caprine infraspinatus tendon cells.

    Science.gov (United States)

    Funakoshi, Tadanao; Spector, Myron

    2010-06-01

    Reparative strategies for the treatment of injuries to tendons, including those of the rotator cuff of the shoulder, need to address the formation of the cartilage which serves as the attachment apparatus to bone and which forms at regions undergoing compressive loading. Moreover, recent work indicates that cells employed for rotator cuff repair may need to synthesize a lubricating glycoprotein, lubricin, which has recently been found to play a role in tendon tribology. The objective of the present study was to investigate the chondrogenic differentiation and lubricin expression of caprine infraspinatus tendon cells in monolayer and three-dimensional culture, and to compare the behavior with bone marrow-derived mesenchymal stem cells (MSCs). The results demonstrated that while tendon cells in various media, including chondrogenic medium, expressed lubricin, virtually none of the MSCs synthesized this important lubricating molecule. Also of interest was that the cartilage formation capacity of the tendon cells grown in pellet culture in chondrogenic medium was comparable with MSCs. These data inform the use of tendon cells for rotator cuff repair, including for fibrocartilaginous zones.

  2. Immortalized bovine mammary epithelial cells express stem cell markers and differentiate in vitro.

    Science.gov (United States)

    Hu, Han; Zheng, Nan; Gao, Haina; Dai, Wenting; Zhang, Yangdong; Li, Songli; Wang, Jiaqi

    2016-08-01

    The bovine mammary epithelial cell is a secretory cell, and its cell number and secretory activity determine milk production. In this study, we immortalized a bovine mammary epithelial cell line by SV40 large T antigen gene using a retrovirus based on Chinese Holstein primary mammary epithelial cells (CMEC) cultured in vitro. An immortalized bovine mammary epithelial cell line surpassed the 50-passage mark and was designated the CMEC-H. The immortalized mammary epithelial cells grew in close contact with each other and exhibited the typical cobblestone morphology characteristic with obvious boundaries. The telomerase expression of CMEC-H has consistently demonstrated the presence of telomerase activity as an immortalized cell line, but the cell line never induced tumor formation in nude mice. CMEC-H expressed epithelial (cytokeratins CK7, CK8, CK18, and CK19), mesenchymal (vimentin), and stem/progenitor (CD44 and p63) cell markers. The induced expression of milk proteins, αS1 -casein, β-casein, κ-casein, and butyrophilin, indicated that CMEC-H maintained the synthesis function of the mammary epithelial cells. The established immortalized bovine mammary epithelial cell line CMEC-H is capable of self-renewal and differentiation and can serve as a valuable reagent for studying the physiological mechanism of the mammary gland.

  3. Arsenic Trioxide Inhibits Proliferation in K562 Cells by Changing Cell Cycle and Survivin Expression

    Institute of Scientific and Technical Information of China (English)

    伍晓菲; 陈智超; 刘仲萍; 周浩; 游泳; 黎纬明; 邹萍

    2004-01-01

    To study the mechanisms involved in the inhibition of chronic myeloid leukemic cells (K562) proliferation induced by arsenic trioxide (As2O3) and to explore the potential role of Survivin, an inhibitor of apoptosis protein, in the regulation of As2O3 induced cell apoptosis, K562 cells were cultured with As2O3 of different concentrations. Cells were collected for proliferation analysis by MTT assay. Cell cycle distribution and cell apoptosis were analyzed by flow cytometry.Expression of Survivin protein and mRNA were detected by flow cytometry and RT-PCR, respectively. Our results showed that As2O3 (2-10 μmol/L) inhibited K562 cells growth effectively, but it did not induce cells apoptosis significantly. The percentage of K562 cells at G2/M phase increased in proportion to As2O3 concentrations, and the expression of Survivin mRNA and content of Survivin protein was up-regulated accordingly. It is concluded that As2 O3 inhibited K562 cells growth by inducing cell cycle arrest mainly at G2/M phase. Over-expression of Survivin gene and protein might be one of the possible mechanisms contributing to K562 cells' resistance to As2O3-induced apoptosis.

  4. Expression of basement membrane antigens in spindle cell melanoma.

    Science.gov (United States)

    Prieto, V G; Woodruff, J M

    1998-07-01

    Spindle cell melanoma (SCM) is an uncommon form of melanoma that may be confused histologically with other tumors, including malignant peripheral nerve sheath tumors (MPNST). Tumors with neural differentiation and melanocytic nevi may both show basement membrane immunohistochemically and at the ultrastructural level. However, most ultrastructural studies of melanoma have failed to demonstrate well formed basement membrane around tumor cells. The presence of basement membrane has been used by some authors as evidence favoring MPNST, as opposed to SCM. To evaluate this distinction immunohistochemically, 22 primary and metastatic cutaneous melanomas having a spindle cell component (SCM) were studied using monoclonal antibodies against laminin and Type IV collagen. S100 protein and HMB45 antigen expression were also studied. All but one of the SCM were reactive for S100 protein in at least 25% of the cells. Thirteen of 20 tumors (65%) were focally reactive with HMB45. Laminin was expressed in 42% of the tumors (only membranous pattern in 3; cytoplasmic and membranous in 5). Seventeen tumors (77%) expressed type IV collagen (only membranous pattern in 7; cytoplasmic and membranous pattern in 10). Laminin and type IV collagen, known components of basement membrane, are often found in SCM. Therefore, their detection cannot be used to distinguish SCM from MPNST.

  5. Binary gene induction and protein expression in individual cells

    Directory of Open Access Journals (Sweden)

    Conolly Rory B

    2006-04-01

    Full Text Available Abstract Background Eukaryotic gene transcription is believed to occur in either a binary or a graded fashion. With binary induction, a transcription activator (TA regulates the probability with which a gene template is switched from the inactive to the active state without affecting the rate at which RNA molecules are produced from the template. With graded, also called rheostat-like, induction the gene template has continuously varying levels of transcriptional activity, and the TA regulates the rate of RNA production. Support for each of these two mechanisms arises primarily from experimental studies measuring reporter proteins in individual cells, rather than from direct measurement of induction events at the gene template. Methods and results In this paper, using a computational model of stochastic gene expression, we have studied the biological and experimental conditions under which a binary induction mode operating at the gene template can give rise to differentially expressed "phenotypes" (i.e., binary, hybrid or graded at the protein level. We have also investigated whether the choice of reporter genes plays a significant role in determining the observed protein expression patterns in individual cells, given the diverse properties of commonly-used reporter genes. Our simulation confirmed early findings that the lifetimes of active/inactive promoters and half-lives of downstream mRNA/protein products are important determinants of various protein expression patterns, but showed that the induction time and the sensitivity with which the expressed genes are detected are also important experimental variables. Using parameter conditions representative of reporter genes including green fluorescence protein (GFP and β-galactosidase, we also demonstrated that graded gene expression is more likely to be observed with GFP, a longer-lived protein with low detection sensitivity. Conclusion The choice of reporter genes may determine whether protein

  6. Mast cells express novel functional IL-15 receptor alpha isoforms.

    Science.gov (United States)

    Bulanova, Elena; Budagian, Vadim; Orinska, Zane; Krause, Hans; Paus, Ralf; Bulfone-Paus, Silvia

    2003-05-15

    Mast cells previously have been reported to be regulated by IL-15 and to express a distinct IL-15R, termed IL-15RX. To further examine IL-15 binding and signaling in mast cells, we have studied the nature of the IL-15R and some of its biological activities in these cells. In this study, we report the existence of three novel isoforms of the IL-15R alpha chain in murine bone marrow-derived mast cells as a result of an alternative exon-splicing mechanism within the IL-15R alpha gene. These correspond to new mRNA transcripts lacking exon 4; exons 3 and 4; or exons 3, 4, and 5 (IL-15R alpha Delta 4, IL-15R alpha Delta 3,4, IL-15R alpha Delta 3,4,5). After transient transfection in COS-7 cells, all IL-15R alpha isoforms associate with the Golgi apparatus, the endoplasmic reticulum, the perinuclear space, and the cell membrane. Analysis of glycosylation pattern demonstrates the usage of a single N-glycosylation site, while no O-glycosylation is observed. Importantly, IL-15 binds with high affinity to, and promotes the survival of, murine BA/F3 cells stably transfected with the IL-15R alpha isoforms. Furthermore, we report that signaling mediated by IL-15 binding to the newly identified IL-15R alpha isoforms involves the phosphorylation of STAT3, STAT5, STAT6, Janus kinase 2, and Syk kinase. Taken together, our data indicate that murine mast cells express novel, fully functional IL-15R alpha isoforms, which can explain the selective regulatory effects of IL-15 on these cells.

  7. Characterization of protocadherin-1 expression in primary bronchial epithelial cells : association with epithelial cell differentiation

    NARCIS (Netherlands)

    Koning, Henk; Sayers, Ian; Stewart, Ceri E.; de Jong, Debora; ten Hacken, Nick H. T.; Postma, Dirkje S.; van Oosterhout, Antoon J. M.; Nawijn, Martijn C.; Koppelman, Gerard H.

    2012-01-01

    Protocadherin-1 (PCDH1) is a novel susceptibility gene for asthma that is expressed in airway epithelium. We aimed to characterize PCDH1 mRNA transcripts and protein expression in primary bronchial epithelial cells and to determine regulation of PCDH1 during mucociliary differentiation. Total RNA an

  8. Phytoestrogens regulate the proliferation and expression of stem cell factors in cell lines of malignant testicular germ cell tumors.

    Science.gov (United States)

    Hasibeder, Astrid; Venkataramani, Vivek; Thelen, Paul; Radzun, Heinz-Joachim; Schweyer, Stefan

    2013-11-01

    Phytoestrogens have been shown to exert anti-proliferative effects on different cancer cells. In addition it could be demonstrated that inhibition of proliferation is associated with downregulation of the known stem cell factors NANOG, POU5F1 and SOX2 in tumor cells. We demonstrate the potential of Belamcanda chinensis extract (BCE) and tectorigenin as anticancer drugs in cell lines of malignant testicular germ cell tumor cells (TGCT) by inhibition of proliferation and regulating the expression of stem cell factors. The TGCT cell lines TCam-2 and NTera-2 were treated with BCE or tectorigenin and MTT assay was used to measure the proliferation of tumor cells. In addition, the expression of stem cell factors was analyzed by quantitative PCR and western blot analysis. Furthermore, global expression analysis was performed by microarray technique. BCE and tectorigenin inhibited proliferation and downregulated the stem cell factors NANOG and POU5F1 in TGCT cells. In addition, gene expression profiling revealed induction of genes important for the differentiation and inhibition of oncogenes. Utilizing connectivity map in an attempt to elucidate mechanism underlying BCE treatments we found highly positive association to histone deacetylase inhibitors (HDACi) amongst others. Causing no histone deacetylase inhibition, the effects of BCE on proliferation and stem cell factors may be based on histone-independent mechanisms such as direct hyperacetylation of transcription factors. Based on these findings, phytoestrogens may be useful as new agents in the treatment of TGCT.

  9. Inducible T-cell receptor expression in precursor T-cells for leukemia control

    Science.gov (United States)

    Hoseini, Shahabuddin S; Hapke, Martin; Herbst, Jessica; Wedekind, Dirk; Baumann, Rolf; Heinz, Niels; Schiedlmeier, Bernhard; Vignali, Dario AA; van den Brink, Marcel R.M.; Schambach, Axel; Blazar, Bruce R.; Sauer, Martin G.

    2015-01-01

    Co-transplantation of hematopoietic stem cells with those engineered to express leukemia-reactive T cell receptors (TCRs) and differentiated ex vivo into precursor T cells (preTs) may reduce the risk of leukemia relapse. Since expression of potentially self-(leukemia-) reactive TCRs will lead to negative selection or provoke autoimmunity upon thymic maturation, we investigated a novel concept whereby TCR expression set under the control of an inducible promoter would allow timely controlled TCR expression. After in vivo maturation and gene induction, preTs developed potent anti-leukemia effects. Engineered preTs provided protection even after repeated leukemia challenges by giving rise to effector and central memory cells. Importantly, adoptive transfer of TCR-transduced allogeneic preTs mediated anti-leukemia effect without evoking graft-versus-host disease (GVHD). Earlier transgene induction forced CD8+ T cell development, was required to obtain a mature T cell subset of targeted specificity, allowed engineered T cells to efficiently pass positive selection and abrogated the endogenous T cell repertoire. Later induction favored CD4 differentiation and failed to produce a leukemia-reactive population emphasizing the dominant role of positive selection. Taken together, we provide new functional insights for the employment of TCR-engineered precursor cells as a controllable immunotherapeutic modality with significant anti-leukemia activity. PMID:25652739

  10. Gene expression profiles of human bone marrow derived mesenchymal stem cells and tendon cells

    Institute of Scientific and Technical Information of China (English)

    胡庆柳; 朴英杰; 邹飞

    2003-01-01

    Objective To study the gene expression profiles of human bone marrow derived mesenchymal stem cells and tendon cells.Methods Total RNA extracted from human bone marrow derived mesenchymal stem cells and tendon cells underwent reverse transcription, and the products were labeled with α-32P dCTP. The cDNA probes of total RNA were hybridized to cDNA microarray with 1176 genes, and then the signals were analyzed by AtlasImage analysis software Version 1.01a.Results Fifteen genes associated with cell proliferation and signal transduction were up-regulated, and one gene that takes part in cell-to-cell adhesion was down-regulated in tendon cells.Conclusion The 15 up-regulated and one down-regulated genes may be beneficial to the orientational differentiation of mesenchymal stem cells into tendon cells.

  11. Liver-specific gene expression in mesenchymal stem cells is induced by liver cells

    Institute of Scientific and Technical Information of China (English)

    Claudia Lange; Philipp Bassler; Michael V. Lioznov; Helge Bruns; Dietrich Kluth; Axel R. Zander; Henning C. Fiegel

    2005-01-01

    AIM: The origin of putative liver cells from distinct bone marrow stem cells, e.g. hematopoietic stem cells or multipotent adult progenitor cells was found in recent in vitro studies. Cell culture experiments revealed a key role of growth factors for the induction of liver-specific genes in stem cell cultures. We investigated the potential of rat mesenchymal stem cells (MSC) from bone marrow to differentiate into hepatocytic cells in vitro. Furthermore,we assessed the influence of cocultured liver cells on induction of liver-specific gene expression.METHODS: Mesenchymal stem cells were marked with green fluorescent protein (GFP) by retroviral gene transduction. Clonal marked MSC were either cultured under liver stimulating conditions using fibronectin-coated culture dishes and medium supplemented with SCF, HGF,EGF, and FGF-4 alone, or in presence of freshly isolated rat liver cells. Cells in cocultures were harvested and GFP+ or GFP- cells were separated using fluorescence activated cell sorting. RT-PCR analysis for the stem cell marker Thy1 and the hepatocytic markers CK-18, albumin, CK-19,and AFP was performed in the different cell populations.RESULTS: Under the specified culture conditions, rat MSC cocultured with liver cells expressed albumin-, CK-18,CK-19, and AFP-RNA over 3 weeks, whereas MSC cultured alone did not show liver specific gene expression.CONCLUSION: The results indicate that (1) rat MSC from bone marrow can differentiate towards hepatocytic lineage in vitro, and (2) that the microenvironment plays a decisive role for the induction of hepatic differentiation of rMSC.

  12. Induction of T Cell Development In Vitro by Delta-Like (Dll)-Expressing Stromal Cells.

    Science.gov (United States)

    Mohtashami, Mahmood; Zarin, Payam; Zúñiga-Pflücker, Juan Carlos

    2016-01-01

    Recreating the thymic microenvironment in vitro poses a great challenge to immunologists. Until recently, the only approach was to utilize the thymic tissue in its three-dimensional form and to transfer the hematopoietic progenitors into this tissue to generate de novo T cells. With the advent of OP9-DL cells (bone marrow-derived cells that are transduced to express Notch ligand, Delta-like), hematopoietic stem cells (HSC) could be induced to differentiate into T cells in culture for the first time outside of the thymic tissue on a monolayer. We, as well as others, asked whether the ability to support T cell development in vitro in a monolayer is unique to BM-derived OP9 cells, and showed that provision of Delta-like expression to thymic epithelial cells and fibroblasts also allowed for T cell development. This provides the opportunity to design an autologous coculture system where the supportive stromal and the hematopoietic components are both derived from the same individual, which has obvious clinical implications. In this chapter, we describe methods for establishing a primary murine dermal fibroblast cell population that is transduced to express Delta-like 4, and describe the conditions for its coculture with HSCs to support T cell lineage initiation and expansion, while comparing it to the now classic OP9-DL coculture.

  13. Human fetal liver stromal cells expressing erythropoietin promote hematopoietic development from human embryonic stem cells.

    Science.gov (United States)

    Yang, Chao; Ji, Lei; Yue, Wen; Shi, Shuang-Shuang; Wang, Ruo-Yong; Li, Yan-Hua; Xie, Xiao-Yan; Xi, Jia-Fei; He, Li-Juan; Nan, Xue; Pei, Xue-Tao

    2012-02-01

    Blood cells transfusion and hematopoietic stem cells (HSCs) transplantation are important methods for cell therapy. They are widely used in the treatment of incurable hematological disorder, infectious diseases, genetic diseases, and immunologic deficiency. However, their availability is limited by quantity, capacity of proliferation and the risk of blood transfusion complications. Recently, human embryonic stem cells (hESCs) have been shown to be an alternative resource for the generation of hematopoietic cells. In the current study, we describe a novel method for the efficient production of hematopoietic cells from hESCs. The stable human fetal liver stromal cell lines (hFLSCs) expressing erythropoietin (EPO) were established using the lentiviral system. We observed that the supernatant from the EPO transfected hFLSCs could induce the hESCs differentiation into hematopoietic cells, especially erythroid cells. They not only expressed fetal and embryonic globins but also expressed the adult-globin chain on further maturation. In addition, these hESCs-derived erythroid cells possess oxygen-transporting capacity, which indicated hESCs could generate terminally mature progenies. This should be useful for ultimately developing an animal-free culture system to generate large numbers of erythroid cells from hESCs and provide an experimental model to study early human erythropoiesis.

  14. PAX2 regulates ADAM10 expression and mediates anchorage-independent cell growth of melanoma cells.

    Directory of Open Access Journals (Sweden)

    Sophia Boyoung Lee

    Full Text Available PAX transcription factors play an important role during development and carcinogenesis. In this study, we investigated PAX2 protein levels in melanocytes and melanoma cells by Western Blot and immunofluorescence analysis and characterized the role of PAX2 in the pathogenesis of melanoma. In vitro we found weak PAX2 protein expression in keratinocytes and melanocytes. Compared to melanocytes increased PAX2 protein levels were detectable in melanoma cell lines. Interestingly, in tissue sections of melanoma patients nuclear PAX2 expression strongly correlated with nuclear atypia and the degree of prominent nucleoli, indicating an association of PAX2 with a more atypical cellular phenotype. In addition, with chromatin immunoprecipitation assay, PAX2 overexpression and PAX2 siRNA we present compelling evidence that PAX2 can regulate ADAM10 expression, a metalloproteinase known to play important roles in melanoma metastasis. In human tissue samples we found co-expression of PAX2 and ADAM10 in melanocytes of benign nevi and in melanoma cells of patients with malignant melanoma. Importantly, the downregulation of PAX2 by specific siRNA inhibited the anchorage independent cell growth and decreased the migratory and invasive capacity of melanoma cells. Furthermore, the downregulation of PAX2 abrogated the chemoresistance of melanoma cells against cisplatin, indicating that PAX2 expression mediates cell survival and plays important roles during melanoma progression.

  15. Trichostatin A Regulates hGCN5 Expression and Cell Cycle on Daudi Cells in vitro

    Institute of Scientific and Technical Information of China (English)

    LIU Hongli; CHEN Yan; CUI Guohui; WU Gang; WANG Tao; HU Jianli

    2006-01-01

    The expression of human general control of amino acid synthesis protein 5 (hGCN5) in human Burkitt's lymphoma Daudi cells in vitro, effects of Trichostatin A (TSA) on cell proliferation and apoptosis and the molecular mechanism of TSA inhibiting proliferation of Daudi cells were investigated. The effects of TSA on the growth of Daudi cells were studied by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium (MTT) assay. The effect of TSA on the cell cycle of Daudi cells was assayed by a propidium iodide method. Immunochemistry and Western blot were used to detect the expression of hGCN5. The proliferation of Daudi cells was decreased in TSA-treated group with a 24 h IC50 value of 415.3979 μg/L. TSA induced apoptosis of Daudi cells in a time- and dose-dependent manner. Treatment with TSA (200 and 400 μg/L) for 24 h, the apoptosis rates of Daudi cells were (14.74±2.04) % and (17.63±1.25) %, respectively. The cell cycle was arrested in G0/G1 phase (50, 100 μtg/L) and in G2/M phase (200 μg/L) by treatment with TSA for 24 h.The expression of hGCN5 protein in Daudi cells was increased in 24 h TSA-treated group by immunochemistry and Western blot (P<0.05). It was suggested that TSA as HDACIs could increase the expression of hGCN5 in Daudi cells, and might play an important role in regulating the proliferation and apoptosis of B-NHL cell line Daudi cells.

  16. Impact of methoxyacetic acid on mouse Leydig cell gene expression

    Directory of Open Access Journals (Sweden)

    Waxman David J

    2010-06-01

    Full Text Available Abstract Background Methoxyacetic acid (MAA is the active metabolite of the widely used industrial chemical ethylene glycol monomethyl ether, which is associated with various developmental and reproductive toxicities, including neural toxicity, blood and immune disorders, limb degeneration and testicular toxicity. Testicular toxicity is caused by degeneration of germ cells in association with changes in gene expression in both germ cells and Sertoli cells of the testis. This study investigates the impact of MAA on gene expression in testicular Leydig cells, which play a critical role in germ cell survival and male reproductive function. Methods Cultured mouse TM3 Leydig cells were treated with MAA for 3, 8, and 24 h and changes in gene expression were monitored by genome-wide transcriptional profiling. Results A total of 3,912 MAA-responsive genes were identified. Ingenuity Pathway analysis identified reproductive system disease, inflammatory disease and connective tissue disorder as the top biological functions affected by MAA. The MAA-responsive genes were classified into 1,366 early responders, 1,387 mid-responders, and 1,138 late responders, based on the time required for MAA to elicit a response. Analysis of enriched functional clusters for each subgroup identified 106 MAA early response genes involved in transcription regulation, including 32 genes associated with developmental processes. 60 DNA-binding proteins responded to MAA rapidly but transiently, and may contribute to the downstream effects of MAA seen for many mid and late response genes. Genes within the phosphatidylinositol/phospholipase C/calcium signaling pathway, whose activity is required for potentiation of nuclear receptor signaling by MAA, were also enriched in the set of early MAA response genes. In contrast, many of the genes responding to MAA at later time points encode membrane proteins that contribute to cell adhesion and membrane signaling. Conclusions These findings

  17. Expression of human adenosine deaminase in murine hematopoietic cells.

    Science.gov (United States)

    Belmont, J W; MacGregor, G R; Wager-Smith, K; Fletcher, F A; Moore, K A; Hawkins, D; Villalon, D; Chang, S M; Caskey, C T

    1988-01-01

    Multiple replication-defective retrovirus vectors were tested for their ability to transfer and express human adenosine deaminase in vitro and in vivo in a mouse bone marrow transplantation model. High-titer virus production was obtained from vectors by using both a retrovirus long terminal repeat promoter and internal transcriptional units with human c-fos and herpes virus thymidine kinase promoters. After infection of primary murine bone marrow with one of these vectors, human adenosine deaminase was detected in 60 to 85% of spleen colony-forming units and in the blood of 14 of 14 syngeneic marrow transplant recipients. This system offers the opportunity to assess methods for increasing efficiency of gene transfer, for regulation of expression of foreign genes in hematopoietic progenitors, and for long-term measurement of the stability of expression in these cells. Images PMID:3072474

  18. CXCL12 expression by healthy and malignant ovarian epithelial cells

    Directory of Open Access Journals (Sweden)

    Emilie Dominique

    2011-03-01

    Full Text Available Abstract Background CXCL12 has been widely reported to play a biologically relevant role in tumor growth and spread. In epithelial ovarian cancer (EOC, CXCL12 enhances tumor angiogenesis and contributes to the immunosuppressive network. However, its prognostic significance remains unclear. We thus compared CXCL12 status in healthy and malignant ovaries, to assess its prognostic value. Methods Immunohistochemistry was used to analyze CXCL12 expression in the reproductive tracts, including the ovaries and fallopian tubes, of healthy women, in benign and borderline epithelial tumors, and in a series of 183 tumor specimens from patients with advanced primary EOC enrolled in a multicenter prospective clinical trial of paclitaxel/carboplatin/gemcitabine-based chemotherapy (GINECO study. Univariate COX model analysis was performed to assess the prognostic value of clinical and biological variables. Kaplan-Meier methods were used to generate progression-free and overall survival curves. Results Epithelial cells from the surface of the ovary and the fallopian tubes stained positive for CXCL12, whereas the follicles within the ovary did not. Epithelial cells in benign, borderline and malignant tumors also expressed CXCL12. In EOC specimens, CXCL12 immunoreactivity was observed mostly in epithelial tumor cells. The intensity of the signal obtained ranged from strong in 86 cases (47% to absent in 18 cases ( Conclusion Our findings highlight the previously unappreciated constitutive expression of CXCL12 on healthy epithelia of the ovary surface and fallopian tubes, indicating that EOC may originate from either of these epithelia. We reveal that CXCL12 production by malignant epithelial cells precedes tumorigenesis and we confirm in a large cohort of patients with advanced EOC that CXCL12 expression level in EOC is not a valuable prognostic factor in itself. Trial Registration ClinicalTrials.gov: NCT00052468

  19. Mural granulosa cell gene expression associated with oocyte developmental competence

    Directory of Open Access Journals (Sweden)

    Jiang Jin-Yi

    2010-03-01

    Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

  20. Interfacial polymerization for colorimetric labeling of protein expression in cells.

    Directory of Open Access Journals (Sweden)

    Jacob L Lilly

    Full Text Available Determining the location of rare proteins in cells typically requires the use of on-sample amplification. Antibody based recognition and enzymatic amplification is used to produce large amounts of visible label at the site of protein expression, but these techniques suffer from the presence of nonspecific reactivity in the biological sample and from poor spatial control over the label. Polymerization based amplification is a recently developed alternative means of creating an on-sample amplification for fluorescence applications, while not suffering from endogenous labels or loss of signal localization. This manuscript builds upon polymerization based amplification by developing a stable, archivable, and colorimetric mode of amplification termed Polymer Dye Labeling. The basic concept involves an interfacial polymer grown at the site of protein expression and subsequent staining of this polymer with an appropriate dye. The dyes Evans Blue and eosin were initially investigated for colorimetric response in a microarray setting, where both specifically stained polymer films on glass. The process was translated to the staining of protein expression in human dermal fibroblast cells, and Polymer Dye Labeling was specific to regions consistent with desired protein expression. The labeling is stable for over 200 days in ambient conditions and is also compatible with modern mounting medium.

  1. Interfacial polymerization for colorimetric labeling of protein expression in cells.

    Science.gov (United States)

    Lilly, Jacob L; Sheldon, Phillip R; Hoversten, Liv J; Romero, Gabriela; Balasubramaniam, Vivek; Berron, Brad J

    2014-01-01

    Determining the location of rare proteins in cells typically requires the use of on-sample amplification. Antibody based recognition and enzymatic amplification is used to produce large amounts of visible label at the site of protein expression, but these techniques suffer from the presence of nonspecific reactivity in the biological sample and from poor spatial control over the label. Polymerization based amplification is a recently developed alternative means of creating an on-sample amplification for fluorescence applications, while not suffering from endogenous labels or loss of signal localization. This manuscript builds upon polymerization based amplification by developing a stable, archivable, and colorimetric mode of amplification termed Polymer Dye Labeling. The basic concept involves an interfacial polymer grown at the site of protein expression and subsequent staining of this polymer with an appropriate dye. The dyes Evans Blue and eosin were initially investigated for colorimetric response in a microarray setting, where both specifically stained polymer films on glass. The process was translated to the staining of protein expression in human dermal fibroblast cells, and Polymer Dye Labeling was specific to regions consistent with desired protein expression. The labeling is stable for over 200 days in ambient conditions and is also compatible with modern mounting medium.

  2. Effect of Cell Adhesion Molecule 1 Expression on Intracellular Granule Movement in Pancreatic α Cells.

    Science.gov (United States)

    Yokawa, Satoru; Furuno, Tadahide; Suzuki, Takahiro; Inoh, Yoshikazu; Suzuki, Ryo; Hirashima, Naohide

    2016-09-01

    Although glucagon secreted from pancreatic α cells plays a role in increasing glucose concentrations in serum, the mechanism regulating glucagon secretion from α cells remains unclear. Cell adhesion molecule 1 (CADM1), identified as an adhesion molecule in α cells, has been reported not only to communicate among α cells and between nerve fibers, but also to prevent excessive glucagon secretion from α cells. Here, we investigated the effect of CADM1 expression on the movement of intracellular secretory granules in α cells because the granule transport is an important step in secretion. Spinning disk microscopic analysis showed that granules moved at a mean velocity of 0.236 ± 0.010 μm/s in the mouse α cell line αTC6 that expressed CADM1 endogenously. The mean velocity was significantly decreased in CADM1-knockdown (KD) cells (mean velocity: 0.190 ± 0.016 μm/s). The velocity of granule movement decreased greatly in αTC6 cells treated with the microtubule-depolymerizing reagent nocodazole, but not in αTC6 cells treated with the actin-depolymerizing reagent cytochalasin D. No difference in the mean velocity was observed between αTC6 and CADM1-KD cells treated with nocodazole. These results suggest that intracellular granules in pancreatic α cells move along the microtubule network, and that CADM1 influences their velocity.

  3. Prostate stromal cells express the progesterone receptor to control cancer cell mobility.

    Directory of Open Access Journals (Sweden)

    Yue Yu

    Full Text Available BACKGROUND: Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood. METHODS: Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels. RESULTS: Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1 and interlukin-6 (IL-6 by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion. CONCLUSIONS: Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.

  4. Alterations in integrin expression modulates invasion of pancreatic cancer cells.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2009-01-01

    BACKGROUND: Factors mediating the invasion of pancreatic cancer cells through the extracellular matrix (ECM) are not fully understood. METHODS: In this study, sub-populations of the human pancreatic cancer cell line, MiaPaCa-2 were established which displayed differences in invasion, adhesion, anoikis, anchorage-independent growth and integrin expression. RESULTS: Clone #3 displayed higher invasion with less adhesion, while Clone #8 was less invasive with increased adhesion to ECM proteins compared to MiaPaCa-2. Clone #8 was more sensitive to anoikis than Clone #3 and MiaPaCa-2, and displayed low colony-forming efficiency in an anchorage-independent growth assay. Integrins beta 1, alpha 5 and alpha 6 were over-expressed in Clone #8. Using small interfering RNA (siRNA), integrin beta1 knockdown in Clone #8 cells increased invasion through matrigel and fibronectin, increased motility, decreased adhesion and anoikis. Integrin alpha 5 and alpha 6 knockdown also resulted in increased motility, invasion through matrigel and decreased adhesion. CONCLUSION: Our results suggest that altered expression of integrins interacting with different extracellular matrixes may play a significant role in suppressing the aggressive invasive phenotype. Analysis of these clonal populations of MiaPaCa-2 provides a model for investigations into the invasive properties of pancreatic carcinoma.

  5. Enteroendocrine cells are specifically marked by cell surface expression of claudin-4 in mouse small intestine.

    Directory of Open Access Journals (Sweden)

    Takahiro Nagatake

    Full Text Available Enteroendocrine cells are solitary epithelial cells scattered throughout the gastrointestinal tract and produce various types of hormones, constituting one of the largest endocrine systems in the body. The study of these rare epithelial cells has been hampered by the difficulty in isolating them because of the lack of specific cell surface markers. Here, we report that enteroendocrine cells selectively express a tight junction membrane protein, claudin-4 (Cld4, and are efficiently isolated with the use of an antibody specific for the Cld4 extracellular domain and flow cytometry. Sorted Cld4+ epithelial cells in the small intestine exclusively expressed a chromogranin A gene (Chga and other enteroendocrine cell-related genes (Ffar1, Ffar4, Gpr119, and the population was divided into two subpopulations based on the activity of binding to Ulex europaeus agglutinin-1 (UEA-1. A Cld4+UEA-1- cell population almost exclusively expressed glucose-dependent insulinotropic polypeptide gene (Gip, thus representing K cells, whereas a Cld4+UEA-1+ cell population expressed other gut hormone genes, including glucagon-like peptide 1 (Gcg, pancreatic polypeptide-like peptide with N-terminal tyrosine amide (Pyy, cholecystokinin (Cck, secretin (Sct, and tryptophan hydroxylase 1 (Tph1. In addition, we found that orally administered luminal antigens were taken up by the solitary Cld4+ cells in the small intestinal villi, raising the possibility that enteroendocrine cells might also play a role in initiation of mucosal immunity. Our results provide a useful tool for the cellular and functional characterization of enteroendocrine cells.

  6. Cell Sorting and Noise-Induced Cell Plasticity Coordinate to Sharpen Boundaries between Gene Expression Domains

    Science.gov (United States)

    2017-01-01

    A fundamental question in biology is how sharp boundaries of gene expression form precisely in spite of biological variation/noise. Numerous mechanisms position gene expression domains across fields of cells (e.g. morphogens), but how these domains are refined remains unclear. In some cases, domain boundaries sharpen through differential adhesion-mediated cell sorting. However, boundaries can also sharpen through cellular plasticity, with cell fate changes driven by up- or down-regulation of gene expression. In this context, we have argued that noise in gene expression can help cells transition to the correct fate. Here we investigate the efficacy of cell sorting, gene expression plasticity, and their combination in boundary sharpening using multi-scale, stochastic models. We focus on the formation of hindbrain segments (rhombomeres) in the developing zebrafish as an example, but the mechanisms investigated apply broadly to many tissues. Our results indicate that neither sorting nor plasticity is sufficient on its own to sharpen transition regions between different rhombomeres. Rather the two have complementary strengths and weaknesses, which synergize when combined to sharpen gene expression boundaries. PMID:28135279

  7. Differential expression and alternative splicing of cell cycle genes in imatinib-treated K562 cells.

    Science.gov (United States)

    Liu, Jing; Lin, Jin; Huang, Lin-Feng; Huang, Bo; Xu, Yan-Mei; Li, Jing; Wang, Yan; Zhang, Jing; Yang, Wei-Ming; Min, Qing-Hua; Wang, Xiao-Zhong

    2015-09-01

    Cancer progression often involves the disorder of the cell cycle, and a number of effective chemotherapeutic drugs have been shown to induce cell cycle arrest. The purpose of this study was to comprehensively investigate the effects of imatinib on the expression profile of cell cycle genes in the chronic myeloid leukemia (CML) K562 cell line. In addition, we also investigated alternative splicing of the cell cycle genes affected by imatinib, since an important relationship has been shown to exist between RNA splicing and cell cycle progression. Exon array analysis was performed using total RNA purified from normal and imatinib-treated K562 cells. We identified 185 differentially expressed genes and 277 alternative splicing events between the two cell groups. A detailed analysis by reverse transcription-PCR (RT-PCR) of key genes confirmed the experimental results of the exon array. These results suggested that treatment of K562 cells with imatinib shifts the expression and alternative splicing profiles of several cell cycle-related genes. Importantly, these findings may help improve imatinib treatment strategies in patients with CML and may be useful for imatinib resistance research and CML drug development.

  8. Expression

    Directory of Open Access Journals (Sweden)

    Wang-Xia Wang

    2014-02-01

    Full Text Available The miR-15/107 family comprises a group of 10 paralogous microRNAs (miRNAs, sharing a 5′ AGCAGC sequence. These miRNAs have overlapping targets. In order to characterize the expression of miR-15/107 family miRNAs, we employed customized TaqMan Low-Density micro-fluid PCR-array to investigate the expression of miR-15/107 family members, and other selected miRNAs, in 11 human tissues obtained at autopsy including the cerebral cortex, frontal cortex, primary visual cortex, thalamus, heart, lung, liver, kidney, spleen, stomach and skeletal muscle. miR-103, miR-195 and miR-497 were expressed at similar levels across various tissues, whereas miR-107 is enriched in brain samples. We also examined the expression patterns of evolutionarily conserved miR-15/107 miRNAs in three distinct primary rat brain cell preparations (enriched for cortical neurons, astrocytes and microglia, respectively. In primary cultures of rat brain cells, several members of the miR-15/107 family are enriched in neurons compared to other cell types in the central nervous system (CNS. In addition to mature miRNAs, we also examined the expression of precursors (pri-miRNAs. Our data suggested a generally poor correlation between the expression of mature miRNAs and their precursors. In summary, we provide a detailed study of the tissue and cell type-specific expression profile of this highly expressed and phylogenetically conserved family of miRNA genes.

  9. Long noncoding RNA FGFR3-AS1 promotes osteosarcoma growth through regulating its natural antisense transcript FGFR3.

    Science.gov (United States)

    Sun, Jiabing; Wang, Xuming; Fu, Chunjiang; Wang, Xiaoyu; Zou, Jilong; Hua, Hanbing; Bi, Zhenggang

    2016-05-01

    Long noncoding RNAs (lncRNAs), a new class of RNAs with no protein-coding potential, have been reported to have crucial roles in the regulation of a variety of tumors. However, the functions and molecular mechanisms of lncRNAs to osteosarcoma are still largely unknown. The purpose of this study is to examine the expression, functions and molecular mechanisms of a new lncRNA FGFR3 antisense transcript 1 (FGFR3-AS1) in osteosarcoma. The expression of FGFR3-AS1 was examined by real-time quantitative PCR. The regulation of FGFR3 by FGFR3-AS1 was examined by RNase protection assay, real-time quantitative PCR, western blotting, and luciferase reporter assay. The effects of FGFR3-AS1 on osteosarcoma cell proliferation and cell cycle were determined by Cell Counting Kit-8, Ethynyl deoxyuridine incorporation assay and flow cytometry. FGFR3-AS1 was upregulated in osteosarcoma. Increased FGFR3-AS1 expression correlates with large tumor size, advanced Enneking stage, metastasis and poor survival. Through antisense pairing with FGFR3 3'UTR, FGFR3-AS1 increases FGFR3 mRNA stability and upregulates FGFR3 expression. The expression of FGFR3-AS1 and FGFR3 is positively correlated in osteosarcoma tissues. Knockdown of FGFR3-AS1 inhibits the proliferation and cell cycle progression of osteosarcoma cells in vitro. Moreover, knockdown of FGFR3-AS1 inhibits xenograft tumor growth of osteosarcoma cells in vivo. These data demonstrate the mechanisms of how antisense noncoding RNA regulate the expression of sense genes, and show the pivotal functions of FGFR3-AS1 in osteosarcoma.

  10. Mutational study of sapovirus expression in insect cells

    Directory of Open Access Journals (Sweden)

    Natori Katsuro

    2005-02-01

    Full Text Available Abstract Human sapovirus (SaV, an agent of human gastroenteritis, cannot be grown in cell culture, but expression of the recombinant capsid protein (rVP1 in a baculovirus expression system results in the formation of virus-like particles (VLPs. In this study we compared the time-course expression of two different SaV rVP1 constructs. One construct had the native sequence (Wt construct, whereas the other had two nucleotide point mutations in which one mutation caused an amino acid substitution and one was silent (MEG-1076 construct. While both constructs formed VLPs morphologically similar to native SaV, Northern blot analysis indicated that the MEG-1076 rVP1 mRNA had increased steady-state levels. Furthermore, Western blot analysis and an antigen enzyme-linked immunosorbent assay showed that the MEG-1076 construct had increased expression levels of rVP1 and yields of VLPs. Interestingly, the position of the mutated residue was strictly conserved residue among other human SaV strains, suggesting an important role for rVP1 expression.

  11. Single-Cell RNA Sequencing Identifies Extracellular Matrix Gene Expression by Pancreatic Circulating Tumor Cells

    Directory of Open Access Journals (Sweden)

    David T. Ting

    2014-09-01

    Full Text Available Circulating tumor cells (CTCs are shed from primary tumors into the bloodstream, mediating the hematogenous spread of cancer to distant organs. To define their composition, we compared genome-wide expression profiles of CTCs with matched primary tumors in a mouse model of pancreatic cancer, isolating individual CTCs using epitope-independent microfluidic capture, followed by single-cell RNA sequencing. CTCs clustered separately from primary tumors and tumor-derived cell lines, showing low-proliferative signatures, enrichment for the stem-cell-associated gene Aldh1a2, biphenotypic expression of epithelial and mesenchymal markers, and expression of Igfbp5, a gene transcript enriched at the epithelial-stromal interface. Mouse as well as human pancreatic CTCs exhibit a very high expression of stromal-derived extracellular matrix (ECM proteins, including SPARC, whose knockdown in cancer cells suppresses cell migration and invasiveness. The aberrant expression by CTCs of stromal ECM genes points to their contribution of microenvironmental signals for the spread of cancer to distant organs.

  12. Analysis of the CD161-expressing cell quantities and CD161 expression levels in peripheral blood natural killer and T cells of systemic lupus erythematosus patients.

    Science.gov (United States)

    Lin, Yi-Lung; Lin, Shih-Chang

    2017-02-01

    Expressed on the cell surface of most of NK cells and some T cells, CD161 has been shown to deliver inhibitory signal in human NK cells. To determine whether the CD161-expressing cell quantities and the cell surface expression levels of CD161 in NK and T cells were altered in systemic lupus erythematosus (SLE) patients, we analyzed the CD3, CD56 and CD161 expression patterns of peripheral blood lymphocytes by flow cytometric analysis to identify different NK and T cell subpopulations. The cell surface expression levels of CD161 were estimated by the mean florescence intensities (MFIs) of CD161. It was found that SLE patients had lower frequencies of CD161+CD56+CD3- and CD161+CD56+CD3+ cells among the lymphocyte population than normal controls, whereas the frequencies of CD161-CD56+CD3- and CD161+CD56-CD3+ cells were not statistically different between two groups. In addition, SLE patients also had decreased absolute counts of all CD161-expressing NK cells and T cells and had reduced frequencies of CD161+ cells in CD56+CD3-, CD56+CD3+ and CD56-CD3+ cell populations. Moreover, SLE patients had reduced MFIs of CD161 in CD161+CD56+CD3+ and CD161+CD56-CD3+, but not CD161+CD56+CD3-, cell populations. Our results indicated that CD161-expressing cell frequency and the CD161 expression levels were reduced in some NK and T cell subpopulations of SLE patients, suggesting possible important role of CD161 and CD161-expressing immune cells in the SLE pathogenesis.

  13. Expression of T cell factor-4 in non-small-cell lung cancer

    Institute of Scientific and Technical Information of China (English)

    LI Chun-yan; WANG Yan; CUI Ze-shi; WANG En-hua

    2005-01-01

    Background T cell factor- 4 (TCF- 4) plays an important role in development and carcinogenesis. Recently, the role of TCF- 4 has been described in colon cancer and other cancers. However, whether TCF- 4 plays a similar role in lung cancer is unknown. To answer this question, we studied the expression of TCF- 4 protein and mRNA in non-small-cell lung cancer (NSCLC) and the relation of TCF- 4 expression pattern to histological type and cell differentiation. Methods Tissue samples from sixty cases of pathologically diagnosed NSCLC and eight normal tissue samples were obtained between September 2001 and March 2003. Immunohistochemistry was used to investigate the distribution of TCF- 4 protein. The staining patterns of the tumors were divided into 4 categories: nuclear staining alone or nuclear staining greater than cytoplasmic staining; cytoplasmic staining or cytoplasmic staining greater than nuclear staining; equal nuclear and cytoplasmic staining; no nuclear staining or cytoplasmic staining. The integrated optical density (OD) values of all sections were analyzed by UIC MetaMorph image analysis software. The expression of TCF- 4 mRNA was detected by one-step reverse transcription-polymerase chain reaction (RT-PCR). The integrated density values of the PCR products were analyzed semi-quantitatively.Results Immunohistochemistry showed that there was no expression of TCF- 4 in normal tissue. However, TCF- 4 was expressed in 86.7% (52/60) of NSCLC samples, mainly in the nuclei of tumor cells. Furthermore, there was a significant difference in TCF- 4 localization patterns between squamous cell carcinomas and adenocarcinomas (P<0.05). The integrated OD values of TCF- 4 expression was significantly higher in tumors with moderate-poor cell differentiation than in well differentiated tumors (51.63±6.67 vs 46.13±12.31, P<0.01). There was no TCF- 4 mRNA expression in normal tissue. However, 63.9% (23/36) of carcinoma samples expressed TCF- 4 mRNA. TCF- 4 mRNA expression was

  14. Embryonic stem cell-derived microvesicles induce gene expression changes in Muller cells of the retina.

    Directory of Open Access Journals (Sweden)

    Diana Katsman

    Full Text Available Cell-derived microvesicles (MVs, recognized as important components of cell-cell communication, contain mRNAs, miRNAs, proteins and lipids and transfer their bioactive contents from parent cells to cells of other origins. We have studied the effect that MVs released from embryonic stem cells (ESMVs have on retinal progenitor Müller cells. Cultured human Müller cells were exposed to mouse ESMVs every 48 hours for a total of 9 treatments. Morphological changes were observed by light microscopy in the treated cells, which grew as individual heterogeneous cells, compared to the uniform, spindle-like adherent cellular sheets of untreated cells. ESMVs transferred to Müller cells embryonic stem cell (ESC mRNAs involved in the maintenance of pluripotency, including Oct4 and Sox2, and the miRNAs of the 290 cluster, important regulators of the ESC-specific cell cycle. Moreover, ESMV exposure induced up-regulation of the basal levels of endogenous human Oct4 mRNA in Müller cells. mRNA and miRNA microarrays of ESMV-treated vs. untreated Müller cells revealed the up-regulation of genes and miRNAs involved in the induction of pluripotency, cellular proliferation, early ocular genes and genes important for retinal protection and remodeling, as well as the down-regulation of inhibitory and scar-related genes and miRNAs involved in differentiation and cell cycle arrest. To further characterize the heterogeneous cell population of ESMV-treated Müller cells, their expression of retinal cell markers was compared to that in untreated control cells by immunocytochemistry. Markers for amacrine, ganglion and rod photoreceptors were present in treated but not in control Müller cells. Together, our findings indicate that ESMs induce de-differentiation and pluripotency in their target Müller cells, which may turn on an early retinogenic program of differentiation.

  15. Expression of stem cell markers in the human fetal kidney.

    Directory of Open Access Journals (Sweden)

    Sally Metsuyanim

    Full Text Available In the human fetal kidney (HFK self-renewing stem cells residing in the metanephric mesenchyme (MM/blastema are induced to form all cell types of the nephron till 34(th week of gestation. Definition of useful markers is crucial for the identification of HFK stem cells. Because wilms' tumor, a pediatric renal cancer, initiates from retention of renal stem cells, we hypothesized that surface antigens previously up-regulated in microarrays of both HFK and blastema-enriched stem-like wilms' tumor xenografts (NCAM, ACVRIIB, DLK1/PREF, GPR39, FZD7, FZD2, NTRK2 are likely to be relevant markers. Comprehensive profiling of these putative and of additional stem cell markers (CD34, CD133, c-Kit, CD90, CD105, CD24 in mid-gestation HFK was performed using immunostaining and FACS in conjunction with EpCAM, an epithelial surface marker that is absent from the MM and increases along nephron differentiation and hence can be separated into negative, dim or bright fractions. No marker was specifically localized to the MM. Nevertheless, FZD7 and NTRK2 were preferentially localized to the MM and emerging tubules (50% of HFK cells and predominantly co-express EpCAM(bright, indicating they are mostly markers of differentiation. Furthermore, localization of NCAM exclusively in the MM and in its nephron progenitor derivatives but also in stroma and the expression pattern of significantly elevated renal stem/progenitor genes Six2, Wt1, Cited1, and Sall1 in NCAM(+EpCAM(- and to a lesser extent in NCAM(+EpCAM(+ fractions confirmed regional identity of cells and assisted us in pinpointing the presence of subpopulations that are putative MM-derived progenitor cells (NCAM(+EpCAM(+FZD7(+, MM stem cells (NCAM(+EpCAM(-FZD7(+ or both (NCAM(+FZD7(+. These results and concepts provide a framework for developing cell selection strategies for human renal cell-based therapies.

  16. A Progenitor Cell Expressing Transcription Factor RORγt Generates All Human Innate Lymphoid Cell Subsets.

    Science.gov (United States)

    Scoville, Steven D; Mundy-Bosse, Bethany L; Zhang, Michael H; Chen, Li; Zhang, Xiaoli; Keller, Karen A; Hughes, Tiffany; Chen, Luxi; Cheng, Stephanie; Bergin, Stephen M; Mao, Hsiaoyin C; McClory, Susan; Yu, Jianhua; Carson, William E; Caligiuri, Michael A; Freud, Aharon G

    2016-05-17

    The current model of murine innate lymphoid cell (ILC) development holds that mouse ILCs are derived downstream of the common lymphoid progenitor through lineage-restricted progenitors. However, corresponding lineage-restricted progenitors in humans have yet to be discovered. Here we identified a progenitor population in human secondary lymphoid tissues (SLTs) that expressed the transcription factor RORγt and was unique in its ability to generate all known ILC subsets, including natural killer (NK) cells, but not other leukocyte populations. In contrast to murine fate-mapping data, which indicate that only ILC3s express Rorγt, these human progenitor cells as well as human peripheral blood NK cells and all mature ILC populations expressed RORγt. Thus, all human ILCs can be generated through an RORγt(+) developmental pathway from a common progenitor in SLTs. These findings help establish the developmental signals and pathways involved in human ILC development.

  17. Nucleus- and cell-specific gene expression in monkey thalamus.

    Science.gov (United States)

    Murray, Karl D; Choudary, Prabhakara V; Jones, Edward G

    2007-02-06

    Nuclei of the mammalian thalamus are aggregations of neurons with unique architectures and input-output connections, yet the molecular determinants of their organizational specificity remain unknown. By comparing expression profiles of thalamus and cerebral cortex in adult rhesus monkeys, we identified transcripts that are unique to dorsal thalamus or to individual nuclei within it. Real-time quantitative PCR and in situ hybridization analyses confirmed the findings. Expression profiling of individual nuclei microdissected from the dorsal thalamus revealed additional subsets of nucleus-specific genes. Functional annotation using Gene Ontology (GO) vocabulary and Ingenuity Pathways Analysis revealed overrepresentation of GO categories related to development, morphogenesis, cell-cell interactions, and extracellular matrix within the thalamus- and nucleus-specific genes, many involved in the Wnt signaling pathway. Examples included the transcription factor TCF7L2, localized exclusively to excitatory neurons; a calmodulin-binding protein PCP4; the bone extracellular matrix molecules SPP1 and SPARC; and other genes involved in axon outgrowth and cell matrix interactions. Other nucleus-specific genes such as CBLN1 are involved in synaptogenesis. The genes identified likely underlie nuclear specification, cell phenotype, and connectivity during development and their maintenance in the adult thalamus.

  18. Restoration of p53 Expression in Human Cancer Cell Lines Upregulates the Expression of Notch1: Implications for Cancer Cell Fate Determination after Genotoxic Stress

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-05-01

    Full Text Available Following genotoxic stress, transcriptional activation of target genes by p53 tumor suppressor is critical in cell fate determination. Here we report that the restoration of p53 function in human cancer cell lines that are deficient in p53 function upregulated the expression of Notch1. Interestingly, the expression of wild-type p53 in human prostate and breast cancer cell lines correlated well with increased expression of Notch1. Furthermore, knockdown of p53 expression in cancer cells that express wild-type p53 resulted in reduced expression of Notch1. Importantly, genotoxic stress to cancer cells that resulted in activation of p53 also upregulated the expression of Notch1. Moreover, p53mediated induction of Notch1 expression was associated with stimulation of the activity of Notch-responsive reporters. Notably, p53 differentially regulated the expression of Notch family members: expression of Notch2 and Notch4 was not induced by p53. Significantly, treatment of cells with gamma secretase inhibitor, an inhibitor of Notch signaling, increased susceptibility to apoptosis in response to genotoxic stress. Together, our observations suggest that p53mediated upregulation of Notch1 expression in human cancer cell lines contributes to cell fate determination after genotoxic stress.

  19. Restoration of p53 Expression in Human Cancer Cell Lines Upregulates the Expression of Notch1: Implications for Cancer Cell Fate Determination after Genotoxic Stress1

    Science.gov (United States)

    Alimirah, Fatouma; Panchanathan, Ravichandran; Davis, Francesca J; Chen, Jianming; Choubey, Divaker

    2007-01-01

    Following genotoxic stress, transcriptional activation of target genes by p53 tumor suppressor is critical in cell fate determination. Here we report that the restoration of p53 function in human cancer cell lines that are deficient in p53 function upregulated the expression of Notch1. Interestingly, the expression of wild-type p53 in human prostate and breast cancer cell lines correlated well with increased expression of Notch1. Furthermore, knockdown of p53 expression in cancer cells that express wild-type p53 resulted in reduced expression of Notch1. Importantly, genotoxic stress to cancer cells that resulted in activation of p53 also upregulated the expression of Notch1. Moreover, p53-mediated induction of Notch1 expression was associated with stimulation of the activity of Notch-responsive reporters. Notably, p53 differentially regulated the expression of Notch family members: expression of Notch2 and Notch4 was not induced by p53. Significantly, treatment of cells with gamma secretase inhibitor, an inhibitor of Notch signaling, increased susceptibility to apoptosis in response to genotoxic stress. Together, our observations suggest that p53-mediated upregulation of Notch1 expression in human cancer cell lines contributes to cell fate determination after genotoxic stress. PMID:17534448

  20. Tetrahydrouridine inhibits cell proliferation through cell cycle regulation regardless of cytidine deaminase expression levels.

    Directory of Open Access Journals (Sweden)

    Naotake Funamizu

    Full Text Available Tetrahydrouridine (THU is a well characterized and potent inhibitor of cytidine deaminase (CDA. Highly expressed CDA catalyzes and inactivates cytidine analogues, ultimately contributing to increased gemcitabine resistance. Therefore, a combination therapy of THU and gemcitabine is considered to be a potential and promising treatment for tumors with highly expressed CDA. In this study, we found that THU has an alternative mechanism for inhibiting cell growth which is independent of CDA expression. Three different carcinoma cell lines (MIAPaCa-2, H441, and H1299 exhibited decreased cell proliferation after sole administration of THU, while being unaffected by knocking down CDA. To investigate the mechanism of THU-induced cell growth inhibition, cell cycle analysis using flow cytometry was performed. This analysis revealed that THU caused an increased rate of G1-phase occurrence while S-phase occurrence was diminished. Similarly, Ki-67 staining further supported that THU reduces cell proliferation. We also found that THU regulates cell cycle progression at the G1/S checkpoint by suppressing E2F1. As a result, a combination regimen of THU and gemcitabine might be a more effective therapy than previously believed for pancreatic carcinoma since THU works as a CDA inhibitor, as well as an inhibitor of cell growth in some types of pancreatic carcinoma cells.

  1. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    Directory of Open Access Journals (Sweden)

    Alberto Miranda

    Full Text Available Cellular prion protein (PRNP is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs. Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB differentiation in mouse Prnp-null (KO and WT embryonic stem cell (ESC lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5 in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel and SPRN (Shadoo, whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  2. Performance benchmarking of four cell-free protein expression systems.

    Science.gov (United States)

    Gagoski, Dejan; Polinkovsky, Mark E; Mureev, Sergey; Kunert, Anne; Johnston, Wayne; Gambin, Yann; Alexandrov, Kirill

    2016-02-01

    Over the last half century, a range of cell-free protein expression systems based on pro- and eukaryotic organisms have been developed and have found a range of applications, from structural biology to directed protein evolution. While it is generally accepted that significant differences in performance among systems exist, there is a paucity of systematic experimental studies supporting this notion. Here, we took advantage of the species-independent translation initiation sequence to express and characterize 87 N-terminally GFP-tagged human cytosolic proteins of different sizes in E. coli, wheat germ (WGE), HeLa, and Leishmania-based (LTE) cell-free systems. Using a combination of single-molecule fluorescence spectroscopy, SDS-PAGE, and Western blot analysis, we assessed the expression yields, the fraction of full-length translation product, and aggregation propensity for each of these systems. Our results demonstrate that the E. coli system has the highest expression yields. However, we observe that high expression levels are accompanied by production of truncated species-particularly pronounced in the case of proteins larger than 70 kDa. Furthermore, proteins produced in the E. coli system display high aggregation propensity, with only 10% of tested proteins being produced in predominantly monodispersed form. The WGE system was the most productive among eukaryotic systems tested. Finally, HeLa and LTE show comparable protein yields that are considerably lower than the ones achieved in the E. coli and WGE systems. The protein products produced in the HeLa system display slightly higher integrity, whereas the LTE-produced proteins have the lowest aggregation propensity among the systems analyzed. The high quality of HeLa- and LTE-produced proteins enable their analysis without purification and make them suitable for analysis of multi-domain eukaryotic proteins.

  3. Arsenic trioxide inhibits cell proliferation and human papillomavirus oncogene expression in cervical cancer cells.

    Science.gov (United States)

    Wang, Hongtao; Gao, Peng; Zheng, Jie

    2014-09-05

    Arsenic trioxide (As2O3) has shown therapeutic effects in some leukemias and solid cancers. However, the molecular mechanisms of its anticancer efficacy have not been clearly elucidated, particularly in solid cancers. Our previous data showed that As2O3 induced apoptosis of human papillomavirus (HPV) 16 DNA-immortalized human cervical epithelial cells and cervical cancer cells and inhibited the expression of HPV oncogenes in these cells. In the present study, we systemically examined the effects of As2O3 on five human cervical cancer cell lines and explored the possible molecular mechanisms. MTT assay showed that HPV-negative C33A cells were more sensitive to growth inhibition induced by As2O3 than HPV-positive cervical cancer cells, and HPV 18-positive HeLa and C4-I cells were more sensitive to As2O3 than HPV 16-positive CaSki and SiHa cells. After As2O3 treatment, both mRNA and protein levels of HPV E6 and E7 obviously decreased in all HPV positive cell lines. In contrast, p53 and Rb protein levels increased in all tested cell lines. Transcription factor AP-1 protein expression decreased significantly in HeLa, CaSki and C33A cells with ELISA method. These results suggest that As2O3 is a potential anticancer drug for cervical cancer.

  4. Expression of lactoperoxidase in differentiated mouse colon epithelial cells.

    Science.gov (United States)

    Kim, Byung-Wook; Esworthy, R Steven; Hahn, Maria A; Pfeifer, Gerd P; Chu, Fong-Fong

    2012-05-01

    Lactoperoxidase (LPO) is known to be present in secreted fluids, such as milk and saliva. Functionally, LPO teams up with dual oxidases (DUOXs) to generate bactericidal hypothiocyanite in the presence of thiocyanate. DUOX2 is expressed in intestinal epithelium, but there is little information on LPO expression in this tissue. To fill the gap of knowledge, we have analyzed Lpo gene expression and its regulation in mouse intestine. In wild-type (WT) C57BL/6 (B6) mouse intestine, an appreciable level of mouse Lpo gene expression was detected in the colon, but not the ileum. However, in B6 mice deficient in glutathione peroxidase (GPx)-1 and -2, GPx1/2-double-knockout (DKO), which had intestinal pathology, the colon Lpo mRNA levels increased 5- to 12-fold depending on mouse age. The Lpo mRNA levels in WT and DKO 129S1/SvlmJ (129) colon were even higher, 9- and 5-fold, than in B6 DKO colon. Higher levels of Lpo protein and enzymatic activity were also detected in the 129 mouse colon compared to B6 colon. Lpo protein was expressed in the differentiated colon epithelial cells, away from the crypt base, as shown by immunohistochemistry. Similar to human LPO mRNA, mouse Lpo mRNA had multiple spliced forms, although only the full-length variant 1 was translated. Higher methylation was found in the 129 than in the B6 strain, in DKO than in control colon, and in older than in juvenile mice. However, methylation of the Lpo intragenic CpG island was not directly induced by inflammation, because dextran sulfate sodium-induced colitis did not increase DNA methylation in B6 DKO colon. Also, Lpo DNA methylation is not correlated with gene expression.

  5. Induction in myeloid leukemic cells of genes that are expressed in different normal tissues

    OpenAIRE

    2005-01-01

    Using DNA microarray and cluster analysis of expressed genes in a cloned line (M1-t-p53) of myeloid leukemic cells, we have analyzed the expression of genes that are preferentially expressed in different normal tissues. Clustering of 547 highly expressed genes in these leukemic cells showed 38 genes preferentially expressed in normal hematopoietic tissues and 122 other genes preferentially expressed in different normal non-hematopoietic tissues including neuronal tissues, muscle, liver and te...

  6. RASSF1A expression inhibits cell growth and enhances cell chemosensitivity to mitomycin in BEL-7402 hepatocellular carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    GUAN Hong-geng; XUE Wan-jiang; QIAN Hai-xin; ZHOU Xiao-jun; QIN Lei; LAN Jing

    2009-01-01

    Background The antitumor role of Ras association domain family 1A (RASSFIA) gene and its potential molecular mechanisms are not well understood. The objective of this study was to observe the antitumor ability of RASSFIA in hepatoceliular carcinoma, and study the mechanisms of cell apoptosis induced by RASSFIA.Methods After stably transfecting a RASSF1A (wild-type or mutant) expression vector into the BEL-7402 hepatocellular carcinoma cell line, RT-PCR and Westem blotting was used to detect the RASSF1A expression levels in recombinant cells. The effects of wild-type RASSF1A on cell growth were observed in vitro by analyzing cell proliferation rate, cell colony formation, and in vivo by analyzing tumorigenesis in nude mice. In addition, the effect of RASSF1A gene expression on the chemosensitivity of human hepatocellular carcinoma cells to antitumor drugs was examined by inhibition of cell proliferation and the percentage of apoptotic cells.Results Wild-type RASSF1A, not the mutant, suppressed cell growth in vitro and in vivo. Re-expression of wild-type RASSF1A could enhance the inhibition of cell proliferation and the percentage of apoptotic cells following cell treatment with mitomycin, but had no significant effect when combined with adriamycin, etoposide, 5-fluorouracil and cisplatJn treatment.Conclusion Wild-type RASSF1A inhibits cell growth and enhances cell chemosensitivity to mitomycin in hepatocellular carcinoma, suggesting that RASSF1A may serve as a new target for gene therapy in hepatocellular carcinoma patients.

  7. SREBP inhibits VEGF expression in human smooth muscle cells.

    Science.gov (United States)

    Motoyama, Koka; Fukumoto, Shinya; Koyama, Hidenori; Emoto, Masanori; Shimano, Hitoshi; Maemura, Koji; Nishizawa, Yoshiki

    2006-03-31

    Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate expression of genes encoding enzymes for lipid biosynthesis. SREBPs are activated by HMG-CoA reductase inhibitors (statins). Statins have been also reported to suppress vascular endothelial growth factor (VEGF) expression in vascular smooth muscle cells (VSMCs). Therefore, we hypothesized that SREBPs are involved in statin-mediated regulation of VEGF production in VSMCs. SREBP1 was robustly expressed, and was activated by atorvastatin in VSMCs, as demonstrated by increased levels of the mature nuclear form of SREBP1, and increased promoter activities of a reporter containing sterol regulatory elements by atorvastatin. Moreover, overexpression of SREBP1a dose-dependently suppressed VEGF promoter activity. Site-specific mutation or deletion of the proximal Sp1 sites reduced the inhibitory effects of SREBP1a on VEGF promoter activity. These data demonstrated that SREBP1, activated by atorvastatin, suppressed VEGF expression through the indirect interaction with the proximal tandem Sp1 sites in VSMCs.

  8. MicroRNA Expression in Alzheimer Blood Mononuclear Cells

    Directory of Open Access Journals (Sweden)

    Hyman M. Schipper

    2007-01-01

    Full Text Available Various coding genes representing multiple functional categories are downregulated in blood mononuclear cells (BMC of patients with sporadic Alzheimer disease (AD. Noncoding microRNAs (miRNA regulate gene expression by degrading messages or inhibiting translation. Using BMC as a paradigm for the study of systemic alterations in AD, we investigated whether peripheral miRNA expression is altered in this condition. MicroRNA levels were assessed using the microRNA microarray (MMChip containing 462 human miRNA, and the results validated by real time PCR. Sixteen AD patients and sixteen normal elderly controls (NEC were matched for ethnicity, age, gender and education. The expression of several BMC miRNAs was found to increase in AD relative to NEC levels, and may differ between AD subjects bearing one or two APOE4 alleles. As compared to NEC, miRNAs signifi cantly upregulated in AD subjects and confi rmed by qPCR were miR-34a and 181b. Predicted target genes downregulated in Alzheimer BMC that correlated with the upregulated miRNAs were largely represented in the functional categories of Transcription/Translation and Synaptic Activity. Several miRNAs targeting the same genes were within the functional category of Injury response/Redox homeostasis. Taken together, induction of microRNA expression in BMC may contribute to the aberrant systemic decline in mRNA levels in sporadic AD.

  9. Tolerogenic IDO+ dendritic cells are induced by PD-1-expressing mast cells

    Directory of Open Access Journals (Sweden)

    Cecilia Pessoa Rodrigues

    2016-01-01

    Full Text Available Mast cells (MC are tissue resident cells, rich in inflammatory mediators, involved in allergic reactions, and with an increasingly recognized role in immunomodulation. Dendritic cells (DCs, on the other hand, are central to the determination of immune response patterns, being highly efficient antigen-presenting cells that respond promptly to changes in their microenvironment. Here, we show that direct cell contact between immature monocyte-derived DCs (iDCs and MC bends DCs towards tolerance induction. DCs that had direct contact with MC (MC-iDC decreased HLA-DR but increased PD-L1 expression and stimulated regulatory T lymphocytes, which expresses FoxP3+, secrete TGF-β and IL-10, and suppress the proliferation of mitogen-stimulated naïve T lymphocytes. Furthermore, MC-iDC expressed higher levels of indoleamine-2,3-deoxigenase (IDO, a phenomenon that was blocked by treatment of MC with anti-PD-1 or by the treatment of DCs with anti-PD-L1 or anti-PD-L2, but not by blocking of H1 and H2 histamine receptors on DCs. Contact with MC also increased phosphorylated STAT-3 levels in iDCs. When a STAT-3 inhibitor, JSI-124, was added to the DCs before contact with MC, the MC-iDC recovered their ability to induce allogeneic T cell proliferation and did not increase their IDO expression.

  10. Dpp-expressing and non-expressing cells: two different populations of growing cells in Drosophila.

    Directory of Open Access Journals (Sweden)

    Carolina Arias

    Full Text Available There are different models that explain growth during development. One model is based on insect and amphibian regeneration studies. This model proposes that growth is directed by pattern, and growth takes place by intercalation at a growth discontinuity; therefore, proliferation should surround the discontinuity. Currently, this model, apart from regenerative studies on mostly adult patterning, has not found supporting evidence in Drosophila that shows proliferation surrounding a discontinuity. Despite this lack of evidence, the importance of discontinuities has been shown in different experiments, even under wt conditions, more specifically in the formation of the leg joints because of the occurrence of cell death at their boundaries. Here, we show the existence of a sharp discontinuity in Decapentaplegic (Dpp in the genital discs at the third larvae stage (L3, which determines the upregulation in the Jun-NH2-Terminal-Kinase (JNK pathway, reaper (rpr, head involution defective (hid and active caspases from its boundaries. The proliferation and cell death surrounding the discontinuity suggest that growth can proceed by intercalation and competitive death takes place in this area. Finally, we show that the Rpr, Grim and Hid (RGH products are a few of the factors that define the growth discontinuity because they are negative regulators of growth, a new function that is unique from their known functions in apoptosis.

  11. Thiazolidinediones enhance vascular endothelial growth factor expression and induce cell growth inhibition in non-small-cell lung cancer cells

    Directory of Open Access Journals (Sweden)

    Yoshizaki Yumiko

    2010-03-01

    Full Text Available Abstract Background It is known that thiazolidinediones are involved in regulating the expression of various genes, including the vascular endothelial growth factor (VEGF gene via peroxisome proliferator-activated receptor γ (PPARγ; VEGF is a prognostic biomarker for non-small-cell lung cancer (NSCLC. Methods In this study, we investigated the effects of troglitazone and ciglitazone on the mRNA expression of VEGF and its receptors in human NSCLC cell lines, RERF-LC-AI, SK-MES-1, PC-14, and A549. These mRNA expressions were evaluated by quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR analysis. We also studied the effect of Je-11, a VEGF inhibitor, on the growth of these cells. Results In NSCLC cells, thiazolidinediones increased the mRNA expression of VEGF and neuropilin-1, but not that of other receptors such as fms-like tyrosine kinase and kinase insert domain receptor-1. Furthermore, the PPARγ antagonist GW9662 completely reversed this thiazolidinedione-induced increase in VEGF expression. Furthermore, the addition of VEGF inhibitors into the culture medium resulted in the reversal of thiazolidinedione-induced growth inhibition. Conclusions Our results indicated that thiazolidinediones enhance VEGF and neuropilin-1 expression and induce the inhibition of cell growth. We propose the existence of a pathway for arresting cell growth that involves the interaction of thiazolidinedione-induced VEGF and neuropilin-1 in NSCLC.

  12. Differential expression of neural cell adhesion molecule and cadherins in pancreatic islets, glucagonomas, and insulinomas

    DEFF Research Database (Denmark)

    Møller, C J; Christgau, S; Williamson, M R;

    1992-01-01

    (delta-cells), and pancreatic polypeptide (PP-cells) in a sequential order. The endocrine cells are believed to arise from a stem cell with neuronal traits. The developmental lineage from a common neuron-like progenitor is evidenced by: transient coexpression of more than one cell type-specific hormone......The endocrine cells of the pancreas develop from the endoderm and yet display several characteristics of a neuronal phenotype. During embryonic life, ductal epithelial cells give rise to first the glugagon-producing cells (alpha-cells) and then cells that express insulin (beta-cells), somatostatin...... in immature cells, expression of neuronal markers during islet cell development, and the pluripotentiality of clones of insulinoma cells to develop into cells expressing other islet cell hormones. The four mature endocrine cell types assume a particular organization within the islets of Langerhans...

  13. Novel method for isolation of murine clara cell secretory protein-expressing cells with traces of stemness.

    Directory of Open Access Journals (Sweden)

    Xiao-Yang Wang

    Full Text Available Clara cells are non-ciliated, secretory bronchiolar epithelial cells that serve to detoxify harmful inhaled substances. Clara cells also function as stem/progenitor cells for repair in the bronchioles. Clara cell secretory protein (CCSP is specifically expressed in pulmonary Clara cells and is widely used as a Clara cell marker. In addition CCSP promoter is commonly used to direct gene expression into the lung in transgenic models. The discovery of CCSP immunoreactivity in plasma membranes of airway lining cells prompted us to explore the possibility of enriching Clara cells by flow cytometry. We established a novel and simple method for the isolation of CCSP-expressing cell Clara cells using a combination of mechanical and enzymatic dissociation followed by flow cytometry sorting technology. We showed that ∼25% of dissociated cells from whole lung expressed CCSP. In the resulting preparation, up to 98% of cells expressed CCSP. Notably, we found that several common stem cell markers including CD44, CD133, Sca-1 and Sox2 were expressed in CCSP(+ cells. Moreover, CCSP(+ cells were able to form spheroid colonies in vitro with 0.97‰ efficiency. Parallel studies in vivo confirmed that a small population of CCSP(-expressing cells in mouse airways also demonstrates stem cell-like properties such as label retention and harboring rare bronchioalveolar stem cells (BASCs in terminal bronchioles (TBs. We conclude that CCSP(+ cells exhibit a number of stem cell-like features including stem cell marker expression, bronchosphere colony formation and self-renewal ability. Clara cell isolation by flow cytometry sorting is a useful method for investigating the function of primary Clara cells in stem cell research and mouse models.

  14. Efflux protein expression in human stem cell-derived retinal pigment epithelial cells.

    Directory of Open Access Journals (Sweden)

    Kati Juuti-Uusitalo

    Full Text Available Retinal pigment epithelial (RPE cells in the back of the eye nourish photoreceptor cells and form a selective barrier that influences drug transport from the blood to the photoreceptor cells. At the molecular level, ATP-dependent efflux transporters have a major role in drug delivery in human RPE. In this study, we assessed the relative expression of several ATP-dependent efflux transporter genes (MRP1, -2, -3, -4, -5, -6, p-gp, and BCRP, the protein expression and localization of MRP1, MRP4, and MRP5, and the functionality of MRP1 efflux pumps at different maturation stages of undifferentiated human embryonic stem cells (hESC and RPE derived from the hESC (hESC-RPE. Our findings revealed that the gene expression of ATP-dependent efflux transporters MRP1, -3, -4, -5, and p-gp fluctuated during hESC-RPE maturation from undifferentiated hESC to fusiform, epithelioid, and finally to cobblestone hESC-RPE. Epithelioid hESC-RPE had the highest expression of MRP1, -3, -4, and P-gp, whereas the most mature cobblestone hESC-RPE had the highest expression of MRP5 and MRP6. These findings indicate that a similar efflux protein profile is shared between hESC-RPE and the human RPE cell line, ARPE-19, and suggest that hESC-RPE cells are suitable in vitro RPE models for drug transport studies. Embryonic stem cell model might provide a novel tool to study retinal cell differentiation, mechanisms of RPE-derived diseases, drug testing and targeted drug therapy.

  15. LIGHT/TNFSR14 can regulate hepatic lipase expression by hepatocytes independent of T cells and Kupffer cells.

    Directory of Open Access Journals (Sweden)

    Bijoy Chellan

    Full Text Available LIGHT/TNFSF14 is a costimulatory molecule expressed on activated T cells for activation and maintenance of T cell homeostasis. LIGHT over expressed in T cells also down regulates hepatic lipase levels in mice through lymphotoxin beta receptor (LTβR signaling. It is unclear whether LIGHT regulates hepatic lipase directly by interacting with LTβR expressing cells in the liver or indirectly by activation of T cells, and whether Kupffer cells, a major cell populations in the liver that expresses the LTβR, are required. Here we report that LIGHT expression via an adenoviral vector (Ad-LIGHT is sufficient to down regulate hepatic lipase expression in mice. Depletion of Kupffer cells using clodronate liposomes had no effect on LIGHT-mediated down regulation of hepatic lipase. LIGHT-mediated regulation of hepatic lipase is also independent of LIGHT expression by T cells or activation of T cells. This is demonstrated by the decreased hepatic lipase expression in the liver of Ad-LIGHT infected recombination activating gene deficient mice that lack mature T cells and by the Ad-LIGHT infection of primary hepatocytes. Hepatic lipase expression was not responsive to LIGHT when mice lacking LTβR globally or only on hepatocytes were infected with Ad-LIGHT. Therefore, our data argues that interaction of LIGHT with LTβR on hepatocytes, but not Kupffer cells, is sufficient to down regulate hepatic lipase expression and that this effect can be independent of LIGHT's costimulatory function.

  16. Live-cell monitoring of periodic gene expression in synchronous human cells identifies Forkhead genes involved in cell cycle control.

    Science.gov (United States)

    Grant, Gavin D; Gamsby, Joshua; Martyanov, Viktor; Brooks, Lionel; George, Lacy K; Mahoney, J Matthew; Loros, Jennifer J; Dunlap, Jay C; Whitfield, Michael L

    2012-08-01

    We developed a system to monitor periodic luciferase activity from cell cycle-regulated promoters in synchronous cells. Reporters were driven by a minimal human E2F1 promoter with peak expression in G1/S or a basal promoter with six Forkhead DNA-binding sites with peak expression at G2/M. After cell cycle synchronization, luciferase activity was measured in live cells at 10-min intervals across three to four synchronous cell cycles, allowing unprecedented resolution of cell cycle-regulated gene expression. We used this assay to screen Forkhead transcription factors for control of periodic gene expression. We confirmed a role for FOXM1 and identified two novel cell cycle regulators, FOXJ3 and FOXK1. Knockdown of FOXJ3 and FOXK1 eliminated cell cycle-dependent oscillations and resulted in decreased cell proliferation rates. Analysis of genes regulated by FOXJ3 and FOXK1 showed that FOXJ3 may regulate a network of zinc finger proteins and that FOXK1 binds to the promoter and regulates DHFR, TYMS, GSDMD, and the E2F binding partner TFDP1. Chromatin immunoprecipitation followed by high-throughput sequencing analysis identified 4329 genomic loci bound by FOXK1, 83% of which contained a FOXK1-binding motif. We verified that a subset of these loci are activated by wild-type FOXK1 but not by a FOXK1 (H355A) DNA-binding mutant.

  17. Casein gene expression in mouse mammary epithelial cell lines: Dependence upon extracellular matrix and cell type

    Energy Technology Data Exchange (ETDEWEB)

    Medina, D.; Oborn, C.J. (Baylor College of Medicine, Houston, TX (USA)); Li, M.L.; Bissell, M.J. (Univ. of California, Berkeley (USA))

    1987-09-01

    The COMMA-D mammary cell line exhibits mammary-specific functional differentiation under appropriate conditions in cell culture. The cytologically heterogeneous COMMA-D parental line and the clonal lines DB-1, TA-5, and FA-1 derived from the COMMA-D parent were examined for similar properties of functional differentiation. In monolayer cell culture, the cell lines DB-1, TA-5, FA-1, and MA-4 were examined for expression of mammary-specific and epithelial-specific proteins by an indirect immunofluorescence assay. The clonal cell lines were relatively homogeneous in their respective staining properties and seemed to represent three subpopulations found in the heterogeneous parental COMMA-D lines. None of the four clonal lines appeared to represent myoepithelial cells. The cell lines were examined for expression of {beta}-casein mRNA in the presence or absence of prolactin. The inducibility of {beta}-casein in the COMMA-D cell line was further enhanced by a reconstituted basement membrane preparation enriched in laminin, collagen IV, and proteoglycans. These results support the hypothesis that the functional response of inducible mammary cell populations is a result of interaction among hormones, multiple extracellular matrix components, and specific cell types.

  18. MicroRNA expression profiling identifies activated B cell status in chronic lymphocytic leukemia cells.

    Directory of Open Access Journals (Sweden)

    Shuqiang Li

    Full Text Available Chronic lymphocytic leukemia (CLL is thought to be a disease of resting lymphocytes. However, recent data suggest that CLL cells may more closely resemble activated B cells. Using microRNA (miRNA expression profiling of highly-enriched CLL cells from 38 patients and 9 untransformed B cells from normal donors before acute CpG activation and 5 matched B cells after acute CpG activation, we demonstrate an activated B cell status for CLL. Gene set enrichment analysis (GSEA identified statistically-significant similarities in miRNA expression between activated B cells and CLL cells including upregulation of miR-34a, miR-155, and miR-342-3p and downregulation of miR-103, miR-181a and miR-181b. Additionally, decreased levels of two CLL signature miRNAs miR-29c and miR-223 are associated with ZAP70(+ and IgV(H unmutated status and with shorter time to first therapy. These data indicate an activated B cell status for CLL cells and suggest that the direction of change of individual miRNAs may predict clinical course in CLL.

  19. Caspases regulate VAMP-8 expression and phagocytosis in dendritic cells.

    Science.gov (United States)

    Ho, Yong Hou Sunny; Cai, Deyu Tarika; Huang, Dachuan; Wang, Cheng Chun; Wong, Siew Heng

    2009-09-18

    During an inflammation and upon encountering pathogens, immature dendritic cells (DC) undergo a maturation process to become highly efficient in presenting antigens. This transition from immature to mature state is accompanied by various physiological, functional and morphological changes including reduction of caspase activity and inhibition of phagocytosis in the mature DC. Caspases are cysteine proteases which play essential roles in apoptosis, necrosis and inflammation. Here, we demonstrate that VAMP-8, (a SNARE protein of the early/late endosomes) which has been shown previously to inhibit phagocytosis in DC, is a substrate of caspases. Furthermore, we identified two putative conserved caspase recognition/cleavage sites on the VAMP-8 protein. Consistent with the up-regulation of VAMP-8 expression upon treatment with caspase inhibitor (CI), immature DC treated with CI exhibits lower phagocytosis activity. Thus, our results highlight the role of caspases in regulating VAMP-8 expression and subsequently phagocytosis during maturation of DC.

  20. Expression of ICAM-1 in colon epithelial cells

    DEFF Research Database (Denmark)

    Vainer, Ben; Sørensen, Susanne; Seidelin, Jakob;

    2003-01-01

    Studies have suggested that in ulcerative colitis (UC), intercellular adhesion molecule-1 (ICAM-1) is involved in migration of leukocytes toward the colonic epithelium. A suitable in vitro model of chronic colonic inflammation does not exist, and the role of the epithelium is based on monolayers ...... of cancer cells. Conflicting results exist on epithelial ICAM-1 expression, and the aim of this study was to compare the expression in various models of colonic epithelium.......Studies have suggested that in ulcerative colitis (UC), intercellular adhesion molecule-1 (ICAM-1) is involved in migration of leukocytes toward the colonic epithelium. A suitable in vitro model of chronic colonic inflammation does not exist, and the role of the epithelium is based on monolayers...

  1. Expression of inducible nitric oxide in human lung epithelial cells.

    Science.gov (United States)

    Robbins, R A; Barnes, P J; Springall, D R; Warren, J B; Kwon, O J; Buttery, L D; Wilson, A J; Geller, D A; Polak, J M

    1994-08-30

    Nitric oxide (NO) is increased in the exhaled air of subjects with several airway disorders. To determine if cytokines could stimulate epithelial cells accounting for the increased NO, the capacity of the proinflammatory cytokines (cytomix: tumor necrosis factor-alpha, interleukin-1 beta, and interferon-gamma) to increase inducible nitric oxide synthase (iNOS) was investigated in A549 and primary cultures of human bronchial epithelial cells. Cytomix induced a time-dependent increase in nitrite levels in culture supernatant fluids (p < 0.05). Increased numbers of cells stained for iNOS and increased iNOS mRNA was detected in the cytokine-stimulated cells compared to control (p < 0.05). Dexamethasone diminished the cytokine-induced increase in nitrite, iNOS by immunocytochemistry, and iNOS mRNA. These data demonstrate that cytokines, such as those released by mononuclear cells, can induce lung epithelial iNOS expression and NO release, and that this is attenuated by dexamethasone.

  2. A novel gene delivery system targeting cells expressing VEGF receptors

    Institute of Scientific and Technical Information of China (English)

    LIJUNMIN; JINGCHULUO; 等

    1999-01-01

    Two ligand oligopeptides GV1 and GV2 were designed according to the putative binding region of VEGF to its receptors.GV1,GV2 and endosome releasing oligopeptide HA20 were conjugated with poly-L-lysine or protamine and the resulting conjugates could interact with DNA in a noncovalent bond to form a complex.Using pSV2-β-galactosidase as a reporter gene,it has been demonstrated that exogenous gene was transferred into bovine aortic arch-derived endothelial cells (ABAE) and human malignant melanoma cell lines (A375) in vitro.In vivo experiments,exogenous gene was transferred into tumor vascular endothelial cells and tumor cells of subcutaneously transplanted human colon cancer LOVO,human malignant melanoma A375 and human hepatoma graft in nude mice.This system could also target gene to intrahepatically transplanted human hepatoma injected via portal vein in nude mice.These results are correlated with the relevant receptors(flt-1,flk-1/KDR) expression on the targeted cells and tissues.

  3. Gene expression pattern of functional neuronal cells derived from human bone marrow mesenchymal stromal cells

    Directory of Open Access Journals (Sweden)

    Bron Dominique

    2008-04-01

    Full Text Available Abstract Background Neuronal tissue has limited potential to self-renew or repair after neurological diseases. Cellular therapies using stem cells are promising approaches for the treatment of neurological diseases. However, the clinical use of embryonic stem cells or foetal tissues is limited by ethical considerations and other scientific problems. Thus, bone marrow mesenchymal stomal cells (BM-MSC could represent an alternative source of stem cells for cell replacement therapies. Indeed, many studies have demonstrated that MSC can give rise to neuronal cells as well as many tissue-specific cell phenotypes. Methods BM-MSC were differentiated in neuron-like cells under specific induction (NPBM + cAMP + IBMX + NGF + Insulin. By day ten, differentiated cells presented an expression profile of real neurons. Functionality of these differentiated cells was evaluated by calcium influx through glutamate receptor AMPA3. Results Using microarray analysis, we compared gene expression profile of these different samples, before and after neurogenic differentiation. Among the 1943 genes differentially expressed, genes down-regulated are involved in osteogenesis, chondrogenesis, adipogenesis, myogenesis and extracellular matrix component (tuftelin, AGC1, FADS3, tropomyosin, fibronectin, ECM2, HAPLN1, vimentin. Interestingly, genes implicated in neurogenesis are increased. Most of them are involved in the synaptic transmission and long term potentialisation as cortactin, CASK, SYNCRIP, SYNTL4 and STX1. Other genes are involved in neurite outgrowth, early neuronal cell development, neuropeptide signaling/synthesis and neuronal receptor (FK506, ARHGAP6, CDKRAP2, PMCH, GFPT2, GRIA3, MCT6, BDNF, PENK, amphiregulin, neurofilament 3, Epha4, synaptotagmin. Using real time RT-PCR, we confirmed the expression of selected neuronal genes: NEGR1, GRIA3 (AMPA3, NEF3, PENK and Epha4. Functionality of these neuron-like cells was demonstrated by Ca2+ influx through glutamate

  4. Germ Cell Nuclear Factor (GCNF) Represses Oct4 Expression and Globally Modulates Gene Expression in Human Embryonic Stem (hES) Cells.

    Science.gov (United States)

    Wang, Hongran; Wang, Xiaohong; Xu, Xueping; Kyba, Michael; Cooney, Austin J

    2016-04-15

    Oct4 is considered a key transcription factor for pluripotent stem cell self-renewal. It binds to specific regions within target genes to regulate their expression and is downregulated upon induction of differentiation of pluripotent stem cells; however, the mechanisms that regulate the levels of human Oct4 expression remain poorly understood. Here we show that expression of human Oct4 is directly repressed by germ cell nuclear factor (GCNF), an orphan nuclear receptor, in hES cells. Knockdown of GCNF by siRNA resulted in maintenance of Oct4 expression during RA-induced hES cell differentiation. While overexpression of GCNF promoted repression of Oct4 expression in both undifferentiated and differentiated hES cells. The level of Oct4 repression was dependent on the level of GCNF expression in a dose-dependent manner. mRNA microarray analysis demonstrated that overexpression of GCNF globally regulates gene expression in undifferentiated and differentiated hES cells. Within the group of altered genes, GCNF down-regulated 36% of the genes, and up-regulated 64% in undifferentiated hES cells. In addition, GCNF also showed a regulatory gene pattern that is different from RA treatment during hES cell differentiation. These findings increase our understanding of the mechanisms that maintain hES cell pluripotency and regulate gene expression during the differentiation process.

  5. Expression of Caspase-3 in Laryngeal Squamous Cell Carcinoma and its Relationship with Cell Apoptosis

    Institute of Scientific and Technical Information of China (English)

    YU Yuan-chen; ZHONG Zhao-kun; LI Ji-xia; YU Chuan-ting

    2015-01-01

    Objective:To investigate the expression of Caspase-3 in laryngeal squamous cell carcinoma (LSCC) and its relationship with cell apoptosis. Methods: The expression of Caspase-3 protein in 43 LSCC tissues and 21 vocal cord polyp tissues was detected using immunohistochemical SP method; the apoptosis of LSCC was measured by in situ end-labeling (TUNEL) assay, and the relationships between Caspase-3 expression and clinicopathological features as well as cell apoptosis in LSCC tissue were analyzed. Results:The positive rate of Caspase-3 expression in LSCC tissue was lower than in vocal cord polyp tissue dramatically, with statistical significance (51.2%vs. 85.7%,P=0.007). Caspase-3 expression in LSCC tissue was closely related to the tumor differentiated degrees, clinical staging and presence or absence of lymph node metastasis (P=0.009, 0.001, 0.018) instead of the gender, age and tumor size (P>0.05). The apoptosis index (AI) of Caspase-3 was (4.31±0.49)% in LSCC tissue, while (24.28±1.07)% in vocal cord polyp tissue. Significant difference was presented between two groups by comparison to the AI (P<0.001). Spearman correlation analysis displayed that Caspase-3 expression in LSCC tissue had a signiifcantly positive correlation with the number of positive TUNEL cells (r=0.435,P=0.000). Conclusion: Low expression of Caspase-3 protein might promote the tumorigenesis and progression by reducing the apoptosis of tumor cells, and detection to its protein can be considered as an important index for judging the differentiation, clinical staging, inifltration and metastasis of laryngeal carcinoma.

  6. PD-1 expression on dendritic cells suppresses CD8+ T cell function and antitumor immunity

    OpenAIRE

    Lim, Tong Seng; Chew, Valerie; Sieow, Je Lin; Goh, Siting; Yeong, Joe Poh-Sheng; Soon, Ai Ling; Ricciardi-Castagnoli, Paola

    2015-01-01

    Programmed death one (PD-1) is a well-established co-inhibitory regulator that suppresses proliferation and cytokine production of T cells. Despite remarkable progress in delineating the functional roles of PD-1 on T lymphocytes, little is known about the regulatory role of PD-1 expressed on myeloid cells such as dendritic cells (DCs). Here, we show that CD8+ T cells can be more potently activated to secrete IL-2 and IFNγ by PD-1-deficient DCs compared to wild-type DCs. Adoptive transfer of P...

  7. Relation of cell proliferation to expression of peripheral benzodiazepine receptors in human breast cancer cell lines.

    Science.gov (United States)

    Beinlich, A; Strohmeier, R; Kaufmann, M; Kuhl, H

    2000-08-01

    Peripheral benzodiazepine receptor (PBR) agonist [(3)H]Ro5-4864 has been shown to bind with high affinity to the human breast cancer cell line BT-20. Therefore, we investigated different human breast cancer cell lines with regard to binding to [(3)H]Ro5-4864 and staining with the PBR-specific monoclonal antibody 8D7. Results were correlated with cell proliferation characteristics. In flow cytometric analysis, the estrogen receptor (ER)-negative breast cancer cell lines BT-20, MDA-MB-435-S, and SK-BR-3 showed significantly higher PBR expression (relative fluorescence intensity) than the ER-positive cells T47-D, MCF-7 and BT-474 (Pdiazepam-binding inhibitor are possibly involved in the regulation of cell proliferation of human breast cancer cell lines.

  8. Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells.

    Science.gov (United States)

    Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

    Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes.

  9. Natural sequence variants of yeast environmental sensors confer cell-to-cell expression variability.

    Science.gov (United States)

    Fehrmann, Steffen; Bottin-Duplus, Hélène; Leonidou, Andri; Mollereau, Esther; Barthelaix, Audrey; Wei, Wu; Steinmetz, Lars M; Yvert, Gaël

    2013-10-08

    Living systems may have evolved probabilistic bet hedging strategies that generate cell-to-cell phenotypic diversity in anticipation of environmental catastrophes, as opposed to adaptation via a deterministic response to environmental changes. Evolution of bet hedging assumes that genotypes segregating in natural populations modulate the level of intraclonal diversity, which so far has largely remained hypothetical. Using a fluorescent P(met17)-GFP reporter, we mapped four genetic loci conferring to a wild yeast strain an elevated cell-to-cell variability in the expression of MET17, a gene regulated by the methionine pathway. A frameshift mutation in the Erc1p transmembrane transporter, probably resulting from a release of laboratory strains from negative selection, reduced P(met17)-GFP expression variability. At a second locus, cis-regulatory polymorphisms increased mean expression of the Mup1p methionine permease, causing increased expression variability in trans. These results demonstrate that an expression quantitative trait locus (eQTL) can simultaneously have a deterministic effect in cis and a probabilistic effect in trans. Our observations indicate that the evolution of transmembrane transporter genes can tune intraclonal variation and may therefore be implicated in both reactive and anticipatory strategies of adaptation.

  10. Cytokine-Induced Cell Surface Expression of Adhesion Molecules in Vascular Endothelial Cells In vitro

    Institute of Scientific and Technical Information of China (English)

    陈红辉; 刘昌勤; 孙圣刚; 梅元武; 童萼塘

    2001-01-01

    Regulation of the adhesion molecules expression by cytokine in vascular endothelial cells was investigated. Human umbilical vein endothelial cells (HUVEC) were stimulated with cytokines, TNF-α (1-250 U/ml) or IL-1β (0.1-50 U/ml) for 24 h. HUVEC were also cultured with cytokines, TNF-α (100 U/ml) or IL-1β (10 U/ml), for 4-72 h, cell surface expression of adhesion molecules (ICAM-1 and VCAM-1) were detected and quantitated by immunocytochemical methods and computerized imaging analysis technique. Adhesion molecules expression were up-regulated by TNF-α, IL-1β in a concentration- and time-dependent manner. Some significant differences were observed between the effects of cytokines on the ICAM-1 and on VCAM-1 expression. Cytokines might directly induce the expression of ICAM-1 and VCAM-1 in vascular endothelial cells. Our observations indicate differential functions of the two adhesion molecules during the evolution of inflammatory responses in stroke.

  11. Analysis of LINE-1 expression in human pluripotent cells.

    Science.gov (United States)

    Muñoz-Lopez, Martin; Garcia-Cañadas, Marta; Macia, Angela; Morell, Santiago; Garcia-Perez, Jose L

    2012-01-01

    Half of the human genome is composed of repeated DNA, and some types are mobile within our genome (transposons and retrotransposons). Despite their abundance, only a small fraction of them are currently active in our genome (Long Interspersed Element-1 (LINE-1), Alu, and SVA elements). LINE-1 or L1 elements are a family of active non-LTR retrotransposons, the ongoing mobilization of which still impacts our genome. As selfish DNA elements, L1 activity is more prominent in early human development, where new insertions would be transmitted to the progeny. Here, we describe the conventional methods aimed to determine the expression level of LINE-1 elements in pluripotent human cells.

  12. Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes

    Energy Technology Data Exchange (ETDEWEB)

    Aires, M.B. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, J.R.A. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Souza, K.S.; Farias, P.S. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, A.C.V. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Fioretto, E.T. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Maria, D.A. [Laboratório de Bioquímica e Biofísica, Instituto Butantan, São Paulo, SP (Brazil)

    2015-07-10

    The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g) with induced diabetes (alloxan, 37 mg/kg) on the 8th gestational day (gd 8). At gd 15, rats from control (n=5) and diabetic (n=5) groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05), CCR2 (P<0.001), and OCT3/4 (P<0.01), and significantly increased expression of CD90 (P<0.05), CD117 (P<0.01), and CD14 (P<0.05) were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers.

  13. PD-1 expression on dendritic cells suppresses CD8+ T cell function and antitumor immunity

    Science.gov (United States)

    Lim, Tong Seng; Chew, Valerie; Sieow, Je Lin; Goh, Siting; Yeong, Joe Poh-Sheng; Soon, Ai Ling; Ricciardi-Castagnoli, Paola

    2016-01-01

    ABSTRACT Programmed death one (PD-1) is a well-established co-inhibitory regulator that suppresses proliferation and cytokine production of T cells. Despite remarkable progress in delineating the functional roles of PD-1 on T lymphocytes, little is known about the regulatory role of PD-1 expressed on myeloid cells such as dendritic cells (DCs). Here, we show that CD8+ T cells can be more potently activated to secrete IL-2 and IFNγ by PD-1-deficient DCs compared to wild-type DCs. Adoptive transfer of PD-1-deficient DCs demonstrated their superior capabilities in inducing antigen-specific CD8+ T cell proliferation in vivo. In addition, we provide first evidence demonstrating the existence of peripheral blood DCs and CD11c+ tumor-infiltrating myeloid cells that co-express PD-1 in patients with hepatocellular carcinoma (HCC). The existence of PD-1-expressing HCC-infiltrating DCs (HIDCs) was further supported in a mouse model of HCC. Intratumoral transfer of PD-1-deficient DCs rendered recipient mice resistant to the growth of HCC by promoting tumor-infiltrating CD8+ effector T cells to secrete perforin and granzyme B. This novel finding provides a deeper understanding of the role of PD-1 in immune regulation and has significant implications for cancer immunotherapies targeting PD-1. PMID:27141339

  14. Glioblastoma formation from cell population depleted of Prominin1-expressing cells.

    Directory of Open Access Journals (Sweden)

    Kenji Nishide

    Full Text Available Prominin1 (Prom1, also known as CD133 in human has been widely used as a marker for cancer stem cells (CSCs, which self-renew and are tumorigenic, in malignant tumors including glioblastoma multiforme (GBM. However, there is other evidence showing that Prom1-negative cancer cells also form tumors in vivo. Thus it remains controversial whether Prom1 is a bona fide marker for CSCs. To verify if Prom1-expressing cells are essential for tumorigenesis, we established a mouse line, whose Prom1-expressing cells can be eliminated conditionally by a Cre-inducible DTA gene on the Prom1 locus together with a tamoxifen-inducible CreER(TM, and generated glioma-initiating cells (GICs-LD by overexpressing both the SV40 Large T antigen and an oncogenic H-Ras(L61 in neural stem cells of the mouse line. We show here that the tamoxifen-treated GICs-LD (GICs-DTA form tumor-spheres in culture and transplantable GBM in vivo. Thus, our studies demonstrate that Prom1-expressing cells are dispensable for gliomagenesis in this mouse model.

  15. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M;

    1992-01-01

    Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...... of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell...

  16. Differences in CART expression and cell cycle behavior discriminate sympathetic neuroblast from chromaffin cell lineages in mouse sympathoadrenal cells.

    Science.gov (United States)

    Chan, Wing Hei; Gonsalvez, David G; Young, Heather M; Southard-Smith, E Michelle; Cane, Kylie N; Anderson, Colin R

    2016-02-01

    Adrenal medullary chromaffin cells and peripheral sympathetic neurons originate from a common sympathoadrenal (SA) progenitor cell. The timing and phenotypic changes that mark this lineage diversification are not fully understood. The present study investigated the expression patterns of phenotypic markers, and cell cycle dynamics, in the adrenal medulla and the neighboring suprarenal ganglion of embryonic mice. The noradrenergic marker, tyrosine hydroxylase (TH), was detected in both presumptive adrenal medulla and sympathetic ganglion cells, but with significantly stronger immunostaining in the former. There was intense cocaine and amphetamine-regulated transcript (CART) peptide immunostaining in most neuroblasts, whereas very few adrenal chromaffin cells showed detectable CART immunostaining. This phenotypic segregation appeared as early as E12.5, before anatomical segregation of the two cell types. Cell cycle dynamics were also examined. Initially, 88% of Sox10 positive (+) neural crest progenitors were proliferating at E10.5. Many SA progenitor cells withdrew from the cell cycle at E11.5 as they started to express TH. Whereas 70% of neuroblasts (TH+/CART+ cells) were back in the cell cycle at E12.5, only around 20% of chromaffin (CART negative) cells were in the cell cycle at E12.5 and subsequent days. Thus, chromaffin cell and neuroblast lineages showed differences in proliferative behavior from their earliest appearance. We conclude that the intensity of TH immunostaining and the expression of CART permit early discrimination of chromaffin cells and sympathetic neuroblasts, and that developing chromaffin cells exhibit significantly lower proliferative activity relative to sympathetic neuroblasts.

  17. Embryo quality predictive models based on cumulus cells gene expression

    Directory of Open Access Journals (Sweden)

    Devjak R

    2016-06-01

    Full Text Available Since the introduction of in vitro fertilization (IVF in clinical practice of infertility treatment, the indicators for high quality embryos were investigated. Cumulus cells (CC have a specific gene expression profile according to the developmental potential of the oocyte they are surrounding, and therefore, specific gene expression could be used as a biomarker. The aim of our study was to combine more than one biomarker to observe improvement in prediction value of embryo development. In this study, 58 CC samples from 17 IVF patients were analyzed. This study was approved by the Republic of Slovenia National Medical Ethics Committee. Gene expression analysis [quantitative real time polymerase chain reaction (qPCR] for five genes, analyzed according to embryo quality level, was performed. Two prediction models were tested for embryo quality prediction: a binary logistic and a decision tree model. As the main outcome, gene expression levels for five genes were taken and the area under the curve (AUC for two prediction models were calculated. Among tested genes, AMHR2 and LIF showed significant expression difference between high quality and low quality embryos. These two genes were used for the construction of two prediction models: the binary logistic model yielded an AUC of 0.72 ± 0.08 and the decision tree model yielded an AUC of 0.73 ± 0.03. Two different prediction models yielded similar predictive power to differentiate high and low quality embryos. In terms of eventual clinical decision making, the decision tree model resulted in easy-to-interpret rules that are highly applicable in clinical practice.

  18. Effect of Exogenous Ghrelin on Cell Differentiation Antigen 40 Expression in Endothelial Cells

    Institute of Scientific and Technical Information of China (English)

    Min ZHANG; Fang YUAN; Hui CHEN; Xingbiao QIU; Weiyi FANG

    2007-01-01

    Ghrelin is a brain-gut peptide that serves as a natural ligand for growth hormone secretagogue receptor (GHSR). It also exists abundantly in the cardiovascular system. In order to evaluate the possible role of ghrelin in the development of atherosclerosis, the effect of ghrelin on the expression of cell differentiation antigen 40 (CD40) were studied. Human umbilical vein endothelial cell (HUVEC) line-ECV 304 was pretreated with different concentrations of ghrelin, des-acyl ghrelin or [d-Lys]-GHRP-6 (a ghrelin receptor antagonist), and then induced with tumor necrosis factor-α (TNF-α) and interferon γ (IFN-γ). The mRNA levels of CD40 were analyzed by reverse transcription-polymerase chain reaction, and the expressions of CD40 protein in the cells were measured by flow cytometry (FCM) and Western blotting. The results showed that exogenous ghrelin could significantly inhibit TNF-α/IFN-γinduced CD40 expression in HUVEC cells in a concentration-dependent manner. When treated with 1000 ng/ml of ghrelin, the mRNA level of CD40 in the cells was decreased by approximately 77%, but when treated with both 1000 ng/ml of ghrelin and 1000 ng/ml of [d-Lys]-GHRP-6, the mRNA level of CD40 in the cells was decreased by only 42%,suggesting that [d-Lys]-GHRP-6 could counteract the inhibitory effect of ghrelin in these cells. However,CD40 expression was not inhibited by des-acyl ghrelin at 1000 ng/ml. The results in protein expression analysis detected by FCM and Western blotting further confirmed these results. Our results suggested that in the cardiovascular system, ghrelin not only has an anti-inflammatory effect, but also has a significant immunoregulatory effect that may be mediated through the GHSR-1 a receptor.

  19. Effect of Interaction between Chromatin Loops on Cell-to-Cell Variability in Gene Expression.

    Directory of Open Access Journals (Sweden)

    Tuoqi Liu

    2016-05-01

    Full Text Available According to recent experimental evidence, the interaction between chromatin loops, which can be characterized by three factors-connection pattern, distance between regulatory elements, and communication form, play an important role in determining the level of cell-to-cell variability in gene expression. These quantitative experiments call for a corresponding modeling effect that addresses the question of how changes in these factors affect variability at the expression level in a systematic rather than case-by-case fashion. Here we make such an effort, based on a mechanic model that maps three fundamental patterns for two interacting DNA loops into a 4-state model of stochastic transcription. We first show that in contrast to side-by-side loops, nested loops enhance mRNA expression and reduce expression noise whereas alternating loops have just opposite effects. Then, we compare effects of facilitated tracking and direct looping on gene expression. We find that the former performs better than the latter in controlling mean expression and in tuning expression noise, but this control or tuning is distance-dependent, remarkable for moderate loop lengths, and there is a limit loop length such that the difference in effect between two communication forms almost disappears. Our analysis and results justify the facilitated chromatin-looping hypothesis.

  20. Induction of Ski protein expression upon luteinization in rat granulosa cells without a change in its mRNA expression.

    Science.gov (United States)

    Kim, Hyun; Yamanouchi, Keitaro; Matsuwaki, Takashi; Nishihara, Masugi

    2012-01-01

    The Ski protein is implicated in the proliferation/differentiation of a variety of cells. We previously reported that the Ski protein is present in granulosa cells of atretic follicles, but not in preovulatory follicles, suggesting that Ski has a role in apoptosis of granulosa cells. However, granulosa cells cannot only undergo apoptosis but can alternatively differentiate into luteal cells. It is unknown whether Ski is expressed and has a role in granulosa cells undergoing luteinization. Thus, the aim of the present study was to determine the localization of the Ski protein in the rat ovary during luteinization to examine if Ski might play a role in this process. In order to examine the Ski protein expression during the progression of luteinization, follicular growth was induced in immature female rats by administration of equine chorionic gonadotropin, and luteinization was induced by human chorionic gonadotropin treatment to mimic the luteinizing hormone (LH) surge. While no Ski-positive granulosa cells were present in the preovulatory follicle, Ski protein expression was induced in response to the LH surge and was maintained after formation of the corpus luteum (CL). Although the Ski protein is absent from the granulosa cells of the preovulatory follicle, its mRNA (c-ski) was expressed, and the level of c-ski mRNA was unchanged even after the LH surge. The combined results demonstrated that Ski protein expression is induced in granulosa cells upon luteinization, and suggested that its expression is regulated posttranscriptionally.

  1. Growth hormone increases vascular cell adhesion molecule 1 expression

    DEFF Research Database (Denmark)

    Hansen, Troels Krarup; Fisker, Sanne; Dall, Rolf

    2004-01-01

    We investigated the impact of GH administration on endothelial adhesion molecules, vascular cell adhesion molecule-1 (VCAM-1) and E-selectin, in vivo and in vitro. Soluble VCAM-1, E-selectin, and C-reactive protein concentrations were measured before and after treatment in 25 healthy subjects...... and 25 adult GH-deficient (GHD) patients randomized to GH treatment or placebo. Furthermore, we studied the direct effect of GH and IGF-I and serum from GH-treated subjects on basal and TNF alpha-stimulated expression of VCAM-1 and E-selectin on cultured human umbilical vein endothelial cells. Baseline...... levels of VCAM-1, but not E-selectin, were significantly lower in GHD patients than in healthy subjects (362 +/- 15 microg/liter vs. 516 +/- 21 microg/liter, P treatment, compared with placebo [net difference between groups 151.8 microg/liter (95...

  2. Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying Ying; Zhu, Jin Yong; Chan, King Ming, E-mail: kingchan@cuhk.edu.hk

    2014-12-15

    Highlights: • Cd stimulated ZFL cell proliferation with decreasing apoptotic cell numbers. • Cd down regulated p53 and RAD51. • Cd up regulated immediate early cancer genes of GADD45 and growth factors. • Cd promoted tumorigenic effects in ZFL cells. - Abstract: Cadmium (Cd) is one of the major transitional metal that has toxic effects in aquatic organisms and their associated ecosystem; however, its hepatic toxicity and carcinogenicity are not very well characterized. We used a zebrafish liver (ZFL) cell line as a model to investigate the mechanism of Cd-induced toxicity on hepatocytes. Our results showed that Cd can be effectively accumulated in ZFL cells in our exposure experiments. Cell cytotoxicity assays and flow cytometer measurements revealed that Cd{sup 2+} stimulated ZFL cell proliferation with decreasing apoptotic cell numbers indicating potentially tumorigenic effects of Cd in ZFL cells. Gene expression profiles also indicated that Cd downregulated oncogenes p53 and rad51 and upregulated immediate response oncogenes, growth arrest and DNA damage-inducible (gadd45) genes, and growth factors. We also found dramatic changes in the gene expression of c-jun and igf1rb at different exposure time points, supporting the notion that potentially tumorigenic of Cd-is involved in the activation of immediate early genes or genes related to apoptosis in cancer promotion.

  3. Effects of cell-cycle-dependent expression on random fluctuations in protein levels.

    Science.gov (United States)

    Soltani, Mohammad; Singh, Abhyudai

    2016-12-01

    Expression of many genes varies as a cell transitions through different cell-cycle stages. How coupling between stochastic expression and cell cycle impacts cell-to-cell variability (noise) in the level of protein is not well understood. We analyse a model where a stable protein is synthesized in random bursts, and the frequency with which bursts occur varies within the cell cycle. Formulae quantifying the extent of fluctuations in the protein copy number are derived and decomposed into components arising from the cell cycle and stochastic processes. The latter stochastic component represents contributions from bursty expression and errors incurred during partitioning of molecules between daughter cells. These formulae reveal an interesting trade-off: cell-cycle dependencies that amplify the noise contribution from bursty expression also attenuate the contribution from partitioning errors. We investigate the existence of optimum strategies for coupling expression to the cell cycle that minimize the stochastic component. Intriguingly, results show that a zero production rate throughout the cell cycle, with expression only occurring just before cell division, minimizes noise from bursty expression for a fixed mean protein level. By contrast, the optimal strategy in the case of partitioning errors is to make the protein just after cell division. We provide examples of regulatory proteins that are expressed only towards the end of the cell cycle, and argue that such strategies enhance robustness of cell-cycle decisions to the intrinsic stochasticity of gene expression.

  4. NOTCH3 expression is induced in mural cells through an autoregulatory loop that requires endothelial-expressed JAGGED1.

    Science.gov (United States)

    Liu, Hua; Kennard, Simone; Lilly, Brenda

    2009-02-27

    Endothelial cells and mural cells (smooth muscle cells, pericytes, or fibroblasts) are known to communicate with one another. Their interactions not only serve to support fully functional blood vessels but also can regulate vessel assembly and differentiation or maturation. In an effort to better understand the molecular components of this heterotypic interaction, we used a 3D model of angiogenesis and screened for genes, which were modulated by coculturing of these 2 different cell types. In doing so, we discovered that NOTCH3 is one gene whose expression is robustly induced in mural cells by coculturing with endothelial cells. Knockdown by small interfering RNA revealed that NOTCH3 is necessary for endothelial-dependent mural cell differentiation, whereas overexpression of NOTCH3 is sufficient to promote smooth muscle gene expression. Moreover, NOTCH3 contributes to the proangiogenic abilities of mural cells cocultured with endothelial cells. Interestingly, we found that the expression of NOTCH3 is dependent on Notch signaling, because the gamma-secretase inhibitor DAPT blocked its upregulation. Furthermore, in mural cells, a dominant-negative Mastermind-like1 construct inhibited NOTCH3 expression, and endothelial-expressed JAGGED1 was required for its induction. Additionally, we demonstrated that NOTCH3 could promote its own expression and that of JAGGED1 in mural cells. Taken together, these data provide a mechanism by which endothelial cells induce the differentiation of mural cells through activation and induction of NOTCH3. These findings also suggest that NOTCH3 has the capacity to maintain a differentiated phenotype through a positive-feedback loop that includes both autoregulation and JAGGED1 expression.

  5. Expression and function of mixed lineage kinases in dendritic cells.

    Science.gov (United States)

    Handley, Matthew E; Rasaiyaah, Jane; Barnett, James; Thakker, Manish; Pollara, Gabriele; Katz, David R; Chain, Benjamin M

    2007-08-01

    Dendritic cells (DCs) sense the presence of conserved microbial structures in their local microenvironment via specific pattern recognition receptors (PRRs). This leads to a programme of changes, which include migration and activation, and enables them to induce adaptive T cell immunity. Mitogen-activated protein kinases (MAPKs) are implicated in this response, but the pathways leading from PRR ligation to MAPK activation, and hence DC activation, are not fully understood. Recent studies in the nervous system have suggested that the mixed lineage kinase (MLK) family of MAPK kinase kinase proteins may be involved as an intermediary step between PRRs and MAPKs. Therefore, in this study, we have used a well-established DC model to explore the role of MLKs in these cells. Messenger RNA for MLKs 2, 3, 4 and DLK and protein for MLKs 2, 3 and DLK are found in DC. DC activation in response to model PRR ligands, such as LPS or poly (I:C), is accompanied by phosphorylation of MLK3. In contrast, another known PRR ligand, zymosan, induces little MLK3 phosphorylation. Inhibition of MLK activity using a pharmacological inhibitor, CEP11004, blocks p38 and Jun N-terminal kinase (JNK) MAPK activation in response to LPS and poly (I:C), but not zymosan. The inhibition is associated with a block in DC activation as measured by cell-surface marker expression and cytokine secretion. Thus, MLKs are expressed in DC, and are implicated in DC activation, and the involvement of MLKs appears to be selective, depending on the nature of the DC stimulus.

  6. Expression of an accessory cell phenotype by hairy cells during lymphocyte colony formation in agar culture.

    Science.gov (United States)

    Farcet, J P; Gourdin, M F; Testa, U; Andre, C; Jouault, H; Reyes, F

    1983-01-01

    Human T lymphocytes require the cooperation of accessory cells to generate lymphocyte colonies in agar culture under PHA stimulation. Various hairy cell enriched fractions, as well as normal monocytes, have been found to be able to initiate colony formation by normal lymphocytes. Leukemic monocytes from CMML patients were also effective, but not the leukemic lymphocytes from CLL patients. The phenotype expressed by HC in agar colonies was further studied using cell surface and enzymatic markers. We have concluded that HC in agar culture in the presence of both normal T lymphocytes and PHA lose the B phenotype that they express in vivo and function like an accessory cell in contrast to normal or leukemic B lymphocytes.

  7. Arsenic trioxide inhibits cell proliferation and human papillomavirus oncogene expression in cervical cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hongtao [Department of Pathology, School of Medicine, Southeast University, Nanjing 210009 (China); Gao, Peng [Department of Internal Medicine, University of Iowa, Iowa City, IA 52242 (United States); Zheng, Jie, E-mail: jiezheng54@126.com [Department of Pathology, School of Medicine, Southeast University, Nanjing 210009 (China)

    2014-09-05

    Highlights: • As{sub 2}O{sub 3} inhibits growth of cervical cancer cells and expression of HPV oncogenes in these cells. • HPV-negative cervical cancer cells are more sensitive to As{sub 2}O{sub 3} than HPV-positive cervical cancer cells. • HPV-18 positive cervical cancer cells are more sensitive to As{sub 2}O{sub 3} than HPV-16 positive cancer cells. • Down-regulation of HPV oncogenes by As{sub 2}O{sub 3} is partially due to the diminished AP-1 binding. - Abstract: Arsenic trioxide (As{sub 2}O{sub 3}) has shown therapeutic effects in some leukemias and solid cancers. However, the molecular mechanisms of its anticancer efficacy have not been clearly elucidated, particularly in solid cancers. Our previous data showed that As{sub 2}O{sub 3} induced apoptosis of human papillomavirus (HPV) 16 DNA-immortalized human cervical epithelial cells and cervical cancer cells and inhibited the expression of HPV oncogenes in these cells. In the present study, we systemically examined the effects of As{sub 2}O{sub 3} on five human cervical cancer cell lines and explored the possible molecular mechanisms. MTT assay showed that HPV-negative C33A cells were more sensitive to growth inhibition induced by As{sub 2}O{sub 3} than HPV-positive cervical cancer cells, and HPV 18-positive HeLa and C4-I cells were more sensitive to As{sub 2}O{sub 3} than HPV 16-positive CaSki and SiHa cells. After As{sub 2}O{sub 3} treatment, both mRNA and protein levels of HPV E6 and E7 obviously decreased in all HPV positive cell lines. In contrast, p53 and Rb protein levels increased in all tested cell lines. Transcription factor AP-1 protein expression decreased significantly in HeLa, CaSki and C33A cells with ELISA method. These results suggest that As{sub 2}O{sub 3} is a potential anticancer drug for cervical cancer.

  8. Deficient Fas expression by CD4+ CCR5+ T cells in multiple sclerosis

    DEFF Research Database (Denmark)

    Julià, Eva; Montalban, Xavier; Al-Zayat, Hammad;

    2006-01-01

    OBJECTIVE: To evaluate whether T cells expressing CCR5 and CXCR3 from multiple sclerosis (MS) patients are more resistant to apoptosis. METHODS: Expression of CD69, TNF-R1, Fas, FasL, bcl-2, and bax was investigated in 41 MS patients and 12 healthy controls by flow cytometry in CD4+ and CD8+ T...... cells expressing CCR5 and CXCR3. RESULTS: In MS patients, the percentage of CD69 was increased and Fas expression decreased in CD4+ CCR5+ T cells. INTERPRETATION: The lower Fas expression in activated CD4+ CCR5+ T cells might contribute to disease pathogenesis by prolonging cell survival and favoring...

  9. Analysis of cell growth and gene expression of porcine adipose tissue-derived mesenchymal stem cells as nuclear donor cell.

    Science.gov (United States)

    Oh, Hyun Ju; Park, Jung Eun; Park, Eun Jung; Kim, Min Jung; Kim, Geon A; Rhee, Sang Ho; Lim, Sang Hyun; Kang, Sung Keun; Lee, Byeong Chun

    2014-12-01

    In several laboratory animals and humans, adipose tissue-derived mesenchymal stem cells (ASC) are of considerable interest because they are easy to harvest and can generate a huge proliferation of cells from a small quantity of fat. In this study, we investigated: (i) the expression patterns of reprogramming-related genes in porcine ASC; and (ii) whether ASC can be a suitable donor cell type for generating cloned pigs. For these experiments, ASC, adult skin fibroblasts (AF) and fetal fibroblasts (FF) were derived from a 4-year-old female miniature pig. The ASC expressed cell-surface markers characteristic of stem cells, and underwent in vitro differentiation when exposed to specific differentiation-inducing conditions. Expression of DNA methyltransferase (DNMT)1 in ASC was similar to that in AF, but the highest expression of the DNMT3B gene was observed in ASC. The expression of OCT4 was significantly higher in FF and ASC than in AF (P development rate of cloned embryos derived from ASC was comparable to the development of those derived using FF. Total cell numbers of blastocysts derived using ASC and FF were significantly higher than in embryos made with AF. The results demonstrated that ASC used for SCNT have a potential comparable to those of AF and FF in terms of embryo in vitro development and blastocyst formation.

  10. Adult human liver mesenchymal progenitor cells express phenylalanine hydroxylase.

    Science.gov (United States)

    Baruteau, Julien; Nyabi, Omar; Najimi, Mustapha; Fauvart, Maarten; Sokal, Etienne

    2014-09-01

    Phenylketonuria (PKU) is one of the most prevalent inherited metabolic diseases and is accountable for a severe encephalopathy by progressive intoxication of the brain by phenylalanine. This results from an ineffective L-phenylalanine hydroxylase enzyme (PAH) due to a mutated phenylalanine hydroxylase (PAH) gene. Neonatal screening programs allow an early dietetic treatment with restrictive phenylalanine intake. This diet prevents most of the neuropsychological disabilities but remains challenging for lifelong compliance. Adult-derived human liver progenitor cells (ADHLPC) are a pool of precursors that can differentiate into hepatocytes. We aim to study PAH expression and PAH activity in a differenciated ADHLPC. ADHLPC were isolated from human hepatocyte primary culture of two different donors and differenciated under specific culture conditions. We demonstrated the high expression of PAH and a large increase of PAH activity in differenciated LPC. The age of the donor, the cellular viability after liver digestion and cryopreservation affects PAH activity. ADHLPC might therefore be considered as a suitable source for cell therapy in PKU.

  11. Gene transfer and expression of enhanced green fluorescent protein in variant HT-29c cells

    Institute of Scientific and Technical Information of China (English)

    Min Wang; Lars Boenicke; Bradley D. Howard; Ilka Vogel; Hoiger Kalthoff

    2003-01-01

    AIM: To study the expression of enhanced green fluorescent protein (EGFP) gene in retrovirally transduced variant HT29 cells.METHODS: The retroviral vector prkat EGFP/neo was constructed and transfected into the 293T cell using a standard calcium phosphate precipitation method. HT-29c cells (selected from HT-29 cells) were transduced by a retroviral vector encoding the GEFP gene. The fluorescence intensity of colorectal carcinoma HT-29c cells after transduced with the EGFP bearing retrovirus was visualized using fluorescence microscope and fluorescence activated cell sorter (FACS) analysis. Multiple biological behaviors of transduced cells such as the proliferating potential and the expression of various antigens were comparatively analyzed between untransduced and transduced cells in vitro. EGFP expression of the fresh tumor tissue was assessed in vivo.RESULTS: After transduced, HT-29c cells displayed a stable and long-term EGFP expression under the nonselective conditionsin vitro. After cells were successively cultured to passage 50 in vitro, EGFP expression was still at a high level. Their biological behaviors, such as expression of tumor antigens, proliferation rate and aggregation capability were not different compared to untransduced parental cells in vitro. In subcutaneous tumors, EGFP was stable and highly expressed.CONCLUSION: An EGFP expressing retroviral vector was used to transduce HT-29c cells. The transduced cells show a stable and long-term EGFP expression in vitro and in vivo.These cells with EGFP are a valuable tool forin vivo research of tumor metastatic spread.

  12. Expression of tumor antigens on primary ovarian cancer cells compared to established ovarian cancer cell lines

    Science.gov (United States)

    Kloudová, Kamila; Hromádková, Hana; Partlová, Simona; Brtnický, Tomáš; Rob, Lukáš; Bartůňková, Jiřina; Hensler, Michal; Halaška, Michael J.; Špíšek, Radek; Fialová, Anna

    2016-01-01

    In order to select a suitable combination of cancer cell lines as an appropriate source of antigens for dendritic cell-based immunotherapy of ovarian cancer, we analyzed the expression level of 21 tumor associated antigens (BIRC5, CA125, CEA, DDX43, EPCAM, FOLR1, Her-2/neu, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, MUC-1, NY-ESO-1, PRAME, p53, TPBG, TRT, WT1) in 4 established ovarian cancer cell lines and in primary tumor cells isolated from the high-grade serous epithelial ovarian cancer tissue. More than 90% of tumor samples expressed very high levels of CA125, FOLR1, EPCAM and MUC-1 and elevated levels of Her-2/neu, similarly to OVCAR-3 cell line. The combination of OV-90 and OVCAR-3 cell lines showed the highest overlap with patients' samples in the TAA expression profile. PMID:27323861

  13. Titanium phosphate glass microcarriers induce enhanced osteogenic cell proliferation and human mesenchymal stem cell protein expression

    Directory of Open Access Journals (Sweden)

    Nilay J Lakhkar

    2015-11-01

    Full Text Available In this study, we have developed 50- to 100-µm-sized titanium phosphate glass microcarriers (denoted as Ti5 that show enhanced proliferation of human mesenchymal stem cells and MG63 osteosarcoma cells, as well as enhanced human mesenchymal stem cell expression of bone differentiation markers, in comparison with commercially available glass microspheres at all time points. We also demonstrate that these microcarriers provide superior human mesenchymal stem cell proliferation with conventional Dulbecco’s Modified Eagle medium than with a specially developed commercial stem cell medium. The microcarrier proliferative capacity is revealed by a 24-fold increase in MG63 cell numbers in spinner flask bioreactor studies performed over a 7-day period, versus only a 6-fold increase in control microspheres under the same conditions; the corresponding values of Ti5 and control microspheres under static culture are 8-fold and 7-fold, respectively. The capability of guided osteogenic differentiation is confirmed by ELISAs for bone morphogenetic protein-2 and osteopontin, which reveal significantly greater expression of these markers, especially osteopontin, by human mesenchymal stem cells on the Ti5 microspheres than on the control. Scanning electron microscopy and confocal laser scanning microscopy images reveal favorable MG63 and human mesenchymal stem cell adhesion on the Ti5 microsphere surfaces. Thus, the results demonstrate the suitability of the developed microspheres for use as microcarriers in bone tissue engineering applications.

  14. Ectopic expression of B-lymphoid kinase in cutaneous T-cell lymphoma

    DEFF Research Database (Denmark)

    Krejsgaard, Thorbjørn; Vetter-Kauczok, Claudia S; Woetmann, Anders;

    2009-01-01

    B-lymphoid kinase (Blk) is exclusively expressed in B cells and thymocytes. Interestingly, transgenic expression of a constitutively active form of Blk in the T-cell lineage of mice results in the development of T-lymphoid lymphomas. Here, we demonstrate nuclear factor-kappa B (NF......-kappaB)-mediated ectopic expression of Blk in malignant T-cell lines established from patients with cutaneous T-cell lymphoma (CTCL). Importantly, Blk is also expressed in situ in lesional tissue specimens from 26 of 31 patients with CTCL. Already in early disease the majority of epidermotropic T cells express Blk...... phosphorylated in malignant CTCL cell lines and spontaneously active in kinase assays. Furthermore, targeting Blk activity and expression by Src kinase inhibitors and small interfering RNA (siRNA) inhibit the proliferation of the malignant T cells. In conclusion, this is the first report of Blk expression...

  15. FcRn expression, ligands binding properties and its regulation in human immune cells and hepatocytes

    OpenAIRE

    2007-01-01

    ABSTRACT Expression and diverse functions of MHC class I related neonatal Fc receptor in different tissues is continually reported. To contribute to the understanding of how the receptor functions according to cell type, we investigated the expression and ligands binding properties of FcRn in human immune cells and hepatocytes. Here, we report that heterodimeric FcRn is expressed in these cells as evidenced by RT-PCR, Western immunoblottting and flow cytometry. The receptor expression i...

  16. Increased T cell expression of CD154 (CD40-ligand) in multiple sclerosis

    DEFF Research Database (Denmark)

    Jensen, J; Krakauer, M; Sellebjerg, F

    2001-01-01

    CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients with sec......CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients...

  17. Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis.

    Science.gov (United States)

    Tai, Mei-Hui; Chang, Chia-Cheng; Kiupel, Matti; Webster, Joshua D; Olson, L Karl; Trosko, James E

    2005-02-01

    The Oct3/4 gene, a POU family transcription factor, has been noted as being specifically expressed in embryonic stem cells and in tumor cells but not in cells of differentiated tissues. With the ability to isolate adult human stem cells it became possible to test for the expression of Oct3/4 gene in adult stem cells and to test the stem cell theory of carcinogenesis. Using antibodies and PCR primers we tested human breast, liver, pancreas, kidney, mesenchyme and gastric stem cells, the cancer cell lines HeLa and MCF-7 and human, dog and rat tumors for Oct4 expression. The results indicate that adult human stem cells, immortalized non-tumorigenic cells and tumor cells and cell lines, but not differentiated cells, express Oct4. Oct4 is expressed in a few cells found in the basal layer of human skin epidermis. The data demonstrate that adult stem cells maintain expression of Oct4, consistent with the stem cell hypothesis of carcinogenesis.

  18. Forced expression of OCT4 influences the expression of pluripotent genes in human mesenchymal stem cells and fibroblasts.

    Science.gov (United States)

    Palma, C S; Tannous, M A; Malta, T M; Russo, E M S; Covas, D T; Picanço-Castro, V

    2013-04-02

    Genetic reprogramming of adult cells to generate induced pluripotent stem (iPS) cells is a new and important step in sidestepping some of the ethical issues and risks involved in the use of embryonic stem cells. iPS cells can be generated by introduction of transcription factors, such as OCT4, SOX2, KLF4, and CMYC. iPS cells resemble embryonic stem cells in their properties and differentiation potential. The mechanisms that lead to induced pluripotency and the effect of each transcription factor are not completely understood. We performed a critical evaluation of the effect of overexpressing OCT4 in mesenchymal stem cells and fibroblasts and found that OCT4 can activate the expression of other stemness genes, such as SOX2, NANOG, CMYC, FOXD3, KLF4, and βCATENIN, which are not normally or are very weakly expressed in mesenchymal stem cells. Transient expression of OCT4 was also performed to evaluate whether these genes are affected by its overexpression in the first 48 h. Transfected fibroblast cells expressed around 275-fold more OCT4 than non-transfected cells. In transient expression, in which cells were analyzed after 48 h, we detected only the up-regulation of FOXD3, SOX2, and KLF4 genes, suggesting that these genes are the earlier targets of OCT4 in this cellular type. We conclude that forced expression of OCT4 can alter cell status and activate the pluripotent network. Knowledge gained through study of these systems may help us to understand the kinetics and mechanism of cell reprogramming.

  19. Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

    Science.gov (United States)

    A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

  20. The Expression of p53 and Cox-2 in Basal Cell Carcinoma, Squamous Cell Carcinoma and Actinic Keratosis Cases

    Directory of Open Access Journals (Sweden)

    Ülker KARAGECE YALÇIN

    2012-05-01

    Full Text Available Objective: The aim of this study was to investigate p53 and COX-2 expressions in basal cell carcinoma, squamous cell carcinoma and actinic keratoses, and to determine a possible relationship.Material and Method: 50 basal cell carcinoma, 45 squamous cell carcinoma and 45 actinic keratosis cases were evaluated. The type of tumor in basal cell carcinoma and tumor differentiation in squamous cell carcinoma were noted and the paraffin block that best represented the tumor was chosen. Immunostaining by p53 and COX-2 was performed on sections of the paraffin blocks.Results: p53 expression was observed in 98% of basal cell carcinoma, 88.9% of squamous cell carcinoma and all actinic keratosis cases. p53 expression was also noted in non-dysplastic appearing epithelium in actinic keratosis cases. COX-2 expression was seen in 90, 100 and 88.9% of the basal cell carcinoma, squamous cell carcinoma and actinic keratosis groups, respectively. Skin appendages, inflammatory cells and vascular structures were also stained by COX-2 besides tumor tissue. COX-2 expression increased by the p53 expression increase in basal cell carcinoma and squamous cell carcinoma. p53 and COX-2 expressions were not related in terms of tumor type in the BCC and were not related in terms of differentiation in SCC.Conclusion: The existence of p53 expression in actinic keratosis cases has supported the idea that p53 plays a role in the early steps of carcinogenesis in skin cancers. The fact that the expression of COX-2 increases in line with the increase of p53 expression in basal cell carcinoma and squamous cell carcinoma cases indicates that COX-2 expression may be affected by p53

  1. Plasma cell alloantigen ENPP1 is expressed by a subset of human B cells with potential regulatory functions.

    Science.gov (United States)

    Yoon, Jeongheon; Wang, Hongsheng; Kim, Yong Chan; Yoshimoto, Momoko; Abbasi, Sadia; Morse Iii, Herbert C

    2016-09-01

    Plasma cell alloantigen 1 (PC1), also known as ENPP1 (ectonucleotide pyrophosphatase/phosphodiesterase 1), is an enzyme involved primarily in hydrolysis of adenosine triphosphate at the cell surface. Although the expression pattern of PC1 is relatively broad, its expression in B cells is found at significant levels only in terminally differentiated germinal center B cells, plasma cells and a subset of B-1a cells in mice. Here we describe studies designed to determine whether expression of PC1 might define novel populations of human B cells with similarities to mouse B cells. We found that PC1 is expressed in small populations of human B lineage cells in peripheral blood, cord blood, tonsils, bone marrow and pediatric peritoneal fluid, with the highest levels in plasma cells. The characteristics of human PC1(+) B cells differ from mouse peritoneal B-1a subsets and from features of the human CD20(+)CD27(+)CD43(+)CD70(-) B-cell subset proposed to be human B-1 cells. Expression of PC1 was greatly increased in B cells stimulated with the combination of CD40 ligand, interleukin (IL)-4 and IL-21. In addition, PC1(+) B cells activated CD4(+) T regulatory cells. ENPP1 thus defines a subset of human B cells that differs significantly from mouse peritoneal B-1a and proposed human B-1 cells.

  2. A rapid and efficient method to express target genes in mammalian cells by baculovirus

    Institute of Scientific and Technical Information of China (English)

    Tong Cheng; Chen-Yu Xu; Ying-Bin Wang; Min Chen; Ting Wu; Jun Zhang; Ning-Shao Xia

    2004-01-01

    AIM: To investigate the modification of baculovirus vector and the feasibility of delivering exogenous genes into mammalian cells with the culture supernatant of Spodoptera frugiperta (Sf9) cells infected by recombinant baculoviruses.METHODS: Two recombinant baculoviruses (BacV-CMVEGFPA, BacV-CMV-EGFPB) containing CMV-EGFP expression cassette were constructed. HepG2 cells were directly incubated with the culture supernatant of Sf9 cells infected by recombinant baculoviruses, and reporter gene transfer and expression efficiencies were analyzed by flow cytometry (FCM). The optimal transduction conditions were investigated by FCM assay in HepG2 cells. Gene-transfer and expression efficiencies in HepG2 or CV1 cells by baculovirus vectors were compared with lipofectAMINE, recombinant retrovirus and vaccinia virus expression systems. Twenty different mammalian cell lines were used to investigate the feasibility of delivering exogenous genes into different mammalian cells with the culture supernatant of infected Sf9 cells.RESULTS: CMV promoter could directly express reporter genes in Sf9 cells with a relatively low efficiency. Target cells incubated with the 1:1 diluted culture supernatant (moi=50) for 12 h at 37 ℃ could achieve the highest transduction and expression efficiencies with least impairment to cell viability. Under similar conditions the baculovirus vector could achieve the highest gene-transfer and expression efficiency than lipofectAMINE, recombinant retrovirus and vaccinia virus expression systems. Most mammalian cell lines could be transduced with recombinant baculovirus. In primate adherent culture cells the recombinant baculovirus could arrive the highest infection and expression efficiencies, but it was not very satisfactory in the cell lines from mice and suspended culture cells.CONCLUSION: Mammalian cells incubated with the culture supernatant of infected Sf9 cells could serve as a very convenient way for rapid and efficient expression of foreign

  3. Differential Gene Expression in Thrombomodulin (TM; CD141)+ and TM− Dendritic Cell Subsets

    OpenAIRE

    Masaaki Toda; Zhifei Shao; Yamaguchi, Ken D.; Takehiro Takagi; Corina N D'Alessandro-Gabazza; Osamu Taguchi; Hugh Salamon; Leung, Lawrence L. K.; Gabazza, Esteban C.; John Morser

    2013-01-01

    Previously we have shown in a mouse model of bronchial asthma that thrombomodulin can convert immunogenic conventional dendritic cells into tolerogenic dendritic cells while inducing its own expression on their cell surface. Thrombomodulin(+) dendritic cells are tolerogenic while thrombomodulin(-) dendritic cells are pro-inflammatory and immunogenic. Here we hypothesized that thrombomodulin treatment of dendritic cells would modulate inflammatory gene expression. Murine bone marrow-derived de...

  4. Expression of soluble triggering receptor expression on myeloid cells-1 in pleural effusion

    Institute of Scientific and Technical Information of China (English)

    HUANG Lu-ying; SHI Huan-zhong; LIANG Qiu-li; WU Yan-bin; QIN Xue-jun; CHEN Yi-qiang

    2008-01-01

    Background Tdggedng receptors expressed on myeloid cells(TREM)proteins are a family of cell surface receptors expressed broadly by cells of the myeloid lineage.The aim of this study was to investigate the clinical significance of soluble TREM-1(sTREM-1)in pleural effusions,and to determine the effects of pneumonia on pleural sTREM-1 concentrations.Methods PleuraI fluid was collected from 109 patients who presented to the respiratory institute (35 with malignant pleural effusion,31 with tuberculous pleural effusion,21 with bacteriaI pleural effusion,and 22 with transudate).The concentrations of sTREM-1,tumor necrosis factor-o(TNF-α)and interleukin-1β(IL-1β)were determined jn effusion and serum samples by enzyme Iinked immunosorbent assay(ELISA).Results The concentrations of sTREM-1 in bacterial pleural effusion were significantly higher than those in malignant.tuberculous,and transudative groups(all P<0.001).An sTREM-1 cutoff value of 768.1 ng/L had a sensitivity of 86%and a specificity of 93%.Pleural sTREM-1 Ievels were positively correlated with Ievels of TNF-α and IL-1β.Patients with complicating bacterial pneumonia did not have elevated concentration of STREM-1 jn pleural effusion when compared with patients without pneumonia.Conclusions Determination of pleural sTREM-1 may improve the ability of clinicians to differentiate pleural effusion patients of bacterial origin from those with other etiologies.The occurrence of bacterial pneumonia did not affect pleural sTREM-1 concentrations.

  5. Aristaless related homeobox gene, Arx, is implicated in mouse fetal Leydig cell differentiation possibly through expressing in the progenitor cells.

    Directory of Open Access Journals (Sweden)

    Kanako Miyabayashi

    Full Text Available Development of the testis begins with the expression of the SRY gene in pre-Sertoli cells. Soon after, testis cords containing Sertoli and germ cells are formed and fetal Leydig cells subsequently develop in the interstitial space. Studies using knockout mice have indicated that multiple genes encoding growth factors and transcription factors are implicated in fetal Leydig cell differentiation. Previously, we demonstrated that the Arx gene is implicated in this process. However, how ARX regulates Leydig cell differentiation remained unknown. In this study, we examined Arx KO testes and revealed that fetal Leydig cell numbers largely decrease throughout the fetal life. Since our study shows that fetal Leydig cells rarely proliferate, this decrease in the KO testes is thought to be due to defects of fetal Leydig progenitor cells. In sexually indifferent fetal gonads of wild type, ARX was expressed in the coelomic epithelial cells and cells underneath the epithelium as well as cells at the gonad-mesonephros border, both of which have been described to contain progenitors of fetal Leydig cells. After testis differentiation, ARX was expressed in a large population of the interstitial cells but not in fetal Leydig cells, raising the possibility that ARX-positive cells contain fetal Leydig progenitor cells. When examining marker gene expression, we observed cells as if they were differentiating into fetal Leydig cells from the progenitor cells. Based on these results, we propose that ARX acts as a positive factor for differentiation of fetal Leydig cells through functioning at the progenitor stage.

  6. Estradiol Receptors Regulate Differential Connexin 43 Expression in F98 and C6 Glioma Cell Lines.

    Directory of Open Access Journals (Sweden)

    Zahra Moinfar

    Full Text Available Glioma is the most common malignant primary brain tumour with male preponderance and poor prognosis. Glioma cells express variable amounts of connexin 43 (Cx43 and estrogen receptors (ERs. Both, Cx43 and ERs, play important roles in cell proliferation and migration. Therefore, we investigated the effects of 17-ß estradiol (E2 on Cx43 expression in two glioma cell lines with variable native expression of Cx43.F98 and C6 rat glioma cells were cultured for 24 h in the presence of 10 nM or 100 nM E2, and the E2-antagonist, Fulvestrant. An MTT assay was performed to evaluate cell viability. ERα, ERβ and Cx43 protein expressions were analysed by western blotting and Cx43 mRNA expression was analysed by real-time polymerase chain reaction. To quantify cell migration, an exclusive zone migration assay was used. Functional coupling of cells via gap junctions was examined using whole-cell patch-clamp technique.E2 reduced Cx43 expression in C6 cells, but increased Cx43 expression in F98 cultures. These effects were mediated via ERs. Moreover, E2 promoted C6 cell migration, but it did not affect F98 cell migration. The expression level of ERα was found to be high in C6, but low in F98 cells. ERβ was exclusively expressed in C6 cells. In addition, E2 treatment induced a significant decrease of ERβ in C6 cultures, while it decreased ERα expression in F98 glioma cells.These findings show that E2 differentially modulates Cx43 expression in F98 and C6 glioma cells, likely due to the differential expression of ERs in each of these cell lines. Our findings point to the molecular mechanisms that might contribute to the gender-specific differences in the malignancy of glioma and could have implications for therapeutic strategies against glioma.

  7. EXPRESSION OF PHOSPHO-(-CATENIN AND ITS SIGNIFICANCE IN NON-SMALL CELL LUNG CANCER

    Institute of Scientific and Technical Information of China (English)

    林东; 王恩华; 张志坤; 徐洪涛; 李庆昌; 邱雪杉

    2003-01-01

    Objective: To investigate phospho-(-catenin expression in non-small cell lung cancer (NSCLC) and to study the relationship between phospho-(-catenin expression and some clinical pathological factors. Methods: The expression of phospho-(-catenin in 67 primary NSCLC cases detected immunohistochemically. Results: phospho- (-catenin was not expressed in normal bronchial mucous cell and showed cytoplasmic and nuclear expression in NSCLC cell. Total positive expression rate reached 62.7%, and positive expression rate of nucleus was 38.8%. The positive expression rate (87.5%) and nuclear expression rate of adenocarcinoma (62.5%) were apparently higher than those of squamous cell cancer (40.0% and 17.1%) (P<0.01). Expression of phospho-(-catenin had no relationship to differentiation degree and lymphatic metastasis. The postoperative survival time is not related to phospho-(- catenin expression. (Log-rank test, P=0.9198; P=0.6274). COX model analysis showed that tumor stage and differentiation are independent risk factors to prognosis (P=0.001; P=0.020). Conclusion: NSCLC cells show positive expression of phospho-(-catenin, phospho-(-catenin nuclear expression is relevant to histological types. There is no difference in postoperative survival time between patients with phospho-(-catenin positive expression and patients with negative expression, expression of phospho-(- catenin is not independent risk factor to prognosis.

  8. Heterogeneity of aberrant immunoglobulin expression in cancer cells

    Institute of Scientific and Technical Information of China (English)

    Duosha Hu; Ya Cao; Zhi Duan; Ming Li; Yiqun Jiang; Haidan Liu; Hui Zheng; Lili Li; Ann M Bode; Zigang Dong

    2011-01-01

    Accumulating evidence has shown that immunoglobulin (Ig) is 'unexpectedly' expressed by epithelial cancer cells and that it can promote tumor growth.The main purpose of this study was to explore the components of the cancerous Ig and its possible function.The presence of cancerous Ig in the Golgi apparatus was confirmed by immunofluorescence,indirectly suggesting that the cancerous Ig was processed and packaged in cancer cells.Western blot analysis and ELISA results indicated that cancer cells produced membrane Ig and secreted Ig into the supernatant fraction.The cancerous Ig consists of an α heavy chain and a κ light chain.Finally,by analyzing the Ig components pulled down by protein A beads,the cancerous Ig was found to be structurally distinct from normal Ig.The cancerous Ig was truncated or aberrant.Although the underlying mechanism that causes the abnormalities has not been determined,our current discoveries strengthen our previous findings and promise fruitful future explorations.

  9. Expression of Telomerase Activity in Gastric Cancer Cells

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Objective To study the relationship between telomerase activity and biological behavior in human gastric cells and appraise the clinical significance of detecting telomerase activity. Methods The telomerase activity in 47 gastric cancer tissue samples,their matched nomal tissues,7 gastric ulcer and 2 gastric cancer cell lines was detected using a PCR-based non-radioisotopic telomeric repeat amplification protocol(TRAP) assay. Results None of the 47 samples from normal gastric tissues expressed telomerase activity.The 41 of 47 cases of gastric cancer presented telomerase activity with an 87.2% positive rate (P<0.001). 2/2 gastric cancer cell lines and 0/7 gastric ulcer line were also positive for telmerase activity.The activity of telomerase was associated with the pathological differentiation of gastric cancer. Conclusion Telomerase activity may be related to the biological behavior of gastric cancer and can help in assessing the malignant poten-tial of gastric cancer.Telomerase activity will be a good diagnostic marker for the detection of gastric cancer.

  10. Cell-based capacitance sensor for analysis of EGFR expression on cell membrane

    Science.gov (United States)

    Shin, Dong-Myeong; Shin, Yong-Cheol; Ha, Ji Hye; Lee, Jong-Ho; Han, Dong-Wook; Kim, Jong-Man; Kim, Hyung Kook; Hwang, Yoon-Hwae

    2013-02-01

    Cancer cells have many kinds of cancer biomarkers. Among them, the epidermal growth factor (EGF) receptors can show a possibility for a cancer marker because the over-expression of EGF receptor is related with fibrous, colorectal, cervical and gastric tumorigenesis. We fabricated the capacitance sensor with a gap area of 50 μm × 200 μm by using photolithography and lift-off method. Using the capacitance sensor, we investigated the time dependent capacitance changes of different kinds of fibrous cells, such as HT1080 fibrosarcoma, L-929 fibroblast cell line and nHDF dermal fibroblast primary cell. We found that when we put the EGF, the capacitance decreased due to the immobilization of EGF to EGF receptor on the cell membrane. The quantitative determination of EGF receptor level for various fibrous cells was carried out and the results showed good correlation with conventional method. Based on our results, we suggest that the capacitance sensor can measure the expression level of the EGF receptor on cell membrane and be a good candidate as a cancer diagnosis.

  11. Effect of promoter architecture on the cell-to-cell variability in gene expression.

    Directory of Open Access Journals (Sweden)

    Alvaro Sanchez

    2011-03-01

    Full Text Available According to recent experimental evidence, promoter architecture, defined by the number, strength and regulatory role of the operators that control transcription, plays a major role in determining the level of cell-to-cell variability in gene expression. These quantitative experiments call for a corresponding modeling effort that addresses the question of how changes in promoter architecture affect variability in gene expression in a systematic rather than case-by-case fashion. In this article we make such a systematic investigation, based on a microscopic model of gene regulation that incorporates stochastic effects. In particular, we show how operator strength and operator multiplicity affect this variability. We examine different modes of transcription factor binding to complex promoters (cooperative, independent, simultaneous and how each of these affects the level of variability in transcriptional output from cell-to-cell. We propose that direct comparison between in vivo single-cell experiments and theoretical predictions for the moments of the probability distribution of mRNA number per cell can be used to test kinetic models of gene regulation. The emphasis of the discussion is on prokaryotic gene regulation, but our analysis can be extended to eukaryotic cells as well.

  12. Use of RUNX2 Expression to Identify Osteogenic Progenitor Cells Derived from Human Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Li Zou

    2015-02-01

    Full Text Available We generated a RUNX2-yellow fluorescent protein (YFP reporter system to study osteogenic development from human embryonic stem cells (hESCs. Our studies demonstrate the fidelity of YFP expression with expression of RUNX2 and other osteogenic genes in hESC-derived osteoprogenitor cells, as well as the osteogenic specificity of YFP signal. In vitro studies confirm that the hESC-derived YFP+ cells have similar osteogenic phenotypes to osteoprogenitor cells generated from bone-marrow mesenchymal stem cells. In vivo studies demonstrate the hESC-derived YFP+ cells can repair a calvarial defect in immunodeficient mice. Using the engineered hESCs, we monitored the osteogenic development and explored the roles of osteogenic supplements BMP2 and FGF9 in osteogenic differentiation of these hESCs in vitro. Taken together, this reporter system provides a novel system to monitor the osteogenic differentiation of hESCs and becomes useful to identify soluble agents and cell signaling pathways that mediate early stages of human bone development.

  13. Gene Cloning of Murine α-Fetoprotein Gene and Construction of Its Eukaryotic Expression Vector and Expression in CHO Cells

    Institute of Scientific and Technical Information of China (English)

    易继林; 田耕

    2003-01-01

    To clone the murine α-fetoprotein (AFP) gene, construct the eukaryotic expression vector of AFP and express in CHO cells, total RNA were extracted from Hepa 1-6 cells, and then the murine α-fetoprotein gene was amplified by RT-PCR and cloned into the eukaryotic expression vector pcDNA3.1. The recombinant of vector was identified by restriction enzyme analysis and sequencing. A fter transient transfection of CHO cells with the vector, Western blotting was used to detect the expression of AFP. It is concluded that the 1.8kb murine α-fetoprotein gene was successfully cloned and its eukaryotic expression vector was successfully constructed.

  14. Persistent donor cell gene expression among human induced pluripotent stem cells contributes to differences with human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Zhumur Ghosh

    Full Text Available Human induced pluripotent stem cells (hiPSCs generated by de-differentiation of adult somatic cells offer potential solutions for the ethical issues surrounding human embryonic stem cells (hESCs, as well as their immunologic rejection after cellular transplantation. However, although hiPSCs have been described as "embryonic stem cell-like", these cells have a distinct gene expression pattern compared to hESCs, making incomplete reprogramming a potential pitfall. It is unclear to what degree the difference in tissue of origin may contribute to these gene expression differences. To answer these important questions, a careful transcriptional profiling analysis is necessary to investigate the exact reprogramming state of hiPSCs, as well as analysis of the impression, if any, of the tissue of origin on the resulting hiPSCs. In this study, we compare the gene profiles of hiPSCs derived from fetal fibroblasts, neonatal fibroblasts, adipose stem cells, and keratinocytes to their corresponding donor cells and hESCs. Our analysis elucidates the overall degree of reprogramming within each hiPSC line, as well as the "distance" between each hiPSC line and its donor cell. We further identify genes that have a similar mode of regulation in hiPSCs and their corresponding donor cells compared to hESCs, allowing us to specify core sets of donor genes that continue to be expressed in each hiPSC line. We report that residual gene expression of the donor cell type contributes significantly to the differences among hiPSCs and hESCs, and adds to the incompleteness in reprogramming. Specifically, our analysis reveals that fetal fibroblast-derived hiPSCs are closer to hESCs, followed by adipose, neonatal fibroblast, and keratinocyte-derived hiPSCs.

  15. Forced expression of the Oct-4 gene influences differentiation of embryonic stem cells

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    By transfecting an Oct-4 expression plasmid into embryonic stem cells (ES cells), the ES-O cell line was constructed, which sustained the expression of Oct-4 gene when induced by retinoic acid. Forced expression of Oct-4 gene could not sustain the stem property of ES-O cells without the differentiation inhibiting factor LIF, but if LIF exists,forced expression of Oct-4 gene could enhance the ability to sustain the undifferentiation state and inhibit cell differentiation induced by retinoic acid. It was indicated that Oct-4 must cooperate with LIF to sustain the undifferentiation state of ES cells. During the cell differentiation, ES-O cells tend to differentiate into neural cells, suggesting that forced expression of Oct-4 gene may be in relation with the differentiation of neuroderm.

  16. HMGB4 is expressed by neuronal cells and affects the expression of genes involved in neural differentiation

    Science.gov (United States)

    Rouhiainen, Ari; Zhao, Xiang; Vanttola, Päivi; Qian, Kui; Kulesskiy, Evgeny; Kuja-Panula, Juha; Gransalke, Kathleen; Grönholm, Mikaela; Unni, Emmanual; Meistrich, Marvin; Tian, Li; Auvinen, Petri; Rauvala, Heikki

    2016-09-01

    HMGB4 is a new member in the family of HMGB proteins that has been characterized in sperm cells, but little is known about its functions in somatic cells. Here we show that HMGB4 and the highly similar rat Transition Protein 4 (HMGB4L1) are expressed in neuronal cells. Both proteins had slow mobility in nucleus of living NIH-3T3 cells. They interacted with histones and their differential expression in transformed cells of the nervous system altered the post-translational modification statuses of histones in vitro. Overexpression of HMGB4 in HEK 293T cells made cells more susceptible to cell death induced by topoisomerase inhibitors in an oncology drug screening array and altered variant composition of histone H3. HMGB4 regulated over 800 genes in HEK 293T cells with a p-value ≤0.013 (n = 3) in a microarray analysis and displayed strongest association with adhesion and histone H2A -processes. In neuronal and transformed cells HMGB4 regulated the expression of an oligodendrocyte marker gene PPP1R14a and other neuronal differentiation marker genes. In conclusion, our data suggests that HMGB4 is a factor that regulates chromatin and expression of neuronal differentiation markers.

  17. Stage-specific embryonic antigen: determining expression in canine glioblastoma, melanoma, and mammary cancer cells

    Science.gov (United States)

    Ito, Daisuke

    2017-01-01

    The expression of stage-specific embryonic antigens (SSEAs) was determined in several types of canine cancer cells. Flow cytometry showed SSEA-1 expression in glioblastoma, melanoma, and mammary cancer cells, although none expressed SSEA-3 or SSEA-4. Expression of SSEA-1 was not detected in lymphoma, osteosarcoma, or hemangiosarcoma cell lines. Relatively stable SSEA-1 expression was observed between 24 and 72 h of culture. After 8 days in culture, sorted SSEA-1− and SSEA-1+ cells re-established SSEA-1 expression to levels comparable to those observed in unsorted cells. Our results document, for the first time, the expression of SSEA-1 in several canine cancer cell lines. PMID:27456773

  18. Andrographolide inhibits hepatoma cells growth and affects the expression of cell cycle related proteins.

    Science.gov (United States)

    Shen, Kai-Kai; Liu, Tian-Yu; Xu, Chong; Ji, Li-Li; Wang, Zheng-Tao

    2009-09-01

    The present study is aimed to investigate the toxic effects of andrographolide (Andro) on hepatoma cells and elucidate its preliminary mechanisms. After cells were treated with different concentrations of Andro (0-50 micromol x L(-1)) for 24 h, cell viability was evaluated with 3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyltetrazolium bromide (MTT) assay. Furthermore, after hepatoma cells (Hep3B and HepG2) were treated with different concentrations of Andro (0-30 micromol x L(-1)) for 14 d, the number of colony formation was accounted under microscope. Cell cycle related proteins such as Cdc-2, phosphorylated-Cdc-2, Cyclin B and Cyclin D1 were detected with Western blotting assay and the cell cycle was analyzed by flow cytometry using propidium iodide staining. MTT results showed that Andro induced growth inhibition of hepatoma cells in a concentration-dependent manner but had no significant effects on human normal liver L-02 cells. Andro dramatically decreased the colony formation of hepatoma cells in the concentration-dependent manner. Moreover, Andro induced a decrease of Hep3B cells at the G0-G1 phase and a concomitant accumulation of cells at G2-M phase. At the molecular level, Western blotting results showed that Andro decreased the expression of Cdc-2, phosphorylated-Cdc-2, Cyclin D1 and Cyclin B proteins in a time-dependent manner, which are all cell cycle related proteins. Taken together, the results demonstrated that Andro specifically inhibited the growth of hepatoma cells and cellular cell cycle related proteins were possibly involved in this process.

  19. Neuropilin-1 expression characterizes T follicular helper (Tfh) cells activated during B cell differentiation in human secondary lymphoid organs.

    Science.gov (United States)

    Renand, Amédée; Milpied, Pierre; Rossignol, Julien; Bruneau, Julie; Lemonnier, François; Dussiot, Michael; Coulon, Séverine; Hermine, Olivier

    2013-01-01

    T follicular helper (Tfh) cells play an essential role in the development of antigen-specific B cell immunity. Tfh cells regulate the differentiation and survival of activated B cells outside and inside germinal centers (GC) of secondary lymphoid organs. They act through cognate contacts with antigen-presenting B cells, but there is no current marker to specifically identify those Tfh cells which productively interact with B cells. Here we show that neuropilin 1 (Nrp1), a cell surface receptor, is selectively expressed by a subset of Tfh cells in human secondary lymphoid organs. Nrp1 expression on Tfh cells correlates with B cell differentiation in vivo and in vitro, is transient, and can be induced upon co-culture with autologous memory B cells in a cell contact-dependent manner. Comparative analysis of ex vivo Nrp1(+) and Nrp1(-) Tfh cells reveals gene expression modulation during activation. Finally, Nrp1 is expressed by malignant Tfh-like cells in a severe case of angioimmunoblastic T-cell lymphoma (AITL) associated with elevated terminal B cell differentiation. Thus, Nrp1 is a specific marker of Tfh cells cognate activation in humans, which may prove useful as a prognostic factor and a therapeutic target in neoplastic diseases associated with Tfh cells activity.

  20. Poor prognostic clinicopathologic features correlate with VEGF expression but not with PTEN expression in squamous cell carcinoma of the larynx

    Directory of Open Access Journals (Sweden)

    Karagoz Filiz

    2010-06-01

    Full Text Available Abstract Background The aim of this study was to assess the relationship between expression of vascular endothelial growth factor (VEGF and phosphatase and tensin homolog deleted in chromosome ten (PTEN, angiogenesis and clinicopathological parameters of squamous cell carcinoma of the larynx. Methods We examined immunohistochemical expression of VEGF and PTEN and CD34 for microvessel density (MVD in sections of formalin-fixed, paraffin embedded tissue blocks of 140 patients with squamous cell carcinoma of the larynx. The intensity of VEGF and PTEN staining and the proportion of cells staining were scored. Results The tumor grade was not significantly related to PTEN expression, but it was to VEGF expression (p = 0.400; p = 0.015, respectively. While there was no significant relationship between PTEN expression and tumor size and cartilage invasion (p = 0.311, p = 0.128, there was a significant relationship between the severity of VEGF expression and tumor size (p = 0.006 and lymph node metastasis (p = 0.048 but not cartilage invasion (p = 0.129. MVD was significantly higher in high-grade tumors (p = 0.003 but had no significant relationship between MVD, lymph node metastasis, and cartilage invasion (p = 0.815, p = 0.204. There was also no significant relationship between PTEN and VEGF expression (p = 0.161 and between PTEN and VEGF expression and the MVD (p = 0.120 and p = 0.175, respectively. Conclusions Increased VEGF expression may play an important role in the outcome of squamous cell carcinoma of the larynx. PTEN expression was not related to VEGF expression and clinicopathological features of squamous cell carcinoma of the larynx.

  1. Bacterial xylanase expression in mammalian cells and transgenic mice.

    Science.gov (United States)

    Fontes, C M; Ali, S; Gilbert, H J; Hazlewood, G P; Hirst, B H; Hall, J

    1999-06-11

    The energy which simple-stomached livestock can derive from dietary plant material is limited by the lack of plant polysaccharide degrading enzymes in their gastro-intestinal (GI) tract and the inefficient microbial fermentation of such material in their hind-gut. In poultry the non-starch polysaccharides found in cereal grains can also impair normal digestive function as they form viscous gels in the GI tract inhibiting the breakdown and absorption of nutrients. The nutrition of such livestock could, therefore, be improved by the introduction of enzymes able to degrade plant polysaccharides in the small intestine. We describe the expression of a xylanase, XYLY', from the bacterium Clostridium thermocellum in mammalian cells and the exocrine pancreas of transgenic mice. The enzyme is synthesised, secreted and functionally active in the eukaryote system. This work demonstrates the feasibility of generating animals with the endogenous capacity to depolymerise the xylan component of hemi-cellulose.

  2. Gene expression in epithelial cells in response to pneumovirus infection

    Directory of Open Access Journals (Sweden)

    Rosenberg Helene F

    2001-05-01

    Full Text Available Abstract Respiratory syncytial virus (RSV and pneumonia virus of mice (PVM are viruses of the family Paramyxoviridae, subfamily pneumovirus, which cause clinically important respiratory infections in humans and rodents, respectively. The respiratory epithelial target cells respond to viral infection with specific alterations in gene expression, including production of chemoattractant cytokines, adhesion molecules, elements that are related to the apoptosis response, and others that remain incompletely understood. Here we review our current understanding of these mucosal responses and discuss several genomic approaches, including differential display reverse transcription-polymerase chain reaction (PCR and gene array strategies, that will permit us to unravel the nature of these responses in a more complete and systematic manner.

  3. Controlled expression of enhanced green fluorescent protein and hepatitis B virus precore protein in mammalian cells

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A novel tetracycline regulation expression system was used to regulate the expression of enhanced green fluorescent protein (EGFP) and hepatitis B virus precore protein in the mammalian cell lines with lipofectAMINE. Flow cytometry assays showed that application of the system resulted in about 18-fold induction of EGFP expression in CHO cell lines and 5-fold induction in SSMC-7721 cells and about 2-fold in the HEK293 cells. Furthermore, the effective use of this system for the controlled expression of HBV precore protein gene in hepatocellular carcinoma cells was tested.

  4. miR-150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely.

    Science.gov (United States)

    Zhou, Beiyan; Wang, Stephanie; Mayr, Christine; Bartel, David P; Lodish, Harvey F

    2007-04-24

    MicroRNAs (miRNAs) are a family of approximately 22-nt noncoding RNAs that can posttranscriptionally regulate gene expression. Several miRNAs are specifically expressed in hematopoietic cells. Here we show that one such miRNA, miR-150, is mainly expressed in the lymph nodes and spleen and is highly up-regulated during the development of mature T and B cells; expression of miR-150 is sharply up-regulated at the immature B cell stage. Overexpression of miR-150 in hematopoietic stem cells, followed by bone marrow transplantation, had little effect on the formation of either mature CD8- and CD4-positive T cells or granulocytes or macrophages, but the formation of mature B cells was greatly impaired. Furthermore, premature expression of miR-150 blocked the transition from the pro-B to the pre-B stage. Our results indicate that miR-150 most likely down-regulates mRNAs that are important for pre- and pro-B cell formation or function, and its ectopic expression in these cells blocks further development of B cells.

  5. Inferring single-cell gene expression mechanisms using stochastic simulation

    Science.gov (United States)

    Daigle, Bernie J.; Soltani, Mohammad; Petzold, Linda R.; Singh, Abhyudai

    2015-01-01

    Motivation: Stochastic promoter switching between transcriptionally active (ON) and inactive (OFF) states is a major source of noise in gene expression. It is often implicitly assumed that transitions between promoter states are memoryless, i.e. promoters spend an exponentially distributed time interval in each of the two states. However, increasing evidence suggests that promoter ON/OFF times can be non-exponential, hinting at more complex transcriptional regulatory architectures. Given the essential role of gene expression in all cellular functions, efficient computational techniques for characterizing promoter architectures are critically needed. Results: We have developed a novel model reduction for promoters with arbitrary numbers of ON and OFF states, allowing us to approximate complex promoter switching behavior with Weibull-distributed ON/OFF times. Using this model reduction, we created bursty Monte Carlo expectation-maximization with modified cross-entropy method (‘bursty MCEM2’), an efficient parameter estimation and model selection technique for inferring the number and configuration of promoter states from single-cell gene expression data. Application of bursty MCEM2 to data from the endogenous mouse glutaminase promoter reveals nearly deterministic promoter OFF times, consistent with a multi-step activation mechanism consisting of 10 or more inactive states. Our novel approach to modeling promoter fluctuations together with bursty MCEM2 provides powerful tools for characterizing transcriptional bursting across genes under different environmental conditions. Availability and implementation: R source code implementing bursty MCEM2 is available upon request. Contact: absingh@udel.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573914

  6. Gene expression disparity in giant cell tumor of bone

    Institute of Scientific and Technical Information of China (English)

    Xiaohua PAN; Shuhua YANG; Deming XIAO; Yong DAI; Lili REN

    2009-01-01

    The aim of this paper was to study the differential gene expression of giant cell tumor of bone (GCTB) by gene chip technology. Total RNA of 8 fresh GCTB specimens (Jaffe Ⅰ:6 cases, Ⅱ: 1 case, Ⅲ: 1 case; Campanacci Ⅰ:6 cases, Ⅱ:1 case, Ⅲ:1 case; Enneking Staging G0T1-2M0, 5 cases, G1T1-2M0: 2 cases, G1T2M0: 1 case) and 4 normal bony callus specimens (the control group) were extracted and purified to get mRNA and then reverse transcribed to complementary DNA, respectively. Microarray screening with a set of 8064 human cDNA genes was conducted to analyze the difference among the samples and the control. The hybridization signals were scanned. The gene expression disparity between the GCTB samples and normal bony callus was significantly different (P<0.01), and the disparity of over 5-fold was found in 47 genes in the GCTB specimens, with 25 genes up-regulated and 22 down-regulated including the extracellular matrix and transforming-related genes, oncogene and its homolog genes, cytokine and its receptor genes. Specific gene spectrum associated with GCTB can be identified by cDNA microarray, which will be the foundation of progressive etiology elucidation, diagnosis and treatment of GCTB.

  7. Thiazolidinediones enhance vascular endothelial growth factor expression and induce cell growth inhibition in non-small-cell lung cancer cells

    OpenAIRE

    Yoshizaki Yumiko; Kumei Shima; Tanno Sachie; Motomura Wataru; Yoshizaki Takayuki; Tanno Satoshi; Okumura Toshikatsu

    2010-01-01

    Abstract Background It is known that thiazolidinediones are involved in regulating the expression of various genes, including the vascular endothelial growth factor (VEGF) gene via peroxisome proliferator-activated receptor γ (PPARγ); VEGF is a prognostic biomarker for non-small-cell lung cancer (NSCLC). Methods In this study, we investigated the effects of troglitazone and ciglitazone on the mRNA expression of VEGF and its receptors in human NSCLC cell lines, RERF-LC-AI, SK-MES-1, PC-14, and...

  8. Effects of resistin-like molecule β over-expression on gastric cancer cells in vitro

    Institute of Scientific and Technical Information of China (English)

    Li-Duan Zheng; Chun-Lei Yang; Teng Qi; Meng Qi; Ling Tong; Qiang-Song Tong

    2012-01-01

    AIM:To investigate the effects of resistin-like molecule β (RELMβ) over-expression on the invasion,metastasis and angiogenesis of gastric cancer cells.METHODS:Human RELMβ encoding expression vector was constructed and transfected into the RELMβ lowly-expressed gastric cancer cell lines SGC-7901 and MKN-45.Gene expression was measured by Western blotting,reverse transcription polymerase chain reaction (PCR) and real-time quantitative PCR.Cell proliferation was measured by 2-(4,5-dimethyltriazol-2-yl)-2,5-diphenyl tetrazolium bromide colorimetry,colony formation and 5-ethynyl-20-deoxyuridine incorporation assays.The in vitro migration,invasion and metastasis of cancer cells were measured by cell adhesion assay,scratch assay and matrigel invasion assay.The angiogenic capabilities of cancer cells were measured by tube formation of endothelial cells.RESULTS:Transfection of RELMβ vector into SGC-7901 and MKN-45 cells resulted in over-expression of RELMβ,which did not influence the cellular proliferation.However,over-expression of RELMβ suppressed the in vitro adhesion,invasion and metastasis of cancer cells,accompanied by decreased expression of matrix metalloproteinase-2 (MMP-2) and MMP-9.Moreover,transfection of RELMβ attenuated the expression of vascular endothelial growth factor and in vitro angiogenic capabilities of cancer cells.CONCLUSION:Over-expression of RELMβ abolishes the invasion,metastasis and angiogenesis of gastric cancer cells in vitro,suggesting its potentials as a novel therapeutic target for gastric cancer.

  9. Lineage-specific expression of bestrophin-2 and bestrophin-4 in human intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Go Ito

    Full Text Available Intestinal epithelial cells (IECs regulate the absorption and secretion of anions, such as HCO3(- or Cl(-. Bestrophin genes represent a newly identified group of calcium-activated Cl(- channels (CaCCs. Studies have suggested that, among the four human bestrophin-family genes, bestrophin-2 (BEST2 and bestrophin-4 (BEST4 might be expressed within the intestinal tissue. Consistently, a study showed that BEST2 is expressed by human colonic goblet cells. However, their precise expression pattern along the gastrointestinal tract, or the lineage specificity of the cells expressing these genes, remains largely unknown. Here, we show that BEST2 and BEST4 are expressed in vivo, each in a distinct, lineage-specific manner, in human IECs. While BEST2 was expressed exclusively in colonic goblet cells, BEST4 was expressed in the absorptive cells of both the small intestine and the colon. In addition, we found that BEST2 expression is significantly down-regulated in the active lesions of ulcerative colitis, where goblet cells were depleted, suggesting that BEST2 expression is restricted to goblet cells under both normal and pathologic conditions. Consistently, the induction of goblet cell differentiation by a Notch inhibitor, LY411575, significantly up-regulated the expression of not BEST4 but BEST2 in MUC2-positive HT-29 cells. Conversely, the induction of absorptive cell differentiation up-regulated the expression of BEST4 in villin-positive Caco-2 cells. In addition, we found that the up- or down-regulation of Notch activity leads to the preferential expression of either BEST4 or BEST2, respectively, in LS174T cells. These results collectively confirmed that BEST2 and BEST4 could be added to the lineage-specific genes of humans IECs due to their abilities to clearly identify goblet cells of colonic origin and a distinct subset of absorptive cells, respectively.

  10. Elevation of NR4A3 expression and its possible role in modulating insulin expression in the pancreatic beta cell.

    Directory of Open Access Journals (Sweden)

    Weina Gao

    Full Text Available BACKGROUND: NR4A3/NOR-1 is a member of the NR4A orphan nuclear receptor subfamily, which contains early response genes that sense and respond to a variety of stimuli in the cellular environment. The role of NR4A3 in insulin expression in pancreatic beta cells remains unknown. METHODS: Dynamic changes in NR4A3 were examined in a pancreatic beta-cell line, MIN6, treated with thapsigargin (TG, palmitate (PA, tunicamycin (TM, and dithiothreitol (DTT, chemicals that produce cell stress and even apoptosis. We exploited virus infection techniques to induce expression of NR4A3 or three deletion mutants, and determined expression of insulin and insulin regulatory genes in MIN6 cells. RESULTS: TG and PA, two endoplasmic reticulum (ER stress inducers, were able to induce unfolded protein response (UPR activation and elevation of NR4A3 expression in MIN6 cells, whereas TM and DTT, two other ER stress inducers, were able to induce UPR activation but not NR4A3 elevation. MIN6 cells over-expressing NR4A3 protein after adenoviral infection exhibited reduced transcription of the insulin genes Ins1 and Ins2, and reduced insulin protein secretion, which were negatively correlated with NR4A3 expression levels. Functional analysis of different deletion mutants of NR4A3 showed that deleting the activation domain AF1 or the DNA-binding domain abolished the down-regulation of insulin transcription by NR4A3 in MIN6 cells, indicating that this down-regulative role was closely related to the NR4A3 trans-activation activity. Over-expression of NR4A3 in MIN6 cells resulted in reduced mRNA transcription of the insulin positive-regulation genes, Pdx1 and NeuroD1. CONCLUSION: Some ER stress inducers, such as TG or PA, are able to elevate NR4A3 expression in MIN6 cells, while others, such as TM or DTT, are not. Over-expression of NR4A3 in MIN6 cells results in down-regulation of insulin gene transcription and insulin secretion. NR4A3 reduces insulin gene expression by

  11. Expression signature in peripheral blood cells for molecular diagnosis of head and neck squamous cell carcinoma.

    Science.gov (United States)

    Braakhuis, B J M; Graveland, A P; Dijk, F; Ylstra, B; van Wieringen, W N; Leemans, C R; Brakenhoff, R H

    2013-07-01

    Patients with head and neck squamous cell carcinoma (HNSCC) have a poor prognosis due to the development of locoregional recurrences, distant metastases, and second primary tumors. There is an urgent need for biomarkers that enable detection and monitoring of the disease to provide adequate therapeutic strategies. In this study, we have investigated markers in peripheral blood cells (PBC) of 28 HNSCC patients who underwent surgery by means of expression profiling. Our hypothesis is that nucleated blood cells circulate continuously, also pass the tumor, and change their expression profile in response to tumor cell factors. For comparison, we enrolled a control group of 11 patients who underwent surgery in the head and neck region for non-HNSCC reasons. A set of 2949 genes was found to be statistically different between the groups (P < 0.05, false discovery rate-corrected) and the most prominently different pathways were EIF2, EIF4, and mTOR signaling. These preliminary results are promising and warrant further studies on the definitive role of PBC gene expression as a biomarker for HNSCC detection and monitoring.

  12. Altered Gene Expressions and Cytogenetic Repair Efficiency in Cells with Suppressed Expression of XPA after Proton Exposure

    Science.gov (United States)

    Zhang, Ye; Rohde, Larry H.; Gridley, Daila S.; Mehta, Satish K.; Pierson, Duane L.; Wu, Honglu

    2009-01-01

    Cellular responses to damages from ionizing radiation (IR) exposure are influenced not only by the genes involved in DNA double strand break (DSB) repair, but also by non- DSB repair genes. We demonstrated previously that suppressed expression of several non-DSB repair genes, such as XPA, elevated IR-induced cytogenetic damages. In the present study, we exposed human fibroblasts that were treated with control or XPA targeting siRNA to 250 MeV protons (0 to 4 Gy), and analyzed chromosome aberrations and expressions of genes involved in DNA repair. As expected, after proton irradiation, cells with suppressed expression of XPA showed a significantly elevated frequency of chromosome aberrations compared with control siRNA treated (CS) cells. Protons caused more severe DNA damages in XPA knock-down cells, as 36% cells contained multiple aberrations compared to 25% in CS cells after 4Gy proton irradiation. Comparison of gene expressions using the real-time PCR array technique revealed that expressions of p53 and its regulated genes in irradiated XPA suppressed cells were altered similarly as in CS cells, suggesting that the impairment of IR induced DNA repair in XPA suppressed cells is p53-independent. Except for XPA, which was more than 2 fold down regulated in XPA suppressed cells, several other DNA damage sensing and repair genes (GTSE1, RBBP8, RAD51, UNG and XRCC2) were shown a more than 1.5 fold difference between XPA knock-down cells and CS cells after proton exposure. The possible involvement of these genes in the impairment of DNA repair in XPA suppressed cells will be further investigated.

  13. Gene expression analysis of cell death induction by Taurolidine in different malignant cell lines

    Directory of Open Access Journals (Sweden)

    Weyhe Dirk

    2010-10-01

    Full Text Available Abstract Background The anti-infective agent Taurolidine (TRD has been shown to have cell death inducing properties, but the mechanism of its action is largely unknown. The aim of this study was to identify potential common target genes modulated at the transcriptional level following TRD treatment in tumour cell lines originating from different cancer types. Methods Five different malignant cell lines (HT29, Chang Liver, HT1080, AsPC-1 and BxPC-3 were incubated with TRD (100 μM, 250 μM and 1000 μM. Proliferation after 8 h and cell viability after 24 h were analyzed by BrdU assay and FACS analysis, respectively. Gene expression analyses were carried out using the Agilent -microarray platform to indentify genes which displayed conjoint regulation following the addition of TRD in all cell lines. Candidate genes were subjected to Ingenuity Pathways Analysis and selected genes were validated by qRT-PCR and Western Blot. Results TRD 250 μM caused a significant inhibition of proliferation as well as apoptotic cell death in all cell lines. Among cell death associated genes with the strongest regulation in gene expression, we identified pro-apoptotic transcription factors (EGR1, ATF3 as well as genes involved in the ER stress response (PPP1R15A, in ubiquitination (TRAF6 and mitochondrial apoptotic pathways (PMAIP1. Conclusions This is the first conjoint analysis of potential target genes of TRD which was performed simultaneously in different malignant cell lines. The results indicate that TRD might be involved in different signal transduction pathways leading to apoptosis.

  14. High expression of hTERT and stemness genes in BORIS/CTCFL positive cells isolated from embryonic cancer cells.

    Directory of Open Access Journals (Sweden)

    Loredana Alberti

    Full Text Available BORIS/CTCFL is a member of cancer testis antigen family normally expressed in germ cells. In tumors, it is aberrantly expressed although its functions are not completely well-defined. To better understand the functions of BORIS in cancer, we selected the embryonic cancer cells as a model. Using a molecular beacon, which specifically targets BORIS mRNA, we demonstrated that BORIS positive cells are a small subpopulation of tumor cells (3-5% of total. The BORIS-positive cells isolated using BORIS-molecular beacon, expressed higher telomerase hTERT, stem cell (NANOG, OCT4, SOX2 and cancer stem cell marker genes (CD44 and ALDH1 compared to the BORIS-negative tumor cells. In order to define the functional role of BORIS, stable BORIS-depleted embryonic cancer cells were generated. BORIS silencing strongly down-regulated the expression of hTERT, stem cell and cancer stem cell marker genes. Moreover, the BORIS knockdown increased cellular senescence in embryonic cancer cells, revealing a putative role of BORIS in the senescence biological program. Our data indicate an association of BORIS expressing cells subpopulation with the expression of stemness genes, highlighting the critical role played by BORIS in embryonic neoplastic disease.

  15. Clear cell papillary renal cell carcinoma: micro-RNA expression profiling and comparison with clear cell renal cell carcinoma and papillary renal cell carcinoma.

    Science.gov (United States)

    Munari, Enrico; Marchionni, Luigi; Chitre, Apurva; Hayashi, Masamichi; Martignoni, Guido; Brunelli, Matteo; Gobbo, Stefano; Argani, Pedram; Allaf, Mohamad; Hoque, Mohammad O; Netto, George J

    2014-06-01

    Clear cell papillary renal cell carcinoma (CCPRCC) is a low-grade renal neoplasm with morphological characteristics mimicking both clear cell renal cell carcinoma (CCRCC) and papillary renal cell carcinoma (PRCC). However, despite some overlapping features, their morphological, immunohistochemical, and molecular profiles are distinct. Micro-RNAs (miRNAs) are small noncoding RNAs that play a crucial role in regulating gene expression and are involved in various biological processes, including cancer development. To better understand the biology of this tumor, we aimed to analyze the miRNA expression profile of a set of CCPRCC using microarray and quantitative reverse transcription-polymerase chain reaction. A total of 15 cases diagnosed as CCPRCC were used in this study. Among the most differentially expressed miRNA in CCPRCC, we found miR-210, miR-122, miR-34a, miR-21, miR-34b*, and miR-489 to be up-regulated, whereas miR-4284, miR-1202, miR-135a, miR-1973, and miR-204 were down-regulated compared with normal renal parenchyma. To identify consensus of differentially regulated miRNA between CCPRCC, CCRCC, and PRCC, we additionally determined differential miRNA expression using 2 publically available microarray data sets from the NCBI Gene Expression Omnibus database (GSE41282 and GSE3798). This comparison revealed that the miRNA expression profile of CCPRCC shows some overlapping characteristics between CCRCC and PRCC. Moreover, CCPRCC lacks dysregulation of important miRNAs typically associated with aggressive behavior. In summary, we describe the miRNA expression profile of a relatively infrequent type of renal cancer. Our results may help in understanding the molecular underpinning of this newly recognized entity.

  16. Correlation of cell surface marker expression with African swine fever virus infection.

    Science.gov (United States)

    Lithgow, Pamela; Takamatsu, Haru; Werling, Dirk; Dixon, Linda; Chapman, Dave

    2014-01-31

    The expression of surface markers on African swine fever virus (ASFV) infected cells was evaluated to assess their involvement in infection. Previous findings indicated CD163 expression was correlated with ASFV susceptibility. However, in this study the expression of porcine CD163 on cell lines did not increase the infection rate of these cells indicating other factors are likely to be important in determining susceptibility to infection. On adherent porcine bone marrow (pBM) cells the expression of CD45 was strongly correlated with infection. CD163 and CD203a expression correlated at intermediate levels with infection, indicating cells expressing these markers could become infected but were not preferentially infected by the virus. Most of the cells expressing MHCII were infected, indicating that they may be preferentially infected although expression of MHCII was not essential for infection and a large percentage of the infected cells were MHCII negative. CD16 showed a marked decrease in expression following infection and significantly lower levels of infected cells were shown to express CD16. Altogether these results suggest CD163 may be involved in ASFV infection but it may not be essential; the results also highlight the importance of other cell markers which requiring further investigation.

  17. Establishment of a pig fibroblast-derived cell line for locus-directed transgene expression in cell cultures and blastocysts

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Li, Juan; Moldt, Brian;

    2011-01-01

    We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon......-based docking vector harbouring a selection gene, an eGFP reporter gene, and an Flp recombinase site for locus-directed gene insertion. PFV cells have insertion of a single docking vector with stable eGFP expression and generated phenotypic normal blastocysts with transgene expression after somatic cell nuclear...

  18. Chondrogenic potential of subpopulations of cells expressing mesenchymal stem cell markers derived from human synovial membranes.

    Science.gov (United States)

    Arufe, M C; De la Fuente, A; Fuentes, I; de Toro, F J; Blanco, F J

    2010-11-01

    In this study we analyzed the chondrogenic potential of subpopulations of mesenchymal stem cells (MSCs) derived from human synovial membranes enriched for CD73, CD106, and CD271 markers. Subpopulations of human synovial membrane MSCs enriched for CD73, CD106, and CD271 markers were isolated using a cytometry sorter and characterized by flow cytometry for MSC markers. The expression of Sox9, Nanog, and Runx2 genes by these cells was measured by reverse transcriptase-polymerase chain reaction. The chondrogenesis of each subpopulation was assessed by culturing the cells in a defined medium to produce spontaneous spheroid formation and differentiation towards chondrocyte-like cells. The examination of the spheroids by histological and immunohistochemical analyses for collagen type II (COL2), aggrecan, collagen type I (COL1), metalloprotease 13 (MMP13), and collagen type X (COLX) levels were performed to assess their chondrogenesis capacity. The adipogenesis and osteogenesis potential of each subpopulation was determined using commercial media; the resulting cells were stained with oil red O or red alizarin to test the degree of differentiation. The subpopulations had different profiles of cells positive for the MSC markers CD44, CD69, CD73, CD90, and CD105 and showed different expression levels of the genes Sox9, Nanog, and Runx2 involved in chondrogenesis, undifferentiation, and osteoblastogenesis, respectively. Immunohistochemical analysis demonstrated that COL1, COL2, COLX, MMP13, and aggrecan were expressed in the spheroids as soon as 14 days of culture. The CD271(+) subpopulation expressed the highest levels of COL2 staining compared to the other subpopulations. CD105 and Runx2 were shown by immunohistochemistry and genetic analysis to have significantly higher expression CD271(+) subpopulation than the other subpopulations. Spheroids formed from CD271-enriched and CD73-enriched MSCs from normal human synovial membranes mimic the native cartilage extracellular

  19. Forced KLF4 expression increases the generation of mature plasma cells and uncovers a network linked with plasma cell stage.

    Science.gov (United States)

    Schoenhals, Matthieu; Jourdan, Michel; Seckinger, Anja; Pantesco, Véronique; Hose, Dirk; Kassambara, Alboukadel; Moreaux, Jérôme; Klein, Bernard

    2016-07-17

    A role of the transcription factor Krüppel-like factor 4 (KLF4) in the generation of mature plasma cells (PC) is unknown. Indeed, KLF4 is critical in controlling the differentiation of various cell linages, particularly monocytes and epithelial cells. KLF4 is expressed at low levels in pro-B cells and its expression increases as they mature into pre-B cells, resting naïve B cells and memory B cells. We show here that KLF4 is expressed in human bone marrow plasma cells and its function was studied using an in vitro model of differentiation of memory B cells into long lived plasma cells. KLF4 is rapidly lost when memory B cells differentiate into highly cell cycling plasmablasts, poorly cycling early plasma cells and then quiescent long-lived plasma cells. A forced expression of KLF4 in plasmablasts enhances the yield of their differentiation into early plasma cell and long lived plasma cells, by inhibiting apoptosis and upregulating previously unknown plasma cell pathways.

  20. Tracking neuronal marker expression inside living differentiating cells using molecular beacons

    DEFF Research Database (Denmark)

    Ilieva, Mirolyuba; Della Vedova, Paolo; Hansen, Ole

    2013-01-01

    Monitoring gene expression is an important tool for elucidating mechanisms of cellular function. In order to monitor gene expression during nerve cell development, molecular beacon (MB) probes targeting markers representing different stages of neuronal differentiation were designed and synthesized...

  1. Strong Expression of Chemokine Receptor CXCR4 by Renal Cell Carcinoma Correlates with Advanced Disease

    Directory of Open Access Journals (Sweden)

    Thomas C. Wehler

    2008-01-01

    Full Text Available Diverse chemokines and their receptors have been associated with tumor growth, tumor dissemination, and local immune escape. In different tumor entities, the level of chemokine receptor CXCR4 expression has been linked with tumor progression and decreased survival. The aim of this study was to evaluate the influence of CXCR4 expression on the progression of human renal cell carcinoma. CXCR4 expression of renal cell carcinoma was assessed by immunohistochemistry in 113 patients. Intensity of CXCR4 expression was correlated with both tumor and patient characteristics. Human renal cell carcinoma revealed variable intensities of CXCR4 expression. Strong CXCR4 expression of renal cell carcinoma was significantly associated with advanced T-status (P=.039, tumor dedifferentiation (P = .0005, and low hemoglobin (P = .039. In summary, strong CXCR4 expression was significantly associated with advanced dedifferentiated renal cell carcinoma.

  2. Gene expression profiling in multipotent DFAT cells derived from mature adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ono, Hiromasa [Laboratory of Cell and Tissue Biology, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510 (Japan); Database Center for Life Science (DBCLS), Research Organization of Information and Systems (ROIS), Faculty of Engineering Bldg.12 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Oki, Yoshinao [Laboratory of Cell and Tissue Biology, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510 (Japan); Bono, Hidemasa [Database Center for Life Science (DBCLS), Research Organization of Information and Systems (ROIS), Faculty of Engineering Bldg.12 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Kano, Koichiro, E-mail: kkano@brs.nihon-u.ac.jp [Laboratory of Cell and Tissue Biology, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510 (Japan)

    2011-04-15

    Highlights: {yields} Adipocyte dedifferentiation is evident in a significant decrease in typical genes. {yields} Cell proliferation is strongly related to adipocyte dedifferentiation. {yields} Dedifferentiated adipocytes express several lineage-specific genes. {yields} Comparative analyses using publicly available datasets boost the interpretation. -- Abstract: Cellular dedifferentiation signifies the withdrawal of cells from a specific differentiated state to a stem cell-like undifferentiated state. However, the mechanism of dedifferentiation remains obscure. Here we performed comparative transcriptome analyses during dedifferentiation in mature adipocytes (MAs) to identify the transcriptional signatures of multipotent dedifferentiated fat (DFAT) cells derived from MAs. Using microarray systems, we explored similarly expressed as well as significantly differentially expressed genes in MAs during dedifferentiation. This analysis revealed significant changes in gene expression during this process, including a significant reduction in expression of genes for lipid metabolism concomitantly with a significant increase in expression of genes for cell movement, cell migration, tissue developmental processes, cell growth, cell proliferation, cell morphogenesis, altered cell shape, and cell differentiation. Our observations indicate that the transcriptional signatures of DFAT cells derived from MAs are summarized in terms of a significant decrease in functional phenotype-related genes and a parallel increase in cell proliferation, altered cell morphology, and regulation of the differentiation of related genes. A better understanding of the mechanisms involved in dedifferentiation may enable scientists to control and possibly alter the plasticity of the differentiated state, which may lead to benefits not only in stem cell research but also in regenerative medicine.

  3. Microarray Gene Expression Analysis to Evaluate Cell Type Specific Expression of Targets Relevant for Immunotherapy of Hematological Malignancies.

    Directory of Open Access Journals (Sweden)

    M J Pont

    Full Text Available Cellular immunotherapy has proven to be effective in the treatment of hematological cancers by donor lymphocyte infusion after allogeneic hematopoietic stem cell transplantation and more recently by targeted therapy with chimeric antigen or T-cell receptor-engineered T cells. However, dependent on the tissue distribution of the antigens that are targeted, anti-tumor responses can be accompanied by undesired side effects. Therefore, detailed tissue distribution analysis is essential to estimate potential efficacy and toxicity of candidate targets for immunotherapy of hematological malignancies. We performed microarray gene expression analysis of hematological malignancies of different origins, healthy hematopoietic cells and various non-hematopoietic cell types from organs that are often targeted in detrimental immune responses after allogeneic stem cell transplantation leading to graft-versus-host disease. Non-hematopoietic cells were also cultured in the presence of IFN-γ to analyze gene expression under inflammatory circumstances. Gene expression was investigated by Illumina HT12.0 microarrays and quality control analysis was performed to confirm the cell-type origin and exclude contamination of non-hematopoietic cell samples with peripheral blood cells. Microarray data were validated by quantitative RT-PCR showing strong correlations between both platforms. Detailed gene expression profiles were generated for various minor histocompatibility antigens and B-cell surface antigens to illustrate the value of the microarray dataset to estimate efficacy and toxicity of candidate targets for immunotherapy. In conclusion, our microarray database provides a relevant platform to analyze and select candidate antigens with hematopoietic (lineage-restricted expression as potential targets for immunotherapy of hematological cancers.

  4. Microarray Gene Expression Analysis to Evaluate Cell Type Specific Expression of Targets Relevant for Immunotherapy of Hematological Malignancies.

    Science.gov (United States)

    Pont, M J; Honders, M W; Kremer, A N; van Kooten, C; Out, C; Hiemstra, P S; de Boer, H C; Jager, M J; Schmelzer, E; Vries, R G; Al Hinai, A S; Kroes, W G; Monajemi, R; Goeman, J J; Böhringer, S; Marijt, W A F; Falkenburg, J H F; Griffioen, M

    2016-01-01

    Cellular immunotherapy has proven to be effective in the treatment of hematological cancers by donor lymphocyte infusion after allogeneic hematopoietic stem cell transplantation and more recently by targeted therapy with chimeric antigen or T-cell receptor-engineered T cells. However, dependent on the tissue distribution of the antigens that are targeted, anti-tumor responses can be accompanied by undesired side effects. Therefore, detailed tissue distribution analysis is essential to estimate potential efficacy and toxicity of candidate targets for immunotherapy of hematological malignancies. We performed microarray gene expression analysis of hematological malignancies of different origins, healthy hematopoietic cells and various non-hematopoietic cell types from organs that are often targeted in detrimental immune responses after allogeneic stem cell transplantation leading to graft-versus-host disease. Non-hematopoietic cells were also cultured in the presence of IFN-γ to analyze gene expression under inflammatory circumstances. Gene expression was investigated by Illumina HT12.0 microarrays and quality control analysis was performed to confirm the cell-type origin and exclude contamination of non-hematopoietic cell samples with peripheral blood cells. Microarray data were validated by quantitative RT-PCR showing strong correlations between both platforms. Detailed gene expression profiles were generated for various minor histocompatibility antigens and B-cell surface antigens to illustrate the value of the microarray dataset to estimate efficacy and toxicity of candidate targets for immunotherapy. In conclusion, our microarray database provides a relevant platform to analyze and select candidate antigens with hematopoietic (lineage)-restricted expression as potential targets for immunotherapy of hematological cancers.

  5. [Construction of nonsense-mutated eukaryotic expression vector of factor IX gene and its expression in COS-7 cells].

    Science.gov (United States)

    Nie, Xin; Yang, Lin-Hua; Chai, Bao-Feng; Shen, Quan; Zhang, Yuan; Zhang, Yao-Fang; Chen, Jian-Fang

    2010-06-01

    The purpose of this study was to construct 4 types of nonsense-mutated eukaryotic expression plasmids of fIX gene, using pcDNA3.1 plasmid containing fIX cDNA as template, and to identify, then to perform their expression in COS-7 cells. These stop mutants constructed by site-directed mutagenesis based on PCR, and further confirmed by DNA sequencing. COS-7 cells were transfected with either the wild-type or mutated fIX expression constructs, then the relative expression levels of fIX mRNA were detected by real time fluorescent quantitative PCR. The result showed that except the designed sites, there were no other nucleotide mutation in the sequences of four nonsense mutants. The results of real time PCR proved that the nonsense-mutated vectors can be effectively expressed in COS-7 cells. It is concluded that the nonsense-mutated eukaryotic expression vectors of fIX gene have been successfully constructed and can express in COS-7 cells, which provides the material basis for further researches on mechanism and treatment of FIX deficiency and the function defects caused by nonsense mutation.

  6. NKT cell-TCR expression activates conventional T cells in vivo, but is largely dispensable for mature NKT cell biology.

    Science.gov (United States)

    Vahl, J Christoph; Heger, Klaus; Knies, Nathalie; Hein, Marco Y; Boon, Louis; Yagita, Hideo; Polic, Bojan; Schmidt-Supprian, Marc

    2013-01-01

    Natural killer T (NKT) cell development depends on recognition of self-glycolipids via their semi-invariant Vα14i-TCR. However, to what extent TCR-mediated signals determine identity and function of mature NKT cells remains incompletely understood. To address this issue, we developed a mouse strain allowing conditional Vα14i-TCR expression from within the endogenous Tcrα locus. We demonstrate that naïve T cells are activated upon replacement of their endogenous TCR repertoire with Vα14i-restricted TCRs, but they do not differentiate into NKT cells. On the other hand, induced TCR ablation on mature NKT cells did not affect their lineage identity, homeostasis, or innate rapid cytokine secretion abilities. We therefore propose that peripheral NKT cells become unresponsive to and thus are independent of their autoreactive TCR.

  7. NKT cell-TCR expression activates conventional T cells in vivo, but is largely dispensable for mature NKT cell biology.

    Directory of Open Access Journals (Sweden)

    J Christoph Vahl

    Full Text Available Natural killer T (NKT cell development depends on recognition of self-glycolipids via their semi-invariant Vα14i-TCR. However, to what extent TCR-mediated signals determine identity and function of mature NKT cells remains incompletely understood. To address this issue, we developed a mouse strain allowing conditional Vα14i-TCR expression from within the endogenous Tcrα locus. We demonstrate that naïve T cells are activated upon replacement of their endogenous TCR repertoire with Vα14i-restricted TCRs, but they do not differentiate into NKT cells. On the other hand, induced TCR ablation on mature NKT cells did not affect their lineage identity, homeostasis, or innate rapid cytokine secretion abilities. We therefore propose that peripheral NKT cells become unresponsive to and thus are independent of their autoreactive TCR.

  8. Light induces Fos expression via extracellular signal-regulated kinases 1/2 in melanopsin-expressing PC12 cells

    DEFF Research Database (Denmark)

    Moldrup, Marie-Louise Bülow; Georg, Birgitte; Falktoft, Birgitte;

    2010-01-01

    The photopigment melanopsin is expressed in a subtype of mammalian ganglion cells in the retina that project to the circadian clock in the hypothalamic suprachiasmatic nucleus to mediate non-visual light information. Melanopsin renders these retinal ganglion cells intrinsically photosensitive and...

  9. Differential expression of sphingolipids in P-glycoprotein or multidrug resistance-related protein 1 expressing human neuroblastoma cell lines

    NARCIS (Netherlands)

    Dijkhuis, AJ; Douwes, J; Kamps, W; Sietsma, H; Kok, JW

    2003-01-01

    The sphingolipid composition and multidrug resistance status of three human neuroblastoma cell lines were established. SK-N-FI cells displayed high expression and functional (efflux) activity of P-glycoprotein, while multidrug resistance-related protein 1 was relatively abundant and most active in S

  10. Construction and identification of eukaryotic eukaryotic expression plasmid pcdna3.1-bace and its transient expression in cells

    Institute of Scientific and Technical Information of China (English)

    Huilin Gong; Guanjun Zhang; Weijiang Dong

    2006-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3.1-BACE and obtain its transient expression in COS-7 cells and high expression in the neuroblastoma SK-N-SH cells. Methods: A 1503 bp cDNA fragment was amplified from the total RNA of human neuroblastoma by RT-PCR method and cloned into plasmid pcDNA3.1. The vector was identified by digestion with restriction enzymes BamHI and XhoI and sequenced by Sanger-dideoxy-mediated chain termination. The expression of BACE gene was detected by immunocytochemistry method. Results: The results showed that the cDNAfragment included 1503 bp total coding region. The recombinant eukaryotic cell expression vector of pcDNA3.1-BACE was constructed successfully,and the sequence of insert was identical to the published sequence. The COS-7 cells and the neuroblastoma SK-N-SH cells transfected with the pcDNA3.1-BACE plasmid expressed high level of BACE protein in cytoplasm. Conclusion: The recombinant plasmid pcDNA3.1-BACE can provide very useful tool for researching the reason of Alzheimer's disease and lays the important foundation for preventing the AD laterly.

  11. Limited gene expression variation in human embryonic stem cell and induced pluripotent stem cell-derived endothelial cells.

    Science.gov (United States)

    White, Mark P; Rufaihah, Abdul J; Liu, Lei; Ghebremariam, Yohannes T; Ivey, Kathryn N; Cooke, John P; Srivastava, Deepak

    2013-01-01

    Recent evidence suggests human embryonic stem cell (hESC) and induced pluripotent stem (iPS) cell lines have differences in their epigenetic marks and transcriptomes, yet the impact of these differences on subsequent terminally differentiated cells is less well understood. Comparison of purified, homogeneous populations of somatic cells derived from multiple independent human iPS and ES lines will be required to address this critical question. Here, we report a differentiation protocol based on embryonic development that consistently yields large numbers of endothelial cells (ECs) derived from multiple hESCs or iPS cells. Mesoderm differentiation of embryoid bodies was maximized, and defined growth factors were used to generate KDR(+) EC progenitors. Magnetic purification of a KDR(+) progenitor subpopulation resulted in an expanding, homogeneous pool of ECs that expressed EC markers and had functional properties of ECs. Comparison of the transcriptomes revealed limited gene expression variability between multiple lines of human iPS-derived ECs or between lines of ES- and iPS-derived ECs. These results demonstrate a method to generate large numbers of pure human EC progenitors and differentiated ECs from pluripotent stem cells and suggest individual lineages derived from human iPS cells may have significantly less variance than their pluripotent founders.

  12. Tat protein expression in MDBK cells does not confer susceptibility to bovine immunodeficiency virus.

    Science.gov (United States)

    Kempster, S; Collins, M E; Brownlie, J

    2002-03-01

    The ability of BIV strain R29 to infect bovine cell lines in the presence or absence of a functional lentiviral Tat protein is described. Jembrana disease virus (JDV) Tat protein was stably expressed in MDBK cells. No viral replication could be detected in this cell line after infection with BIV R29. Transfection of MDBK cells and MDBK Tat expressing cells with BIV R29 proviral DNA established that BIV R29 could not replicate in MDBK cells. Whether viral entry into MDBK cells is also a block to BIV R29 infection of MDBK cells has yet to be established.

  13. Expression of hepatitis C virus envelope protein 2 induces apoptosis in cultured mammalian cells

    Institute of Scientific and Technical Information of China (English)

    Li-Xin Zhu; Jing Liu; You-Hua Xie; Yu-Ying Kong; Ye Ye; Chun-Lin Wang; Guang-Di Li; Yuan Wang

    2004-01-01

    AIM: To explore the role of hepatitis C virus (HCV) envelope protein 2 (E2) in the induction of apoptosis.METHODS: A carboxyterminal truncated E2 (E2-661) was transiently expressed in several cultured mammalian cell lines or stably expressed in Chinese hamster ovary (CHO)cell line. Cell proliferation was assessed by 3H thymidine uptake. Apoptosis was examined by Hoechst 33258staining, flow cytometry and DNA fragmentation analysis.RESULTS: Reduced proliferation was readily observed in the E2-661 expressing cells. These cells manifested the typical features of apoptosis, including cell shrinkage,chromatin condensation and hypodiploid genomic DNA content. Similar apoptotic cell death was observed in an E2-661 stably expressing cell line.CONCLUSION: HCV E2 can induce apoptosis in cultured mammalian cells.

  14. Down-regulation of vimentin expression inhibits carcinoma cell migration and adhesion.

    Science.gov (United States)

    McInroy, Lorna; Määttä, Arto

    2007-08-17

    Vimentin is a type III Intermediate filament protein that is expressed frequently in epithelial carcinomas correlating with invasiveness and poor prognosis. We have analysed migration and adhesion to collagenous matrix of a panel of carcinoma cell lines. In vitro invasiveness was highest in vimentin-positive SW480 colon cancer and MDA-MB-231 breast cancer cells and the role of vimentin in these cell lines was investigated by RNA interference. Down-regulation of vimentin expression resulted in impaired migration in both scratch-wound experiments and in invasion assays through cell culture inserts coated with collagen gel. Compromised migration was observed in both cell lines, whereas cell attachment assays revealed impaired adhesion to fibrillar collagen in MDA-MB-231 cells while the adhesion of vimentin-ablated SW480 cells, that express both vimentin and keratin intermediate filaments was not affected. In conclusion, ablation of vimentin expression inhibits migration and invasion of colon and breast cancer cell lines.

  15. Apposition of iroquois expressing and non-expressing cells leads to cell sorting and fold formation in the Drosophila imaginal wing disc

    Directory of Open Access Journals (Sweden)

    González-Pérez Esther

    2007-09-01

    Full Text Available Abstract Background The organization of the different tissues of an animal requires mechanisms that regulate cell-cell adhesion to promote and maintain the physical separation of adjacent cell populations. In the Drosophila imaginal wing disc the iroquois homeobox genes are expressed in the notum anlage and contribute to the specification of notum identity. These genes are not expressed in the adjacent wing hinge territory. These territories are separated by an approximately straight boundary that in the mature disc is associated with an epithelial fold. The mechanism by which these two cell populations are kept separate is unclear. Results Here we show that the Iro-C genes participate in keeping the notum and wing cell populations separate. Indeed, within the notum anlage, cells not expressing Iro-C tend to join together and sort out from their Iro-C expressing neighbours. We also show that apposition of Iro-C expressing and non-expressing cells induces invagination and apico-basal shortening of the Iro-C- cells. This effect probably underlies formation of the fold that separates the notum and wing hinge territories. In addition, cells overexpressing a member of the Iro-C contact one another and become organized in a network of thin strings that surrounds and isolates large groups of non-overexpressing cells. The strings appear to exert a pulling force along their longitudinal axis. Conclusion Apposition of cells expressing and non-expressing the Iro-C, as it occurs in the notum-wing hinge border of the Drosophila wing disc, influences cell behaviour. It leads to cell sorting, and cellular invagination and apical-basal shortening. These effects probably account for keeping the prospective notum and wing hinge cell populations separate and underlie epithelial fold formation. Cells that overexpress a member of the Iro-C and that confront non-expressing cells establish contacts between themselves and become organized in a network of thin strings

  16. Inhibition of LINE-1 retrotransposon-encoded reverse transcriptase modulates the expression of cell differentiation genes in breast cancer cells.

    Science.gov (United States)

    Patnala, Radhika; Lee, Sung-Hun; Dahlstrom, Jane E; Ohms, Stephen; Chen, Long; Dheen, S Thameem; Rangasamy, Danny

    2014-01-01

    Long Interspersed Elements (L1 elements) are biologically active retrotransposons that are capable of autonomous replication using their own reverse transcriptase (RT) enzyme. Expression of the normally repressed RT has been implicated in cancer cell growth. However, at present, little is known about the expression of L1-encoded RT activity or the molecular changes that are associated with RT activity in the development of breast cancer. Here, we report that RT activity is widespread in breast cancer cells. The expression of RT protein decreased markedly in breast cancer cells after treatment with the antiretroviral drug, efavirenz. While the majority of cells showed a significant reduction in proliferation, inhibition of RT was also accompanied by cell-specific differences in morphology. MCF7 cells displayed elongated microtubule extensions that adhered tightly to their substrate, while a large fraction of the T47D cells that we studied formed long filopodia projections. These morphological changes were reversible upon cessation of RT inhibition, confirming their dependence on RT activity. We also carried out gene expression profiling with microarrays and determined the genes that were differentially expressed during the process of cellular differentiation. Genes involved in proliferation, cell migration, and invasive activity were repressed in RT-inhibited cells. Concomitantly, genes involved in cell projection, formation of vacuolar membranes, and cell-to-cell junctions were significantly upregulated in RT-inhibited cells. qRT-PCR examination of the mRNA expression of these genes in additional cell lines yielded close correlation between their differential expression and the degree of cellular differentiation. Our study demonstrates that the inhibition of L1-encoded RT can reduce the rate of proliferation and promote differentiation of breast cancer cells. Together, these results provide a direct functional link between the expression of L1 retrotransposons and

  17. Neurotrophin and Trk expression by cells of the human lamina cribrosa following oxygen-glucose deprivation

    OpenAIRE

    Clark Abbot F; Lambert Wendi S; Wordinger Robert J

    2004-01-01

    Abstract Background Ischemia within the optic nerve head (ONH) may contribute to retinal ganglion cell (RGC) loss in primary open angle glaucoma (POAG). Ischemia has been reported to increase neurotrophin and high affinity Trk receptor expression by CNS neurons and glial cells. We have previously demonstrated neurotrophin and Trk expression within the lamina cribrosa (LC) region of the ONH. To determine if ischemia alters neurotrophin and Trk protein expression in cells from the human LC, cul...

  18. Construction and characteristics of a transformed lepidopteran cell clone expressing baculovirus p35

    Institute of Scientific and Technical Information of China (English)

    ZHENG Guiling; LI Changyou; LI Guoxun; WANG Ping; Robert R. Granados

    2005-01-01

    A transformed cell line was constructed from Mythimna separata cells Ms7311 by lipofection method. TMs7311 cells were generated using a double selection technique involving a selection in the antibiotic Zeocin, followed by a second round of selection by exhibiting cell characterization. A cell clone expressing p35 was obtained with high level of AcMNPV and recombinant proteins. Compared with wild type Ms7311 cells, the cell clone showed increased resistance to Actinamycin D-induced apoptosis and a profound resistance to nutrient development (PBS). When the cell clone was infected with recombinant baculoviruses expressing secreted alkaline phosphatase (SEAP) and β-galactosi- dase, expression of the recombinant proteins from TMs7311 cells exceeded that from parental Ms7311 cells. Production of budded virus and occlusion body was significantly higher than that from parental cells Ms7311.

  19. Changes of PIG3 Expression and Cell Cycle of AHH-1 Cells Induced by Fast Neutrons

    Institute of Scientific and Technical Information of China (English)

    SUI; Li; MA; Nan-ru; KONG; Fu-quan; WANG; Xiao; ZHANG; Xiao-ling; CHEN; Hong-tao

    2013-01-01

    Biological dosimeter has unique advantages for the detection of human body damage induced by nuclear radiation.PIG3 is DNA damage inducible gene located downstream of the p53(tumor suppressor gene),which appears at the early stage after radiation and is associated with cell apoptosis.PIG3expression can be measured by modern molecular biological technology and is suitable for quick doses

  20. Differential expression of Yes-associated protein is correlated with expression of cell cycle markers and pathologic TNM staging in non-small-cell lung carcinoma.

    Science.gov (United States)

    Kim, Jin Man; Kang, Dong Wook; Long, Liang Zhe; Huang, Song-Mei; Yeo, Min-Kyung; Yi, Eunhee S; Kim, Kyung-Hee

    2011-03-01

    Yes-associated protein, a downstream effector of the Hippo signaling pathway, has been linked to progression of non-small-cell lung carcinoma. The aim of this study was to investigate expression of Yes-associated protein in lung adenocarcinoma and squamous cell carcinoma. Associations of Yes-associated protein expression with clinicopathologic parameters, expression of cell cycle-specific markers, and epidermal growth factor receptor gene amplification were also analyzed. In a univariate analysis of the 66 adenocarcinomas, high nuclear expression of Yes-associated protein was significantly correlated with expression of cyclin A and mitogen-activated protein kinase. Multivariate analysis, including age and sex, showed that cyclin A expression was independently correlated with nuclear expression of Yes-associated protein in adenocarcinomas. Furthermore, high nuclear expression of Yes-associated protein was also a significant predictor of epidermal growth factor receptor gene amplification for adenocarcinoma. For the 102 squamous cell carcinomas, univariate analysis revealed that high cytoplasmic expression of Yes-associated protein was correlated with the low pathologic TNM staging (stage I) and histologic grading. Multivariate analysis, including age and sex, showed that cytoplasmic expression of Yes-associated protein was an independent predictor of low pathologic TNM staging. These results indicate that nuclear overexpression of Yes-associated protein contributes to pulmonary adenocarcinoma growth and that high cytoplasmic expression of Yes-associated protein is an independent predictor of low pathologic TNM staging and histologic grading. The differential effects of Yes-associated protein expression patterns in adenocarcinomas and squamous cell carcinomas suggest that Yes-associated protein may play important roles in different pathways in distinct tumor subtypes. These observations may, therefore, lead to new perspectives on therapeutic targeting of these tumor

  1. Expression of germ cell nuclear factor in mouse germ cells and sperm during postnatal period

    Institute of Scientific and Technical Information of China (English)

    ChenXu; Zong-YaoZhou; Qiang-SuGuo; Yi-FeiWang

    2004-01-01

    Aim: To assess the spatial and temporal expression of germ cell nuclear factor (GCNF) in male mouse germ cells during postnatal development and in sperm before and after capacitation. Methods: The indirect immunofluorescence method with anti-GCNF antiserum was used to investigate the GCNF expression in mice at day 8, 10,14, 17, 20, 28, 35, 70, and 420 after birth and in sperm before and after capacitation. Results: With the proceeding of spermatogenesis, GCNF was first detected in the nuclei of spermatogonia and a few early stage primary spermatocytes at day 8, which was increased gradually at day 10 to 14 inclusive. From day 17 to day 20, the GCNF was concentrated in round spermatids, while both spermatogonia and early stage primary spermatocytes became GCNF negative. From day 28 until day 420, strong GCNF expression was shown in round spermatids and pachytene spermatocytes, while spermatogonia, early primary spermatocytes and elongating spermatids were all GCNF negative.In addition, it was also found that GCNF was localized on the acrosomal cap region of spermatozoa and there was a big change in GCNF expression during capacitation, from 98 % GCNF positive before capacitation to about 20 % positive following capacitation. The localization of GCNF in caput and cauda spermatozoa was similar. Conclusion:GCNF may play important roles in spermatogenesis, capacitation and fertilization. (Asian J Androl 2004 Sep; 6: 217-222)

  2. Lack of correlation between telomere length and telomerase activity and expression in leukemic cells.

    Science.gov (United States)

    Januszkiewicz, Danuta; Wysoki, Jacek; Lewandowski, Krzysztof; Pernak, Monika; Nowicka, Karina; Rembowska, Jolanta; Nowak, Jerzy

    2003-12-01

    The expression of three components of telomerase complex (hTR, hTERT, TP1) along with telomerase activity and telomere length in leukemic cells was investigated. Cells were isolated from peripheral blood and/or bone marrow of children with acute lymphoblastic (ALL) and non-lymphoblastic (ANLL) leukemia. Expression of three components of telomerase as well as telomerase activity was found in all leukemic cells. Chemiluminescent detection of terminal restriction fragments (TRF) from DNA isolated from ALL cells showed variable patterns expressing considerable heterogeneity of telomere length. The ALL cells appeared to have both long and short telomere lengths, in contrast to normal peripheral lymphocytes, which produced limited pattern of TRF. The ANLL cells produced predominantly short telomere pattern despite high telomerase activity and expression. It can be concluded that high telomerase activity and expression in leukemic cells is not always correlated with long telomeres (TRF pattern).

  3. Expression pattern of fibroblast growth factors (FGFs), their receptors and antagonists in primary endothelial cells and vascular smooth muscle cells.

    Science.gov (United States)

    Antoine, M; Wirz, W; Tag, C G; Mavituna, M; Emans, N; Korff, T; Stoldt, V; Gressner, A M; Kiefer, P

    2005-06-01

    Fibroblast growth factors (FGFs) are important angiogenic growth factors. While basic FGF (FGF2) is well established as a potent inducer of angiogenesis much less is known about other FGFs possibly expressed by EC. We investigated the expression of all known FGFs, their main tyrosine kinase receptors and antagonists by RT-PCR analysis in human umbilical vascular endothelial cells (HUVECs) to obtain a complete expression profile of this important growth factor system in model endothelial cells (EC). In addition to FGFR1IIIc, which is considered as the major FGF receptor in EC, HUVECs express similar levels of FGFR3IIIc, detectable amounts of FGFR2IIIc and a new FGF receptor without an intracellular kinase domain (FGFR5). HUVECs express several secreted FGFs, including FGF5, 7, 8, 16 and 18 and two members of the fibroblast growth factor homologous factors (FHFs), not yet reported to be expressed in EC. The expression panel was compared with that obtained from human vascular smooth muscle cells (VSMCs) and human aortic tissue. Human umbilical artery smooth muscle cells (HUASMCs) and HUVECs express the identical FGF receptor and ligand panel implicating that both cell types act, according the FGF signals more as an entity than as individual cell types. Expression of Fgf1, 2, 7, 16 and 18 and the antagonists Sprouty 2,3 and 4 was demonstrated for all analysed cDNAs. The IIIc isoforms of FGFR1 and 2 and the novel FGFR5 were expressed in the aorta, but expression of the FGF receptor 3 was not detected in cDNAs derived from aortic tissue. In the VSMC of rat aortic tissue and in HUASM cultured cells we could demonstrate FGF18 immunoreactivity in the nucleus of the cells. The expression of several secreted FGFs by EC may focus the view more on their paracrine effects on neighbouring cells during tissue regeneration or tumor formation.

  4. Expression of maturation-specific nuclear antigens in differentiating human myeloid leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Murao, S.; Epstein, A.L.; Clevenger, C.V.; Huberman, E.

    1985-02-01

    The expression of three myeloid-specific nuclear antigens was studied by indirect immunofluorescence with murine monoclonal antibodies in human myeloid (HL-60, ML-2, KG-1, and B-II) leukemia cells treated with chemical inducers of cell differentiation. Treatment of the promyelocytic HL-60 cells with dimethyl sulfoxide or 1,25-dihydroxyvitamin DT induced the cells to acquire a phenotype that resembled that of granulocytes and monocytesmacrophages, respectively. These phenotypes were characterized by changes in cell growth, cell morphology, expression of specific cell surface antigens, and activities of lysozyme and nonspecific esterase enzymes. Induction of these differentiation markers in the HL-60 cells was associated with induction of the myeloid-specific nuclear antigens. The ML-2 cells, which are arrested at the myeloblast-promyelocyte stage, were also susceptible to the induction of cell differentiation and to changes in the expression of the nuclear antigens, but the degree of susceptibility was less than in the HL-60 cells. The less-differentiated KG-1 and B-II myeloid cells were either not responsive or responded only in a limited degree to the induction of cell differentiation or to changes in the expression of the nuclear antigens. The authors suggest that the reactivity of cells with monoclonal antibodies to specific nuclear antigens can be used as a maturational marker in cell differentiation studies. Furthermore, nuclear antigens expressed early in cellular differentiation may provide information about changes in regulatory elements in normal and malignant cells. 40 references, 2 figures, 1 table.

  5. Expression of nucleostemin in prostate cancer and its effect on the proliferation of PC-3 cells

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Background Nucleostemin is essential for the proliferation and survival of stem and cancer cells,but it is unknown whether this newly identified molecule is involved in prostate cancer pathogenesis.Methods Total RNA and protein were extracted from prostate cancer tissues and PC-3,LNCap and DU145 cell lines.The nucleostemin mRNA and protein expression were measured by RT-PCR and Western blot.Immunohistochemistry was also used to detect the nucleostemin protein expression in prostate cancer tissues and PC-3 cells.A nucleostemin specific,short hairpin RNA,expression plasmid was used to transfect PC-3 cells.The changes of nucleostemin gene were detected and the proliferative capacity of the cells was determined.Results Nucleostemin was highly expressed in prostate cancer tissues and cell lines.Nucleostemin expression level in the silencer group PC-3 cells remarkably reduced.The proliferation rate of silencer group PC-3 cells decreased and the percentage of G1 stage cells increased.The neoplasm forming capacity in nude mice of the silencer group PC-3 cells decreased significantly.Conclusions Nucleostemin is highly expressed in prostate cancer tissues and cell lines.The proliferative capacity of PC-3 cells is remarkably reduced after silencing nucleostemin gene expression.

  6. β-catenin expression pattern in primary oral squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    CAI Zhi-gang; SHI Xiao-jian; GAO Yan; WEI Ming-jie; WANG Cun-yu; YU Guang-yan

    2008-01-01

    Background β-catenin, a 92 kDa protein that binds to the cytoplasmic tail of E-cadherin, has an essential role in intercellular adhesion and signal transduction. Aberrant expression of β-catenin has been associated with progression and metastasis of various human cancers. The aim of this study was to elucidate the expression pattem of β-catenin in primary oral squamous cell carcinoma and examine the correlation between β-catenin expression and tumor differentiation, histological grade and lymph node status as well as its clinical significances.Methods Seventy-six patients with oral squamous cell carcinoma and sixteen metastatic lymph nodes were studied.The β-catenin expression was determined by immunohistochemical staining. The correlation with clinical, histological data was analyzed statistically.Results Normal oral epithelium showed strong β-catenin expression at the cell membrane, but no cytoplasmic or nuclear expression. Different degrees of reduced expression of β-catenin at the cell membrane were found in 54 cases with squamous cell carcinoma (71%). Cytoplasmic β-catenin expression was found in 17 tumors (22.4%). Three caseswere found with nuclear β-catenin expression. In sixteen lymph nodes with metastatic squamous cell carcinoma,negative β-catenin expression at the cell membrane was seen in 13 tumors (81.2%) and weak expression in 3 tumors (18.8%). Statistical analysis showed that there was an inverse correlation between β-catenin expression and lymph node status and histological grade of tumors.Conclusions Reduced β-catenin expression at the cell membrane is clearly associated with lymph node metastasis. A reduced expression of β-catenin may constitute a hallmark of aggressive biological behavior of squamous cell carcinoma.

  7. PD-L1 Expression on Retrovirus-Infected Cells Mediates Immune Escape from CD8+ T Cell Killing.

    Directory of Open Access Journals (Sweden)

    Ilseyar Akhmetzyanova

    2015-10-01

    Full Text Available Cytotoxic CD8+ T Lymphocytes (CTL efficiently control acute virus infections but can become exhausted when a chronic infection develops. Signaling of the inhibitory receptor PD-1 is an important mechanism for the development of virus-specific CD8+ T cell dysfunction. However, it has recently been shown that during the initial phase of infection virus-specific CD8+ T cells express high levels of PD-1, but are fully competent in producing cytokines and killing virus-infected target cells. To better understand the role of the PD-1 signaling pathway in CD8+ T cell cytotoxicity during acute viral infections we analyzed the expression of the ligand on retrovirus-infected cells targeted by CTLs. We observed increased levels of PD-L1 expression after infection of cells with the murine Friend retrovirus (FV or with HIV. In FV infected mice, virus-specific CTLs efficiently eliminated infected target cells that expressed low levels of PD-L1 or that were deficient for PD-L1 but the population of PD-L1high cells escaped elimination and formed a reservoir for chronic FV replication. Infected cells with high PD-L1 expression mediated a negative feedback on CD8+ T cells and inhibited their expansion and cytotoxic functions. These findings provide evidence for a novel immune escape mechanism during acute retroviral infection based on PD-L1 expression levels on virus infected target cells.

  8. PKCeta enhances cell cycle progression, the expression of G1 cyclins and p21 in MCF-7 cells.

    Science.gov (United States)

    Fima, E; Shtutman, M; Libros, P; Missel, A; Shahaf, G; Kahana, G; Livneh, E

    2001-10-11

    Protein kinase C encodes a family of enzymes implicated in cellular differentiation, growth control and tumor promotion. However, not much is known with respect to the molecular mechanisms that link protein kinase C to cell cycle control. Here we report that the expression of PKCeta in MCF-7 cells, under the control of a tetracycline-responsive inducible promoter, enhanced cell growth and affected the cell cycle at several points. The induced expression of another PKC isoform, PKCdelta, in MCF-7 cells had opposite effects and inhibited their growth. PKCeta expression activated cellular pathways in these cells that resulted in the increased expression of the G1 phase cyclins, cyclin D and cyclin E. Expression of the cyclin-dependent kinase inhibitor p21(WAF1) was also specifically elevated in PKCeta expressing cells, but its overall effects were not inhibitory. Although, the protein levels of the cyclin-dependent kinase inhibitor p27(KIP1) were not altered by the induced expression of PKCeta, the cyclin E associated Cdk2 kinase activity was in correlation with the p27(KIP1) bound to the cyclin E complex and not by p21(WAF1) binding. PKCeta expression enhanced the removal of p27(KIP1) from this complex, and its re-association with the cyclin D/Cdk4 complex. Reduced binding of p27(KIP1) to the cyclin D/Cdk4 complex at early time points of the cell cycle also enhanced the activity of this complex, while at later time points the decrease in bound p21(WAF1) correlated with its increased activity in PKCeta-expressing cells. Thus, PKCeta induces altered expression of several cell cycle functions, which may contribute to its ability to affect cell growth.

  9. Silibinin inhibits triple negative breast cancer cell motility by suppressing TGF-β2 expression.

    Science.gov (United States)

    Kim, Sangmin; Han, Jeonghun; Jeon, Myeongjin; You, Daeun; Lee, Jeongmin; Kim, Hee Jung; Bae, Sarang; Nam, Seok Jin; Lee, Jeong Eon

    2016-08-01

    Transforming growth factor-beta (TGF-β) is a multifunctional cytokine that regulates many biological events including cell motility and angiogenesis. Here, we investigated the role of elevated TGF-β2 level in triple negative breast cancer (TNBC) cells and the inhibitory effect of silibinin on TGF-β2 action in TNBC cells. Breast cancer patients with high TGF-β2 expression have a poor prognosis. The levels of TGF-β2 expression increased significantly in TNBC cells compared with those in non-TNBC cells. In addition, cell motility-related genes such as fibronectin (FN) and matrix metalloproteinase-2 (MMP-2) expression also increased in TNBC cells. Basal FN, MMP-2, and MMP-9 expression levels decreased in response to LY2109761, a dual TGF-β receptor I/II inhibitor, in TNBC cells. TNBC cell migration also decreased in response to LY2109761. Furthermore, we observed that TGF-β2 augmented the FN, MMP-2, and MMP-9 expression levels in a time- and dose-dependent manner. In contrast, TGF-β2-induced FN, MMP-2, and MMP-9 expression levels decreased significantly in response to LY2109761. Interestingly, we found that silibinin decreased TGF-β2 mRNA expression level but not that of TGF-β1 in TNBC cells. Cell migration as well as basal FN and MMP-2 expression levels decreased in response to silibinin. Furthermore, silibinin significantly decreased TGF-β2-induced FN, MMP-2, and MMP-9 expression levels and suppressed the lung metastasis of TNBC cells. Taken together, these results suggest that silibinin suppresses metastatic potential of TNBC cells by inhibiting TGF-β2 expression in TNBC cells. Thus, silibinin may be a promising therapeutic drug to treat TNBC.

  10. Differences in integrin expression and signaling within human breast cancer cells

    Directory of Open Access Journals (Sweden)

    Liu Yongqing

    2011-07-01

    Full Text Available Abstract Background Integrins are used as prognostic indicators in breast cancer. Following engagement with extracellular matrix proteins, their signaling influences numerous cellular processes including migration, proliferation, and death. Integrin signaling varies between cell types through differential expression of integrin subunits, and changes within a given cell upon exposure to a cell agonist or through changes in its surroundings. These variations in signaling can profoundly affect the phenotypic, tumorogenecity and metastatic properties of cancer cells. In the present study, we investigated if there were differences in the expression of integrins, integrin structures, and integrin co-receptors within three breast cancer cells and if these differences effected integrin signaling. Methods Expression of integrins, urokinase receptor and vascular endothelial cell growth factor receptor (VEGFR in metastatic MDA-MB-435 and MDA-MB-231, non-metastatic MCF7 and non-breast cancer Hek-293 cells was measured by flow cytometry. Cell adhesion was assessed using collagen, fibrinogen, fibronectin and vitronectin coated plates. Changes in kinase levels following PMA stimulation, and cell adhesion-induced activation of kinases were determined by western blot analysis. Distribution of actin stress fibers and focal adhesions was assessed by immunocytochemistry. Results All cells expressed αv integrins, while high β5 and αvβ5 expression was restricted to the cancer cells and high β3 and αvβ3 expression was restricted to MDA-MB-435 cells. The two metastatic cells were the least adhesive, but all cells adhered well to most proteins in the absence of PMA. All proliferating cells expressed activated pSrc, but only proliferating metastatic cells expressed high pMEK levels. PMA treatment resulted in time-dependent changes in activated kinase levels, and only MDA-MB-231 cells constitutively expressed high levels of activated pMEK. MDA-MB-435 cells formed

  11. Dendritic differentiation of cerebellar Purkinje cells is promoted by ryanodine receptors expressed by Purkinje and granule cells.

    Science.gov (United States)

    Ohashi, Ryo; Sakata, Shin-ichi; Naito, Asami; Hirashima, Naohide; Tanaka, Masahiko

    2014-04-01

    Cerebellar Purkinje cells have the most elaborate dendritic trees among neurons in the brain. We examined the roles of ryanodine receptor (RyR), an intracellular Ca(2+) release channel, in the dendrite formation of Purkinje cells using cerebellar cell cultures. In the cerebellum, Purkinje cells express RyR1 and RyR2, whereas granule cells express RyR2. When ryanodine (10 µM), a blocker of RyR, was added to the culture medium, the elongation and branching of Purkinje cell dendrites were markedly inhibited. When we transferred small interfering RNA (siRNA) against RyR1 into Purkinje cells using single-cell electroporation, dendritic branching but not elongation of the electroporated Purkinje cells was inhibited. On the other hand, transfection of RyR2 siRNA into granule cells also inhibited dendritic branching of Purkinje cells. Furthermore, ryanodine reduced the levels of brain-derived neurotrophic factor (BDNF) in the culture medium. The ryanodine-induced inhibition of dendritic differentiation was partially rescued when BDNF was exogenously added to the culture medium in addition to ryanodine. Overall, these results suggest that RyRs expressed by both Purkinje and granule cells play important roles in promoting the dendritic differentiation of Purkinje cells and that RyR2 expressed by granule cells is involved in the secretion of BDNF from granule cells.

  12. Human cancer cells express Slug-based epithelial-mesenchymal transition gene expression signature obtained in vivo

    Directory of Open Access Journals (Sweden)

    Anastassiou Dimitris

    2011-12-01

    Full Text Available Abstract Background The biological mechanisms underlying cancer cell motility and invasiveness remain unclear, although it has been hypothesized that they involve some type of epithelial-mesenchymal transition (EMT. Methods We used xenograft models of human cancer cells in immunocompromised mice, profiling the harvested tumors separately with species-specific probes and computationally analyzing the results. Results Here we show that human cancer cells express in vivo a precise multi-cancer invasion-associated gene expression signature that prominently includes many EMT markers, among them the transcription factor Slug, fibronectin, and α-SMA. We found that human, but not mouse, cells express the signature and Slug is the only upregulated EMT-inducing transcription factor. The signature is also present in samples from many publicly available cancer gene expression datasets, suggesting that it is produced by the cancer cells themselves in multiple cancer types, including nonepithelial cancers such as neuroblastoma. Furthermore, we found that the presence of the signature in human xenografted cells was associated with a downregulation of adipocyte markers in the mouse tissue adjacent to the invasive tumor, suggesting that the signature is triggered by contextual microenvironmental interactions when the cancer cells encounter adipocytes, as previously reported. Conclusions The known, precise and consistent gene composition of this cancer mesenchymal transition signature, particularly when combined with simultaneous analysis of the adjacent microenvironment, provides unique opportunities for shedding light on the underlying mechanisms of cancer invasiveness as well as identifying potential diagnostic markers and targets for metastasis-inhibiting therapeutics.

  13. Lineage Tracing and Cell Ablation Identify a Post-Aire-Expressing Thymic Epithelial Cell Population

    Directory of Open Access Journals (Sweden)

    Todd C. Metzger

    2013-10-01

    Full Text Available Thymic epithelial cells in the medulla (mTECs play a critical role in enforcing central tolerance through expression and presentation of tissue-specific antigens (TSAs and deletion of autoreactive thymocytes. TSA expression requires autoimmune regulator (Aire, a transcriptional activator present in a subset of mTECs characterized by high CD80 and major histocompatibility complex II expression and a lack of potential for differentiation or proliferation. Here, using an Aire-DTR transgenic line, we show that short-term ablation specifically targets Aire+ mTECs, which quickly undergo RANK-dependent recovery. Repeated ablation also affects Aire− mTECs, and using an inducible Aire-Cre fate-mapping system, we find that this results from the loss of a subset of mTECs that showed prior expression of Aire, maintains intermediate TSA expression, and preferentially migrates toward the center of the medulla. These results clearly identify a distinct stage of mTEC development and underscore the diversity of mTECs that play a key role in maintaining tolerance.

  14. MICA Expression Is Regulated by Cell Adhesion and Contact in a FAK/Src-Dependent Manner

    Science.gov (United States)

    Moncayo, Gerald; Lin, Da; McCarthy, Michael T.; Watson, Aleksandra A.; O’Callaghan, Christopher A.

    2017-01-01

    MICA is a major ligand for the NKG2D immune receptor, which plays a key role in activating natural killer (NK) cells and cytotoxic T cells. We analyzed NKG2D ligand expression on a range of cell types and could demonstrate that MICA expression levels were closely linked to cellular growth mode. While the expression of other NKG2D ligands was largely independent of cell growth mode, MICA expression was mainly found on cells cultured as adherent cells. In addition, MICA surface expression was reduced through increase in cell–cell contact or loss of cell–matrix adherence. Furthermore, we found that the reduction in MICA expression was modulated by focal adhesion kinase (FAK)/Src signaling and associated with increased susceptibility to NK cell-mediated killing. While the mechanisms of tumor immune evasion are not fully understood, the reduction of MICA expression following loss of attachment poises a potential way by which metastasizing tumor cells avoid immune detection. The role of FAK/Src in this process indicates a potential therapeutic approach to modulate MICA expression and immune recognition of tumor cells during metastasis. PMID:28154561

  15. Pancreatic cancer cells express CD44 variant 9 and multidrug resistance protein 1 during mitosis.

    Science.gov (United States)

    Kiuchi, Shizuka; Ikeshita, Shunji; Miyatake, Yukiko; Kasahara, Masanori

    2015-02-01

    Pancreatic cancer is one of the most lethal cancers with high metastatic potential and strong chemoresistance. Its intractable natures are attributed to high robustness in tumor cells for their survival. We demonstrate here that pancreatic cancer cells (PCCs) with an epithelial phenotype upregulate cell surface expression of CD44 variant 9 (CD44v9), an important cancer stem cell marker, during the mitotic phases of the cell cycle. Of five human CD44(+) PCC lines examined, three cell lines, PCI-24, PCI-43 and PCI-55, expressed E-cadherin and CD44 variants, suggesting that they have an epithelial phenotype. By contrast, PANC-1 and MIA PaCa-2 cells expressed vimentin and ZEB1, suggesting that they have a mesenchymal phenotype. PCCs with an epithelial phenotype upregulated cell surface expression of CD44v9 in prophase, metaphase, anaphase and telophase and downregulated CD44v9 expression in late-telophase, cytokinesis and interphase. Sorted CD44v9-negative PCI-55 cells resumed CD44v9 expression when they re-entered the mitotic stage. Interestingly, CD44v9(bright) mitotic cells expressed multidrug resistance protein 1 (MDR1) intracellularly. Upregulated expression of CD44v9 and MDR1 might contribute to the intractable nature of PCCs with high proliferative activity.

  16. Requirement of cyclooxygenase-2 expression and prostaglandins for human prostate cancer cell invasion.

    Science.gov (United States)

    Nithipatikom, Kasem; Isbell, Marilyn A; Lindholm, Paul F; Kajdacsy-Balla, Andre; Kaul, Sushma; Campell, William B

    2002-01-01

    The PC-3 Low Invasive cells and the PC-3 High Invasive cells were used to investigate the correlation of the COX-2 expression and its arachidonic acid metabolites, prostaglandins, with their invasiveness through Matrigel using a Boyden chamber assay. The COX-2 expression in PC-3 High Invasive cells was approximately 3-fold higher than in PC-3 Low Invasive cells while the COX-1 expression was similar in both cell sublines. When incubated with arachidonic acid, PGE2 was the major prostaglandin produced by these cells. PC-3 High Invasive cells produced PGE2 approximately 2.5-fold higher than PC-3 Low Invasive cells. PGD2 was the second most abundant prostaglandin produced by these cells. Both indomethacin (a nonspecific COX inhibitor) and NS-398 (a specific COX-2 inhibitor) inhibited the production of prostaglandins and the cell invasion. PGE2 alone did not induce the cell invasion of PC-3 Low Invasive cells. However, PGE2 reversed the inhibition of cell invasion by NS-398 and enhanced the cell invasion of the PC-3 High Invasive cells. In contrast, PGD2 slightly inhibited the cell invasion. These results suggest that in the PC-3 Low Invasive cells, COX-2-derived PGE2 may not be sufficient to induce cell invasion while in the PC-3 High Invasive cells, PGE2 may be sufficient to act as an enhancer for the cell invasion. Further, PGD2 may represent a weak inhibitor and counteracts the effect of PGE2 in the cell invasion.

  17. Characterization of Cardiac-Resident Progenitor Cells Expressing High Aldehyde Dehydrogenase Activity

    Directory of Open Access Journals (Sweden)

    Marc-Estienne Roehrich

    2013-01-01

    Full Text Available High aldehyde dehydrogenase (ALDH activity has been associated with stem and progenitor cells in various tissues. Human cord blood and bone marrow ALDH-bright (ALDHbr cells have displayed angiogenic activity in preclinical studies and have been shown to be safe in clinical trials in patients with ischemic cardiovascular disease. The presence of ALDHbr cells in the heart has not been evaluated so far. We have characterized ALDHbr cells isolated from mouse hearts. One percent of nonmyocytic cells from neonatal and adult hearts were ALDHbr. ALDHvery-br cells were more frequent in neonatal hearts than adult. ALDHbr cells were more frequent in atria than ventricles. Expression of ALDH1A1 isozyme transcripts was highest in ALDHvery-br cells, intermediate in ALDHbr cells, and lowest in ALDHdim cells. ALDH1A2 expression was highest in ALDHvery-br cells, intermediate in ALDHdim cells, and lowest in ALDHbr cells. ALDH1A3 and ALDH2 expression was detectable in ALDHvery-br and ALDHbr cells, unlike ALDHdim cells, albeit at lower levels compared with ALDH1A1 and ALDH1A2. Freshly isolated ALDHbr cells were enriched for cells expressing stem cell antigen-1, CD34, CD90, CD44, and CD106. ALDHbr cells, unlike ALDHdim cells, could be grown in culture for more than 40 passages. They expressed sarcomeric α-actinin and could be differentiated along multiple mesenchymal lineages. However, the proportion of ALDHbr cells declined with cell passage. In conclusion, the cardiac-derived ALDHbr population is enriched for progenitor cells that exhibit mesenchymal progenitor-like characteristics and can be expanded in culture. The regenerative potential of cardiac-derived ALDHbr cells remains to be evaluated.

  18. Expression of goose parvovirus whole VP3 protein and its epitopes in Escherichia coli cells.

    Science.gov (United States)

    Tarasiuk, K; Woźniakowski, G; Holec-Gąsior, L

    2015-01-01

    The aim of this study was the expression of goose parvovirus capsid protein (VP3) and its epitopes in Escherichia coli cells. Expression of the whole VP3 protein provided an insufficient amount of protein. In contrast, the expression of two VP3 epitopes (VP3ep4, VP3ep6) in E. coli, resulted in very high expression levels. This may suggest that smaller parts of the GPV antigenic determinants are more efficiently expressed than the complete VP3 gene.

  19. Environmental alkylphenols modulate cytokine expression in plasmacytoid dendritic cells.

    Directory of Open Access Journals (Sweden)

    Chih-Hsing Hung

    Full Text Available BACKGROUND: Alkylphenols, such as nonylphenol (NP and 4-octylphenol (4-OP, have the potential to disturb immune system due to their weak estrogen-like activity, an effect with potential serious public health impact due to the worldwide distribution of these substances. Plasmacytoid dendritic cells (PDCs can secrete large amounts of type I IFNs and are critical in immune regulation. However, there has been limited study about the influence of alkylphenols on the function of pDCs. OBJECTIVE: The aim of this study was to examine the effect of alkylphenols on pDC functions in vitro and in vivo and then further explored the involved signaling pathways and epigenetic changes. METHODS: Circulating pDCs from human peripheral blood mononuclear cells were treated with alkylphenols with or without CpG stimulation. Alkylphenol-associated cytokine responses, signaling events, histone modifications and viral activity were further examined. In NP-exposed mice, the effect of NP on splenic pDC function and allergic lung inflammation were also assessed. RESULTS: The results showed that NP increased the expression of TNF-α, but suppressed IL-10 production in the range of physiological doses, concomitant with activation of the MKK3/6-p38 signaling pathway and enhanced levels of acetylated histone 3 as well as histone 4 at the TNFA gene locus. Further, in CpG-stimulated pDCs, NP suppressed type I IFNs production, associated with down-regulation of IRF-7 and MKK1/2-ERK-Elk-1 pathways and led to the impaired anti-enterovirus 71 activity in vitro. Additionally, splenic pDCs from NP-exposed mice showed similar cytokine changes upon CpG stimulation under conditions relevant to route and level of exposure in humans. NP treatment also enhanced allergic lung inflammation in vivo. CONCLUSION: Alkylphenols may influence pDCs' functions via their abilities to induce expression of a pro-inflammatory cytokine, TNF-α, and to suppress regulatory cytokines, including IL-10, IFN

  20. Gene cloning of human soluble CD14 and its expression in eucaryotic cells

    Institute of Scientific and Technical Information of China (English)

    荫俊; 白洁; 王威; 宋伟; 王忠泽

    2002-01-01

    To express human soluble CD14 (sCD14) in eukaryotic cells. Methods: Human sCD14 cDNA was amplified from U937 cells with RT-PCR method. The recombinant expression plasmid pEF1/HisC/sCD14348aa was constructed and the expression in COS-7 cells was carried out using liposome transfection method. The yield was examined with scanning map identification. The expressed product was purified by immuno-affinity chromatography. Results: Sequence analysis demonstrated that the amplified gene sequence and those reported by documents were completely identical. sCD14 was expressed with high-yield. The expressed product was purified to above 90%. Recombinant sCD14, specifically combinable with endotoxins, had a natural biological activity. Conclusions: Human sCD14 was expressed in COS-7 cells, which laid a foundation for further study.

  1. Mast cells infiltration and decreased E-cadherin expression in ketamine-induced cystitis

    Directory of Open Access Journals (Sweden)

    Mengqiang Li

    2015-01-01

    Conclusions: Increased mast cells in bladder wall and downregulated expression of E-cadherin junction protein in epithelial cells were probably associated with interstitial inflammation and fissures in mucosa. It implied that ketamine induced an interstitial cystitis.

  2. Dissecting the heterogeneity of gene expressions in mouse embryonic stem cells

    Science.gov (United States)

    Zou, Ling-Nan; Thomson, Matt; Liu, S. John; Ramanathan, Sharad

    2011-03-01

    A population of genetically identical cells, of the same nominal cell type, and cultured in the same petri dish, will nevertheless often exhibit varying patterns of gene expression. Taking mouse embryonic stem (ES) cells as a model system, we use immunofluorescence and flow cytometry to examine in detail the distribution of expression levels for various transcription factors key to the maintenance of the ES cell identity. We find the population-level distribution of many proteins, once rescaled by the average expression level, have very similar shapes. This suggest the largest component of observed heterogeneity comes from a single source. More subtly, we find the expression many of genes appears to modulate with the cell cycle. This may suggest that the program for maintaining ES cell identity is tightly coupled to the cell cycle machinery. This work is supported by the Harvard Stem Cell Institute and the Jane Coffin Childs Memorial Fund for Medical Research.

  3. T cells expressing VHH-directed oligoclonal chimeric HER2 antigen receptors

    DEFF Research Database (Denmark)

    Jamnani, Fatemeh Rahimi; Rahbarizadeh, Fatemeh; Shokrgozar, Mohammad Ali;

    2014-01-01

    Adoptive cell therapy with engineered T cells expressing chimeric antigen receptors (CARs) originated from antibodies is a promising strategy in cancer immunotherapy. Several unsuccessful trials, however, highlight the need for alternative conventional binding domains and the better combination...

  4. Increasing RpoS expression causes cell death in Borrelia burgdorferi.

    Directory of Open Access Journals (Sweden)

    Linxu Chen

    Full Text Available RpoS, one of the two alternative σ factors in Borrelia burgdorferi, is tightly controlled by multiple regulators and, in turn, determines expression of many critical virulence factors. Here we show that increasing RpoS expression causes cell death. The immediate effect of increasing RpoS expression was to promote bacterial division and as a consequence result in a rapid increase in cell number before causing bacterial death. No DNA fragmentation or degradation was observed during this induced cell death. Cryo-electron microscopy showed induced cells first formed blebs, which were eventually released from dying cells. Apparently blebbing initiated cell disintegration leading to cell death. These findings led us to hypothesize that increasing RpoS expression triggers intracellular programs and/or pathways that cause spirochete death. The potential biological significance of induced cell death may help B. burgdorferi regulate its population to maintain its life cycle in nature.

  5. Effect of Human Cytomegalovirus Infection on Nerve Growth Factor Expression in Human Glioma U251 Cells

    Institute of Scientific and Technical Information of China (English)

    HAI-TAO WANG; BIN WANG; ZHI-JUN LIU; ZHI-QIANG BAI; LING LI; HAI-YAN LIU; DONG-MENG QIAN; ZHI-YONG YAN; XU-XIA SONG

    2009-01-01

    Objectives To explore the change of endogenic nerve growth factor (NGF) expression in human glioma cells infected with human cytomegalovirus (HCMV). Methods U251 cells were cultured in RPMI 1640 culture medium and infected with HCMV AD169 strain in vitro to establish a cell model of viral infection. Morphologic changes of U251 cells were observed under inverted microscope before and after infection with HCMV. Expression of NGF gene and protein of cells was detected by RT-PCR and Western blotting before and after infection with HCMV. Results The cytopathic effects of HCMV-infected cells appeared on day 5 after infection. However, differential NGF expression was evident on day 7. NGF expression was decreased significantly in U251 cells on day 7 after infection in comparison with control group (P<0.05). Conclusion HCMV can down-regulate endogenous NGF levels in human glioma cell line U251.

  6. The expression of P63 protein in some keratinocyte original tissues and cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective:To examine the expression patterns of p63 in tissues of particular keratinocyte original hyperproliferate diseases and variety cell types for determining if P63 is the marker of proliferative potential keratinocytes.Methods:P63 protein Was detected and analyzed by immunoreacdvity method and Western blot in biopsy specimens of keratinocyte original disorders including squamous cell carcinomas SCC,basal cell carcinomas BCC,Bowen's disease and other tissues or cells,such as psoriasis vulgaris,normal skin tissues,primary cultured keratinocytes,immortal HaCaT cells,and epidermoid carcinoma cells A431.Results:P63 protein was expressed in the nuclei of basal and suprabasal layer of the epidermis,germinative cells of sebaceous glands in normal epidermal.P63 was strongly and diffusely detected in the majority of tumor cells in BCC and poorly-differentiated SCC.In Bowen's disease,p63expresses are remarkable in all cell layers.In the psoriasis plaque epidermal,p63 expressed mainly in basal cells and part of spinous cells.P63 expressed more strongly in primary cultured keratinocytes than in A431 cells or HaCaT cells.Conclusion:P63 is a nuclei marker of undifferentiated keratinocytes with the proliferative potential and may disrupt the terminal differentiation.The overexpression of p63 reflects immaturity of the tumor cells.The immunohistochemical staining of p63 may be useful for investigating the origin and differentiation of tumor cells.

  7. Effects of fulvestrant on biological activity and Wnt expression in rat GH3 cells

    Institute of Scientific and Technical Information of China (English)

    Jiwei Bai; Yan Wang; Chuzhong Li; Yazhuo Zhang

    2012-01-01

    The present study investigated the influence of anti-estrogen treatment (fulvestrant) on pituitary adenoma cell line GH3 biological activity, the estrogen receptor α pathway, the WnT pathway, and mechanisms of decreased Wnt inhibitory factor-1 expression in GH3 cells. Results showed that fulvestrant suppressed GH3 cell proliferation and reduced hormone secretion in a dose-dependent manner. Estrogen receptor α and Wnt4 expression decreased, but Wnt inhibitory factor-1 expression increased in a dose-dependent manner following fulvestrant treatment, and β-catenin expression remained unchanged. Inhibitors of DNA methylation and histone modification upregulated Wnt inhibitory factor-1 expression. Results suggested that fulvestrant suppressed biological activity of GH3 cells via the estrogen receptor α and Wnt pathways. These results suggested that decreased Wnt inhibitory factor-1 expression in GH3 cells played a role in epigenetic mechanisms. Anti-estrogen therapies could provide novel treatments for growth hormone adenomas.

  8. Functional expression of mammalian receptors and membrane channels in different cells.

    Science.gov (United States)

    Eifler, Nora; Duckely, Myriam; Sumanovski, Lazar T; Egan, Terrance M; Oksche, Alexander; Konopka, James B; Lüthi, Anita; Engel, Andreas; Werten, Paul J L

    2007-08-01

    In native tissues, the majority of medically important membrane proteins is only present at low concentrations, making their overexpression in recombinant systems a prerequisite for structural studies. Here, we explore the commonly used eukaryotic expression systems-yeast, baculovirus/insect cells (Sf9) and Semliki Forest Virus (SFV)/mammalian cells-for the expression of seven different eukaryotic membrane proteins from a variety of protein families. The expression levels, quality, biological activity, localization and solubility of all expressed proteins are compared in order to identify the advantages of one system over the other. SFV-transfected mammalian cell lines provide the closest to native environment for the expression of mammalian membrane proteins, and they exhibited the best overall performance. But depending on the protein, baculovirus-infected Sf9 cells performed almost as well as mammalian cells. The lowest expression levels for the proteins tested here were obtained in yeast.

  9. Low microRNA-199a expression in human amniotic epithelial cell feeder layers maintains human-induced pluripotent stem cell pluripotency via increased leukemia inhibitory factor expression

    Institute of Scientific and Technical Information of China (English)

    Te Liu; Qing Chen; Yongyi Huang; Qin Huang; Lizhen Jiang; Lihe Guo

    2012-01-01

    Human-induced pluripotent stem (iPS) cells share the same key properties as embryonic stem cells,and may be generated from patient- or disease-specific sources,which makes them attractive for personalized medicine,drug screens,or cellular therapy.Long-term cultivation and maintenance of normal iPS cells in an undifferentiated self-renewing state is a major challenge.Our previous studies have shown that human amniotic epithelial cells (HuAECs) could provide a good source of feeder cells for mouse and human embryonic stem cells,or spermatogonial stem cells,as they express endogenous leukemia inhibitory factor (LIF) at high levels.Here,we examined the effect of exogenous microRNA-199a regulation on endogenous LIF expression in HuAECs,and in torn on human iPS cell pluripotency.We found that HuAECs feeder cells transfected with microRNA-199a mutant expressed LIF at high levels,allowing iPS to maintain a high level of alkaline phosphatase activity in longterm culture and form teratomas in severe combined immunodeficient mice.The expression of stem cell markers was increased in iPS cultured on HuAECs feeder cells transfected with the microRNA-199a mutant,compared with iPS cultured on HuAECs transfected with microRNA-199a or mouse embryo fibroblasts.Taken together,these results suggested that LIF expression might be regulated by microRNA-199a,and LIF was a crucial component in feeder cells,and also was required for maintenance of human iPS cells in an undifferentiated,proliferative state capable of self-renewal.

  10. Quantum dots-based multiplexed immunohistochemistry of protein expression in human prostate cancer cells

    Directory of Open Access Journals (Sweden)

    C Shi

    2008-06-01

    Full Text Available Semiconductor quantum dots (QDs are bright fluorescent nanoparticles that have been successfully used for the detection of biomarker expression in cells. The objective of the present study is to use this technology in a multiplexing manner to determine at a single cell level the expression of a cell-specific bio-marker, prostate-specific antigen (PSA expressed by human prostate cancer LNCaP and ARCaP cell lines. Here we compared the sensitivity of immunohistochemistry (IHC and QD-based detection of AR and PSA expression in these cell lines. Further, we conducted multiplexing QD-based detection of PSA and androgen receptor (AR expression in LNCaP cells subjecting to androgen (R1881 stimulation. The involvement of AR in PSA regulation in LNCaP cells, at a single cell level, was confirmed by the co-incubation of LNCaP cells in the presence of both R1881 and its receptor antagonist, bicalutamide (Casodex. We showed here the superior quality of QDs, in comparison to IHC, for the detection of AR and PSA in cultured LNCaP and ARCaP cells. Multiplexing QDs technique can be used to detect simultaneously AR and PSA expression induced by R1881 which promoted AR translocation from its cytosolic to the nuclear compartment.We observed AR antagonist, bicalutamide, inhibited AR nuclear translocation and PSA, but not AR expression in LNCaP cells.

  11. Interleukin-1 receptors are differentially expressed in normal and psoriatic T cells.

    Science.gov (United States)

    Bebes, Attila; Kovács-Sólyom, Ferenc; Prihoda, Judit; Kui, Róbert; Kemény, Lajos; Gyulai, Rolland

    2014-01-01

    This study was carried out to examine the possible role of interleukin-1 (IL-1) in the functional insufficiency of regulatory T cells in psoriasis, by comparing the expression of IL-1 receptors on healthy control and psoriatic T cells. Patients with moderate-to-severe chronic plaque psoriasis and healthy volunteers, matched in age and sex, were selected for all experiments. CD4(+)CD25(-) effector and CD4(+)CD25(+)CD127(low) regulatory T cells were separated and used for the experiments. Expression of the mRNA of IL-1 receptors (IL-1R1, IL-1R2, and sIL-1R2) was determined by quantitative real-time RT-PCR. Cell surface IL-1 receptor expression was assessed by flow cytometry. Relative expression of the signal transmitting IL-1 receptor type 1 (IL-1R1) mRNA is higher in resting psoriatic effector and regulatory T cells, and activation induces higher IL-1R1 protein expression in psoriatic T cells than in healthy cells. Psoriatic regulatory and effector T cells express increased mRNA levels of the decoy IL-1 receptors (IL-1R2 and sIL-1R2) upon activation compared to healthy counterparts. Psoriatic T cells release slightly more sIL-1R2 into their surrounding than healthy T cells. In conclusion, changes in the expression of IL-1 receptors in psoriatic regulatory and effector T cells could contribute to the pathogenesis of psoriasis.

  12. RNA interference by expression of short hairpin RNAs suppresses bcl-xL gene expression in nasopharyngeal carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    Fang LIU; Cheng-wei HE; Yue-fei ZHANG; Ke-yuan ZHOU

    2005-01-01

    Aim: To evaluate a new plasmid mediated RNA interference (RNAi) system and investigate whether knock-down of bcl-xL by short hairpin RNA (shRNA) can induce apoptosis of human nasopharyngeal carcinoma (NPC) cell line CNE-2Z in vitro. Methods: The plasmid containing mU6 promoter was subcloned to yield the pmU6 plasmid, recombinant plasmid expressing shRNA targeting bcl-xL gene was designed and constructed, and were co-transfected cells with green fluorescence protein expressing plasmid. Flow cytometry was used to evaluate transfection efficiency, and RT-PCR and Western blot were applied to analyze bcl-xL mRNA and protein levels, respectively. Results: The shRNA expressed by the recombi nant plasmid efficiently suppressed bcl-xL gene expression and induced apoptosis .of NPC cells in vitro. Conclusion: The recombinant plasmid can sufficiently mediate RNAi in CNE-2Z cells, and knock-down of the bcl-xL expression by shRNA significantly induced apoptosis in CNE-2Z cells. The results suggest this new system, mediated RNAi can be used as a tool for the study of gene function and gene therapy.

  13. The expression of glucose regulated protein-94 in colorectal carcinoma cells treated by sodium butyrate

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The expression of glucose regulated protein 94 (GRP94)during the treatment of human colorectal carcinoma cell lineClone A cells with sodium butyrate was studied. Sodium butyrate (SB) can cause functional and morphological effects on Clone A cells including growth arrest at G0/G1 stage and cell differentiation as observed by morphological changes, MTT and flow cytometry assays, as well as reduced Grp94 gene expression as shown by Northern blot and Western blot assays. The possible mechanism of the correlation between Grp94 gene expression and tumor growth inhibition and cell differentiation is briefly discussed.

  14. The expression of glucose regulated protein—94 in colorectal carcinoma cells treated by sodium butyrate

    Institute of Scientific and Technical Information of China (English)

    WUYIDI; JINDANSONG

    2000-01-01

    The expression of glucose regulated protein 94 (GPR94) during the treatment of human colorectal carcinoma cell lineClone A cells with codium butyrate was studied.Dodium butyrate (SB) can cause functional and morphological effects on Clone A cells including growth arrest at G0/G1 stage and cell differentiation as observed by morphological changes,MTT and flow cytometry assays,as well as reduced Grp94 gene expression as shown by Northern blot and Western blot assays.The possible mechanism of the correlation between Grp94 gene expression and tumor growth inhibition and cell differentiation is briefly discussed.

  15. Comparative identification of Ca2+ channel expression in INS-1 and rat pancreatic β cells

    Institute of Scientific and Technical Information of China (English)

    Fei Li; Zong-Ming Zhang

    2009-01-01

    AIM: To identify and compare the profile of Ca2+ channel subunit expression in INS-1 and rat pancreatic β cells. METHODS: The rat insulin-secreting INS-1 cell line was cultured in RPMI-1640 with Wistar rats employed as islet donors. Ca2+ channel subunit expression in INS-1 and isolated rat β cells were examined by reverse transcription polymerase chain reaction (RT-PCR). Absolute real-time quantitative PCR was performed in a Bio-Rad iQ5 Gradient Real Time PCR system and the data analyzed using an iQ5 system to identify the expression level of the Ca2+ channel subunits. RESULTS: In INS-1 cells, the L-type Ca2+ channel 1C subunit had the highest expression level and the TPRM2 subunit had the second highest expression. In rat β cells, the TPRC4β subunit expression was dominant and the expression of the L-type 1C subunit exceeded the 1D subunit expression about two-fold. This result agreed with other studies, confirming the important role of the L-type 1C subunit in insulinsecreting cells, and suggested that non-voltageoperated Ca2+ channels may have an important role in biphasic insulin secretion. CONCLUSION: Twelve major Ca2+ channel subunit types were identified in INS-1 and rat β cells and significant differences were observed in the expression of certain subunits between these cells.

  16. Distinct gene expression signatures in human embryonic stem cells differentiated towards definitive endoderm at single-cell level

    DEFF Research Database (Denmark)

    Norrman, Karin; Strömbeck, Anna; Semb, Henrik;

    2013-01-01

    of anterior definitive endoderm (DE). Here, we differentiated human embryonic stem cells towards DE using three different activin A based treatments. Differentiation efficiencies were evaluated by gene expression profiling over time at cell population level. A panel of key markers was used to study DE...... for the three activin A based protocols applied. Our data provide novel insights in DE gene expression at the cellular level of in vitro differentiated human embryonic stem cells, and illustrate the power of using single-cell gene expression profiling to study differentiation heterogeneity and to characterize......Characterization of directed differentiation of pluripotent stem cells towards therapeutically relevant cell types, including pancreatic beta-cells and hepatocytes, depends on molecular markers and assays that resolve the signature of individual cells. Pancreas and liver both have a common origin...

  17. Correlation between Twist expression and multidrug resistance of breast cancer cell lines

    Institute of Scientific and Technical Information of China (English)

    Yue-Xi Wang; Xiao-Mei Chen; Jun Yan; Zhi-Ping Li

    2016-01-01

    Objective:To study the correlation between Twist expression and multidrug resistance of breast cancer cell lines. Methods:Human breast cancer cell lines MCF-7, cisplatin-resistant human breast cancer cell lines MCF-7/DDP, doxorubicin-resistant human breast cancer cell lines MCF-7/Adr and taxol-resistant human breast cancer cell lines MCF/PTX were cultured, Twist in human breast cancer cell lines MCF-7 was overexpressed and treated with doxorubicin, and then cell viability and expression levels of EMT marker molecules and related signaling pathway molecules were detected. Results:mRNA contents and protein contents of Twist in drug-resistant breast cancer cell lines MCF-7/DDP, MCF-7/Adr and MCF/PTX were higher than those in MCF-7 cell lines;after doxorubicin treatment, inhibitory rates of cell viability in MCF-7 cell lines were higher than those in MCF-7/Adr and MCF-7/Twist cell lines;E-cadherin expression levels in MCF-7/Adr cell lines and MCF-7/Twist cell lines were lower than those in MCF-7 cell lines, and mRNA contents and protein contents of N-cadherin, Vimentin, TGF-β, Smad, Wnt,β-catenin, TNF-αand NF-kB were higher than those in MCF-7 cell lines. Conclusion:Increased expression of Twist is associated with the occurrence of drug resistance in breast cancer cells.

  18. The Single Cell Proteome Project - Cell-Cycle Dependent Protein Expression in Breast Cancer Cell Lines

    Science.gov (United States)

    2005-01-01

    sequencing or hybridization array capillary chromatography. After a 6-min-long preliminary technologies.30,31 separation, fractions from the first...characterize single cells. These tools include mass cating cells contain diploid, S-phase and tetraploid frac- spectrometry, electrochemistry and capillary...separation tions; and some advanced tumors contain tetraploid and methods. This review focuses on the use of capillary aneuploid cells [2

  19. Curcumin-mediated decrease in the expression of nucleolar organizer regions in cervical cancer (HeLa) cells.

    Science.gov (United States)

    Lewinska, Anna; Adamczyk, Jagoda; Pajak, Justyna; Stoklosa, Sylwia; Kubis, Barbara; Pastuszek, Paulina; Slota, Ewa; Wnuk, Maciej

    2014-09-01

    Curcumin, the major yellow-orange pigment of turmeric derived from the rhizome of Curcuma longa, is a highly pleiotropic molecule with the potential to modulate inflammation, oxidative stress, cell survival, cell secretion, homeostasis and proliferation. Curcumin, at relatively high concentrations, was repeatedly reported to be a potent inducer of apoptosis in cancer cells and thus considered a promising anticancer agent. In the present paper, the effects of low concentrations of curcumin on human cervical cancer (HeLa) cells were studied. We found curcumin-mediated decrease in the cell number and viability, and increase in apoptotic events and superoxide level. In contrast to previously shown curcumin cytotoxicity toward different cervical cancer lines, we observed toxic effects when even as low as 1 μM concentration of curcumin was used. Curcumin was not genotoxic to HeLa cells. Because argyrophilic nucleolar protein (AgNOR protein) expression is elevated in malignant cells compared to normal cells reflecting the rapidity of cancer cell proliferation, we evaluated curcumin-associated changes in size (area) and number of silver deposits. We showed curcumin-induced decrease in AgNOR protein pools, which may be mediated by global DNA hypermethylation observed after low concentration curcumin treatment. In summary, we have shown for the first time that curcumin at low micromolar range may be effective against HeLa cells, which may have implications for curcumin-based treatment of cervical cancer in humans.

  20. [Construction of eukaryotic expressing vector of multiple myeloma mucin-1 and its expression in COS-7 cells in vitro].

    Science.gov (United States)

    Liu, Kun; Luo, Yun-Jiao; Liu, Yue-Bo; Yao, Jin; Yang, Hong; Mou, Hong; Huang, Gui-Yun; Zhang, You

    2009-08-01

    In order to construct an eukaryotic expression vector for gene of multiple myeloma mucin1 (muc1-2vntr) gene and to express it in COS-7 cells in vitro, so to provide the basic material for further research of multiple myeloma DNA vaccine. muc1-2vntr coding gene was used as a research gene and a KOZAK sequence was inserted before the gene Hind III and XbaI restriction sites were inserted before and after the coding gene. Then the whole sequence was synthesized and inserted into pcDNA3.1/myc-his B vector, and the resulted recombinant vector was transformed into E.coil competent cells to get an engineering strain, the recombinant plasmid pcDNA3.1-2vntr/myc-his B identified by restriction analysis and DNA sequencing were transfected into COS-7 cells by liposome-mediated gene transfer method. Finally, fluorescent microscopy was used to assess GFP expression and Western blot analysis using muc1 monoclonal antibody was used to recognize vntr, confirming the expression of vntr. The results showed that the full length of synthesized muc1-2vntr gene, as expected, was 140 bp. Both restriction analysis and DNA sequencing demonstrated that pcDNA3.1-2vntr/myc-his B included the whole translation frame region and muc1-2vntr gene. Furthermore, the fluorescence microscopy proved that the recombinant plasmid had been successfully transfected into COS-7 cells. The expression of mucin-1 protein was observed both in the transfected cell and the cell supernatant by Western blot. It is concluded that the pcDNA3.1-2vntr/myc-his B has been successfully constructed and expressed in COS-7 cells in vitro, which provides the basic material for further researches of mucin-1 function and possible multiple myloma DNA vaccine.

  1. Differential expression profiles of glycosphingolipids in human breast cancer stem cells vs. cancer non-stem cells

    DEFF Research Database (Denmark)

    Liang, Yuh-Jin; Ding, Yao; Levery, Steven B;

    2013-01-01

    Previous studies demonstrated that certain glycosphingolipids (GSLs) are involved in various cell functions, such as cell growth and motility. Recent studies showed changes in GSL expression during differentiation of human embryonic stem cells; however, little is known about expression profiles...... of GSLs in cancer stem cells (CSCs). CSCs are a small subpopulation in cancer and are proposed as cancer-initiating cells, have been shown to be resistant to numerous chemotherapies, and may cause cancer recurrence. Here, we analyzed GSLs expressed in human breast CSCs by applying a CSC model induced...... significantly reduced the expression of GD2 and GD3 and caused a phenotype change from CSC to a non-CSC, which was detected by reduced mammosphere formation and cell motility. Our results provide insight into GSL profiles in human breast CSCs, indicate a functional role of GD2 and GD3 in CSCs, and suggest...

  2. Regulation of the cell cycle via mitochondrial gene expression and energy metabolism in HeLa cells

    Institute of Scientific and Technical Information of China (English)

    Wei Xiong; Yang Jiao; Weiwei Huang; Mingxing Ma; Min Yu; Qinghua Cui; Deyong Tan

    2012-01-01

    Human cervical cancer HeLa cells have functional mitochondria.Recent studies have suggested that mitochondrial metabolism plays an essential role in tumor cell proliferation.Nevertheless,how cells coordinate mitochondrial dynamics and cell cycle progression remains to be clarified.To investigate the relationship between mitochondrial function and cell cycle regulation,the mitochondrial gene expression profile and cellular ATP levels were determined by cell cycle progress analysis in the present study.HeLa cells were synchronized in the G0/G1 phase by serum starvation,and re-entered cell cycle by restoring serum culture,time course experiment was performed to analyze the expression of mitochondrial transcription regulators and mitochondrial genes,mitochondrial membrane potential (MMP),cellular ATP levels,and cell cycle progression.The results showed that when arrested G0/G1 cells were stimulated in serum-containing medium,the amount of DNA and the expression levels of both mRNA and proteins in mitochondria started to increase at 2 h time point,whereas the MMP and ATP level elevated at 4 h.Furthermore,the cyclin D1 expression began to increase at 4 h after serum triggered cell cycle.ATP synthesis inhibitor-oligomycintreatment suppressed the cyclin D1 and cyclin B1 expression levels and blocked cell cycle progression.Taken together,our results suggested that increased mitochondrial gene expression levels,oxidative phosphorylation activation,and cellular ATP content increase are important events for triggering cell cycle.Finally,we demonstrated that mitochondrial gene expression levels and cellular ATP content are tightly regulated and might play a central role in regulating cell proliferation.

  3. Granulosa cells and retinoic acid co-treatment enrich potential germ cells from manually selected Oct4-EGFP expressing human embryonic stem cells.

    Science.gov (United States)

    Chen, Hsin-Fu; Jan, Pey-Shynan; Kuo, Hung-Chih; Wu, Fang-Chun; Lan, Chen-Wei; Huang, Mei-Chi; Chien, Chung-Liang; Ho, Hong-Nerng

    2014-09-01

    Differentiation of human embryonic stem (HES) cells to germ cells may become clinically useful in overcoming diseases related to germ-cell development. Niches were used to differentiate HES cell lines, NTU1 and H9 Oct4-enhanced green fluorescence protein (EGFP), including laminin, granulosa cell co-culture or conditioned medium, ovarian stromal cell co-culture or conditioned medium, retinoic acid, stem cell factor (SCF) and BMP4-BMP7-BMP8b treatment. Flow cytometry showed that granulosa cell co-culture (P cells expressing early germ cell marker stage-specific embryonic antigen 1(SSEA1); sorted SSEA1[+] cells did not express higher levels of germ cell gene VASA and GDF9. Manually collected H9 Oct4-EGFP[+] cells expressed significantly higher levels of VASA (P = 0.005) and GDF9 (P = 0.001). H9 Oct4-EGFP[+] cells developed to ovarian follicle-like structures after culture for 28 days but with low efficiency. Unlike SCF and BMP4, retinoic acid co-treatment enhanced VASA, GDF9 and SCP3 expression. A protocol is recommended to enrich differentiated HES cells with germ-cell potential by culture with granulosa cells, conditioned medium or retinoic acid, manual selection of Oct4-EGFP[+] cells, and analysis of VASA, GDF9 expression, or both.

  4. Gene expression profiling in multipotent DFAT cells derived from mature adipocytes.

    Science.gov (United States)

    Ono, Hiromasa; Oki, Yoshinao; Bono, Hidemasa; Kano, Koichiro

    2011-04-15

    Cellular dedifferentiation signifies the withdrawal of cells from a specific differentiated state to a stem cell-like undifferentiated state. However, the mechanism of dedifferentiation remains obscure. Here we performed comparative transcriptome analyses during dedifferentiation in mature adipocytes (MAs) to identify the transcriptional signatures of multipotent dedifferentiated fat (DFAT) cells derived from MAs. Using microarray systems, we explored similarly expressed as well as significantly differentially expressed genes in MAs during dedifferentiation. This analysis revealed significant changes in gene expression during this process, including a significant reduction in expression of genes for lipid metabolism concomitantly with a significant increase in expression of genes for cell movement, cell migration, tissue developmental processes, cell growth, cell proliferation, cell morphogenesis, altered cell shape, and cell differentiation. Our observations indicate that the transcriptional signatures of DFAT cells derived from MAs are summarized in terms of a significant decrease in functional phenotype-related genes and a parallel increase in cell proliferation, altered cell morphology, and regulation of the differentiation of related genes. A better understanding of the mechanisms involved in dedifferentiation may enable scientists to control and possibly alter the plasticity of the differentiated state, which may lead to benefits not only in stem cell research but also in regenerative medicine.

  5. In vitro reprogramming of pancreatic alpha cells towards a beta cell phenotype following ectopic HNF4α expression.

    Science.gov (United States)

    Sangan, Caroline B; Jover, Ramiro; Heimberg, Harry; Tosh, David

    2015-01-05

    There is currently a shortage of organ donors available for pancreatic beta cell transplantation into diabetic patients. An alternative source of beta cells is pre-existing pancreatic cells. While we know that beta cells can arise directly from alpha cells during pancreatic regeneration we do not understand the molecular basis for the switch in phenotype. The aim of the present study was to investigate if hepatocyte nuclear factor 4 alpha (HNF4α), a transcription factor essential for a normal beta cell phenotype, could induce the reprogramming of alpha cells towards potential beta cells. We utilised an in vitro model of pancreatic alpha cells, the murine αTC1-9 cell line. We initially characterised the αTC1-9 cell line before and following adenovirus-mediated ectopic expression of HNF4α. We analysed the phenotype at transcript and protein level and assessed its glucose-responsiveness. Ectopic HNF4α expression in the αTC1-9 cell line induced a change in morphology (1.7-fold increase in size), suppressed glucagon expression, induced key beta cell-specific markers (insulin, C-peptide, glucokinase, GLUT2 and Pax4) and pancreatic polypeptide (PP) and enabled the cells to secrete insulin in a glucose-regulated manner. In conclusion, HNF4α reprograms alpha cells to beta-like cells.

  6. Lineage relationship of prostate cancer cell types based on gene expression

    Directory of Open Access Journals (Sweden)

    Ware Carol B

    2011-05-01

    Full Text Available Abstract Background Prostate tumor heterogeneity is a major factor in disease management. Heterogeneity could be due to multiple cancer cell types with distinct gene expression. Of clinical importance is the so-called cancer stem cell type. Cell type-specific transcriptomes are used to examine lineage relationship among cancer cell types and their expression similarity to normal cell types including stem/progenitor cells. Methods Transcriptomes were determined by Affymetrix DNA array analysis for the following cell types. Putative prostate progenitor cell populations were characterized and isolated by expression of the membrane transporter ABCG2. Stem cells were represented by embryonic stem and embryonal carcinoma cells. The cancer cell types were Gleason pattern 3 (glandular histomorphology and pattern 4 (aglandular sorted from primary tumors, cultured prostate cancer cell lines originally established from metastatic lesions, xenografts LuCaP 35 (adenocarcinoma phenotype and LuCaP 49 (neuroendocrine/small cell carcinoma grown in mice. No detectable gene expression differences were detected among serial passages of the LuCaP xenografts. Results Based on transcriptomes, the different cancer cell types could be clustered into a luminal-like grouping and a non-luminal-like (also not basal-like grouping. The non-luminal-like types showed expression more similar to that of stem/progenitor cells than the luminal-like types. However, none showed expression of stem cell genes known to maintain stemness. Conclusions Non-luminal-like types are all representatives of aggressive disease, and this could be attributed to the similarity in overall gene expression to stem and progenitor cell types.

  7. Regulation of ADAM12 cell-surface expression by protein kinase C epsilon

    DEFF Research Database (Denmark)

    Sundberg, Christina; Thodeti, Charles Kumar; Kveiborg, Marie;

    2004-01-01

    as a constitutively active protein. However, little is known about the regulation of ADAM12 cell-surface translocation. Here, we used human RD rhabdomyosarcoma cells, which express ADAM12 at the cell surface, in a temporal pattern. We report that protein kinase C (PKC) epsilon induces ADAM12 translocation to the cell...

  8. An in situ hybridization-based screen for heterogeneously expressed genes in mouse ES cells.

    Science.gov (United States)

    Carter, Mark G; Stagg, Carole A; Falco, Geppino; Yoshikawa, Toshiyuki; Bassey, Uwem C; Aiba, Kazuhiro; Sharova, Lioudmila V; Shaik, Nabeebi; Ko, Minoru S H

    2008-02-01

    We previously reported that Zscan4 showed heterogeneous expression patterns in mouse embryonic stem (ES) cells. To identify genes that show similar expression patterns, we carried out high-throughput in situ hybridization assays on ES cell cultures for 244 genes. Most of the genes are involved in transcriptional regulation, and were selected using microarray-based comparisons of gene expression profiles in ES and embryonal carcinoma (EC) cells versus differentiated cell types. Pou5f1 (Oct4, Oct3/4) and Krt8 (EndoA) were used as controls. Hybridization signals were detected on ES cell colonies for 147 genes (60%). The majority (136 genes) of them showed relatively homogeneous expression in ES cell colonies. However, we found that two genes unequivocally showed Zscan4-like spotted expression pattern (spot-in-colony pattern; Whsc2 and Rhox9). We also found that nine genes showed relatively heterogeneous expression pattern (mosaic-in-colony pattern: Zfp42/Rex1, Rest, Atf4, Pa2g4, E2f2, Nanog, Dppa3/Pgc7/Stella, Esrrb, and Fscn1). Among these genes, Zfp42/Rex1 showed unequivocally heterogeneous expression in individual ES cells prepared by the CytoSpin. These results show the presence of different types or states of cells within ES cell cultures otherwise thought to be undifferentiated and homogeneous, suggesting a previously unappreciated complexity in ES cell cultures.

  9. Restrictions in cell cycle progression of adult vestibular supporting cells in response to ectopic cyclin D1 expression.

    Directory of Open Access Journals (Sweden)

    Heidi Loponen

    Full Text Available Sensory hair cells and supporting cells of the mammalian inner ear are quiescent cells, which do not regenerate. In contrast, non-mammalian supporting cells have the ability to re-enter the cell cycle and produce replacement hair cells. Earlier studies have demonstrated cyclin D1 expression in the developing mouse supporting cells and its downregulation along maturation. In explant cultures of the mouse utricle, we have here focused on the cell cycle control mechanisms and proliferative potential of adult supporting cells. These cells were forced into the cell cycle through adenoviral-mediated cyclin D1 overexpression. Ectopic cyclin D1 triggered robust cell cycle re-entry of supporting cells, accompanied by changes in p27(Kip1 and p21(Cip1 expressions. Main part of cell cycle reactivated supporting cells were DNA damaged and arrested at the G2/M boundary. Only small numbers of mitotic supporting cells and rare cells with signs of two successive replications were found. Ectopic cyclin D1-triggered cell cycle reactivation did not lead to hyperplasia of the sensory epithelium. In addition, a part of ectopic cyclin D1 was sequestered in the cytoplasm, reflecting its ineffective nuclear import. Combined, our data reveal intrinsic barriers that limit proliferative capacity of utricular supporting cells.

  10. Intracellular expression of toll-like receptor 4 in neuroblastoma cells and their unresponsiveness to lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    Mori Isamu

    2006-12-01

    Full Text Available Abstract Background Recently it has been reported that, toll-like receptors (TLRs are expressed on a series of tumor cells, such as colon cancer, breast cancer, prostate cancer, melanoma and lung cancer. Although some cancer cells like melanoma cells are known to respond to lipopolysaccharide (LPS via TLR4, not all cancer cells are positive for TLR4. There is little information on the expression and function of TLR4 in neuroblastoma cells. In this study, we investigated the expression of TLR4 in human neuroblastoma NB-1 cell line. Methods Expression and localization of TLR4 were detected by reverse transcription-polymerase chain reaction (RT-PCR and flow cytometric analysis, respectively. Activation of nuclear factor (NF-κB by LPS was detected by degradation of IκB-α and NF-κB luciferase assay. Activation and expression of mitogen-activated protein (MAP kinase and interferon regulatory factor (IRF-3 was detected by immunoblot analysis. Results Human NB-1 neuroblastoma cells expressed intracellular form of TLR4, but not the cell surface form. Further, NB-1 cells express CD14, MD2 and MyD88, which are required for LPS response. However, LPS did not significantly induce NF-κB activation in NB-1 cells although it slightly degraded IκB-α. NB-1 cells expressed no IRF-3, which plays a pivotal role on the MyD88-independent pathway of LPS signaling. Collectively, NB-1 cells are capable to avoid their response to LPS. Conclusion Although human NB-1 neuroblastoma cells possessed all the molecules required for LPS response, they did not respond to LPS. It might be responsible for intracellular expression of TLR4 or lack of IRF-3.

  11. Differential expression of nanog1 and nanogp8 in colon cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ishiguro, Tatsuya; Sato, Ai; Ohata, Hirokazu; Sakai, Hiroaki [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Nakagama, Hitoshi, E-mail: hnakagam@ncc.go.jp [Division of Cancer Development System, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Okamoto, Koji, E-mail: kojokamo@ncc.go.jo [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan)

    2012-02-10

    Highlights: Black-Right-Pointing-Pointer Nanog is expressed in a majority of colon cancer cell lines examined. Black-Right-Pointing-Pointer Both nanog1 and nanogp8 are expressed in colon cancer cells with varying ratios. Black-Right-Pointing-Pointer Nanog mediates cell proliferation of colon cancer cells. Black-Right-Pointing-Pointer Nanog predominantly localizes in cytoplasm of colon cancer cells. -- Abstract: Nanog, a homeodomain transcription factor, is an essential regulator for promotion of self-renewal of embryonic stem cells and inhibition of their differentiation. It has been demonstrated that nanog1 as well as nanogp8, a retrogene of nanog1, is preferentially expressed in advanced stages of several types of cancer, suggesting their involvement during cancer progression. Here, we investigated the expression of Nanog in well-characterized colon cancer cell lines. Expression of Nanog was detectable in 5 (HCT116, HT29, RKO, SW48, SW620) out of seven cell lines examined. RNA expression analyses of nanog1 and nanogp8 indicated that, while nanog1 was a major form in SW620 as well as in teratoma cells Tera-2, nanogp8 was preferentially expressed in HT29 and HCT116. In accordance with this, shRNA-mediated knockdown of nanog1 caused the reduction of Nanog in SW620 but not in HT29. Inhibition of Nanog in SW620 cells negatively affected cell proliferation and tumor formation in mouse xenograft. Biochemical subcellular fractionation and immunostaining analyses revealed predominant localization of Nanog in cytoplasm in SW620 and HT29, while it was mainly localized in nucleus in Tera-2. Our data indicate that nanog1 and nanogp8 are differentially expressed in colon cancer cells, and suggest that their expression contributes to proliferation of colon cancer cells.

  12. Cancer-testis antigen expression in digestive tract carcinomas: frequent expression in esophageal squamous cell carcinoma and its precursor lesions.

    Science.gov (United States)

    Chen, Yao-Tseng; Panarelli, Nicole C; Piotti, Kathryn C; Yantiss, Rhonda K

    2014-05-01

    Cancer-testis (CT) antigens are attractive tumor antigens for cancer immunotherapy. They comprise a group of proteins normally expressed in germ cells and aberrantly activated in a variety of human cancers. The protein expression of eight cancer-testis antigens [MAGEA, NY-ESO-1, GAGE, MAGEC1 (CT7), MAGEC2 (CT10), CT45, SAGE1, and NXF2] was evaluated by immunohistochemistry in 61 esophageal carcinomas (40 adenocarcinoma and 21 squamous cell carcinoma), 50 gastric carcinomas (34 diffuse and 16 intestinal type), and 141 colorectal carcinomas. The highest frequency of expression was found in esophageal squamous cell carcinomas: Positive staining for MAGEA, CT45, CT7, SAGE1, GAGE, NXF2, NY-ESO-1, and CT10 was observed in 57%, 38%, 33%, 33%, 29%, 29%, 19%, and 14% of squamous cell carcinomas, respectively. Similar staining patterns were observed in squamous dysplasias. Expression frequencies of cancer-testis antigens were seen in 2% to 24% of gastroesophageal adenocarcinomas and were not significantly different between adenocarcinomas of the stomach versus the esophagus, or between diffuse and intestinal types of gastric adenocarcinomas. Colorectal cancers did not express NY-ESO-1, CT7, CT10, or GAGE, and only infrequently expressed SAGE1 (0.7%) MAGEA (1.4%), CT45 (3.5%), and NXF2 (8.5%). We conclude that cancer-testis antigens are frequently expressed in esophageal squamous neoplasms. Although cancer-testis antigens are generally considered to be expressed later in tumor progression, they are found in squamous dysplasias, suggesting a potential diagnostic role for cancer-testis antigens in the evaluation of premalignant squamous lesions.

  13. NCR1 Expression Identifies Canine Natural Killer Cell Subsets with Phenotypic Similarity to Human Natural Killer Cells

    Directory of Open Access Journals (Sweden)

    Jennifer Ann Foltz

    2016-11-01

    Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.

  14. Different Effects of BORIS/CTCFL on Stemness Gene Expression, Sphere Formation and Cell Survival in Epithelial Cancer Stem Cells.

    Directory of Open Access Journals (Sweden)

    Loredana Alberti

    Full Text Available Cancer stem cells are cancer cells characterized by stem cell properties and represent a small population of tumor cells that drives tumor development, progression, metastasis and drug resistance. To date, the molecular mechanisms that generate and regulate cancer stem cells are not well defined. BORIS (Brother of Regulator of Imprinted Sites or CTCFL (CTCF-like is a DNA-binding protein that is expressed in normal tissues only in germ cells and is re-activated in tumors. Recent evidences have highlighted the correlation of BORIS/CTCFL expression with poor overall survival of different cancer patients. We have previously shown an association of BORIS-expressing cells with stemness gene expression in embryonic cancer cells. Here, we studied the role of BORIS in epithelial tumor cells. Using BORIS-molecular beacon that was already validated, we were able to show the presence of BORIS mRNA in cancer stem cell-enriched populations (side population and spheres of cervical, colon and breast tumor cells. BORIS silencing studies showed a decrease of sphere formation capacity in breast and colon tumor cells. Importantly, BORIS-silencing led to down-regulation of hTERT, stem cell (NANOG, OCT4, SOX2 and BMI1 and cancer stem cell markers (ABCG2, CD44 and ALDH1 genes. Conversely, BORIS-induction led to up-regulation of the same genes. These phenotypes were observed in cervical, colon and invasive breast tumor cells. However, a completely different behavior was observed in the non-invasive breast tumor cells (MCF7. Indeed, these cells acquired an epithelial mesenchymal transition phenotype after BORIS silencing. Our results demonstrate that BORIS is associated with cancer stem cell-enriched populations of several epithelial tumor cells and the different phenotypes depend on the origin of tumor cells.

  15. The Lgr5 transgene is expressed specifically in glycinergic amacrine cells in the mouse retina.

    Science.gov (United States)

    Sukhdeo, Kumar; Koch, Catherine E; Miller, Tyler E; Zhou, Hannah; Rivera, Maricruz; Yan, Kenneth; Cepko, Constance L; Lathia, Justin D; Rich, Jeremy N

    2014-02-01

    Retinal amacrine cells are a diverse set of interneurons within the inner nuclear layer. The canonical Wnt pathway is highly active within mature amacrine cells, but its role remains unclear. Leucine-rich repeat containing G-protein receptor 5 (Lgr5) is a newly identified component of the Wnt receptor complex that potentiates beta-catenin signaling. In multiple epithelial organs Lgr5 marks adult tissue stem cells. We investigated the expression of this gene using Lgr5-eGFP-IRES-CreER transgenic reporter mice. In the eye, Lgr5 was exclusively expressed in glycinergic amacrine cells in adult mice. Amacrine cells are post-mitotic and represent the first neuronal and non-stem cell lineage to express Lgr5. We further interrogated the spatiotemporal labeling of individual amacrine cells with controlled fluorophore expression. This "fluorofilling" technique provides a tool to study amacrine morphology and dissect neural networks.

  16. Spontaneously immortalised bovine mammary epithelial cells exhibit a distinct gene expression pattern from the breast cancer cells

    Directory of Open Access Journals (Sweden)

    Li Qianqian

    2010-10-01

    Full Text Available Abstract Background Spontaneous immortalisation of cultured mammary epithelial cells (MECs is an extremely rare event, and the molecular mechanism behind spontaneous immortalisation of MECs is unclear. Here, we report the establishment of a spontaneously immortalised bovine mammary epithelial cell line (BME65Cs and the changes in gene expression associated with BME65Cs cells. Results BME65Cs cells maintain the general characteristics of normal mammary epithelial cells in morphology, karyotype and immunohistochemistry, and are accompanied by the activation of endogenous bTERT (bovine Telomerase Reverse Transcriptase and stabilisation of the telomere. Currently, BME65Cs cells have been passed for more than 220 generations, and these cells exhibit non-malignant transformation. The expression of multiple genes was investigated in BME65Cs cells, senescent BMECs (bovine MECs cells, early passage BMECs cells and MCF-7 cells (a human breast cancer cell line. In comparison with early passage BMECs cells, the expression of senescence-relevant apoptosis-related gene were significantly changed in BME65Cs cells. P16INK4a was downregulated, p53 was low expressed and Bax/Bcl-2 ratio was reversed. Moreover, a slight upregulation of the oncogene c-Myc, along with an undetectable level of breast tumor-related gene Bag-1 and TRPS-1, was observed in BME65Cs cells while these genes are all highly expressed in MCF-7. In addition, DNMT1 is upregulated in BME65Cs. These results suggest that the inhibition of both senescence and mitochondrial apoptosis signalling pathways contribute to the immortality of BME65Cs cells. The expression of p53 and p16INK4a in BME65Cs was altered in the pattern of down-regulation but not "loss", suggesting that this spontaneous immortalization is possibly initiated by other mechanism rather than gene mutation of p53 or p16INK4a. Conclusions Spontaneously immortalised BME65Cs cells maintain many characteristics of normal BMEC cells and

  17. Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Schuller Hildegard M

    2005-08-01

    Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein

  18. Expression of the melanoma cell adhesion molecule in human mesenchymal stromal cells regulates proliferation, differentiation, and maintenance of hematopoietic stem and progenitor cells.

    Science.gov (United States)

    Stopp, Sabine; Bornhäuser, Martin; Ugarte, Fernando; Wobus, Manja; Kuhn, Matthias; Brenner, Sebastian; Thieme, Sebastian

    2013-04-01

    The melanoma cell adhesion molecule defines mesenchymal stromal cells in the human bone marrow that regenerate bone and establish a hematopoietic microenvironment in vivo. The role of the melanoma cell adhesion molecule in primary human mesenchymal stromal cells and the maintenance of hematopoietic stem and progenitor cells during ex vivo culture has not yet been demonstrated. We applied RNA interference or ectopic overexpression of the melanoma cell adhesion molecule in human mesenchymal stromal cells to evaluate the effect of the melanoma cell adhesion molecule on their proliferation and differentiation as well as its influence on co-cultivated hematopoietic stem and progenitor cells. Knockdown and overexpression of the melanoma cell adhesion molecule affected several characteristics of human mesenchymal stromal cells related to osteogenic differentiation, proliferation, and migration. Furthermore, knockdown of the melanoma cell adhesion molecule in human mesenchymal stromal cells stimulated the proliferation of hematopoietic stem and progenitor cells, and strongly reduced the formation of long-term culture-initiating cells. In contrast, melanoma cell adhesion molecule-overexpressing human mesenchymal stromal cells provided a supportive microenvironment for hematopoietic stem and progenitor cells. Expression of the melanoma cell adhesion molecule increased the adhesion of hematopoietic stem and progenitor cells to human mesenchymal stromal cells and their migration beneath the monolayer of human mesenchymal stromal cells. Our results demonstrate that the expression of the melanoma cell adhesion molecule in human mesenchymal stromal cells determines their fate and regulates the maintenance of hematopoietic stem and progenitor cells through direct cell-cell contact.

  19. Silencing BRE expression in human umbilical cord perivascular (HUCPV progenitor cells accelerates osteogenic and chondrogenic differentiation.

    Directory of Open Access Journals (Sweden)

    Elve Chen

    Full Text Available BRE is a multifunctional adapter protein involved in DNA repair, cell survival and stress response. To date, most studies of this protein have been focused in the tumor model. The role of BRE in stem cell biology has never been investigated. Therefore, we have used HUCPV progenitor cells to elucidate the function of BRE. HUCPV cells are multipotent fetal progenitor cells which possess the ability to differentiate into a multitude of mesenchymal cell lineages when chemically induced and can be more easily amplified in culture. In this study, we have established that BRE expression was normally expressed in HUCPV cells but become down-regulated when the cells were induced to differentiate. In addition, silencing BRE expression, using BRE-siRNAs, in HUCPV cells could accelerate induced chondrogenic and osteogenic differentiation. Hence, we postulated that BRE played an important role in maintaining the stemness of HUCPV cells. We used microarray analysis to examine the transcriptome of BRE-silenced cells. BRE-silencing negatively regulated OCT4, FGF5 and FOXO1A. BRE-silencing also altered the expression of epigenetic genes and components of the TGF-β/BMP and FGF signaling pathways which are crucially involved in maintaining stem cell self-renewal. Comparative proteomic profiling also revealed that BRE-silencing resulted in decreased expressions of actin-binding proteins. In sum, we propose that BRE acts like an adaptor protein that promotes stemness and at the same time inhibits the differentiation of HUCPV cells.

  20. Micro-RNA expression in cisplatin resistant germ cell tumor cell lines

    Directory of Open Access Journals (Sweden)

    Meineke Viktor

    2011-05-01

    Full Text Available Abstract Background We compared microRNA expression patterns in three cisplatin resistant sublines derived from paternal cisplatin sensitive germ cell tumor cell lines in order to improve our understanding of the mechanisms of cisplatin resistance. Methods Three cisplatin resistant sublines (NTERA-2-R, NCCIT-R, 2102EP-R showing 2.7-11.3-fold increase in drug resistance after intermittent exposure to increasing doses of cisplatin were compared to their parental counterparts, three well established relatively cisplatin sensitive germ cell tumor cell lines (NTERA-2, NCCIT, 2102EP. Cells were cultured and total RNA was isolated from all 6 cell lines in three independent experiments. RNA was converted into cDNA and quantitative RT-PCR was run using 384 well low density arrays covering almost all (738 known microRNA species of human origin. Results Altogether 72 of 738 (9.8% microRNAs appeared differentially expressed between sensitive and resistant cell line pairs (NTERA-2R/NTERA-2 = 43, NCCIT-R/NCCIT = 53, 2102EP-R/2102EP = 15 of which 46.7-95.3% were up-regulated (NTERA-2R/NTERA-2 = 95.3%, NCCIT-R/NCCIT = 62.3%, 2102EP-R/2102EP = 46.7%. The number of genes showing differential expression in more than one of the cell line pairs was 34 between NTERA-2R/NTERA-2 (79% and NCCIT-R/NCCIT (64%, and 3 and 4, respectively, between these two cell lines and 2102EP-R/2102EP (about 27%. Only the has-miR-10b involved in breast cancer invasion and metastasis and has-miR-512-3p appeared to be up-regulated (2-3-fold in all three cell lines. The hsa-miR-371-373 cluster (counteracting cellular senescence and linked with differentiation potency, as well as hsa-miR-520c/-520h (inhibiting the tumor suppressor p21 were 3.9-16.3 fold up-regulated in two of the three cisplatin resistant cell lines. Several new micro-RNA species missing an annotation towards cisplatin resistance could be identified. These were hsa-miR-512-3p/-515/-517/-518/-525 (up to 8.1-fold up

  1. Expression of p63 in anaplastic large cell lymphoma but not in classical Hodgkin's lymphoma.

    Science.gov (United States)

    Gualco, Gabriela; Weiss, Lawrence M; Bacchi, Carlos E

    2008-10-01

    Immunohistochemical determination of p63 protein is frequently used in the pathologic diagnosis of nonhematological solid tumors. In malignant hematological disease, p63 expression has been reported in 22% of follicular lymphoma, about 35% of diffuse large B-cell lymphoma, 23% of chronic lymphocytic leukemia, and in some cases of blast crisis of chronic myelogenous leukemia. Anaplastic large cell lymphoma is a rare disease that accounts for less than 5% of all cases of non-Hodgkin's lymphoma. There is little information concerning p63 expression in this specific type of lymphoma. In some cases, the morphological and phenotypic features between anaplastic large cell lymphoma and classical Hodgkin's lymphoma are similar, making this differential diagnosis challenging. We studied p63 expression using a tissue microarray approach in 154 cases of anaplastic large cell lymphoma, including 38% anaplastic large cell kinase positive and 62% anaplastic large cell kinase negative, and 58 Hodgkin's lymphoma cases. Sixty-eight cases of anaplastic large cell lymphoma (44%) showed p63 nuclear positivity (41% of anaplastic large cell kinase positive and 47% of anaplastic large cell kinase negative). Of 130 cases of systemic-anaplastic large cell lymphoma, 42% showed p63 positivity. The neoplastic cells expressed p63 in 38% of the cases of CD45-negative/anaplastic large cell kinase-negative null cell-type anaplastic large cell lymphoma, a subgroup that offers the most difficulties in the differential diagnosis with classical Hodgkin's lymphoma. In contrast, none of the cases of classical Hodgkin's lymphoma demonstrated any p63 expression. These results demonstrate that p63 protein expression is frequently expressed in a subset of anaplastic large cell lymphoma cases and may be used as a potential tool in the differential diagnosis between anaplastic large cell lymphoma and classical Hodgkin's lymphoma.

  2. Expression of phenotypic markers of mast cells, macrophages and dendritic cells in gallbladder mucosa with calculous cholecystitis.

    Science.gov (United States)

    Kasprzak, A A; Szmyt, M; Malkowski, W; Surdyk-Zasada, J; Przybyszewska, W; Szmeja, J; Helak-Łapaj, C; Seraszek-Jaros, A; Kaczmarek, E

    2013-12-01

    The study aimed at quantitative analysis of expression involving markers of mast cells (tryptase), monocytes/macrophages (CD68 molecule) and dendritic cells (S100 protein) in gallbladder mucosa with acute and chronic calculous cholecystitis. Routinely prepared tissue material from the patients with acute (ACC) (n = 16) and chronic calculous cholecystitis (CCC) (n = 55) was evaluated. Three cellular markers were localized by immunocytochemistry. Their expression was quantified using spatial visualization technique. The expression of tryptase was similar in acute and chronic cholecystitis. CD68 expression in ACC was significantly higher than in the CCC group. Expression of S100 protein was significantly higher in CCC as compared to the ACC group. No significant correlations were disclosed between expression of studied markers and grading in the gallbladder wall. A weak negative correlation was noted between expression of CD68 and number of gallstones in the CCC group. The spatial visualization technique allowed for a credible quantitative evaluation of expression involving markers of mast cells (MCs), monocytes/macrophages (Mo/Ma) and dendritic cells (DCs) in gallbladder mucosa with ACC and CCC. For the first time mucosal expression of S100 protein-positive DCs was evaluated in calculous cholecystitis. The results point to distinct functions of studied cell types in the non-specific immune response in calculous cholecystitis.

  3. PRIMING EFFECT OF HOMOCYSTEINE ON INDUCIBLE VASCULAR CELL ADHESION MOLECULE-1 EXPRESSION IN ENDOTHELIAL CELLS

    Science.gov (United States)

    Séguin, Chantal; Abid, Md. Ruhul; Spokes, Katherine C.; Schoots, Ivo G; Brkovic, Alexandre; Sirois, Martin G.; Aird, William C.

    2017-01-01

    Hyperhomocysteinemia is an independent risk factor for the development of atherosclerosis, as well as for arterial and venous thrombosis. However, the mechanisms through which elevated circulating levels of homocysteine cause vascular injury and promote thrombosis remain unclear. Here, we tested the hypothesis that homocysteine (Hcy) sensitizes endothelial cells to the effect of inflammatory mediators. Human umbilical vein endothelial cells (HUVEC) were incubated with Hcy 1.0 mM for varying time points, and then treated in the absence or presence of 1.5 U/ml thrombin or 10 ng/ml lipopolysaccharide (LPS). Hcy alone had no effect on the expression of vascular cell adhesion molecule (VCAM)-1. However, Hcy enhanced thrombin- and LPS-mediated induction of VCAM-1 mRNA and protein levels. Consistent with these results, pretreatment of HUVEC with Hcy resulted in a two-fold increase in LSP-mediated induction of leukocyte adhesion. The latter effect was significantly inhibited by anti-VCAM-1 antibodies. Together, these findings suggest that Hcy sensitizes HUVEC to the effect of inflammatory mediators thrombin and LPS, at least in part through VCAM-1 expression and function. PMID:18406566

  4. Expression and purification of recombinant vesicular glutamate transporter VGLUT1 using PC12 cells and High Five insect cells

    Directory of Open Access Journals (Sweden)

    Andersen Søren S.L.

    2004-01-01

    Full Text Available In synaptic vesicles, the estimated concentration of the excitatory amino acid glutamate is 100-150 mM. It was recently discovered that VGLUT1, previously characterized as an inorganic phosphate transporter (BNPI with 9-11 predicted transmembrane spanning domains, is capable of transporting glutamate. The expression and His-tag based purification of recombinant VGLUT1 from PC12 cells and High Five insect cells is described. Significantly better virus and protein expression was obtained using High Five rather than Sf9 insect cells. PC12 cell expressed VGLUT1 is functional but not the Baculovirus expressed protein. The lack of functionality of the Baculovirus expressed VGLUT1 is discussed. The data indicate that VGLUT1 readily oligomerizes/dimerizes. The data are discussed in the context of developing this system further in order to reconstitute vesicular glutamate uptake in vitro using lipid-detergent vesicles.

  5. Requirement for Tumor Necrosis Factor Receptor 2 Expression on Vascular Cells To Induce Experimental Cerebral Malaria

    OpenAIRE

    Stoelcker, Benjamin; Hehlgans, Thomas; Weigl, Karin; Bluethmann, Horst; Grau, Georges E.; Männel, Daniela N

    2002-01-01

    Using tumor necrosis factor receptor type 2 (TNFR2)-deficient mice and generating bone marrow chimeras which express TNFR2 on either hematopoietic or nonhematopoietic cells, we demonstrated the requirement for TNFR2 expression on tissue cells to induce lethal cerebral malaria. Thus, TNFR2 on the brain vasculature mediates tumor necrosis factor-induced neurovascular lesions in experimental cerebral malaria.

  6. RNA interference inhibits expression of vascular endothelial growth factor (VEGF) in human retinal pigment epithelial cells

    Institute of Scientific and Technical Information of China (English)

    CAI Chun-mei; SUN Bao-chen; LIU Xu-yang; WANG Jin-jin; LI Jun-fa; HAN Song; WANG Ning-li; LU Qing-jun

    2005-01-01

    @@ Choroidal neovascularization (CNV), a major cause of vision loss, is the result of the increased vascular endothelial growth factor (VEGF) expression in human retinal pigment epithelial (RPE) cells. It is important to inhibit the expression of VEGF protein in RPE cells.

  7. Autonomous Bacterial Localization and Gene Expression Based on Nearby Cell Receptor Density

    Science.gov (United States)

    2013-01-22

    Upon detection of B1–5 mM AI-2, these cells express T7 polymerase that amplifies the native lsr operon response by overexpressing DsRed (see...2 for initiating gene expression (lsr operon ). (B) Indicated densities of PCI-15B or HEK293 cells were seeded to wells followed by mouse anti-EGFR

  8. Expression of heregulin and ErbB receptors in mesenchymal stem cells

    Institute of Scientific and Technical Information of China (English)

    GUI Chun; WANG Jian-an; HE Ai-na; CHEN Tie-long; LIU Xian-bao; LUO Rong-hua; JIANG Jun

    2008-01-01

    Background Mesenchymal stem cells are a promising cell type for cell transplantation in myocardial infarction.Type Ⅰ neuregulins-1,also known as heregulin,can promote the survival of cardiomyocytes and stimulate angiogenesis.The purpose of this study was to investigate the expression of heregulin and ErbB receptors in mesenchymaI stem cells,then further detect the secretion of heregulin and the changes in expression of heregulin and ErbB receptors under conditions of serum deprivation and hypoxia.Methods Mesenchymal stem cells lsolated frOm bone marrow of 180 g male Sprague-Dawley rats were cultured.Passage 3 cells were detected experimentally by regular reverse transcriptase-polymerase chain reaction(RT-PCR),quantitative real time PCR and Western blotting.Results Heregulin and ErbB receptors were expressed in mesenchymal stem cells,and all three ErbB receptors mRNA expressions were significantly down-regulated by serum deprivation and hypoxia,but serum deprivation and hypoxia significantly increased the protein expression of heregulin.Serum deprivation and hypoxia more than 12 hours could induce the secretion of heregulin.Conclusions Mesenchymal stem cells can express all three ErbB receptors and heregulin.Serum deprivation and hypoxia decrease the mRNA expression of ErbB receptors,increase the expression of heregulin,and activate the secretion of heregulin.

  9. Both Freshly Prepared and Frozen-Stored Amniotic Membrane Cells Express the Complement Inhibitor CD59

    Directory of Open Access Journals (Sweden)

    Ágnes Füst

    2012-01-01

    Full Text Available Amniotic membrane proved to be very effective tool in the treatment of a number of ocular surface diseases. The amniotic membrane, however, has to be stored before its transplantation onto the ocular surface followed by mandatory serologic control in order to exclude the transmission of certain viruses. Therefore it is most important to study if cryopreservation of the membrane affects cell surface expression of the molecules. We measured cell surface expression of CD59, a membrane-bound complement inhibitor on the cells of freshly prepared and cryopreserved amniotic membrane. Cells of amniotic membrane were separated mechanically. Epithelial and mesenchymal cells were identified by the intracellular expression of nanog and the cell surface ICAM1 positivity, respectively. Multicolor flow cytometric immunophenotyping was used for determination of the CD59 expression. CellQuest-Pro software program (Becton Dickinson was used both for measurements and analysis. CD59-positive cells could be detected in all investigated samples and in all investigated cell types, although the expression level of CD59 differed. CD59 was expressed both on freshly prepared and frozen-stored samples. Higher level of CD59 was detected on ICAM1+ mesenchymal cells than on nanog+ epithelial cells. Our findings indicate that amniotic membranes maintain their complement inhibiting capacity after cryopreservation.

  10. Importance of inducible multidrug resistance 1 expression in HL-60 cells resistant to gemtuzumab ozogamicin.

    Science.gov (United States)

    Matsumoto, Taichi; Jimi, Shiro; Hara, Shuuji; Takamatsu, Yasushi; Suzumiya, Junji; Tamura, Kazuo

    2012-07-01

    Resistance to gemtuzumab ozogamicin (GO) hampers the effective treatment of refractory acute myeloid leukemia (AML). To clarify the mechanism of resistance to GO, HL-60 cells were persistently exposed to GO in order to establish GO-resistant HL-60 (HL-60/GOR) cells. Multidrug resistance 1 (MDR-1) was strongly expressed in HL-60/GOR cells, but not in HL-60 cells. Although withdrawal of GO after the chronic exposure of HL-60/GOR cells to this compound gradually decreased MDR-1 expression to trace levels, reintroducing GO restored high MDR-1 expression in HL-60/GOR cells, but not in HL-60 cells. These results indicate that HL-60/GOR cells acquired the ability to induce MDR-1 expression in response to GO. U0126, a MEK1/2 inhibitor, prevented GO-inducible MDR-1 expression and abrogated GO resistance in HL-60/GOR cells. These results suggest that in the clinical use of GO, inducible MDR-1 expression in tumor cells should be investigated before treatment with GO. If the cells are positive then MEK1/2 inhibitors may be effective in overcoming resistance to GO.

  11. Ubiquitous expression of MAKORIN-2 in normal and malignant hematopoietic cells and its growth promoting activity.

    Directory of Open Access Journals (Sweden)

    King Yiu Lee

    Full Text Available Makorin-2 (MKRN2 is a highly conserved protein and yet its functions are largely unknown. We investigated the expression levels of MKRN2 and RAF1 in normal and malignant hematopoietic cells, and leukemia cell lines. We also attempted to delineate the role of MKRN2 in umbilical cord blood CD34+ stem/progenitor cells and K562 cell line by over-expression and inhibition of MKRN2 through lentivirus transduction and shRNA nucleofection, respectively. Our results provided the first evidence on the ubiquitous expression of MKRN2 in normal hematopoietic cells, embryonic stem cell lines, primary leukemia and leukemic cell lines of myeloid, lymphoid, erythroid and megakaryocytic lineages. The expression levels of MKRN2 were generally higher in primary leukemia samples compared with those in age-matched normal BM cells. In all leukemia subtypes, there was no significant correlation between expression levels of MKRN2 and RAF1. sh-MKRN2-silenced CD34+ cells had a significantly lower proliferation capacity and decreased levels of the early stem/progenitor subpopulation (CFU-GEMM compared with control cultures. Over-expression of MKRN2 in K562 cells increased cell proliferation. Our results indicated possible roles of MKRN2 in normal and malignant hematopoiesis.

  12. Ectopic expression of telomerase enhances osteopontin and osteocalcin expression during osteogenic differentiation of human mesenchymal stem cells from elder donors

    Directory of Open Access Journals (Sweden)

    Machado CB

    2009-01-01

    Full Text Available Age related bone loss is one of the most prevalent diseases in the elder population. The osteoblasts are the effectors cells of bone formation and regeneration. With the aging the osteoblasts become senescent reducing their ability to produce bone. Cellular replicative senescence is triggered by telomers shortening. Telomerase elongate the telomers length and maintain the cell proliferative capacity. Here, we demonstrated that the expression of human telomerase reverse transcriptase mediated by an adenovirus vector increases the levels of osteopontin and osteocalcin mRNA during the in vitro osteogenic differentiation of elderly human mesenchymal stem cells. Bone marrow human mesenchymal stem cells were obtained from old donors (>65 years and induced to differentiate into osteoblasts for 14 days. The levels of mRNA of human telomerase reverse transcriptase, osteopontin and osteocalcin during the differentiation were assessed by semi-quantitative PCR before and during the differentiation on days 7 and 14. Infected cells showed 1.5 fold increase in telomerase expression. Also telomerized cells exhibit 1.5 fold increase in osteopontin and 0.5 fold increase in osteocalcin expression compared to primary osteoblasts isolated from the same donors. The transformed cells were not able to form tumours in NUDE mice.

  13. Chemokine receptor expression on B cells and effect of interferon-beta in multiple sclerosis

    DEFF Research Database (Denmark)

    Sørensen, Torben Lykke; Roed, Hanne; Sellebjerg, Finn

    2002-01-01

    We investigated the B-cell expression of chemokine receptors CXCR3, CXCR5 and CCR5 in the blood and cerebrospinal fluid (CSF) from patients in relapse of multiple sclerosis (MS) and in neurological controls. Chemokine receptor expression was also studied in interferon-beta-treated patients...... with relapsing-remitting or secondary progressive MS. We observed significantly higher expression of CXCR3 on B cells in the CSF in active MS than in controls. Patients with active MS also had higher B-cell expression of CCR5 in blood. No major differences between RRMS and SPMS patients were detected...

  14. Lineage-specific expression of bestrophin-2 and bestrophin-4 in human intestinal epithelial cells

    DEFF Research Database (Denmark)

    Ito, Go; Okamoto, Ryuichi; Murano, Tatsuro

    2013-01-01

    Intestinal epithelial cells (IECs) regulate the absorption and secretion of anions, such as HCO3(-) or Cl(-). Bestrophin genes represent a newly identified group of calcium-activated Cl(-) channels (CaCCs). Studies have suggested that, among the four human bestrophin-family genes, bestrophin-2...... (BEST2) and bestrophin-4 (BEST4) might be expressed within the intestinal tissue. Consistently, a study showed that BEST2 is expressed by human colonic goblet cells. However, their precise expression pattern along the gastrointestinal tract, or the lineage specificity of the cells expressing these genes...

  15. Butyrate stimulates IL-32α expression in human intestinal epithelial cell lines

    Institute of Scientific and Technical Information of China (English)

    Ayako; Kobori; Shigeki; Bamba; Hirotsugu; Imaeda; Hiromitsu; Ban; Tomoyuki; Tsujikawa; Yasuharu; Saito; Yoshihide; Fujiyama; Akira; Andoh

    2010-01-01

    AIM: To investigate the effects of butyrate on interleukin (IL)-32α expression in epithelial cell lines. METHODS: The human intestinal epithelial cell lines HT-29, SW480, and T84 were used. Intracellular IL- 32α was determined by Western blotting analyses. IL- 32α mRNA expression was analyzed by real-time poly-merase chain reaction. RESULTS: Acetate and propionate had no effects on IL-32α mRNA expression. Butyrate significantly enhanced IL-32α expression in all cell lines. Butyrate also up-regulated IL-1β-i...

  16. T-Cadherin Expression in Melanoma Cells Stimulates Stromal Cell Recruitment and Invasion by Regulating the Expression of Chemokines, Integrins and Adhesion Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Rubina, Kseniya A., E-mail: rkseniya@mail.ru; Surkova, Ekaterina I.; Semina, Ekaterina V.; Sysoeva, Veronika Y.; Kalinina, Natalia I. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation); Poliakov, Alexei A. [Division of Developmental Neurobiology, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA (United Kingdom); Treshalina, Helena M. [Federal State Budgetary Scietific Institution «N.N. Blokhin Russian Cancer Research Center» (FSBSI “N.N.Blokhin RCRC”), Kashirskoe Shosse 24, Moscow 115478 (Russian Federation); Tkachuk, Vsevolod A. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation)

    2015-07-21

    T-cadherin is a glycosyl-phosphatidylinositol (GPI) anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate that T-cadherin overexpression leads to the increase in the expression of anti-angiogenic molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells.

  17. Dual-function vector for protein expression in both mammalian cells and Xenopus laevis oocytes

    DEFF Research Database (Denmark)

    Jespersen, Thomas; Grunnet, M; Angelo, K;

    2002-01-01

    will often engage both oocytes and mammalian cells. Efficient expression of a protein in both systems have thus far only been possible by subcloning the cDNA into two different vectors because several different molecular requirements should be fulfilled to obtain a high protein level in both mammalian cells...... and oocytes. To address this problem, we have constructed a plasmid vector, pXOOM, that can function as a template for expression in both oocytes and mammalian cells. By including all the necessary RNA stability elements for oocyte expression in a standard mammalian expression vector, we have obtained a dual......-function vector capable of supporting protein production in both Xenopus oocytes and CHO-K1 cells at an expression level equivalent to the levels obtained with vectors optimized for either oocyte or mammalian expression. Our functional studies have been performed with hERGI, KCNQ4, and Kv1.3 potassium channels....

  18. Light induces Fos expression via extracellular signal-regulated kinases 1/2 in melanopsin-expressing PC12 cells

    DEFF Research Database (Denmark)

    Moldrup, Marie-Louise Bülow; Georg, Birgitte; Falktoft, Birgitte;

    2010-01-01

    -regulated protein kinase 1/2 (ERK1/2) was found as pharmacological blockage of this kinase suppressed the light-induced Fos expression. Illumination increased the inositol phosphate turnover and induced phosphorylation of ERK1/2 and p38 but not the c-Jun N-terminal kinase. The Galpha(q/11) protein inhibitor YM......254890 attenuated these intracellular light responses. Our data strongly indicate that Galpha(q/11)-mediated ERK1/2 activation is essential for expression of Fos upon illumination of melanopsin-expressing PC12 cells....

  19. Activation of TIM1 induces colon cancer cell apoptosis via modulating Fas ligand expression.

    Science.gov (United States)

    Wang, Hao; Zhang, Xueyan; Sun, Wenjing; Hu, Xiaocui; Li, Xiaolin; Fu, Songbin; Liu, Chen

    2016-04-29

    The pathogenesis of colon cancer is unclear. It is proposed that TIM1 has an association with human cancer. The present study aims to investigate the role of TIM1 activation in the inhibition of human colon cancer cells. In this study, human colon cancer cell line, HT29 and T84 cells were cultured. The expression of TIM1 was assessed by real time RT-PCR and Western blotting. The TIM1 on the cancer cells was activated in the culture by adding recombinant TIM4. The chromatin structure at the FasL promoter locus was assessed by chromatin immunoprecipitation. The apoptosis of the cancer cells was assessed by flow cytometry. The results showed that human colon cancer cell lines, HT29 cells and T84 cells, expressed TIM1. Activation of TIM1 by exposing the cells to TIM4 significantly increased the frequency of apoptotic colon cancer cells. The expression of FasL was increased in the cancer cells after treating by TIM4. Blocking Fas or FasL abolished the exposure to TIM4-induced T84 cell apoptosis. In conclusion, HT29 cells and T84 cells express TIM1; activation TIM1 can induce the cancer cell apoptosis. TIM1 may be a novel therapeutic target of colon cancer.

  20. IL-7 modulates B cells survival and activation by inducing BAFF and CD70 expression in T cells.

    Science.gov (United States)

    Sammicheli, Stefano; Ruffin, Nicolas; Lantto, Rebecka; Vivar, Nancy; Chiodi, Francesca; Rethi, Bence

    2012-06-01

    Interleukin-7 (IL-7) promotes the maintenance and activation of peripheral T cells, whereas it does not act directly on mature B cells due to the lack of IL-7Rα expression on these. We report here that, in spite of the insensitivity of B cells to IL-7, high concentration of IL-7 can lead to increased B cell survival and antibody production in the presence of T cells, without the use of any further B cell stimulatory signal. IL-7 promoted B cell activation through inducing CD70 expression on resting T cells, particularly on CD4+ memory cells. The interaction of CD70 molecules with the B cell costimulatory receptor CD27 led to B cell proliferation, the accumulation of CD38 + CD20- plasmablasts and antibody production. In addition, IL-7 treatment induced BAFF secretion from resting peripheral T cells thereby promoting B cell survival. IL-7 levels can increase in lymphopenic conditions, in autoimmune diseases or in patients receiving T cell regenerative IL-7 therapy. Based on our findings high IL-7 levels can lead to increased B cell activation by inducing the B cell regulatory proteins CD70 and BAFF in resting T cells. Such activity might be beneficial in short term immune-stimulatory IL-7 therapies; permanently increased IL-7 levels, on the other hand, can contribute to impaired B cell tolerance.

  1. Wnt5a attenuates Wnt3a-induced alkaline phosphatase expression in dental follicle cells

    Energy Technology Data Exchange (ETDEWEB)

    Sakisaka, Yukihiko [Department of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Tsuchiya, Masahiro [Department of Oral Diagnosis, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Tohoku Fukushi University, Sendai 989-3201 (Japan); Nakamura, Takashi [Department of Pediatric Dentistry, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Liason Center for Innovative Dentistry, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Tamura, Masato [Department of Biochemistry and Molecular Biology, Hokkaido University Graduate School of Dentistry, Sapporo 060-8586 (Japan); Shimauchi, Hidetoshi [Department of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Nemoto, Eiji, E-mail: e-nemoto@dent.tohoku.ac.jp [Department of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)

    2015-08-01

    Wnt signaling regulates multiple cellular events such as cell proliferation, differentiation, and apoptosis through β-catenin-dependent canonical and β-catenin-independent noncanonical pathways. Canonical Wnt/β-catenin signaling can promote the differentiation of dental follicle cells, putative progenitor cells for cementoblasts, osteoblasts, and periodontal ligament cells, toward a cementoblast/osteoblast phenotype during root formation, but little is known about the biological significance of noncanonical Wnt signaling in this process. We identified the expression of Wnt5a, a representative noncanonical Wnt ligand, in tooth root lining cells (i.e. precementoblasts/cementoblasts) and dental follicle cells during mouse tooth root development, as assessed by immunohistochemistry. Silencing expression of the Wnt5a gene in a dental follicle cell line resulted in enhancement of the Wnt3a (a representative canonical Wnt ligand)-mediated increase in alkaline phosphatase (ALP) expression. Conversely, treatment with recombinant Wnt5a inhibited the increase in ALP expression, suggesting that Wnt5a signaling functions as a negative regulator of canonical Wnt-mediated ALP expression of dental follicle cells. Wnt5a did not affect the nuclear translocation of β-catenin as well as β-catenin-mediated transcriptional activation of T-cell factor (Tcf) triggered by Wnt3a, suggesting that Wnt5a inhibits the downstream part of the β-catenin-Tcf pathway. These findings suggest the existence of a feedback mechanism between canonical and noncanonical Wnt signaling during the differentiation of dental follicle cells. - Highlights: • Dental follicle cells express Wnt5a during tooth root development. • Silencing of Wnt5a enhances Wnt3a-mediated ALP expression of dental follicle cells. • Conversely, treatment with rWnt5a inhibited the increase in ALP expression. • Wnt5a functions as a negative regulator of Wnt3a-mediated ALP expression.

  2. Construction of porcine CCK pDNA and its expression in COS-7 cells.

    Science.gov (United States)

    Bai, Jigang; Lü, Yi; Bai, Qiaoling

    2007-06-01

    CCK correlates with the generation and progression of pancreatic cancer. The research aims to construct eukaryotic expression plasmid pIRES2-EGFP/CCK (CCK pDNA) and transiently express it in COS-7 cells. Total RNA was extracted from porcine intestinal mucosa. RT-PCR was used to amplify the aimed segments CCKcDNA which was then digested with EcoR1 and BamH1 and inserted into a eukaryotic expression plasmid pIRES2-EGFP to construct CCK pDNA. The constructed plasmid was transfected into COS-7 cells by lepofectamin 2000-mediated transfer method. The expression of CCK in transfected COS-7 cells was detected 24, 48 and 72 h post-transfection with fluorescence microscopy and the expression level of CCK mRNA in transfected COS-7 cells was assayed by using RT-PCR. The results showed CCK pDNA was successfully constructed and expressed transiently in COS-7 cells. Green fluorescent protein could be detected in the COS-7 cells transfected with porcine CCK pDNA 24 h post-transfection. At 48th h post-transfection, the number of positive cells was increased significantly and much brighter green fluorescence could be detected. And 72 h post-transfection, the green fluorescence of positive cells became even stronger, while no green fluorescence was detected in the control group. The expression of CCK mRNA in the cells was detectable by using RT-PCR. In COS-7 cells transfected with CCK pDNA a high level of porcine CCK mRNA was detected while no expression of porcine CCKmRNA was found in the cells transfected with null plasmid. It was concluded CCK pDNA was expressed successfully in COS-7 cells, which lays a foundation for further research on the relationship between CCK and tumor.

  3. Construction of Porcine CCK pDNA and Its Expression in COS-7 Cells

    Institute of Scientific and Technical Information of China (English)

    BAI Jigang; L(U) Yi; BAI Qiaoling

    2007-01-01

    CCK correlates with the generation and progression of pancreatic cancer. The research aims to construct eukaryotic expression plasmid pIRES2-EGFP/CCK (CCK pDNA) and transiently express it in COS-7 cells. Total RNA was extracted from porcine intestinal mucosa. RT-PCR was used to amplify the aimed segments CCKcDNA which was then digested with EcoR1 and BamH1 and inserted into a eukaryotic expression plasmid pIRES2-EGFP to construct CCK pDNA. The constructed plasmid was transfected into COS-7 cells by lepofectamine TM2000-mediated transfer method.The expression of CCK in transfected COS-7 cells was detected 24, 48 and 72 h post-transfection with fluorescence microscopy and the expression level of CCK mRNA in transfected COS-7 cells was assayed by using RT-PCR. The results showed CCK pDNA was successfully constructed and expressed transiently in COS-7 cells. Green fluorescent protein could be detected in the COS-7 cells transfected with porcine CCK pDNA 24 h post-transfection. At 48th h post-transfection, the number of positive cells was increased significantly and much brighter green fluorescence could be detected.And 72 h post-transfection, the green fluorescence of positive cells became even stronger, while no green fluorescence was detected in the control group. The expression of CCK mRNA in the cells was detectable by using RT-PCR. In COS-7 cells transfected with CCK pDNA a high level of porcine CCK mRNA was detected while no expression of porcine CCKmRNA was found in the cells transfected with null plasmid. It was concluded CCK pDNA was expressed successfully in COS-7 cells,which lays a foundation for further research on the relationship between CCK and tumor.

  4. PU.1 Expression in T Follicular Helper Cells Limits CD40L-Dependent Germinal Center B Cell Development.

    Science.gov (United States)

    Awe, Olufolakemi; Hufford, Matthew M; Wu, Hao; Pham, Duy; Chang, Hua-Chen; Jabeen, Rukhsana; Dent, Alexander L; Kaplan, Mark H

    2015-10-15

    PU.1 is an ETS family transcription factor that is important for the development of multiple hematopoietic cell lineages. Previous work demonstrated a critical role for PU.1 in promoting Th9 development and in limiting Th2 cytokine production. Whether PU.1 has functions in other Th lineages is not clear. In this study, we examined the effects of ectopic expression of PU.1 in CD4(+) T cells and observed decreased expression of genes involved with the function of T follicular helper (Tfh) cells, including Il21 and Tnfsf5 (encoding CD40L). T cells from conditional mutant mice that lack expression of PU.1 in T cells (Sfpi1(lck-/-)) demonstrated increased production of CD40L and IL-21 in vitro. Following adjuvant-dependent or adjuvant-independent immunization, we observed that Sfpi1(lck-/-) mice had increased numbers of Tfh cells, increased germinal center B cells (GCB cells), and increased Ab production in vivo. This correlated with increased expression of IL-21 and CD40L in Tfh cells from Sfpi1(lck-/-) mice compared with control mice. Finally, although blockade of IL-21 did not affect GCB cells in Sfpi1(lck-/-) mice, anti-CD40L treatment of immunized Sfpi1(lck-/-) mice decreased GCB cell numbers and Ag-specific Ig concentrations. Together, these data indicate an inhibitory role for PU.1 in the function of Tfh cells, germinal centers, and Tfh-dependent humoral immunity.

  5. The ectopic expression of Pax4 in the mouse pancreas converts progenitor cells into alpha and subsequently beta cells

    DEFF Research Database (Denmark)

    Collombat, Patrick; Xu, Xiaobo; Ravassard, Philippe;

    2009-01-01

    We have previously reported that the loss of Arx and/or Pax4 gene activity leads to a shift in the fate of the different endocrine cell subtypes in the mouse pancreas, without affecting the total endocrine cell numbers. Here, we conditionally and ectopically express Pax4 using different cell-spec...

  6. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    Directory of Open Access Journals (Sweden)

    Nakamura Shinichiro

    2011-01-01

    Full Text Available Abstract Background Runt-related transcription factor 3 (RUNX3 is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC. Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91% and tissues (90%. RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis.

  7. Differentially expressed cytosolic proteins in human leukemia and lymphoma cell lines correlate with lineages and functions.

    Science.gov (United States)

    Gez, Swetlana; Crossett, Ben; Christopherson, Richard I

    2007-09-01

    Identification of cytosolic proteins differentially expressed between types of leukemia and lymphoma may provide a molecular basis for classification and understanding their cellular properties. Two-dimensional fluorescence difference gel electrophoresis (DIGE) and mass spectrometry have been used to identify proteins that are differentially expressed in cytosolic extracts from four human leukemia and lymphoma cell lines: HL-60 (acute promyelocytic leukemia), MEC1 (B-cell chronic lymphocytic leukemia), CCRF-CEM (T-cell acute lymphoblastic leukemia) and Raji (B-cell Burkitt's lymphoma). A total of 247 differentially expressed proteins were identified between the four cell lines. Analysis of the data by principal component analysis identified 22 protein spots (17 different protein species) differentially expressed at more than a 95% variance level between these cell lines. Several of these proteins were differentially expressed in only one cell line: HL-60 (myeloperoxidase, phosphoprotein 32 family member A, ras related protein Rab-11B, protein disulfide-isomerase, ran-specific GTPase-activating protein, nucleophosmin and S-100 calcium binding protein A4), and Raji (ezrin). Several of these proteins were differentially expressed in two cell lines: Raji and MEC1 (C-1-tetrahydrofolate synthase, elongation factor 2, alpha- and beta-tubulin, transgelin-2 and stathmin). MEC1 and CCRF-CEM (gamma-enolase), HL-60 and CCRF-CEM (ubiquitin-conjugating enzyme E2 N). The differentially expressed proteins identified in these four cell lines correlate with cellular properties and provide insights into the molecular basis of these malignancies.

  8. CD160-associated CD8 T-cell functional impairment is independent of PD-1 expression.

    Directory of Open Access Journals (Sweden)

    Selena Viganò

    2014-09-01

    Full Text Available Expression of co-inhibitory molecules is generally associated with T-cell dysfunction in chronic viral infections such as HIV or HCV. However, their relative contribution in the T-cell impairment remains unclear. In the present study, we have evaluated the impact of the expression of co-inhibitory molecules such as 2B4, PD-1 and CD160 on the functions of CD8 T-cells specific to influenza, EBV and CMV. We show that CD8 T-cell populations expressing CD160, but not PD-1, had reduced proliferation capacity and perforin expression, thus indicating that the functional impairment in CD160(+ CD8 T cells may be independent of PD-1 expression. The blockade of CD160/CD160-ligand interaction restored CD8 T-cell proliferation capacity, and the extent of restoration directly correlated with the ex vivo proportion of CD160(+ CD8 T cells suggesting that CD160 negatively regulates TCR-mediated signaling. Furthermore, CD160 expression was not up-regulated upon T-cell activation or proliferation as compared to PD-1. Taken together, these results provide evidence that CD160-associated CD8 T-cell functional impairment is independent of PD-1 expression.

  9. Interleukin-2 expression and glioma cell proliferation following Vaceinia vector gene transfection in vivo

    Institute of Scientific and Technical Information of China (English)

    Xiaogang Wang; Xuezhong Wei; Jiangqiu Liu

    2008-01-01

    BACKGROUND: The effectiveness of gene therapy is closely related to the efficiency of vector transfection and expression.OBJECTIVE: This study was designed to transfect a human brain glioma cell line with recombinant Vaccinia virus expressing the interleukin-2 (rVV-IL-2) gene, and to observe IL-2 expression and glioma cell proliferation potential after transfection. DESIGN: Experimental observation. SETTING: Department of Neurosurgery, Shenyang Military Area Command of Chinese PLA. MATERIALS: The rVV-IL-2 vectors were obtained through homologous recombination and screening in the Second Military Medical University of Chinese PLA. The human brain glioma cell line and IL-2-dependent cells were produced by the Second Military Medical University of Chinese PLA. Human IL-2 was produced by Genzyme Corporation. MAIN OUTCOME MEASURES: IL-2 expression at different time points after transfection of human brain glioma cells with varying MOI of Vaccinia viral vectors; in vitro proliferation capacity of human brain glioma cells among the 4 groups. RESULTS: IL-2 expression was detectable 4 hours after Vaccinia viral vector transfection and reached 300 kU/L by 8 hours. There was no significant difference in the proliferating rate of human brain glioma cells among the 4 groups (P > 0.05).CONCLUSION: Vaccinia viral vectors can transfect human brain glioma cells in vitro and express high levels of IL-2. Vaccinia virus and high IL-2 expression do not influence the proliferation rate of human brain glioma cells in vitro.

  10. [Effect of Siwu decoction on function and expression of P-glycoprotein in Caco-2 cells].

    Science.gov (United States)

    Jiang, Yi; Ma, Zeng-chun; Huang, Xian-ju; You, Qing; Tan, Hong-ling; Wang, Yu-guang; Liang, Qian-de; Tang, Xiang-lin; Xiao, Cheng-rong; Gao, Yue

    2015-03-01

    To study the effect of Siwu decoction on the function and expression of P-glycoprotein (P-gp) in Caco-2 cells. The Real-time quantitative poly-merase chain reaction (Q-PCR) was used to analyze the mRNA expression of MDR1 gene in Caco-2 cells. Flow cytometer was used to study the effect of Siwu decoction on the uptake of Rhodamine 123 in Caco-2 cells, in order to evaluate the efflux function of P-gp. Western blotting method was used to detect the effect of Siwu decoction on the P-gp protein expression of Caco-2 cells. Compared with the blank control group, after Caco-2 incubation with Siwu decoction at concentrations of 3.3, 5.0, 10.0 g x L(-1) for 24, 48, 72 h, the mRNA expression of MDR1 was up-regulated, suggesting the effect of Siwu decoction in inducing the expression of MDR1. After the administration with Siwu decoction in Caco-2 cells for 48 h, the uptake of Rhodamine 123 in Caco-2 cells decreased by respectively 16.6%, 22.1% (P P P-gp efflux function of Caco-2 cells. After the incubation of Caco-2 cells with Siwu decoction for 48 h, the P-gp protein expression on Caco-2 cell emebranes, demonstrating the effect of Siwu decoction in inducing the protein expression of P-gp.

  11. Vagaries of fluorochrome reporter gene expression in Foxp3+ regulatory T cells.

    Directory of Open Access Journals (Sweden)

    Sonja Schallenberg

    Full Text Available CD4(+CD25(+ regulatory T (Treg cell lineage commitment and expression of the transcription factor Foxp3 can be induced at the CD4(+CD8(+ double-positive (DP and CD4(+CD8(? single-positive stages of thymic development, as well as in postthymic CD4(+ T cells in peripheral lymphoid tissues. The availability of transgenic mice with Foxp3-dependent fluorochrome reporter gene expression has greatly facilitated studies on the intra- and extrathymic generation of murine Foxp3(+ Treg cells. Here, we performed a comparative analysis of thymic Treg cell development and peripheral compartments of mature Treg cells in various transgenic strains with gene targeted and bacterial artificial chromosome (BAC-driven Foxp3-fluorochrome expression. These studies revealed a relative deficiency of Foxp3(+ DP thymocytes selectively in mice with targeted insertion of the fluorochrome reporter gene coding sequence into the endogenous Foxp3 gene. While Foxp3 BAC-driven fluorochrome expression in ex vivo CD4(+ T cells was found to faithfully reflect Foxp3 protein expression, we provide evidence that Foxp3 BAC transgenesis can result in sizable populations of Foxp3(+ Treg cells that lack fluorochrome reporter expression. This could be attributed to both timely delayed up-regulation of BAC expression in developing Treg cells and the accumulation of peripheral Foxp3(+ Treg cells with continuous transcriptional inactivity of the Foxp3 BAC transgene.

  12. Upregulation of T-Cell-Specific Transcription Factor Expression in Pediatric T-Cell Acute Lymphoblastic Leukemia (T-ALL

    Directory of Open Access Journals (Sweden)

    Müge Sayitoğlu

    2012-12-01

    Full Text Available OBJECTIVE: T-cell acute lymphoblastic leukemia (T-ALL is associated with recurrent chromosomal aberrations and abnormal ectopic gene expression during T-cell development. In order to gain insight into the pathogenesis of T-ALL this study aimed to measure the level of expression of 7 T-cell oncogenes (LMO2, LYL1, TAL1, TLX1, TLX3, BMI1, and CALM-AF10 in pediatric T-ALL patients. METHODS: LMO2, LYL1, TLX1, TLX3, BMI1, TAL1, and CALM-AF10 expression was measured using quantitative real-time PCR in 43 pediatric T-ALL patients. RESULTS: A high level of expression of LMO2, LYL1, TAL1, and BMI1 genes was observed in a large group of T-ALL. Several gene expression signatures indicative of leukemic arrest at specific stages of normal thymocyte development (LYL1 and LMO2 were highly expressed during the cortical and mature stages of T-cell development. Furthermore, upregulated TAL1 and BMI1 expression was observed in all phenotypic subgroups. In all, 6 of the patients had TLX1 and TLX3 proto-oncogene expression, which does not occur in normal cells, and none of the patients had CALM-AF10 fusion gene transcription. Expression of LYL1 alone and LMO2-LYL1 co-expression were associated with mediastinal involvement; however, high-level oncogene expression was not predictive of outcome in the present pediatric T-ALL patient group, but there was a trend towards a poor prognostic impact of TAL1 and/or LMO2 and/or LYL1 protooncogene expression. CONCLUSION: Poor prognostic impact of TAL1 and/or LMO2 and/or LYL1 proto-oncogene expression indicate the need for extensive study on oncogenic rearrangement and immunophenotypic markers in T-ALL, and their relationship to treatment outcome.

  13. Protein hairy enhancer of split-1 expression during differentiation of muscle-derived stem cells into neuron-like cells

    Institute of Scientific and Technical Information of China (English)

    Mina Huang; Zhanpeng Guo; Kun Liu; Xifan Mei; Shiqiang Fang; Jinhao Zeng; Yansong Wang; Yajiang Yuan

    2012-01-01

    Muscle-derived stem cells were isolated from the skeletal muscle of Sprague-Dawley neonatal rats aged 3 days old.Cells at passage 5 were incubated in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum,20 μg/L nerve growth factor,20 μg/L basic fibroblast growth factor and 1% (v/v) penicillin for 6 days.Cells presented with long processes, similar to nerve cells.Connections were formed between cell processes.Immunocytochemical staining with neuron specific enolase verified that cells differentiated into neuron-like cells. Immunofluorescence cytochemistry and western blot results revealed that the expression of protein hairy enhancer of split-1 was significantly reduced.These results indicate that low expression of protein hairy enhancer of split-1 participates in the differentiation of muscle-derived stem cells into neuron-like cells.

  14. Neurotrophin and Trk expression by cells of the human lamina cribrosa following oxygen-glucose deprivation

    Directory of Open Access Journals (Sweden)

    Clark Abbot F

    2004-12-01

    Full Text Available Abstract Background Ischemia within the optic nerve head (ONH may contribute to retinal ganglion cell (RGC loss in primary open angle glaucoma (POAG. Ischemia has been reported to increase neurotrophin and high affinity Trk receptor expression by CNS neurons and glial cells. We have previously demonstrated neurotrophin and Trk expression within the lamina cribrosa (LC region of the ONH. To determine if ischemia alters neurotrophin and Trk protein expression in cells from the human LC, cultured LC cells and ONH astrocytes were exposed to 48 hours of oxygen-glucose deprivation (OGD. Also cells were exposed to 48 hours of OGD followed by 24 hours of recovery in normal growth conditions. Cell number, neurotrophin and Trk receptor protein expression, neurotrophin secretion, and Trk receptor activation were examined. Results Cell number was estimated using an assay for cell metabolism following 24, 48 and 72 hours of OGD. A statistically significant decrease in LC and ONH astrocyte cell number did not occur until 72 hours of OGD, therefore cellular protein and conditioned media were collected at 48 hours OGD. Protein expression of NGF, BDNF and NT-3 by LC cells and ONH astrocytes increased following OGD, as did NGF secretion. Recovery from OGD increased BDNF protein expression in LC cells. In ONH astrocytes, recovery from OGD increased NGF protein expression, and decreased BDNF secretion. Trk A expression and activation in LC cells was increased following OGD while expression and activation of all other Trk receptors was decreased. A similar increase in Trk A expression and activation was observed in ONH astrocytes following recovery from OGD. Conclusions In vitro conditions that mimic ischemia increase the expression and secretion of neurotrophins by cells from the ONH. Increased Trk A expression and activation in LC cells following OGD and in ONH astrocytes following recovery from OGD suggest autocrine/paracrine neurotrophin signaling could be a

  15. Validation of cell-free culture using scanning electron microscopy (SEM) and gene expression studies.

    Science.gov (United States)

    Yang, R; Elankumaran, Y; Hijjawi, N; Ryan, U

    2015-06-01

    A cell-free culture system for Cryptosporidium parvum was analysed using scanning electron microscopy (SEM) to characterise life cycle stages and compare gene expression in cell-free culture and cell culture using HCT-8 cells. Cryptosporidium parvum samples were harvested at 2 h, 8 h, 14 h, 26 h, 50 h, 74 h, 98 h, 122 h and 170 h, chemically fixed and specimens were observed using a Zeiss 1555 scanning electron microscope. The presence of sporozoites, trophozoites and type I merozoites were identified by SEM. Gene expression in cell culture and cell-free culture was studied using reverse transcriptase quantitative PCR (RT-qPCR) of the sporozoite surface antigen protein (cp15), the glycoprotein 900 (gp900), the Cryptosporidium oocyst wall protein (COWP) and 18S ribosomal RNA (rRNA) genes in both cell free and conventional cell culture. In cell culture, cp15 expression peaked at 74 h, gp900 expression peaked at 74 h and 98 h and COWP expression peaked at 50 h. In cell-free culture, CP15 expression peaked at 98 h, gp900 expression peaked at 74 h and COWP expression peaked at 122 h. The present study is the first to compare gene expression of C. parvum in cell culture and cell-free culture and to characterise life cycle stages of C. parvum in cell-free culture using SEM. Findings from this study showed that gene expression patterns in cell culture and cell-free culture were similar but in cell-free culture, gene expression was delayed for CP15 and COWP in cell free culture compared with the cell culture system and was lower. Although three life cycle stageswere conclusively identified, improvements in SEM methodology should lead to the detection of more life cycle stages.

  16. Patterns of expression of keratin 17 in human epithelia: dependency on cell position.

    Science.gov (United States)

    Troyanovsky, S M; Guelstein, V I; Tchipysheva, T A; Krutovskikh, V A; Bannikov, G A

    1989-07-01

    By immunomorphology, using keratin 17-specific monoclonal antibody, it has been shown that this keratin is expressed only in the basal cells of a group of complex epithelia: glandular epithelium with myoepithelial component, transitional and pseudostratified epithelia. Immunolocalization of keratin 17 provides evidence that the expression of this keratin strongly depends on the cell position within epithelial structures. The topographical character of the keratin expression suggests that these proteins may be implicated in the generation of spatial organization of epithelial tissues.

  17. Gut microbiota regulates NKG2D ligand expression on intestinal epithelial cells

    DEFF Research Database (Denmark)

    Hansen, Camilla Hartmann Friis; Holm, Thomas L.; Krych, Lukasz

    2013-01-01

    Intestinal epithelial cells (IECs) are one of a few cell types in the body with constitutive surface expression of natural killer group 2 member D (NKG2D) ligands, although the magnitude of ligand expression by IECs varies. Here, we investigated whether the gut microbiota regulates the NKG2D ligand...... expression is kept in check by an intestinal regulatory immune milieu induced by members of the gut microbiota, for example A. muciniphila....

  18. Expression of GPI-80, a beta2-integrin-associated glycosylphosphatidylinositol-anchored protein, requires neutrophil differentiation with dimethyl sulfoxide in HL-60 cells.

    Science.gov (United States)

    Takeda, Yuji; Fu, Junfen; Suzuki, Kichiya; Sendo, Dai; Nitto, Takeaki; Sendo, Fujiro; Araki, Yoshihiko

    2003-06-10

    GPI-80 is a member of the amidohydrolase family that has been proposed as a potential regulator of beta2-integrin-dependent leukocyte adhesion. GPI-80 is expressed mainly in human neutrophils. Our previous studies suggested that GPI-80 expression might be associated with myeloid differentiation. To verify this, we examined whether GPI-80 is expressed on the human promyelocytic leukemia cell line HL-60 following treatment with differentiation inducers. GPI-80 expression was induced in cells treated with dimethyl sulfoxide (DMSO) to stimulate differentiation down the neutrophil pathway. On the other hand, all-trans-retinoic acid (ATRA), another neutrophil-inducing reagent, induced no clear GPI-80 expression. Potent monocyte-inducing reagents such as 1alpha,25-dihydroxyvitamin D(3) or phorbol 12-myristate 13-acetate also had no significant effect on the protein expression. GPI-80-positive cells were found in the well-differentiated CD11b-positive and transferrin-receptor-negative cell population. Granulocyte colony-stimulating factor, which augments neutrophil differentiation of HL-60 cells, up-regulated GPI-80 expression in the presence of DMSO. Granulocyte/macrophage colony-stimulating factor, which is known to suppress the neutrophil maturation of cells, inhibited expression. Adhesion of DMSO-induced cells was regulated by anti-GPI-80 monoclonal antibody, similar to the regulation observed in neutrophils. These results suggest that use of DMSO to induce neutrophil differentiation provides suitable conditions for GPI-80 expression, and that this culture system may be a helpful model for further study of the regulation of GPI-80 expression during myeloid differentiation.

  19. Notch signalling inhibits CD4 expression during initiation and differentiation of human T cell lineage.

    Directory of Open Access Journals (Sweden)

    Stephen M Carlin

    Full Text Available The Delta/Notch signal transduction pathway is central to T cell differentiation from haemopoietic stem cells (HSCs. Although T cell development is well characterized using expression of cell surface markers, the detailed mechanisms driving differentiation have not been established. This issue becomes central with observations that adult HSCs exhibit poor differentiation towards the T cell lineage relative to neonatal or embryonic precursors. This study investigates the contribution of Notch signalling and stromal support cells to differentiation of adult and Cord Blood (CB human HSCs, using the Notch signalling OP9Delta co-culture system. Co-cultured cells were assayed at weekly intervals during development for phenotype markers using flow cytometry. Cells were also assayed for mRNA expression at critical developmental stages. Expression of the central thymocyte marker CD4 was initiated independently of Notch signalling, while cells grown with Notch signalling had reduced expression of CD4 mRNA and protein. Interruption of Notch signalling in partially differentiated cells increased CD4 mRNA and protein expression, and promoted differentiation to CD4(+ CD8(+ T cells. We identified a set of genes related to T cell development that were initiated by Notch signalling, and also a set of genes subsequently altered by Notch signal interruption. These results demonstrate that while Notch signalling is essential for establishment of the T cell lineage, at later stages of differentiation, its removal late in differentiation promotes more efficient DP cell generation. Notch signalling adds to signals provided by stromal cells to allow HSCs to differentiate to T cells via initiation of transcription factors such as HES1, GATA3 and TCF7. We also identify gene expression profile differences that may account for low generation of T cells from adult HSCs.

  20. Differential expression of thromboxane synthase in prostate carcinoma: role in tumor cell motility.

    Science.gov (United States)

    Nie, Daotai; Che, Mingxin; Zacharek, Alex; Qiao, Yan; Li, Li; Li, Xinglin; Lamberti, Mario; Tang, Keqin; Cai, Yilong; Guo, Yande; Grignon, David; Honn, Kenneth V

    2004-02-01

    Arachidonic acid metabolism through cyclooxygenase, lipoxygenase, or P-450 epoxygenase pathways can generate a variety of eicosanoids. Thromboxane synthase (TxS) metabolizes the cyclooxygenase product, prostanglandin H(2), into thromboxane A(2) (TXA(2)), which can cause vessel constriction, platelet activation, and aggregation. Here we demonstrate that human prostate cancer (PCa) cells express enzymatically active TxS and that this enzyme is involved in cell motility. In human PCa cell lines, PC-3, PC-3M, and ML-2 cells expressed higher levels of TxS than normal prostate epithelial cells or other established PCa cell lines such as DU145, LNCaP, or PPC-1. We cloned and sequenced the full-length TxS cDNA from PC-3 cells and found two changes in the amino acid residues. Immunohistochemical analysis of tumor specimens revealed that expression of TxS is weak or absent in normal differentiated luminal, or secretory cells, significantly elevated in less differentiated or advanced prostate tumors, and markedly increased in tumors with perineural invasion. TxS expressed in PC-3 cells was enzymatically active and susceptible to carboxyheptal imidazole, an inhibitor of TxS. The biosynthesis of TXA(2) in PC-3 cells was dependent on COX-2, and to a lesser extent, COX-1. Treatment of PC-3 cells with a COX-1 selective inhibitor, piroxicam, reduced TXA(2) synthesis by approximately 40%, while the COX-2 specific inhibitor NS398 reduced TXA(2) production by approximately 80%. Inhibition of TxS activity or blockade of TXA(2) function reduced PC-3 cell migration on fibronectin, while having minimal effects on cell cycle progression or survival. Finally, increased expression of TxS in DU145 cells increased cell motility. Our data suggest that human PCa cells express TxS and that this enzyme may contribute to PCa progression through modulating cell motility.

  1. Human CD4+ CD25+ Foxp3+ regulatory T cells do not constitutively express IL-35.

    Science.gov (United States)

    Bardel, Emilie; Larousserie, Frédérique; Charlot-Rabiega, Pascaline; Coulomb-L'Herminé, Aurore; Devergne, Odile

    2008-11-15

    EBV-induced gene 3 (EBI3) can associate with p28 to form the heterodimeric cytokine IL-27, or with the p35 subunit of IL-12 to form the EBI3/p35 heterodimer, recently named IL-35. In mice, IL-35 has been shown to be constitutively expressed by CD4(+)CD25(+)Foxp3(+) regulatory T cells (Treg cells) and suggested to contribute to their suppressive activity. In this study, we investigated whether human Treg cells express IL-35. Double-staining analysis of human thymuses showed that neither Foxp3(+) nor CD25(+) cells coexpressed EBI3. Similarly, Foxp3(+) cells present in human lymph nodes, tonsils, spleens, and intestines did not express EBI3. Consistent with these in situ observations, Treg cells purified from blood or tonsils were negative for EBI3 by immunoblotting. Other human T cell subsets, including effector T cells, naive and memory CD4(+) T cells, CD8(+) and gammadelta T cells also did not constitutively express EBI3, which contrasts with IL-35 expression observed in murine CD8(+) and gammadelta T cells. Furthermore, although CD3/CD28 stimulation consistently induced low levels of EBI3 in various CD4(+) T cell subsets, no EBI3 could be detected in CD3/CD28-stimulated Treg cells. RT-PCR analysis showed that, whereas p35 transcripts were detected in both Teff and Treg cells, EBI3 transcripts were detected only in activated Teff cells, but not in resting or activated Treg cells. Thus, in contrast to their murine counterpart, human Treg cells do not express detectable amounts of IL-35.

  2. Systemic sclerosis patients present alterations in the expression of molecules involved in B cell regulation

    Directory of Open Access Journals (Sweden)

    Lilian eSoto

    2015-09-01

    Full Text Available The activation threshold of B cells is tightly regulated by an array of inhibitory and activator receptors, in such a way that disturbances in their expression can lead to the appearance of autoimmunity. The aim of this study was to evaluate the expression of activating and inhibitory molecules involved in the modulation of B cell functions in transitional, naïve and memory B cell sub-populations from systemic sclerosis patients. To achieve this, blood samples were drawn from thirty one systemic sclerosis patients and fifty three healthy individuals. Surface expression of CD86, MHC II, CD19, CD21, CD40, CD22, Siglec 10, CD35, and FcgammaRIIB was determined by flow cytometry. IL-10 production was evaluated by intracellular flow cytometry from isolated B cells. Soluble IL-6 and IL-10 levels were measured by ELISA from supernatants of stimulated B cells. Systemic sclerosis patients exhibit an increased frequency of transitional and naïve B cells related to memory B cells, compared to healthy controls. Transitional and naïve B cells from patients express higher levels of CD86 and FcgammaRIIB than healthy donors. Also, B cells from patients show high expression of CD19 and CD40, while memory cells from systemic sclerosis patients show reduced expression of CD35. CD19 and CD35 expression levels associate to different autoantibody profiles. IL-10+ B cells and secreted levels of IL-10 were markedly reduced in patients. In conclusion, systemic sclerosis patients show alterations in the expression of molecules involved in B cell regulation. These abnormalities may be determinant in the B cell hyperactivation observed in systemic sclerosis.

  3. Germ cell development in the Honeybee (Apis mellifera; Vasa and Nanos expression

    Directory of Open Access Journals (Sweden)

    Dearden Peter K

    2006-02-01

    Full Text Available Abstract Background Studies of specification of germ-cells in insect embryos has indicated that in many taxa the germ cells form early in development, and their formation is associated with pole plasm, germ plasm or an organelle called the oosome. None of these morphological features associated with germ cell formation have been identified in the Honeybee Apis mellifera. In this study I report the cloning and expression analysis of Honeybee homologues of vasa and nanos, germ cell markers in insects and other animals. Results Apis vasa and nanos RNAs are present in early honeybee embryos, but the RNAs clear rapidly, without any cells expressing these germ cell markers past stage 2. These genes are then only expressed in a line of cells in the abdomen from stage 9 onwards. These cells are the developing germ cells that are moved dorsally by dorsal closure and are placed in the genital ridge. Conclusion This study of the expression of germ cell markers in the honeybee implies that in this species either germ cells are formed by an inductive event, late in embryogenesis, or they are formed early in development in the absence of vasa and nanos expression. This contrasts with germ cell development in other members of the Hymenoptera, Diptera and Lepidoptera.

  4. Regulatory constraints in the generation and differentiation of IgE-expressing B cells.

    Science.gov (United States)

    Yang, Zhiyong; Robinson, Marcus J; Allen, Christopher D C

    2014-06-01

    B cells expressing antibodies of the immunoglobulin E (IgE) isotype are rare, yet are heavily implicated in the pathogenesis of allergies and asthma. This review discusses recent methodological advances that permit sensitive probing of IgE-expressing (IgE(+)) B cells in vivo and have accordingly clarified the basic behavior and fate of IgE(+) B cells during immune responses in mouse models. IgE antibody secreting plasma cells can arise from extrafollicular foci, germinal centers, and memory B cells. However, compared to B cells expressing other isotypes, IgE(+) B cells are susceptible to multiple additional regulatory constraints that restrict the size of the IgE(+) B cell pool at each stage, coordinately limiting the overall magnitude, affinity, and duration of the IgE antibody response.

  5. Expression of midkine and its clinical significance in esophageal squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    Ying-Jia Ren; Qing-Yun Zhang

    2006-01-01

    AIM: To investigate the expression of midkine in esophageal squamous cell carcinoma (ESCC) and analyze its relationship with clinicopathological features.METHODS: RT-PCR and immunocytochemical staining were used to detect the expression of midkine mRNA and protein in EC109 cells, respectively. Then the expression of midkine in 66 cases of ESCC samples were detected by immunohistochemistry using monoclonal antibodies against human midkine. RESULTS: Midkine was expressed in EC109 cell by RTPCR and immunocytochemistry. The immunoreactivity was detected in 56.1% (37/66) of the ESCC samples.The expression of midkine was found in cytoplasm of tumor cells. Notably, the intensity of midkine was stronger at the area abundant in vessels and the invading border of the tumors. Midkine was more intensely expressed in well differentiated tumors (76.9%)than in moderately and poorly differentiated tumors (43.1% and 41.2%, respectively) (P<0.05). There was no statistically significant correlation between midkine expression and gender, age, clinical stage, lymph node metastasis or survival in ESCC.CONCLUSION: Midkine is overexpressed in ESCC. It may play a role in tumor angiogenesis and invasion.The expression of midkine is correlated with tumor cell differentiation in ESCC. The more poorly tumor cells differentiate, the weaker midkine expresses.

  6. E-cadherin expression and its clinical significance in 41 cases of spinal plasma cell myeloma

    Institute of Scientific and Technical Information of China (English)

    Wang Liangzhe; Liu Huimin; He Jin; Li Yuli; Xu Yi; Chen Bing

    2009-01-01

    Objective: To investigate the expression level of E-cadherin in spinal plasma cell myeloma and its relationship with the clinicopathological indexes of spinal plasma cell myeloma. Methods: The expression of E-cadherin was detected in 41 cases of spinal plasma cell myeloma and 14 cases of simple bone cysts by using S-P (streptavidin-perosidase) immunohistochemical staining. The relationship between E-cadherin expression and the clinicopathological features was analyzed. Results: In spinal plasma cell myelomas, the positive expression rate of E-cadherin (46.34 %) was higher than that in simple bone cyst tissues (all negative) (P0.05), but had relationship with the classification of light chain. The expression rate in lambda chain subgroup was lower than that in the others (P<0.05). We also found the E-cadherin negative patients had a higher overall survival rate than those who had strong E-cadherin expression (P<0.05). Conclusion: E-cadherin expressed higher in spinal plasma cell myelomas than in simple bone cyst tissues and its expression had relationship with the light chain classification in spinal plasma cell myeloma. The patients with no stain of E-cadherin may have a poor prognosis. Detecting the type of light chain associated with expression of E-cadherin might be helpful in evaluating the outcome of spinal PCM patients.

  7. [Comparative study of therapy targeted genes expression in neuroblastoma cell lines].

    Science.gov (United States)

    Lebedev, T D; Spirin, P V; Orlova, N N; Prokofjeva, M M; Prassolov, V S

    2015-01-01

    In this study we evaluated c-kit, VEGFA, and MYC gene expression level in seven neuroblastoma stable cell lines: SK-N-SH, SK-N-BE, SK-N-AS, SH-SY5Y, Kelly, IMR-32, and LAN-1. Expression levels of these genes can serve as diagnostic factors of cancer progression, and proteins encoded by these genes are promising targets for neuroblastoma treatment. SH-SY5Y and SK-N-AS cells have highest MYC expression and the same VEGFA expression, although SH-SY5Y has 10 times higher c-kit expression than SK-N-AS cells. Both IMR-32 and LAN-1 cells have low MYC expression level, but differ in c-kit expression, IMR-32 has significantly higher c-kit expression, than any other neuroblastoma cell line. LAN-1 on the other hand has the highest VEGFA expression. These data suggest that MYC, c-kit, and VEGFA genes can play different roles in development and progression of neuroblastoma depending on other activated molecular mechanisms in malignant cells.

  8. Gene expression profiles of hepatic cell-type specific marker genes in progression of liver fibrosis

    Institute of Scientific and Technical Information of China (English)

    Yoshiyuki Takahara; Mitsuo Takahashi; Hiroki Wagatsuma; Fumihiko Yokoya; Qing-Wei Zhang; Mutsuyo Yamaguchi; Hiroyuki Aburatani; Norifumi Kawada

    2006-01-01

    AIM: To determine the gene expression profile data for the whole liver during development of dimethylnitrosamine (DMN)-induced hepatic fibrosis.METHODS: Marker genes were identified for different types of hepatic cells, including hepatic stellate cells (HSCs), Kupffer cells (including other inflammatory cells),and hepatocytes, using independent temporal DNA microarray data obtained from isolated hepatic cells.RESULTS: The cell-type analysis of gene expression gave several key results and led to formation of three hypotheses: (1) changes in the expression of HSCspecific marker genes during fibrosis were similar to gene expression data in in vitro cultured HSCs, suggesting a major role of the self-activating characteristics of HSCs in formation of fibrosis; (2) expression of mast cell-specific marker genes reached a peak during liver fibrosis,suggesting a possible role of mast cells in formation of fibrosis; and (3) abnormal expression of hepatocytespecific marker genes was found across several metabolic pathways during fibrosis, including sulfur-containing amino acid metabolism, fatty acid metabolism, and drug metabolism, suggesting a mechanistic relationship between these abnormalities and symptoms of liver fibrosis.CONCLUSION: Analysis of marker genes for specific hepatic cell types can identify the key aspects of fibrogenesis. Sequential activation of inflammatory cells and the self-supporting properties of HSCs play an important role in development of fibrosis.

  9. Melanoma chemotherapy leads to the selection of ABCB5-expressing cells.

    Directory of Open Access Journals (Sweden)

    Marine Chartrain

    Full Text Available Metastatic melanoma is the most aggressive skin cancer. Recently, phenotypically distinct subpopulations of tumor cells were identified. Among them, ABCB5-expressing cells were proposed to display an enhanced tumorigenicity with stem cell-like properties. In addition, ABCB5(+ cells are thought to participate to chemoresistance through a potential efflux function of ABCB5. Nevertheless, the fate of these cells upon drugs that are used in melanoma chemotherapy remains to be clarified. Here we explored the effect of anti-melanoma treatments on the ABCB5-expressing cells. Using a melanoma xenograft model (WM266-4, we observed in vivo that ABCB5-expressing cells are enriched after a temozolomide treatment that induces a significant tumor regression. These results were further confirmed in a preliminary study conducted on clinical samples from patients that received dacarbazine. In vitro, we showed that ABCB5-expressing cells selectively survive when exposed to dacarbazine, the reference treatment of metastatic melanoma, but also to vemurafenib, a new inhibitor of the mutated kinase V600E BRAF and other various chemotherapeutic drugs. Our results show that anti-melanoma chemotherapy migh