Novel method to load multiple genes onto a mammalian artificial chromosome.

Directory of Open Access Journals (Sweden)

Anna Tóth

Full Text Available Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

Novel method to load multiple genes onto a mammalian artificial chromosome.

Science.gov (United States)

Tóth, Anna; Fodor, Katalin; Praznovszky, Tünde; Tubak, Vilmos; Udvardy, Andor; Hadlaczky, Gyula; Katona, Robert L

2014-01-01

Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs) was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS) cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

The utility of flow sorting to identify chromosomes carrying a single copy transgene in wheat

Czech Academy of Sciences Publication Activity Database

Cápal, Petr; Endo, Takashi R.; Vrána, Jan; Kubaláková, Marie; Karafiátová, Miroslava; Komínková, Eva; Mora-Ramirez, I.; Weschke, W.; Doležel, Jaroslav

2016-01-01

Roč. 12, APR 25 (2016), s. 24 ISSN 1746-4811 R&D Projects: GA MŠk(CZ) LO1204; GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : Transgene localization * Flow cytometric sorting * Single chromosome amplification Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.510, year: 2016

Human Artificial Chromosomes with Alpha Satellite-Based De Novo Centromeres Show Increased Frequency of Nondisjunction and Anaphase Lag

OpenAIRE

Rudd, M. Katharine; Mays, Robert W.; Schwartz, Stuart; Willard, Huntington F.

2003-01-01

Human artificial chromosomes have been used to model requirements for human chromosome segregation and to explore the nature of sequences competent for centromere function. Normal human centromeres require specialized chromatin that consists of alpha satellite DNA complexed with epigenetically modified histones and centromere-specific proteins. While several types of alpha satellite DNA have been used to assemble de novo centromeres in artificial chromosome assays, the extent to which they fu...

A Yeast Artificial Chromosome Library Database: Design Considerations

OpenAIRE

Frisse, Mark E.; Ge, NengJie; Langenbacher, JulieM.; Kahn, Michael G.; Brownstein, Bernard H.

1990-01-01

This paper first describes a simple collection of HyperCard stacks created and used by genetics researchers to catalog information in a human yeast artificial chromosome (YAC) library. Although an intuitive human-computer interface made the HyperCard program easy to use, the program was neither an efficient nor a secure primary database for vital laboratory data. This paper subsequently describes a relational database implementation prototype that overcomes HyperCard's deficiencies as a datab...

Establishment and characterization of CAG/EGFP transgenic rabbit line.

Science.gov (United States)

Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

2007-02-01

Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

Chromosomal localisation of the CD4cre transgene in B6·Cg-Tg(Cd4-cre)1Cwi mice.

Science.gov (United States)

Westendorf, Kerstin; Durek, Pawel; Ayew, Samia; Mashreghi, Mir-Farzin; Radbruch, Andreas

2016-09-01

The B6·Cg-Tg(Cd4-cre)1Cwi line expresses CRE recombinase under the control of the promoter and regulatory elements of the Cd4 gene. Here we show that CRE recombinase expression reduces the number and frequencies of CD4 positive subsets in a dose-dependent manner and localize the integration site of the transgenic construct to position 60335693-60341285 (qD) of chromosome 3. The insert contains at least 15 complete sequential copies of the transgenic construct. Based on this information we describe a novel PCR assay for genetic typing of transgenic mice. Copyright © 2016 Elsevier B.V. All rights reserved.

Cellular, molecular and functional characterisation of YAC transgenic mouse models of Friedreich ataxia.

Directory of Open Access Journals (Sweden)

Sara Anjomani Virmouni

Full Text Available Friedreich ataxia (FRDA is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats, YG8R (90 and 190 GAA repeats and YG22R (190 GAA repeats.We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R.Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy.

Natural - synthetic - artificial!

DEFF Research Database (Denmark)

Nielsen, Peter E

2010-01-01

The terms "natural," "synthetic" and "artificial" are discussed in relation to synthetic and artificial chromosomes and genomes, synthetic and artificial cells and artificial life.......The terms "natural," "synthetic" and "artificial" are discussed in relation to synthetic and artificial chromosomes and genomes, synthetic and artificial cells and artificial life....

Rapid generation of markerless recombinant MVA vaccines by en passant recombineering of a self-excising bacterial artificial chromosome.

Science.gov (United States)

Cottingham, Matthew G; Gilbert, Sarah C

2010-09-01

The non-replicating poxviral vector modified vaccinia virus Ankara (MVA) is currently a leading candidate for development of novel recombinant vaccines against globally important diseases. The 1980s technology for making recombinant MVA (and other poxviruses) is powerful and robust, but relies on rare recombination events in poxviral-infected cells. In the 21st century, it has become possible to apply bacterial artificial chromosome (BAC) technology to poxviruses, as first demonstrated by B. Moss' lab in 2002 for vaccinia virus. A similar BAC clone of MVA was subsequently derived, but while recombination-mediated genetic engineering for rapid production was used of deletion mutants, an alternative method was required for efficient insertion of transgenes. Furthermore "markerless" viruses, which carry no trace of the selectable marker used for their isolation, are increasingly required for clinical trials, and the viruses derived via the new method contained the BAC sequence in their genomic DNA. Two methods are adapted to MVA-BAC to provide more rapid generation of markerless recombinants in weeks rather than months. "En passant" recombineering is applied to the insertion of a transgene expression cassette and the removal of the selectable marker in bacteria; and a self-excising variant of MVA-BAC is constructed, in which the BAC cassette region is rapidly and efficiently lost from the viral genome following rescue of the BAC into infectious virus. These methods greatly facilitate and accelerate production of recombinant MVA, including markerless constructs. Copyright 2010 Elsevier B.V. All rights reserved.

Bacterial Artificial Chromosome Libraries of Pulse Crops: Characteristics and Applications

OpenAIRE

Kangfu Yu

2012-01-01

Pulse crops are considered minor on a global scale despite their nutritional value for human consumption. Therefore, they are relatively less extensively studied in comparison with the major crops. The need to improve pulse crop production and quality will increase with the increasing global demand for food security and people's awareness of nutritious food. The improvement of pulse crops will require fully utilizing all their genetic resources. Bacterial artificial chromosome (BAC) libraries...

HACking the centromere chromatin code: insights from human artificial chromosomes.

Science.gov (United States)

Bergmann, Jan H; Martins, Nuno M C; Larionov, Vladimir; Masumoto, Hiroshi; Earnshaw, William C

2012-07-01

The centromere is a specialized chromosomal region that serves as the assembly site of the kinetochore. At the centromere, CENP-A nucleosomes form part of a chromatin landscape termed centrochromatin. This chromatin environment conveys epigenetic marks regulating kinetochore formation. Recent work sheds light on the intricate relationship between centrochromatin state, the CENP-A assembly pathway and the maintenance of centromere function. Here, we review the emerging picture of how chromatin affects mammalian kinetochore formation. We place particular emphasis on data obtained from Human Artificial Chromosome (HAC) biology and the targeted engineering of centrochromatin using synthetic HACs. We discuss implications of these findings, which indicate that a delicate balance of histone modifications and chromatin state dictates both de novo centromere formation and the maintenance of centromere identity in dividing cell populations.

Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance.

Science.gov (United States)

Niu, Qi-Wen; Lin, Shih-Shun; Reyes, Jose Luis; Chen, Kuan-Chun; Wu, Hui-Wen; Yeh, Shyi-Dong; Chua, Nam-Hai

2006-11-01

Plant microRNAs (miRNAs) regulate the abundance of target mRNAs by guiding their cleavage at the sequence complementary region. We have modified an Arabidopsis thaliana miR159 precursor to express artificial miRNAs (amiRNAs) targeting viral mRNA sequences encoding two gene silencing suppressors, P69 of turnip yellow mosaic virus (TYMV) and HC-Pro of turnip mosaic virus (TuMV). Production of these amiRNAs requires A. thaliana DICER-like protein 1. Transgenic A. thaliana plants expressing amiR-P69(159) and amiR-HC-Pro(159) are specifically resistant to TYMV and TuMV, respectively. Expression of amiR-TuCP(159) targeting TuMV coat protein sequences also confers specific TuMV resistance. However, transgenic plants that express both amiR-P69(159) and amiR-HC-Pro(159) from a dimeric pre-amiR-P69(159)/amiR-HC-Pro(159) transgene are resistant to both viruses. The virus resistance trait is displayed at the cell level and is hereditable. More important, the resistance trait is maintained at 15 degrees C, a temperature that compromises small interfering RNA-mediated gene silencing. The amiRNA-mediated approach should have broad applicability for engineering multiple virus resistance in crop plants.

Developing de novo human artificial chromosomes in embryonic stem cells using HSV-1 amplicon technology.

Science.gov (United States)

Moralli, Daniela; Monaco, Zoia L

2015-02-01

De novo artificial chromosomes expressing genes have been generated in human embryonic stem cells (hESc) and are maintained following differentiation into other cell types. Human artificial chromosomes (HAC) are small, functional, extrachromosomal elements, which behave as normal chromosomes in human cells. De novo HAC are generated following delivery of alpha satellite DNA into target cells. HAC are characterized by high levels of mitotic stability and are used as models to study centromere formation and chromosome organisation. They are successful and effective as gene expression vectors since they remain autonomous and can accommodate larger genes and regulatory regions for long-term expression studies in cells unlike other viral gene delivery vectors currently used. Transferring the essential DNA sequences for HAC formation intact across the cell membrane has been challenging for a number of years. A highly efficient delivery system based on HSV-1 amplicons has been used to target DNA directly to the ES cell nucleus and HAC stably generated in human embryonic stem cells (hESc) at high frequency. HAC were detected using an improved protocol for hESc chromosome harvesting, which consistently produced high-quality metaphase spreads that could routinely detect HAC in hESc. In tumour cells, the input DNA often integrated in the host chromosomes, but in the host ES genome, it remained intact. The hESc containing the HAC formed embryoid bodies, generated teratoma in mice, and differentiated into neuronal cells where the HAC were maintained. The HAC structure and chromatin composition was similar to the endogenous hESc chromosomes. This review will discuss the technological advances in HAC vector delivery using HSV-1 amplicons and the improvements in the identification of de novo HAC in hESc.

Validation of the use of an artificial mitochondrial reporter DNA vector containing a Cytomegalovirus promoter for mitochondrial transgene expression.

Science.gov (United States)

Yamada, Yuma; Ishikawa, Takuya; Harashima, Hideyoshi

2017-08-01

Mitochondria have their own gene expression system that is independent of the nuclear system, and control cellular functions in cooperation with the nucleus. While a number of useful technologies for achieving nuclear transgene expression have been reported, only a few have focused on mitochondria. In this study, we validated the utility of an artificial mitochondrial DNA vector with a virus promoter on mitochondrial transgene expression. We designed and constructed pCMV-mtLuc (CGG) that contains a CMV promotor derived from Cytomegalovirus and an artificial mitochondrial genome with a NanoLuc (Nluc) luciferase gene that records adjustments to the mitochondrial codon system. Nluc luciferase activity measurements showed that the pCMV-mtLuc (CGG) efficiently produced the Nluc luciferase protein in human HeLa cells. Moreover, we optimized the mitochondrial transfection of pCMV-mtLuc (CGG) using a MITO-Porter system, a liposome-based carrier for mitochondrial delivery via membrane fusion. As a result, we found that transfection of pCMV-mtLuc (CGG) by MITO-Porter modified with the KALA peptide (cationic amphipathic cell-penetrating peptide) showed a high mitochondrial transgene expression. The developed mitochondrial transgene expression system represents a potentially useful tool for the fields of nanoscience and nanotechnology for controlling the intracellular microenvironment via the regulation of mitochondrial function and promises to open additional innovative research fields of study. Copyright © 2017 Elsevier Ltd. All rights reserved.

Restoration of spermatogenesis and male fertility using an androgen receptor transgene.

Directory of Open Access Journals (Sweden)

William H Walker

Full Text Available Androgens signal through the androgen receptor (AR to regulate male secondary sexual characteristics, reproductive tract development, prostate function, sperm production, bone and muscle mass as well as body hair growth among other functions. We developed a transgenic mouse model in which endogenous AR expression was replaced by a functionally modified AR transgene. A bacterial artificial chromosome (BAC was constructed containing all AR exons and introns plus 40 kb each of 5' and 3' regulatory sequence. Insertion of an internal ribosome entry site and the EGFP gene 3' to AR allowed co-expression of AR and EGFP. Pronuclear injection of the BAC resulted in six founder mice that displayed EGFP production in appropriate AR expressing tissues. The six founder mice were mated into a Sertoli cell specific AR knockout (SCARKO background in which spermatogenesis is blocked at the meiosis stage of germ cell development. The AR-EGFP transgene was expressed in a cyclical manner similar to that of endogenous AR in Sertoli cells and fertility was restored as offspring were produced in the absence of Sertoli cell AR. Thus, the AR-EGFP transgene under the control of AR regulatory elements is capable of rescuing AR function in a cell selective, AR-null background. These initial studies provide proof of principle that a strategy employing the AR-EGFP transgene can be used to understand AR functions. Transgenic mice expressing selective modifications of the AR-EGFP transgene may provide crucial information needed to elicit the molecular mechanisms by which AR acts in the testis and other androgen responsive tissues.

Complete Genomes of Classical Swine Fever Virus Cloned into Bacterial Artificial Chromosomes

DEFF Research Database (Denmark)

Rasmussen, Thomas Bruun; Reimann, I.; Uttenthal, Åse

Complete genome amplification of viral RNA provides a new tool for the generation of modified pestiviruses. We have used our full-genome amplification strategy for generation of amplicons representing complete genomes of classical swine fever virus. The amplicons were cloned directly into a stabl...... single-copy bacterial artificial chromosome (BAC) generating full-length pestivirus DNAs from which infectious RNA transcripts could be also derived. Our strategy allows construction of stable infectious BAC DNAs from a single full-length PCR product....

Active role of a human genomic insert in replication of a yeast artificial chromosome.

Science.gov (United States)

van Brabant, A J; Fangman, W L; Brewer, B J

1999-06-01

Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

Bacterial Artificial Chromosome Libraries of Pulse Crops: Characteristics and Applications

Directory of Open Access Journals (Sweden)

Kangfu Yu

2012-01-01

Full Text Available Pulse crops are considered minor on a global scale despite their nutritional value for human consumption. Therefore, they are relatively less extensively studied in comparison with the major crops. The need to improve pulse crop production and quality will increase with the increasing global demand for food security and people's awareness of nutritious food. The improvement of pulse crops will require fully utilizing all their genetic resources. Bacterial artificial chromosome (BAC libraries of pulse crops are essential genomic resources that have the potential to accelerate gene discovery and enhance molecular breeding in these crops. Here, we review the availability, characteristics, applications, and potential applications of the BAC libraries of pulse crops.

Bacterial Artificial Chromosome Libraries of Pulse Crops: Characteristics and Applications

Science.gov (United States)

Yu, Kangfu

2012-01-01

Pulse crops are considered minor on a global scale despite their nutritional value for human consumption. Therefore, they are relatively less extensively studied in comparison with the major crops. The need to improve pulse crop production and quality will increase with the increasing global demand for food security and people's awareness of nutritious food. The improvement of pulse crops will require fully utilizing all their genetic resources. Bacterial artificial chromosome (BAC) libraries of pulse crops are essential genomic resources that have the potential to accelerate gene discovery and enhance molecular breeding in these crops. Here, we review the availability, characteristics, applications, and potential applications of the BAC libraries of pulse crops. PMID:21811383

Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

Science.gov (United States)

Tang, Wei; Newton, Ronald J; Weidner, Douglas A

2007-01-01

An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

DNA immunization with a herpes simplex virus 2 bacterial artificial chromosome

International Nuclear Information System (INIS)

Meseda, Clement A.; Schmeisser, Falko; Pedersen, Robin; Woerner, Amy; Weir, Jerry P.

2004-01-01

Construction of a herpes simplex virus 2 (HSV-2) bacterial artificial chromosome (BAC) is described. BAC vector sequences were inserted into the thymidine kinase gene of HSV-2 by homologous recombination. DNA from cells infected with the resulting recombinant virus was transformed into E. coli, and colonies containing the HSV-2 BAC (HSV2-BAC) were isolated and analyzed for the expected genotype. HSV2-BAC DNA was infectious when transfected back into mammalian cells and the resulting virus was thymidine kinase negative. When used to immunize mice, the HSV2-BAC DNA elicited a strong HSV-2 specific antibody response that was equal to or greater than live virus immunization. Further, HSV2-BAC immunization was protective when animals were challenged with a lethal dose of virus. The utility of the HSV2-BAC for construction of recombinant virus genomes was demonstrated by elimination of the HSV-2 glycoprotein D (gD) gene. A recombinant HSV-2 BAC with the gD gene deleted was isolated and shown to be incapable of producing infectious virus following transfection unless an HSV gD gene was expressed in a complementing cell line. Immunization of mice with the HSV2 gD-BAC also elicited an HSV-2 specific antibody response and was protective. The results demonstrate the feasibility of DNA immunization with HSV-2 bacterial artificial chromosomes for replicating and nonreplicating candidate HSV-2 vaccines, as well as the utility of BAC technology for construction and maintenance of novel HSV-2 vaccines. The results further suggest that such technology will be a powerful tool for dissecting the immune response to HSV-2

Next Generation Sequencing of Classical Swine Fever Virus and Border Disease virus cloned in Bacterial Artificial Chromosomes

DEFF Research Database (Denmark)

Fahnøe, Ulrik; Höper, Dirk; Beer, martin

2012-01-01

artificial chromosomes (BACs). From these BACs, RNA copies of the viral genomes can be transcribed in vitro and upon transfection of these RNAs into mammalian cells, autonomous replication of the viral genome occurs and infectious progeny can be rescued. However, we have observed that virus progeny can...

Dysregulation of gene expression in the artificial human trisomy cells of chromosome 8 associated with transformed cell phenotypes.

Directory of Open Access Journals (Sweden)

Hisakatsu Nawata

Full Text Available A change in chromosome number, known as aneuploidy, is a common characteristic of cancer. Aneuploidy disrupts gene expression in human cancer cells and immortalized human epithelial cells, but not in normal human cells. However, the relationship between aneuploidy and cancer remains unclear. To study the effects of aneuploidy in normal human cells, we generated artificial cells of human primary fibroblast having three chromosome 8 (trisomy 8 cells by using microcell-mediated chromosome transfer technique. In addition to decreased proliferation, the trisomy 8 cells lost contact inhibition and reproliferated after exhibiting senescence-like characteristics that are typical of transformed cells. Furthermore, the trisomy 8 cells exhibited chromosome instability, and the overall gene expression profile based on microarray analyses was significantly different from that of diploid human primary fibroblasts. Our data suggest that aneuploidy, even a single chromosome gain, can be introduced into normal human cells and causes, in some cases, a partial cancer phenotype due to a disruption in overall gene expression.

Sex chromosome-specific regulation in the Drosophila male germline but little evidence for chromosomal dosage compensation or meiotic inactivation.

Directory of Open Access Journals (Sweden)

Colin D Meiklejohn

2011-08-01

Full Text Available The evolution of heteromorphic sex chromosomes (e.g., XY in males or ZW in females has repeatedly elicited the evolution of two kinds of chromosome-specific regulation: dosage compensation--the equalization of X chromosome gene expression in males and females--and meiotic sex chromosome inactivation (MSCI--the transcriptional silencing and heterochromatinization of the X during meiosis in the male (or Z in the female germline. How the X chromosome is regulated in the Drosophila melanogaster male germline is unclear. Here we report three new findings concerning gene expression from the X in Drosophila testes. First, X chromosome-wide dosage compensation appears to be absent from most of the Drosophila male germline. Second, microarray analysis provides no evidence for X chromosome-specific inactivation during meiosis. Third, we confirm the previous discovery that the expression of transgene reporters driven by autosomal spermatogenesis-specific promoters is strongly reduced when inserted on the X chromosome versus the autosomes; but we show that this chromosomal difference in expression is established in premeiotic cells and persists in meiotic cells. The magnitude of the X-autosome difference in transgene expression cannot be explained by the absence of dosage compensation, suggesting that a previously unrecognized mechanism limits expression from the X during spermatogenesis in Drosophila. These findings help to resolve several previously conflicting reports and have implications for patterns of genome evolution and speciation in Drosophila.

An origin-deficient yeast artificial chromosome triggers a cell cycle checkpoint.

Science.gov (United States)

van Brabant, A J; Buchanan, C D; Charboneau, E; Fangman, W L; Brewer, B J

2001-04-01

Checkpoint controls coordinate entry into mitosis with the completion of DNA replication. Depletion of nucleotide precursors by treatment with the drug hydroxyurea triggers such a checkpoint response. However, it is not clear whether the signal for this hydroxyurea-induced checkpoint pathway is the presence of unreplicated DNA, or rather the persistence of single-stranded or damaged DNA. In a yeast artificial chromosome (YAC) we have engineered an approximately 170 kb region lacking efficient replication origins that allows us to explore the specific effects of unreplicated DNA on cell cycle progression. Replication of this YAC extends the length of S phase and causes cells to engage an S/M checkpoint. In the absence of Rad9 the YAC becomes unstable, undergoing deletions within the origin-free region.

Construction of bacterial artificial chromosome libraries for Zhikong Scallop Chlamys farreri

Institute of Scientific and Technical Information of China (English)

ZHANG Yang; ZHANG Xiaojun; Chantel F.SCHEURING; ZHANG Hongbin; LI Fuhua; XIANG Jianhai

2008-01-01

Two Large-insert genomic bacterial artificial chromosome (BAC) libraries of Zhikong scallop Chlamys farreri were constructed to promote our genetic and genomic research.High-quality megabase-sized DNA was isolated from the adductor muscle of the scallop and partially digested by BamH I and Mbo I,respectively.The BamH I library consisted of 53760 clones while the Mbo I library consisted of 7680 clones.Approximately 96% of the clones in BamH I library contained nuclear DNA inserts in average size of 100 kb,providing a coverage of 5.3 haploid genome equivalents.Similarly,the Mbo I library with an average insert of 145 kb and no insert-empty clones,thus providing a genome coverage of 1.1 haploid genome equivalents.

Artificial activation of mature unfertilized eggs in the malaria vector mosquito, Anopheles stephensi (Diptera, Culicidae).

Science.gov (United States)

Yamamoto, Daisuke S; Hatakeyama, Masatsugu; Matsuoka, Hiroyuki

2013-08-01

In the past decade, many transgenic lines of mosquitoes have been generated and analyzed, whereas the maintenance of a large number of transgenic lines requires a great deal of effort and cost. In vitro fertilization by an injection of cryopreserved sperm into eggs has been proven to be effective for the maintenance of strains in mammals. The technique of artificial egg activation is a prerequisite for the establishment of in vitro fertilization by sperm injection. We demonstrated that artificial egg activation is feasible in the malaria vector mosquito, Anopheles stephensi (Diptera, Culicidae). Nearly 100% of eggs dissected from virgin females immersed in distilled water darkened, similar to normally oviposited fertilized eggs. It was revealed by the cytological examination of chromosomes that meiotic arrest was relieved in these eggs approximately 20 min after incubation in water. Biochemical examinations revealed that MAPK (mitogen-activated protein kinase)/ERK (extracellular signal-regulated protein kinase) and MEK (MAPK/ERK kinase) were dephosphorylated similar to that in fertilized eggs. These results indicate that dissected unfertilized eggs were activated in distilled water and started development. Injection of distilled water into body cavity of the virgin blood-fed females also induced activation of a portion of eggs in the ovaries. The technique of artificial egg activation is expected to contribute to the success of in vitro fertilization in A. stephensi.

Overexpression of host plant urease in transgenic silkworms.

Science.gov (United States)

Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

2015-06-01

Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

Role of Human Na,K-ATPase alpha 4 in Sperm Function, Derived from Studies in Transgenic Mice

Science.gov (United States)

McDermott, Jeffrey; Sánchez, Gladis; Nangia, Ajay K.; Blanco, Gustavo

2014-01-01

SUMMARY Most of our knowledge on the biological role of the testis-specific Na,K-ATPase alpha 4 isoform derives from studies performed in non-human species. Here, we studied the function of human Na,K-ATPase alpha 4 after its expression in transgenic mice. Using a bacterial artificial chromosome (BAC) construct, containing the human ATP1A4 gene locus, we obtained expression of the human α4 transgene specifically in mouse sperm, enriched in the sperm flagellum. The expressed, human alpha 4 was active, and compared to wild-type sperm, those from transgenic mice displayed higher Na,K-ATPase alpha 4 activity and greater binding of fluorescently labeled ouabain, which is typical of the alpha 4 isoform. The expression and activity of endogenous alpha 4 and the other Na,K-ATPase alpha isoform present in sperm, alpha 1, remained unchanged. Male mice expressing the human ATP1A4 transgene exhibited similar testis size and morphology, normal sperm number and shape, and no changes in overall fertility compared to wild-type mice. Sperm carrying the human transgene exhibited enhanced total motility and an increase in multiple parameters of sperm movement, including higher sperm hyperactive motility. In contrast, no statistically significant changes in sperm membrane potential, protein tyrosine phosphorylation, or spontaneous acrosome reaction were found between wild-type and transgenic mice. Altogether, these results provide new genetic evidence for an important role of human Na,K-ATPase alpha 4 in sperm motility and hyperactivation, and establishes a new animal model for future studies of this isoform. PMID:25640246

Principles and application of transgenic technology in marine organisms

Science.gov (United States)

Marine organisms into which a foreign gene or noncoding DNA fragment is artificially introduced and stably integrated in their genomes are termed transgenic marine organisms. Since the first report in 1985, a wide range of transgenic fish and marine bivalve mollusks have been produced by microinjec...

Single-copy insertion of transgenes in Caenorhabditis elegans

DEFF Research Database (Denmark)

Frøkjaer-Jensen, Christian; Davis, M Wayne; Hopkins, Christopher E

2008-01-01

developed a method that inserts a single copy of a transgene into a defined site. Mobilization of a Mos1 transposon generates a double-strand break in noncoding DNA. The break is repaired by copying DNA from an extrachromosomal template into the chromosomal site. Homozygous single-copy insertions can...... be obtained in less than 2 weeks by injecting approximately 20 worms. We have successfully inserted transgenes as long as 9 kb and verified that single copies are inserted at the targeted site. Single-copy transgenes are expressed at endogenous levels and can be expressed in the female and male germlines....

Construction of a nurse shark (Ginglymostoma cirratum) bacterial artificial chromosome (BAC) library and a preliminary genome survey

OpenAIRE

Luo, Meizhong; Kim, HyeRan; Kudrna, Dave; Sisneros, Nicholas B; Lee, So-Jeong; Mueller, Christopher; Collura, Kristi; Zuccolo, Andrea; Buckingham, E Bryan; Grim, Suzanne M; Yanagiya, Kazuyo; Inoko, Hidetoshi; Shiina, Takashi; Flajnik, Martin F; Wing, Rod A

2006-01-01

Abstract Background Sharks are members of the taxonomic class Chondrichthyes, the oldest living jawed vertebrates. Genomic studies of this group, in comparison to representative species in other vertebrate taxa, will allow us to theorize about the fundamental genetic, developmental, and functional characteristics in the common ancestor of all jawed vertebrates. Aims In order to obtain mapping and sequencing data for comparative genomics, we constructed a bacterial artificial chromosome (BAC) ...

A transgenic approach to study argininosuccinate synthetase gene expression

Science.gov (United States)

2014-01-01

Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage

Using Bacterial Artificial Chromosomes in Leukemia Research: The Experience at the University Cytogenetics Laboratory in Brest, France

Directory of Open Access Journals (Sweden)

Etienne De Braekeleer

2011-01-01

Full Text Available The development of the bacterial artificial chromosome (BAC system was driven in part by the human genome project in order to construct genomic DNA libraries and physical maps for genomic sequencing. The availability of BAC clones has become a valuable tool for identifying cancer genes. We report here our experience in identifying genes located at breakpoints of chromosomal rearrangements and in defining the size and boundaries of deletions in hematological diseases. The methodology used in our laboratory consists of a three-step approach using conventional cytogenetics followed by FISH with commercial probes, then BAC clones. One limitation to the BAC system is that it can only accommodate inserts of up to 300 kb. As a consequence, analyzing the extent of deletions requires a large amount of material. Array comparative genomic hybridization (array-CGH using a BAC/PAC system can be an alternative. However, this technique has limitations also, and it cannot be used to identify candidate genes at breakpoints of chromosomal rearrangements such as translocations, insertions, and inversions.

Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida.

Directory of Open Access Journals (Sweden)

Yulong Guo

Full Text Available Although artificial microRNA (amiRNA technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1, based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of ami

Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida).

Science.gov (United States)

Guo, Yulong; Han, Yao; Ma, Jing; Wang, Huiping; Sang, Xianchun; Li, Mingyang

2014-01-01

Although artificial microRNA (amiRNA) technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1), based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of amiRNAs in gene

Efficient assembly of de novo human artificial chromosomes from large genomic loci

Directory of Open Access Journals (Sweden)

Stromberg Gregory

2005-07-01

Full Text Available Abstract Background Human Artificial Chromosomes (HACs are potentially useful vectors for gene transfer studies and for functional annotation of the genome because of their suitability for cloning, manipulating and transferring large segments of the genome. However, development of HACs for the transfer of large genomic loci into mammalian cells has been limited by difficulties in manipulating high-molecular weight DNA, as well as by the low overall frequencies of de novo HAC formation. Indeed, to date, only a small number of large (>100 kb genomic loci have been reported to be successfully packaged into de novo HACs. Results We have developed novel methodologies to enable efficient assembly of HAC vectors containing any genomic locus of interest. We report here the creation of a novel, bimolecular system based on bacterial artificial chromosomes (BACs for the construction of HACs incorporating any defined genomic region. We have utilized this vector system to rapidly design, construct and validate multiple de novo HACs containing large (100–200 kb genomic loci including therapeutically significant genes for human growth hormone (HGH, polycystic kidney disease (PKD1 and ß-globin. We report significant differences in the ability of different genomic loci to support de novo HAC formation, suggesting possible effects of cis-acting genomic elements. Finally, as a proof of principle, we have observed sustained ß-globin gene expression from HACs incorporating the entire 200 kb ß-globin genomic locus for over 90 days in the absence of selection. Conclusion Taken together, these results are significant for the development of HAC vector technology, as they enable high-throughput assembly and functional validation of HACs containing any large genomic locus. We have evaluated the impact of different genomic loci on the frequency of HAC formation and identified segments of genomic DNA that appear to facilitate de novo HAC formation. These genomic loci

Induction of genomic instability and activation of autophagy in artificial human aneuploid cells

Energy Technology Data Exchange (ETDEWEB)

Ariyoshi, Kentaro [Hirosaki University, Institute of Radiation Emergency Medicine, 66-1 Hon-cho, Hirosaki 036-8564 (Japan); Miura, Tomisato; Kasai, Kosuke; Fujishima, Yohei [Department of Biomedical Sciences, Hirosaki University Graduate School of Health Sciences, 66-1 Hon-cho, Hirosaki 036-8564 (Japan); Oshimura, Mitsuo [Chromosome Engineering Research Center (CERC), Tottori University, Nishicho 86, Yonago, Tottori 683-8503 (Japan); Yoshida, Mitsuaki A., E-mail: ariyoshi@hirosaki-u.ac.jp [Hirosaki University, Institute of Radiation Emergency Medicine, 66-1 Hon-cho, Hirosaki 036-8564 (Japan)

2016-08-15

Highlights: • Clones with artificial aneuploidy of chromosome 8 or chromosome 22 both show inhibited proliferation and genomic instability. • Increased autophagy was observed in the artificially aneuploid clones. • Inhibition of autophagy resulted in increased genomic instability and DNA damage. • Intracellular levels of reactive oxygen species were up-regulated in the artificially aneuploid clones. - Abstract: Chromosome missegregation can lead to a change in chromosome number known as aneuploidy. Although aneuploidy is a known hallmark of cancer cells, the various mechanisms by which altered gene and/or DNA copy number facilitate tumorigenesis remain unclear. To understand the effect of aneuploidy occurring in non-tumorigenic human breast epithelial cells, we generated clones harboring artificial aneuploidy using microcell-mediated chromosome transfer. Our results demonstrate that clones with artificial aneuploidy of chromosome 8 or chromosome 22 both show inhibited proliferation and genomic instability. Also, the increased autophagy was observed in the artificially aneuploidy clones, and inhibition of autophagy resulted in increased genomic instability and DNA damage. In addition, the intracellular levels of reactive oxygen species were up-regulated in the artificially aneuploid clones, and inhibition of autophagy further increased the production of reactive oxygen species. Together, these results suggest that even a single extraneous chromosome can induce genomic instability, and that autophagy triggered by aneuploidy-induced stress is a mechanism to protect cells bearing abnormal chromosome number.

Induction of genomic instability and activation of autophagy in artificial human aneuploid cells

International Nuclear Information System (INIS)

Ariyoshi, Kentaro; Miura, Tomisato; Kasai, Kosuke; Fujishima, Yohei; Oshimura, Mitsuo; Yoshida, Mitsuaki A.

2016-01-01

Highlights: • Clones with artificial aneuploidy of chromosome 8 or chromosome 22 both show inhibited proliferation and genomic instability. • Increased autophagy was observed in the artificially aneuploid clones. • Inhibition of autophagy resulted in increased genomic instability and DNA damage. • Intracellular levels of reactive oxygen species were up-regulated in the artificially aneuploid clones. - Abstract: Chromosome missegregation can lead to a change in chromosome number known as aneuploidy. Although aneuploidy is a known hallmark of cancer cells, the various mechanisms by which altered gene and/or DNA copy number facilitate tumorigenesis remain unclear. To understand the effect of aneuploidy occurring in non-tumorigenic human breast epithelial cells, we generated clones harboring artificial aneuploidy using microcell-mediated chromosome transfer. Our results demonstrate that clones with artificial aneuploidy of chromosome 8 or chromosome 22 both show inhibited proliferation and genomic instability. Also, the increased autophagy was observed in the artificially aneuploidy clones, and inhibition of autophagy resulted in increased genomic instability and DNA damage. In addition, the intracellular levels of reactive oxygen species were up-regulated in the artificially aneuploid clones, and inhibition of autophagy further increased the production of reactive oxygen species. Together, these results suggest that even a single extraneous chromosome can induce genomic instability, and that autophagy triggered by aneuploidy-induced stress is a mechanism to protect cells bearing abnormal chromosome number.

Bacterial Artificial Chromosome Clones of Viruses Comprising the Towne Cytomegalovirus Vaccine

Directory of Open Access Journals (Sweden)

Xiaohong Cui

2012-01-01

Full Text Available Bacterial artificial chromosome (BAC clones have proven invaluable for genetic manipulation of herpesvirus genomes. BAC cloning can also be useful for capturing representative genomes that comprise a viral stock or mixture. The Towne live attenuated cytomegalovirus vaccine was developed in the 1970s by serial passage in cultured fibroblasts. Although its safety, immunogenicity, and efficacy have been evaluated in nearly a thousand human subjects, the vaccine itself has been little studied. Instead, genetic composition and in vitro growth properties have been inferred from studies of laboratory stocks that may not always accurately represent the viruses that comprise the vaccine. Here we describe the use of BAC cloning to define the genotypic and phenotypic properties of viruses from the Towne vaccine. Given the extensive safety history of the Towne vaccine, these BACs provide a logical starting point for the development of next-generation rationally engineered cytomegalovirus vaccines.

Bacterial artificial chromosome clones of viruses comprising the towne cytomegalovirus vaccine.

Science.gov (United States)

Cui, Xiaohong; Adler, Stuart P; Davison, Andrew J; Smith, Larry; Habib, El-Sayed E; McVoy, Michael A

2012-01-01

Bacterial artificial chromosome (BAC) clones have proven invaluable for genetic manipulation of herpesvirus genomes. BAC cloning can also be useful for capturing representative genomes that comprise a viral stock or mixture. The Towne live attenuated cytomegalovirus vaccine was developed in the 1970s by serial passage in cultured fibroblasts. Although its safety, immunogenicity, and efficacy have been evaluated in nearly a thousand human subjects, the vaccine itself has been little studied. Instead, genetic composition and in vitro growth properties have been inferred from studies of laboratory stocks that may not always accurately represent the viruses that comprise the vaccine. Here we describe the use of BAC cloning to define the genotypic and phenotypic properties of viruses from the Towne vaccine. Given the extensive safety history of the Towne vaccine, these BACs provide a logical starting point for the development of next-generation rationally engineered cytomegalovirus vaccines.

A novel transgenic mouse model of lysosomal storage disorder

OpenAIRE

Ortiz-Miranda, Sonia; Ji, Rui; Jurczyk, Agata; Aryee, Ken-Edwin; Mo, Shunyan; Fletcher, Terry; Shaffer, Scott A.; Greiner, Dale L.; Bortell, Rita; Gregg, Ronald G.; Cheng, Alan; Hennings, Leah J.; Rittenhouse, Ann R.

2016-01-01

We provide an explanation for striking pathology found in a subset of genetically engineered mice homozygous for a rat CaVβ2a transgene (Tg+/+). Multiple transgene (Tg) copies inserted into chromosome 19; at this same site a large deletion occurred, ablating cholesterol 25-hydroxylase and partially deleting lysosomal acid lipase and CD95. Their loss of function can account for lipid build up and immune system hypertrophy, which defines this phenotype and serendipitously provides a novel model...

Cattle mammary bioreactor generated by a novel procedure of transgenic cloning for large-scale production of functional human lactoferrin.

Directory of Open Access Journals (Sweden)

Penghua Yang

Full Text Available Large-scale production of biopharmaceuticals by current bioreactor techniques is limited by low transgenic efficiency and low expression of foreign proteins. In general, a bacterial artificial chromosome (BAC harboring most regulatory elements is capable of overcoming the limitations, but transferring BAC into donor cells is difficult. We describe here the use of cattle mammary bioreactor to produce functional recombinant human lactoferrin (rhLF by a novel procedure of transgenic cloning, which employs microinjection to generate transgenic somatic cells as donor cells. Bovine fibroblast cells were co-microinjected for the first time with a 150-kb BAC carrying the human lactoferrin gene and a marker gene. The resulting transfection efficiency of up to 15.79 x 10(-2 percent was notably higher than that of electroporation and lipofection. Following somatic cell nuclear transfer, we obtained two transgenic cows that secreted rhLF at high levels, 2.5 g/l and 3.4 g/l, respectively. The rhLF had a similar pattern of glycosylation and proteolytic susceptibility as the natural human counterpart. Biochemical analysis revealed that the iron-binding and releasing properties of rhLF were identical to that of native hLF. Importantly, an antibacterial experiment further demonstrated that rhLF was functional. Our results indicate that co-microinjection with a BAC and a marker gene into donor cells for somatic cell cloning indeed improves transgenic efficiency. Moreover, the cattle mammary bioreactors generated with this novel procedure produce functional rhLF on an industrial scale.

Handmade cloned transgenic sheep rich in omega-3 Fatty acids.

Directory of Open Access Journals (Sweden)

Peng Zhang

Full Text Available Technology of somatic cell nuclear transfer (SCNT has been adapted worldwide to generate transgenic animals, although the traditional procedure relies largely on instrumental micromanipulation. In this study, we used the modified handmade cloning (HMC established in cattle and pig to produce transgenic sheep with elevated levels of omega-3 (n-3 fatty acids. Codon-optimized nematode mfat-1 was inserted into a eukaryotic expression vector and was transferred into the genome of primary ovine fibroblast cells from a male Chinese merino sheep. Reverse transcriptase PCR, gas chromatography, and chromosome analyses were performed to select nuclear donor cells capable of converting omega-6 (n-6 into n-3 fatty acids. Blastocysts developed after 7 days of in vitro culture were surgically transplanted into the uterus of female ovine recipients of a local sheep breed in Xinjiang. For the HMC, approximately 8.9% (n  =925 of reconstructed embryos developed to the blastocyst stage. Four recipients became pregnant after 53 blastocysts were transplanted into 29 naturally cycling females, and a total of 3 live transgenic lambs were produced. Detailed analyses on one of the transgenic lambs revealed a single integration of the modified nematode mfat-1 gene at sheep chromosome 5. The transgenic sheep expressed functional n-3 fatty acid desaturase, accompanied by more than 2-folds reduction of n-6/n-3 ratio in the muscle (p<0.01 and other major organs/tissues (p<0.05. To our knowledge, this is the first report of transgenic sheep produced by the HMC. Compared to the traditional SCNT method, HMC showed an equivalent efficiency but proved cheaper and easier in operation.

Reversible immortalisation enables genetic correction of human muscle progenitors and engineering of next-generation human artificial chromosomes for Duchenne muscular dystrophy.

Science.gov (United States)

Benedetti, Sara; Uno, Narumi; Hoshiya, Hidetoshi; Ragazzi, Martina; Ferrari, Giulia; Kazuki, Yasuhiro; Moyle, Louise Anne; Tonlorenzi, Rossana; Lombardo, Angelo; Chaouch, Soraya; Mouly, Vincent; Moore, Marc; Popplewell, Linda; Kazuki, Kanako; Katoh, Motonobu; Naldini, Luigi; Dickson, George; Messina, Graziella; Oshimura, Mitsuo; Cossu, Giulio; Tedesco, Francesco Saverio

2018-02-01

Transferring large or multiple genes into primary human stem/progenitor cells is challenged by restrictions in vector capacity, and this hurdle limits the success of gene therapy. A paradigm is Duchenne muscular dystrophy (DMD), an incurable disorder caused by mutations in the largest human gene: dystrophin. The combination of large-capacity vectors, such as human artificial chromosomes (HACs), with stem/progenitor cells may overcome this limitation. We previously reported amelioration of the dystrophic phenotype in mice transplanted with murine muscle progenitors containing a HAC with the entire dystrophin locus (DYS-HAC). However, translation of this strategy to human muscle progenitors requires extension of their proliferative potential to withstand clonal cell expansion after HAC transfer. Here, we show that reversible cell immortalisation mediated by lentivirally delivered excisable hTERT and Bmi1 transgenes extended cell proliferation, enabling transfer of a novel DYS-HAC into DMD satellite cell-derived myoblasts and perivascular cell-derived mesoangioblasts. Genetically corrected cells maintained a stable karyotype, did not undergo tumorigenic transformation and retained their migration ability. Cells remained myogenic in vitro (spontaneously or upon MyoD induction) and engrafted murine skeletal muscle upon transplantation. Finally, we combined the aforementioned functions into a next-generation HAC capable of delivering reversible immortalisation, complete genetic correction, additional dystrophin expression, inducible differentiation and controllable cell death. This work establishes a novel platform for complex gene transfer into clinically relevant human muscle progenitors for DMD gene therapy. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Development of a quantitative pachytene chromosome map and its unification with somatic chromosome and linkage maps of rice (Oryza sativa L.).

Science.gov (United States)

Ohmido, Nobuko; Iwata, Aiko; Kato, Seiji; Wako, Toshiyuki; Fukui, Kiichi

2018-01-01

A quantitative pachytene chromosome map of rice (Oryza sativa L.) was developed using imaging methods. The map depicts not only distribution patterns of chromomeres specific to pachytene chromosomes, but also the higher order information of chromosomal structures, such as heterochromatin (condensed regions), euchromatin (decondensed regions), the primary constrictions (centromeres), and the secondary constriction (nucleolar organizing regions, NOR). These features were image analyzed and quantitatively mapped onto the map by Chromosome Image Analyzing System ver. 4.0 (CHIAS IV). Correlation between H3K9me2, an epigenetic marker and formation and/or maintenance of heterochromatin, thus was, clearly visualized. Then the pachytene chromosome map was unified with the existing somatic chromosome and linkage maps by physically mapping common DNA markers among them, such as a rice A genome specific tandem repeat sequence (TrsA), 5S and 45S ribosomal RNA genes, five bacterial artificial chromosome (BAC) clones, four P1 bacteriophage artificial chromosome (PAC) clones using multicolor fluorescence in situ hybridization (FISH). Detailed comparison between the locations of the DNA probes on the pachytene chromosomes using multicolor FISH, and the linkage map enabled determination of the chromosome number and short/long arms of individual pachytene chromosomes using the chromosome number and arm assignment designated for the linkage map. As a result, the quantitative pachytene chromosome map was unified with two other major rice chromosome maps representing somatic prometaphase chromosomes and genetic linkages. In conclusion, the unification of the three rice maps serves as an indispensable basic information, not only for an in-depth comparison between genetic and chromosomal data, but also for practical breeding programs.

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

Science.gov (United States)

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing

Directory of Open Access Journals (Sweden)

Doori Park

2015-09-01

Full Text Available Molecular characterization technology in genetically modified organisms, in addition to how transgenic biotechnologies are developed now require full transparency to assess the risk to living modified and non-modified organisms. Next generation sequencing (NGS methodology is suggested as an effective means in genome characterization and detection of transgenic insertion locations. In the present study, we applied NGS to insert transgenic loci, specifically the epidermal growth factor (EGF in genetically modified rice cells. A total of 29.3 Gb (~72× coverage was sequenced with a 2 × 150 bp paired end method by Illumina HiSeq2500, which was consecutively mapped to the rice genome and T-vector sequence. The compatible pairs of reads were successfully mapped to 10 loci on the rice chromosome and vector sequences were validated to the insertion location by polymerase chain reaction (PCR amplification. The EGF transgenic site was confirmed only on chromosome 4 by PCR. Results of this study demonstrated the success of NGS data to characterize the rice genome. Bioinformatics analyses must be developed in association with NGS data to identify highly accurate transgenic sites.

Complex genomic rearrangement in CCS-LacZ transgenic mice.

Science.gov (United States)

Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

2007-02-01

The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

Interphase Chromosome Profiling: A Method for Conventional Banded Chromosome Analysis Using Interphase Nuclei.

Science.gov (United States)

Babu, Ramesh; Van Dyke, Daniel L; Dev, Vaithilingam G; Koduru, Prasad; Rao, Nagesh; Mitter, Navnit S; Liu, Mingya; Fuentes, Ernesto; Fuentes, Sarah; Papa, Stephen

2018-02-01

- Chromosome analysis on bone marrow or peripheral blood samples fails in a small proportion of attempts. A method that is more reliable, with similar or better resolution, would be a welcome addition to the armamentarium of the cytogenetics laboratory. - To develop a method similar to banded metaphase chromosome analysis that relies only on interphase nuclei. - To label multiple targets in an equidistant fashion along the entire length of each chromosome, including landmark subtelomere and centromere regions. Each label so generated by using cloned bacterial artificial chromosome probes is molecularly distinct with unique spectral characteristics, so the number and position of the labels can be tracked to identify chromosome abnormalities. - Interphase chromosome profiling (ICP) demonstrated results similar to conventional chromosome analysis and fluorescence in situ hybridization in 55 previously studied cases and obtained useful ICP chromosome analysis results on another 29 cases in which conventional methods failed. - ICP is a new and powerful method to karyotype peripheral blood and bone marrow aspirate preparations without reliance on metaphase chromosome preparations. It will be of particular value for cases with a failed conventional analysis or when a fast turnaround time is required.

De novo CpG methylation on an artificial chromosome-like vector maintained for a long-term in mammalian cells.

Science.gov (United States)

Nishioka, Keisuke; Kishida, Tsunao; Masui, Shinji; Mazda, Osam

2016-04-01

To examine whether an autonomously replicating, artificial chromosome-like vector containing a long genomic DNA sequence (namely, Epigenosome-Nanog) undergoes de novo CpG methylation after maintenance in cultured cells for more than a half year. Epigenosome-Nanog efficiently replicated in iPS cells after transfection. In HeLa and C2C12 cells Epigenosome-Nanog was stably maintained for more than eight months. The CpG methylation occurred de novo at the Nanog gene promoter region on the epigenosome in C2C12 cells but the degrees of methylation were much lower than those at the same CpG sites on the chromosomes. Among the four CpG sites at the region, the upstream two CpGs underwent methylation in a correlated manner while methylation at the downstream two CpGs was also correlated to each other, and these correlations were commonly shared between the epigenosome and the chromosome. CpG methylation thus was not solely dependent on the nucleotide sequence at the DNA locus. The epigenosome may become a useful tool to study the mechanisms of epigenetic regulation of a genetic region of interest in mammalian cells.

A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype

Science.gov (United States)

Slee, R.; Grimes, B.; Speed, R. M.; Taggart, M.; Maguire, S. M.; Ross, A.; McGill, N. I.; Saunders, P. T. K.; Cooke, H. J.

1999-01-01

In a subset of infertile men, a spectrum of spermatogenic defects ranging from a complete absence of germ cells (sertoli cell only) to oligozoospermia is associated with microdeletions of the DAZ (deleted in azoospermia) gene cluster on human distal Yq. DAZ encodes a testis-specific protein with RNA-binding potential recently derived from a single-copy gene DAZL1 (DAZ-like) on chromosome 3. Y chromosomal DAZ homologues are confined to humans and higher primates. It remains unclear which function unique to higher primate spermatogenesis DAZ may serve, and the functional status of the gene recently has been questioned. To assess the extent of functional conservation we have tested the capacity of a human DAZ gene contained in a 225-kb yeast artificial chromosome to complement the sterile phenotype of the Dazl null mouse (Dazl−/−), which is characterized by severe germ-cell depletion and meiotic failure. Although Dazl−/− mice remained infertile when the DAZ transgene was introduced, histological examination revealed a partial and variable rescue of the mutant phenotype, manifest as a pronounced increase in the germ cell population of the seminiferous tubules and survival to the pachytene stage of meiosis. As well as constituting definitive proof of the spermatogenic role of the DAZ gene product, these findings confirm the high degree of functional conservation between the DAZ and DAZL1 genes, suggesting they may constitute a single target for contraceptive intervention and raising the possibility of therapeutic up-regulation of the DAZL1 gene in infertile men. PMID:10393944

Fluorescent In Situ Hybridization to Detect Transgene Integration into Plant Genomes

Science.gov (United States)

Schwarzacher, Trude

Fluorescent chromosome analysis technologies have advanced our understanding of genome organization during the last 30 years and have enabled the investigation of DNA organization and structure as well as the evolution of chromosomes. Fluorescent chromosome staining allows even small chromosomes to be visualized, characterized by their composition and morphology, and counted. Aneuploidies and polyploidies can be established for species, breeding lines, and individuals, including changes occurring during hybridization or tissue culture and transformation protocols. Fluorescent in situ hybridization correlates molecular information of a DNA sequence with its physical location on chromosomes and genomes. It thus allows determination of the physical position of sequences and often is the only means to determine the abundance and distribution of DNA sequences that are difficult to map with any other molecular method or would require segregation analysis, in particular multicopy or repetitive DNA. Equally, it is often the best way to establish the incorporation of transgenes, their numbers, and physical organization along chromosomes. This chapter presents protocols for probe and chromosome preparation, fluorescent in situ hybridization, chromosome staining, and the analysis of results.

Identification and Preliminary Analysis of Several Centromere-associated Bacterial Artificial Chromosome Clones from a Diploid Wheat Library

Institute of Scientific and Technical Information of China (English)

无

2006-01-01

Although the centromeres of some plants have been investigated previously, our knowledge of the wheat centromere is still very limited. To understand the structure and function of the wheat centromere, we used two centromeric repeats (RCS1 and CCS1-5ab) to obtain some centromere-associated bacterial artificial chromosome (BAC) clones in 32 RCS1-related BAC clones that had been screened out from a diploid wheat (Triticum boeoticum Boiss.; 2n=2x=14) BAC library. Southern hybridization results indicated that, of the 32 candidates,there were 28 RCS1-positive clones. Based on gel blot patterns, the frequency of RCS1 was approximately one copy every 69.4 kb in these 28 RCS1-positive BAC clones. More bands were detected when the same filter was probed with CCS1-5ab. Furthermore, the CCS1 bands covered all the bands detected by RCS1, which suggests that some CCS1 repeats were distributed together with RCS1. The frequency of CCS1 families was once every 35.8 kb, nearly twice that of RCS1. Fluorescence in situ hybridization (FISH) analysis indicated that the five BAC clones containing RCS1 and CCS1 sequences all detected signals at the centromeric regions in hexaploid wheat, but the signal intensities on the A-genome chromosomes were stronger than those on the B- and/or D-genome chromosomes. The FISH analysis among nine Triticeae cereals indicated that there were A-genomespecific (or rich) sequences dispersing on chromosome arms in the BAC clone TbBAC5. In addition, at the interphase cells, the centromeres of diploid species usually clustered at one pole and formed a ring-like allocation in the period before metaphase.

The XX sex chromosome complement in mice is associated with increased spontaneous lupus compared with XY.

Science.gov (United States)

Sasidhar, Manda V; Itoh, Noriko; Gold, Stefan M; Lawson, Gregory W; Voskuhl, Rhonda R

2012-08-01

Many autoimmune diseases are characterised by a female predominance. This may be caused by sex hormones, sex chromosomes or both. This report uses a transgenic mouse model to investigate how sex chromosome complement, not confounded by differences in gonadal type, might contribute to lupus pathogenesis. Transgenic NZM2328 mice were created by deletion of the Sry gene from the Y chromosome, thereby separating genetic from gonadal sex. Survival, renal histopathology and markers of immune activation were compared in mice carrying the XX versus the XY(-) sex chromosome complement, with each genotype being ovary bearing. Mice with XX sex chromosome complement compared with XY(-) exhibited poorer survival rates and increased kidney pathology. Splenic T lymphocytes from XX mice demonstrated upregulated X-linked CD40 ligand expression and higher levels of activation markers ex vivo. Increased MMP, TGF and IL-13 production was found, while IL-2 was lower in XX mice. An accumulation of splenic follicular B cells and peritoneal marginal zone B cells was observed, coupled with upregulated costimulatory marker expression on B cells in XX mice. These data show that the XX sex chromosome complement, compared with XY(-), is associated with accelerated spontaneous lupus.

Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system.

Science.gov (United States)

Pyeon, Hye-Rim; Nah, Hee-Ju; Kang, Seung-Hoon; Choi, Si-Sun; Kim, Eung-Soo

2017-05-31

Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes. To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem

Construction of a llama bacterial artificial chromosome library with approximately 9-fold genome equivalent coverage.

Science.gov (United States)

Airmet, K W; Hinckley, J D; Tree, L T; Moss, M; Blumell, S; Ulicny, K; Gustafson, A K; Weed, M; Theodosis, R; Lehnardt, M; Genho, J; Stevens, M R; Kooyman, D L

2012-01-01

The Ilama is an important agricultural livestock in much of South America. The llama is increasing in popularity in the United States as a companion animal. Little work has been done to improve llama production using modern technology. A paucity of information is available regarding the llama genome. We report the construction of a llama bacterial artificial chromosome (BAC) library of about 196,224 clones in the vector pECBAC1. Using flow cytometry and bovine, human, mouse, and chicken as controls, we determined the llama genome size to be 2.4 × 10⁹ bp. The average insert size of the library is 137.8 kb corresponding to approximately 9-fold genome coverage. Further studies are needed to further characterize the library and llama genome. We anticipate that this new library will help facilitate future genomic studies in the llama.

Efficient generation of recombinant RNA viruses using targeted recombination-mediated mutagenesis of bacterial artificial chromosomes containing full-length cDNA

DEFF Research Database (Denmark)

Rasmussen, Thomas Bruun; Risager, Peter Christian; Fahnøe, Ulrik

2013-01-01

Background Infectious cDNA clones are a prerequisite for directed genetic manipulation of RNA viruses. Here, a strategy to facilitate manipulation and rescue of classical swine fever viruses (CSFVs) from full-length cDNAs present within bacterial artificial chromosomes (BACs) is described....... This strategy allows manipulation of viral cDNA by targeted recombination-mediated mutagenesis within bacteria. Results A new CSFV-BAC (pBeloR26) derived from the Riems vaccine strain has been constructed and subsequently modified in the E2 coding sequence, using the targeted recombination strategy to enable...

Genomic localization of the Z/EG transgene in the mouse genome.

Science.gov (United States)

Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel

2010-02-01

The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.

Naturally occurring minichromosome platforms in chromosome engineering: an overview.

Science.gov (United States)

Raimondi, Elena

2011-01-01

Artificially modified chromosome vectors are non-integrating gene delivery platforms that can shuttle very large DNA fragments in various recipient cells: theoretically, no size limit exists for the chromosome segments that an engineered minichromosome can accommodate. Therefore, genetically manipulated chromosomes might be potentially ideal vector systems, especially when the complexity of higher eukaryotic genes is concerned. This review focuses on those chromosome vectors generated using spontaneously occurring small markers as starting material. The definition and manipulation of the centromere domain is one of the main obstacles in chromosome engineering: naturally occurring minichromosomes, due to their inherent small size, were helpful in defining some aspects of centromere function. In addition, several distinctive features of small marker chromosomes, like their appearance as supernumerary elements in otherwise normal karyotypes, have been successfully exploited to use them as gene delivery vectors. The key technologies employed for minichromosome engineering are: size reduction, gene targeting, and vector delivery in various recipient cells. In spite of the significant advances that have been recently achieved in all these fields, several unsolved problems limit the potential of artificially modified chromosomes. Still, these vector systems have been exploited in a number of applications where the investigation of the controlled expression of large DNA segments is needed. A typical example is the analysis of genes whose expression strictly depends on the chromosomal environment in which they are positioned, where engineered chromosomes can be envisaged as epigenetically regulated expression systems. A novel and exciting advance concerns the use of engineered minichromosomes to study the organization and dynamics of local chromatin structures.

Process for assembly and transformation into Saccharomyces cerevisiae of a synthetic yeast artificial chromosome containing a multigene cassette to express enzymes that enhance xylose utilization designed for an automated pla

Science.gov (United States)

A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system ...

ФC31 Integrase-Mediated Isolation and Characterization of Novel Safe Harbors for Transgene Expression in the Pig Genome

Science.gov (United States)

Bi, Yanzhen; Hua, Zaidong; Ren, Hongyan; Zhang, Liping; Xiao, Hongwei; Liu, Ximei; Hua, Wenjun; Mei, Shuqi; Molenaar, Adrian; Laible, Götz; Zheng, Xinmin

2018-01-01

Programmable nucleases have allowed the rapid development of gene editing and transgenics, but the technology still suffers from the lack of predefined genetic loci for reliable transgene expression and maintenance. To address this issue, we used ФC31 integrase to navigate the porcine genome and identify the pseudo attP sites suitable as safe harbors for sustained transgene expression. The combined ФC31 integrase mRNA and an enhanced green fluorescence protein (EGFP) reporter donor were microinjected into one-cell zygotes for transgene integration. Among the resulting seven EGFP-positive piglets, two had transgene integrations at pseudo attP sites, located in an intergenic region of chromosome 1 (chr1-attP) and the 6th intron of the TRABD2A gene on chromosome 3 (chr3-attP), respectively. The integration structure was determined by TAIL-PCR and Southern blotting. Primary fibroblast cells were isolated from the two piglets and examined using fluorescence-activated cell sorting (FACS) and enzyme-linked immunosorbent assay (ELISA), which demonstrated that the chr1-attP site was more potent than chr3-attP site in supporting the EGFP expression. Both piglets had green feet under the emission of UV light, and pelleted primary fibroblast cells were green-colored under natural light, corroborating that the two pseudo attP sites are beneficial to transgene expression. The discovery of these two novel safe harbors for robust and durable transgene expression will greatly facilitate the use of transgenic pigs for basic, biomedical and agricultural studies and applications. PMID:29300364

Demasculinization of the Anopheles gambiae X chromosome

Directory of Open Access Journals (Sweden)

Magnusson Kalle

2012-05-01

Full Text Available Abstract Background In a number of organisms sex-biased genes are non-randomly distributed between autosomes and the shared sex chromosome X (or Z. Studies on Anopheles gambiae have produced conflicting results regarding the underrepresentation of male-biased genes on the X chromosome and it is unclear to what extent sexual antagonism, dosage compensation or X-inactivation in the male germline, the evolutionary forces that have been suggested to affect the chromosomal distribution of sex-biased genes, are operational in Anopheles. Results We performed a meta-analysis of sex-biased gene expression in Anopheles gambiae which provides evidence for a general underrepresentation of male-biased genes on the X-chromosome that increased in significance with the observed degree of sex-bias. A phylogenomic comparison between Drosophila melanogaster, Aedes aegypti and Culex quinquefasciatus also indicates that the Anopheles X chromosome strongly disfavours the evolutionary conservation of male-biased expression and that novel male-biased genes are more likely to arise on autosomes. Finally, we demonstrate experimentally that transgenes situated on the Anopheles gambiae X chromosome are transcriptionally silenced in the male germline. Conclusion The data presented here support the hypothesis that the observed demasculinization of the Anopheles X chromosome is driven by X-chromosome inactivation in the male germline and by sexual antagonism. The demasculinization appears to be the consequence of a loss of male-biased expression, rather than a failure in the establishment or the extinction of male-biased genes.

Chromosome-specific DNA Repeat Probes

Energy Technology Data Exchange (ETDEWEB)

Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

2006-03-16

In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

Construction of a Bacterial Artificial Chromosome Library of TM-1, a Standard Line for Genetics and Genomics in Upland Cotton

Institute of Scientific and Technical Information of China (English)

Yan Hu; Wang-Zhen Guo; Tian-Zhen Zhang

2009-01-01

A bacterial artificial chromosome (BAC) library was constructed for Gossyplum hirsutum acc. TM-1, a genetic and genomic standard line for Upland cotton. The library consists of 147 456 clones with an average insert size of 122.8 kb ranging from 97 to 240 kb. About 96.0% of the clones have inserts over 100 kb. Therefore, this library represents theoretically 7.4 haploid genome equivalents based on an AD genome size of 2 425 Mb. Clones were stored in 384 384- well plates and arrayed into multiplex pools for rapid and reliable library screening. BAC screening was carded out by four-round polymerase chain reactions using 23 simple sequence repeats (SSR) markers, three sequence-related amplified polymorphism markers and one pair of pdmere for a gene associated with fiber development to test the quality of the library. Correspondingly, in total 92 positive BAC clones were Identified with an average four positive clones per SSR marker, ranging from one to eight hits. Additionally, since these SSR markers have been localized to chromosome 12 (A12) and 26 (D12) according to the genetic map, these BAC clonee are expected to serve as seeds for the physical mapping of these two homologous chromosomes, sequentially map-based cloning of quantitative trait loci or genes associated with Important agronomic traits.

A bacterial artificial chromosome-based physical map of Manihot esculenta ssp.flabellifolia

Institute of Scientific and Technical Information of China (English)

Yuhua FU; Zhiqiang XIA; Shujuan WANG; Xin CHEN; Cheng LU; Mingcheng LUO; Hongbin ZHANG; Wenquan WANG

2016-01-01

Cassava (Manihot esculenta) is known as the third most important food crop in the tropics and also used for industrial feedstock for biofuels.Two new bacterial artificial chromosome (BAC) libraries were constructed for W14 (M.Esculenta ssp.flabellifolia),a wild ancestor of domesticated cassava.The libraries were constructed with EcoRI and HindⅢ insertion vectors,respectively.The EcoRI library has 29952 clones with an average insert size of 115 kb,while the HindⅢ library consists of 29952 clones with an average insert of 129 kb.The combined libraries contain a total of 59904 clones with an average insert size of 125 kb,representing approximately 10×haploid genome equivalents.A total of 29952 clones were fingerprinted and resulted in a cassava physical map composed of 2485 contigs with an average physical length of 336 kb and 2909 singletons,representing approximately 762 Mb of the cassava genome.5000 clones located at the ends of BAC contigs were selected and sequenced.A total of 6077 SNPs and 231 indels were identified,that covered 459 gene sequences,of which 6 genes were associated with starch and sucrose metabolism.This BAC-based physical map provides valuable tools to understand the genetics and evolution of cassava.

Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents

International Nuclear Information System (INIS)

Albertsen, H.M.; Abderrahim, H.; Cann, H.M.; Dausset, J.; Le Paslier, D.; Cohen, D.

1990-01-01

Prior to constructing a library of yeast artificial chromosomes (YACs) containing very large human DNA fragments, the authors performed a series of preliminary experiments aimed at developing a suitable protocol. They found an inverse relationship between YAC insert size and transformation efficiency. Evidence of occasional rearrangement within YAC inserts was found resulting in clonally stable internal deletions or clonally unstable size variations. A protocol was developed for preparative electrophoretic enrichment of high molecular mass human DNA fragments from partial restriction digests and ligation with the YAC vector in agarose. A YAC library has been constructed from large fragments of DNA from an Epstein-Barr virus-transformed human lymphoblastoid cell line. The library presently contains 50,000 clones, 95% of which are greater than 250 kilobase pairs in size. The mean YAC size of the library, calculated from 132 randomly isolated clones, is 430 kilobase pairs. The library thus contains the equivalent of approximately seven haploid human genomes

Competitive Expression of Endogenous Wheat CENH3 May Lead to Suppression of Alien ZmCENH3 in Transgenic Wheat × Maize Hybrids.

Science.gov (United States)

Chen, Wei; Zhu, Qilin; Wang, Haiyan; Xiao, Jin; Xing, Liping; Chen, Peidu; Jin, Weiwei; Wang, Xiu-E

2015-11-20

Uniparental chromosome elimination in wheat × maize hybrid embryos is widely used in double haploid production of wheat. Several explanations have been proposed for this phenomenon, one of which is that the lack of cross-species CENH3 incorporation may act as a barrier to interspecies hybridization. However, it is unknown if this mechanism applies universally. To study the role of CENH3 in maize chromosome elimination of wheat × maize hybrid embryos, maize ZmCENH3 and wheat αTaCENH3-B driven by the constitutive CaMV35S promoter were transformed into wheat variety Yangmai 158. Five transgenic lines for ZmCENH3 and six transgenic lines for αTaCENH3-B were identified. RT-PCR analysis showed that the transgene could be transcribed at a low level in all ZmCENH3 transgenic lines, whereas transcription of endogenous wheat CENH3 was significantly up-regulated. Interestingly, the expression levels of both wheat CENH3 and ZmCENH3 in the ZmCENH3 transgenic wheat × maize hybrid embryos were higher than those in the non-transformed Yangmai 158 × maize hybrid embryos. This indicates that the alien ZmCENH3 in wheat may induce competitive expression of endogenous wheat CENH3, leading to suppression of ZmCENH3 over-expression. Eliminations of maize chromosomes in hybrid embryos of ZmCENH3 transgenic wheat × maize and Yangmai 158 × maize were compared by observations on micronuclei presence, by marker analysis using maize SSRs (simple sequence repeats), and by FISH (fluorescence in situ hybridization) using 45S rDNA as a probe. The results indicate that maize chromosome elimination events in the two crosses are not significantly different. Fusion protein ZmCENH3-YFP could not be detected in ZmCENH3 transgenic wheat by either Western blotting or immnunostaining, whereas accumulation and loading of the αTaCENH3-B-GFP fusion protein was normal in αTaCENH3-B transgenic lines. As ZmCENH3-YFP did not accumulate after AM114 treatment, we speculate that low levels of Zm

Specific micro RNA-regulated TetR-KRAB transcriptional control of transgene expression in viral vector-transduced cells.

Directory of Open Access Journals (Sweden)

Virginie Pichard

Full Text Available Precise control of transgene expression in a tissue-specific and temporally regulated manner is desirable for many basic and applied investigations gene therapy applications. This is important to regulate dose of transgene products and minimize unwanted effects. Previously described methods have employed tissue specific promoters, miRNA-based transgene silencing or tetR-KRAB-mediated suppression of transgene promoters. To improve on versatility of transgene expression control, we have developed expression systems that use combinations of a tetR-KRAB artificial transgene-repressor, endogenous miRNA silencing machinery and tissue specific promoters. Precise control of transgene expression was demonstrated in liver-, macrophage- and muscle-derived cells. Efficiency was also demonstrated in vivo in murine muscle. This multicomponent and modular regulatory system provides a robust and easily adaptable method for achieving regulated transgene expression in different tissue types. The improved precision of regulation will be useful for many gene therapy applications requiring specific spatiotemporal transgene regulation.

Construction of a full-length infectious bacterial artificial chromosome clone of duck enteritis virus vaccine strain

Science.gov (United States)

2013-01-01

Background Duck enteritis virus (DEV) is the causative agent of duck viral enteritis, which causes an acute, contagious and lethal disease of many species of waterfowl within the order Anseriformes. In recent years, two laboratories have reported on the successful construction of DEV infectious clones in viral vectors to express exogenous genes. The clones obtained were either created with deletion of viral genes and based on highly virulent strains or were constructed using a traditional overlapping fosmid DNA system. Here, we report the construction of a full-length infectious clone of DEV vaccine strain that was cloned into a bacterial artificial chromosome (BAC). Methods A mini-F vector as a BAC that allows the maintenance of large circular DNA in E. coli was introduced into the intergenic region between UL15B and UL18 of a DEV vaccine strain by homologous recombination in chicken embryoblasts (CEFs). Then, the full-length DEV clone pDEV-vac was obtained by electroporating circular viral replication intermediates containing the mini-F sequence into E. coli DH10B and identified by enzyme digestion and sequencing. The infectivity of the pDEV-vac was validated by DEV reconstitution from CEFs transfected with pDEV-vac. The reconstructed virus without mini-F vector sequence was also rescued by co-transfecting the Cre recombinase expression plasmid pCAGGS-NLS/Cre and pDEV-vac into CEF cultures. Finally, the in vitro growth properties and immunoprotection capacity in ducks of the reconstructed viruses were also determined and compared with the parental virus. Results The full genome of the DEV vaccine strain was successfully cloned into the BAC, and this BAC clone was infectious. The in vitro growth properties of these reconstructions were very similar to parental DEV, and ducks immunized with these viruses acquired protection against virulent DEV challenge. Conclusions DEV vaccine virus was cloned as an infectious bacterial artificial chromosome maintaining full

Detailed comparison between the wheat chromosome group 7 short arms and the rice chromosome arms 6S and 8L with special reference to genes involved in starch biosynthesis

DEFF Research Database (Denmark)

Li, Zhongyi; Huang, Bingyan; Rampling, Lynette

2004-01-01

Rice bacterial artificial chromosome (BAC) clones have been identified that contain sequences orthologous to each EST localized to wheat chromosome 7AS deletion stocks by Southern blot hybridization. This information has been used to relate the DNA sequence included in each wheat deletion stock t...

A BAC-based transgenic mouse specifically expresses an inducible Cre in the urothelium.

Directory of Open Access Journals (Sweden)

Tian Huai Shen

Full Text Available Cre-loxp mediated conditional knockout strategy has played critical roles for revealing functions of many genes essential for development, as well as the causal relationships between gene mutations and diseases in the postnatal adult mice. One key factor of this strategy is the availability of mice with tissue- or cell type-specific Cre expression. However, the success of the traditional molecular cloning approach to generate mice with tissue specific Cre expression often depends on luck. Here we provide a better alternative by using bacterial artificial chromosome (BAC-based recombineering to insert iCreERT2 cDNA at the ATG start of the Upk2 gene. The BAC-based transgenic mice express the inducible Cre specifically in the urothelium as demonstrated by mRNA expression and staining for LacZ expression after crossing with a Rosa26 reporter mouse. Taking into consideration the size of the gene of interest and neighboring genes included in a BAC, this method should be widely applicable for generation of mice with tissue specific gene expression or deletions in a more specific manner than previously reported.

Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

Science.gov (United States)

Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

1999-01-01

Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.

Directory of Open Access Journals (Sweden)

Gloria Volohonsky

2017-01-01

Full Text Available Mosquitoes genetically engineered to be resistant to Plasmodium parasites represent a promising novel approach in the fight against malaria. The insect immune system itself is a source of anti-parasitic genes potentially exploitable for transgenic designs. The Anopheles gambiae thioester containing protein 1 (TEP1 is a potent anti-parasitic protein. TEP1 is secreted and circulates in the mosquito hemolymph, where its activated cleaved form binds and eliminates malaria parasites. Here we investigated whether TEP1 can be used to create malaria resistant mosquitoes. Using a GFP reporter transgene, we determined that the fat body is the main site of TEP1 expression. We generated transgenic mosquitoes that express TEP1r, a potent refractory allele of TEP1, in the fat body and examined the activity of the transgenic protein in wild-type or TEP1 mutant genetic backgrounds. Transgenic TEP1r rescued loss-of-function mutations, but did not increase parasite resistance in the presence of a wild-type susceptible allele. Consistent with previous reports, TEP1 protein expressed from the transgene in the fat body was taken up by hemocytes upon a challenge with injected bacteria. Furthermore, although maturation of transgenic TEP1 into the cleaved form was impaired in one of the TEP1 mutant lines, it was still sufficient to reduce parasite numbers and induce parasite melanization. We also report here the first use of Transcription Activator Like Effectors (TALEs in Anopheles gambiae to stimulate expression of endogenous TEP1. We found that artificial elevation of TEP1 expression remains moderate in vivo and that enhancement of endogenous TEP1 expression did not result in increased resistance to Plasmodium. Taken together, our results reveal the difficulty of artificially influencing TEP1-mediated Plasmodium resistance, and contribute to further our understanding of the molecular mechanisms underlying mosquito resistance to Plasmodium parasites.

Chemical mutagens, transposons, and transgenes to interrogate gene function in Drosophila melanogaster.

Science.gov (United States)

Venken, Koen J T; Bellen, Hugo J

2014-06-15

The study of genetics, genes, and chromosomal inheritance was initiated by Thomas Morgan in 1910, when the first visible mutations were identified in fruit flies. The field expanded upon the work initiated by Herman Muller in 1926 when he used X-rays to develop the first balancer chromosomes. Today, balancers are still invaluable to maintain mutations and transgenes but the arsenal of tools has expanded vastly and numerous new methods have been developed, many relying on the availability of the genome sequence and transposable elements. Forward genetic screens based on chemical mutagenesis or transposable elements have resulted in the unbiased identification of many novel players involved in processes probed by specific phenotypic assays. Reverse genetic approaches have relied on the availability of a carefully selected set of transposon insertions spread throughout the genome to allow the manipulation of the region in the vicinity of each insertion. Lastly, the ability to transform Drosophila with single copy transgenes using transposons or site-specific integration using the ΦC31 integrase has allowed numerous manipulations, including the ability to create and integrate genomic rescue constructs, generate duplications, RNAi knock-out technology, binary expression systems like the GAL4/UAS system as well as other methods. Here, we will discuss the most useful methodologies to interrogate the fruit fly genome in vivo focusing on chemical mutagenesis, transposons and transgenes. Genome engineering approaches based on nucleases and RNAi technology are discussed in following chapters. Copyright © 2014 Elsevier Inc. All rights reserved.

Telomerase-mediated life-span extension of human primary fibroblasts by human artificial chromosome (HAC) vector

International Nuclear Information System (INIS)

Shitara, Shingo; Kakeda, Minoru; Nagata, Keiko; Hiratsuka, Masaharu; Sano, Akiko; Osawa, Kanako; Okazaki, Akiyo; Katoh, Motonobu; Kazuki, Yasuhiro; Oshimura, Mitsuo; Tomizuka, Kazuma

2008-01-01

Telomerase-mediated life-span extension enables the expansion of normal cells without malignant transformation, and thus has been thought to be useful in cell therapies. Currently, integrating vectors including the retrovirus are used for human telomerase reverse transcriptase (hTERT)-mediated expansion of normal cells; however, the use of these vectors potentially causes unexpected insertional mutagenesis and/or activation of oncogenes. Here, we established normal human fibroblast (hPF) clones retaining non-integrating human artificial chromosome (HAC) vectors harboring the hTERT expression cassette. In hTERT-HAC/hPF clones, we observed the telomerase activity and the suppression of senescent-associated SA-β-galactosidase activity. Furthermore, the hTERT-HAC/hPF clones continued growing beyond 120 days after cloning, whereas the hPF clones retaining the silent hTERT-HAC senesced within 70 days. Thus, hTERT-HAC-mediated episomal expression of hTERT allows the extension of the life-span of human primary cells, implying that gene delivery by non-integrating HAC vectors can be used to control cellular proliferative capacity of primary cultured cells

A molecularly defined duplication set for the X chromosome of Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.

2010-07-22

We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

The dynamics of long-term transgene expression in engrafted neural stem cells.

Science.gov (United States)

Lee, Jean-Pyo; Tsai, David J; In Park, Kook; Harvey, Alan R; Snyder, Evan Y

2009-07-01

To assess the dynamics and confounding variables that influence transgene expression in neural stem cells (NSCs), we generated distinct NSC clones from the same pool of cells, carrying the same reporter gene transcribed from the same promoter, transduced by the same retroviral vector, and transplanted similarly at the same differentiation state, at the same time and location, into the brains of newborn mouse littermates, and monitored in parallel for over a year in vivo (without immunosuppression). Therefore, the sole variables were transgene chromosomal insertion site and copy number. We then adapted and optimized a technique that tests, at the single cell level, persistence of stem cell-mediated transgene expression in vivo based on correlating the presence of the transgene in a given NSC's nucleus (by fluorescence in situ hybridization [FISH]) with the frequency of that transgene's product within the same cell (by combined immunohistochemistry [IHC]). Under the above-stated conditions, insertion site is likely the most contributory variable dictating transgene downregulation in an NSC after 3 months in vivo. We also observed that this obstacle could be effectively and safely counteracted by simple serial infections (as few as three) inserting redundant copies of the transgene into the prospective donor NSC. (The preservation of normal growth control mechanisms and an absence of tumorigenic potential can be readily screened and ensured ex vivo prior to transplantation.) The combined FISH/IHC strategy employed here for monitoring the dynamics of transgene expression at the single cell level in vivo may be used for other types of therapeutic and housekeeping genes in endogenous and exogenous stem cells of many organs and lineages. Copyright 2009 Wiley-Liss, Inc.

Oviduct-Specific Expression of Human Neutrophil Defensin 4 in Lentivirally Generated Transgenic Chickens

Science.gov (United States)

Liu, Tongxin; Wu, Hanyu; Cao, Dainan; Li, Qingyuan; Zhang, Yaqiong; Li, Ning; Hu, Xiaoxiang

2015-01-01

The expression of oviduct-specific recombinant proteins in transgenic chickens is a promising technology for the production of therapeutic biologics in eggs. In this study, we constructed a lentiviral vector encoding an expression cassette for human neutrophil defensin 4 (HNP4), a compound that displays high activity against Escherichia coli, and produced transgenic chickens that expressed the recombinant HNP4 protein in egg whites. After the antimicrobial activity of the recombinant HNP4 protein was tested at the cellular level, a 2.8-kb ovalbumin promoter was used to drive HNP4 expression specifically in oviduct tissues. From 669 injected eggs, 218 chickens were successfully hatched. Ten G0 roosters, with semens identified as positive for the transgene, were mated with wild-type hens to generate G1 chickens. From 1,274 total offspring, fifteen G1 transgenic chickens were positive for the transgene, which was confirmed by PCR and Southern blotting. The results of the Southern blotting and genome walking indicated that a single copy of the HNP4 gene was integrated into chromosomes 1, 2, 3, 4, 6 and 24 of the chickens. As expected, HNP4 expression was restricted to the oviduct tissues, and the levels of both transcriptional and translational HNP4 expression varied greatly in transgenic chickens with different transgene insertion sites. The amount of HNP4 protein expressed in the eggs of G1 and G2 heterozygous transgenic chickens ranged from 1.65 μg/ml to 10.18 μg/ml. These results indicated that the production of transgenic chickens that expressed HNP4 protein in egg whites was successful. PMID:26020529

Centromere Destiny in Dicentric Chromosomes: New Insights from the Evolution of Human Chromosome 2 Ancestral Centromeric Region.

Science.gov (United States)

Chiatante, Giorgia; Giannuzzi, Giuliana; Calabrese, Francesco Maria; Eichler, Evan E; Ventura, Mario

2017-07-01

Dicentric chromosomes are products of genomic rearrangements that place two centromeres on the same chromosome. Due to the presence of two primary constrictions, they are inherently unstable and overcome their instability by epigenetically inactivating and/or deleting one of the two centromeres, thus resulting in functionally monocentric chromosomes that segregate normally during cell division. Our understanding to date of dicentric chromosome formation, behavior and fate has been largely inferred from observational studies in plants and humans as well as artificially produced de novo dicentrics in yeast and in human cells. We investigate the most recent product of a chromosome fusion event fixed in the human lineage, human chromosome 2, whose stability was acquired by the suppression of one centromere, resulting in a unique difference in chromosome number between humans (46 chromosomes) and our most closely related ape relatives (48 chromosomes). Using molecular cytogenetics, sequencing, and comparative sequence data, we deeply characterize the relicts of the chromosome 2q ancestral centromere and its flanking regions, gaining insight into the ancestral organization that can be easily broadened to all acrocentric chromosome centromeres. Moreover, our analyses offered the opportunity to trace the evolutionary history of rDNA and satellite III sequences among great apes, thus suggesting a new hypothesis for the preferential inactivation of some human centromeres, including IIq. Our results suggest two possible centromere inactivation models to explain the evolutionarily stabilization of human chromosome 2 over the last 5-6 million years. Our results strongly favor centromere excision through a one-step process. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Construction of an Americn mink Bacterial Artificial Chromosome (BAC) library and sequencing candidate genes important for the fur industry

DEFF Research Database (Denmark)

Anistoroaei, Razvan Marian; Hallers, Boudewijn ten; Nefedov, Michael

2011-01-01

BACKGROUND: Bacterial artificial chromosome (BAC) libraries continue to be invaluable tools for the genomic analysis of complex organisms. Complemented by the newly and fast growing deep sequencing technologies, they provide an excellent source of information in genomics projects. RESULTS: Here, we...... report the construction and characterization of the CHORI-231 BAC library constructed from a Danish-farmed, male American mink (Neovison vison). The library contains approximately 165,888 clones with an average insert size of 170 kb, representing approximately 10-fold coverage. High-density filters, each...... consisting of 18,432 clones spotted in duplicate, have been produced for hybridization screening and are publicly available. Overgo probes derived from expressed sequence tags (ESTs), representing 21 candidate genes for traits important for the mink industry, were used to screen the BAC library...

Impact of transgene genome location on gene migration from herbicide-resistant wheat (Triticum aestivum L.) to jointed goatgrass (Aegilops cylindrica Host).

Science.gov (United States)

Rehman, Maqsood; Hansen, Jennifer L; Mallory-Smith, Carol A; Zemetra, Robert S

2017-08-01

Wheat (Triticum aestivum) (ABD) and jointed goatgrass (Aegilops cylindrica) (CD) can cross and produce hybrids that can backcross to either parent. Such backcrosses can result in progeny with chromosomes and/or chromosome segments retained from wheat. Thus, a herbicide resistance gene could migrate from wheat to jointed goatgrass. In theory, the risk of gene migration from herbicide-resistant wheat to jointed goatgrass is more likely if the gene is located on the D genome and less likely if the gene is located on the A or B genome of wheat. BC 1 populations (jointed goatgrass as a recurrent parent) were analyzed for chromosome numbers and transgene transmission rates under sprayed and non-sprayed conditions. Transgene retention in the non-sprayed BC 1 generation for the A, B and D genomes was 84, 60 and 64% respectively. In the sprayed populations, the retention was 81, 59 and 74% respectively. The gene transmission rates were higher than the expected 50% or less under sprayed and non-sprayed conditions, possibly owing to meiotic chromosome restitution and/or chromosome non-disjunction. Such high transmission rates in the BC 1 generation negates the benefits of gene placement for reducing the potential of gene migration from wheat to jointed goatgrass. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Functional characterization of Kaposi's sarcoma-associated herpesvirus small capsid protein by bacterial artificial chromosome-based mutagenesis

International Nuclear Information System (INIS)

Sathish, Narayanan; Yuan Yan

2010-01-01

A systematic investigation of interactions amongst KSHV capsid proteins was undertaken in this study to comprehend lesser known KSHV capsid assembly mechanisms. Interestingly the interaction patterns of the KSHV small capsid protein, ORF65 suggested its plausible role in viral capsid assembly pathways. Towards further understanding this, ORF65-null recombinant mutants (BAC-Δ65 and BAC-stop65) employing a bacterial artificial chromosome (BAC) system were generated. No significant difference was found in both overall viral gene expression and lytic DNA replication between stable monolayers of 293T-BAC36 (wild-type) and 293T-BAC-ORF65-null upon induction with 12-O-tetradecanoylphorbol-13-acetate, though the latter released 30-fold fewer virions to the medium than 293T-BAC36 cells. Sedimentation profiles of capsid proteins of ORF65-null recombinant mutants were non-reflective of their organization into the KSHV capsids and were also undetectable in cytoplasmic extracts compared to noticeable levels in nuclear extracts. These observations collectively suggested the pivotal role of ORF65 in the KSHV capsid assembly processes.

Construction of BAC Libraries from Flow-Sorted Chromosomes.

Science.gov (United States)

Šafář, Jan; Šimková, Hana; Doležel, Jaroslav

2016-01-01

Cloned DNA libraries in bacterial artificial chromosome (BAC) are the most widely used form of large-insert DNA libraries. BAC libraries are typically represented by ordered clones derived from genomic DNA of a particular organism. In the case of large eukaryotic genomes, whole-genome libraries consist of a hundred thousand to a million clones, which make their handling and screening a daunting task. The labor and cost of working with whole-genome libraries can be greatly reduced by constructing a library derived from a smaller part of the genome. Here we describe construction of BAC libraries from mitotic chromosomes purified by flow cytometric sorting. Chromosome-specific BAC libraries facilitate positional gene cloning, physical mapping, and sequencing in complex plant genomes.

Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions

Directory of Open Access Journals (Sweden)

Patricia Horn

2017-12-01

Full Text Available As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia, for which the highest paternal leakage has been observed. The variety white 115 (W115 served as recipient and Pink Wave (PW and the transplastomic variant PW T16, encoding the uidA reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid. Keywords: Paternal plastid inheritance, Transgene confinement, Greenhouse, Field trial, Pollen mediated gene flow

Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions.

Science.gov (United States)

Horn, Patricia; Nausch, Henrik; Baars, Susanne; Schmidtke, Jörg; Schmidt, Kerstin; Schneider, Anja; Leister, Dario; Broer, Inge

2017-12-01

As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia , for which the highest paternal leakage has been observed. The variety white 115 (W115) served as recipient and Pink Wave (PW) and the transplastomic variant PW T16, encoding the uid A reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid.

A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.

Science.gov (United States)

Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C

2010-12-01

We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

Macrophage specific overexpression of the human macrophage scavenger receptor in transgenic mice, using a 180-kb yeast artificial chromosome, leads to enhanced foam cell formation of isolated peritoneal macrophages

NARCIS (Netherlands)

de Winther, M. P.; van Dijk, K. W.; van Vlijmen, B. J.; Gijbels, M. J.; Heus, J. J.; Wijers, E. R.; van den Bos, A. C.; Breuer, M.; Frants, R. R.; Havekes, L. M.; Hofker, M. H.

1999-01-01

Macrophage scavenger receptors class A (MSR) are thought to play an important role in atherogenesis by mediating the unrestricted uptake of modified lipoproteins by macrophages in the vessel wall leading to foam cell formation. To investigate the in vivo role of the MSR in this process, a transgenic

Broader expression of the mouse platelet factor 4-cre transgene beyond the megakaryocyte lineage.

Science.gov (United States)

Pertuy, F; Aguilar, A; Strassel, C; Eckly, A; Freund, J-N; Duluc, I; Gachet, C; Lanza, F; Léon, C

2015-01-01

Transgenic mice expressing cre recombinase under the control of the platelet factor 4 (Pf4) promoter, in the context of a 100-kb bacterial artificial chromosome, have become a valuable tool with which to study genetic modifications in the platelet lineage. However, the specificity of cre expression has recently been questioned, and the time of its onset during megakaryopoiesis remains unknown. To characterize the expression of this transgene, we used double-fluorescent cre reporter mice. In the bone marrow, Pf4-cre-mediated recombination had occurred in all CD42-positive megakaryocytes as early as stage I of maturation, and in rare CD42-negative cells. In circulating blood, all platelets had recombined, along with only a minor fraction of CD45-positive cells. However, we found that all tissues contained recombined cells of monocyte/macrophage origin. When recombined, these cells might potentially modify the function of the tissues under particular conditions, especially inflammatory conditions, which further increase recombination in immune cells. Unexpectedly, a subset of epithelial cells from the distal colon showed signs of recombination resulting from endogenous Pf4-cre expression. This is probably the basis of the unexplained colon tumors developed by Apc(flox/flox) ;Pf4-cre mice, generated in a separate study on the role of Apc in platelet formation. Altogether, our results indicate early recombination with full penetrance in megakaryopoiesis, and confirm the value of Pf4-cre mice for the genetic engineering of megakaryocytes and platelets. However, care must be taken when investigating the role of platelets in processes outside hemostasis, especially when immune cells might be involved. © 2014 International Society on Thrombosis and Haemostasis.

Delineating Rearrangements in Single Yeast Artificial Chromosomes by Quantitative DNA Fiber Mapping

Energy Technology Data Exchange (ETDEWEB)

Weier, Heinz-Ulrich G.; Greulich-Bode, Karin M.; Wu, Jenny; Duell, Thomas

2009-09-18

Cloning of large chunks of human genomic DNA in recombinant systems such as yeast or bacterial artificial chromosomes has greatly facilitated the construction of physical maps, the positional cloning of disease genes or the preparation of patient-specific DNA probes for diagnostic purposes. For this process to work efficiently, the DNA cloning process and subsequent clone propagation need to maintain stable inserts that are neither deleted nor otherwise rearranged. Some regions of the human genome; however, appear to have a higher propensity than others to rearrange in any host system. Thus, techniques to detect and accurately characterize such rearrangements need to be developed. We developed a technique termed 'Quantitative DNA Fiber Mapping (QDFM)' that allows accurate tagging of sequence elements of interest with near kilobase accuracy and optimized it for delineation of rearrangements in recombinant DNA clones. This paper demonstrates the power of this microscopic approach by investigating YAC rearrangements. In our examples, high-resolution physical maps for regions within the immunoglobulin lambda variant gene cluster were constructed for three different YAC clones carrying deletions of 95 kb and more. Rearrangements within YACs could be demonstrated unambiguously by pairwise mapping of cosmids along YAC DNA molecules. When coverage by YAC clones was not available, distances between cosmid clones were estimated by hybridization of cosmids onto DNA fibers prepared from human genomic DNA. In addition, the QDFM technology provides essential information about clone stability facilitating closure of the maps of the human genome as well as those of model organisms.

Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

Science.gov (United States)

Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

2015-10-29

Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

Science.gov (United States)

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Chromatin structure and ionizing-radiation-induced chromosome aberrations

International Nuclear Information System (INIS)

Muehlmann-Diaz, M.C.

1993-01-01

The possible influence of chromatic structure or activity on chromosomal radiosensitivity was studied. A cell line was isolated which contained some 10 5 copies of an amplified plasmid in a single large mosquito artificial chromosome (MAC). This chromosome was hypersensitive to DNase I. Its radiosensitivity was some three fold greater than normal mosquito chromosomes in the same cell. In cultured human cells irradiated during G 0 , the initial breakage frequency in chromosome 4, 19 and the euchromatic and heterochromatic portions of the Y chromosome were measured over a wide range of doses by inducing Premature Chromosome Condensation (PCC) immediately after irradiation with Cs-137 gamma rays. No evidence was seen that Y heterochromatin or large fragments of it remained unbroken. The only significant deviation from the expected initial breakage frequency per Gy per unit length of chromosome was that observed for the euchromatic portion of the Y chromosome, with breakage nearly twice that expected. The development of aberrations involving X and Y chromosomes at the first mitosis after irradation was also studied. Normal female cells sustained about twice the frequency of aberrations involving X chromosomes for a dose of 7.3 Gy than the corresponding male cells. Fibroblasts from individuals with supernumerary X chromosomes did not show any further increase in X aberrations for this dos. The frequency of aberrations involving the heterochromatic portion of the long arm of the Y chromosome was about what would be expected for a similar length of autosome, but the euchromatic portion of the Y was about 3 times more radiosensitive per unit length. 5-Azacytidine treatment of cultured human female fibroblasts or fibroblasts from a 49,XXXXY individual, reduced the methylation of cytosine residues in DNA, and resulted in an increased chromosomal radiosensitivity in general, but it did not increase the frequency of aberrations involving the X chromosomes

Condensation of chromatin in transcriptional regions of an inactivated plant transgene: evidence for an active role of transcription in gene silencing.

Science.gov (United States)

van Blokland, R; ten Lohuis, M; Meyer, P

1997-12-01

The chromatin structures of two epigenetic alleles of a transgene were investigated by measuring the local accessibility of transgene chromatin to endonucleases. The two epialleles represented the active, hypomethylated state of a transgene in line 17-I of Petunia hybrida, and a transcriptionally inactive, hypermethylated derivative of the same transgene in line 17-IV. In nuclear preparations the inactive epiallele was significantly less sensitive to DNasel digestion and nuclease S7 digestion than the transcriptionally active epiallele, whereas no significant differences in accessibility were observed between naked DNA samples of the two epialleles. Our data suggest that a condensed chromatin structure is specifically imposed on transcribed regions of the construct in line 17-IV. In contrast, in both epialleles the plasmid region of the transgene, which is not transcriptionally active in plants, retains the same accessibility to endonucleases as the chromosomal integration site. These data suggest that transcriptional inactivation is linked to the process of transcription, and imply that control of transgene expression via the use of inducible or tissue-specific promoters might prevent transgene silencing and conserve the active state of transgenes during sexual propagation.

Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.

Science.gov (United States)

Carabajal Paladino, Leonela Z; Nguyen, Petr; Síchová, Jindra; Marec, František

2014-01-01

We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms.

6q deletion detected by fluorescence in situ hybridization using bacterial artificial chromosome in chronic lymphocytic leukemia.

Science.gov (United States)

Dalsass, Alessia; Mestichelli, Francesca; Ruggieri, Miriana; Gaspari, Paola; Pezzoni, Valerio; Vagnoni, Davide; Angelini, Mario; Angelini, Stefano; Bigazzi, Catia; Falcioni, Sadia; Troiani, Emanuela; Alesiani, Francesco; Catarini, Massimo; Attolico, Immacolata; Scortechini, Ilaria; Discepoli, Giancarlo; Galieni, Piero

2013-07-01

Deletions of the long arm of chromosome 6 are known to occur at relatively low frequency (3-6%) in chronic lymphocytic leukemia (CLL), and they are more frequently observed in 6q21. Few data have been reported regarding other bands on 6q involved by cytogenetic alterations in CLL. The cytogenetic study was performed in nuclei and metaphases obtained after stimulation with a combination of CpG-oligonucleotide DSP30 and interleukin-2. Four bacterial artificial chromosome (BAC) clones mapping regions in bands 6q16, 6q23, 6q25, 6q27 were used as probes for fluorescence in situ hybridization in 107 CLL cases in order to analyze the occurrence and localization of 6q aberrations. We identified 11 cases (10.2%) with 6q deletion of 107 patients studied with CLL. The trends of survival curves and the treatment-free intervals (TFI) of patients with deletion suggest a better outcome than the other cytogenetic risk groups. We observed two subgroups with 6q deletion as the sole anomaly: two cases with 6q16 deletion, and three cases with 6q25.2-27 deletion. There were differences of age, stage, and TFI between both subgroups. By using BAC probes, we observed that 6q deletion has a higher frequency in CLL and is linked with a good prognosis. In addition, it was observed that the deletion in 6q16 appears to be the most frequent and, if present as the only abnormality, it could be associated with a most widespread disease. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Hominoid chromosomal rearrangements on 17q map to complex regions of segmental duplication.

Science.gov (United States)

Cardone, Maria Francesca; Jiang, Zhaoshi; D'Addabbo, Pietro; Archidiacono, Nicoletta; Rocchi, Mariano; Eichler, Evan E; Ventura, Mario

2008-01-01

Chromosomal rearrangements, such as translocations and inversions, are recurrent phenomena during evolution, and both of them are involved in reproductive isolation and speciation. To better understand the molecular basis of chromosome rearrangements and their part in karyotype evolution, we have investigated the history of human chromosome 17 by comparative fluorescence in situ hybridization (FISH) and sequence analysis. Human bacterial artificial chromosome/p1 artificial chromosome probes spanning the length of chromosome 17 were used in FISH experiments on great apes, Old World monkeys and New World monkeys to study the evolutionary history of this chromosome. We observed that the macaque marker order represents the ancestral organization. Human, chimpanzee and gorilla homologous chromosomes differ by a paracentric inversion that occurred specifically in the Homo sapiens/Pan troglodytes/Gorilla gorilla ancestor. Detailed analyses of the paracentric inversion revealed that the breakpoints mapped to two regions syntenic to human 17q12/21 and 17q23, both rich in segmental duplications. Sequence analyses of the human and macaque organization suggest that the duplication events occurred in the catarrhine ancestor with the duplication blocks continuing to duplicate or undergo gene conversion during evolution of the hominoid lineage. We propose that the presence of these duplicons has mediated the inversion in the H. sapiens/P. troglodytes/G. gorilla ancestor. Recently, the same duplication blocks have been shown to be polymorphic in the human population and to be involved in triggering microdeletion and duplication in human. These results further support a model where genomic architecture has a direct role in both rearrangement involved in karyotype evolution and genomic instability in human.

Advances in detection systems of gene and chromosome abnormalities

International Nuclear Information System (INIS)

Yatagai, Takeo

2002-01-01

This review is described from the aspect of radiation biology. For analysis at gene level, oxidative lesion of DNA like 7,8-dihydro-8-oxoguanine formation and its repair by DNA polymerase η etc in bacteria, yeast and mammalian cells are suggested to be a useful index of radiation mutation. Transgenic mice with E. coli and/or phage gene as a reporter can be a tool for gene analysis for specific organ mutation: data obtained by irradiation of X-ray, γ-ray and accelerated carbon beam to the mouse gpt delta are presented. For analysis from gene to chromosome levels, loss of heterozygosity of a specific gene is a key for analysis of chromosome aberration at the molecular level. Studies in yeast and mammalian cells are presented. The author also described data of gene mutation in TK6 cells irradiated by 2 Gy of X-ray and 10 cGy of carbon beam (135 MeV/u) generated by ring-cycrotron. Human-hamster hybrid cell is an alternative tool. Concerning significance at the individual level, the author quoted studies of irradiation of parent mice resulting in increased incidence of somatic cell mutation and of cancer in offspring. Future systems for gene mutation will be a use of transgenic mice or of markers like a specific cancer. (K.H.)

Striatal Distribution and Cytoarchitecture of Dopamine Receptor Subtype 1 and 2: Evidence from Double-Labeling Transgenic Mice

Directory of Open Access Journals (Sweden)

Keke Ren

2017-08-01

Full Text Available As the main input nucleus of the basal ganglion, the striatum executes different functions, including motivation, reward and attention. The functions of the striatum highly rely on its subregions that receive projections from various cortical areas and the distribution of striatonigral neurons that express D1 dopamine (DA receptors (or D1 medium-sized spiny neurons, D1 MSNs and striatopallidal neurons that express D2 DA receptors (or D2 MSNs. Using bacterial artificial chromosome (BAC transgenic mice, several studies have recently been performed on the spatial distribution of D1 and D2 MSNs. However, these studies mainly focused on enumeration of either D1-enhanced fluorescent protein (eGFP or D2-eGFP in mice. In the present work, we used Drd1a-tdTamato and Drd2-eGFP double BAC transgenic mice to evaluate the spatial pattern of D1 MSNs (red fluorescence and D2 MSNs (green fluorescence along the rostro-caudal axis of the dorsal striatum. The dorsal striatum was divided into three subregions: rostral caudoputamen (CPr, intermediate CP (CPi, and caudal CP (CPc across the rostral–caudal extent of the striatum. The results demonstrate that D1 and D2 MSNs were intermingled with each other in most of these regions. The cell density of D1 MSNs was slightly higher than D2 MSNs through CPr, CPi, and CPc, though it did not reach significance. However, in CPi, the ratio of D1/D2 in the ventromedial CPi group was significantly higher than those in dorsolateral, dorsomedial, and ventrolateral CPi. There was similar proportion of cells that co-expressed D1 and D2 receptors. Moreover, we demonstrated a pathway-specific activation pattern of D1 MSNs and D2 MSNs in a manic like mouse model induced by D-Amphetamine by utilizing this double transgenic mice and c-fos immunoreactivity. Our results may provide a morphological basis for the function or pathophysiology of striatonigral and striatopallidal neurons with diverse cortical inputs to the dorsal striatum.

Comparison of the chromosome maps around a resistance hot spot on chromosome 5 of potato and tomato using BAC-FISH painting.

Science.gov (United States)

Achenbach, Ute C; Tang, Xiaomin; Ballvora, Agim; de Jong, Hans; Gebhardt, Christiane

2010-02-01

Potato chromosome 5 harbours numerous genes for important qualitative and quantitative traits, such as resistance to the root cyst nematode Globodera pallida and the late blight fungus, Phytophthora infestans. The genes make up part of a "hot spot" for resistances to various pathogens covering a genetic map length of 3 cM between markers GP21 and GP179. We established the physical size and position of this region on chromosome 5 in potato and tomato using fluorescence in situ hybridization (FISH) on pachytene chromosomes. Five potato bacterial artificial chromosome (BAC) clones with the genetically anchored markers GP21, R1-contig (proximal end), CosA, GP179, and StPto were selected, labeled with different fluorophores, and hybridized in a five-colour FISH experiment. Our results showed the location of the BAC clones in the middle of the long arm of chromosome 5 in both potato and tomato. Based on chromosome measurements, we estimate the physical size of the GP21-GP179 interval at 0.85 Mb and 1.2 Mb in potato and tomato, respectively. The GP21-GP179 interval is part of a genome segment known to have inverted map positions between potato and tomato.

Chromosome duplication in Lolium multiflorum Lam.

Directory of Open Access Journals (Sweden)

Roselaine Cristina Pereira

2014-11-01

Full Text Available Artificial chromosome duplication of diploid genotypes of Lolium multiflorum (2n=2x=14 is worthy to breeding, and aims to increase the expression of traits with agronomic interest. The purpose of this study was to obtain polyploid plants of L. multiflorum from local diploid populations in order to exploit adaptation and future verification of the effects of polyploidy in agronomic traits. Seedlings were immersed in different colchicine solutions for an exposure time of 3h and 24h. Ploidy determination was made by the DNA content and certified by chromosomes counts. The plants confirmed as tetraploids were placed in a greenhouse, and, at flowering, pollen viability was evaluated, and seeds were harvested to assess the stability of the progenies. The percentage of polyploids obtained was 20%. Pollen viability of the tetraploids generated ranged from 58% to 69%. The tetraploid plants obtained in the experiment generated 164 progenies, of which 109 presented DNA content compatible with the tetraploid level, showing stability of chromosome duplication in the filial generation.

A novel transgenic mouse model of lysosomal storage disorder.

Science.gov (United States)

Ortiz-Miranda, Sonia; Ji, Rui; Jurczyk, Agata; Aryee, Ken-Edwin; Mo, Shunyan; Fletcher, Terry; Shaffer, Scott A; Greiner, Dale L; Bortell, Rita; Gregg, Ronald G; Cheng, Alan; Hennings, Leah J; Rittenhouse, Ann R

2016-11-01

Knockout technology has proven useful for delineating functional roles of specific genes. Here we describe and provide an explanation for striking pathology that occurs in a subset of genetically engineered mice expressing a rat Ca V β2a transgene under control of the cardiac α-myosin heavy chain promoter. Lesions were limited to mice homozygous for transgene and independent of native Cacnb2 genomic copy number. Gross findings included an atrophied pancreas; decreased adipose tissue; thickened, orange intestines; and enlarged liver, spleen, and abdominal lymph nodes. Immune cell infiltration and cell engulfment by macrophages were associated with loss of pancreatic acinar cells. Foamy macrophages diffusely infiltrated the small intestine's lamina propria, while similar macrophage aggregates packed liver and splenic red pulp sinusoids. Periodic acid-Schiff-positive, diastase-resistant, iron-negative, Oil Red O-positive, and autofluorescent cytoplasm was indicative of a lipid storage disorder. Electron microscopic analysis revealed liver sinusoids distended by clusters of macrophages containing intracellular myelin "swirls" and hepatocytes with enlarged lysosomes. Additionally, build up of cholesterol, cholesterol esters, and triglycerides, along with changes in liver metabolic enzyme levels, were consistent with a lipid processing defect. Because of this complex pathology, we examined the transgene insertion site. Multiple transgene copies inserted into chromosome 19; at this same site, an approximate 180,000 base pair deletion occurred, ablating cholesterol 25-hydroxylase and partially deleting lysosomal acid lipase and CD95 Loss of gene function can account for the altered lipid processing, along with hypertrophy of the immune system, which define this phenotype, and serendipitously provides a novel mouse model of lysosomal storage disorder. Copyright © 2016 the American Physiological Society.

Overexpression of eIF-5A2 in mice causes accelerated organismal aging by increasing chromosome instability

Directory of Open Access Journals (Sweden)

Chen Leilei

2011-05-01

Full Text Available Abstract Background Amplification of 3q26 is one of the most frequent genetic alterations in many human malignancies. Recently, we isolated a novel oncogene eIF-5A2 within the 3q26 region. Functional study has demonstrated the oncogenic role of eIF-5A2 in the initiation and progression of human cancers. In the present study, we aim to investigate the physiological and pathological effect of eIF-5A2 in an eIF-5A2 transgenic mouse model. Methods An eIF-5A2 transgenic mouse model was generated using human eIF-5A2 cDNA. The eIF-5A2 transgenic mice were characterized by histological and immunohistochemistry analyses. The aging phenotypes were further characterized by wound healing, bone X-ray imaging and calcification analysis. Mouse embryo fibroblasts (MEF were isolated to further investigate molecular mechanism of eIF-5A2 in aging. Results Instead of resulting in spontaneous tumor formation, overexpression of eIF-5A2 accelerated the aging process in adult transgenic mice. This included decreased growth rate and body weight, shortened life span, kyphosis, osteoporosis, delay of wound healing and ossification. Investigation of the correlation between cellular senescence and aging showed that cellular senescence is not required for the aging phenotypes in eIF-5A2 mice. Interestingly, we found that activation of eIF-5A2 repressed p19 level and therefore destabilized p53 in transgenic mouse embryo fibroblast (MEF cells. This subsequently allowed for the accumulation of chromosomal instability, such as errors in cell dividing during metaphase and anaphase. Additionally, a significantly increase in number of aneuploidy cells (p Conclusion These observations suggest that eIF-5A2 mouse models could accelerate organismal aging by increasing chromosome instability.

Hyperactivity and learning deficits in transgenic mice bearing a human mutant thyroid hormone beta1 receptor gene.

Science.gov (United States)

McDonald, M P; Wong, R; Goldstein, G; Weintraub, B; Cheng, S Y; Crawley, J N

1998-01-01

Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor beta (TRbeta) gene on chromosome 3, representing a mutation of the ligand-binding domain of the TRbeta gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRbeta gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRbeta gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD.

Hyperactivity and Learning Deficits in Transgenic Mice Bearing a Human Mutant Thyroid Hormone β1 Receptor Gene

Science.gov (United States)

McDonald, Michael P.; Wong, Rosemary; Goldstein, Gregory; Weintraub, Bruce; Cheng, Sheue-yann; Crawley, Jacqueline N.

1998-01-01

Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor β (TRβ) gene on chromosome 3, representing a mutation of the ligandbinding domain of the TRβ gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRβ gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRβ gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD. PMID:10454355

Construction of an infectious clone of canine herpesvirus genome as a bacterial artificial chromosome.

Science.gov (United States)

Arii, Jun; Hushur, Orkash; Kato, Kentaro; Kawaguchi, Yasushi; Tohya, Yukinobu; Akashi, Hiroomi

2006-04-01

Canine herpesvirus (CHV) is an attractive candidate not only for use as a recombinant vaccine to protect dogs from a variety of canine pathogens but also as a viral vector for gene therapy in domestic animals. However, developments in this area have been impeded by the complicated techniques used for eukaryotic homologous recombination. To overcome these problems, we used bacterial artificial chromosomes (BACs) to generate infectious BACs. Our findings may be summarized as follows: (i) the CHV genome (pCHV/BAC), in which a BAC flanked by loxP sites was inserted into the thymidine kinase gene, was maintained in Escherichia coli; (ii) transfection of pCHV/BAC into A-72 cells resulted in the production of infectious virus; (iii) the BAC vector sequence was almost perfectly excisable from the genome of the reconstituted virus CHV/BAC by co-infection with CHV/BAC and a recombinant adenovirus that expressed the Cre recombinase; and (iv) a recombinant virus in which the glycoprotein C gene was deleted was generated by lambda recombination followed by Flp recombination, which resulted in a reduction in viral titer compared with that of the wild-type virus. The infectious clone pCHV/BAC is useful for the modification of the CHV genome using bacterial genetics, and CHV/BAC should have multiple applications in the rapid generation of genetically engineered CHV recombinants and the development of CHV vectors for vaccination and gene therapy in domestic animals.

Mushroom body miscellanea: transgenic Drosophila strains expressing anatomical and physiological sensor proteins in Kenyon cells

Science.gov (United States)

Pech, Ulrike; Dipt, Shubham; Barth, Jonas; Singh, Priyanka; Jauch, Mandy; Thum, Andreas S.; Fiala, André; Riemensperger, Thomas

2013-01-01

The fruit fly Drosophila melanogaster represents a key model organism for analyzing how neuronal circuits regulate behavior. The mushroom body in the central brain is a particularly prominent brain region that has been intensely studied in several insect species and been implicated in a variety of behaviors, e.g., associative learning, locomotor activity, and sleep. Drosophila melanogaster offers the advantage that transgenes can be easily expressed in neuronal subpopulations, e.g., in intrinsic mushroom body neurons (Kenyon cells). A number of transgenes has been described and engineered to visualize the anatomy of neurons, to monitor physiological parameters of neuronal activity, and to manipulate neuronal function artificially. To target the expression of these transgenes selectively to specific neurons several sophisticated bi- or even multipartite transcription systems have been invented. However, the number of transgenes that can be combined in the genome of an individual fly is limited in practice. To facilitate the analysis of the mushroom body we provide a compilation of transgenic fruit flies that express transgenes under direct control of the Kenyon-cell specific promoter, mb247. The transgenes expressed are fluorescence reporters to analyze neuroanatomical aspects of the mushroom body, proteins to restrict ectopic gene expression to mushroom bodies, or fluorescent sensors to monitor physiological parameters of neuronal activity of Kenyon cells. Some of the transgenic animals compiled here have been published already, whereas others are novel and characterized here for the first time. Overall, the collection of transgenic flies expressing sensor and reporter genes in Kenyon cells facilitates combinations with binary transcription systems and might, ultimately, advance the physiological analysis of mushroom body function. PMID:24065891

Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

Directory of Open Access Journals (Sweden)

Tina Schäfer

2012-01-01

Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

Meiotic transmission of an in vitro-assembled autonomous maize minichromosome.

Directory of Open Access Journals (Sweden)

Shawn R Carlson

2007-10-01

Full Text Available Autonomous chromosomes are generated in yeast (yeast artificial chromosomes and human fibrosarcoma cells (human artificial chromosomes by introducing purified DNA fragments that nucleate a kinetochore, replicate, and segregate to daughter cells. These autonomous minichromosomes are convenient for manipulating and delivering DNA segments containing multiple genes. In contrast, commercial production of transgenic crops relies on methods that integrate one or a few genes into host chromosomes; extensive screening to identify insertions with the desired expression level, copy number, structure, and genomic location; and long breeding programs to produce varieties that carry multiple transgenes. As a step toward improving transgenic crop production, we report the development of autonomous maize minichromosomes (MMCs. We constructed circular MMCs by combining DsRed and nptII marker genes with 7-190 kb of genomic maize DNA fragments containing satellites, retroelements, and/or other repeats commonly found in centromeres and using particle bombardment to deliver these constructs into embryogenic maize tissue. We selected transformed cells, regenerated plants, and propagated their progeny for multiple generations in the absence of selection. Fluorescent in situ hybridization and segregation analysis demonstrated that autonomous MMCs can be mitotically and meiotically maintained. The MMC described here showed meiotic segregation ratios approaching Mendelian inheritance: 93% transmission as a disome (100% expected, 39% transmission as a monosome crossed to wild type (50% expected, and 59% transmission in self crosses (75% expected. The fluorescent DsRed reporter gene on the MMC was expressed through four generations, and Southern blot analysis indicated the encoded genes were intact. This novel approach for plant transformation can facilitate crop biotechnology by (i combining several trait genes on a single DNA fragment, (ii arranging genes in a defined

Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: an alternative to Bt-toxin technology.

Science.gov (United States)

Agrawal, Aditi; Rajamani, Vijayalakshmi; Reddy, Vanga Siva; Mukherjee, Sunil Kumar; Bhatnagar, Raj K

2015-10-01

The success of Bt transgenics in controlling predation of crops has been tempered by sporadic emergence of resistance in targeted insect larvae. Such emerging threats have prompted the search for novel insecticidal molecules that are specific and could be expressed through plants. We have resorted to small RNA-based technology for an investigative search and focused our attention to an insect-specific miRNA that interferes with the insect molting process resulting in the death of the larvae. In this study, we report the designing of a vector that produces artificial microRNA (amiR), namely amiR-24, which targets the chitinase gene of Helicoverpa armigera. This vector was used as transgene in tobacco. Northern blot and real-time analysis revealed the high level expression of amiR-24 in transgenic tobacco plants. Larvae feeding on the transgenic plants ceased to molt further and eventually died. Our results demonstrate that transgenic tobacco plants can express amiR-24 insectice specific to H. armigera.

Neuropeptide Y receptor genes on human chromosome 4q31-q32 map to conserved linkage groups on mouse chromosomes 3 and 8

Energy Technology Data Exchange (ETDEWEB)

Lutz, C.M.; Frankel, W.N. [Jackson Lab., Bar Harbor, ME (United States); Richards, J.E. [Univ. of Michigan Medical School, Ann Arbor, MI (United States)] [and others

1997-05-01

Npy1r and Npy2r, the genes encoding mouse type 1 and type 2 neuropeptide Y receptors, have been mapped by interspecific backcross analysis. Previous studies have localized the human genes encoding these receptors to chromosome 4q31-q32. We have now assigned Npy1r and Npy2r to conserved linkage groups on mouse Chr 8 and Chr 3, respectively, which correspond to the distal region of human chromosome 4q. Using yeast artificial chromosomes, we have estimated the distance between the human genes to be approximately 6 cM. Although ancient tandem duplication events may account for some closely spaced G-protein-coupled receptor genes, the large genetic distance between the human type 1 and type 2 neuropeptide Y receptor genes raises questions about whether this mechanism accounts for their proximity. 20 refs., 1 fig.

Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.

Science.gov (United States)

Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M

1997-10-01

We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.

Chromosome microdissection and cloning in human genome and genetic disease analysis

International Nuclear Information System (INIS)

Kao, Faten; Yu, Jingwei

1991-01-01

A procedure has been described for microdissection and microcloning of human chromosomal DNA sequences in which universal amplification of the dissected fragments by Mbo I linker adaptor and polymerase chain reaction is used. A very large library comprising 700,000 recombinant plasmid microclones from 30 dissected chromosomes of human chromosome 21 was constructed. Colony hybridization showed that 42% of the clones contained repetitive sequences and 58% contained single or low-copy sequences. The insert sizes generated by complete Mbo I cleavage ranged from 50 to 1,100 base pairs with a mean of 416 base pairs. Southern blot analysis of microclones from the library confirmed their human origin and chromosome 21 specificity. Some of these clones have also been regionally mapped to specific sites of chromosome 21 by using a regional mapping panel of cell hybrids. This chromosome microtechnology can generate large numbers of microclones with unique sequences from defined chromosomal regions and can be used for processes such as (i) isolating corresponding yeast artificial chromosome clones with large inserts, (ii) screening various cDNA libraries for isolating expressed sequences, and (iii) constructing region-specific libraries of the entire human genome. The studies described here demonstrate the power of this technology for high-resolution genome analysis and explicate their use in an efficient search for disease-associated genes localized to specific chromosomal regions

Fed-batch bioreactor performance and cell line stability evaluation of the artificial chromosome expression technology expressing an IgG1 in Chinese hamster ovary cells.

Science.gov (United States)

Combs, Rodney G; Yu, Erwin; Roe, Susanna; Piatchek, Michele Bailey; Jones, Heather L; Mott, John; Kennard, Malcolm L; Goosney, Danika L; Monteith, Diane

2011-01-01

The artificial chromosome expression (ACE) technology system uses an engineered artificial chromosome containing multiple site-specific recombination acceptor sites for the rapid and efficient construction of stable cell lines. The construction of Chinese hamster ovary(CHO) cell lines expressing an IgG1 monoclonal antibody (MAb) using the ACE system has been previously described (Kennard et al., Biotechnol Bioeng. 2009;104:540-553). To further demonstrate the manufacturing feasibility of the ACE system, four CHO cell lines expressing the human IgG1 MAb 4A1 were evaluated in batch and fed-batch shake flasks and in a 2-L fed-batch bioreactor. The batch shake flasks achieved titers between 0.7 and 1.1 g/L, whereas the fed-batch shake flask process improved titers to 2.5–3.0 g/L. The lead 4A1 ACE cell line achieved titers of 4.0 g/L with an average specific productivity of 40 pg/(cell day) when cultured in a non optimized 2-L fed-batch bioreactor using a completely chemically defined process. Generational stability characterization of the lead 4A1-expressing cell line demonstrated that the cell line was stable for up to 75 days in culture. Product quality attributes of the 4A1 MAb produced by the ACE system during the stability evaluation period were unchanged and also comparable to existing expression technologies such as the CHO-dhfr system. The results of this evaluation demonstrate that a clonal, stable MAb-expressing CHO cell line can be produced using ACE technology that performs competitively using a chemically defined fed-batch bioreactor process with comparable product quality attributes to cell lines generated by existing technologies.

Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

Directory of Open Access Journals (Sweden)

Xiuling Cao

Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

Localization of the homolog of a mouse craniofacial mutant to human chromosome 18q11 and evaluation of linkage to human CLP and CPO

Energy Technology Data Exchange (ETDEWEB)

Griffith, A.J.; Burgess, D.L.; Kohrman, D.C.; Yu, J. [Univ. of Michigan, Ann Arbor, MI (United States)] [and others

1996-06-15

The transgene-induced mutation 9257 and the spontaneous mutation twirler cause craniofacial and inner ear malformations and are located on mouse chromosome 18 near the ataxia locus ax. To map the human homolog of 9257, a probe from the transgene insertion site was used to screen a human genomic library. Analysis of a cross-hybridizing human clone identified a 3-kb conserved sequence block that does not appear to contain protein coding sequence. Analysis of somatic cell hybrid panels assigned the human locus to 18q11. The polymorphic microsatellite markers D18S1001 and D18S1002 were isolated from the human locus and mapped by linkage analysis using the CEPH pedigrees. The 9257 locus maps close to the centromeres of human chromosome 18q and mouse chromosome 18 at the proximal end of a conserved linkage group. To evaluate the role of this locus in human craniofacial disorders, linkage to D18S1002 was tested in 11 families with autosomal dominant nonsyndromic cleft lip and palate and 3 families with autosomal dominant cleft palate only. Obligatory recombinants were observed in 8 of the families, and negative lod scores from the other families indicated that these disorders are not linked to the chromosome 18 loci. 23 refs., 4 figs., 2 tabs.

Maize histone H2B-mCherry: a new fluorescent chromatin marker for somatic and meiotic chromosome research.

Science.gov (United States)

Howe, Elizabeth S; Clemente, Thomas E; Bass, Hank W

2012-06-01

Cytological studies of fluorescent proteins are rapidly yielding insights into chromatin structure and dynamics. Here we describe the production and cytological characterization of new transgenic maize lines expressing a fluorescent histone fusion protein, H2B-mCherry. The transgene is expressed under the control of the maize ubiquitin1 promoter, including its first exon and intron. Polymerase chain reaction-based genotyping and root-tip microscopy showed that most of the lines carrying the transgene also expressed it, producing bright uniform staining of nuclei. Further, plants showing expression in root tips at the seedling stage also showed expression during meiosis, late in the life cycle. Detailed high-resolution three-dimensional imaging of cells and nuclei from various somatic and meiotic cell types showed that H2B-mCherry produced remarkably clear images of chromatin and chromosome fiber morphology, as seen in somatic, male meiotic prophase, and early microgametophyte cells. H2B-mCherry also yielded distinct nucleolus staining and was shown to be compatible with fluorescence in situ hybridization. We found several instances where H2B-mCherry was superior to DAPI as a generalized chromatin stain. Our study establishes these histone H2B-mCherry lines as new biological reagents for visualizing chromatin structure, chromosome morphology, and nuclear dynamics in fixed and living cells in a model plant genetic system.

Genome scan identifies a locus affecting gamma-globin expression in human beta-cluster YAC transgenic mice

Energy Technology Data Exchange (ETDEWEB)

Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.

2000-03-01

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.

Pathogenicity of a Very Virulent Strain of Marek's Disease Herpesvirus Cloned as Infectious Bacterial Artificial Chromosomes

Directory of Open Access Journals (Sweden)

Lorraine P. Smith

2011-01-01

Full Text Available Bacterial artificial chromosome (BAC vectors containing the full-length genomes of several herpesviruses have been used widely as tools to enable functional studies of viral genes. Marek's disease viruses (MDVs are highly oncogenic alphaherpesviruses that induce rapid-onset T-cell lymphomas in chickens. Oncogenic strains of MDV reconstituted from BAC clones have been used to examine the role of viral genes in inducing tumours. Past studies have demonstrated continuous increase in virulence of MDV strains. We have previously reported on the UK isolate C12/130 that showed increased virulence features including lymphoid organ atrophy and enhanced tropism for the central nervous system. Here we report the construction of the BAC clones (pC12/130 of this strain. Chickens were infected with viruses reconstituted from the pC12/130 clones along with the wild-type virus for the comparison of the pathogenic properties. Our studies show that BAC-derived viruses induced disease similar to the wild-type virus, though there were differences in the levels of pathogenicity between individual viruses. Generation of BAC clones that differ in the potential to induce cytolytic disease provide the opportunity to identify the molecular determinants of increased virulence by direct sequence analysis as well as by using reverse genetics approaches on the infectious BAC clones.

Yeast artificial chromosome cloning in the glycerol kinase and adrenal hypoplasia congenita region of Xp21

Energy Technology Data Exchange (ETDEWEB)

Worley, K.C.; Ellison, K.A.; Zhang, Y.H.; Wang, D.F.; Mason, J.; Roth, E.J.; Adams, V.; Fogt, D.D.; Zhu, X.M.; Towbin, J.A. [Baylor College of Medicine, Houston, TX (United States)] [and others

1993-05-01

The adrenal hypoplasia congenita (AHC) and glycerol kinase (GK) loci are telomeric to the Duchenne muscular dystrophy locus in Xp21. The authors developed a pair of yeast artificial chromosome (YAC) contigs spanning at least 1.2 Mb and encompassing the region from the telomeric end of the Duchenne muscular dystrophy (DMD) locus to beyond YHX39 (DXS727), including the genes for AHC and GK. The centromeric contig consists of 13 YACs reaching more than 600 kb from DMD through GK. The telomeric contig group consists of 8 YACs containing more than 600 kb including the markers YHX39 (DXS727) and QST-59 (DXS319). Patient deletion breakpoints in the region of the two YAC contigs define at least eight intervals, and seven deletion breakpoints are contained within these contigs. In addition to the probes developed from YAC ends, they have mapped eight Alu-PCR probes amplified from a radiation-reduced somatic cell hybrid, two anonymous DNA probes, and one Alu-PCR product amplified from a cosmid end, for a total of 26 new markers within this region of 2 Mb or less. One YAC in the centromeric contig contains an insert encompassing the minimum interval for GK deficiency defined by patient deletion breakpoints, and this clone includes all or part of the GK gene. 33 refs., 3 figs., 5 tabs.

Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

Directory of Open Access Journals (Sweden)

Hongmei Wang

Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

[TSA improve transgenic porcine cloned embryo development and transgene expression].

Science.gov (United States)

Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

2011-07-01

Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

Development of a multiple-gene-loading method by combining multi-integration system-equipped mouse artificial chromosome vector and CRISPR-Cas9.

Directory of Open Access Journals (Sweden)

Kazuhisa Honma

Full Text Available Mouse artificial chromosome (MAC vectors have several advantages as gene delivery vectors, such as stable and independent maintenance in host cells without integration, transferability from donor cells to recipient cells via microcell-mediated chromosome transfer (MMCT, and the potential for loading a megabase-sized DNA fragment. Previously, a MAC containing a multi-integrase platform (MI-MAC was developed to facilitate the transfer of multiple genes into desired cells. Although the MI system can theoretically hold five gene-loading vectors (GLVs, there are a limited number of drugs available for the selection of multiple-GLV integration. To overcome this issue, we attempted to knock out and reuse drug resistance genes (DRGs using the CRISPR-Cas9 system. In this study, we developed new methods for multiple-GLV integration. As a proof of concept, we introduced five GLVs in the MI-MAC by these methods, in which each GLV contained a gene encoding a fluorescent or luminescent protein (EGFP, mCherry, BFP, Eluc, and Cluc. Genes of interest (GOI on the MI-MAC were expressed stably and functionally without silencing in the host cells. Furthermore, the MI-MAC carrying five GLVs was transferred to other cells by MMCT, and the resultant recipient cells exhibited all five fluorescence/luminescence signals. Thus, the MI-MAC was successfully used as a multiple-GLV integration vector using the CRISPR-Cas9 system. The MI-MAC employing these methods may resolve bottlenecks in developing multiple-gene humanized models, multiple-gene monitoring models, disease models, reprogramming, and inducible gene expression systems.

Use of the viral 2A peptide for bicistronic expression in transgenic mice

Directory of Open Access Journals (Sweden)

Trichas Georgios

2008-09-01

that the transgene has integrated into the X chromosome in this line. Conclusion The 2A peptide efficiently mediates co-translational cleavage in transgenic mice in which it has been inherited through the germ-line. Mice expressing it ubiquitously throughout development and into adulthood appear normal. It is therefore a viable tool for use in genetically engineered mice and represents a superior alternative to the widely used internal ribosomal entry site.

Adaptive radiation in the Hawaiian silversword alliance (Compositae-Madiinae). II. Cytogenetics of artificial and natural hybrids

International Nuclear Information System (INIS)

Carr, G.D.; Kyhos, D.W.

1986-01-01

The Hawaiian silversword alliance of Argyroxiphium, Dubautia, and Wilkesia, in spite of exhibiting spectacular morphological, ecological, physiological, and chromosomal diversity, is remarkably cohesive, genetically. This is attested to by the ease of production of artificial hybrids and by the high frequency of spontaneous hybridization among such life forms as mat-forming subshrub, monocarpic rosette shrub, polycarpic shrub, cushion plant, tree, and vine. Even the least fertile of these hybrids is capable of producing backcross progeny. Moreover, first generation interspecific and intergeneric hybrids have been successfully used to produce trispecific hybrids in a number of instances. In general, the widest hybrid combinations have been as readily produced as crosses within a species. At present eight genomes or chromosome races distinguished by reciprocal translocations are recognized on the basis of meiotic analysis of artificial and spontaneous hybrids. Seven of these races are found among those species with 14 pairs of chromosomes. The eighth genome very likely characterizes all nine species of this alliance that have 13 pairs of chromosomes. The cytogenetic data indicate that redundancy of translocations involving the same chromosomes has been a recurrent theme in the chromosomal differentiation of these taxa. There appears to be little, if any, correlation between chromosomal evolution and adaptive radiation as assessed by gross habital differentiation in this group. However, within Dubautia, a novel ecophysiological trait associated with colonization of xeric habitats is restricted to species with n = 13. In contrast to the bulk of the Hawaiian flora, which is characterized by self-compatibility and chromosomal stability, it is suggested that the occurrence of self-incompatibility in the Hawaiian Madiinae may have favored selection of supergenes via chromosomal repatterning, and this may account for the diversity of chromosome structure seen in this group

Rapid characterization of transgenic and non-transgenic soybean oils by chemometric methods using NIR spectroscopy

Science.gov (United States)

Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard

Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.

High-resolution physical map for chromosome 16q12.1-q13, the Blau syndrome locus

Directory of Open Access Journals (Sweden)

Bonavita Gina

2002-08-01

Full Text Available Abstract Background The Blau syndrome (MIM 186580, an autosomal dominant granulomatous disease, was previously mapped to chromosome 16p12-q21. However, inconsistent physical maps of the region and consequently an unknown order of microsatellite markers, hampered us from further refining the genetic locus for the Blau syndrome. To address this problem, we constructed our own high-resolution physical map for the Blau susceptibility region. Results We generated a high-resolution physical map that provides more than 90% coverage of a refined Blau susceptibility region. The map consists of four contigs of sequence tagged site-based bacterial artificial chromosomes with a total of 124 bacterial artificial chromosomes, and spans approximately 7.5 Mbp; however, three gaps still exist in this map with sizes of 425, 530 and 375 kbp, respectively, estimated from radiation hybrid mapping. Conclusions Our high-resolution map will assist genetic studies of loci in the interval from D16S3080, near D16S409, and D16S408 (16q12.1 to 16q13.

Chromosome Doubling of Microspore-Derived Plants from Cabbage (Brassica oleracea var. capitata L.) and Broccoli (Brassica oleracea var. italica L.).

Science.gov (United States)

Yuan, Suxia; Su, Yanbin; Liu, Yumei; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian

2015-01-01

Chromosome doubling of microspore-derived plants is an important factor in the practical application of microspore culture technology because breeding programs require a large number of genetically stable, homozygous doubled haploid plants with a high level of fertility. In the present paper, 29 populations of microspore-derived plantlets from cabbage (Brassica oleracea var. capitata) and broccoli (Brassica oleracea var. italica) were used to study the ploidy level and spontaneous chromosome doubling of these populations, the artificial chromosome doubling induced by colchicine, and the influence of tissue culture duration on the chromosomal ploidy of the microspore-derived regenerants. Spontaneous chromosome doubling occurred randomly and was genotype dependent. In the plant populations derived from microspores, there were haploids, diploids, and even a low frequency of polyploids and mixed-ploidy plantlets. The total spontaneous doubling in the 14 cabbage populations ranged from 0 to 76.9%, compared with 52.2 to 100% in the 15 broccoli populations. To improve the rate of chromosome doubling, an efficient and reliable artificial chromosome doubling protocol (i.e., the immersion of haploid plantlet roots in a colchicine solution) was developed for cabbage and broccoli microspore-derived haploids. The optimal chromosome doubling of the haploids was obtained with a solution of 0.2% colchicine for 9-12 h or 0.4% colchicine for 3-9 h for cabbage and 0.05% colchicine for 6-12 h for broccoli. This protocol produced chromosome doubling in over 50% of the haploid genotypes for most of the populations derived from cabbage and broccoli. Notably, after 1 or more years in tissue culture, the chromosomes of the haploids were doubled, and most of the haploids turned into doubled haploid or mixed-ploidy plants. This is the first report indicating that tissue culture duration can change the chromosomal ploidy of microspore-derived regenerants.

Transgenic mice with increased Cu/Zn-superoxide dismutase activity: animal model of dosage effects in Down syndrome

International Nuclear Information System (INIS)

Epstein, C.J.; Avraham, K.B.; Lovett, M.; Smith, S.; Elroy-Stein, O.; Rotman, G.; Bry, C.; Groner, Y.

1987-01-01

Down syndrome, the phenotypic expression of human trisomy 21, is presumed to result from a 1.5-fold increase in the expression of the genes on human chromosome 21. As an approach to the development of an animal model for Down syndrome, several strains of transgenic mice that carry the human Cu/Zn-superoxide dismutase gene have been prepared. The animals express the transgene in a manner similar to that of humans, with 0.9- and 0.7-kilobase transcripts in a 1:4 ratio, and synthesize the human enzyme in an active form capable of forming human-mouse enzyme heterodimers. Cu/Zn-superoxide dismutase activity is increased from 1.6- to 6.0-fold in the brains of four transgenic strains and to an equal or lesser extent in several other tissues. These animals provide a unique system for studying the consequences of increased dosage of the Cu/Zn-superoxide dismutase gene in Down syndrome and the role of this enzyme in a variety of other pathological processes

Physical Mapping of Bread Wheat Chromosome 5A: An Integrated Approach

Directory of Open Access Journals (Sweden)

Delfina Barabaschi

2015-11-01

Full Text Available The huge size, redundancy, and highly repetitive nature of the bread wheat [ (L.] genome, makes it among the most difficult species to be sequenced. To overcome these limitations, a strategy based on the separation of individual chromosomes or chromosome arms and the subsequent production of physical maps was established within the frame of the International Wheat Genome Sequence Consortium (IWGSC. A total of 95,812 bacterial artificial chromosome (BAC clones of short-arm chromosome 5A (5AS and long-arm chromosome 5A (5AL arm-specific BAC libraries were fingerprinted and assembled into contigs by complementary analytical approaches based on the FingerPrinted Contig (FPC and Linear Topological Contig (LTC tools. Combined anchoring approaches based on polymerase chain reaction (PCR marker screening, microarray, and sequence homology searches applied to several genomic tools (i.e., genetic maps, deletion bin map, neighbor maps, BAC end sequences (BESs, genome zipper, and chromosome survey sequences allowed the development of a high-quality physical map with an anchored physical coverage of 75% for 5AS and 53% for 5AL with high portions (64 and 48%, respectively of contigs ordered along the chromosome. In the genome of grasses, [ (L. Beauv.], rice ( L., and sorghum [ (L. Moench] homologs of genes on wheat chromosome 5A were separated into syntenic blocks on different chromosomes as a result of translocations and inversions during evolution. The physical map presented represents an essential resource for fine genetic mapping and map-based cloning of agronomically relevant traits and a reference for the 5A sequencing projects.

Evaluation of an automated karyotyping system for chromosome aberration analysis

International Nuclear Information System (INIS)

Prichard, H.M.

1987-01-01

Chromosome aberration analysis is a promising complement to conventional radiation dosimetry, particularly in the complex radiation fields encountered in the space environment. The capabilities of a recently developed automated karyotyping system were evaluated both to determine current capabilities and limitations and to suggest areas where future development should be emphasized. Cells exposed to radiometric chemicals and to photon and particulate radiation were evaluated by manual inspection and by automated karyotyping. It was demonstrated that the evaluated programs were appropriate for image digitization, storage, and transmission. However, automated and semi-automated scoring techniques must be advanced significantly if in-flight chromosome aberration analysis is to be practical. A degree of artificial intelligence may be necessary to realize this goal

Preimplantation diagnosis of repeated miscarriage due to chromosomal translocations using metaphase chromosomes of a blastomere biopsied from 4- to 6-cell-stage embryos.

Science.gov (United States)

Tanaka, Atsushi; Nagayoshi, Motoi; Awata, Shoichiro; Mawatari, Yoshifumi; Tanaka, Izumi; Kusunoki, Hiroshi

2004-01-01

To evaluate the safety and accuracy of karyotyping the blastomere chromosomes at metaphase in the natural cell cycle for preimplantation diagnosis. A pilot study. A private infertility clinic and a university laboratory. Eleven patients undergoing IVF and preimplantation diagnosis. Intact human embryos at the 4- to 6-cell stage and human-mouse heterokaryons were cultured and checked hourly for disappearance of the nuclear envelope. After it disappeared, the metaphase chromosomes were analyzed by fluorescence in situ hybridization. Percentage of analyzable metaphase plates and safety and accuracy of the method. The success rate of electrofusion to form human-mouse heterokaryons was 87.1% (27/31), and analyzable chromosomes were obtained from 77.4% (24/31) of the heterokaryons. On the other hand, disappearance of the nuclear envelope occurred in 89.5% (17/19) of the human embryos and it began earlier than that in the heterokaryons. Analyzable chromosomes were obtained and their translocation sites were identified in all blastomeres biopsied from the 17 embryos. After the biopsy, 67.0% of the embryos could develop to the blastocyst stage. The natural cell cycle method reported herein requires frequent observation, but it is safe, with no artificial effects on the chromosomes and without loss of or damage to blastomeres, which occurred with the electrofusion method. Using the natural cell cycle method, we could perform preimplantation diagnosis with nearly 100% accuracy.

Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

Directory of Open Access Journals (Sweden)

Vinciane Régnier

Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

Science.gov (United States)

Régnier, Vinciane; Billard, Jean-Marie; Gupta, Sapna; Potier, Brigitte; Woerner, Stéphanie; Paly, Evelyne; Ledru, Aurélie; David, Sabrina; Luilier, Sabrina; Bizot, Jean-Charles; Vacano, Guido; Kraus, Jan P; Patterson, David; Kruger, Warren D; Delabar, Jean M; London, Jaqueline

2012-01-01

The cystathionine β-synthase (CBS) gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS) cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA) metabolism, a pathway important for several brain physiological processes. Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1) expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line. We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

Transfer of an expression YAC into goat fetal fibroblasts by cell fusion for mammary gland bioreactor

International Nuclear Information System (INIS)

Zhang Xufeng; Wu Guoxiang; Chen, Jian-Quan; Zhang Aimin; Liu Siguo; Jiao Binghua; Cheng Guoxiang

2005-01-01

Yeast artificial chromosomes (YACs) as transgenes in transgenic animals are likely to ensure optimal expression levels. Microinjection of YACs is the exclusive technique used to produce YACs transgenic livestock so far. However, low efficiency and high cost are its critical restrictive factors. In this study, we presented a novel procedure to produce YACs transgenic livestock as mammary gland bioreactor. A targeting vector, containing the gene of interest-a human serum albumin minigene (intron 1, 2), yeast selectable marker (G418R), and mammalian cell resistance marker (neo r ), replaced the α-lactalbumin gene in a 210 kb human α-lactalbumin YAC by homogeneous recombination in yeasts. The chimeric YAC was introduced into goat fetal fibroblasts using polyethylene glycol-mediated spheroplast fusion. PCR and Southern analysis showed that intact YAC was integrated in the genome of resistant cells. Perhaps, it may offer a cell-based route by nuclear transfer to produce YACs transgenic livestock

Transgenic Drosophila simulans strains prove the identity of the speciation gene Lethal hybrid rescue.

Science.gov (United States)

Prigent, Stéphane R; Matsubayashi, Hiroshi; Yamamoto, Masa-Toshi

2009-10-01

Speciation genes are responsible for genetic incompatibilities in hybrids of incipient species and therefore participate in reproductive isolation leading to complete speciation. Hybrid males between Drosophila melanogaster females and D. simulans males die at late larval or prepupal stages due to a failure in chromosome condensation during mitosis. However a mutant male of D. simulans, named Lethal hybrid rescue (Lhr), produces viable hybrid males when crossed to females of D. melanogaster. Recently the Lhr gene has been proposed as corresponding to the CG18468 gene in D. melanogaster. However this identification relied on sequence characteristics more than on a precise mapping and the use of the GAL4/UAS system to drive the transgene in D. melanogaster might have increased the complexity of interaction. Thus here we propose an independent identification of the Lhr gene based on a more precise mapping and transgenic experiments in D. simulans. We have mapped the Lhr gene by using Single Nucleotide Polymorphisms (SNPs) and identified within the candidate region the gene homologous to CG18468 as the Lhr gene as it was previously reported. Transgenic experiments in D. simulans with the native promoter of CG18468 prove that it is the Lhr gene of D. simulans by inducing the lethality of the hybrid males.

A chromosome conformation capture ordered sequence of the barley genome

Czech Academy of Sciences Publication Activity Database

Mascher, M.; Gundlach, H.; Himmelbach, A.; Beier, S.; Twardziok, S. O.; Wicker, T.; Šimková, Hana; Staňková, Helena; Vrána, Jan; Chan, S.; Munoz-Amatrian, M.; Houben, A.; Doležel, Jaroslav; Ayling, S.; Lonardi, S.; Mayer, K.F.X.; Zhang, G.; Braumann, I.; Spannagl, M.; Li, C.; Waugh, R.; Stein, N.

2017-01-01

Roč. 544, č. 7651 (2017), s. 427-433 ISSN 0028-0836 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : bacterial artificial chromosomes * inverted-repeat elements * complex-plant genomes * hi-c * environmental adaptation * ltr retrotransposons * structural variation * maize genome * software * database Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 40.137, year: 2016

A Fine Physical Map of the Rice Chromosome 4

Science.gov (United States)

Zhao, Qiang; Zhang, Yu; Cheng, Zhukuan; Chen, Mingsheng; Wang, Shengyue; Feng, Qi; Huang, Yucheng; Li, Ying; Tang, Yesheng; Zhou, Bo; Chen, Zhehua; Yu, Shuliang; Zhu, Jingjie; Hu, Xin; Mu, Jie; Ying, Kai; Hao, Pei; Zhang, Lei; Lu, Yiqi; Zhang, Lei S.; Liu, Yilei; Yu, Zhen; Fan, Danlin; Weng, Qijun; Chen, Ling; Lu, Tingting; Liu, Xiaohui; Jia, Peixin; Sun, Tongguo; Wu, Yongrui; Zhang, Yujun; Lu, Ying; Li, Can; Wang, Rong; Lei, Haiyan; Li, Tao; Hu, Hao; Wu, Mei; Zhang, Runquan; Guan, Jianping; Zhu, Jia; Fu, Gang; Gu, Minghong; Hong, Guofan; Xue, Yongbiao; Wing, Rod; Jiang, Jiming; Han, Bin

2002-01-01

As part of an international effort to completely sequence the rice genome, we have produced a fine bacterial artificial chromosome (BAC)-based physical map of the Oryza sativa japonica Nipponbare chromosome 4 through an integration of 114 sequenced BAC clones from a taxonomically related subspecies O. sativa indica Guangluai 4 and 182 RFLP and 407 expressed sequence tag (EST) markers with the fingerprinted data of the Nipponbare genome. The map consists of 11 contigs with a total length of 34.5 Mb covering 94% of the estimated chromosome size (36.8 Mb). BAC clones corresponding to telomeres, as well as to the centromere position, were determined by BAC-pachytene chromosome fluorescence in situ hybridization (FISH). This gave rise to an estimated length ratio of 5.13 for the long arm and 2.9 for the short arm (on the basis of the physical map), which indicates that the short arm is a highly condensed one. The FISH analysis and physical mapping also showed that the short arm and the pericentromeric region of the long arm are rich in heterochromatin, which occupied 45% of the chromosome, indicating that this chromosome is likely very difficult to sequence. To our knowledge, this map provides the first example of a rapid and reliable physical mapping on the basis of the integration of the data from two taxonomically related subspecies. [The following individuals and institutions kindly provided reagents, samples, or unpublished information as indicated in the paper: S. McCouch, T. Sasaki, and Monsanto.] PMID:11997348

The artificial gene Jazz, a transcriptional regulator of utrophin, corrects the dystrophic pathology in mdx mice.

Science.gov (United States)

Di Certo, Maria Grazia; Corbi, Nicoletta; Strimpakos, Georgios; Onori, Annalisa; Luvisetto, Siro; Severini, Cinzia; Guglielmotti, Angelo; Batassa, Enrico Maria; Pisani, Cinzia; Floridi, Aristide; Benassi, Barbara; Fanciulli, Maurizio; Magrelli, Armando; Mattei, Elisabetta; Passananti, Claudio

2010-03-01

The absence of the cytoskeletal protein dystrophin results in Duchenne muscular dystrophy (DMD). The utrophin protein is the best candidate for dystrophin replacement in DMD patients. To obtain therapeutic levels of utrophin expression in dystrophic muscle, we developed an alternative strategy based on the use of artificial zinc finger transcription factors (ZF ATFs). The ZF ATF 'Jazz' was recently engineered and tested in vivo by generating a transgenic mouse specifically expressing Jazz at the muscular level. To validate the ZF ATF technology for DMD treatment we generated a second mouse model by crossing Jazz-transgenic mice with dystrophin-deficient mdx mice. Here, we show that the artificial Jazz protein restores sarcolemmal integrity and prevents the development of the dystrophic disease in mdx mice. This exclusive animal model establishes the notion that utrophin-based therapy for DMD can be efficiently developed using ZF ATF technology and candidates Jazz as a novel therapeutic molecule for DMD therapy.

Structure, tissue distribution, and chromosomal localization of the prepronociceptin gene.

Science.gov (United States)

Mollereau, C; Simons, M J; Soularue, P; Liners, F; Vassart, G; Meunier, J C; Parmentier, M

1996-08-06

Nociceptin (orphanin FQ), the newly discovered natural agonist of opioid receptor-like (ORL1) receptor, is a neuropeptide that is endowed with pronociceptive activity in vivo. Nociceptin is derived from a larger precursor, prepronociceptin (PPNOC), whose human, mouse, and rat genes we have now isolated. The PPNOC gene is highly conserved in the three species and displays organizational features that are strikingly similar to those of the genes of preproenkephalin, preprodynorphin, and preproopiomelanocortin, the precursors to endogenous opioid peptides, suggesting the four genes belong to the same family-i.e., have a common evolutionary origin. The PPNOC gene encodes a single copy of nociceptin as well as of other peptides whose sequence is strictly conserved across murine and human species; hence it is likely to be neurophysiologically significant. Northern blot analysis shows that the PPNOC gene is predominantly transcribed in the central nervous system (brain and spinal cord) and, albeit weakly, in the ovary, the sole peripheral organ expressing the gene. By using a radiation hybrid cell line panel, the PPNOC gene was mapped to the short arm of human chromosome 8 (8p21), between sequence-tagged site markers WI-5833 and WI-1172, in close proximity of the locus encoding the neurofilament light chain NEFL. Analysis of yeast artificial chromosome clones belonging to the WC8.4 contig covering the 8p21 region did not allow to detect the presence of the gene on these yeast artificial chromosomes, suggesting a gap in the coverage within this contig.

Small RNAs were involved in homozygous state-associated silencing of a marker gene (Neomycin phosphotransferase II: nptII) in transgenic tomato plants.

Science.gov (United States)

Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli

2013-07-01

Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Generation of meiomaps of genome-wide recombination and chromosome segregation in human oocytes

DEFF Research Database (Denmark)

Ottolini, Christian S; Capalbo, Antonio; Newnham, Louise

2016-01-01

We have developed a protocol for the generation of genome-wide maps (meiomaps) of recombination and chromosome segregation for the three products of human female meiosis: the first and second polar bodies (PB1 and PB2) and the corresponding oocyte. PB1 is biopsied and the oocyte is artificially......-nucleotide polymorphisms (SNPs) genome-wide by microarray. Informative maternal heterozygous SNPs are phased using a haploid PB2 or oocyte as a reference. A simple algorithm is then used to identify the maternal haplotypes for each chromosome, in all of the products of meiosis for each oocyte. This allows mapping...

Transgenic algae engineered for higher performance

Science.gov (United States)

Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

2014-10-21

The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

The genome of cultivated sweet potato contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop.

Science.gov (United States)

Kyndt, Tina; Quispe, Dora; Zhai, Hong; Jarret, Robert; Ghislain, Marc; Liu, Qingchang; Gheysen, Godelieve; Kreuze, Jan F

2015-05-05

Agrobacterium rhizogenes and Agrobacterium tumefaciens are plant pathogenic bacteria capable of transferring DNA fragments [transfer DNA (T-DNA)] bearing functional genes into the host plant genome. This naturally occurring mechanism has been adapted by plant biotechnologists to develop genetically modified crops that today are grown on more than 10% of the world's arable land, although their use can result in considerable controversy. While assembling small interfering RNAs, or siRNAs, of sweet potato plants for metagenomic analysis, sequences homologous to T-DNA sequences from Agrobacterium spp. were discovered. Simple and quantitative PCR, Southern blotting, genome walking, and bacterial artificial chromosome library screening and sequencing unambiguously demonstrated that two different T-DNA regions (IbT-DNA1 and IbT-DNA2) are present in the cultivated sweet potato (Ipomoea batatas [L.] Lam.) genome and that these foreign genes are expressed at detectable levels in different tissues of the sweet potato plant. IbT-DNA1 was found to contain four open reading frames (ORFs) homologous to the tryptophan-2-monooxygenase (iaaM), indole-3-acetamide hydrolase (iaaH), C-protein (C-prot), and agrocinopine synthase (Acs) genes of Agrobacterium spp. IbT-DNA1 was detected in all 291 cultigens examined, but not in close wild relatives. IbT-DNA2 contained at least five ORFs with significant homology to the ORF14, ORF17n, rooting locus (Rol)B/RolC, ORF13, and ORF18/ORF17n genes of A. rhizogenes. IbT-DNA2 was detected in 45 of 217 genotypes that included both cultivated and wild species. Our finding, that sweet potato is naturally transgenic while being a widely and traditionally consumed food crop, could affect the current consumer distrust of the safety of transgenic food crops.

A highly efficient targeted recombination system for engineering linear chromosomes of industrial bacteria Streptomyces.

Science.gov (United States)

Pan, Hung-Yin; Chen, Carton W; Huang, Chih-Hung

2018-04-17

Soil bacteria Streptomyces are the most important producers of secondary metabolites, including most known antibiotics. These bacteria and their close relatives are unique in possessing linear chromosomes, which typically harbor 20 to 30 biosynthetic gene clusters of tens to hundreds of kb in length. Many Streptomyces chromosomes are accompanied by linear plasmids with sizes ranging from several to several hundred kb. The large linear plasmids also often contain biosynthetic gene clusters. We have developed a targeted recombination procedure for arm exchanges between a linear plasmid and a linear chromosome. A chromosomal segment inserted in an artificially constructed plasmid allows homologous recombination between the two replicons at the homology. Depending on the design, the recombination may result in two recombinant replicons or a single recombinant chromosome with the loss of the recombinant plasmid that lacks a replication origin. The efficiency of such targeted recombination ranges from 9 to 83% depending on the locations of the homology (and thus the size of the chromosomal arm exchanged), essentially eliminating the necessity of selection. The targeted recombination is useful for the efficient engineering of the Streptomyces genome for large-scale deletion, addition, and shuffling.

Ectopic expression of the agouti gene in transgenic mice causes obesity, features of type II diabetes, and yellow fur

Energy Technology Data Exchange (ETDEWEB)

Klebig, M.L.; Woychik, R.P. [Oak Ridge National Laboratory, Oak Ridge, TN (United States); Wilkinson, J.E. [Univ. of Tennessee, Knoxville, TN (United States); Geisler, J.G. [Oak Ridge National Laboratory, Oak Ridge, TN (United States)]|[Univ. of Tennessee, Knoxville, TN (United States)

1995-05-23

Mice that carry the lethal yellow (A{sup y}) or viable yellow (A{sup vy}) mutation, two dominant mutations of the agouti (a) gene in mouse chromosome 2, exhibit a phenotype that includes yellow fur, marked obesity, a form of type II diabetes associated with insulin resistance, and an increased susceptibility to tumor development. Molecular analyses of these and several other dominant {open_quotes}obese yellow{close_quotes} a-locus mutations suggested that ectopic expression of the normal agouti protein gives rise to this complex pleiotropic phenotype. We have now tested this hypothesis directly by generating transgenic mice that ectopically express an agouti cDNA clone encoding the normal agouti protein in all tissues examined. Transgenic mice of both sexes have yellow fur, become obese, and develop hyperinsulinemia. In addition, male transgenic mice develop hyperglycemia by 12-20 weeks of age. These results demonstrate conclusively that the ectopic agouti expression is responsible for most, if not all, of the phenotypic traits of the dominant, obese yellow mutants. 42 refs., 5 figs.

Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

OpenAIRE

Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

2011-01-01

In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

Construction and Identification of Bacterial Artificial Chromosome Library for 0-613-2R in Upland Cotton

Institute of Scientific and Technical Information of China (English)

无

2006-01-01

A bacterial artificial chromosome (BAC) library containing a large genomic DNA insert is an important tool for genome physical mapping, map-based cloning, and genome sequencing. To isolate genes via a map-based cloning strategy and to perform physical mapping of the cotton genome, a high-quality BAC library containing large cotton DNA inserts is needed. We have developed a BAC library of the restoring line 0-613-2R for isolating the fertility restorer (Rf1) gene and genomic research in cotton (Gossypium hirsutum L.). The BAC library contains 97 825 clones stored in 255 pieces of a 384-well microtiter plate. Random samples of BACs digested with the Notl enzyme indicated that the average insert size is approximately 130 kb, with a range of 80-275 kb,and 95.7% of the BAC clones in the library have an average insert size larger than 100 kb. Based on a cotton genome size of 2 250 Mb, library coverage is 5.7 x haploid genome equivalents. Four clones were selected randomly from the library to determine the stability of the BAC clones. There were no different fingerprints for 0 and 100 generations of each clone digested with Notl and Hindlll enzymes. Thus, the stability of a single BAC clone can be sustained at least for 100 generations. Eight simple sequence repeat (SSR) markers flanking the Rf1 gene were chosen to screen the BAC library by pool using PCR method and 25 positive clones were identified with 3.1 positive clones per SSR marker.

Technologies for Hemostasis and Stabilization of the Acute Traumatic Wound

Science.gov (United States)

2013-10-01

bacteriophage derived artificial chromosome (PAC) in Escherichia coli cells from Genome Systems, Inc. (St. Louis, MO). All three transgenes were...sequencer. N-terminal sequencing was performed by the University of Nebraska Medical Center’s Protein Structure Core Facility. The disappearance of...and N = 3 for the pdFI and rFI treatment groups. analysis indicated that the rates of disappearance of the γ-chain were similar for pdFI and rFI

Genome-Wide Analysis of a TaLEA-Introduced Transgenic Populus simonii × Populus nigra Dwarf Mutant

Directory of Open Access Journals (Sweden)

Jing Jiang

2012-03-01

Full Text Available A dwarf mutant (dwf1 was obtained among 15 transgenic lines, when TaLEA (Tamarix androssowii late embryogenesis abundant gene was introduced into Populus simonii × Populus nigra by Agrobacterium tumefaciens-mediated transformation. Under the same growth conditions, dwf1 height was significantly reduced compared with the wild type and the other transgenic lines. Because only one transgenic line (dwf1 displayed the dwarf phenotype, we considered that T-DNA insertion sites may play a role in the mutant formation. The mechanisms underlying this effect were investigated using TAIL-PCR (thermal asymmetric interlaced PCR and microarrays methods. According to the TAIL-PCR results, two flanking sequences located on chromosome IV and VIII respectively, were cloned. The results indicated the integration of two independent T-DNA copies. We searched for the potential genes near to the T-DNA insertions. The nearest gene was a putative poplar AP2 transcription factor (GI: 224073210. Expression analysis showed that AP2 was up-regulated in dwf1 compared with the wild type and the other transgenic lines. According to the microarrays results, a total of 537 genes involved in hydrolase, kinase and transcription factor activities, as well as protein and nucleotide binding, showed significant alterations in gene expression. These genes were expressed in more than 60 metabolic pathways, including starch, sucrose, galactose and glycerolipid metabolism and phenylpropanoids and flavonoid biosyntheses. Our transcriptome and T-DNA insertion sites analyses might provide some useful insights into the dwarf mutant formation.

Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

International Nuclear Information System (INIS)

Robab, U.E.; )

2014-01-01

The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

Construction and Analysis of Siberian Tiger Bacterial Artificial Chromosome Library with Approximately 6.5-Fold Genome Equivalent Coverage

Science.gov (United States)

Liu, Changqing; Bai, Chunyu; Guo, Yu; Liu, Dan; Lu, Taofeng; Li, Xiangchen; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

2014-01-01

Bacterial artificial chromosome (BAC) libraries are extremely valuable for the genome-wide genetic dissection of complex organisms. The Siberian tiger, one of the most well-known wild primitive carnivores in China, is an endangered animal. In order to promote research on its genome, a high-redundancy BAC library of the Siberian tiger was constructed and characterized. The library is divided into two sub-libraries prepared from blood cells and two sub-libraries prepared from fibroblasts. This BAC library contains 153,600 individually archived clones; for PCR-based screening of the library, BACs were placed into 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 116.5 kb, representing approximately 6.46 genome equivalents of the haploid genome and affording a 98.86% statistical probability of obtaining at least one clone containing a unique DNA sequence. Screening the library with 19 microsatellite markers and a SRY sequence revealed that each of these markers were present in the library; the average number of positive clones per marker was 6.74 (range 2 to 12), consistent with 6.46 coverage of the tiger genome. Additionally, we identified 72 microsatellite markers that could potentially be used as genetic markers. This BAC library will serve as a valuable resource for physical mapping, comparative genomic study and large-scale genome sequencing in the tiger. PMID:24608928

Chromosome

Science.gov (United States)

... St Louis, MO: Elsevier; 2017:chap 69. Taber's Medical Dictionary Online. Chromosome. www.tabers.com/tabersonline/view/Tabers-Dictionary/753321/all/chromosome?q=Chromosome&ti=0 . Accessed June 11, 2017.

Mutually exclusive expression of human red and green visual pigment-reporter transgenes occurs at high frequency in murine cone photoreceptors.

Science.gov (United States)

Wang, Y; Smallwood, P M; Cowan, M; Blesh, D; Lawler, A; Nathans, J

1999-04-27

This study examines the mechanism of mutually exclusive expression of the human X-linked red and green visual pigment genes in their respective cone photoreceptors by asking whether this expression pattern can be produced in a mammal that normally carries only a single X-linked visual pigment gene. To address this question, we generated transgenic mice that carry a single copy of a minimal human X chromosome visual pigment gene array in which the red and green pigment gene transcription units were replaced, respectively, by alkaline phosphatase and beta-galactosidase reporters. As determined by histochemical staining, the reporters are expressed exclusively in cone photoreceptor cells. In 20 transgenic mice carrying any one of three independent transgene insertion events, an average of 63% of expressing cones have alkaline phosphatase activity, 10% have beta-galactosidase activity, and 27% have activity for both reporters. Thus, mutually exclusive expression of red and green pigment transgenes can be achieved in a large fraction of cones in a dichromat mammal, suggesting a facile evolutionary path for the development of trichromacy after visual pigment gene duplication. These observations are consistent with a model of visual pigment expression in which stochastic pairing occurs between a locus control region and either the red or the green pigment gene promotor.

Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

Science.gov (United States)

Meyer, P; Heidmann, I

1994-05-25

We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

Human Chromosome 21: Mapping of the chromosomes and cloning of cDNAs

Energy Technology Data Exchange (ETDEWEB)

Antonarakis, S.E.

1991-09-01

The objective of the research funded by DOE grant DE-FG02-89ER60857 from 6/15/89 to 8/31/91 was to contribute to the physical mapping of human chromosome 21 (HC21) by cloning large fragments of DNA into Yeast Artificial Chromosomes (YACs) and identify YACs that map on HC21. A total of 54 sequence tagged sites (STS) have been developed and mapped in our laboratory to HC21 and can be used as initial reference points for YAC identification and construction of overlapping clones. A small YAC library was constructed which is HC21 specific. DNA from somatic cell hybrid WAV17 or from flow-sorted HC21 was partially digested with EcoRI, ligated into vectors PJS97, PJS98, and YACs have been obtained with average size insert of more than 300 kb. This library has been deposited in D. Patterson's lab for the Joint YAC screening effort. Additional YAC libraries from ICI Pharmaceuticals or from Los Alamos National Laboratories have been screened with several STS and positive YACs have been identified. Work in progress includes screening of YAC libraries in order to construct overlapping clones, characterization of the cloning ends of YACs, characterization of additional STS and cloning of HC21 specific cDNAs. 15 refs., 2 figs., 5 tabs.

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

Science.gov (United States)

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre

Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa

Science.gov (United States)

While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

Science.gov (United States)

Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

2005-04-01

Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

Science.gov (United States)

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.

Science.gov (United States)

Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A

1996-11-01

Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and

In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

Energy Technology Data Exchange (ETDEWEB)

Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.

2006-02-01

The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

Directory of Open Access Journals (Sweden)

Jinlong Guo

2015-01-01

Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

[New advances in animal transgenic technology].

Science.gov (United States)

Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang

2010-06-01

Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.

Dantrolene is neuroprotective in Huntington's disease transgenic mouse model

Directory of Open Access Journals (Sweden)

Chen Xi

2011-11-01

Full Text Available Abstract Background Huntington's disease (HD is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs. Our group has previously demonstrated that calcium (Ca2+ signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128. Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2 and spinocerebellar ataxia 3 (SCA3 mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. Results The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Conclusions Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that Ryan

Dantrolene is neuroprotective in Huntington's disease transgenic mouse model.

Science.gov (United States)

Chen, Xi; Wu, Jun; Lvovskaya, Svetlana; Herndon, Emily; Supnet, Charlene; Bezprozvanny, Ilya

2011-11-25

Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as

Construction and Analysis of Siberian Tiger Bacterial Artificial Chromosome Library with Approximately 6.5-Fold Genome Equivalent Coverage

Directory of Open Access Journals (Sweden)

Changqing Liu

2014-03-01

Full Text Available Bacterial artificial chromosome (BAC libraries are extremely valuable for the genome-wide genetic dissection of complex organisms. The Siberian tiger, one of the most well-known wild primitive carnivores in China, is an endangered animal. In order to promote research on its genome, a high-redundancy BAC library of the Siberian tiger was constructed and characterized. The library is divided into two sub-libraries prepared from blood cells and two sub-libraries prepared from fibroblasts. This BAC library contains 153,600 individually archived clones; for PCR-based screening of the library, BACs were placed into 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 116.5 kb, representing approximately 6.46 genome equivalents of the haploid genome and affording a 98.86% statistical probability of obtaining at least one clone containing a unique DNA sequence. Screening the library with 19 microsatellite markers and a SRY sequence revealed that each of these markers were present in the library; the average number of positive clones per marker was 6.74 (range 2 to 12, consistent with 6.46 coverage of the tiger genome. Additionally, we identified 72 microsatellite markers that could potentially be used as genetic markers. This BAC library will serve as a valuable resource for physical mapping, comparative genomic study and large-scale genome sequencing in the tiger.

Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

Science.gov (United States)

Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

2009-05-01

Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Directory of Open Access Journals (Sweden)

Giulia Breveglieri

2015-01-01

Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Science.gov (United States)

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Construction and characterization of a bacterial artificial chromosome library of the causal agent of Black Sigatoka fungal leaf spot disease of banana and plantain, Mycosphaerella fijiensis.

Science.gov (United States)

Canto-Canché, Blondy; Guillén-Maldonado, Diana Karina; Peraza-Echeverría, Leticia; Conde-Ferráez, Laura; James-Kay, Andrew

2007-05-01

A bacterial artificial chromosome library of the causal agent of the Black Sigatoka leaf spot disease of banana and plantain, Mycosphaerella fijiensis, has been constructed using a non-sphaeroplasting technique and characterized using both homologous and heterologous probes. After first and a second size selection of PFGE-fractionated DNA, a ligation was obtained using a 1:4 molar ratio (insert:vector). One hundred random clones were analyzed, and the mean insert size was estimated to be 90 kb. The range of the insert sizes was between 40 and 160 kb. The highest percentage of inserts belonged to the range between 80 and 100 kb; 32% of the inserts had 2 or 3 internal NotI sites. This library consists of 1920 clones, if the genomic size is at least 35 Mb, then this represents 4.9 x genome equivalents, which was supported by hybridization results with homologous and heterologous probes.

Binding of Multiple Rap1 Proteins Stimulates Chromosome Breakage Induction during DNA Replication.

Directory of Open Access Journals (Sweden)

Greicy H Goto

2015-08-01

Full Text Available Telomeres, the ends of linear eukaryotic chromosomes, have a specialized chromatin structure that provides a stable chromosomal terminus. In budding yeast Rap1 protein binds to telomeric TG repeat and negatively regulates telomere length. Here we show that binding of multiple Rap1 proteins stimulates DNA double-stranded break (DSB induction at both telomeric and non-telomeric regions. Consistent with the role of DSB induction, Rap1 stimulates nearby recombination events in a dosage-dependent manner. Rap1 recruits Rif1 and Rif2 to telomeres, but neither Rif1 nor Rif2 is required for DSB induction. Rap1-mediated DSB induction involves replication fork progression but inactivation of checkpoint kinase Mec1 does not affect DSB induction. Rap1 tethering shortens artificially elongated telomeres in parallel with telomerase inhibition, and this telomere shortening does not require homologous recombination. These results suggest that Rap1 contributes to telomere homeostasis by promoting chromosome breakage.

Neuroanatomy and transgenic technologies

Science.gov (United States)

This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

Agronomic performance, chromosomal stability and resistance to velvetbean caterpillar of transgenic soybean expressing cry1Ac gene Performance agronômica, estabilidade cromossômica e resistência à lagarta-da-soja em soja transgênica que expressa o gene cry1Ac

Directory of Open Access Journals (Sweden)

Milena Schenkel Homrich

2008-07-01

Full Text Available The objective of this work was to analyze the agronomic performance and chromosomal stability of transgenic homozygous progenies of soybean [Glycine max (L. Merrill.], and to confirm the resistance of these plants against Anticarsia gemmatalis. Eleven progenies expressing cry1Ac, hpt and gusA genes were evaluated for agronomic characteristics in relation to the nontransformed parent IAS 5 cultivar. Cytogenetical analysis was carried out on transgenic and nontransgenic plants. Two out of the 11 transgenic progenies were also evaluated, in vitro and in vivo, for resistance to A. gemmatalis. Two negative controls were used in resistance bioassays: a transgenic homozygous line, containing only the gusA reporter gene, and nontransgenic 'IAS 5' plants. The presence of cry1Ac transgene affected neither the development nor the yield of plants. Cytogenetical analysis showed that transgenic plants presented normal karyotype. In detached-leaf bioassay, cry1Ac plants exhibited complete efficacy against A. gemmatalis, whereas negative controls were significantly damaged. Whole-plant feeding assay confirmed a very high protection of cry1Ac against velvetbean caterpillar, while nontransgenic 'IAS 5' plants and homozygous gusA line exhibited 56.5 and 71.5% defoliation, respectively. The presence of cry1Ac transgene doesn't affect the majority of agronomic traits (including yield of soybean and grants high protection against A. gemmatalis.O objetivo deste trabalho foi analisar a performance agronômica e a estabilidade cromossômica de progênies transgênicas homozigotas de soja [Glycine max (L. Merrill.], e confirmar a resistência dessas plantas a Anticarsia gemmatalis. Onze progênies com expressão dos genes cry1Ac, hpt e gusA foram avaliadas quanto às características agronômicas, em relação à cultivar parental IAS 5 não transformada. Análises citogenéticas foram realizadas em plantas transgênicas e não transgênicas. Duas das 11 prog

Biotechnology network promotes knowledge of transgenics

International Nuclear Information System (INIS)

Blanco Picado, Patricia; Valdez Melara, Marta

2015-01-01

Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

Rapid and efficient introduction of a foreign gene into bacterial artificial chromosome-cloned varicella vaccine by Tn7-mediated site-specific transposition

International Nuclear Information System (INIS)

Somboonthum, Pranee; Koshizuka, Tetsuo; Okamoto, Shigefumi; Matsuura, Masaaki; Gomi, Yasuyuki; Takahashi, Michiaki; Yamanishi, Koichi; Mori, Yasuko

2010-01-01

Using a rapid and reliable system based on Tn7-mediated site-specific transposition, we have successfully constructed a recombinant Oka varicella vaccine (vOka) expressing the mumps virus (MuV) fusion protein (F). The backbone of the vector was our previously reported vOka-BAC (bacterial artificial chromosome) genome. We inserted the transposon Tn7 attachment sequence, LacZα-mini-attTn7, into the region between ORF12 and ORF13 to generate a vOka-BAC-Tn genome. The MuV-F expressing cassette was transposed into the vOka-BAC genome at the mini-attTn7 transposition site. MuV-F protein was expressed in recombinant virus, rvOka-F infected cells. In addition, the MuV-F protein was cleaved in the rvOka-F infected cells as in MuV-infected cells. The growth of rvOka-F was similar to that of the original recombinant vOka without the F gene. Thus, we show that Tn7-mediated transposition is an efficient method for introducing a foreign gene expression cassette into the vOka-BAC genome as a live virus vector.

Gametocidal chromosomes enhancing chromosome aberration in common wheat induced by 5-azacytidine.

Science.gov (United States)

Su, W-Y; Cong, W-W; Shu, Y-J; Wang, D; Xu, G-H; Guo, C-H

2013-07-08

The gametocidal (Gc) chromosome from Aegilops spp induces chromosome mutation, which is introduced into common wheat as a tool of chromosome manipulation for genetic improvement. The Gc chromosome functions similar to a restriction-modification system in bacteria, in which DNA methylation is an important regulator. We treated root tips of wheat carrying Gc chromosomes with the hypomethylation agent 5-azacytidine; chromosome breakage and micronuclei were observed in these root tips. The frequency of aberrations differed in wheat containing different Gc chromosomes, suggesting different functions inducing chromosome breakage. Gc chromosome 3C caused the greatest degree of chromosome aberration, while Gc chromosome 3C(SAT) and 2C caused only slight chromosome aberration. Gc chromosome 3C induced different degrees of chromosome aberration in wheat varieties Triticum aestivum var. Chinese Spring and Norin 26, demonstrating an inhibition function in common wheat.

[The obtainment and characteristics of Kalanchoe pinnata L. plants expressing the artificial gene of the cecropin P1 antimicrobial peptide].

Science.gov (United States)

Zakharchenko, N S; Rukavtsova, E B; Shevchuk, T V; Furs, O V; Pigoleva, S V; Lebedeva, A A; Chulina, I A; Baidakova, L K; Bur'yanov, Ya I

2016-01-01

Kalanchoe pinnata L. plants bearing an artificial CP1 gene encoding the cecropin P1 antimicrobial peptide have been obtained. The presence of the CP1 gene in the plant genome has been confirmed by PCR. Cecropin P1 synthesis in transgenic plants has been shown by MALDI mass spectrometry and Western blotting. The obtained plants have been highly resistant to bacterial and fungal phytopathogens, and their extracts have demonstrated antimicrobial activity towards human and animal pathogens. It has been shown that transgenic plants bearing the CP1 gene can be colonized by the beneficial associative microorganisms Methylovorus mays.

ANIMALES TRANSGÉNICOS COMO ORGANISMOS ARTIFICIALES ANIMAIS TRANSGÊNICOS COMO ORGANISMOS ARTIFICIAIS TRANSGENIC ANIMALS AS ARTIFICIAL ORGANISMS

Directory of Open Access Journals (Sweden)

Alexandre Bota Arqué

2007-06-01

Full Text Available La modificación genética de organismos vivos ha generado interrogantes éticos de difícil solución. La búsqueda de marcos conceptuales lleva a plantear si ha habido una modificación del estatuto ontológico de los organismos alterados por la biotecnología. Este artículo realiza una aproximación al organismo biotecnológico a partir del pensamiento de los filósofos José Ortega y Gasset y Xavier Zubiri acerca del hombre y de la técnica, conceptualizando el objeto artificial biotecnológico como "organismo artificial", con la particularidad de ser el primer objeto producido por el hombre que se reproduce independientementeA modificação genética de organismos vivos gerou interrogativos éticos de difícil solução. A busca de marcos conceituais leva a questionar se ocorreu uma modificação do estatuto ontológico dos organismos modificados pela biotecnologia. Este artigo realiza uma aproximação ao organismo biotecnológico a partir do pensamento dos filósofos José Ortega y Gasset e Xavier Zubiri a respeito do homem e da técnica. Conceptualiza o objeto artificial biotecnológico como um "organismo artificial", com a particularidade de ser o primeiro objeto produzido pelo homem que se reproduz independentementeThe possibility of genetic modification of living organisms has generated ethical questions of difficult solution. The searching for conceptual frames has put into question whether the ontological status of organisms altered by biotechnology has been changed. This paper approaches the biotechnological organism following the thinking of philosophers Ortega y Gasset and Xavier Zubiri, based on their view on anthropology and technology conceptualizing the biotechnological artificial object as an "artificial organism" with the particularity that it is the first object produced by human beings which reproduces independently

Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

Science.gov (United States)

2013-01-01

Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

Fetal chromosome analysis: screening for chromosome disease?

DEFF Research Database (Denmark)

Philip, J; Tabor, Ann; Bang, J

1983-01-01

The aim of the study was to investigate the rationale of the current indications for fetal chromosome analysis. 5372 women had 5423 amniocentesis performed, this group constituting a consecutive sample at the chromosome laboratory, Rigshospitalet, Copenhagen from March 1973 to September 1980 (Group...... A + B). Pregnant women 35 years of age, women who previously had a chromosomally abnormal child, families with translocation carriers or other heritable chromosomal disease, families where the father was 50 years or more and women in families with a history of Down's syndrome (group A), were compared...... to women having amniocentesis, although considered not to have any increased risk of fetal chromosome abnormality (1390 pregnancies, group B). They were also compared with 750 consecutive pregnancies in women 25-34 years of age, in whom all heritable diseases were excluded (group C). The risk of unbalanced...

Transgene mobilization and regulatory uncertainty for non-GE fruit products of transgenic rootstocks.

Science.gov (United States)

Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B

2012-10-31

Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio. Copyright © 2012 Elsevier B.V. All rights reserved.

Construction of a nurse shark (Ginglymostoma cirratum bacterial artificial chromosome (BAC library and a preliminary genome survey

Directory of Open Access Journals (Sweden)

Inoko Hidetoshi

2006-05-01

Full Text Available Abstract Background Sharks are members of the taxonomic class Chondrichthyes, the oldest living jawed vertebrates. Genomic studies of this group, in comparison to representative species in other vertebrate taxa, will allow us to theorize about the fundamental genetic, developmental, and functional characteristics in the common ancestor of all jawed vertebrates. Aims In order to obtain mapping and sequencing data for comparative genomics, we constructed a bacterial artificial chromosome (BAC library for the nurse shark, Ginglymostoma cirratum. Results The BAC library consists of 313,344 clones with an average insert size of 144 kb, covering ~4.5 × 1010 bp and thus providing an 11-fold coverage of the haploid genome. BAC end sequence analyses revealed, in addition to LINEs and SINEs commonly found in other animal and plant genomes, two new groups of nurse shark-specific repetitive elements, NSRE1 and NSRE2 that seem to be major components of the nurse shark genome. Screening the library with single-copy or multi-copy gene probes showed 6–28 primary positive clones per probe of which 50–90% were true positives, demonstrating that the BAC library is representative of the different regions of the nurse shark genome. Furthermore, some BAC clones contained multiple genes, making physical mapping feasible. Conclusion We have constructed a deep-coverage, high-quality, large insert, and publicly available BAC library for a cartilaginous fish. It will be very useful to the scientific community interested in shark genomic structure, comparative genomics, and functional studies. We found two new groups of repetitive elements specific to the nurse shark genome, which may contribute to the architecture and evolution of the nurse shark genome.

Construction of a nurse shark (Ginglymostoma cirratum) bacterial artificial chromosome (BAC) library and a preliminary genome survey.

Science.gov (United States)

Luo, Meizhong; Kim, Hyeran; Kudrna, Dave; Sisneros, Nicholas B; Lee, So-Jeong; Mueller, Christopher; Collura, Kristi; Zuccolo, Andrea; Buckingham, E Bryan; Grim, Suzanne M; Yanagiya, Kazuyo; Inoko, Hidetoshi; Shiina, Takashi; Flajnik, Martin F; Wing, Rod A; Ohta, Yuko

2006-05-03

Sharks are members of the taxonomic class Chondrichthyes, the oldest living jawed vertebrates. Genomic studies of this group, in comparison to representative species in other vertebrate taxa, will allow us to theorize about the fundamental genetic, developmental, and functional characteristics in the common ancestor of all jawed vertebrates. In order to obtain mapping and sequencing data for comparative genomics, we constructed a bacterial artificial chromosome (BAC) library for the nurse shark, Ginglymostoma cirratum. The BAC library consists of 313,344 clones with an average insert size of 144 kb, covering ~4.5 x 1010 bp and thus providing an 11-fold coverage of the haploid genome. BAC end sequence analyses revealed, in addition to LINEs and SINEs commonly found in other animal and plant genomes, two new groups of nurse shark-specific repetitive elements, NSRE1 and NSRE2 that seem to be major components of the nurse shark genome. Screening the library with single-copy or multi-copy gene probes showed 6-28 primary positive clones per probe of which 50-90% were true positives, demonstrating that the BAC library is representative of the different regions of the nurse shark genome. Furthermore, some BAC clones contained multiple genes, making physical mapping feasible. We have constructed a deep-coverage, high-quality, large insert, and publicly available BAC library for a cartilaginous fish. It will be very useful to the scientific community interested in shark genomic structure, comparative genomics, and functional studies. We found two new groups of repetitive elements specific to the nurse shark genome, which may contribute to the architecture and evolution of the nurse shark genome.

Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

Directory of Open Access Journals (Sweden)

Mengling Wen

Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen.

Science.gov (United States)

Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N; Chen, Fajun

2017-11-07

Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO 2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO 2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2, 1 and 2 N). It is elucidated that the increased levels of global atmospheric CO 2 concentration will trigger up-regulation of Bt toxin expression in transgenic rice, especially with appropriate increase of N fertilizer supply, while, to some extent, the exogenous Bt-transgene expression is reduced at sub-N levels (1/4 and 1/2N), even though the total protein of plant tissues is reduced and the plant growth is restricted. The unpredictable and stochastic occurrence of transgene silencing and epigenetic alternations remains unresolved for most transgenic plants. It is expected that N fertilization supply may promote the expression of transgenic Bt toxin in transgenic Bt rice, particularly under elevated CO 2 .

Two new types of chromosomal rearrangements in the swine species induced by semen irradiation

International Nuclear Information System (INIS)

Franceschini, P.H.; Mikich, A.B.; Garcia, J.M.; Almeida Junior, I.L.; Pinheiro, L.E.L.

1991-01-01

In the present experiment were used one boar and 5 descendent of Landrace and Large White cross-breeding were used, all the animals were healthy concerning to the reproductive aspect and chromosome constitution. Initially semen was collected from the boar through the glove hand method, diluted and submitted to gamma irradiation. The total applied dose was of 800 R, with an exposition period of 3,76 min. The artificial insemination of the females with the treated semen was performed from the time of observation of positive tolerance reflex, with each animal receiving 2 inseminations with a 12 hour interval in between. after birth, the piglets had their blood aseptically collected for karyotype preparation and analysis. From 17 piglets born and cytogenetically analysed, 2 chromosomal rearrangements were detected, namely, a reciprocal translocation or insertion, 8q-; 14p+ in a female a pericentric inversion in chromosome 1 in a male. (author). 18 refs, 2 figs

Inter-chromosomal heterogeneity in the formation of radiation induced chromosomal aberrations

International Nuclear Information System (INIS)

Natarajan, A.T.; Vermeulen, S.; Boei, J.J.W.A.

1997-01-01

It is generally assumed that radiation induced chromosomal lesions are distributed randomly and repaired randomly among the genome. Recent studies using fluorescent in situ hybridization (FISH) and chromosome specific DNA libraries indicate that some chromosomes are more sensitive for radiation induced aberration formation than others. Chromosome No. 4 in human and chromosome No. 8 in Chinese hamster have been found to involve more in exchange aberrations than others, when calculated on the basis of their DNA content. Painting with arm specific chromosome libraries indicate that the frequencies of radiation induced intra-chromosome exchanges (i.e., between the arms of a chromosome, such as centric rings and inversions) are far in excess than one would expect on the basis of the frequencies of observed inter-chromosomal exchanges. The possible factors leading to the observed heterogeneity will be discussed

Transmission of chromosomal and instability via a chromosome irradiated with ionizing radiation

International Nuclear Information System (INIS)

Kodama, Seiji; Tanabe, Masateru; Shiraishi, Kazunori; Oshimura, Mitsuo

2010-01-01

We examined the stability of the transferred chromosome in 5 and 12 microcell hybrids including unirradiated human chromosomes 6 and 8, respectively, and 6 and 19 microcell hybrids including 4 Gy-irradiated human chromosomes 6 and 8, respectively. The transferred chromosome was structurally stable in most microcell hybrids transferred with the unirradiated chromosomes 6 and 8. In contrast, the 4 Gy-irradiated human chromosomes were unstable in 3 out of 6 hybrids (50%) with chromosome 6 and 3 out of 19 hybrids (16%) with chromosome 8, showing multiple aberrations in high frequencies (35∼98%). To know the cause of delayed chromosomal instability, intrachromosomal rearrangements of the human chromosome is investigated by subtelomere FISH in 17 microcell hybrids transferred with chromosomes 6 and 8. We found frequent intrachromosomal in 7 microcell hybrids (41%). However, no clear correlation was observed between the intrachromosomal rearrangements and the induction of delayed chromosomal instability by ionizing radiation

Mitotic chromosome structure

International Nuclear Information System (INIS)

Heermann, Dieter W.

2012-01-01

Mounting evidence is compiling linking the physical organizational structure of chromosomes and the nuclear structure to biological function. At the base of the physical organizational structure of both is the concept of loop formation. This implies that physical proximity within chromosomes is provided for otherwise distal genomic regions and thus hierarchically organizing the chromosomes. Together with entropy many experimental observations can be explained with these two concepts. Among the observations that can be explained are the measured physical extent of the chromosomes, their shape, mechanical behavior, the segregation into territories (chromosomal and territories within chromosomes), the results from chromosome conformation capture experiments, as well as linking gene expression to structural organization.

Mitotic chromosome structure

Energy Technology Data Exchange (ETDEWEB)

Heermann, Dieter W., E-mail: heermann@tphys.uni-heidelberg.de

2012-07-15

Mounting evidence is compiling linking the physical organizational structure of chromosomes and the nuclear structure to biological function. At the base of the physical organizational structure of both is the concept of loop formation. This implies that physical proximity within chromosomes is provided for otherwise distal genomic regions and thus hierarchically organizing the chromosomes. Together with entropy many experimental observations can be explained with these two concepts. Among the observations that can be explained are the measured physical extent of the chromosomes, their shape, mechanical behavior, the segregation into territories (chromosomal and territories within chromosomes), the results from chromosome conformation capture experiments, as well as linking gene expression to structural organization.

Generation of an approximately 2.4 Mb human X centromere-based minichromosome by targeted telomere-associated chromosome fragmentation in DT40.

Science.gov (United States)

Mills, W; Critcher, R; Lee, C; Farr, C J

1999-05-01

A linear mammalian artificial chromosome (MAC) will require at least three types of functional element: a centromere, two telomeres and origins of replication. As yet, our understanding of these elements, as well as many other aspects of structure and organization which may be critical for a fully functional mammalian chromosome, remains poor. As a way of defining these various requirements, minichromosome reagents are being developed and analysed. Approaches for minichromosome generation fall into two broad categories: de novo assembly from candidate DNA sequences, or the fragmentation of an existing chromosome to reduce it to a minimal size. Here we describe the generation of a human minichromosome using the latter, top-down, approach. A human X chromosome, present in a DT40-human microcell hybrid, has been manipulated using homologous recombination and the targeted seeding of a de novo telomere. This strategy has generated a linear approximately 2.4 Mb human X centromere-based minichromosome capped by two artificially seeded telomeres: one immediately flanking the centromeric alpha-satellite DNA and the other targeted to the zinc finger gene ZXDA in Xp11.21. The chromosome retains an alpha-satellite domain of approximately 1. 8 Mb, a small array of gamma-satellite repeat ( approximately 40 kb) and approximately 400 kb of Xp proximal DNA sequence. The mitotic stability of this minichromosome has been examined, both in DT40 and following transfer into hamster and human cell lines. In all three backgrounds, the minichromosome is retained efficiently, but in the human and hamster microcell hybrids its copy number is poorly regulated. This approach of engineering well-defined chromosome reagents will allow key questions in MAC development (such as whether a lower size limit exists) to be addressed. In addition, the 2.4 Mb minichromosome described here has potential to be developed as a vector for gene delivery.

A method for high efficiency YAC lipofection into murine embryonic stem cells.

Science.gov (United States)

Lee, J T; Jaenisch, R

1996-01-01

We describe a modified protocol for introducing yeast artificial chromosomes (YACs) into murine embryonic stem (ES) cells by lipofection. With a decreased DNA:cell ratio, increased concentration of condensing agents and altered culture conditions, this protocol reduces the requirement for YAC DNA to a few micrograms, improves the recovery of neomycin-resistant ES colonies and increases the yield of clones containing both flanking vector markers and insert. These modifications enable generation of sufficient 'intact' transgenic clones for biological analysis with a single experiment. PMID:9016681

Transgenic Expression of the piRNA-Resistant Masculinizer Gene Induces Female-Specific Lethality and Partial Female-to-Male Sex Reversal in the Silkworm, Bombyx mori.

Science.gov (United States)

Sakai, Hiroki; Sumitani, Megumi; Chikami, Yasuhiko; Yahata, Kensuke; Uchino, Keiro; Kiuchi, Takashi; Katsuma, Susumu; Aoki, Fugaku; Sezutsu, Hideki; Suzuki, Masataka G

2016-08-01

In Bombyx mori (B. mori), Fem piRNA originates from the W chromosome and is responsible for femaleness. The Fem piRNA-PIWI complex targets and cleaves mRNAs transcribed from the Masc gene. Masc encodes a novel CCCH type zinc-finger protein and is required for male-specific splicing of B. mori doublesex (Bmdsx) transcripts. In the present study, several silkworm strains carrying a transgene, which encodes a Fem piRNA-resistant Masc mRNA (Masc-R), were generated. Forced expression of the Masc-R transgene caused female-specific lethality during the larval stages. One of the Masc-R strains weakly expressed Masc-R in various tissues. Females heterozygous for the transgene expressed male-specific isoform of the Bombyx homolog of insulin-like growth factor II mRNA-binding protein (ImpM) and Bmdsx. All examined females showed a lower inducibility of vitellogenin synthesis and exhibited abnormalities in the ovaries. Testis-like tissues were observed in abnormal ovaries and, notably, the tissues contained considerable numbers of sperm bundles. Homozygous expression of the transgene resulted in formation of the male-specific abdominal segment in adult females and caused partial male differentiation in female genitalia. These results strongly suggest that Masc is an important regulatory gene of maleness in B. mori.

Progress on researches of transgenic alfalfa

International Nuclear Information System (INIS)

Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

2010-01-01

In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

Chromosomal aberration

International Nuclear Information System (INIS)

Ishii, Yutaka

1988-01-01

Chromosomal aberrations are classified into two types, chromosome-type and chromatid-type. Chromosom-type aberrations include terminal deletion, dicentric, ring and interstitial deletion, and chromatid-type aberrations include achromatic lesion, chromatid deletion, isochromatid deletion and chromatid exchange. Clastogens which induce chromosomal aberration are divided into ''S-dependent'' agents and ''S-independent''. It might mean whether they can induce double strand breaks independent of the S phase or not. Double strand breaks may be the ultimate lesions to induce chromosomal aberrations. Caffeine added even in the G 2 phase appeared to modify the frequency of chromatid aberrations induced by X-rays and mitomycin C. Those might suggest that the G 2 phase involves in the chromatid aberration formation. The double strand breaks might be repaired by ''G 2 repair system'', the error of which might yield breakage types of chromatid aberrations and the by-pass of which might yield chromatid exchanges. Chromosome-type aberrations might be formed in the G 1 phase. (author)

Y-chromosome evolution: emerging insights into processes of Y-chromosome degeneration.

Science.gov (United States)

Bachtrog, Doris

2013-02-01

The human Y chromosome is intriguing not only because it harbours the master-switch gene that determines gender but also because of its unusual evolutionary history. The Y chromosome evolved from an autosome, and its evolution has been characterized by massive gene decay. Recent whole-genome and transcriptome analyses of Y chromosomes in humans and other primates, in Drosophila species and in plants have shed light on the current gene content of the Y chromosome, its origins and its long-term fate. Furthermore, comparative analysis of young and old Y chromosomes has given further insights into the evolutionary and molecular forces triggering Y-chromosome degeneration and into the evolutionary destiny of the Y chromosome.

Transgenics, agroindustry and food sovereignty

Directory of Open Access Journals (Sweden)

Xavier Alejandro León Vega

2014-10-01

Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

Chromosomal abnormalities in human glioblastomas: gain in chromosome 7p correlating with loss in chromosome 10q.

Science.gov (United States)

Inda, María del Mar; Fan, Xing; Muñoz, Jorge; Perot, Christine; Fauvet, Didier; Danglot, Giselle; Palacio, Ana; Madero, Pilar; Zazpe, Idoya; Portillo, Eduardo; Tuñón, Teresa; Martínez-Peñuela, José María; Alfaro, Jorge; Eiras, José; Bernheim, Alain; Castresana, Javier S

2003-01-01

Various genomic alterations have been detected in glioblastoma. Chromosome 7p, with the epidermal growth factor receptor locus, together with chromosome 10q, with the phosphatase and tensin homologue deleted in chromosome 10 and deleted in malignant brain tumors-1 loci, and chromosome 9p, with the cyclin-dependent kinase inhibitor 2A locus, are among the most frequently damaged chromosomal regions in glioblastoma. In this study, we evaluated the genetic status of 32 glioblastomas by comparative genomic hybridization; the sensitivity of comparative genomic hybridization versus differential polymerase chain reaction to detect deletions at the phosphatase and tensin homologue deleted in chromosome 10, deleted in malignant brain tumors-1, and cyclin-dependent kinase inhibitor 2A loci and amplifications at the cyclin-dependent kinase 4 locus; the frequency of genetic lesions (gain or loss) at 16 different selected loci (including oncogenes, tumor-suppressor genes, and proliferation markers) mapping on 13 different chromosomes; and the possible existence of a statistical association between any pair of molecular markers studied, to subdivide the glioblastoma entity molecularly. Comparative genomic hybridization showed that the most frequent region of gain was chromosome 7p, whereas the most frequent losses occurred on chromosomes 10q and 13q. The only statistically significant association was found for 7p gain and 10q loss. Copyright 2002 Wiley-Liss, Inc.

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

Science.gov (United States)

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

Directory of Open Access Journals (Sweden)

Teruhiko Suzuki

Full Text Available Human artificial chromosomes (HACs are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

Diversity of arthropod community in transgenic poplar-cotton ecosystems.

Science.gov (United States)

Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

2015-12-02

Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

Slit scan flow cytometry of isolated chromosomes following fluorescence hybridization: an approach of online screening for specific chromosomes and chromosome translocations

NARCIS (Netherlands)

Hausmann, M.; Dudin, G.; Aten, J. A.; Heilig, R.; Diaz, E.; Cremer, C.

1991-01-01

The recently developed methods of non radioactive in situ hybridization of chromosomes offer new aspects for chromosome analysis. Fluorescent labelling of hybridized chromosomes or chromosomal subregions allows to facilitate considerably the detection of specific chromosomal abnormalities. For many

An Empirical Assessment of Transgene Flow from a Bt Transgenic Poplar Plantation.

Directory of Open Access Journals (Sweden)

Jianjun Hu

Full Text Available To assess the possible impact of transgenic poplar plantations on the ecosystem, we analyzed the frequency and distance of gene flow from a mature male transgenic Populus nigra plantation carrying the Bacillus thuringiensis toxin gene (Bt poplar and the survival of Bt poplar seeds. The resultant Bt poplar seeds occurred at a frequency of ~0.15% at 0 m to ~0.02% at 500 m from the Bt poplar plantation. The germination of Bt poplar seeds diminished within three weeks in the field (germination rate from 68% to 0% compared to 48% after three weeks of storage at 4°C. The survival rate of seedlings in the field was 0% without any treatment but increased to 1.7% under the addition of four treatments (cleaning and trimming, watering, weeding, and covering with plastic film to maintain moisture after being seeded in the field for eight weeks. The results of this study indicate that gene flow originating from the Bt poplar plantation occurred at an extremely low level through pollen or seeds under natural conditions. This study provides first-hand field data on the extent of transgene flow in poplar plantations and offers guidance for the risk assessment of transgenic poplar plantations.

Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

Directory of Open Access Journals (Sweden)

Warwick Suzanne I

2009-10-01

Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen

OpenAIRE

Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N.; Chen, Fajun

2017-01-01

Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2...

Small chromosomal regions position themselves autonomously according to their chromatin class.

Science.gov (United States)

van de Werken, Harmen J G; Haan, Josien C; Feodorova, Yana; Bijos, Dominika; Weuts, An; Theunis, Koen; Holwerda, Sjoerd J B; Meuleman, Wouter; Pagie, Ludo; Thanisch, Katharina; Kumar, Parveen; Leonhardt, Heinrich; Marynen, Peter; van Steensel, Bas; Voet, Thierry; de Laat, Wouter; Solovei, Irina; Joffe, Boris

2017-06-01

The spatial arrangement of chromatin is linked to the regulation of nuclear processes. One striking aspect of nuclear organization is the spatial segregation of heterochromatic and euchromatic domains. The mechanisms of this chromatin segregation are still poorly understood. In this work, we investigated the link between the primary genomic sequence and chromatin domains. We analyzed the spatial intranuclear arrangement of a human artificial chromosome (HAC) in a xenospecific mouse background in comparison to an orthologous region of native mouse chromosome. The two orthologous regions include segments that can be assigned to three major chromatin classes according to their gene abundance and repeat repertoire: (1) gene-rich and SINE-rich euchromatin; (2) gene-poor and LINE/LTR-rich heterochromatin; and (3) gene-depleted and satellite DNA-containing constitutive heterochromatin. We show, using fluorescence in situ hybridization (FISH) and 4C-seq technologies, that chromatin segments ranging from 0.6 to 3 Mb cluster with segments of the same chromatin class. As a consequence, the chromatin segments acquire corresponding positions in the nucleus irrespective of their chromosomal context, thereby strongly suggesting that this is their autonomous property. Interactions with the nuclear lamina, although largely retained in the HAC, reveal less autonomy. Taken together, our results suggest that building of a functional nucleus is largely a self-organizing process based on mutual recognition of chromosome segments belonging to the major chromatin classes. © 2017 van de Werken et al.; Published by Cold Spring Harbor Laboratory Press.

Morphological images analysis and chromosomic aberrations classification based on fuzzy logic

International Nuclear Information System (INIS)

Souza, Leonardo Peres

2011-01-01

This work has implemented a methodology for automation of images analysis of chromosomes of human cells irradiated at IEA-R1 nuclear reactor (located at IPEN, Sao Paulo, Brazil), and therefore subject to morphological aberrations. This methodology intends to be a tool for helping cytogeneticists on identification, characterization and classification of chromosomal metaphasic analysis. The methodology development has included the creation of a software application based on artificial intelligence techniques using Fuzzy Logic combined with image processing techniques. The developed application was named CHRIMAN and is composed of modules that contain the methodological steps which are important requirements in order to achieve an automated analysis. The first step is the standardization of the bi-dimensional digital image acquisition procedure through coupling a simple digital camera to the ocular of the conventional metaphasic analysis microscope. Second step is related to the image treatment achieved through digital filters application; storing and organization of information obtained both from image content itself, and from selected extracted features, for further use on pattern recognition algorithms. The third step consists on characterizing, counting and classification of stored digital images and extracted features information. The accuracy in the recognition of chromosome images is 93.9%. This classification is based on classical standards obtained at Buckton [1973], and enables support to geneticist on chromosomic analysis procedure, decreasing analysis time, and creating conditions to include this method on a broader evaluation system on human cell damage due to ionizing radiation exposure. (author)

The effects of Fe2O3 nanoparticles on physiology and insecticide activity in non-transgenic and Bt-transgenic cotton

Directory of Open Access Journals (Sweden)

Nhan eLe Van

2016-01-01

Full Text Available As the demands for nanotechnology and nanoparticle (NP applications in agriculture increase, the ecological risk has drawn more attention because of the unpredictable results of interactions between NPs and transgenic crops. In this study, we investigated the effects of various concentrations of Fe2O3 NPs on Bt-transgenic cotton in comparison with conventional cotton for 10 days. Each treatment was conducted in triplicate, and each experiment was repeated three times. Results demonstrated that Fe2O3 nanoparticles (NPs inhibited the plant height and root length of Bt-transgenic cotton and promoted root hairs and biomass of non-transgenic cotton. Nutrients such as Na and K in Bt-transgenic cotton roots increased, while Zn contents decreased with Fe2O3 NPs. Most hormones in the roots of Bt-transgenic cotton increased at low Fe2O3 NP exposure (100 mg·L−1 but decreased at high concentrations of Fe2O3 NPs (1000 mg·L−1. Fe2O3 NPs increased the Bt-toxin in leaves and roots of Bt-transgenic cotton. Fe2O3 NPs were absorbed into roots, then transported to the shoots of both Bt-transgenic and non-transgenic cottons. The bioaccumulation of Fe2O3 NPs in plants might be a potential risk for agricultural crops and affect the environment and human health.

Stability in chromosome number and DNA content in synthetic tetraploids of Lolium multiflorum after two generations of selection

Directory of Open Access Journals (Sweden)

Roselaine Cristina Pereira

Full Text Available ABSTRACT: Chromosome doubling of Italian ryegrass genotypes ( Lolium multiflorum Lam. adapted to the brazilian edaphoclimatic conditions is an important strategy used by breeders and aims to obtain more vigorous genotypes with better forage quality and disease resistance. The effectiveness of chromosome doubling can be measured by genetic stability and fertility rates of plants over generations. However, a common problem in the polyploidization process is the regeneration of mixoploid plants that have impaired fertility and genetic stability. The objective of this study was to verify if progenies of recently tetraploidized plants remain stable regarding DNA content and chromosome number, over two generations. Progenies of L. multiflorum plants artificially tetraploidized with colchicine treatment were evaluated. Chromosome counting and estimates of the DNA content were used to evaluate the genetic stability. The percentage of tetraploid plants (4X increased over generations (18%, 34% and 91% in cycle 0, 1 and 2, respectively. All progenies identified as tetraploid by flow citometry showed variation in chromosome number (mixoploidy, but produced viable seeds. Results showed that stabilization in chromosome number and DNA content in tetraploidized plant progenies requires time and that the success of this procedure depends on a continuous and accurate screening and selection.

First Birth after Sperm Selection through Discontinuous Gradient Centrifugation and Artificial Insemination from a Chromosomal Translocation Carrier

Directory of Open Access Journals (Sweden)

Alexandre Rouen

2014-01-01

Full Text Available Introduction. Balanced chromosomal carriers, though usually healthy, are confronted with recurrent spontaneous abortions and malformations in the offspring. Those are related to the transmission of an abnormal, chromosomally unbalanced genotype. We evidenced that the proportion of unbalanced spermatozoa can be significantly decreased through a sperm preparation process called discontinuous gradient centrifugation (DGC. We therefore started offering intrauterine inseminations with this procedure to couples with a male translocation carriers. Case Presentation. We report the case of a 37-year-old man carrying a t(3;10(q25;p13 reciprocal translocation. He and his partner had had trouble conceiving for ten years and had four spontaneous abortions. DGC in this patient decreased the proportion of unbalanced spermatozoa from 63.6% to 52.3%. They were therefore offered intrauterine insemination with DGC, which eventually led to the birth of a healthy female child carrying the paternal translocation. Conclusion. We showed that translocation carriers could be offered intrauterine inseminations with DGC. Before this, the only two options were natural conception with prenatal diagnosis and termination of chromosomally unbalanced fetuses or preimplantation genetic diagnosis, which is a much heavier and costly procedure. We are currently offering this option through a multicentric program in France, and this is the first birth originating from it.

In vivo overexpression of Emi1 promotes chromosome instability and tumorigenesis.

Science.gov (United States)

Vaidyanathan, S; Cato, K; Tang, L; Pavey, S; Haass, N K; Gabrielli, B G; Duijf, P H G

2016-10-13

Cell cycle genes are often aberrantly expressed in cancer, but how their misexpression drives tumorigenesis mostly remains unclear. From S phase to early mitosis, EMI1 (also known as FBXO5) inhibits the anaphase-promoting complex/cyclosome, which controls cell cycle progression through the sequential degradation of various substrates. By analyzing 7403 human tumor samples, we find that EMI1 overexpression is widespread in solid tumors but not in blood cancers. In solid cancers, EMI1 overexpression is a strong prognostic marker for poor patient outcome. To investigate causality, we generated a transgenic mouse model in which we overexpressed Emi1. Emi1-overexpressing animals develop a wide variety of solid tumors, in particular adenomas and carcinomas with inflammation and lymphocyte infiltration, but not blood cancers. These tumors are significantly larger and more penetrant, abundant, proliferative and metastatic than control tumors. In addition, they are highly aneuploid with tumor cells frequently being in early mitosis and showing mitotic abnormalities, including lagging and incorrectly segregating chromosomes. We further demonstrate in vitro that even though EMI1 overexpression may cause mitotic arrest and cell death, it also promotes chromosome instability (CIN) following delayed chromosome alignment and anaphase onset. In human solid tumors, EMI1 is co-expressed with many markers for CIN and EMI1 overexpression is a stronger marker for CIN than most well-established ones. The fact that Emi1 overexpression promotes CIN and the formation of solid cancers in vivo indicates that Emi1 overexpression actively drives solid tumorigenesis. These novel mechanistic insights have important clinical implications.

Transgene flow: Facts, speculations and possible countermeasures

Science.gov (United States)

Ryffel, Gerhart U

2014-01-01

Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

Directory of Open Access Journals (Sweden)

Lori A. McEachern

2012-01-01

Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

Incorporation of a lambda phage recombination system and EGFP detection to simplify mutagenesis of Herpes simplex virus bacterial artificial chromosomes

Directory of Open Access Journals (Sweden)

Weir Jerry P

2007-05-01

Full Text Available Abstract Background Targeted mutagenesis of the herpesvirus genomes has been facilitated by the use of bacterial artificial chromosome (BAC technology. Such modified genomes have potential uses in understanding viral pathogenesis, gene identification and characterization, and the development of new viral vectors and vaccines. We have previously described the construction of a herpes simplex virus 2 (HSV-2 BAC and the use of an allele replacement strategy to construct HSV-2 recombinants. While the BAC mutagenesis procedure is a powerful method to generate HSV-2 recombinants, particularly in the absence of selective marker in eukaryotic culture, the mutagenesis procedure is still difficult and cumbersome. Results Here we describe the incorporation of a phage lambda recombination system into an allele replacement vector. This strategy enables any DNA fragment containing the phage attL recombination sites to be efficiently inserted into the attR sites of the allele replacement vector using phage lambda clonase. We also describe how the incorporation of EGFP into the allele replacement vector can facilitate the selection of the desired cross-over recombinant BACs when the allele replacement reaction is a viral gene deletion. Finally, we incorporate the lambda phage recombination sites directly into an HSV-2 BAC vector for direct recombination of gene cassettes using the phage lambda clonase-driven recombination reaction. Conclusion Together, these improvements to the techniques of HSV BAC mutagenesis will facilitate the construction of recombinant herpes simplex viruses and viral vectors.

[Progress in transgenic fish techniques and application].

Science.gov (United States)

Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

2011-05-01

Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA.

Directory of Open Access Journals (Sweden)

Matthew G Cottingham

2008-02-01

Full Text Available The production, manipulation and rescue of a bacterial artificial chromosome clone of Vaccinia virus (VAC-BAC in order to expedite construction of expression vectors and mutagenesis of the genome has been described (Domi & Moss, 2002, PNAS99 12415-20. The genomic BAC clone was 'rescued' back to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA, now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full-length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A46R or B7R did not significantly affect CD8(+ T cell immunogenicity in BALB/c mice, but deletion of B15R enhanced specific CD8(+ T cell responses to one of two endogenous viral epitopes (from the E2 and F2 proteins, in accordance with published work (Staib et al., 2005, J. Gen. Virol.86, 1997-2006. In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+ T cells against an epitope from Plasmodium berghei was created using GalK counterselection to insert an antigen expression cassette lacking a tandem marker gene into the traditional thymidine kinase locus of MVA-BAC. MVA continues to feature prominently in clinical trials of recombinant vaccines against diseases such as HIV-AIDS, malaria and tuberculosis. Here we demonstrate in proof-of-concept experiments that MVA-BAC recombineering is a viable route to more rapid and efficient generation of new candidate mutant and recombinant

Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

Science.gov (United States)

Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

2011-01-01

Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

The overexpression of insect endogenous small RNAs in transgenic rice inhibits growth and delays pupation of striped stem borer (Chilo suppressalis).

Science.gov (United States)

Jiang, Shan; Wu, Hao; Liu, Haoju; Zheng, Jie; Lin, Yongjun; Chen, Hao

2017-07-01

The striped stem borer (SSB), Chilo suppressalis Walker, is a major rice insect pest worldwide. RNA interference (RNAi) has become a promising strategy for developing insect-resistant crops. In a previous study, five double-stranded RNAs (dsRNAs) targeting important SSB housekeeping genes were overexpressed in rice, but none of the acquired dsRNA-transgenic rice plants showed significant effects on SSB. Thirteen selected SSB endogenous small RNAs, predicted as SSB novel microRNAs (miRNAs), were overexpressed in rice using artificial miRNA (amiRNA) expression technology. Feeding tests showed that two out of 13 selected SSB novel miRNAs caused significant growth inhibition for feeding SSB larvae based on transgenic rice expression. Pupation was delayed 4 days when SSB larvae consecutively fed on transgenic rice expressing the SSB novel miRNA candidate csu-novel-miR15 (csu-15 rice). Gene expression analysis confirmed that the expression levels of at least six SSB unigenes significantly changed (i.e., were up- or down-regulated) after feeding on csu-15 rice. Our research demonstrated a novel RNAi strategy using SSB endogenous small RNAs to develop RNAi crops for pest management; this strategy is different from the common RNAi resulting from transgenic dsRNAs or amiRNAs targeting certain insect endogenous genes. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Transgenic plants with enhanced growth characteristics

Energy Technology Data Exchange (ETDEWEB)

Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

2018-01-09

The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

Transgenic plants with enhanced growth characteristics

Energy Technology Data Exchange (ETDEWEB)

Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

2016-09-06

The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

Recent progress on technologies and applications of transgenic ...

African Journals Online (AJOL)

USER

2010-06-14

Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.

Efficient transformation and artificial miRNA gene silencing in Lemna minor.

Science.gov (United States)

Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

2015-01-01

Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Artificial activation of toxin-antitoxin systems as an antibacterial strategy.

Science.gov (United States)

Williams, Julia J; Hergenrother, Paul J

2012-06-01

Toxin-antitoxin (TA) systems are unique modules that effect plasmid stabilization via post-segregational killing of the bacterial host. The genes encoding TA systems also exist on bacterial chromosomes, and it has been speculated that these are involved in a variety of cellular processes. Interest in TA systems has increased dramatically over the past 5 years as the ubiquitous nature of TA genes on bacterial genomes has been revealed. The exploitation of TA systems as an antibacterial strategy via artificial activation of the toxin has been proposed and has considerable potential; however, efforts in this area remain in the early stages and several major questions remain. This review investigates the tractability of targeting TA systems to kill bacteria, including fundamental requirements for success, recent advances, and challenges associated with artificial toxin activation. Copyright © 2012 Elsevier Ltd. All rights reserved.

Vibrio chromosome-specific families

DEFF Research Database (Denmark)

Lukjancenko, Oksana; Ussery, David

2014-01-01

We have compared chromosome-specific genes in a set of 18 finished Vibrio genomes, and, in addition, also calculated the pan- and core-genomes from a data set of more than 250 draft Vibrio genome sequences. These genomes come from 9 known species and 2 unknown species. Within the finished...... chromosomes, we find a core set of 1269 encoded protein families for chromosome 1, and a core of 252 encoded protein families for chromosome 2. Many of these core proteins are also found in the draft genomes (although which chromosome they are located on is unknown.) Of the chromosome specific core protein...... families, 1169 and 153 are uniquely found in chromosomes 1 and 2, respectively. Gene ontology (GO) terms for each of the protein families were determined, and the different sets for each chromosome were compared. A total of 363 different "Molecular Function" GO categories were found for chromosome 1...

Giemsa C-banding of Barley Chromosomes. IV. Chromosomal Constitution of Autotetraploid Barley

DEFF Research Database (Denmark)

Linde-Laursen, Ib

1984-01-01

The progeny of an autotetraploid barley plant (C1) consisted of 45 tetraploids and 33 aneuploids. Giemsa C-banding was used to identify each of the chromosomes in 20 euploid and 31 aneuploid C2--seedlings, and in 11 C3--offspring of aneuploid C2--plants. The euploid C2--seedlings all had four...... homologues of each of the chromosomes. The aneuploid C2--seedlings were fairly equally distributed on hypo-and hyperploids, and on the seven chromosome groups. This suggests that a particular chromosome is lost or gained at random in gametes and embryos. The 11 C3--seedlings comprised seven true euploids......, one seedling with 2n=28 having an extra chromosome 6 and missing one chromosome 3, and three seedlings with 2n=29. The chromosomal composition of aneuploid C3--seedlings did not reflect that of their aneuploid C2--parents with respect to missing or extra chromosomes. Two hypohexaploid C2--seedlings...

Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

International Nuclear Information System (INIS)

Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira; Kamihira, Masamichi

2012-01-01

Highlights: ► Adeno-associated virus (AAV) is capable of targeted integration in human cells. ► Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. ► A targeted integration system of IDRV DNA using the AAV integration mechanism. ► Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors, therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.

The influence of elevated endogenous free radical production on apoptosis and genomic instability in transgenic growth hormone mice

International Nuclear Information System (INIS)

Lemon, J.A.; Rollo, D.; Boreham, D.R.

2003-01-01

Full text: Previous studies have shown transgenic growth hormone mice (TGM) have significantly elevated levels of endogenous reactive oxygen species (ROS) and lipid peroxidation, shortened lifespan (approximately 50% of normal siblings), greatly enhanced learning in youth, and accelerated aging with a rapid age-related loss of cognitive abilities. A complex oral antioxidant supplement was found to completely abolish the cognitive decline and significantly extend longevity in TGM. We have determined in a recently completed experiment studying radiation-induced apoptosis that the antioxidant supplement significantly reduces the elevated level of apoptosis seen in untreated old TGM compared to age-matched controls. It was also determined that older normal mice treated with the supplement also show a reduction in apoptosis. We are conducting experiments using spectral karyotyping to examine genomic instability in TGM and their normal siblings, that indicate, given their elevated ROS, TGM show an increase in chromosome aberrations compared to normal controls. Based on our previous experiments we speculate that TGM treated with the antioxidant supplement are expected to show a reduction in ROS induced chromosome aberrations

Construction of physical maps for the sex-specific regions of papaya sex chromosomes

Directory of Open Access Journals (Sweden)

Na Jong-Kuk

2012-05-01

Full Text Available Abstract Background Papaya is a major fruit crop in tropical and subtropical regions worldwide. It is trioecious with three sex forms: male, female, and hermaphrodite. Sex determination is controlled by a pair of nascent sex chromosomes with two slightly different Y chromosomes, Y for male and Yh for hermaphrodite. The sex chromosome genotypes are XY (male, XYh (hermaphrodite, and XX (female. The papaya hermaphrodite-specific Yh chromosome region (HSY is pericentromeric and heterochromatic. Physical mapping of HSY and its X counterpart is essential for sequencing these regions and uncovering the early events of sex chromosome evolution and to identify the sex determination genes for crop improvement. Results A reiterate chromosome walking strategy was applied to construct the two physical maps with three bacterial artificial chromosome (BAC libraries. The HSY physical map consists of 68 overlapped BACs on the minimum tiling path, and covers all four HSY-specific Knobs. One gap remained in the region of Knob 1, the only knob structure shared between HSY and X, due to the lack of HSY-specific sequences. This gap was filled on the physical map of the HSY corresponding region in the X chromosome. The X physical map consists of 44 BACs on the minimum tiling path with one gap remaining in the middle, due to the nature of highly repetitive sequences. This gap was filled on the HSY physical map. The borders of the non-recombining HSY were defined genetically by fine mapping using 1460 F2 individuals. The genetically defined HSY spanned approximately 8.5 Mb, whereas its X counterpart extended about 5.4 Mb including a 900 Kb region containing the Knob 1 shared by the HSY and X. The 8.5 Mb HSY corresponds to 4.5 Mb of its X counterpart, showing 4 Mb (89% DNA sequence expansion. Conclusion The 89% increase of DNA sequence in HSY indicates rapid expansion of the Yh chromosome after genetic recombination was suppressed 2–3 million years ago. The

IDENTIFICATION OF ESCAPED TRANSGENIC CREEPING BENTGRASS IN OREGON

Science.gov (United States)

When transgenic plants are cultivated near wild species that are sexually compatible with the crop, gene flow between the crop and wild plants is possible. A resultant concern is that transgene flow and transgene introgression within wild populations could have unintended ecologi...

Accumulation of nickel in transgenic tobacco

Science.gov (United States)

Sidik, Nik Marzuki; Othman, Noor Farhan

2013-11-01

The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

Discrimination of chromosome by autoradiography

International Nuclear Information System (INIS)

Masubuchi, Masanori

1975-01-01

This paper describes discrimination of chromosome by autoradiography. In this method, the difference in DNA synthetic phase between each chromosome was used as a standard, and the used chromosome was in metaphase, as morphological characteristics were markedly in this phase. Cell cycle and autoradiography with 3 H-thymidine were also examined. In order to discriminate chromosome by autoradiography, it was effective to utilize the labelled pattern in late DNA synthetic phase, where asynchronous replication of chromosome appeared most obviously. DNA synthesis in chromosome was examined in each DNA synthetic phase by culturing the chromosome after the treatment with 3 H-thymidine and altering the time to prepare chromosome specimen. Discrimination of chromosome in plants and animals by autoradiography was also mentioned. It was noticed as a structural and functional discrimination of chromosome to observe amino acid uptake into chromosome protein and to utilize the difference in labelled pattern between the sites of chromosome. (K. Serizawa)

Transgene mus som sygdomsmodeller

DEFF Research Database (Denmark)

Schuster, Mikkel Bruhn; Porse, Bo Torben

2003-01-01

Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

Highly Efficient Transfer of Chromosomes to a Broad Range of Target Cells Using Chinese Hamster Ovary Cells Expressing Murine Leukemia Virus-Derived Envelope Proteins.

Directory of Open Access Journals (Sweden)

Teruhiko Suzuki

Full Text Available Microcell-mediated chromosome transfer (MMCT is an essential step for introducing chromosomes from donor cells to recipient cells. MMCT allows not only for genetic/epigenetic analysis of specific chromosomes, but also for utilization of human and mouse artificial chromosomes (HACs/MACs as gene delivery vectors. Although the scientific demand for genome scale analyses is increasing, the poor transfer efficiency of the current method has hampered the application of chromosome engineering technology. Here, we developed a highly efficient chromosome transfer method, called retro-MMCT, which is based on Chinese hamster ovary cells expressing envelope proteins derived from ecotropic or amphotropic murine leukemia viruses. Using this method, we transferred MACs to NIH3T3 cells with 26.5 times greater efficiency than that obtained using the conventional MMCT method. Retro-MMCT was applicable to a variety of recipient cells, including embryonic stem cells. Moreover, retro-MMCT enabled efficient transfer of MAC to recipient cells derived from humans, monkeys, mice, rats, and rabbits. These results demonstrate the utility of retro-MMCT for the efficient transfer of chromosomes to various types of target cell.

A proteomic study to identify soya allergens--the human response to transgenic versus non-transgenic soya samples.

Science.gov (United States)

Batista, Rita; Martins, Isabel; Jeno, Paul; Ricardo, Cândido Pinto; Oliveira, Maria Margarida

2007-01-01

In spite of being among the main foods responsible for allergic reactions worldwide, soybean (Glycine max)-derived products continue to be increasingly widespread in a variety of food products due to their well-documented health benefits. Soybean also continues to be one of the elected target crops for genetic modification. The aim of this study was to characterize the soya proteome and, specifically, IgE-reactive proteins as well as to compare the IgE response in soya-allergic individuals to genetically modified Roundup Ready soya versus its non-transgenic control. We performed two-dimensional gel electrophoresis of protein extracts from a 5% genetically modified Roundup Ready flour sample and its non-transgenic control followed by Western blotting with plasma from 5 soya-sensitive individuals. We used peptide tandem mass spectrometry to identify soya proteins (55 protein matches), specifically IgE-binding ones, and to evaluate differences between transgenic and non-transgenic samples. We identified 2 new potential soybean allergens--one is maturation associated and seems to be part of the late embryogenesis abundant proteins group and the other is a cysteine proteinase inhibitor. None of the individuals tested reacted differentially to the transgenic versus non-transgenic samples under study. Soybean endogenous allergen expression does not seem to be altered after genetic modification. Proteomics should be considered a powerful tool for functional characterization of plants and for food safety assessment. Copyright (c) 2007 S. Karger AG, Basel.

Verification and characterization of chromosome duplication in haploid maize.

Science.gov (United States)

de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S

2015-06-26

Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.

The Y chromosome of the Atelidae family (Platyrrhini): study by chromosome microdissection.

Science.gov (United States)

Gifalli-Iughetti, C; Koiffmann, C P

2009-01-01

In order to study the intergeneric variability of the Y chromosome, we describe the hybridization of the Y chromosome of Brachytelesarachnoides, obtained by microdissection, to metaphases of Atelesbelzebuthmarginatus, Lagothrixlagothricha, and Alouatta male specimens. Brachytelesarachnoides (Atelinae) has 62 chromosomes and a very small Y chromosome. Our results showed that the Brachytelesarachnoides Y chromosome probe hybridized to Lagothrixlagothricha metaphases yielding one hybridization signal on only the tiny Y chromosome, and when hybridized with Atelesbelzebuthmarginatus metaphases it yielded one hybridization signal on two thirds of the small acrocentric Y chromosome. However, no hybridization signal was observed in Alouatta metaphases (subfamily Alouattinae), a closely related genus in the Atelidae family. Furthermore, our data support a close phylogenetic relationship among Brachyteles, Ateles, and Lagothrix and their placement in the Atelinae subfamily, but exclude Alouatta from this group indicating its placement as basal to this group. Copyright 2009 S. Karger AG, Basel.

Mammalian Synthetic Biology: Time for Big MACs.

Science.gov (United States)

Martella, Andrea; Pollard, Steven M; Dai, Junbiao; Cai, Yizhi

2016-10-21

The enabling technologies of synthetic biology are opening up new opportunities for engineering and enhancement of mammalian cells. This will stimulate diverse applications in many life science sectors such as regenerative medicine, development of biosensing cell lines, therapeutic protein production, and generation of new synthetic genetic regulatory circuits. Harnessing the full potential of these new engineering-based approaches requires the design and assembly of large DNA constructs-potentially up to chromosome scale-and the effective delivery of these large DNA payloads to the host cell. Random integration of large transgenes, encoding therapeutic proteins or genetic circuits into host chromosomes, has several drawbacks such as risks of insertional mutagenesis, lack of control over transgene copy-number and position-specific effects; these can compromise the intended functioning of genetic circuits. The development of a system orthogonal to the endogenous genome is therefore beneficial. Mammalian artificial chromosomes (MACs) are functional, add-on chromosomal elements, which behave as normal chromosomes-being replicating and portioned to daughter cells at each cell division. They are deployed as useful gene expression vectors as they remain independent from the host genome. MACs are maintained as a single-copy and can accommodate multiple gene expression cassettes of, in theory, unlimited DNA size (MACs up to 10 megabases have been constructed). MACs therefore enabled control over ectopic gene expression and represent an excellent platform to rapidly prototype and characterize novel synthetic gene circuits without recourse to engineering the host genome. This review describes the obstacles synthetic biologists face when working with mammalian systems and how the development of improved MACs can overcome these-particularly given the spectacular advances in DNA synthesis and assembly that are fuelling this research area.

Chromosomal instability can be induced by the formation of breakage-prone chromosome rearrangement junctions

International Nuclear Information System (INIS)

Allen, R.N.; Ritter, L.; Moore, S.R.; Grosovsky, A.J.

2003-01-01

Full text: Studies in our lab have led to the hypothesis that chromosomal rearrangements can generate novel breakage-prone sites, resulting in chromosomal instability acting predominantly in cis. For example, specific breakage of large blocks of centromeric region heterochromatin on chromosome 16q by treatment with 2,6-diaminopurine (DAP) is associated with repeated rearrangement of chromosome 16q during outgrowth of DAP-treated clones, thereby establishing a link between the initial site of damage and the occurrence of persistent chromosomal instability. Similarly, karyotypic analysis of gamma ray induced instability demonstrated that chromosomal rearrangements in sub-clones were significantly clustered near the site of previously identified chromosomal rearrangement junctions in unstable parental clones. This study investigates the hypothesis that integration of transfected sequences into host chromosomes could create breakage-prone junction regions and persistent genomic instability without exposure to DNA-damage agents. These junctions may mimic the unstable chromosomal rearrangements induced by DAP or radiation, and thus provide a test of the broader hypothesis that instability can to some extent be attributed to the formation of novel chromosomal breakage hot spots. These experiments were performed using human-hamster hybrid AL cells containing a single human chromosome 11, which was used to monitor instability in a chromosomal painting assay. AL cells were transfected with a 2.5 Kb fragment containing multiple copies of the 180 bp human alpha heterochromatic repeat, which resulted in chromosomal instability in 41% of the transfected clones. Parallel exposure to gamma-radiation resulted in a similar level of chromosomal instability, although control transfections with plasmid alone did not lead to karyotypic instability. Chromosomal instability induced by integration of alpha heterochromatic repeats was also frequently associated with delayed reproductive

Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

Science.gov (United States)

Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

2016-09-01

Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

Micromechanics of human mitotic chromosomes

International Nuclear Information System (INIS)

Sun, Mingxuan; Kawamura, Ryo; Marko, John F

2011-01-01

Eukaryote cells dramatically reorganize their long chromosomal DNAs to facilitate their physical segregation during mitosis. The internal organization of folded mitotic chromosomes remains a basic mystery of cell biology; its understanding would likely shed light on how chromosomes are separated from one another as well as into chromosome structure between cell divisions. We report biophysical experiments on single mitotic chromosomes from human cells, where we combine micromanipulation, nano-Newton-scale force measurement and biochemical treatments to study chromosome connectivity and topology. Results are in accord with previous experiments on amphibian chromosomes and support the 'chromatin network' model of mitotic chromosome structure. Prospects for studies of chromosome-organizing proteins using siRNA expression knockdowns, as well as for differential studies of chromosomes with and without mutations associated with genetic diseases, are also discussed

An Efficient Method for Generation of Transgenic Rats Avoiding Embryo Manipulation

Directory of Open Access Journals (Sweden)

Bhola Shankar Pradhan

2016-01-01

Full Text Available Although rats are preferred over mice as an animal model, transgenic animals are generated predominantly using mouse embryos. There are limitations in the generation of transgenic rat by embryo manipulation. Unlike mouse embryos, most of the rat embryos do not survive after male pronuclear DNA injection which reduces the efficiency of generation of transgenic rat by this method. More importantly, this method requires hundreds of eggs collected by killing several females for insertion of transgene to generate transgenic rat. To this end, we developed a noninvasive and deathless technique for generation of transgenic rats by integrating transgene into the genome of the spermatogonial cells by testicular injection of DNA followed by electroporation. After standardization of this technique using EGFP as a transgene, a transgenic disease model displaying alpha thalassemia was successfully generated using rats. This efficient method will ease the generation of transgenic rats without killing the lives of rats while simultaneously reducing the number of rats used for generation of transgenic animal.

Efficient site-specific integration in Plasmodium falciparum chromosomes mediated by mycobacteriophage Bxb1 integrase.

Science.gov (United States)

Nkrumah, Louis J; Muhle, Rebecca A; Moura, Pedro A; Ghosh, Pallavi; Hatfull, Graham F; Jacobs, William R; Fidock, David A

2006-08-01

Here we report an efficient, site-specific system of genetic integration into Plasmodium falciparum malaria parasite chromosomes. This is mediated by mycobacteriophage Bxb1 integrase, which catalyzes recombination between an incoming attP and a chromosomal attB site. We developed P. falciparum lines with the attB site integrated into the glutaredoxin-like cg6 gene. Transfection of these attB(+) lines with a dual-plasmid system, expressing a transgene on an attP-containing plasmid together with a drug resistance gene and the integrase on a separate plasmid, produced recombinant parasites within 2 to 4 weeks that were genetically uniform for single-copy plasmid integration. Integrase-mediated recombination resulted in proper targeting of parasite proteins to intra-erythrocytic compartments, including the apicoplast, a plastid-like organelle. Recombinant attB x attP parasites were genetically stable in the absence of drug and were phenotypically homogeneous. This system can be exploited for rapid genetic integration and complementation analyses at any stage of the P. falciparum life cycle, and it illustrates the utility of Bxb1-based integrative recombination for genetic studies of intracellular eukaryotic organisms.

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

Science.gov (United States)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

2014-12-01

Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

Science.gov (United States)

Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

2016-10-01

An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

Production of transgenic pigs over-expressing the antiviral gene Mx1

Directory of Open Access Journals (Sweden)

Quanmei Yan

2014-01-01

Full Text Available The myxovirus resistance gene (Mx1 has a broad spectrum of antiviral activities. It is therefore an interesting candidate gene to improve disease resistance in farm animals. In this study, we report the use of somatic cell nuclear transfer (SCNT to produce transgenic pigs over-expressing the Mx1 gene. These transgenic pigs express approximately 15–25 times more Mx1 mRNA than non-transgenic pigs, and the protein level of Mx1 was also markedly enhanced. We challenged fibroblast cells isolated from the ear skin of transgenic and control pigs with influenza A virus and classical swine fever virus (CFSV. Indirect immunofluorescence assay (IFA revealed a profound decrease of influenza A proliferation in Mx1 transgenic cells. Growth kinetics showed an approximately 10-fold reduction of viral copies in the transgenic cells compared to non-transgenic controls. Additionally, we found that the Mx1 transgenic cells were more resistant to CSFV infection in comparison to non-transgenic cells. These results demonstrate that the Mx1 transgene can protect against viral infection in cells of transgenic pigs and indicate that the Mx1 transgene can be harnessed to develop disease-resistant pigs.

Chromosomal divergence and evolutionary inferences in Rhodniini based on the chromosomal location of ribosomal genes

Directory of Open Access Journals (Sweden)

Sebastian Pita

2013-05-01

Full Text Available In this study, we used fluorescence in situ hybridisation to determine the chromosomal location of 45S rDNA clusters in 10 species of the tribe Rhodniini (Hemiptera: Reduviidae: Triatominae. The results showed striking inter and intraspecific variability, with the location of the rDNA clusters restricted to sex chromosomes with two patterns: either on one (X chromosome or both sex chromosomes (X and Y chromosomes. This variation occurs within a genus that has an unchanging diploid chromosome number (2n = 22, including 20 autosomes and 2 sex chromosomes and a similar chromosome size and genomic DNA content, reflecting a genome dynamic not revealed by these chromosome traits. The rDNA variation in closely related species and the intraspecific polymorphism in Rhodnius ecuadoriensis suggested that the chromosomal position of rDNA clusters might be a useful marker to identify recently diverged species or populations. We discuss the ancestral position of ribosomal genes in the tribe Rhodniini and the possible mechanisms involved in the variation of the rDNA clusters, including the loss of rDNA loci on the Y chromosome, transposition and ectopic pairing. The last two processes involve chromosomal exchanges between both sex chromosomes, in contrast to the widely accepted idea that the achiasmatic sex chromosomes of Heteroptera do not interchange sequences.

Energy homeostasis targets chromosomal reconfiguration of the human GH1 locus.

Science.gov (United States)

Vakili, Hana; Jin, Yan; Cattini, Peter A

2014-11-01

Levels of pituitary growth hormone (GH), a metabolic homeostatic factor with strong lipolytic activity, are decreased in obese individuals. GH declines prior to the onset of weight gain in response to excess caloric intake and hyperinsulinemia; however, the mechanism by which GH is reduced is not clear. We used transgenic mice expressing the human GH (hGH) gene, GH1, to assess the effect of high caloric intake on expression as well as the local chromosome structure of the intact GH1 locus. Animals exposed to 3 days of high caloric intake exhibited hyperinsulinemia without hyperglycemia and a decrease in both hGH synthesis and secretion, but no difference in endogenous production of murine GH. Efficient GH1 expression requires a long-range intrachromosomal interaction between remote enhancer sequences and the proximal promoter region through "looping" of intervening chromatin. High caloric intake disrupted this interaction and decreased both histone H3/H4 hyperacetylation and RNA polymerase II occupancy at the GH1 promoter. Incorporation of physical activity muted the effects of excess caloric intake on insulin levels, GH1 promoter hyperacetylation, chromosomal architecture, and expression. These results indicate that energy homeostasis alters postnatal hGH synthesis through dynamic changes in the 3-dimensional chromatin structure of the GH1 locus, including structures required for cell type specificity during development.

Telomere dysfunction and chromosome instability

Energy Technology Data Exchange (ETDEWEB)

Murnane, John P., E-mail: jmurnane@radonc.ucsf.edu [Department of Radiation Oncology, University of California San Francisco, 2340 Sutter Street, San Francisco, CA 94143-1331 (United States)

2012-02-01

The ends of chromosomes are composed of a short repeat sequence and associated proteins that together form a cap, called a telomere, that keeps the ends from appearing as double-strand breaks (DSBs) and prevents chromosome fusion. The loss of telomeric repeat sequences or deficiencies in telomeric proteins can result in chromosome fusion and lead to chromosome instability. The similarity between chromosome rearrangements resulting from telomere loss and those found in cancer cells implicates telomere loss as an important mechanism for the chromosome instability contributing to human cancer. Telomere loss in cancer cells can occur through gradual shortening due to insufficient telomerase, the protein that maintains telomeres. However, cancer cells often have a high rate of spontaneous telomere loss despite the expression of telomerase, which has been proposed to result from a combination of oncogene-mediated replication stress and a deficiency in DSB repair in telomeric regions. Chromosome fusion in mammalian cells primarily involves nonhomologous end joining (NHEJ), which is the major form of DSB repair. Chromosome fusion initiates chromosome instability involving breakage-fusion-bridge (B/F/B) cycles, in which dicentric chromosomes form bridges and break as the cell attempts to divide, repeating the process in subsequent cell cycles. Fusion between sister chromatids results in large inverted repeats on the end of the chromosome, which amplify further following additional B/F/B cycles. B/F/B cycles continue until the chromosome acquires a new telomere, most often by translocation of the end of another chromosome. The instability is not confined to a chromosome that loses its telomere, because the instability is transferred to the chromosome donating a translocation. Moreover, the amplified regions are unstable and form extrachromosomal DNA that can reintegrate at new locations. Knowledge concerning the factors promoting telomere loss and its consequences is

How To Produce and Characterize Transgenic Plants.

Science.gov (United States)

Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

2002-01-01

Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

Fetal chromosome analysis

DEFF Research Database (Denmark)

Philip, J; Tabor, A; Bang, J

1983-01-01

The aim of the study was to investigate the rationale of the current indications for fetal chromosome analysis. 5372 women had 5423 amniocentesis performed, this group constituting a consecutive sample at the chromosome laboratory, Rigshospitalet, Copenhagen from March 1973 to September 1980 (Group...... A + B). Pregnant women 35 years of age, women who previously had a chromosomally abnormal child, families with translocation carriers or other heritable chromosomal disease, families where the father was 50 years or more and women in families with a history of Down's syndrome (group A), were compared...... to women having amniocentesis, although considered not to have any increased risk of fetal chromosome abnormality (1390 pregnancies, group B). They were also compared with 750 consecutive pregnancies in women 25-34 years of age, in whom all heritable diseases were excluded (group C). The risk of unbalanced...

Microdissection and chromosome painting of the alien chromosome in an addition line of wheat-Thinopyrum intermedium

Science.gov (United States)

The chromosome painting is an efficient tool for chromosome research. However, plant chromosome painting is relatively underdeveloped. In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat-Thinopyrum intermedium addition line, and chromosomes of...

Microdissection and chromosome painting of the alien chromosome in an addition line of wheat--Thinopyrum intermedium.

Science.gov (United States)

Deng, Chuanliang; Bai, Lili; Fu, Shulan; Yin, Weibo; Zhang, Yingxin; Chen, Yuhong; Wang, Richard R-C; Zhang, Xiangqi; Han, Fangpu; Hu, Zanmin

2013-01-01

In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat--Thinopyrum intermedium addition line, and the chromosomes of the three different genomes of Th. Intermedium. The smallest alien chromosome of TAi-27 was microdissected and its DNA amplified by DOP-PCR was used as a probe to hybridize with metaphase chromosomes of TAi-27 and Th. intermedium. Results showed that hybridization signals were observed in all regions of a pair of the smallest alien chromosomes and the pericentromeric area of another pair of alien chromosomes in TAi-27, indicating that the probe from microdissected chromosome is species specific. In Th. intermedium, 14 chromosomes had wide and strong hybridization signals distributed mainly on the pericentromere area and 9 chromosomes with narrow and weak signals on the pericentromere area. The remaining chromosomes displayed a very weak or no signal. Sequential FISH/GISH on Th. intermedium chromosomes using the DNAs of microdissected chromosome, Pseudoroegneria spicata (St genome) and pDbH12 (a J(s) genome specific probe) as the probes indicated that the microdissected chromosome belonged to the St genome, three genomes (J(s) , J and St) in Th. intermedium could be distinguished, in which there is no hybridization signal on J genome that is similar to the genome of Th. bessarabicum. Our results showed that the smallest alien chromosomes may represent a truncated chromosome and the repetitive sequence distribution might be similar in different chromosomes within the St genome. However, the repetitive sequence distributions are different within the J(s) genome, within a single chromosome, and among different genomes in Th. intermedium. Our results suggested that chromosome painting could be feasible in some plants and useful in detecting chromosome variation and repetitive sequence distribution in different genomes of polyploidy plants, which is helpful for understanding the evolution of different

Microdissection and Chromosome Painting of the Alien Chromosome in an Addition Line of Wheat - Thinopyrum intermedium

Science.gov (United States)

Yin, Weibo; Zhang, Yingxin; Chen, Yuhong; Wang, Richard R.-C.; Zhang, Xiangqi; Han, Fangpu; Hu, Zanmin

2013-01-01

In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat - Thinopyrum intermedium addition line, and the chromosomes of the three different genomes of Th. Intermedium. The smallest alien chromosome of TAi-27 was microdissected and its DNA amplified by DOP-PCR was used as a probe to hybridize with metaphase chromosomes of TAi-27 and Th . intermedium . Results showed that hybridization signals were observed in all regions of a pair of the smallest alien chromosomes and the pericentromeric area of another pair of alien chromosomes in TAi-27, indicating that the probe from microdissected chromosome is species specific. In Th . intermedium , 14 chromosomes had wide and strong hybridization signals distributed mainly on the pericentromere area and 9 chromosomes with narrow and weak signals on the pericentromere area. The remaining chromosomes displayed a very weak or no signal. Sequential FISH/GISH on Th . intermedium chromosomes using the DNAs of microdissected chromosome, Pseudoroegneria spicata (St genome) and pDbH12 (a Js genome specific probe) as the probes indicated that the microdissected chromosome belonged to the St genome, three genomes (Js, J and St) in Th . intermedium could be distinguished, in which there is no hybridization signal on J genome that is similar to the genome of Th . bessarabicum . Our results showed that the smallest alien chromosomes may represent a truncated chromosome and the repetitive sequence distribution might be similar in different chromosomes within the St genome. However, the repetitive sequence distributions are different within the Js genome, within a single chromosome, and among different genomes in Th . intermedium . Our results suggested that chromosome painting could be feasible in some plants and useful in detecting chromosome variation and repetitive sequence distribution in different genomes of polyploidy plants, which is helpful for understanding the evolution of different

Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

African Journals Online (AJOL)

STORAGESEVER

2009-08-04

Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

The growth performance of F1 transgenic mutiara catfish

Science.gov (United States)

Iskandar; Buwono, I. D.; Agung, M. U. K.

2018-04-01

The growth of catfish (African or Sangkuriang strain) these days is tend to decreased. One of the solutions due to this problem is to improve the genetics of growth using transgenesis technology, toward more profitable. The specific objective of the research is to detect the transmission of exogenous GH (African catfish GH inserts) inside the F1 transgenic Mutiara catfish using PCR (Polymerase Chain Reaction) method and to evaluate the growth performance of transgenic Mutiara catfish made using the parameters of feed conversion (FCR = Feed Conversion Ratio). Transgenic catfish (strain mutiara) F0 and F1 carried African catfish GH (600 bp) can be produced. Superiority characters of transgenic catfish represented heritability (h2 ) and heterosis (H), indicating that the offspring of hybrid F1 transgenic mutiara catfish had phenotypes rapid growth (h2 = 17.55 % and H = 42.83 %) compared to non-transgenic catfish (h 2 = 10.07 % and H = 18.56 %). Evaluation of the efficiency of feed use parameters feed conversion ratio, shows that F1 transgenic mutiara catfish (FCR = 0.85) more efficient in converting feed into meat.

Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

African Journals Online (AJOL)

Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

Sex-chromosome anaphase movements in crane-fly spermatocytes are coordinated: ultraviolet microbeam irradiation of one kinetochore of one sex chromosome blocks the movements of both sex chromosomes

International Nuclear Information System (INIS)

Swedak, J.A.M.; Forer, A.

1987-01-01

Sex chromosomes in crane-fly spermatocytes move polewards at anaphase after the autosomes have reached the poles. We irradiated one kinetochore of one sex chromosome using an ultraviolet microbeam. When both sex chromosomes were normally oriented, irradiation of a single kinetochore permanently blocked movement of both sex chromosomes. Irradiation of non-kinetochore chromosomal regions or of spindle fibres did not block movement, or blocked movement only temporarily. We argue that ultraviolet irradiation of one kinetochore blocks movement of both sex chromosomes because of effects on a 'signal' system. Irradiation of one kinetochore of a maloriented sex chromosome did not block motion of either sex chromosome. However, irradiation of one kinetochore of a normally oriented sex chromosome permanently blocked motion of both that sex chromosome and the maloriented sex chromosome. Thus for the signal system to allow the sex chromosomes to move to the pole each sex chromosome must have one spindle fibre to each pole. (author)

Modeling Chromosomes

Science.gov (United States)

Robertson, Carol

2016-01-01

Learning about chromosomes is standard fare in biology classrooms today. However, students may find it difficult to understand the relationships among the "genome", "chromosomes", "genes", a "gene locus", and "alleles". In the simple activity described in this article, which follows the 5E approach…

Chromosomal Conditions

Science.gov (United States)

... and more. Stony Point, NY 10980 Close X Home > Complications & Loss > Birth defects & other health conditions > Chromosomal conditions Chromosomal conditions ... Disorders See also: Genetic counseling , Your family health history Last reviewed: February, 2013 ... labor & premature birth The newborn intensive care unit (NICU) Birth defects & ...

Electochemical detection of chromosome translocation

DEFF Research Database (Denmark)

Kwasny, Dorota; Dimaki, Maria; Silahtaroglu, Asli

2014-01-01

Cytogenetics is a study of the cell structure with a main focus on chromosomes content and their structure. Chromosome abnormalities, such as translocations may cause various genetic disorders and heametological malignancies. Chromosome translocations are structural rearrangements of two...... chromosomes that results in formation of derivative chromosomes with a mixed DNA sequence. The method currently used for their detection is Fluorescent In Situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the derivative chromosomes. We present here a double...... hybridization approach developed for label-free detection of the chromosome translocations. For specific translocation detection it is necessary to determine that the two DNA sequences forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The electrochemical...

The Dmp1-SOST Transgene Interacts With and Downregulates the Dmp1-Cre Transgene and the Rosa(Notch) Allele.

Science.gov (United States)

Zanotti, Stefano; Canalis, Ernesto

2016-05-01

Activation of Notch1 in osteocytes of Rosa(Notch) mice, where a loxP-flanked STOP cassette and the Nicd coding sequence were targeted to the reverse orientation splice acceptor (Rosa)26 locus, causes osteopetrosis associated with suppressed Sost expression and enhanced Wnt signaling. To determine whether Sost downregulation mediates the effects of Notch activation in osteocytes, Rosa(Notch) mice were crossed with transgenics expressing Cre recombinase or SOST under the control of the dentin matrix protein (Dmp)1 promoter. Dmp1-SOST transgenics displayed vertebral osteopenia and a modest femoral cancellous and cortical bone phenotype, whereas hemizygous Dmp1-Cre transgenics heterozygous for the Rosa(Notch) allele (Dmp1-Cre;Rosa(Notch)) exhibited osteopetrosis. The phenotype of Notch activation in osteocytes was prevented in Dmp1-Cre;Rosa(Notch) mice hemizygous for the Dmp1-SOST transgene. The effect was associated with downregulated Notch signaling and suppressed Dmp1 and Rosa26 expression. To test whether SOST regulates Notch expression in osteocytes, cortical bone cultures from Dmp1-Cre;Rosa(Notch) mice or from Rosa(Notch) control littermates were exposed to recombinant human SOST. The addition of SOST had only modest effects on Notch target gene mRNA levels and suppressed Dmp1, but not Cre or Rosa26, expression. These findings suggest that prevention of the Dmp1-Cre;Rosa(Notch) skeletal phenotype by Dmp1-SOST is not secondary to SOST expression but to interactions among the Dmp1-SOST and Dmp1-Cre transgenes and the Rosa26 locus. In conclusion, the Dmp1-SOST transgene suppresses the expression of the Dmp1-Cre transgene and of Rosa26. © 2015 Wiley Periodicals, Inc.

Transgene teknikker erstatter problematisk avl

DEFF Research Database (Denmark)

Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

2016-01-01

Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

Microdissection and chromosome painting of the alien chromosome in an addition line of wheat--Thinopyrum intermedium.

Directory of Open Access Journals (Sweden)

Chuanliang Deng

Full Text Available In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat--Thinopyrum intermedium addition line, and the chromosomes of the three different genomes of Th. Intermedium. The smallest alien chromosome of TAi-27 was microdissected and its DNA amplified by DOP-PCR was used as a probe to hybridize with metaphase chromosomes of TAi-27 and Th. intermedium. Results showed that hybridization signals were observed in all regions of a pair of the smallest alien chromosomes and the pericentromeric area of another pair of alien chromosomes in TAi-27, indicating that the probe from microdissected chromosome is species specific. In Th. intermedium, 14 chromosomes had wide and strong hybridization signals distributed mainly on the pericentromere area and 9 chromosomes with narrow and weak signals on the pericentromere area. The remaining chromosomes displayed a very weak or no signal. Sequential FISH/GISH on Th. intermedium chromosomes using the DNAs of microdissected chromosome, Pseudoroegneria spicata (St genome and pDbH12 (a J(s genome specific probe as the probes indicated that the microdissected chromosome belonged to the St genome, three genomes (J(s , J and St in Th. intermedium could be distinguished, in which there is no hybridization signal on J genome that is similar to the genome of Th. bessarabicum. Our results showed that the smallest alien chromosomes may represent a truncated chromosome and the repetitive sequence distribution might be similar in different chromosomes within the St genome. However, the repetitive sequence distributions are different within the J(s genome, within a single chromosome, and among different genomes in Th. intermedium. Our results suggested that chromosome painting could be feasible in some plants and useful in detecting chromosome variation and repetitive sequence distribution in different genomes of polyploidy plants, which is helpful for understanding the evolution of

Physical mapping of chromosome 8p22 markers and their homozygous deletion in a metastatic prostate cancer

Energy Technology Data Exchange (ETDEWEB)

Bova, G.S.; Pin, S.S.; Isaacs, W.B. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)]|[Brady Urological Institute, Baltimore, MD (United States)] [and others

1996-07-01

Numerous studies have implicated the short arm of chromosome 8 as the site of one or more tumor suppressor genes inactivated in carcinogenesis of the prostate, colon, lung, and liver. Previously, we identified a homozygous deletion on chromosome 8p22 in a metastatic prostate cancer. To map this homozygous deletion physically, long-range restriction mapping was performed using yeast artificial chromosomes (YACs) spanning approximately 2 Mb of chromosome band 8p22. Subcloned genomic DNA and cDNA probes isolated by hybrid capture from these YACs were mapped in relation to one another, reinforcing map integrity. Mapped single-copy probes from the region were then applied to DNA isolated from a metastatic prostate cancer containing a chromosome 8p22 homozygous deletion and indicated that its deletion spans 730-970 kb. Candidate genes PRLTS (PDGF-receptor {beta}-like tumor suppressor) and CTSB (cathepsin B) are located outside the region of homozygous deletion. Genethon marker D8S549 is located approximately at the center of this region of homozygous deletion. Two new microsatellite polymorphisms, D8S1991 and D8S1992, also located within the region of homozygous deletion on chromosome 8p22, are described. Physical mapping places cosmid CI8-2644 telomeric to MSR (macrophage scavenger receptor), the reverse of a previously published map, altering the interpretation of published deletion studies. This work should prove helpful in the identification of candidate tumor suppressor genes in this region. 47 refs., 5 figs., 1 tab.

Recent advances in the development of new transgenic animal technology.

Science.gov (United States)

Miao, Xiangyang

2013-03-01

Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

Chromosomal mapping of canine-derived BAC clones to the red fox and American mink genomes.

Science.gov (United States)

Kukekova, Anna V; Vorobieva, Nadegda V; Beklemisheva, Violetta R; Johnson, Jennifer L; Temnykh, Svetlana V; Yudkin, Dmitry V; Trut, Lyudmila N; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D; Acland, Gregory M; Graphodatsky, Alexander S

2009-01-01

High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene-containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations.

Pure chromosome-specific PCR libraries from single sorted chromosomes

NARCIS (Netherlands)

VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

1994-01-01

Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

Chromosomal homologies among vampire bats revealed by chromosome painting (phyllostomidae, chiroptera).

Science.gov (United States)

Sotero-Caio, C G; Pieczarka, J C; Nagamachi, C Y; Gomes, A J B; Lira, T C; O'Brien, P C M; Ferguson-Smith, M A; Souza, M J; Santos, N

2011-01-01

Substantial effort has been made to elucidate karyotypic evolution of phyllostomid bats, mostly through comparisons of G-banding patterns. However, due to the limited number of G-bands in respective karyotypes and to the similarity of non-homologous bands, an accurate evolutionary history of chromosome segments remains questionable. This is the case for vampire bats (Desmodontinae). Despite several proposed homologies, banding data have not yet provided a detailed understanding of the chromosomal changes within vampire genera. We examined karyotype differentiation of the 3 species within this subfamily using whole chromosomal probes from Phyllostomus hastatus (Phyllostominae) and Carollia brevicauda (Carolliinae). Painting probes of P. hastatus respectively detected 22, 21 and 23 conserved segments in Diphylla ecaudata, Diaemus youngi, and Desmodus rotundus karyotypes, whereas 27, 27 and 28 were respectively detectedwith C. brevicauda paints. Based on the evolutionary relationships proposed by morphological and molecular data, we present probable chromosomal synapomorphies for vampire bats and propose chromosomes that were present in the common ancestor of the 5 genera analyzed. Karyotype comparisons allowed us to relate a number of conserved chromosomal segments among the 5 species, providing a broader database for understanding karyotype evolution in the family. 2010 S. Karger AG, Basel.

Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

Directory of Open Access Journals (Sweden)

Sachin Kajla

Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

Establishment of a mouse model with misregulated chromosome condensation due to defective Mcph1 function.

Directory of Open Access Journals (Sweden)

Marc Trimborn

Full Text Available Mutations in the human gene MCPH1 cause primary microcephaly associated with a unique cellular phenotype with premature chromosome condensation (PCC in early G2 phase and delayed decondensation post-mitosis (PCC syndrome. The gene encodes the BRCT-domain containing protein microcephalin/BRIT1. Apart from its role in the regulation of chromosome condensation, the protein is involved in the cellular response to DNA damage. We report here on the first mouse model of impaired Mcph1-function. The model was established based on an embryonic stem cell line from BayGenomics (RR0608 containing a gene trap in intron 12 of the Mcph1 gene deleting the C-terminal BRCT-domain of the protein. Although residual wild type allele can be detected by quantitative real-time PCR cell cultures generated from mouse tissues bearing the homozygous gene trap mutation display the cellular phenotype of misregulated chromosome condensation that is characteristic for the human disorder, confirming defective Mcph1 function due to the gene trap mutation. While surprisingly the DNA damage response (formation of repair foci, chromosomal breakage, and G2/M checkpoint function after irradiation appears to be largely normal in cell cultures derived from Mcph1(gt/gt mice, the overall survival rates of the Mcph1(gt/gt animals are significantly reduced compared to wild type and heterozygous mice. However, we could not detect clear signs of premature malignant disease development due to the perturbed Mcph1 function. Moreover, the animals show no obvious physical phenotype and no reduced fertility. Body and brain size are within the range of wild type controls. Gene expression on RNA and protein level did not reveal any specific pattern of differentially regulated genes. To the best of our knowledge this represents the first mammalian transgenic model displaying a defect in mitotic chromosome condensation and is also the first mouse model for impaired Mcph1-function.

Establishment of a mouse model with misregulated chromosome condensation due to defective Mcph1 function.

Science.gov (United States)

Trimborn, Marc; Ghani, Mahdi; Walther, Diego J; Dopatka, Monika; Dutrannoy, Véronique; Busche, Andreas; Meyer, Franziska; Nowak, Stefanie; Nowak, Jean; Zabel, Claus; Klose, Joachim; Esquitino, Veronica; Garshasbi, Masoud; Kuss, Andreas W; Ropers, Hans-Hilger; Mueller, Susanne; Poehlmann, Charlotte; Gavvovidis, Ioannis; Schindler, Detlev; Sperling, Karl; Neitzel, Heidemarie

2010-02-16

Mutations in the human gene MCPH1 cause primary microcephaly associated with a unique cellular phenotype with premature chromosome condensation (PCC) in early G2 phase and delayed decondensation post-mitosis (PCC syndrome). The gene encodes the BRCT-domain containing protein microcephalin/BRIT1. Apart from its role in the regulation of chromosome condensation, the protein is involved in the cellular response to DNA damage. We report here on the first mouse model of impaired Mcph1-function. The model was established based on an embryonic stem cell line from BayGenomics (RR0608) containing a gene trap in intron 12 of the Mcph1 gene deleting the C-terminal BRCT-domain of the protein. Although residual wild type allele can be detected by quantitative real-time PCR cell cultures generated from mouse tissues bearing the homozygous gene trap mutation display the cellular phenotype of misregulated chromosome condensation that is characteristic for the human disorder, confirming defective Mcph1 function due to the gene trap mutation. While surprisingly the DNA damage response (formation of repair foci, chromosomal breakage, and G2/M checkpoint function after irradiation) appears to be largely normal in cell cultures derived from Mcph1(gt/gt) mice, the overall survival rates of the Mcph1(gt/gt) animals are significantly reduced compared to wild type and heterozygous mice. However, we could not detect clear signs of premature malignant disease development due to the perturbed Mcph1 function. Moreover, the animals show no obvious physical phenotype and no reduced fertility. Body and brain size are within the range of wild type controls. Gene expression on RNA and protein level did not reveal any specific pattern of differentially regulated genes. To the best of our knowledge this represents the first mammalian transgenic model displaying a defect in mitotic chromosome condensation and is also the first mouse model for impaired Mcph1-function.

The X chromosome in space.

Science.gov (United States)

Jégu, Teddy; Aeby, Eric; Lee, Jeannie T

2017-06-01

Extensive 3D folding is required to package a genome into the tiny nuclear space, and this packaging must be compatible with proper gene expression. Thus, in the well-hierarchized nucleus, chromosomes occupy discrete territories and adopt specific 3D organizational structures that facilitate interactions between regulatory elements for gene expression. The mammalian X chromosome exemplifies this structure-function relationship. Recent studies have shown that, upon X-chromosome inactivation, active and inactive X chromosomes localize to different subnuclear positions and adopt distinct chromosomal architectures that reflect their activity states. Here, we review the roles of long non-coding RNAs, chromosomal organizational structures and the subnuclear localization of chromosomes as they relate to X-linked gene expression.

in transgenic cucumber

African Journals Online (AJOL)

Jane

2011-07-18

Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

Energy Technology Data Exchange (ETDEWEB)

Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

2009-01-30

Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

The ecological risks of transgenic plants.

Science.gov (United States)

Giovannetti, Manuela

2003-01-01

Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.

Advancing environmental risk assessment for transgenic biofeedstock crops

Directory of Open Access Journals (Sweden)

Wolt Jeffrey D

2009-11-01

Full Text Available Abstract Transgenic modification of plants is a key enabling technology for developing sustainable biofeedstocks for biofuels production. Regulatory decisions and the wider acceptance and development of transgenic biofeedstock crops are considered from the context of science-based risk assessment. The risk assessment paradigm for transgenic biofeedstock crops is fundamentally no different from that of current generation transgenic crops, except that the focus of the assessment must consider the unique attributes of a given biofeedstock crop and its environmental release. For currently envisioned biofeedstock crops, particular emphasis in risk assessment will be given to characterization of altered metabolic profiles and their implications relative to non-target environmental effects and food safety; weediness and invasiveness when plants are modified for abiotic stress tolerance or are domesticated; and aggregate risk when plants are platforms for multi-product production. Robust risk assessments for transgenic biofeedstock crops are case-specific, initiated through problem formulation, and use tiered approaches for risk characterization.

New Y chromosomes and early stages of sex chromosome ...

Indian Academy of Sciences (India)

2010-09-06

Sep 6, 2010 ... chromosomes are evolutionary consequences of that func- tion. Given sufficient ... (for a review, see Charlesworth et al. 2005). ... In the present paper, I review sex deter- mination .... part had apparently been exchanged against the homologous ... age group III-Y chromosomes were successful while in well-.

Using 3-color chromosome painting to decide between chromosome aberration models

International Nuclear Information System (INIS)

Lucas, J.N.; Sachs, R.K.

1993-01-01

Ionizing radiation produces chromosome aberrations when DNA double strand breaks (DSB) interact pairwise. For more than 30 years there have been two main, competing theories of such binary DSB interactions. The classical theory asserts that an unrepaired DSB makes two ends which separate, with each end subsequently able to join any similar (non-telomeric) end. The exchange theory asserts that the two DSB ends remain associated until repair or a reciprocal chromosome exchange involving a second DSB occurs. The authors conducted an experiment to test these models, using 3-color chromosome painting. After in vitro irradiation of resting human lymphocytes, they observed cells with three-color triplets at first metaphase: three derivative chromosomes having permuted colors, as if three broken chromosomes had played musical chairs. On the exchange model in its standard form such 3-color triplets cannot occur. On the classical model the expected frequency can be calculated. They report data and computer calculations which exclude the exchange model and favor the classical model

Persistence of chromosomal abnormalities additional to the Philadelphia chromosome after Philadelphia chromosome disappearance during imatinib therapy for chronic myeloid leukemia.

Science.gov (United States)

Zaccaria, Alfonso; Valenti, Anna Maria; Donti, Emilio; Gozzetti, Alessandro; Ronconi, Sonia; Spedicato, Francesco

2007-04-01

Five Philadelphia chromosome positive (Ph+) chronic myeloid leukemia (CML) patients with additional chromosome abnormalities at diagnosis have been followed during Imatinib therapy. In all, the Ph chromosome disappeared, while the 5 cases, additional abnormalities [dup(1); del(5), +8 (2 patients) and +14] persisted in the subsequent studies, performed over a period of 11 to 49 months, either alone or together with a karyotypically normal cell population. This finding is consistent with a secondary origin of the Ph chromosome in these patients. It is still to early to evaluate the possible prognostic value of these additional abnormalities.

Preliminarily study on the maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on gastropods

Science.gov (United States)

Zhu, Tingbing; Zhang, Lihong; Zhang, Tanglin; Wang, Yaping; Hu, Wei; Olsen, Rolf Eric; Zhu, Zuoyan

2017-10-01

The present study preliminarily examined the differences in maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on four gastropods species (Bellamya aeruginosa, Radix auricularia, Parafossarulus sinensis and Alocinma longicornis) under laboratory conditions. In the maximum handling size trial, five fish from each age group (1-year-old and 2-year-old) and each genotype (transgenic and non-transgenic) of common carp were individually allowed to feed on B. aeruginosa with wide shell height range. The results showed that maximum handling size increased linearly with fish length, and there was no significant difference in maximum handling size between the two genotypes. In the size selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on three size groups of B. aeruginosa. The results show that the two genotypes of C. carpio favored the small-sized group over the large-sized group. In the species selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on thin-shelled B. aeruginosa and thick-shelled R. auricularia, and five pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on two gastropods species (P. sinensis and A. longicornis) with similar size and shell strength. The results showed that both genotypes preferred thin-shelled Radix auricularia rather than thick-shelled B. aeruginosa, but there were no significant difference in selectivity between the two genotypes when fed on P. sinensis and A. longicornis. The present study indicates that transgenic and non-transgenic C. carpio show similar selectivity of predation on the size- and species-limited gastropods. While this information may be useful for assessing the environmental risk of transgenic carp, it does not necessarily demonstrate that transgenic common carp might

Reproductive Incompatibility Involving Senegalese Aedes aegypti (L Is Associated with Chromosome Rearrangements.

Directory of Open Access Journals (Sweden)

Laura B Dickson

2016-04-01

Full Text Available Aedes aegypti, the primary vector of dengue, yellow fever and Zika flaviviruses, consists of at least two subspecies. Aedes aegypti (Aaa is light in color, has pale scales on the first abdominal tergite, oviposits in artificial containers, and preferentially feeds on humans. Aedes aegypti formosus (Aaf, has a dark cuticle, is restricted to sub-Saharan Africa, has no pale scales on the first abdominal tergite and frequently oviposits in natural containers. Scale patterns correlate with cuticle color in East Africa but not in Senegal, West Africa where black cuticle mosquitoes display a continuum of scaling patterns and breed domestically indoors. An earlier laboratory study did not indicate any pre- or postzygotic barriers to gene flow between Aaa and Aaf in East Africa. However, similar attempts to construct F1 intercross families between Aaa laboratory strains and Senegal Ae. aegypti (SenAae failed due to poor F1 oviposition and low F2 egg-to-adult survival. Insemination and assortative mating experiments failed to identify prezygotic mating barriers. Backcrosses were performed to test for postzygotic isolation patterns consistent with Haldane's rule modified for species, like Aedes, that have an autosomal sex determining locus (SDL. Egg-pupal survival was predicted to be low in females mated to hybrid F1 males but average when a male mates with a hybrid F1 female. Survival was in fact significantly reduced when females mated to hybrid males but egg-pupal survival was significantly increased when males were mated to hybrid F1 females. These observations are therefore inconclusive with regards to Haldane's rule. Basic cytogenetic analyses and Fluorescent In Situ Hybridization (FISH experiments were performed to compare SenAae strains with the IB12 strain of Aaa that was used for genome sequencing and physical mapping. Some SenAae strains had longer chromosomes than IB12 and significantly different centromeric indices on chromosomes 1 and 3. DAPI

Reproductive Incompatibility Involving Senegalese Aedes aegypti (L) Is Associated with Chromosome Rearrangements

Science.gov (United States)

Dickson, Laura B.; Sharakhova, Maria V.; Timoshevskiy, Vladimir A.; Fleming, Karen L.; Caspary, Alex; Sylla, Massamba; Black, William C.

2016-01-01

Aedes aegypti, the primary vector of dengue, yellow fever and Zika flaviviruses, consists of at least two subspecies. Aedes aegypti (Aaa) is light in color, has pale scales on the first abdominal tergite, oviposits in artificial containers, and preferentially feeds on humans. Aedes aegypti formosus (Aaf), has a dark cuticle, is restricted to sub-Saharan Africa, has no pale scales on the first abdominal tergite and frequently oviposits in natural containers. Scale patterns correlate with cuticle color in East Africa but not in Senegal, West Africa where black cuticle mosquitoes display a continuum of scaling patterns and breed domestically indoors. An earlier laboratory study did not indicate any pre- or postzygotic barriers to gene flow between Aaa and Aaf in East Africa. However, similar attempts to construct F1 intercross families between Aaa laboratory strains and Senegal Ae. aegypti (SenAae) failed due to poor F1 oviposition and low F2 egg-to-adult survival. Insemination and assortative mating experiments failed to identify prezygotic mating barriers. Backcrosses were performed to test for postzygotic isolation patterns consistent with Haldane’s rule modified for species, like Aedes, that have an autosomal sex determining locus (SDL). Egg-pupal survival was predicted to be low in females mated to hybrid F1 males but average when a male mates with a hybrid F1 female. Survival was in fact significantly reduced when females mated to hybrid males but egg-pupal survival was significantly increased when males were mated to hybrid F1 females. These observations are therefore inconclusive with regards to Haldane’s rule. Basic cytogenetic analyses and Fluorescent In Situ Hybridization (FISH) experiments were performed to compare SenAae strains with the IB12 strain of Aaa that was used for genome sequencing and physical mapping. Some SenAae strains had longer chromosomes than IB12 and significantly different centromeric indices on chromosomes 1 and 3. DAPI staining

Non-Mendelian Dominant Maternal Effects Caused by CRISPR/Cas9 Transgenic Components in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Chun-Chieh Lin

2016-11-01

Full Text Available The CRISPR/Cas9 system has revolutionized genomic editing. The Cas9 endonuclease targets DNA via an experimentally determined guide RNA (gRNA. This results in a double-strand break at the target site . We generated transgenic Drosophila melanogaster in which the CRISPR/Cas9 system was used to target a GAL4 transgene in vivo. To our surprise, progeny whose genomes did not contain CRISPR/Cas9 components were still capable of mutating GAL4 sequences. We demonstrate this effect was caused by maternal deposition of Cas9 and gRNAs into the embryo, leading to extensive GAL4 mutations in both somatic and germline tissues. This serves as a cautionary observation on the effects of maternal contributions when conducting experiments using genomically encoded CRISPR/Cas9 components. These results also highlight a mode of artificial inheritance in which maternal contributions of DNA editing components lead to transmissible mutant defects even in animals whose genomes lack the editing components. We suggest calling this a dominant maternal effect to reflect it is caused by the gain of maternally contributed products. Models of CRISPR-mediated gene drive will need to incorporate dominant maternal effects in order to accurately predict the efficiency and dynamics of gene drive in a population.

Chromosomal instability and double minute chromosomes in a breast cancer patient

International Nuclear Information System (INIS)

Lalic, H.; Radosevic-Stasic, B.

2004-01-01

Cytogenetic analysis was performed in peripheral blood lymphocytes (PBL) of a woman with ductal breast carcinoma, who as a hospital employee was exposed professionally for 15 years to low doses of ionizing radiation. The most important finding after the chemotherapy in combination with radiotherapy was the presence of double minutes (DM) chromosomes, in combination with other chromosomal abnormalities (on 200 scored metaphases were found 2 chromatid breaks, 10 dicentrics, 11 acentric fragments, 2 gaps, and 3 double min chromosomes). In a repeated analysis (after 6 months), DM chromosomes were still present. To rule out the possibility that the patient was overexposed to ionizing radiation at work, her blood test was compared with a group of coworkers as well as with a group of professionally unexposed people. The data rejected this possibility, but the retroactive analysis showed that the patient even at the time of employment had a moderately increased number of chromosomal aberrations (3.5%) consisting of 3 isochromatids and 4 gaps, suggesting that her initial genomic instability enhanced the later development. The finding of a continuous presence of rare DM chromosomes in her PBL (4 and 10 months after radio-chemotherapy) was considered as an indicator of additional risk, which might have some prognostic significance. (author)

Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

DEFF Research Database (Denmark)

Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

2012-01-01

Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

Chromosome painting in plants.

NARCIS (Netherlands)

Schubert, I.; Fransz, P.F.; Fuchs, J.; Jong, de J.H.

2001-01-01

The current 'state-of-art' as to chromosome painting in plants is reviewed. We define different situations described as painting so far: i) Genomic in situ hybridisation (GISH) with total genomic DNA to distinguish alien chromosomes on the basis of divergent dispersed repeats, ii) 'Chromosomal in

Noninvolvement of the X chromosome in radiation-induced chromosome translocations in the human lymphoblastoid cell line TK6

International Nuclear Information System (INIS)

Jordan, R.; Schwartz, J.L.

1994-01-01

Fluorescence in situ hybridization procedures were used to examine the influence of chromosome locus on the frequency and type of chromosome aberrations induced by 60 Co γ rays in the human lymphoblastoid cell line TK6. Aberrations involving the X chromosome were compared to those involving the similarly sized autosome chromosome 7. When corrected for DNA content, acentric fragments were induced with equal frequency in the X and 7 chromosomes. Dose-dependent increases in chromosomal interchanges involving chromosome 7 were noted, and the frequencies of balanced translocations and dicentrics produced were approximately equal. Chromosome interchanges involving the X chromosome were rare and showed no apparent dose dependence. Thus, while chromosomes 7 and X are equally sensitive to the induction of chromosome breaks, the X chromosome is much less likely to interact with autosomes than chromosome 7. The noninvolvement of the X chromosome in translocations with autosomes may reflect a more peripheral and separate location for the X chromosome in the mammalian nucleus. 20 refs., 2 figs., 1 tab

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots

DEFF Research Database (Denmark)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke

2014-01-01

induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots...

Chromosome painting in biological dosimetry: Semi-automatic system to score stable chromosome aberrations

International Nuclear Information System (INIS)

Garcia-Sagredo, J.M.; Vallcorba, I.; Sanchez-Hombre, M.C.; Ferro, M.T.; San Roman Cos-Gayon, C.; Santos, A.; Malpica, N.; Ortiz, C.

1997-01-01

From the beginning of the description of the procedure of chromosome painting by fluorescence in situ hybridization (FISH), it was thought its possible application to score induced chromosomal aberrations in radiation exposition. With chromosome painting it is possible to detect changes between chromosomes that has been validated in radiation exposition. Translocation scoring by FISH, contrarily to the unstable dicentrics, mainly detect stable chromosome aberrations that do not disappear, it allows the capability of quantify delayed acute expositions or chronic cumulative expositions. The large number of cells that have to be analyzed for high accuracy, specially when dealing with low radiation doses, makes it almost imperative to use an automatic analysis system. After validate translocation scoring by FISH in our, we have evaluated the ability and sensitivity to detect chromosomal aberrations by chromosome using different paint probes used, showing that any combination of paint probes can be used to score induced chromosomal aberrations. Our group has developed a FISH analysis that is currently being adapted for translocation scoring analysis. It includes systematic error correction and internal control probes. The performance tests carried out show that 9,000 cells can be analyzed in 10 hr. using a Sparc 4/370. Although with a faster computer, a higher throughput is expected, for large population screening or very low radiation doses, this performance still has to be improved. (author)

Comprehensive cytological characterization of the Gossypium hirsutum genome based on the development of a set of chromosome cytological markers

Institute of Scientific and Technical Information of China (English)

Wenbo; Shan; Yanqin; Jiang; Jinlei; Han; Kai; Wang

2016-01-01

Cotton is the world’s most important natural fiber crop. It is also a model system for studying polyploidization, genomic organization, and genome-size variation. Integrating the cytological characterization of cotton with its genetic map will be essential for understanding its genome structure and evolution, as well as for performing further genetic-map based mapping and cloning. In this study, we isolated a complete set of bacterial artificial chromosome clones anchored to each of the 52 chromosome arms of the tetraploid cotton Gossypium hirsutum. Combining these with telomere and centromere markers, we constructed a standard karyotype for the G. hirsutum inbred line TM-1. We dissected the chromosome arm localizations of the 45 S and 5S r DNA and suggest a centromere repositioning event in the homoeologous chromosomes AT09 and DT09. By integrating a systematic karyotype analysis with the genetic linkage map, we observed different genome sizes and chromosomal structures between the subgenomes of the tetraploid cotton and those of its diploid ancestors. Using evidence of conserved coding sequences, we suggest that the different evolutionary paths of non-coding retrotransposons account for most of the variation in size between the subgenomes of tetraploid cotton and its diploid ancestors. These results provide insights into the cotton genome and will facilitate further genome studies in G. hirsutum.

Comprehensive cytological characterization of the Gossypium hirsutum genome based on the development of a set of chromosome cytological markers

Directory of Open Access Journals (Sweden)

Wenbo Shan

2016-08-01

Full Text Available Cotton is the world's most important natural fiber crop. It is also a model system for studying polyploidization, genomic organization, and genome-size variation. Integrating the cytological characterization of cotton with its genetic map will be essential for understanding its genome structure and evolution, as well as for performing further genetic-map based mapping and cloning. In this study, we isolated a complete set of bacterial artificial chromosome clones anchored to each of the 52 chromosome arms of the tetraploid cotton Gossypium hirsutum. Combining these with telomere and centromere markers, we constructed a standard karyotype for the G. hirsutum inbred line TM-1. We dissected the chromosome arm localizations of the 45S and 5S rDNA and suggest a centromere repositioning event in the homoeologous chromosomes AT09 and DT09. By integrating a systematic karyotype analysis with the genetic linkage map, we observed different genome sizes and chromosomal structures between the subgenomes of the tetraploid cotton and those of its diploid ancestors. Using evidence of conserved coding sequences, we suggest that the different evolutionary paths of non-coding retrotransposons account for most of the variation in size between the subgenomes of tetraploid cotton and its diploid ancestors. These results provide insights into the cotton genome and will facilitate further genome studies in G. hirsutum.

Over-representation of specific regions of chromosome 22 in cells from human glioma correlate with resistance to 1,3-bis(2-chloroethyl)-1-nitrosourea

International Nuclear Information System (INIS)

Hank, Nicole C; Shapiro, Joan Rankin; Scheck, Adrienne C

2006-01-01

Glioblastoma multiforme is the most malignant form of brain tumor. Despite treatment including surgical resection, adjuvant chemotherapy, and radiation, these tumors typically recur. The recurrent tumor is often resistant to further therapy with the same agent, suggesting that the surviving cells that repopulate the tumor mass have an intrinsic genetic advantage. We previously demonstrated that cells selected for resistance to 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) are near-diploid, with over-representation of part or all of chromosomes 7 and 22. While cells from untreated gliomas often have over-representation of chromosome 7, chromosome 22 is typically under-represented. We have analyzed cells from primary and recurrent tumors from the same patient before and after in vitro selection for resistance to clinically relevant doses of BCNU. Karyotypic analyses were done to demonstrate the genetic makeup of these cells, and fluorescent in situ hybridization analyses have defined the region(s) of chromosome 22 retained in these BCNU-resistant cells. Karyotypic analyses demonstrated that cells selected for BCNU resistance were near-diploid with over-representation of chromosomes 7 and 22. In cells where whole copies of chromosome 22 were not identified, numerous fragments of this chromosome were retained and inserted into several marker and derivative chromosomes. Fluorescent in situ hybridization analyses using whole chromosome paints confirmed this finding. Additional FISH analysis using bacterial artificial chromosome probes spanning the length of chromosome 22 have allowed us to map the over-represented region to 22q12.3–13.32. Cells selected for BCNU resistance either in vivo or in vitro retain sequences mapped to chromosome 22. The specific over-representation of sequences mapped to 22q12.3–13.32 suggest the presence of a DNA sequence important to BCNU survival and/or resistance located in this region of chromosome 22

Reproductive fitness of outcrossed hybrids between transgenic broccoli (brassica oleracea) carrying the ipt transgene and conventional varieties of kale, broccoli and cauliflower

International Nuclear Information System (INIS)

Ting, P.; Tu, Y.; Lin, C.; Chang, H.; Chen, L.; Litfu, A

2014-01-01

Pollens are potential carriers for genetically modified crops to transfer genetic materials horizontally to other plants. For phanerogams, pollen viability and cross-compatibility are critical factors for successful outcross hybridization. To evaluate this possibility, this project investigated pollen viability and pod setting rate by comparing broccoli (Brassica oleracea L. var. italica Planck) and broccoli transformed with the isopentenyl transferase (ipt) gene. Both served as pollen donors and four other varieties as pollen receptors to determine outcross rates. For pollen viability, F1 progeny was higher (p?0.05) for the cross of transgenic ipt broccoli with Li Syue significantly by FDA (fluorescein diacetate) assay. Higher successful hybrids were observed for transgenic ipt broccoli with Fu Yue, Li Syue and Green King. As pollen properties, number and grain diameter were significantly larger (p?0.05) in hybrid combinations of transgenic ipt broccoli with Li Syue and Green King significantly (p?0.05). The pod setting rates were higher while transgenic ipt broccoli served as donor plant. These results analyzing pollen properties between transgenic crops with possible outcross candidates would serve as one of those critical strategies for evaluating environmental biosafety issues for transgenic crops. (author)

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Chromosomal abnormalities in roots of aquatic plant Elodea canadensis as a tool for testing genotoxicity of bottom sediments.

Science.gov (United States)

Zotina, Tatiana; Medvedeva, Marina; Trofimova, Elena; Alexandrova, Yuliyana; Dementyev, Dmitry; Bolsunovsky, Alexander

2015-12-01

Submersed freshwater macrophytes are considered as relevant indicators for use in bulk bottom sediment contact tests. The purpose of this study was to estimate the validity of endpoints of aquatic plant Elodea canadensis for laboratory genotoxicity testing of natural bottom sediments. The inherent level of chromosome abnormalities (on artificial sediments) in roots of E. canadensis under laboratory conditions was lower than the percentage of abnormal cells in bulk sediments from the Yenisei River. The percentage of abnormal cells in roots of E. canadensis was more sensitive to the presence of genotoxic agents in laboratory contact tests than in the natural population of the plant. The spectra of chromosomal abnormalities that occur in roots of E. canadensis under natural conditions in the Yenisei River and in laboratory contact tests on the bulk bottom sediments from the Yenisei River were similar. Hence, chromosome abnormalities in roots of E. canadensis can be used as a relevant and sensitive genotoxicity endpoint in bottom sediment-contact tests. Copyright © 2015 Elsevier Inc. All rights reserved.

Drug-induced premature chromosome condensation (PCC) protocols: cytogenetic approaches in mitotic chromosome and interphase chromatin.

Science.gov (United States)

Gotoh, Eisuke

2015-01-01

Chromosome analysis is a fundamental technique which is used in wide areas of cytogenetic study including karyotyping species, hereditary diseases diagnosis, or chromosome biology study. Chromosomes are usually prepared from mitotic cells arrested by colcemid block protocol. However, obtaining mitotic chromosomes is often hampered under several circumstances. As a result, cytogenetic analysis will be sometimes difficult or even impossible in such cases. Premature chromosome condensation (PCC) (see Note 1) is an alternative method that has proved to be a unique and useful way in chromosome analysis. Former, PCC has been achieved following cell fusion method (cell-fusion PCC) mediated either by fusogenic viruses (e.g., Sendai virus) or cell fusion chemicals (e.g., polyethylene glycol), but the cell fusion PCC has several drawbacks. The novel drug-induced PCC using protein phosphatase inhibitors was introduced about 20 years ago. This method is much simpler and easier even than the conventional mitotic chromosome preparation protocol use with colcemid block and furthermore obtained PCC index (equivalent to mitotic index for metaphase chromosome) is usually much higher than colcemid block method. Moreover, this method allows the interphase chromatin to be condensed to visualize like mitotic chromosomes. Therefore drug-induced PCC has opened the way for chromosome analysis not only in metaphase chromosomes but also in interphase chromatin. The drug-induced PCC has thus proven the usefulness in cytogenetics and other cell biology fields. For this second edition version, updated modifications/changes are supplemented in Subheadings 2, 3, and 4, and a new section describing the application of PCC in chromosome science fields is added with citation of updated references.

Integrated gene mapping and synteny studies give insights into the evolution of a sex proto-chromosome in Solea senegalensis.

Science.gov (United States)

Portela-Bens, Silvia; Merlo, Manuel Alejandro; Rodríguez, María Esther; Cross, Ismael; Manchado, Manuel; Kosyakova, Nadezda; Liehr, Thomas; Rebordinos, Laureana

2017-03-01

The evolution of genes related to sex and reproduction in fish shows high plasticity and, to date, the sex determination system has only been identified in a few species. Solea senegalensis has 42 chromosomes and an XX/XY chromosome system for sex determination, while related species show the ZZ/ZW system. Next-generation sequencing (NGS), multi-color fluorescence in situ hybridization (mFISH) techniques, and bioinformatics analysis have been carried out, with the objective of revealing new information about sex determination and reproduction in S. senegalensis. To that end, several bacterial artificial chromosome (BAC) clones that contain candidate genes involved in such processes (dmrt1, dmrt2, dmrt3, dmrt4, sox3, sox6, sox8, sox9, lh, cyp19a1a, amh, vasa, aqp3, and nanos3) were analyzed and compared with the same region in other related species. Synteny studies showed that the co-localization of dmrt1-dmrt2-drmt3 in the largest metacentric chromosome of S. senegalensis is coincident with that found in the Z chromosome of Cynoglossus semilaevis, which would potentially make this a sex proto-chromosome. Phylogenetic studies show the close proximity of S. senegalensis to Oryzias latipes, a species with an XX/XY system and a sex master gene. Comparative mapping provides evidence of the preferential association of these candidate genes in particular chromosome pairs. By using the NGS and mFISH techniques, it has been possible to obtain an integrated genetic map, which shows that 15 out of 21 chromosome pairs of S. senegalensis have at least one BAC clone. This result is important for distinguishing those chromosome pairs of S. senegalensis that are similar in shape and size. The mFISH analysis shows the following co-localizations in the same chromosomes: dmrt1-dmrt2-dmrt3, dmrt4-sox9-thrb, aqp3-sox8, cyp19a1a-fshb, igsf9b-sox3, and lysg-sox6.

Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

Science.gov (United States)

Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

2012-10-01

Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

Transposon-mediated BAC transgenesis in zebrafish and mice

Directory of Open Access Journals (Sweden)

Sumiyama Kenta

2009-10-01

Full Text Available Abstract Background Bacterial artificial chromosomes (BACs are among the most widely used tools for studies of gene regulation and function in model vertebrates, yet methods for predictable delivery of BAC transgenes to the genome are currently limited. This is because BAC transgenes are usually microinjected as naked DNA into fertilized eggs and are known to integrate as multi-copy concatamers in the genome. Although conventional methods for BAC transgenesis have been very fruitful, complementary methods for generating single copy BAC integrations would be desirable for many applications. Results We took advantage of the precise cut-and-paste behavior of a natural transposon, Tol2, to develop a new method for BAC transgenesis. In this new method, the minimal sequences of the Tol2 transposon were used to deliver precisely single copies of a ~70 kb BAC transgene to the zebrafish and mouse genomes. We mapped the BAC insertion sites in the genome by standard PCR methods and confirmed transposase-mediated integrations. Conclusion The Tol2 transposon has a surprisingly large cargo capacity that can be harnessed for BAC transgenesis. The precise delivery of single-copy BAC transgenes by Tol2 represents a useful complement to conventional BAC transgenesis, and could aid greatly in the production of transgenic fish and mice for genomics projects, especially those in which single-copy integrations are desired.

Mitotic chromosome condensation in vertebrates

International Nuclear Information System (INIS)

Vagnarelli, Paola

2012-01-01

Work from several laboratories over the past 10–15 years has revealed that, within the interphase nucleus, chromosomes are organized into spatially distinct territories [T. Cremer, C. Cremer, Chromosome territories, nuclear architecture and gene regulation in mammalian cells, Nat. Rev. Genet. 2 (2001) 292–301 and T. Cremer, M. Cremer, S. Dietzel, S. Muller, I. Solovei, S. Fakan, Chromosome territories—a functional nuclear landscape, Curr. Opin. Cell Biol. 18 (2006) 307–316]. The overall compaction level and intranuclear location varies as a function of gene density for both entire chromosomes [J.A. Croft, J.M. Bridger, S. Boyle, P. Perry, P. Teague,W.A. Bickmore, Differences in the localization and morphology of chromosomes in the human nucleus, J. Cell Biol. 145 (1999) 1119–1131] and specific chromosomal regions [N.L. Mahy, P.E. Perry, S. Gilchrist, R.A. Baldock, W.A. Bickmore, Spatial organization of active and inactive genes and noncoding DNA within chromosome territories, J. Cell Biol. 157 (2002) 579–589] (Fig. 1A, A'). In prophase, when cyclin B activity reaches a high threshold, chromosome condensation occurs followed by Nuclear Envelope Breakdown (NEB) [1]. At this point vertebrate chromosomes appear as compact structures harboring an attachment point for the spindle microtubules physically recognizable as a primary constriction where the two sister chromatids are held together. The transition from an unshaped interphase chromosome to the highly structured mitotic chromosome (compare Figs. 1A and B) has fascinated researchers for several decades now; however a definite picture of how this process is achieved and regulated is not yet in our hands and it will require more investigation to comprehend the complete process. From a biochemical point of view a vertebrate mitotic chromosomes is composed of DNA, histone proteins (60%) and non-histone proteins (40%) [6]. I will discuss below what is known to date on the contribution of these two different

Mitotic chromosome condensation in vertebrates

Energy Technology Data Exchange (ETDEWEB)

Vagnarelli, Paola, E-mail: P.Vagnarelli@ed.ac.uk

2012-07-15

Work from several laboratories over the past 10-15 years has revealed that, within the interphase nucleus, chromosomes are organized into spatially distinct territories [T. Cremer, C. Cremer, Chromosome territories, nuclear architecture and gene regulation in mammalian cells, Nat. Rev. Genet. 2 (2001) 292-301 and T. Cremer, M. Cremer, S. Dietzel, S. Muller, I. Solovei, S. Fakan, Chromosome territories-a functional nuclear landscape, Curr. Opin. Cell Biol. 18 (2006) 307-316]. The overall compaction level and intranuclear location varies as a function of gene density for both entire chromosomes [J.A. Croft, J.M. Bridger, S. Boyle, P. Perry, P. Teague,W.A. Bickmore, Differences in the localization and morphology of chromosomes in the human nucleus, J. Cell Biol. 145 (1999) 1119-1131] and specific chromosomal regions [N.L. Mahy, P.E. Perry, S. Gilchrist, R.A. Baldock, W.A. Bickmore, Spatial organization of active and inactive genes and noncoding DNA within chromosome territories, J. Cell Biol. 157 (2002) 579-589] (Fig. 1A, A'). In prophase, when cyclin B activity reaches a high threshold, chromosome condensation occurs followed by Nuclear Envelope Breakdown (NEB) [1]. At this point vertebrate chromosomes appear as compact structures harboring an attachment point for the spindle microtubules physically recognizable as a primary constriction where the two sister chromatids are held together. The transition from an unshaped interphase chromosome to the highly structured mitotic chromosome (compare Figs. 1A and B) has fascinated researchers for several decades now; however a definite picture of how this process is achieved and regulated is not yet in our hands and it will require more investigation to comprehend the complete process. From a biochemical point of view a vertebrate mitotic chromosomes is composed of DNA, histone proteins (60%) and non-histone proteins (40%) [6]. I will discuss below what is known to date on the contribution of these two different classes

Design and Management of Field Trials of Transgenic Cereals

Science.gov (United States)

Bedő, Zoltán; Rakszegi, Mariann; Láng, László

The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

Expression of plant sweet protein brazzein in the milk of transgenic mice.

Directory of Open Access Journals (Sweden)

Sen Yan

Full Text Available Sugar, the most popular sweetener, is essential in daily food. However, excessive sugar intake has been associated with several lifestyle-related diseases. Finding healthier and more economical alternatives to sugars and artificial sweeteners has received increasing attention to fulfill the growing demand. Brazzein, which comes from the pulp of the edible fruit of the African plant Pentadiplandra brazzeana Baill, is a protein that is 2,000 times sweeter than sucrose by weight. Here we report the production of transgenic mice that carry the optimized brazzein gene driven by the goat Beta-casein promoter, which specifically directs gene expression in the mammary glands. Using western blot analysis and immunohistochemistry, we confirmed that brazzein could be efficiently expressed in mammalian milk, while retaining its sweetness. This study presents the possibility of producing plant protein-sweetened milk from large animals such as cattle and goats.

Chromosomal rearrangement interferes with meiotic X chromosome inactivation

Czech Academy of Sciences Publication Activity Database

Homolka, David; Ivánek, Robert; Čapková, Jana; Jansa, Petr; Forejt, Jiří

2007-01-01

Roč. 17, č. 10 (2007), s. 1431-1437 ISSN 1088-9051 R&D Projects: GA MŠk(CZ) 1M0520; GA ČR GA301/06/1334; GA ČR GA301/07/1383 Grant - others:Howard Hughes Medical Institute(US) HHMI 55000306 Institutional research plan: CEZ:AV0Z50520514 Keywords : chromosomal translocations * meiotic X chromosome inactivation * spermatogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.224, year: 2007

Expression of multiple proteins in transgenic plants

Science.gov (United States)

Vierstra, Richard D.; Walker, Joseph M.

2002-01-01

A method is disclosed for the production of multiple proteins in transgenic plants. A DNA construct for introduction into plants includes a provision to express a fusion protein of two proteins of interest joined by a linking domain including plant ubiquitin. When the fusion protein is produced in the cells of a transgenic plant transformed with the DNA construction, native enzymes present in plant cells cleave the fusion protein to release both proteins of interest into the cells of the transgenic plant. Since the proteins are produced from the same fusion protein, the initial quantities of the proteins in the cells of the plant are approximately equal.

Postmortem findings in cloned and transgenic piglets dead before weaning

DEFF Research Database (Denmark)

Schmidt, Mette; Winther, K.D.; Secher, Jan Ole Bertelsen

2015-01-01

Important factors contributing to the well-known high mortality of piglets produced by SCNT are gross malformations of vital organs. The aim of the present retrospective study was to describe malformations found in cloned piglets, transgenic or not, dying or culled before weaning on Day 28. Large...... White (LW) embryos were transferred to 78 LW recipients, while 72 recipients received Göttingen embryos (67 transgenic and five not transgenic) and 56 received Yucatan embryos (43 transgenic and 13 not transgenic). Overall pregnancy rate was 76%, and there were more abortions in recipients with minipig...... in 152 piglets, but several piglets showed two (n = 58) or more (n = 23) malformations (7.4% and 2.8% of all born, respectively). A significantly higher malformation rate was found in transgenic Göttingen and Yucatan piglets (32% and 46% of all born, respectively) than in nontransgenic LW (17...

Single molecule Raman spectroscopic assay to detect transgene from GM plants.

Science.gov (United States)

Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph

2017-09-01

Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.

Illegal gene flow from transgenic creeping bentgrass: the saga continues.

Science.gov (United States)

Snow, Allison A

2012-10-01

Ecologists have paid close attention to environmental effects that fitness-enhancing transgenes might have following crop-to-wild gene flow (e.g. Snow et al. 2003). For some crops, gene flow also can lead to legal problems,especially when government agencies have not approved transgenic events for unrestricted environmental release.Creeping bentgrass (Agrostis stolonifera), a common turf grass used in golf courses, is the focus of both areas of concern. In 2002, prior to expected deregulation (still pending), The Scotts Company planted creeping bentgrass with transgenic resistance to the herbicide glyphosate,also known as RoundUp, on 162 ha in a designated control area in central Oregon (Fig. 1).Despite efforts to restrict gene flow, wind-dispersed pollen carried transgenes to florets of local A. stolonifera and A. gigantea as far as 14 km away, and to sentinel plants placed as far as 21 km away (Watrud et al. 2004).Then, in August 2003, a strong wind event moved transgenic seeds from wind rows of cut bentgrass into nearby areas. The company’s efforts to kill all transgenic survivors in the area failed: feral glyphosate-resistant populations of A. stolonifera were found by Reichman et al.(2006), and 62% of 585 bentgrass plants had the telltale CP4 EPSPS transgene in 2006 (Zapiola et al. 2008; Fig. 2).Now, in this issue, the story gets even more interesting as Zapiola & Mallory-Smith (2012) describe a transgenic,intergeneric hybrid produced on a feral, transgenic creeping bentgrass plant that received pollen from Polypogon monspeliensis (rabbitfoot grass). Their finding raises a host of new questions about the prevalence and fitness of intergeneric hybrids, as well as how to evaluate the full extent of gene flow from transgenic crops.

Paternal isodisomy of chromosome 6 in association with a maternal supernumerary marker chromosome (6)

Energy Technology Data Exchange (ETDEWEB)

James, R.S.; Crolla, J.A.; Sitch, F.L. [Salisbury District Hospital, Wiltshire (United Kingdom)] [and others

1994-09-01

Uniparental disomy may arise by a number of different mechanisms of aneuploidy correction. A population that has been identified as being at increased risk of aneuploidy are those individuals bearing supernumerary marker chromosomes (SMCs). There have been a number of cases reported of trisomy 21 in association with bi-satellited marker chromosomes have described two individuals with small inv dup (15) markers. One had paternal isodisomy of chromosome 15 and Angelman syndrome. The other had maternal heterodisomy (15) and Prader-Willi syndrome. At the Wessex Regional Genetics Laboratory we have conducted a search for uniparental disomy of the normal homologues of the chromosomes from which SMCs originated. Our study population consists of 39 probands with SMCs originating from a number of different autosomes, including 17 with SMCs of chromosome 15 origin. Using PCR amplification of microsatellite repeat sequences located distal to the regions included in the SMCs we have determined the parental origin of the two normal homologues in each case. We have identified paternal isodisomy of chromosome 6 in a female child with a supernumerary marker ring chromosome 6 in approximately 70% of peripheral blood lymphocytes. The marker was found to be of maternal origin. This is the second case of paternal isodisomy of chromosome 6 to be reported, and the first in association with a SMC resulting in a partial trisomy for a portion of the short arm of chromosome 6. In spite of this, the patient appears to be functioning appropriately for her age.

Gonadal sex chromosome complement in individuals with sex chromosomal and/or gonadal disorders

Energy Technology Data Exchange (ETDEWEB)

Bridge, J.A.; Sanger, W.G.; Seemayer, T. [Univ. of Nebraska Medical Center, Omaha, NE (United States)] [and others

1994-09-01

Gonadal abnormalities are characteristically seen in patients with sex chromosomal aneuploidy. Morphologically these abnormalities can be variable and are hypothesized to be dependent on the sex chromosomal consititution of the gonad (independent of the chromosomal complement of other tissues, such as peripheral blood lymphocytes). In this study, the gonadal sex chromosome complement was evaluated for potential mosaicism and correlated with the histopathology from 5 patients with known sex chromosomal and/or gonadal disorders. FISH techniques using X and Y chromosome specific probes were performed on nuclei extracted from paraffin embedded tissue. Gonadal tissue obtained from case 1 (a true hemaphroditic newborn) consisted of ovotestes and epididymis (left side) and ovary with fallopian tube (right side). Cytogenetic and FISH studies performed on blood, ovotestes and ovary revealed an XX complement. Cytogenetic analysis of blood from case 2, a 4-year-old with suspected Turner syndrome revealed 45,X/46,X,del(Y)(q11.21). FISH analysis of the resected gonads (histologically = immature testes) confirmed an X/XY mosaic complement. Histologically, the gonadal tissue was testicular. Severe autolysis prohibited successful analysis in the 2 remaining cases. In summary, molecular cytogenetic evaluation of gonadal tissue from individuals with sex chromosomal and/or gonadal disorders did not reveal tissue-specific anomalies which could account for differences observed pathologically.

The distribution of chromosome aberrations among chromosomes of karyotype in exposed human lymphocyte

International Nuclear Information System (INIS)

Que Tran; Tien Hoang Hung

1997-01-01

Induced chromosome aberrations (ch. ab.) in exposed Human peripheral blood lymphocyte have been used to assay radio.bio.doses, because of their characters such as: the maintaining Go phase in cell cycle in body, the distribution of cell in blood system and the distribution of ch. ab. in exposed cells of body and among chromosomes of karyotype. The frequency of ch. ab. reflected the quantity of radiation dose, dose rate and radiation energy. The dependence between radiation dose and frequency of ch. ab. was illustrated by the mathematic equations. The distribution of induced ch. ab. among the cells exposed to uniform radiation fields was Poisson's, but the distribution of ch. ab. among chromosomes in karyotype depended on radiation field and mononucleotid sequence of DNA molecular of each chromosome. The minimum influence of mononucleotid sequence of DNA molecular in inform ch. ab. will be advantageous state for dose-assessments. The location of induced ch. ab. in exposed Human lymphocyte had been determined by karyotype analyses. The data of statistic analyse had improved that the number of ch. ab. depended on the size of chromosomes in karyotype. The equal distribution of ch. ab.among chromosomes in karyotype provided the objectiveness and the accuracy of using the chromosomal aberrant analysis technique on bio-dosimetry. (author)

Male mating strategy and the introgression of a growth hormone transgene.

Science.gov (United States)

Valosaari, Kata-Riina; Aikio, Sami; Kaitala, Veijo

2008-11-01

Escaped transgenic organisms (GMO's) may threaten the populations of their wild relatives if able to hybridize with each other. The introgression of a growth enhancement transgene into a wild Atlantic salmon population may be affected by the transgene's effects not only on fitness parameters, but also on mating behaviour. Large anadromous GMO males are most preferred in mating, but a transgene can also give the large sneakers a reproductive advantage over the smaller wild individuals. With a simulation model, we studied whether the increase in the proportion and mating success of sneakers in transgenic and hybrid genotypes could facilitate the introgression of a transgene into wild population after the release of GMOs. The model combines population dynamics and Mendelian inheritance of a transgenic trait. We found that the introgression of the transgene is strongly affected by the greater mating preference of large GMO males. Furthermore, the difference in reproductive success between the anadromous versus sneaker strategy defines how much GMO's have to be preferred to be able to invade. These results emphasize the importance of detailed knowledge of reproductive systems and the effect of a transgene on the phenotype and behaviour of GMOs when assessing the consequences of their release or escape to the wild.

Analysis of the Ceratitis capitata y chromosome using in situ hybridization to mitotic chromosomes

International Nuclear Information System (INIS)

Willhoeft, U.; Franz, G.

1998-01-01

In Ceratitis capitata the Y chromosome is responsible for sex-determination. We used fluorescence in situ hybridization (FISH) for cytogenetic analysis of mitotic chromosomes. FISH with the wild-type strain EgyptII and two repetitive DNA probes enabled us to differentiate between the short and the long arm of the Y chromosome and gives a much better resolution than C-banding of mitotic chromosomes. We identified the Y-chromosomal breakpoints in Y-autosome translocations using FISH. Even more complex rearrangements i.e. deletions and insertions in some translocation strains were detected by this method. A strategy for mapping the primary sex determination factor in Ceratitis capitata by FISH is presented. (author)

Numerically abnormal chromosome constitutions in humans

Energy Technology Data Exchange (ETDEWEB)

NONE

1993-12-31

Chapter 24, discusses numerically abnormal chromosome constitutions in humans. This involves abnormalities of human chromosome number, including polyploidy (when the number of sets of chromosomes increases) and aneuploidy (when the number of individual normal chromosomes changes). Chapter sections discuss the following chromosomal abnormalities: human triploids, imprinting and uniparental disomy, human tetraploids, hydatidiform moles, anomalies caused by chromosomal imbalance, 13 trisomy (D{sub 1} trisomy, Patau syndrome), 21 trisomy (Down syndrome), 18 trisomy syndrome (Edwards syndrome), other autosomal aneuploidy syndromes, and spontaneous abortions. The chapter concludes with remarks on the nonrandom participation of chromosomes in trisomy. 69 refs., 3 figs., 4 tabs.

Identifying sites of replication initiation in yeast chromosomes: looking for origins in all the right places.

Science.gov (United States)

van Brabant, A J; Hunt, S Y; Fangman, W L; Brewer, B J

1998-06-01

DNA fragments that contain an active origin of replication generate bubble-shaped replication intermediates with diverging forks. We describe two methods that use two-dimensional (2-D) agarose gel electrophoresis along with DNA sequence information to identify replication origins in natural and artificial Saccharomyces cerevisiae chromosomes. The first method uses 2-D gels of overlapping DNA fragments to locate an active chromosomal replication origin within a region known to confer autonomous replication on a plasmid. A variant form of 2-D gels can be used to determine the direction of fork movement, and the second method uses this technique to find restriction fragments that are replicated by diverging forks, indicating that a bidirectional replication origin is located between the two fragments. Either of these two methods can be applied to the analysis of any genomic region for which there is DNA sequence information or an adequate restriction map.

Artificial Consciousness or Artificial Intelligence

OpenAIRE

Spanache Florin

2017-01-01

Artificial intelligence is a tool designed by people for the gratification of their own creative ego, so we can not confuse conscience with intelligence and not even intelligence in its human representation with conscience. They are all different concepts and they have different uses. Philosophically, there are differences between autonomous people and automatic artificial intelligence. This is the difference between intelligence and artificial intelligence, autonomous versus a...

Assessing the value of transgenic crops.

Science.gov (United States)

Lacey, Hugh

2002-10-01

In the current controversy about the value of transgenic crops, matters open to empirical inquiry are centrally at issue. One such matter is a key premise in a common argument (that I summarize) that transgenic crops should be considered to have universal value. The premise is that there are no alternative forms of agriculture available to enable the production of sufficient food to feed the world. The proponents of agroecology challenge it, claiming that agroecology provides an alternative, and they deny the claim that it is well founded on empirical evidence. It is, therefore, a matter of both social and scientific importance that this premise and the criticisms of it be investigated rigorously and empirically, so that the benefits and disadvantages of transgenic-intensive agriculture and agroecology can be compared in a reliable way. Conducting adequate investigation about the potential contribution of agroecology requires that the cultural conditions of its practice (and, thus, of the practices and movements of small-scale farmers in the "third world") be strengthened--and this puts the interests of investigation into tension with the socio-economic interests driving the development of transgenics. General issues about relationship between ethical argument and empirical (scientific) investigation are raised throughout the article.

Metal resistance sequences and transgenic plants

Science.gov (United States)

Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

1999-10-12

The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

Transgenic plants with increased calcium stores

Science.gov (United States)

Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Robertson, Dominique (Inventor); Boss, Wendy (Inventor)

2004-01-01

The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.

Origin of amphibian and avian chromosomes by fission, fusion, and retention of ancestral chromosomes

Science.gov (United States)

Voss, Stephen R.; Kump, D. Kevin; Putta, Srikrishna; Pauly, Nathan; Reynolds, Anna; Henry, Rema J.; Basa, Saritha; Walker, John A.; Smith, Jeramiah J.

2011-01-01

Amphibian genomes differ greatly in DNA content and chromosome size, morphology, and number. Investigations of this diversity are needed to identify mechanisms that have shaped the evolution of vertebrate genomes. We used comparative mapping to investigate the organization of genes in the Mexican axolotl (Ambystoma mexicanum), a species that presents relatively few chromosomes (n = 14) and a gigantic genome (>20 pg/N). We show extensive conservation of synteny between Ambystoma, chicken, and human, and a positive correlation between the length of conserved segments and genome size. Ambystoma segments are estimated to be four to 51 times longer than homologous human and chicken segments. Strikingly, genes demarking the structures of 28 chicken chromosomes are ordered among linkage groups defining the Ambystoma genome, and we show that these same chromosomal segments are also conserved in a distantly related anuran amphibian (Xenopus tropicalis). Using linkage relationships from the amphibian maps, we predict that three chicken chromosomes originated by fusion, nine to 14 originated by fission, and 12–17 evolved directly from ancestral tetrapod chromosomes. We further show that some ancestral segments were fused prior to the divergence of salamanders and anurans, while others fused independently and randomly as chromosome numbers were reduced in lineages leading to Ambystoma and Xenopus. The maintenance of gene order relationships between chromosomal segments that have greatly expanded and contracted in salamander and chicken genomes, respectively, suggests selection to maintain synteny relationships and/or extremely low rates of chromosomal rearrangement. Overall, the results demonstrate the value of data from diverse, amphibian genomes in studies of vertebrate genome evolution. PMID:21482624

Lectin cDNA and transgenic plants derived therefrom

Science.gov (United States)

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

Asexual Reproduction Does Not Apparently Increase the Rate of Chromosomal Evolution: Karyotype Stability in Diploid and Triploid Clonal Hybrid Fish (Cobitis, Cypriniformes, Teleostei).

Science.gov (United States)

Majtánová, Zuzana; Choleva, Lukáš; Symonová, Radka; Ráb, Petr; Kotusz, Jan; Pekárik, Ladislav; Janko, Karel

2016-01-01

Interspecific hybridization, polyploidization and transitions from sexuality to asexuality considerably affect organismal genomes. Especially the last mentioned process has been assumed to play a significant role in the initiation of chromosomal rearrangements, causing increased rates of karyotype evolution. We used cytogenetic analysis and molecular dating of cladogenetic events to compare the rate of changes of chromosome morphology and karyotype in asexually and sexually reproducing counterparts in European spined loach fish (Cobitis). We studied metaphases of three sexually reproducing species and their diploid and polyploid hybrid clones of different age of origin. The material includes artificial F1 hybrid strains, representatives of lineage originated in Holocene epoch, and also individuals of an oldest known age to date (roughly 0.37 MYA). Thereafter we applied GISH technique as a marker to differentiate parental chromosomal sets in hybrids. Although the sexual species accumulated remarkable chromosomal rearrangements after their speciation, we observed no differences in chromosome numbers and/or morphology among karyotypes of asexual hybrids. These hybrids possess chromosome sets originating from respective parental species with no cytogenetically detectable recombinations, suggesting their integrity even in a long term. The switch to asexual reproduction thus did not provoke any significant acceleration of the rate of chromosomal evolution in Cobitis. Asexual animals described in other case studies reproduce ameiotically, while Cobitis hybrids described here produce eggs likely through modified meiosis. Therefore, our findings indicate that the effect of asexuality on the rate of chromosomal change may be context-dependent rather than universal and related to particular type of asexual reproduction.

Asexual Reproduction Does Not Apparently Increase the Rate of Chromosomal Evolution: Karyotype Stability in Diploid and Triploid Clonal Hybrid Fish (Cobitis, Cypriniformes, Teleostei.

Directory of Open Access Journals (Sweden)

Zuzana Majtánová

Full Text Available Interspecific hybridization, polyploidization and transitions from sexuality to asexuality considerably affect organismal genomes. Especially the last mentioned process has been assumed to play a significant role in the initiation of chromosomal rearrangements, causing increased rates of karyotype evolution. We used cytogenetic analysis and molecular dating of cladogenetic events to compare the rate of changes of chromosome morphology and karyotype in asexually and sexually reproducing counterparts in European spined loach fish (Cobitis. We studied metaphases of three sexually reproducing species and their diploid and polyploid hybrid clones of different age of origin. The material includes artificial F1 hybrid strains, representatives of lineage originated in Holocene epoch, and also individuals of an oldest known age to date (roughly 0.37 MYA. Thereafter we applied GISH technique as a marker to differentiate parental chromosomal sets in hybrids. Although the sexual species accumulated remarkable chromosomal rearrangements after their speciation, we observed no differences in chromosome numbers and/or morphology among karyotypes of asexual hybrids. These hybrids possess chromosome sets originating from respective parental species with no cytogenetically detectable recombinations, suggesting their integrity even in a long term. The switch to asexual reproduction thus did not provoke any significant acceleration of the rate of chromosomal evolution in Cobitis. Asexual animals described in other case studies reproduce ameiotically, while Cobitis hybrids described here produce eggs likely through modified meiosis. Therefore, our findings indicate that the effect of asexuality on the rate of chromosomal change may be context-dependent rather than universal and related to particular type of asexual reproduction.

Molecular fundamentals of chromosomal mutagenesis

International Nuclear Information System (INIS)

Ganassi, E.Eh.; Zaichkina, S.I.; Malakhova, L.V.

1987-01-01

Precise quantitative correlation between the yield of chromosome structure damages and the yield of DNA damages is shown when comparing data on molecular and cytogenetic investigations carried out in cultural Mammalia cells. As the chromosome structure damage is to be connected with the damage of its carcass structure, then it is natural that DNA damage in loop regions is not to affect considerably the structure, while DNA damage lying on the loop base and connected with the chromosome carcass is to play a determining role in chromosomal mutagenesis. This DNA constitutes 1-2% from the total quantity of nuclear DNA. If one accepts that damages of these regions of DNA are ''hot'' points of chromosomal mutagenesis, then it becomes clear why 1-2% of preparation damages in a cell are realized in chromosome structural damages

Exchange of core chromosomes and horizontal transfer of lineage-specific chromosomes in Fusarium oxysporum

NARCIS (Netherlands)

Vlaardingerbroek, I.; Beerens, B.; Rose, L.; Fokkens, L.; Cornelissen, B.J.C.; Rep, M.

2016-01-01

Horizontal transfer of supernumerary or lineage-specific (LS) chromosomes has been described in a number of plant pathogenic filamentous fungi. So far it was not known whether transfer is restricted to chromosomes of certain size or properties, or whether 'core' chromosomes can also undergo

Chromosomal geometry in the interface from the frequency of the radiation induced chromosome aberrations

International Nuclear Information System (INIS)

Nasazzi, N.; Otero, D.; Di Giorgio, M.

1996-01-01

Ionizing radiation induces DNA double-strand breaks (DSBs) and their interaction and illegitimate recombination produces chromosomal aberrations. Stable chromosomal aberrations comprise inter-chromosomal events (translocations) and intra-chromosomal events (inversions). When DSBs induction and interaction is done at random, and the proximity effects are neglected, the expected relation between translocations and inversions is F=86, based on chromosome arm length. The number of translocations and inversions is analyzed by using G-banding in 16 lymphocytes cultures from blood samples acutely irradiated with γ-rays (dose range: 0,5 Gy - 3 Gy). The result obtained was: F=13,5, significantly smaller than F=86. Literature data show similar small F values, but strongly spread. The excess of inversions could be explained by a 'proximity effect', it means that more proximate DSBs have more interaction probability. Therefore, it is possible to postulate a special chromosome arrangement during irradiation and the subsequent interval. We propose a model where individual chromosomes show spherical confinement with some degree of overlapping and DSBs induction proportional to cross section. A DSBs interaction probability function with cut-off length= 1μ is assumed. According to our results, the confinement volume is ≅ 6.4% of the nuclear volume. Nevertheless, we presume that large spread in F data could be due to temporal variation in overlapping and spatial chromosomal confinement. (authors). 14 refs

Analysis of transgenic wheat (Triticum aestivum L.) harboring a maize (Zea mays L.) gene for plastid EF-Tu: segregation pattern, expression and effects of the transgene.

Science.gov (United States)

Fu, Jianming; Ristic, Zoran

2010-06-01

We previously reported that transgenic wheat (Triticum aestivum L.) carrying a maize (Zea mays L.) gene (Zmeftu1) for chloroplast protein synthesis elongation factor, EF-Tu, displays reduced thermal aggregation of leaf proteins, reduced injury to photosynthetic membranes (thylakoids), and enhanced rate of CO(2) fixation following exposure to heat stress (18 h at 45 degrees C) [Fu et al. in Plant Mol Biol 68:277-288, 2008]. In the current study, we investigated the segregation pattern and expression of the transgene Zmeftu1 and determined the grain yield of transgenic plants after exposure to a brief heat stress (18 h at 45 degrees C). We also assessed thermal aggregation of soluble leaf proteins in transgenic plants, testing the hypothesis that increased levels of EF-Tu will lead to a non-specific protection of leaf proteins against thermal aggregation. The transgenic wheat displayed a single-gene pattern of segregation of Zmeftu1. Zmeftu1 was expressed, and the transgenic plants synthesized and accumulated three anti-EF-Tu cross-reacting polypeptides of similar molecular mass but different pI, suggesting the possibility of posttranslational modification of this protein. The transgenic plants also showed better grain yield after exposure to heat stress compared with their non-transgenic counterparts. Soluble leaf proteins of various molecular masses displayed lower thermal aggregation in transgenic than in non-transgenic wheat. The results suggest that overexpression of chloroplast EF-Tu can be beneficial to wheat tolerance to heat stress. Moreover, the results also support the hypothesis that EF-Tu contributes to heat tolerance by acting as a molecular chaperone and protecting heat-labile proteins from thermal aggregation in a non-specific manner.

Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

Directory of Open Access Journals (Sweden)

Kohn Aimee

2009-01-01

Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

Directory of Open Access Journals (Sweden)

Dismuke Adria D

2009-07-01

Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

Painting of fourth and chromosome-wide regulation of the 4th chromosome in Drosophila melanogaster.

Science.gov (United States)

Johansson, Anna-Mia; Stenberg, Per; Bernhardsson, Carolina; Larsson, Jan

2007-05-02

Drosophila melanogaster exhibits two expression-regulating systems that target whole, specific chromosomes: the dosage compensation system whereby the male-specific lethal complex doubles transcription of genes on the male X-chromosome and the chromosome 4-specific protein Painting of fourth, POF. POF is the first example of an autosome-specific protein and its presence raises the question of the universality of chromosome-specific regulation. Here we show that POF and heterochromatin protein 1 (HP1) are involved in the global regulation of the 4th chromosome. Contrary to previous conclusions, Pof is not essential for survival of diplo-4th karyotype flies. However, Pof is essential for survival of haplo-4th individuals and expression of chromosome 4 genes in diplo-4th individuals is decreased in the absence of Pof. Mapping of POF using chromatin immunoprecipitation suggested that it binds within genes. Furthermore, we show that POF binding is dependent on heterochromatin and that POF and HP1 bind interdependently to the 4th chromosome. We propose a balancing mechanism involving POF and HP1 that provides a feedback system for fine-tuning expression status of genes on the 4th chromosome.

Keeping the genie in the bottle: transgene biocontainment by excision in pollen.

Science.gov (United States)

Moon, Hong S; Li, Yi; Stewart, C Neal

2010-01-01

Gene flow from transgenic plants is an environmental and regulatory concern. While biocontainment might be achieved using male sterility or transgenic mitigation tools, we believe that perhaps the optimal solution might be simply to remove transgenes from pollen. Male sterility might not be ideal for many pollinators, and might not be implementable using standardized genes. Transgenic mitigation might not be useful to control conspecific gene flow (e.g. crop to crop), and relies on competition and not biocontainment per se. Site-specific recombination systems could allow highly efficient excision of transgenes in pollen to eliminate, or at least minimize, unwanted transgene movement via pollen dispersal. There are other potential biotechnologies, such as zinc finger nucleases, that could be also used for transgene excision.

Chromosome Territories

OpenAIRE

Cremer, Thomas; Cremer, Marion

2010-01-01

Chromosome territories (CTs) constitute a major feature of nuclear architecture. In a brief statement, the possible contribution of nuclear architecture studies to the field of epigenomics is considered, followed by a historical account of the CT concept and the final compelling experimental evidence of a territorial organization of chromosomes in all eukaryotes studied to date. Present knowledge of nonrandom CT arrangements, of the internal CT architecture, and of structural interactions wit...

Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo.

Science.gov (United States)

Bidlack, Felicitas B; Xia, Yan; Pugach, Megan K

2017-01-01

Mice lacking amelogenin (KO) have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes ( Tg ) representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180 Tg , CTRNC Tg and LRAP Tg mice to generate M180 Tg and CTRNC Tg double transgene and M180 Tg , CTRNC Tg , LRAP Tg triple transgene mice with transgene hemizygosity (on one allelle) or homozygosity (on both alleles). Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene ( p structure, but only up to a maximum of ~80% that of molar and ~40% that of incisor wild-type enamel.

Chromosomal Evolution in Chiroptera.

Science.gov (United States)

Sotero-Caio, Cibele G; Baker, Robert J; Volleth, Marianne

2017-10-13

Chiroptera is the second largest order among mammals, with over 1300 species in 21 extant families. The group is extremely diverse in several aspects of its natural history, including dietary strategies, ecology, behavior and morphology. Bat genomes show ample chromosome diversity (from 2n = 14 to 62). As with other mammalian orders, Chiroptera is characterized by clades with low, moderate and extreme chromosomal change. In this article, we will discuss trends of karyotypic evolution within distinct bat lineages (especially Phyllostomidae, Hipposideridae and Rhinolophidae), focusing on two perspectives: evolution of genome architecture, modes of chromosomal evolution, and the use of chromosome data to resolve taxonomic problems.

Chromosomal Evolution in Chiroptera

Directory of Open Access Journals (Sweden)

Cibele G. Sotero-Caio

2017-10-01

Full Text Available Chiroptera is the second largest order among mammals, with over 1300 species in 21 extant families. The group is extremely diverse in several aspects of its natural history, including dietary strategies, ecology, behavior and morphology. Bat genomes show ample chromosome diversity (from 2n = 14 to 62. As with other mammalian orders, Chiroptera is characterized by clades with low, moderate and extreme chromosomal change. In this article, we will discuss trends of karyotypic evolution within distinct bat lineages (especially Phyllostomidae, Hipposideridae and Rhinolophidae, focusing on two perspectives: evolution of genome architecture, modes of chromosomal evolution, and the use of chromosome data to resolve taxonomic problems.

GSK-3 inhibitors induce chromosome instability

Directory of Open Access Journals (Sweden)

Staples Oliver D

2007-08-01

Full Text Available Abstract Background Several mechanisms operate during mitosis to ensure accurate chromosome segregation. However, during tumour evolution these mechanisms go awry resulting in chromosome instability. While several lines of evidence suggest that mutations in adenomatous polyposis coli (APC may promote chromosome instability, at least in colon cancer, the underlying mechanisms remain unclear. Here, we turn our attention to GSK-3 – a protein kinase, which in concert with APC, targets β-catenin for proteolysis – and ask whether GSK-3 is required for accurate chromosome segregation. Results To probe the role of GSK-3 in mitosis, we inhibited GSK-3 kinase activity in cells using a panel of small molecule inhibitors, including SB-415286, AR-A014418, 1-Azakenpaullone and CHIR99021. Analysis of synchronised HeLa cells shows that GSK-3 inhibitors do not prevent G1/S progression or cell division. They do, however, significantly delay mitotic exit, largely because inhibitor-treated cells have difficulty aligning all their chromosomes. Although bipolar spindles form and the majority of chromosomes biorient, one or more chromosomes often remain mono-oriented near the spindle poles. Despite a prolonged mitotic delay, anaphase frequently initiates without the last chromosome aligning, resulting in chromosome non-disjunction. To rule out the possibility of "off-target" effects, we also used RNA interference to selectively repress GSK-3β. Cells deficient for GSK-3β exhibit a similar chromosome alignment defect, with chromosomes clustered near the spindle poles. GSK-3β repression also results in cells accumulating micronuclei, a hallmark of chromosome missegregation. Conclusion Thus, not only do our observations indicate a role for GSK-3 in accurate chromosome segregation, but they also raise the possibility that, if used as therapeutic agents, GSK-3 inhibitors may induce unwanted side effects by inducing chromosome instability.

Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo

Directory of Open Access Journals (Sweden)

Felicitas B. Bidlack

2017-11-01

Full Text Available Mice lacking amelogenin (KO have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes (Tg representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180Tg, CTRNCTg and LRAPTg mice to generate M180Tg and CTRNCTg double transgene and M180Tg, CTRNCTg, LRAPTg triple transgene mice with transgene hemizygosity (on one allelle or homozygosity (on both alleles. Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene (p < 0.05. The presence of the LRAPTg did not improve the phenotype of M180Tg/CTRNCTg/KO enamel. In the absence of endogenous amelogenin, the addition of amelogenin transgenes representing the most

Bean Yellow Dwarf Virus replicons for high-level transgene expression in transgenic plants and cell cultures.

Science.gov (United States)

Zhang, Xiuren; Mason, Hugh

2006-02-05

A novel stable transgenic plant expression system was developed using elements of the replication machinery of Bean Yellow Dwarf Virus (BeYDV). The system contains two transgenes: 1) The BeYDV replicon vector with an expression cassette flanked by cis-acting DNA elements of BeYDV, and 2) The viral replication initiator protein (Rep) controlled by an alcohol-inducible promoter. When Rep expression was triggered by treatment with ethanol, it induced release of the BeYDV replicon from stably integrated T-DNA and episomal replication to high copy number. Replicon amplification resulted in substantially increased transgene mRNA levels (up to 80-fold) and translation products (up to 10-fold) after induction of Rep expression by ethanol treatment in tobacco NT1 cells and leaves of whole potato plants. Thus, the BeYDV stable transformant replicon system is a powerful tool for plant-based production of recombinant proteins. (c) 2005 Wiley Periodicals, Inc.

Transgenic cassava lines carrying heterologous alternative oxidase ...

African Journals Online (AJOL)

Afuape

2013-07-03

Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

Dielectrophoretic manipulation of human chromosomes in microfluidic channels: extracting chromosome dielectric properties

DEFF Research Database (Denmark)

Clausen, Casper Hyttel; Dimaki, Maria; Buckley, Sonia

2011-01-01

An investigation of the dielectric properties of polyamine buffer prepared human chromosomes is presented in this paper. Chromosomes prepared in this buffer are only a few micrometers in size and shaped roughly like spherical discs. Dielectrophoresis was therefore chosen as the method...... of manipulation combined with a custom designed microfluidic system containing the required electrodes for dielectrophoresis experiments. Our results show that although this system is presently not able to distinguish between the different chromosomes, it can provide average data for the dielectric properties...... of human chromosomes in polyamine buffer. These can then be used to optimize system designs for further characterization and even sorting. The experimental data from the dielectrophoretic manipulation were combined with theoretical calculations to extract a range of values for the permittivity...

Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

Science.gov (United States)

Nocarova, Eva; Fischer, Lukas

2009-04-22

Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

Ethics and Transgenic Crops: a Review

OpenAIRE

Robinson, Jonathan

1999-01-01

This article represents a review of some of the ethical dilemmas that have arisen as a result of the development and deployment of transgenic crop plants. The potential for transgenic crops to alleviate human hunger and the possible effects on human health are discussed. Risks and benefits to the environment resulting from genetic engineering of crops for resistance to biotic and abiotic stresses are considered, in addition to effects on biodiversity. The socio-economic impacts and distributi...

A Transgenic Tri-Modality Reporter Mouse

OpenAIRE

Yan, Xinrui; Ray, Pritha; Paulmurugan, Ramasamy; Tong, Ricky; Gong, Yongquan; Sathirachinda, Ataya; Wu, Joseph C.; Gambhir, Sanjiv S.

2013-01-01

Transgenic mouse with a stably integrated reporter gene(s) can be a valuable resource for obtaining uniformly labeled stem cells, tissues, and organs for various applications. We have generated a transgenic mouse model that ubiquitously expresses a tri-fusion reporter gene (fluc2-tdTomato-ttk) driven by a constitutive chicken β-actin promoter. This "Tri-Modality Reporter Mouse" system allows one to isolate most cells from this donor mouse and image them for bioluminescent (fluc2), fluorescent...

Mechanisms of ring chromosome formation in 11 cases of human ring chromosome 21

DEFF Research Database (Denmark)

McGinniss, M J; Kazazian, H H; Stetten, G

1992-01-01

We studied the mechanism of ring chromosome 21 (r(21)) formation in 13 patients (11 unique r(21)s), consisting of 7 from five families with familial r(21) and 6 with de novo r(21). The copy number of chromosome 21 sequences in the rings of these patients was determined by quantitative dosage......), resulting in deletion of varying amounts of 21q22.1 to 21qter. The data from one individual who had a Down syndrome phenotype were consistent with asymmetric breakage and reunion of 21q sequences from an intermediate isochromosome or Robertsonian translocation chromosome as reported by Wong et al. Another......). The phenotype of patients correlated well with the extent of deletion or duplication of chromosome 21 sequences. These data demonstrate three mechanisms of r(21) formation and show that the phenotype of r(21) patients varies with the extent of chromosome 21 monosomy or trisomy....

Essential roles of BCCIP in mouse embryonic development and structural stability of chromosomes.

Directory of Open Access Journals (Sweden)

Huimei Lu

2011-09-01

Full Text Available BCCIP is a BRCA2- and CDKN1A(p21-interacting protein that has been implicated in the maintenance of genomic integrity. To understand the in vivo functions of BCCIP, we generated a conditional BCCIP knockdown transgenic mouse model using Cre-LoxP mediated RNA interference. The BCCIP knockdown embryos displayed impaired cellular proliferation and apoptosis at day E7.5. Consistent with these results, the in vitro proliferation of blastocysts and mouse embryonic fibroblasts (MEFs of BCCIP knockdown mice were impaired considerably. The BCCIP deficient mouse embryos die before E11.5 day. Deletion of the p53 gene could not rescue the embryonic lethality due to BCCIP deficiency, but partially rescues the growth delay of mouse embryonic fibroblasts in vitro. To further understand the cause of development and proliferation defects in BCCIP-deficient mice, MEFs were subjected to chromosome stability analysis. The BCCIP-deficient MEFs displayed significant spontaneous chromosome structural alterations associated with replication stress, including a 3.5-fold induction of chromatid breaks. Remarkably, the BCCIP-deficient MEFs had a ∼20-fold increase in sister chromatid union (SCU, yet the induction of sister chromatid exchanges (SCE was modestly at 1.5 fold. SCU is a unique type of chromatid aberration that may give rise to chromatin bridges between daughter nuclei in anaphase. In addition, the BCCIP-deficient MEFs have reduced repair of irradiation-induced DNA damage and reductions of Rad51 protein and nuclear foci. Our data suggest a unique function of BCCIP, not only in repair of DNA damage, but also in resolving stalled replication forks and prevention of replication stress. In addition, BCCIP deficiency causes excessive spontaneous chromatin bridges via the formation of SCU, which can subsequently impair chromosome segregations in mitosis and cell division.

Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

Science.gov (United States)

Pons, Elsa; Peris, Josep E; Peña, Leandro

2012-07-15

The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

Generation and characterization of human heme oxygenase-1 transgenic pigs.

Directory of Open Access Journals (Sweden)

Hye-Jung Yeom

Full Text Available Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1, an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs. Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

Generation and characterization of human heme oxygenase-1 transgenic pigs.

Science.gov (United States)

Yeom, Hye-Jung; Koo, Ok Jae; Yang, Jaeseok; Cho, Bumrae; Hwang, Jong-Ik; Park, Sol Ji; Hurh, Sunghoon; Kim, Hwajung; Lee, Eun Mi; Ro, Han; Kang, Jung Taek; Kim, Su Jin; Won, Jae-Kyung; O'Connell, Philip J; Kim, Hyunil; Surh, Charles D; Lee, Byeong-Chun; Ahn, Curie

2012-01-01

Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1), an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs). Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

The Zebrafish Anillin-eGFP Reporter Marks Late Dividing Retinal Precursors and Stem Cells Entering Neuronal Lineages.

Directory of Open Access Journals (Sweden)

Meret Cepero Malo

Full Text Available Monitoring cycling behaviours of stem and somatic cells in the living animal is a powerful tool to better understand tissue development and homeostasis. The tg(anillin:anillin-eGFP transgenic line carries the full-length zebrafish F-actin binding protein Anillin fused to eGFP from a bacterial artificial chromosome (BAC containing Anillin cis-regulatory sequences. Here we report the suitability of the Anillin-eGFP reporter as a direct indicator of cycling cells in the late embryonic and post-embryonic retina. We show that combining the anillin:anillin-eGFP with other transgenes such as ptf1a:dsRed and atoh7:gap-RFP allows obtaining spatial and temporal resolution of the mitotic potentials of specific retinal cell populations. This is exemplified by the analysis of the origin of the previously reported apically and non-apically dividing late committed precursors of the photoreceptor and horizontal cell layers.

Chromosome analysis of arsenic affected cattle

Directory of Open Access Journals (Sweden)

S. Shekhar

2014-10-01

Full Text Available Aim: The aim was to study the chromosome analysis of arsenic affected cattle. Materials and Methods: 27 female cattle (21 arsenic affected and 6 normal were selected for cytogenetical study. The blood samples were collected, incubated, and cultured using appropriate media and specific methods. The samples were analyzed for chromosome number and morphology, relative length of the chromosome, arm ratio, and centromere index of X chromosome and chromosomal abnormalities in arsenic affected cattle to that of normal ones. Results: The diploid number of metaphase chromosomes in arsenic affected cattle as well as in normal cattle were all 2n=60, 58 being autosomes and 2 being sex chromosomes. From the centromeric position, karyotyping studies revealed that all the 29 pair of autosomes was found to be acrocentric or telocentric, and the sex chromosomes (XX were submetacentric in both normal and arsenic affected cattle. The relative length of all the autosome pairs and sex chrosomosome pair was found to be higher in normal than that of arsenic affected cattle. The mean arm ratio of X-chromosome was higher in normal than that of arsenic affected cattle, but it is reverse in case of centromere index value of X-chromosome. There was no significant difference of arm ratio and centromere index of X-chromosomes between arsenic affected and normal cattle. No chromosomal abnormalities were found in arsenic affected cattle. Conclusion: The chromosome analysis of arsenic affected cattle in West Bengal reported for the first time in this present study which may serve as a guideline for future studies in other species. These reference values will also help in comparison of cytological studies of arsenic affected cattle to that of various toxicants.

Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

Science.gov (United States)

Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

2010-04-01

Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

Is passive transmission of non-viral vectors through artificial insemination of sperm-DNA mixtures sufficient for chicken transgenesis?

Science.gov (United States)

CHAPARIAN, Shahram; ABDULAHNEJAD, Ahad; RASHIDI, Farzad; TOGHYANI, Majid; GHEISARI, Abbasali; EGHBALSAIED, Shahin

2016-01-01

DNA uptake in the post-acrosomal region of the spermatozoa takes place exclusively in immotile spermatozoa that are naturally unable to fertilize eggs. The present study aimed to assess whether passive transmission of non-viral vectors to the surrounding areas of chicken embryos could be an alternate mechanism in chicken sperm-mediated gene transfer. First, the presence of nucleases in rooster seminal plasma was evaluated. Semen ejaculates from five roosters were centrifuged and the supernatant was incubated with pBL2 for 1 h. A robust nuclease cocktail was detected in the rooster semen. To overcome these nucleases, plasmid-TransIT combinations were incubated with semen for 1 h. Incubation of exogenous DNA in the lipoplex structure could considerably bypass the semen nuclease effect. Then, intravaginal insemination of 1 × 109 sperm mixed with lipoplexes (40 µg pBL2:40 µl TransIT) was carried out in 15 virgin hens. Neither the epithelial tissue from the inseminated female reproductive tracts nor the produced embryos following artificial insemination showed the transgene. To remove any bias in the transgene transmission possibility, the plasmid-TransIT admixture was directly injected in close vicinity of the embryos in newly laid eggs. Nonetheless, none of the produced fetuses or chicks carried the transgene. In conclusion, the results of the present study revealed a nuclease admixture in rooster seminal plasma, and passive/active transmission of the non-viral vector into close vicinity of the chicken embryo was inefficient for producing transgenic chicks. PMID:26935324

Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

International Nuclear Information System (INIS)

Ahmad, R.; Hussain, J.

2014-01-01

Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

Transposon-mediated BAC transgenesis in human ES cells

Science.gov (United States)

Rostovskaya, Maria; Fu, Jun; Obst, Mandy; Baer, Isabell; Weidlich, Stefanie; Wang, Hailong; Smith, Andrew J. H.; Anastassiadis, Konstantinos; Stewart, A. Francis

2012-01-01

Transgenesis is a cornerstone of molecular biology. The ability to integrate a specifically engineered piece of DNA into the genome of a living system is fundamental to our efforts to understand life and exploit its implications for medicine, nanotechnology and bioprospecting. However, transgenesis has been hampered by position effects and multi-copy integration problems, which are mainly due to the use of small, plasmid-based transgenes. Large transgenes based on native genomic regions cloned into bacterial artificial chromosomes (BACs) circumvent these problems but are prone to fragmentation. Herein, we report that contrary to widely held notions, large BAC-sized constructs do not prohibit transposition. We also report the first reliable method for BAC transgenesis in human embryonic stem cells (hESCs). The PiggyBac or Sleeping Beauty transposon inverted repeats were integrated into BAC vectors by recombineering, followed by co-lipofection with the corresponding transposase in hESCs to generate robust fluorescent protein reporter lines for OCT4, NANOG, GATA4 and PAX6. BAC transposition delivers several advantages, including increased frequencies of single-copy, full-length integration, which will be useful in all transgenic systems but especially in difficult venues like hESCs. PMID:22753106

The Mechanism of the Silencing of a Transgene, NCED3‐LUC, in Arabidopsis Thaliana

KAUST Repository

Zhao, Junsong

2011-06-20

The Arabidopsis thaliana NCED3‐LUC transgenic line was constructed by several groups to study the regulatory network of the NCED3 gene, the protein of which catalyzes the rate‐limiting step of ABA biosynthesis under drought. The transgenic luciferase gene is expressed when the plants encounter drought stress. Intriguingly, this transgenic luciferase gene is silenced after propagation for several generations. To determine the mechanism of this gene silencing, we used a forward genetics approach. The seeds of NCED3‐LUC (referred as the ‘wild type’) were mutagenized by ethane methyl sulfonate (EMS). One mutant line, denoted as #73, with recovered luciferase activity was selected for further study. Analysis of the methylation status by bisulfite sequencing revealed that the transgenic NCED3 promoter in the #73 mutant had less methylation than the wild type. Demethylation was also evident for the endogenous NCED3 promoter and retrotransposon AtSN1 in the #73 mutant. The phenotype of #73 mutant includes small size, rapid dehydration rate, altered morphology, and a thin epicuticular wax layer. By use of map‐based cloning, the region containing the mutated gene was delimited to a contig of two BAC clones, F11F19 and F9C22, on chromosome 2. Our results indicate that NCED3‐LUC gene silencing results from hypermethylation of its promoter region, but additional study is required to determine the exact position of the mutated gene and to fully understand the mechanism of NCED3‐LUC silencing. 4 ACKNOWLEDGEMENTS I would like to take this opportunity to thank my committee chair, Professor Jian‐Kang Zhu, who is also the supervisor of my master’s thesis, for his guidance throughout the course of this research. I also would like to thank my committee members, Professor Liming Xiong and Professor Samir Hamdan, for their patience and support in reviewing my thesis. My appreciation also goes to Dr. Zhenyu Wang for taking time to teach me basic experimental skills and

Chromosome heteromorphisms in the Japanese, 3

International Nuclear Information System (INIS)

Sofuni, Toshio; Awa, A.A.

1982-12-01

The type and frequency of chromosome variants detected by the C-staining method were ascertained in 1,857 individuals residing in Hiroshima. The most frequent heteromorphic variant was the total inversion of the C-band in chromosome 9 found in 27 individuals (1.45%). The total inversion of the C-band in chromosome 1 was not seen in this sample, but the partial inversion of the C-band in chromosome 1 was found in 18 persons (0.97%). Partial inversion was also detected in the C-band in chromosome 9 in 22 individuals (1.18%). In chromosome 16, neither total nor partial inversion of the C-band was observed in the present study. The frequencies of chromosomes 1, 9, and 16 with a very large C-band were 0.70%, 0.22%, and 0.54%, respectively. Aside from these (1, 9, and 16) a very large C-band was found occasionally in chromosomes 4, 5, 6, 11, 12, 14, and 15, and an unusual insertion of the Y chromosome was observed. A total of 128 C-band variants (6.89%) was found in the 1,857 Hiroshima residents. (author)

Gene flow from transgenic common beans expressing the bar gene.

Science.gov (United States)

Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

2010-01-01

Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

Semi-automatic laser beam microdissection of the Y chromosome and analysis of Y chromosome DNA in a dioecious plant, Silene latifolia

International Nuclear Information System (INIS)

Matsunaga, S.; Kawano, S.; Michimoto, T.; Higashiyama, T.; Nakao, S.; Sakai, A.; Kuroiwa, T.

1999-01-01

Silene latifolia has heteromorphic sex chromosomes, the X and Y chromosomes. The Y chromosome, which is thought to carry the male determining gene, was isolated by UV laser microdissection and amplified by degenerate oligonucleotide-primed PCR. In situ chromosome suppression of the amplified Y chromosome DNA in the presence of female genomic DNA as a competitor showed that the microdissected Y chromosome DNA did not specifically hybridize to the Y chromosome, but-hybridized to all chromosomes. This result suggests that the Y chromosome does not contain Y chromosome-enriched repetitive sequences. A repetitive sequence in the microdissected Y chromosome, RMY1, was isolated while screening repetitive sequences in the amplified Y chromosome. Part of the nucleotide sequence shared a similarity to that of X-43.1, which was isolated from microdissected X chromosomes. Since fluorescence in situ hybridization analysis with RMY1 demonstrated that RMY1 was localized at the ends of the chromosome, RMY1 may be a subtelomeric repetitive sequence. Regarding the sex chromosomes, RMY1 was detected at both ends of the X chromosome and at one end near the pseudoautosomal region of the Y chromosome. The different localization of RMY1 on the sex chromosomes provides a clue to the problem of how the sex chromosomes arose from autosomes

THE ABILITY OF FAST-GROWING TRANSGENIC AFRICAN CATFISH (Clarias gariepinus ON PREDATOR AVOIDANCE

Directory of Open Access Journals (Sweden)

Huria Marnis

2016-12-01

Full Text Available Research Institute for Fish Breeding has produced transgenic African catfish (Clarias gariepinus containing stripped catfish growth hormone gene (PccBA-PhGH with growth 19.86% faster than that of non-transgenic fish. This fish has high potential to be released and utilized for fish farming sector to increase national production. However, there is not yet information about environmental risk of this fish. One of the major fitness traits determining potential environmental risk is predator avoidance. This study aimed to determine the predator avoidance ability of transgenic African catfish in an experimental laboratory condition. In this study, thirty five individuals each of transgenic and non-transgenic with body weight of about 0.1 ± 0.019 g were communally stocked in 60 cm x 40 cm x 40 cm aquarium with limited feeding frequency (ad libitum twice a day. One day after the fish were stocked, the predators were added to each aquarium. The non-transgenic and transgenic with body weight of 1.0 ± 0.024 g were stocked as predators as many as five individual in each aquarium. After approximately two weeks of predation, all remaining fish were collected for transgenic verification by PCR method. Genomic DNA was isolated from fin tissue of individually survivors. The results of this study showed that the transgenic fish had worse predator avoidance and lower cannibal than non-transgenic (P0.05 in limited food. The transgenic fish may have lower fitness than non-transgenic.

Radiation arteriopathy in the transgenic arteriovenous fistula model.

Science.gov (United States)

Lawton, Michael T; Arnold, Christine M; Kim, Yung J; Bogarin, Ernesto A; Stewart, Campbell L; Wulfstat, Amanda A; Derugin, Nikita; Deen, Dennis; Young, William L

2008-05-01

The transgenic arteriovenous fistula model, surgically constructed with transgenic mouse aorta interposed in common carotid artery-to-external jugular vein fistulae in nude rats, has a 4-month experimental window because patency and transgenic phenotype are lost over time. We adapted this model to investigate occlusive arteriopathy in brain arteriovenous malformations after radiosurgery by radiating grafted aorta before insertion in the fistula. We hypothesized that high-dose radiation would reproduce the arteriopathy observed clinically within the experimental time window and that deletions of endoglin (ENG) and endothelial nitric oxide synthase (eNOS) genes would modify the radiation response. Radiation arteriopathy in the common carotid arteries of 171 wild-type mice was examined with doses of 25, 80, 120, or 200 Gy (Experiment 1). Radiation arteriopathy in 68 wild-type arteriovenous fistulae was examined histologically and morphometrically with preoperative radiation doses of 0, 25, or 200 Gy (Experiment 2). Radiation arteriopathy in 51 transgenic arteriovenous fistulae (36 ENG and 15 eNOS knock-out fistulae) was examined using preoperative radiation doses of 0, 25, or 200 Gy (Experiment 3). High-dose radiation (200 Gy) of mouse common carotid arteries induced only mild arteriopathy (mean score, 0.66) without intimal hyperplasia and with high mortality (68%). Radiation arteriopathy in wild-type arteriovenous fistulae was severe (mean score, 3.5 at 200 Gy), with intimal hyperplasia and medial disruption at 3 months, decreasing luminal areas with increasing dose, and no mortality. Arteriopathy was robust in transgenic arteriovenous fistulae with ENG +/- and with eNOS +/-, with thick intimal hyperplasia in the former and distinct smooth muscle cell proliferation in the latter. The transgenic arteriovenous fistula model can be adapted to rapidly reproduce radiation arteriopathy observed in resected brain arteriovenous malformations after radiosurgery. High

Chromosomal instability induced by ionizing radiation

International Nuclear Information System (INIS)

Morgan, W.F.; Marder, B.A.; Day, J.P.

1995-01-01

There is accumulating evidence indicating genomic instability can manifest multiple generations after cellular exposure to DNA damaging agents. For instance, some cells surviving exposure to ionizing radiations show delayed reproductive cell death, delayed mutation and / or delayed chromosomal instability. Such instability, especially chromosome destabilization has been implicated in mutation, gene amplification, cellular transformation, and cell killing. To investigate chromosomal instability following DNA damage, we have used fluorescence in situ hybridization to detect chromosomal rearrangements in a human/hamster somatic hybrid cell line following exposure to ionizing radiation. Delayed chromosomal instability was detected when multiple populations of uniquely arranged metaphases were observed in clonal isolates raised from single cells. The relationship between delayed chromosomal destabilization and other endpoints of genomic instability, namely; delayed mutation and gene amplification will be discussed, as will the potential cytogenetic and molecular mechanisms contributing to delayed chromosomal instability

Plant mitochondrial genome: “A sweet and safe home'' for transgene ...

African Journals Online (AJOL)

Transfer of transgene through pollens to related plant species is a big environmental concern. Mitochondrion is also a superb and putative aspirant for transgene containment like plastids. Having its own transcription and translation machinery, and maternal inheritance gives assurance of transgene containment with high ...

The effect of ethylene on transgenic melon ripening and fruit quality ...

African Journals Online (AJOL)

In cell wall expression analysis, MPG1 increased when fruits of transgenic melons were exposed to ethylene; showing they are ethylene- dependent. MPG2 decreased ... Ethylene productions in transgenic fruits were reestablished when ethylene was applied, exhibiting the same behavior as transgenic fruits. Antioxidant ...

Unique mosaicism of structural chromosomal rearrangement: is chromosome 18 preferentially involved?

NARCIS (Netherlands)

Pater, J.M. de; Smeets, D.F.C.M.; Scheres, J.M.J.C.

2003-01-01

The mentally normal mother of a 4-year-old boy with del(18)(q21.3) syndrome was tested cytogenetically to study the possibility of an inherited structural rearrangement of chromosome 18. She was found to carry an unusual mosaicism involving chromosomes 18 and 21. Two unbalanced cell lines were seen

B chromosomes are associated with redistribution of genetic recombination towards lower recombination chromosomal regions in perennial ryegrass.

Science.gov (United States)

Harper, John; Phillips, Dylan; Thomas, Ann; Gasior, Dagmara; Evans, Caron; Powell, Wayne; King, Julie; King, Ian; Jenkins, Glyn; Armstead, Ian

2018-04-09

Supernumerary 'B' chromosomes are non-essential components of the genome present in a range of plant and animal species-including many grasses. Within diploid and polyploid ryegrass and fescue species, including the forage grass perennial ryegrass (Lolium perenne L.), the presence of B chromosomes has been reported as influencing both chromosome pairing and chiasma frequencies. In this study, the effects of the presence/absence of B chromosomes on genetic recombination has been investigated through generating DArT (Diversity Arrays Technology) marker genetic maps for six perennial ryegrass diploid populations, the pollen parents of which contained either two B or zero B chromosomes. Through genetic and cytological analyses of these progeny and their parents, we have identified that, while overall cytological estimates of chiasma frequencies were significantly lower in pollen mother cells with two B chromosomes as compared with zero B chromosomes, the recombination frequencies within some marker intervals were actually increased, particularly for marker intervals in lower recombination regions of chromosomes, namely pericentromeric regions. Thus, in perennial ryegrass, the presence of two B chromosomes redistributed patterns of meiotic recombination in pollen mother cells in ways which could increase the range of allelic variation available to plant breeders.

Designer proton-channel transgenic algae for photobiological hydrogen production

Science.gov (United States)

Lee, James Weifu [Knoxville, TN

2011-04-26

A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.

HIM-8 binds to the X chromosome pairing center and mediates chromosome-specific meiotic synapsis.

Science.gov (United States)

Phillips, Carolyn M; Wong, Chihunt; Bhalla, Needhi; Carlton, Peter M; Weiser, Pinky; Meneely, Philip M; Dernburg, Abby F

2005-12-16

The him-8 gene is essential for proper meiotic segregation of the X chromosomes in C. elegans. Here we show that loss of him-8 function causes profound X chromosome-specific defects in homolog pairing and synapsis. him-8 encodes a C2H2 zinc-finger protein that is expressed during meiosis and concentrates at a site on the X chromosome known as the meiotic pairing center (PC). A role for HIM-8 in PC function is supported by genetic interactions between PC lesions and him-8 mutations. HIM-8 bound chromosome sites associate with the nuclear envelope (NE) throughout meiotic prophase. Surprisingly, a point mutation in him-8 that retains both chromosome binding and NE localization fails to stabilize pairing or promote synapsis. These observations indicate that stabilization of homolog pairing is an active process in which the tethering of chromosome sites to the NE may be necessary but is not sufficient.

HIM-8 binds to the X chromosome pairing center and mediates chromosome-specific meiotic synapsis

International Nuclear Information System (INIS)

Phillips, Carolyn M.; Wong, Chihunt; Bhalla, Needhi; Carlton, Peter M.; Weiser, Pinky; Meneely, Philip M.; Dernburg, Abby F.

2005-01-01

The him-8 gene is essential for proper meiotic segregation of the X chromosomes in C. elegans. Here we show that loss of him-8 function causes profound X-chromosome-specific defects in homolog pairing and synapsis.him-8 encodes a C2H2 zinc finger protein that is expressed during meiosis and concentrates at a site on the X chromosome known as themeiotic Pairing Center (PC). A role for HIM-8 in PC function is supported by genetic interactions between PC lesions and him-8 mutations. HIM-8-bound chromosome sites associate with the nuclear envelope (NE)throughout meiotic prophase. Surprisingly, a point mutation in him-8 that retains both chromosome binding and NE localization fails to stabilize pairing or promote synapsis. These observations indicate that stabilization of homolog pairing is an active process in which the tethering of chromosome sites to the NE may be necessary but is not sufficient

Transgenics in Agriculture

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

Statistics for X-chromosome associations.

Science.gov (United States)

Özbek, Umut; Lin, Hui-Min; Lin, Yan; Weeks, Daniel E; Chen, Wei; Shaffer, John R; Purcell, Shaun M; Feingold, Eleanor

2018-06-13

In a genome-wide association study (GWAS), association between genotype and phenotype at autosomal loci is generally tested by regression models. However, X-chromosome data are often excluded from published analyses of autosomes because of the difference between males and females in number of X chromosomes. Failure to analyze X-chromosome data at all is obviously less than ideal, and can lead to missed discoveries. Even when X-chromosome data are included, they are often analyzed with suboptimal statistics. Several mathematically sensible statistics for X-chromosome association have been proposed. The optimality of these statistics, however, is based on very specific simple genetic models. In addition, while previous simulation studies of these statistics have been informative, they have focused on single-marker tests and have not considered the types of error that occur even under the null hypothesis when the entire X chromosome is scanned. In this study, we comprehensively tested several X-chromosome association statistics using simulation studies that include the entire chromosome. We also considered a wide range of trait models for sex differences and phenotypic effects of X inactivation. We found that models that do not incorporate a sex effect can have large type I error in some cases. We also found that many of the best statistics perform well even when there are modest deviations, such as trait variance differences between the sexes or small sex differences in allele frequencies, from assumptions. © 2018 WILEY PERIODICALS, INC.

Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

International Nuclear Information System (INIS)

Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

2005-01-01

It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

Overexpression of a flower-specific aerolysin-like protein from the dioecious plant Rumex acetosa alters flower development and induces male sterility in transgenic tobacco.

Science.gov (United States)

Manzano, Susana; Megías, Zoraida; Martínez, Cecilia; García, Alicia; Aguado, Encarnación; Chileh, Tarik; López-Alonso, Diego; García-Maroto, Federico; Kejnovský, Eduard; Široký, Jiří; Kubát, Zdeněk; Králová, Tereza; Vyskot, Boris; Jamilena, Manuel

2017-01-01

Sex determination in Rumex acetosa, a dioecious plant with a complex XY 1 Y 2 sex chromosome system (females are XX and males are XY 1 Y 2 ), is not controlled by an active Y chromosome but depends on the ratio between the number of X chromosomes and autosomes. To gain insight into the molecular mechanisms of sex determination, we generated a subtracted cDNA library enriched in genes specifically or predominantly expressed in female floral buds in early stages of development, when sex determination mechanisms come into play. In the present paper, we report the molecular and functional characterization of FEM32, a gene encoding a protein that shares a common architecture with proteins in different plants, animals, bacteria and fungi of the aerolysin superfamily; many of these function as β pore-forming toxins. The expression analysis, assessed by northern blot, RT-PCR and in situ hybridization, demonstrates that this gene is specifically expressed in flowers in both early and late stages of development, although its transcripts accumulate much more in female flowers than in male flowers. The ectopic expression of FEM32 under both the constitutive promoter 35S and the flower-specific promoter AP3 in transgenic tobacco showed no obvious alteration in vegetative development but was able to alter floral organ growth and pollen fertility. The 35S::FEM32 and AP3::FEM32 transgenic lines showed a reduction in stamen development and pollen viability, as well as a diminution in fruit set, fruit development and seed production. Compared with other floral organs, pistil development was, however, enhanced in plants overexpressing FEM32. According to these effects, it is likely that FEM32 functions in Rumex by arresting stamen and pollen development during female flower development. The aerolysin-like pore-forming proteins of eukaryotes are mainly involved in defence mechanisms against bacteria, fungi and insects and are also involved in apoptosis and programmed cell death (PCD

Chromosome Connections: Compelling Clues to Common Ancestry

Science.gov (United States)

Flammer, Larry

2013-01-01

Students compare banding patterns on hominid chromosomes and see striking evidence of their common ancestry. To test this, human chromosome no. 2 is matched with two shorter chimpanzee chromosomes, leading to the hypothesis that human chromosome 2 resulted from the fusion of the two shorter chromosomes. Students test that hypothesis by looking for…

First molecular identification of the transgene red fluorescent protein (RFP in transgenic ornamental zebrafish (Danio rerio introduced in Peru

Directory of Open Access Journals (Sweden)

Carlos Scotto

2013-09-01

Full Text Available In this paper the transgenic fluorescent red, orange and pink zebra fish (Danio rerio, found in local aquariums in Peru, were identified using the PCR technique to amplify the transgene RFP sea anemone belonging to Discosoma spp. The gene expression of the red fluorescent protein (RFP transgene was found to determine different gradients-of-bioluminescence (shades in color in each GMO fish analyzed. We performed sequence analysis of the two variants of the RFP along with six variants of the existing fluorescent protein GFP from the Genbank, this could help identify quickly if they are new genes or variants thereof as these novel fluorescent proteins may be introduced in aquatic GMO in the future. Thus, developing and improving biosecurity measures through its timely detection at the molecular genetic level.

Linkage group-chromosome correlations in Sordaria macrospora: Chromosome identification by three dimensional reconstruction of their synaptonemal complex.

Science.gov (United States)

Zickler, D; Leblon, G; Haedens, V; Collard, A; Thuriaux, P

1984-01-01

Reconstruction of serially sectioned zygotene and pachytene nuclei has allowed, by measuring the lengths of synaptonemal complexes, an assignment of the 7 linkage (LG) groups to the 7 chromosomes in the fungus Sordaria macrospora. The 7 LG have been established using 19 mutants showing low second division segregation frequencies. Eight chromosomal rearrangements mapped on the 7 LG were used to identify the chromosomes involved. The following one to one assignment of the 7 LG to specific chromosomes was obtained: LG a: chromosome (chr) 1, LG b: chr5, LG c: chr6, LG d: chr7, LG e: chr4, LG f: chr3 and LG g: chr2 (the chromosome carrying the nucleolus organizer region).

Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

Energy Technology Data Exchange (ETDEWEB)

Warburton, P.E.; Gosden, J.; Lawson, D. [Western General Hospital, Edinburgh (United Kingdom)] [and others

1996-04-15

Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

Comparative physical mapping between wheat chromosome arm 2BL and rice chromosome 4.

Science.gov (United States)

Lee, Tong Geon; Lee, Yong Jin; Kim, Dae Yeon; Seo, Yong Weon

2010-12-01

Physical maps of chromosomes provide a framework for organizing and integrating diverse genetic information. DNA microarrays are a valuable technique for physical mapping and can also be used to facilitate the discovery of single feature polymorphisms (SFPs). Wheat chromosome arm 2BL was physically mapped using a Wheat Genome Array onto near-isogenic lines (NILs) with the aid of wheat-rice synteny and mapped wheat EST information. Using high variance probe set (HVP) analysis, 314 HVPs constituting genes present on 2BL were identified. The 314 HVPs were grouped into 3 categories: HVPs that match only rice chromosome 4 (298 HVPs), those that match only wheat ESTs mapped on 2BL (1), and those that match both rice chromosome 4 and wheat ESTs mapped on 2BL (15). All HVPs were converted into gene sets, which represented either unique rice gene models or mapped wheat ESTs that matched identified HVPs. Comparative physical maps were constructed for 16 wheat gene sets and 271 rice gene sets. Of the 271 rice gene sets, 257 were mapped to the 18-35 Mb regions on rice chromosome 4. Based on HVP analysis and sequence similarity between the gene models in the rice chromosomes and mapped wheat ESTs, the outermost rice gene model that limits the translocation breakpoint to orthologous regions was identified.

A Rare De novo Complex Chromosomal Rearrangement (CCR) Involving Four Chromosomes in An Oligo-asthenosperm Infertile Man.

Science.gov (United States)

Asia, Saba; Vaziri Nasab, Hamed; Sabbaghian, Marjan; Kalantari, Hamid; Zari Moradi, Shabnam; Gourabi, Hamid; Mohseni Meybodi, Anahita

2014-01-01

Complex chromosomal rearrangements (CCRs) are rare events involving more than two chromosomes and over two breakpoints. They are usually associated with infertility or sub fertility in male carriers. Here we report a novel case of a CCR in a 30-year-old oligoasthenosperm man with a history of varicocelectomy, normal testes size and normal endocrinology profile referred for chromosome analysis to the Genetics unit of Royan Reproductive Biomedicine Research Center. Chromosomal analysis was performed using peripheral blood lymphocyte cultures and analyzed by GTG banding. Additional tests such as C-banding and multicolor fluorescence in situ hybridization (FISH) procedure for each of the involved chromosomes were performed to determine the patterns of the segregations. Y chromosome microdeletions in the azoospermia factor (AZF) region were analyzed with multiplex polymerase chain reaction. To identify the history and origin of this CCR, all the family members were analyzed. No micro deletion in Y chromosome was detected. The same de novo reciprocal exchange was also found in his monozygous twin brother. The other siblings and parents were normal. CCRs are associated with male infertility as a result of spermatogenic disruption due to complex meiotic configurations and the production of chromosomally abnormal sperms. These chromosomal rearrangements might have an influence on decreasing the number of sperms.

Chromosome Banding in Amphibia. XXXVI. Multimorphic Sex Chromosomes and an Enigmatic Sex Determination in Eleutherodactylus johnstonei (Anura, Eleutherodactylidae).

Science.gov (United States)

Schmid, Michael; Steinlein, Claus

2018-01-01

A detailed cytogenetic study on the leaf litter frog Eleutherodactylus johnstonei from 14 different Caribbean islands and the mainlands of Venezuela and Guyana revealed the existence of multimorphic XY♂/XX♀ sex chromosomes 14. Their male sex determination and development depends either on the presence of 2 telocentric chromosomes 14 (XtYt), or on 1 submetacentric chromosome 14 (Xsm) plus 1 telocentric chromosome 14 (Yt), or on the presence of 2 submetacentric chromosomes 14 (XsmYsm). The female sex determination and development requires either the presence of 2 telocentric chromosomes 14 (XtXt) or 2 submetacentric chromosomes 14 (XsmXsm). In all individuals analyzed, the sex chromosomes 14 carry a prominent nucleolus organizer region in their long arms. An explanation is given for the origin of the (XtYt)♂, (XsmYt)♂, (XsmYsm)♂, (XtXt)♀, and (XsmXsm)♀ in the different populations of E. johnstonei. Furthermore, the present study gives detailed data on the chromosome banding patterns, in situ hybridization experiments, and the genome size of E. johnstonei. © 2018 S. Karger AG, Basel.

The mechanisms underlying sexual differentiation of behavior and physiology in mammals and birds: relative contributions of sex steroids and sex chromosomes

Directory of Open Access Journals (Sweden)

Fumihiko eMaekawa

2014-08-01

Full Text Available From a classical viewpoint, sex-specific behavior and physiological functions as well as the brain structures of mammals such as rats and mice, have been thought to be influenced by perinatal sex steroids secreted by the gonads. Sex steroids have also been thought to affect the differentiation of the sex-typical behavior of a few members of the avian order Galliformes, including the Japanese quail and chickens, during their development in ovo. However, recent mammalian studies that focused on the artificial shuffling or knockout of the sex-determining gene, Sry, have revealed that sex chromosomal effects may be associated with particular types of sex-linked differences such as aggression levels, social interaction, and autoimmune diseases, independently of sex steroid-mediated effects. In addition, studies on naturally occurring, rare phenomena such as gynandromorphic birds and experimentally constructed chimeras in which the composition of sex chromosomes in the brain differs from that in the other parts of the body, indicated that sex chromosomes play certain direct roles in the sex-specific differentiation of the gonads and the brain. In this article, we review the relative contributions of sex steroids and sex chromosomes in the determination of brain functions related to sexual behavior and reproductive physiology in mammals and birds.

Calcium electrotransfer for termination of transgene expression in muscle

DEFF Research Database (Denmark)

Hojman, Pernille; Spanggaard, Iben; Olsen, Caroline Holkman

2011-01-01

Gene electrotransfer is expanding in clinical use, thus we have searched for an emergency procedure to stop transgene expression in case of serious adverse events. Calcium is cytotoxic at high intracellular levels, so we tested effects of calcium electrotransfer on transgene expression in muscle....... A clinical grade calcium solution (20 μl, 168 mM) was injected into transfected mouse or rat tibialis cranialis muscle. Ca(2+) uptake was quantified using calcium 45 ((45)Ca), and voltage and time between injection and pulsation were varied. Extinction of transgene expression was investigated by using both...... voltage pulses of 1000 V/cm. Using these parameters, in vivo imaging showed that transgene expression significantly decreased 4 hr after Ca(2+) electrotransfer and was eliminated within 24 hr. Similarly, serum erythropoietin was reduced by 46% at 4 hr and to control levels at 2 days. Histological analyses...

Polycythemia in transgenic mice expressing the human erythropoietin gene

International Nuclear Information System (INIS)

Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.; Antonarakis, S.E.

1989-01-01

Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5' flanking sequence and 0.7 kilobase of 3' flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver, adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels

Cre-/IoxP-Mediated Recombination between the SIL and SCL Genes Leads to a Block in T-Cell Development at the CD4-CD8- to CD4+CD8+ Transition

Directory of Open Access Journals (Sweden)

Yue Cheng

2007-04-01

Full Text Available In the most common form of stem cell leukemia (SCL gene rearrangement, an interstitial deletion of 82 kb brings SCL under the control of regulatory elements that normally govern expression of the ubiquitously expressed SCL interrupting locus (SIL gene, which is located directly upstream of SCL. To investigate the effect of this fusion in a mouse model, a bacterial artificial chromosome (BAC clone containing both human SIL and SCL genes was isolated, and IoxP sites were inserted into intron 1 of both the SIL and SCL genes, corresponding to the sites at which recombination occurs in human T-cell acute lymphocytic leukemia patients. This BAC clone was used to generate transgenic SILIoxloxSCL mice. These transgenic mice were subsequently bred to Lck-Cre mice that express the Cre recombinase specifically in the thymus. The BAC transgene was recombined between the two IoxP sites in over 50% of the thymocytes from SILIoxloxSCL/Cre double-transgenic mice, bringing the SCL gene under the direct control of SIL regulatory elements. Aberrant SCL gene expression in the thymus was verified by reverse transcription- polymerase chain reaction. Using FACS analysis, we found that mice carrying both SILIoxloxSCL and Cre transgenes have increased CD4-/CD8- thymocytes compared with transgenenegative mice. In the spleen, these transgenic mice show a marked reduction in the number of mature CD4+ or CD8+ cells. These results demonstrate that conditional activation of SCL under control of SIL regulatory elements can impair normal T-cell development.

Novel activation domain derived from Che-1 cofactor coupled with the artificial protein Jazz drives utrophin upregulation.

Science.gov (United States)

Desantis, Agata; Onori, Annalisa; Di Certo, Maria Grazia; Mattei, Elisabetta; Fanciulli, Maurizio; Passananti, Claudio; Corbi, Nicoletta

2009-02-01

Our aim is to upregulate the expression level of the dystrophin related gene utrophin in Duchenne muscular dystrophy, thus complementing the lack of dystrophin functions. To this end, we have engineered synthetic zinc finger based transcription factors. We have previously shown that the artificial three-zinc finger protein named Jazz fused with the Vp16 activation domain, is able to bind utrophin promoter A and to increase the endogenous level of utrophin in transgenic mice. Here, we report on an innovative artificial protein, named CJ7, that consists of Jazz DNA binding domain fused to a novel activation domain derived from the regulatory multivalent adaptor protein Che-1/AATF. This transcriptional activation domain is 100 amino acids in size and it is very powerful as compared to the Vp16 activation domain. We show that CJ7 protein efficiently promotes transcription and accumulation of the acetylated form of histone H3 on the genomic utrophin promoter locus.

Artificial intelligence

CERN Document Server

Hunt, Earl B

1975-01-01

Artificial Intelligence provides information pertinent to the fundamental aspects of artificial intelligence. This book presents the basic mathematical and computational approaches to problems in the artificial intelligence field.Organized into four parts encompassing 16 chapters, this book begins with an overview of the various fields of artificial intelligence. This text then attempts to connect artificial intelligence problems to some of the notions of computability and abstract computing devices. Other chapters consider the general notion of computability, with focus on the interaction bet

Frequencies of chromosome aberration on radiation workers

International Nuclear Information System (INIS)

Yanti Lusiyanti; Zubaidah Alatas

2016-01-01

Radiation exposure of the body can cause damage to the genetic material in cells (cytogenetic) in the form of changes in the structure or chromosomal aberrations in peripheral blood lymphocytes. Chromosomal aberrations can be unstable as dicentric and ring chromosomes, and is stable as translocation. Dicentric chromosome is the gold standard biomarker due to radiation exposure, and chromosome translocation is a biomarker for retrospective biodosimetry. The aim of this studi is to conduct examination of chromosomal aberrations in the radiation worker to determine the potential damage of cell that may arise due to occupational radiation exposure. The examination have been carried out on blood samples from 55 radiation workers in the range of 5-30 year of service. Chromosome aberration frequency measurement starts with blood sampling, culturing, harvesting, slide preparations, and lymphocyte chromosome staining with Giemsa and painting with Fluorescence In Situ Hybridization (FISH) technique. The results showed that chromosomal translocations are not found in blood samples radiation workers and dicentric chromosomes found only on 2 blood samples of radiation workers with a frequency of 0.001/cell. The frequency of chromosomal aberrations in the blood cells such workers within normal limits and this means that the workers have been implemented a radiation safety aspects very well. (author)

Telomere dysfunction and chromosome structure modulate the contribution of individual chromosomes in abnormal nuclear morphologies

Energy Technology Data Exchange (ETDEWEB)

Pampalona, J.; Soler, D.; Genesca, A. [Department of Cell Biology, Physiology and Immunology, Universitat Autonoma de Barcelona, Bellaterra E-08193 (Spain); Tusell, L., E-mail: laura.tusell@uab.es [Department of Cell Biology, Physiology and Immunology, Universitat Autonoma de Barcelona, Bellaterra E-08193 (Spain)

2010-01-05

The cytokinesis-block micronucleus assay has emerged as a biomarker of chromosome damage relevant to cancer. Although it was initially developed to measure micronuclei, it is also useful for measuring nucleoplasmic bridges and nuclear buds. Abnormal nuclear morphologies are frequently observed in malignant tissues and short-term tumour cell cultures. Changes in chromosome structure and number resulting from chromosome instability are important factors in oncogenesis. Telomeres have become key players in the initiation of chromosome instability related to carcinogenesis by means of breakage-fusion-bridge cycles. To better understand the connection between telomere dysfunction and the appearance of abnormal nuclear morphologies, we have characterised the presence of micronuclei, nucleoplasmic bridges and nuclear buds in human mammary primary epithelial cells. These cells can proliferate beyond the Hayflick limit by spontaneously losing expression of the p16{sup INK4a} protein. Progressive telomere shortening leads to the loss of the capping function, and the appearance of end-to-end chromosome fusions that can enter into breakage-fusion-bridge cycles generating massive chromosomal instability. In human mammary epithelial cells, different types of abnormal nuclear morphologies were observed, however only nucleoplasmatic bridges and buds increased significantly with population doublings. Fluorescent in situ hybridisation using centromeric and painting specific probes for chromosomes with eroded telomeres has revealed that these chromosomes are preferentially included in the different types of abnormal nuclear morphologies observed, thus reflecting their common origin. Accordingly, real-time imaging of cell divisions enabled us to determine that anaphase bridge resolution was mainly through chromatin breakage and the formation of symmetric buds in daughter nuclei. Few micronuclei emerged in this cell system thus validating the scoring of nucleoplasmic bridges and

Telomere dysfunction and chromosome structure modulate the contribution of individual chromosomes in abnormal nuclear morphologies

International Nuclear Information System (INIS)

Pampalona, J.; Soler, D.; Genesca, A.; Tusell, L.

2010-01-01

The cytokinesis-block micronucleus assay has emerged as a biomarker of chromosome damage relevant to cancer. Although it was initially developed to measure micronuclei, it is also useful for measuring nucleoplasmic bridges and nuclear buds. Abnormal nuclear morphologies are frequently observed in malignant tissues and short-term tumour cell cultures. Changes in chromosome structure and number resulting from chromosome instability are important factors in oncogenesis. Telomeres have become key players in the initiation of chromosome instability related to carcinogenesis by means of breakage-fusion-bridge cycles. To better understand the connection between telomere dysfunction and the appearance of abnormal nuclear morphologies, we have characterised the presence of micronuclei, nucleoplasmic bridges and nuclear buds in human mammary primary epithelial cells. These cells can proliferate beyond the Hayflick limit by spontaneously losing expression of the p16 INK4a protein. Progressive telomere shortening leads to the loss of the capping function, and the appearance of end-to-end chromosome fusions that can enter into breakage-fusion-bridge cycles generating massive chromosomal instability. In human mammary epithelial cells, different types of abnormal nuclear morphologies were observed, however only nucleoplasmatic bridges and buds increased significantly with population doublings. Fluorescent in situ hybridisation using centromeric and painting specific probes for chromosomes with eroded telomeres has revealed that these chromosomes are preferentially included in the different types of abnormal nuclear morphologies observed, thus reflecting their common origin. Accordingly, real-time imaging of cell divisions enabled us to determine that anaphase bridge resolution was mainly through chromatin breakage and the formation of symmetric buds in daughter nuclei. Few micronuclei emerged in this cell system thus validating the scoring of nucleoplasmic bridges and nuclear

Telomere dysfunction and chromosome structure modulate the contribution of individual chromosomes in abnormal nuclear morphologies.

Science.gov (United States)

Pampalona, J; Soler, D; Genescà, A; Tusell, L

2010-01-05

The cytokinesis-block micronucleus assay has emerged as a biomarker of chromosome damage relevant to cancer. Although it was initially developed to measure micronuclei, it is also useful for measuring nucleoplasmic bridges and nuclear buds. Abnormal nuclear morphologies are frequently observed in malignant tissues and short-term tumour cell cultures. Changes in chromosome structure and number resulting from chromosome instability are important factors in oncogenesis. Telomeres have become key players in the initiation of chromosome instability related to carcinogenesis by means of breakage-fusion-bridge cycles. To better understand the connection between telomere dysfunction and the appearance of abnormal nuclear morphologies, we have characterised the presence of micronuclei, nucleoplasmic bridges and nuclear buds in human mammary primary epithelial cells. These cells can proliferate beyond the Hayflick limit by spontaneously losing expression of the p16(INK4a) protein. Progressive telomere shortening leads to the loss of the capping function, and the appearance of end-to-end chromosome fusions that can enter into breakage-fusion-bridge cycles generating massive chromosomal instability. In human mammary epithelial cells, different types of abnormal nuclear morphologies were observed, however only nucleoplasmatic bridges and buds increased significantly with population doublings. Fluorescent in situ hybridisation using centromeric and painting specific probes for chromosomes with eroded telomeres has revealed that these chromosomes are preferentially included in the different types of abnormal nuclear morphologies observed, thus reflecting their common origin. Accordingly, real-time imaging of cell divisions enabled us to determine that anaphase bridge resolution was mainly through chromatin breakage and the formation of symmetric buds in daughter nuclei. Few micronuclei emerged in this cell system thus validating the scoring of nucleoplasmic bridges and nuclear

Prospecting for Microelement Function and Biosafety Assessment of Transgenic Cereal Plants

Directory of Open Access Journals (Sweden)

Xiaofen Yu

2018-03-01

Full Text Available Microelement contents and metabolism are vitally important for cereal plant growth and development as well as end-use properties. While minerals phytotoxicity harms plants, microelement deficiency also affects human health. Genetic engineering provides a promising way to solve these problems. As plants vary in abilities to uptake, transport, and accumulate minerals, and the key enzymes acting on that process is primarily presented in this review. Subsequently, microelement function and biosafety assessment of transgenic cereal plants have become a key issue to be addressed. Progress in genetic engineering of cereal plants has been made with the introduction of quality, high-yield, and resistant genes since the first transgenic rice, corn, and wheat were born in 1988, 1990, and 1992, respectively. As the biosafety issue of transgenic cereal plants has now risen to be a top concern, many studies on transgenic biosafety have been carried out. Transgenic cereal biosafety issues mainly include two subjects, environmental friendliness and end-use safety. Different levels of gene confirmation, genomics, proteomics, metabolomics and nutritiomics, absorption, metabolism, and function have been investigated. Also, the different levels of microelement contents have been measured in transgenic plants. Based on the motivation of the requested biosafety, systematic designs, and analysis of transgenic cereal are also presented in this review paper.

Prospecting for Microelement Function and Biosafety Assessment of Transgenic Cereal Plants.

Science.gov (United States)

Yu, Xiaofen; Luo, Qingchen; Huang, Kaixun; Yang, Guangxiao; He, Guangyuan

2018-01-01

Microelement contents and metabolism are vitally important for cereal plant growth and development as well as end-use properties. While minerals phytotoxicity harms plants, microelement deficiency also affects human health. Genetic engineering provides a promising way to solve these problems. As plants vary in abilities to uptake, transport, and accumulate minerals, and the key enzymes acting on that process is primarily presented in this review. Subsequently, microelement function and biosafety assessment of transgenic cereal plants have become a key issue to be addressed. Progress in genetic engineering of cereal plants has been made with the introduction of quality, high-yield, and resistant genes since the first transgenic rice, corn, and wheat were born in 1988, 1990, and 1992, respectively. As the biosafety issue of transgenic cereal plants has now risen to be a top concern, many studies on transgenic biosafety have been carried out. Transgenic cereal biosafety issues mainly include two subjects, environmental friendliness and end-use safety. Different levels of gene confirmation, genomics, proteomics, metabolomics and nutritiomics, absorption, metabolism, and function have been investigated. Also, the different levels of microelement contents have been measured in transgenic plants. Based on the motivation of the requested biosafety, systematic designs, and analysis of transgenic cereal are also presented in this review paper.

Label Free Chromosome Translocation Detection with Silicon nanowires

DEFF Research Database (Denmark)

Kwasny, Dorota; Andersen, Karsten Brandt; Frøhling, Kasper Bayer

HROMOSOME translocation, which is a rearrangement of arms between two chromosomes, is a major group of chromosome abnormalities leading to cancer. As a result, two derivative chromosomes with sequences coming from both chromosomes are formed. The current translocation detection method is a Fluore......HROMOSOME translocation, which is a rearrangement of arms between two chromosomes, is a major group of chromosome abnormalities leading to cancer. As a result, two derivative chromosomes with sequences coming from both chromosomes are formed. The current translocation detection method...

Female chromosome X mosaicism is age-related and preferentially affects the inactivated X chromosome

Science.gov (United States)

Machiela, Mitchell J.; Zhou, Weiyin; Karlins, Eric; Sampson, Joshua N.; Freedman, Neal D.; Yang, Qi; Hicks, Belynda; Dagnall, Casey; Hautman, Christopher; Jacobs, Kevin B.; Abnet, Christian C.; Aldrich, Melinda C.; Amos, Christopher; Amundadottir, Laufey T.; Arslan, Alan A.; Beane-Freeman, Laura E.; Berndt, Sonja I.; Black, Amanda; Blot, William J.; Bock, Cathryn H.; Bracci, Paige M.; Brinton, Louise A.; Bueno-de-Mesquita, H Bas; Burdett, Laurie; Buring, Julie E.; Butler, Mary A.; Canzian, Federico; Carreón, Tania; Chaffee, Kari G.; Chang, I-Shou; Chatterjee, Nilanjan; Chen, Chu; Chen, Constance; Chen, Kexin; Chung, Charles C.; Cook, Linda S.; Crous Bou, Marta; Cullen, Michael; Davis, Faith G.; De Vivo, Immaculata; Ding, Ti; Doherty, Jennifer; Duell, Eric J.; Epstein, Caroline G.; Fan, Jin-Hu; Figueroa, Jonine D.; Fraumeni, Joseph F.; Friedenreich, Christine M.; Fuchs, Charles S.; Gallinger, Steven; Gao, Yu-Tang; Gapstur, Susan M.; Garcia-Closas, Montserrat; Gaudet, Mia M.; Gaziano, J. Michael; Giles, Graham G.; Gillanders, Elizabeth M.; Giovannucci, Edward L.; Goldin, Lynn; Goldstein, Alisa M.; Haiman, Christopher A.; Hallmans, Goran; Hankinson, Susan E.; Harris, Curtis C.; Henriksson, Roger; Holly, Elizabeth A.; Hong, Yun-Chul; Hoover, Robert N.; Hsiung, Chao A.; Hu, Nan; Hu, Wei; Hunter, David J.; Hutchinson, Amy; Jenab, Mazda; Johansen, Christoffer; Khaw, Kay-Tee; Kim, Hee Nam; Kim, Yeul Hong; Kim, Young Tae; Klein, Alison P.; Klein, Robert; Koh, Woon-Puay; Kolonel, Laurence N.; Kooperberg, Charles; Kraft, Peter; Krogh, Vittorio; Kurtz, Robert C.; LaCroix, Andrea; Lan, Qing; Landi, Maria Teresa; Marchand, Loic Le; Li, Donghui; Liang, Xiaolin; Liao, Linda M.; Lin, Dongxin; Liu, Jianjun; Lissowska, Jolanta; Lu, Lingeng; Magliocco, Anthony M.; Malats, Nuria; Matsuo, Keitaro; McNeill, Lorna H.; McWilliams, Robert R.; Melin, Beatrice S.; Mirabello, Lisa; Moore, Lee; Olson, Sara H.; Orlow, Irene; Park, Jae Yong; Patiño-Garcia, Ana; Peplonska, Beata; Peters, Ulrike; Petersen, Gloria M.; Pooler, Loreall; Prescott, Jennifer; Prokunina-Olsson, Ludmila; Purdue, Mark P.; Qiao, You-Lin; Rajaraman, Preetha; Real, Francisco X.; Riboli, Elio; Risch, Harvey A.; Rodriguez-Santiago, Benjamin; Ruder, Avima M.; Savage, Sharon A.; Schumacher, Fredrick; Schwartz, Ann G.; Schwartz, Kendra L.; Seow, Adeline; Wendy Setiawan, Veronica; Severi, Gianluca; Shen, Hongbing; Sheng, Xin; Shin, Min-Ho; Shu, Xiao-Ou; Silverman, Debra T.; Spitz, Margaret R.; Stevens, Victoria L.; Stolzenberg-Solomon, Rachael; Stram, Daniel; Tang, Ze-Zhong; Taylor, Philip R.; Teras, Lauren R.; Tobias, Geoffrey S.; Van Den Berg, David; Visvanathan, Kala; Wacholder, Sholom; Wang, Jiu-Cun; Wang, Zhaoming; Wentzensen, Nicolas; Wheeler, William; White, Emily; Wiencke, John K.; Wolpin, Brian M.; Wong, Maria Pik; Wu, Chen; Wu, Tangchun; Wu, Xifeng; Wu, Yi-Long; Wunder, Jay S.; Xia, Lucy; Yang, Hannah P.; Yang, Pan-Chyr; Yu, Kai; Zanetti, Krista A.; Zeleniuch-Jacquotte, Anne; Zheng, Wei; Zhou, Baosen; Ziegler, Regina G.; Perez-Jurado, Luis A.; Caporaso, Neil E.; Rothman, Nathaniel; Tucker, Margaret; Dean, Michael C.; Yeager, Meredith; Chanock, Stephen J.

2016-01-01

To investigate large structural clonal mosaicism of chromosome X, we analysed the SNP microarray intensity data of 38,303 women from cancer genome-wide association studies (20,878 cases and 17,425 controls) and detected 124 mosaic X events >2 Mb in 97 (0.25%) women. Here we show rates for X-chromosome mosaicism are four times higher than mean autosomal rates; X mosaic events more often include the entire chromosome and participants with X events more likely harbour autosomal mosaic events. X mosaicism frequency increases with age (0.11% in 50-year olds; 0.45% in 75-year olds), as reported for Y and autosomes. Methylation array analyses of 33 women with X mosaicism indicate events preferentially involve the inactive X chromosome. Our results provide further evidence that the sex chromosomes undergo mosaic events more frequently than autosomes, which could have implications for understanding the underlying mechanisms of mosaic events and their possible contribution to risk for chronic diseases. PMID:27291797

Influence of Phytase Transgenic Corn on the Intestinal Microflora and the Fate of Transgenic DNA and Protein in Digesta and Tissues of Broilers

Science.gov (United States)

Li, Sufen; Li, Ang; Zhang, Liyang; Liu, Zhenhua; Luo, Xugang

2015-01-01

An experiment was conducted to investigate the effect of phytase transgenic corn (PTC) on intestinal microflora, and the fate of transgenic DNA and protein in the digesta and tissues of broilers. A total of 160 1-day-old Arbor Acres commercial male broilers were randomly assigned to 20 cages (8 chicks per cage) with 10 cages (replicates) for each treatment. Birds were fed with a diet containing either PTC (54.0% during 1–21 days and 61.0% during 22–42 days) or non-transgenic isogenic control corn (CC) for a duration of 42 days. There were no significant differences (P>0.05) between birds fed with the PTC diets and those fed with the CC diets in the quantities of aerobic bacteria, anaerobic bacteria, colibacillus and lactobacilli, or microbial diversities in the contents of ileum and cecum. Transgenic phyA2 DNA was not detected, but phyA2 protein was detected in the digesta of duodenum and jejunum of broilers fed with the PTC diets. Both transgenic phyA2 DNA and protein fragments were not found in the digesta of the ileum and rectum, heart, liver, kidney, and breast or thigh muscles of broilers fed with the PTC diets. It was concluded that PTC had no adverse effect on the quantity and diversity of gut microorganisms; Transgenic phyA2 DNA or protein was rapidly degraded in the intestinal tract and was not transferred to the tissues of broilers. PMID:26599444

Stabilization of chromosomes by DNA intercalators for flow karyotyping and identification by banding of isolated chromosomes

NARCIS (Netherlands)

Aten, J. A.; Buys, C. H.; van der Veen, A. Y.; Mesa, J. R.; Yu, L. C.; Gray, J. W.; Osinga, J.; Stap, J.

1987-01-01

A number of structurally unrelated DNA intercalators have been studied as stabilizers of mitotic chromosomes during isolation from rodent and human metaphase cells. Seven out of the nine intercalators tested were found to be useful as chromosome stabilizing agents. Chromosome suspensions prepared in

Transgenic animals and their application in medicine

OpenAIRE

Bagle TR, Kunkulol RR, Baig MS, More SY

2013-01-01

Transgenic animals are animals that are genetically altered to have traits that mimic symptoms of specific human pathologies. They provide genetic models of various human diseases which are important in understanding disease and developing new targets. In early 1980 Gordon and co-workers described the first gene addition experiment using the microinjection technology and since then the impact of transgenic technology on basic research has been significant. Within 20 years of its inception, AT...

Neocentromeres Provide Chromosome Segregation Accuracy and Centromere Clustering to Multiple Loci along a Candida albicans Chromosome.

Directory of Open Access Journals (Sweden)

Laura S Burrack

2016-09-01

Full Text Available Assembly of kinetochore complexes, involving greater than one hundred proteins, is essential for chromosome segregation and genome stability. Neocentromeres, or new centromeres, occur when kinetochores assemble de novo, at DNA loci not previously associated with kinetochore proteins, and they restore chromosome segregation to chromosomes lacking a functional centromere. Neocentromeres have been observed in a number of diseases and may play an evolutionary role in adaptation or speciation. However, the consequences of neocentromere formation on chromosome missegregation rates, gene expression, and three-dimensional (3D nuclear structure are not well understood. Here, we used Candida albicans, an organism with small, epigenetically-inherited centromeres, as a model system to study the functions of twenty different neocentromere loci along a single chromosome, chromosome 5. Comparison of neocentromere properties relative to native centromere functions revealed that all twenty neocentromeres mediated chromosome segregation, albeit to different degrees. Some neocentromeres also caused reduced levels of transcription from genes found within the neocentromere region. Furthermore, like native centromeres, neocentromeres clustered in 3D with active/functional centromeres, indicating that formation of a new centromere mediates the reorganization of 3D nuclear architecture. This demonstrates that centromere clustering depends on epigenetically defined function and not on the primary DNA sequence, and that neocentromere function is independent of its distance from the native centromere position. Together, the results show that a neocentromere can form at many loci along a chromosome and can support the assembly of a functional kinetochore that exhibits native centromere functions including chromosome segregation accuracy and centromere clustering within the nucleus.

ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.

Directory of Open Access Journals (Sweden)

Donal McHugh

Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.

Artificial Consciousness or Artificial Intelligence

Directory of Open Access Journals (Sweden)

Spanache Florin

2017-05-01

Full Text Available Artificial intelligence is a tool designed by people for the gratification of their own creative ego, so we can not confuse conscience with intelligence and not even intelligence in its human representation with conscience. They are all different concepts and they have different uses. Philosophically, there are differences between autonomous people and automatic artificial intelligence. This is the difference between intelligence and artificial intelligence, autonomous versus automatic. But conscience is above these differences because it is neither conditioned by the self-preservation of autonomy, because a conscience is something that you use to help your neighbor, nor automatic, because one’s conscience is tested by situations which are not similar or subject to routine. So, artificial intelligence is only in science-fiction literature similar to an autonomous conscience-endowed being. In real life, religion with its notions of redemption, sin, expiation, confession and communion will not have any meaning for a machine which cannot make a mistake on its own.

Comparative studies focusing on transgenic through cp4EPSPS gene and non-transgenic soybean plants: an analysis of protein species and enzymes.

Science.gov (United States)

Arruda, Sandra C C; Barbosa, Herbert S; Azevedo, Ricardo A; Arruda, Marco A Z

2013-11-20

This work evaluates the activity of a few key enzymes involved in combating reactive oxygen species (ROS), such as ascorbate peroxidase (EC 1.11.1.11), catalase (EC 1.11.1.6), glutathione reductase (EC 1.6.4.2), and superoxide dismutase (EC 1.15.1.1), as well as the concentration of malondialdehyde and hydrogen peroxide in transgenic and non-transgenic soybean leaves. Additionally, differential protein species from leaves of both genotypes were evaluated by applying a regulation factor of ≥1.8 to further corroborate the hypothesis that genetic modification itself can be a stress factor for these plants. For this task, transgenic soybean plants were obtained from seeds modified with the cp4EPSPS gene. The results revealed higher activities of all evaluated enzymes in transgenic than in non-transgenic soybean leaves (ranging from 13.8 to 70.1%), as well as higher concentrations of malondialdehyde and hydrogen peroxide in transgenic soybean leaves, clearly indicating a condition of oxidative stress established in the transgenic genotype. Additionally, 47 proteins were differentially abundant when comparing the leaves of both plants, with 26 species accurately identified, including the protein involved in the genetic modification (CP4EPSPS). From these results, it is possible to conclude that the plant is searching for a new equilibrium to maintain its metabolism because the stress condition is being maintained within levels that can be tolerated by the plant. The present paper is the first one in the literature where are shown translational aspects involving plant stress and the genetic modification for soybean involving the cp4 EPSPS gene. The main biological importance of this work is to make possible the demystification of the genetic modification, allowing answers for some questions that still remain unknown, and enlarge our knowledge about genetically modified organisms. This article is part of a Special Issue entitled: Translational Plant Proteomics. Copyright

Non-motor and motor features in LRRK2 transgenic mice.

Directory of Open Access Journals (Sweden)

Zoë Bichler

Full Text Available Non-motor symptoms are increasingly recognized as important features of Parkinson's disease (PD. LRRK2 mutations are common causes of familial and sporadic PD. Non-motor features have not been yet comprehensively evaluated in LRRK2 transgenic mouse models.Using a transgenic mouse model overexpressing the R1441G mutation of the human LRRK2 gene, we have investigated the longitudinal correlation between motor and non-motor symptoms and determined if specific non-motor phenotypes precede motor symptoms.We investigated the onset of motor and non-motor phenotypes on the LRRK2(R1441G BAC transgenic mice and their littermate controls from 4 to 21 month-old using a battery of behavioral tests. The transgenic mutant mice displayed mild hypokinesia in the open field from 16 months old, with gastrointestinal dysfunctions beginning at 6 months old. Non-motor features such as depression and anxiety-like behaviors, sensorial functions (pain sensitivity and olfaction, and learning and memory abilities in the passive avoidance test were similar in the transgenic animals compared to littermate controls.LRRK2(R1441G BAC transgenic mice displayed gastrointestinal dysfunction at an early stage but did not have abnormalities in fine behaviors, olfaction, pain sensitivity, mood disorders and learning and memory compared to non-transgenic littermate controls. The observations on olfaction and gastrointestinal dysfunction in this model validate findings in human carriers. These mice did recapitulate mild Parkinsonian motor features at late stages but compensatory mechanisms modulating the progression of PD in these models should be further evaluated.

Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

Science.gov (United States)

Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

2014-01-01

RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. I. Construction of single chromosomal DNA libraries.

Science.gov (United States)

Huang, D; Wu, W; Zhou, Y; Hu, Z; Lu, L

2004-05-01

Construction of single chromosomal DNA libraries by means of chromosome microdissection and microcloning will be useful for genomic research, especially for those species that have not been extensively studied genetically. Application of the technology of microdissection and microcloning to woody fruit plants has not been reported hitherto, largely due to the generally small sizes of metaphase chromosomes and the difficulty of chromosome preparation. The present study was performed to establish a method for single chromosome microdissection and microcloning in woody fruit species using pomelo as a model. The standard karyotype of a pomelo cultivar ( Citrus grandis cv. Guanxi) was established based on 20 prometaphase photomicrographs. According to the standard karyotype, chromosome 1 was identified and isolated with fine glass microneedles controlled by a micromanipulator. DNA fragments ranging from 0.3 kb to 2 kb were acquired from the isolated single chromosome 1 via two rounds of PCR mediated by Sau3A linker adaptors and then cloned into T-easy vectors to generate a DNA library of chromosome 1. Approximately 30,000 recombinant clones were obtained. Evaluation based on 108 randomly selected clones showed that the sizes of the cloned inserts varied from 0.5 kb to 1.5 kb with an average of 860 bp. Our research suggests that microdissection and microcloning of single small chromosomes in woody plants is feasible.

Transgenic plants expressing GLK1 and CCA1 having increased nitrogen assimilation capacity

Science.gov (United States)

Coruzzi, Gloria [New York, NY; Gutierrez, Rodrigo A [Santiago, CL; Nero, Damion C [Woodside, NY

2012-04-10

Provided herein are compositions and methods for producing transgenic plants. In specific embodiments, transgenic plants comprise a construct comprising a polynucleotide encoding CCA1, GLK1 or bZIP1, operably linked to a plant-specific promote, wherein the CCA1, GLK1 or bZIP1 is ectopically overexpressed in the transgenic plants, and wherein the promoter is optionally a constitutive or inducible promoter. In other embodiments, transgenic plants in which express a lower level of CCA1, GLK1 or bZIP1 are provided. Also provided herein are commercial products (e.g., pulp, paper, paper products, or lumber) derived from the transgenic plants (e.g., transgenic trees) produced using the methods provided herein.

Delimiting the origin of a B chromosome by FISH mapping, chromosome painting and DNA sequence analysis in Astyanax paranae (Teleostei, Characiformes.

Directory of Open Access Journals (Sweden)

Duílio M Z de A Silva

Full Text Available Supernumerary (B chromosomes have been shown to contain a wide variety of repetitive sequences. For this reason, fluorescent in situ hybridisation (FISH is a useful tool for ascertaining the origin of these genomic elements, especially when combined with painting from microdissected B chromosomes. In order to investigate the origin of B chromosomes in the fish species Astyanax paranae, these two approaches were used along with PCR amplification of specific DNA sequences obtained from the B chromosomes and its comparison with those residing in the A chromosomes. Remarkably, chromosome painting with the one-arm metacentric B chromosome probe showed hybridization signals on entire B chromosome, while FISH mapping revealed the presence of H1 histone and 18S rDNA genes symmetrically placed in both arms of the B chromosome. These results support the hypothesis that the B chromosome of A. paranae is an isochromosome. Additionally, the chromosome pairs Nos. 2 or 23 are considered the possible B chromosome ancestors since both contain syntenic H1 and 18S rRNA sequences. The analysis of DNA sequence fragments of the histone and rRNA genes obtained from the microdissected B chromosomes showed high similarity with those obtained from 0B individuals, which supports the intraspecific origin of B chromosomes in A. paranae. Finally, the population hereby analysed showed a female-biased B chromosome presence suggesting that B chromosomes in this species could influence sex determinism.

Retrospective dosimetry using chromosome painting

International Nuclear Information System (INIS)

Nasazzi, N.B.; Giorgio, M.D.; Taja, M.R.

2000-01-01

Chromosome aberration frequency measured in peripheral lymphocytes of persons exposed to ionizing radiation has been used since 1960s for dose assessment. Suspected overexposure is usually evaluated by the frequency of dicentrics and centric rings using an appropriate in vitro calibration curve. However, these chromosome aberrations are unstable with time after exposure and dose reconstruction may encounter uncertainties when the time between the exposure and the analysis is considerable or even unknown. It appears that translocations persist with time after exposure and may be used as an indication of acute past overexposures. Moreover, they appear to accumulate the cytogenetical information, which correlates with the dose received under fractionated, chronic or even occupational exposure conditions. Translocations may be detected using G-banding, which allows to score the total amount of radiation induced translocations but it is a time consuming method, or by Chromosome Painting, a method base on the Fluorescence in situ Hybridization (FISH) technique, painting only some chromosome pairs with specific whole chromosome probes and then extrapolating the observed translocation frequencies to the full genome. The latter method allows a faster aberration scoring than G-banding and appears to be the most promissory tool for biodosimetry, particularly when it is necessary to assess low doses and consequently to score a large number of metaphases, e.g. radiation workers exposed within dose limits. As with the unstable chromosome aberration, it is necessary an in vitro calibration curve based on the frequency of stable chromosome aberrations to assess doses. Our laboratory performed calibration curves for Co 60 γ-rays based on the frequencies of unstable (dicentrics and centric rings detected by conventional Giemsa staining) and stable chromosome aberrations (translocations and inversions, detected by G-banding). In order to minimize the interlaboratory variability, we

Transgenic Wheat, Barley and Oats: Future Prospects

Science.gov (United States)

Dunwell, Jim M.