WorldWideScience

Sample records for artemia salina leach

  1. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine.

    Science.gov (United States)

    Arcanjo, D D R; Albuquerque, A C M; Melo-Neto, B; Santana, L C L R; Medeiros, M G F; Citó, Amgl

    2012-08-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Justicia pectoralis and Equisetum sp.) against Artemia salina. Biological activity was evaluated for extracts at 1, 10, 100, and 1000 µg/mL in triplicate, and the mean lethal concentration values (LC50) were obtained by probit analysis. The species Acmella uliginosa showed the highest bioactivity, and its flower extract was more active than its leaf extract.

  2. First secondary metabolites from Herissantia crispa L (Brizicky) and the toxicity activity against Artemia salina Leach

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Danielly Albuquerque da; Matias, Wemerson Neves; Lima, Igara Oliveira; Xavier, Aline Lira; Costa, Vivian Bruna Machado; Diniz, Margareth de Fatima Formiga Melo; Agra, Maria de Fatima; Batista, Leonia Maria; Souza, Maria de Fatima Vanderlei de [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Lab. de Tecnologia Farmaceutica Prof. Delby Fernandes de Medeiros; Silva, Davi Antas e [Universidade Federal Rural de Pernambuco, Serra Talhada, PE (Brazil). Dept. de Quimica

    2009-07-01

    The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-{beta}-D-glucopyranoside, stigmasterol 3-O-{beta}-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol), 3,5,7,3',4'-pentahydroxyflavone (quercetin), unpublished in the genus Herissantia, besides {beta}-sitosterol, kaempferol 3-O-{beta}-D-(6''-E-p-coumaroil) (tiliroside) glucopyranoside and kaempferol 3,7-di-O-{alpha}-L-ramnopyranoside (lespedin), described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, {sup 1}H and {sup 13}C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out. (author)

  3. First secondary metabolites from Herissantia crispa L (Brizicky and the toxicity activity against Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Danielly Albuquerque da Costa

    2009-01-01

    Full Text Available The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-β-D-glucopyranoside, stigmasterol 3-O-β-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol, 3,5,7,3',4'-pentahydroxyflavone (quercetin, unpublished in the genus Herissantia, besides β-sitosterol, kaempferol 3-O-β-D-(6''-E-p-coumaroil (tiliroside glucopyranoside and kaempferol 3,7-di-O-α-L-ramnopyranoside (lespedin, described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, ¹H and 13C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out.

  4. Improved synthesis of seven aromatic Baylis-Hillman adducts (BHA): evaluation against Artemia salina Leach. and Leishmania chagasi.

    Science.gov (United States)

    Barbosa, Ticiano P; Junior, Cláudio G L; Silva, Fábio P L; Lopes, Horacimone M; Figueiredo, Lucas R F; Sousa, Suervy C O; Batista, Guilherme N; da Silva, Thiago G; Silva, Tania M S; de Oliveira, Márcia R; Vasconcellos, Mário L A A

    2009-04-01

    We described a very efficient procedure to prepare seven aromatic compounds (1-7), a new class of antileishmanial substances, through Baylis-Hillman reaction (BHR). With one, all the Baylis-Hillman adducts were prepared in quantitative yields by reaction of the corresponding aromatic aldehydes in acrylonitrile at 0 degrees C in only 10-40min reaction time. We present our results about the toxicities of these compounds evaluated on the microcrustaceous Artemia salina Leach. and against promastigote Leishmania chagasi. All substances evaluated in this work have showed high bioactivity. The 3-hydroxy-2-methylene-3-(4-bromopheny)propanenitrile (4) (LC(50)=30.9 microg/mL on A. salina; IC(50)=25.2 microM on L. chagasi) was the most active compound evaluated on A. salina Leach. and on promastigote L. chagasi. The 2-[hydroxy(pyridin-4-yl)methyl]acrylonitrile (7) (LC(50)=30.9 microg/mL on A. salina Leach.; IC(50)=4.8 microg/mL on L. chagasi) was also a very active substance evaluated in this work on promastigote L. chagasi.

  5. Atividade antibacteriana in vitro e toxicidade frente à Artemia salina Leach. de alguns compostos triazenos

    Directory of Open Access Journals (Sweden)

    Gustavo Luiz Paraginski

    2014-01-01

    Full Text Available Bacterial resistance to antibacterial agents is currently a major concern. We report the synthesis, in vitro antibacterial activity and toxicity toward Artemia salina of six diaryltriazene compounds bearing different substituent groups. Minimal Inhibitory Concentration (MIC and Minimal Bactericidal Concentration (MBC values against standard strains (ATCC and clinical isolates (including ESBL, MBL and AmpC strains were good to very good, in the range 8 to 128 mg mL-1. Results suggest that hydroxyl, 4-carboxyl and 4-phenyldiazenil groups attached to the diaryltriazenes provide enhanced activity. Toxicity results showed very low LC50 values for three compounds (10-fold lower than DTIC.

  6. Brine shrimp (Artemia salina Leach bioassay of extracts from Lychnophoriopsis candelabrum and different Lychnophora species

    Directory of Open Access Journals (Sweden)

    Z.S Ferraz Filha

    2012-01-01

    Full Text Available The present study aimed to evaluate on Artemia salina the citotoxicity of twenty-two extracts from five species of the genus Lychnophora and one species of the genus Lychnophoriopsis. The extracts solubilized in DMSO and prepared at the final concentrations of 100, 250, 375, 500 and 600 μg mL-1 were added to tubes containing Artemia salina nauplii (10 units each and filled to 5 mL total volume with artificial salt water. Lapachol and 5% DMSO were used as positive and negative controls, respectively. The samples were kept under light and dead larvae were counted after 24 hours of contact. LC50 was calculated by using Probit software. The crude ethanol extracts from five species showed low lethality in the following order: Lychnophora trichocarpha (LC50 = 672.38 μg mL-1 > Lychnophora pinaster (LC50 = 678.73 μg mL-1 > Lychnophora ericoides (LC50 = 738.09 μg mL-1 > Lychnophoriopsis candelabrum (LC50 = 812.57 μg mL-1 > Lychnophora passerina (LC50 = 921.78 μg mL-1. All tested extracts from L. candelabrum and chloroform extract from L. staavioides showed light toxicity on A. salina. Results indicated that there are substances with potential pharmacological activity in all tested species.O presente estudo teve como objetivo avaliar a citotoxicidade sobre Artemia salina de vinte e dois extratos de cinco espécies do gênero Lychnophora e de uma espécie de Lychnophoriopsis. Os extratos solubilizados em DMSO, preparados nas concentrações finais de 100, 250, 375, 500 e 600 μg mL-1, foram adicionados a recipientes contendo náuplios de Artemia salina (10 unidades cada e completou-se o volume para 5 mL com solução marinha. Lapachol e DMSO 5% foram usados como controles positivo e negativo, respectivamente. As amostras foram mantidas sob iluminação e as larvas mortas foram contadas após 24 horas de contato. O cálculo da LC50 foi feito utilizando-se o programa Probitos. Os extratos etanólicos brutos de cinco espécies apresentaram baixa

  7. Efeito alelopático e toxicidade frente à Artemia salina Leach dos extatos do fruto de Euterpe edulis Martius Allelopathic effects and toxicity against Artemia salina Leach of extracts of the fruit of Euterpe edulis Martius

    Directory of Open Access Journals (Sweden)

    Cristina Peitz de Lima

    2011-06-01

    Full Text Available Alelopatia é um processo envolvendo metabólitos secundários produzidos por plantas que infl uenciam o crescimento e desenvolvimento de sistemas agrícolas. Devido à toxicidade dos herbicidas sintéticos para o meio ambiente e para a saúde humana tem-se aumentado o interesse na exploração da alelopatia como uma alternativa para o controle de plantas daninhas. O presente trabalho avaliou efeito dos extratos dos frutos de Euterpe edulis Martius sobre o desenvolvimento de cipselas e plântulas de Lactuca sativa Linné, foram determinados o índice de velocidade de germinação, o crescimento da radícula e do hipocótilo. Para a avaliação da toxicidade dos extratos foi realizado o ensaio de toxicidade frente ao microcrustáceo Artemia salina Leach determinando-se a CL50 e percentual de mortalidade. A fração remanescente demonstrou efeito alelopático, pois todas as concentrações alteraram os valores do índice de velocidade de germinação e as concentrações de 0,2 e 0,4 mg inibiram tanto o crescimento da radícula quanto o crescimento do hipocótilo. No ensaio de toxicidade todos os extratos apresentaram CL50 superior a 1000 ppm e 0% de mortalidade das artemias, indicando a não toxicidade dos extratos.Allelopathy is a process involving secondary metabolites produced by plants that influence growth and development of agricultural systems. Because of the toxicity of synthetic herbicides to the environment and human health, there has been increased interest in exploiting allelopathy as an alternative for weed control. This study evaluated the eff ect of extracts of Euterpe edulis Martius fruits on the development of cypselae and seedlings of Lactuca sativa Linné; the germination speed index, radicle and hypocotyl growth were determined. To evaluate the toxicity of the extracts the toxicity test against Artemia salina Leach was used, where the LC50 and mortality rate were determined. Th e remaining fraction showed allelopathic effect

  8. Síntese de 1,3,5-triazinas substituídas e avaliação da toxicidade frente a Artemia Salina leach Synthesis of substituted 1,3,5-triazines and toxicity evaluation against Artemia Salina leach

    Directory of Open Access Journals (Sweden)

    Márcia Ferreira Cavalcante

    2000-02-01

    Full Text Available The synthesis of ten symmetrically and unsymmetrically substituted 1,3,5-triazines by Phase Transfer Catalysis (PTC method is described. Their toxicities were determined against Artemia salina Leach. The LD50 values have also been obtained for these compounds.

  9. Synthesis Organonitrogen Compounds from Patchouli Alcohol Through Ritter Reaction with Acetonitrile and Its Toxicity to Artemia salina Leach.

    Directory of Open Access Journals (Sweden)

    Khoirun Nisyak

    2013-03-01

    Full Text Available Patchouli oil contains a compound with biological activities to human body called the patchouli alcohol that can be further developed in medical field. This research aimed to synthesize organonitrogen compound from patchouli alcohol through Ritter reaction with acetonitrile and discover its toxicity towards Artemia salina Leach. The isolation of patchouli alcohol from patchouli oil using fractional distillation under reduced pressure method. The synthesis of organonitrogen compound is done at room temperature with the mol ratio of patchouli alcohol: acetonitrile: sulfuric acid is 1:1,5:4 for 24 hours. The result showed that the amount of patchouli alcohol produced from fractional distillation is 65,25%. The main product yielded from the synthesis between patchouli alcohol and acetonitrile through Ritter reaction is 36,93 % of N-(4,8a,9,9-tetramethyl decahydro-1,6-methanonaphtalene-1-yl acetamide. Starting material used have LC50 of 77,39 ppm. The product of synthesis have higher toxicity level than starting material, which have LC50 value is 10,39 ppm with the potential as medical compounds.

  10. FRAKSINASI DAN IDENTIFIKASI SENYAWA ANTIKANKER EKSTRAK KULIT BATANG Rhizopora mucronata SERTA UJI TOKSISITASNYA TERHADAP LARVA UDANG (Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Hartiwi Diastuti

    2009-11-01

    Full Text Available Investigation the anticancer potency of R. mucronata has not been carried yet. This research were aimed to extract the bioactive compound of R. mucronata with various organic solvents, examine their toxicity againts A. salina Leach larv. and identify the toxic compounds from R. mucronata steam bark. The extraction of R. mucronata steam bark were peformed by maseration with n-hexane, chloroform, ethylacetate and methanol, repectively. The extracts were examined their toxicity againsts A. salina Leach larv. The highest activity extracts was fractionated performed by coloumn chromatography. The fractions respectively was examined their toxicity againts A. salina Leach larv. Identification of toxic compound was carry out using gas chromatography-mass spectrometry (GC-MS. The chloroform extracts of R. mucronata had toxic character. Toxicity test to A. salina Leach larv. The Result showed that the chloroform fraction 1 (C1 of R. mucronata steam bark had LC50 equal to 301.50 ppm. Phytochemical study showed that the active fractions contained terpenoid. Bioactive compound from R. mucronata steam bark were dioctyl phthalate and cyclopropyle azulene decahydro-1,1,7-trimethyl-4-methylene.

  11. Synthesis, toxicity towards brine shrimp (Artemia salina Leach and antimicrobial activity evaluation of 3,5-diphenylchlorinated-1,2,4- oxadiazoles = Síntese, toxicidade frente a Artemia salina Leach e avaliação da atividade antimicrobiana de 1,2,4-oxadiazóis-3,5-difenilclorados

    Directory of Open Access Journals (Sweden)

    Silvio Luiz Machado

    2005-07-01

    Full Text Available The known oxadiazoles 3,5-bis-(phenyl-1,2,4-oxadiazole (3a; the 3-(4-chlorophenyl-5-phenyl-1,2,4-oxadiazole (3b; and the new 3,5-diphenylchlorinated-1,2,4-oxadiazoles 3c-e were synthesized from the reaction of benzamidoximes with an appropriated acid chloride and cyclisation of the resulting O-acylbenzamidoxime intermediate. The compounds synthesized were characterized on the basis of their IR, NMR (1D and 2D and mass spectral data. Compounds 3a-e were evaluated for their antimicrobial activity and for their toxicity towards brineshrimp (Artemia salina Leach. Os oxadiazóis 3,5-bis-(fenil-1,2,4- oxadiazol (3a e 3-(4-clorofenil-5-fenil-1,2,4-oxadiazol (3b, já descritos na literatura, e, os 1,2,4- oxadiazóis-3,5-fenilclorados inéditos 3c-e, foram sintetizados pela reação de bezamidoximas com um cloreto de ácido apropriado, seguido da ciclização do intermediário O-acilíco resultante. Os compostos obtidos foram caracterizados com base nas análises dos dados espectroscópicos de IV, EM e RMN (uni- e bidimensionais. Os compostos 3a-e foram submetidos a bioensaios paraavaliação de atividade antimicrobiana e, de toxicidade frente ao microcrustáceo Artemia salina Leach.

  12. Historical Notes on Artemia salina (L.)

    NARCIS (Netherlands)

    Kuenen, D.J.

    1938-01-01

    Although an abundant literature exists on Artemia salina, there are still interesting facts in the first history of the discovery of this remarkable animal and in the first study of its habits, which seem to be now forgotten. It is generally considered that Rackett (1812) was the first to give a dra

  13. Historical Notes on Artemia salina (L.)

    NARCIS (Netherlands)

    Kuenen, D.J.

    1938-01-01

    Although an abundant literature exists on Artemia salina, there are still interesting facts in the first history of the discovery of this remarkable animal and in the first study of its habits, which seem to be now forgotten. It is generally considered that Rackett (1812) was the first to give a dra

  14. Dinucleosidasetetraphosphatase in rat liver and Artemia salina.

    Science.gov (United States)

    Vallejo, C G; Lobaton, C D; Quintanilla, M; Sillero, A; Sillero, M A

    1976-06-07

    A comparative study of an enzymatic activity present in Artemia salina and rat liver which specifically splits dinucleoside tetraphosphates is presented. All the purine and pyrimidine dinucleoside tetraphosphates tested, i.e. diadenosine, diguanosine, dixanthosine and diuridine tetraphosphates, were substrates of both enzymes with similar maximum velocities and Km values, (around 10 muM). The inhibition by nucleotides of the enzyme from the two sources is also similar. Particularly relevant is the strong inhibition caused by nucleoside tetraphosphates which have Ki values in the nanomolar range. The Artemia enzyme has a slightly lower molecular weight (17 500) than the liver enzyme (21 000) and is more resistant to acidic pH. Based on previous findings, the enzyme from Artemia salina was named diguanosinetetraphosphatase (EC 3.6.1.17) by the Enzyme Commission. The results presented in this paper show that the liver and Artemia enzymes are similar, and we propose to name this enzyme as dinucleosidetetraphosphatase or dinucleoside-tetraphosphate nucleotidehydrolase.

  15. Chemical variation of essential oil constituents of Ocimum gratissimum L. from Benin, and impact on antimicrobial properties and toxicity against Artemia salina leach.

    Science.gov (United States)

    Kpadonou Kpoviessi, Bénédicta G H; Ladekan, Eléonore Yayi; Kpoviessi, D S Salomé; Gbaguidi, Fernand; Yehouenou, Boniface; Quetin-Leclercq, Joëlle; Figueredo, Gilles; Moudachirou, Mansourou; Accrombessi, Georges C

    2012-01-01

    To determine the period of harvest that optimizes the antimicrobial activities of the essential oil of Ocimum gratissimum L. from Benin, aerial plant parts were collected at two vegetative stages (pre- and full-flowering) and three sampling times (7 am, 1 pm, and 7 pm). Extraction by hydrodistillation yielded between 0.65 and 0.78% of essential oils. Characterization of the oils by GC-FID and GC/MS analysis revealed the presence of monoterpenes (87.26-93.81%), sesquiterpenes (5.57-11.34%), and aliphatic compounds (0.15-0.18%), with p-cymene (1; 28.08-53.82%), thymol (2; 3.32-29.13%), γ-terpinene (3; 1.11-10.91%), α-thujene (4; 3.37-10.77%), and β-myrcene (5; 4.24-8.28%) as major components. Two chemotypes were observed, i.e., a p-cymene/thymol and a p-cymene chemotype, for plants harvested at 7 am for the former and at 1 pm or 7 pm for the latter, respectively. The oils were fungicidal against Candida albicans, with the sample from full-flowering plants collected at 7 am being the most active (MIC = 0.06±0.00 mg/ml). The chemical variation of the oils also influenced the antimicrobial effect against Staphylococcus aureus; the most active oil was obtained from plants at the pre-flowering stage collected at 7 am (MIC=0.24±0.01 mg/ml). Escherichia coli was insensitive to the chemical variation of the oils (MICs of ca. 0.48±0.02 mg/ml for all oils). Moreover, the essential oils showed low toxicity against Artemia salina Leach larvae, with LC(50) values in the range of 43-146 μg/ml. This is the first study of the interaction between the daytime of collection and vegetative stage of the plants and the antimicrobial properties and toxicity of the essential oil of O. gratissimum from Benin.

  16. Specific anion effects in Artemia salina.

    Science.gov (United States)

    Lo Nostro, Pierandrea; Ninham, Barry W; Carretti, Emiliano; Dei, Luigi; Baglioni, Piero

    2015-09-01

    The specific anion effect on the vitality of Artemia salina was investigated by measuring the Lethal Time LT50 of the crustaceans in the presence of different sodium salts solutions at room temperature and at the same ionic strength as natural seawater. Fluoride, thiocyanate and perchlorate are the most toxic agents, while chloride, bromide and sulfate are well tolerated. The rates of oxygen consumption of brine shrimps were recorded in mixed NaCl+NaF or NaCl+NaSCN solutions as a function of time. The results are discussed in terms of the Hofmeister series, and suggest that, besides the biochemical processes that involve F(-), SCN(-) and ClO4(-), the different physico-chemical properties of the strong kosmotropic and chaotropic anions may contribute in determining their strong toxicity for A. salina.

  17. Larvicidal activity of some marine macrophytes against Artemia salina

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    and Microdictyon pseudohapteron, seagrasses (Halophila ovalis and Syringodium isoetifolium and lichens (Umbilicaria arpina) were tested for larvicidal activity using Artemia salina nauplii. The LC50 values for the PE-fraction of M. pseudohapteron and A. muscoides...

  18. The swimming mechanics of Artemia Salina

    Science.gov (United States)

    Ruiz-Angulo, A.; Ramos-Musalem, A. K.; Zenit, R.

    2013-11-01

    An experimental study to analyze the swimming strategy of a small crustacean (Artemia Salina) was conducted. This animal has a series of eleven pairs of paddle-like appendices in its thorax. These legs move in metachronal-wave fashion to achieve locomotion. To quantify the swimming performance, both high speed video recordings of the legs motion and time-resolved PIV measurements of the induced propulsive jet were conducted. Experiments were conducted for both tethered and freely swimming specimens. We found that despite their small size, the propulsion is achieved by an inertial mechanism. An analysis of the efficiency of the leg wave-like motion is presented and discussed. A brief discussion on the mixing capability of the induced flow is also presented.

  19. Acute toxicity of organic solvents on Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Barahona-Gomariz, M.V.; Sanz-Barrera, F.; Sanchez-Fortun, S. (Complutense Univ. of Madrid (Spain))

    1994-05-01

    Organic solvents can make their way into the environment as industrial wastes and components of pesticide formulation. In laboratory bioassays, the use of organic formulations. In laboratory bioassays, the use of organic solvents is often unavoidable, since many pesticides and organic pollutants have low water solubility and must be dissolved in organic solvents prior to addition into experimental systems. In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species are of recent interest as test models due to the need for developing nonmammalian test systems. Toxic effects of organic solvents have been tested with a few aquatic species, but information on the comparative toxicity of solvents towards Artemia salina is not available. Artemia salina have, within recent years, gained popularity as test organisms for short-term toxicity testing. Because Artemia salina exhibit rapid development and growth within 48 hr after hatch, their potential as a model organism for toxicology screening has been considered. To do this, synchronous populations of Artemia salina at different development intervals must be available.

  20. Comparison of the Artemia salina and Artemia fransiscana bioassays for toxicity of Indian medicinal plants

    Institute of Scientific and Technical Information of China (English)

    Thangapandi Veni; Thambusamy Pushpanathan

    2014-01-01

    Objective:To evaluate leaves extract of Azima tetracantha and Gmelina asiatica for lethality to brine shrimp larvae (Artemia salina and Artemia fransiscana). Methods: The plant materials were extracted based on polarity gradients of petroleum ether, benzene, chloroform, acetone, ethanol and methanol. The extracts were investigated for their cytotoxic potential. Results: In the brine shrimp lethality assay of all extracts, exception of acetone, ethanol and petroleum ether extracts Gmelina asiatica displayed 100%mortality at 1 000 μg/mL by Artemia salina and Artemia fransiscana. Chloroform extract was the most potent and presented the highest percentage of mortality with the lowest LC50 values by both assay too. Conclusions:The results of the present study suggest the presence of photochemical possessing cytotoxic agents.

  1. Cyanobacterial cytotoxicity versus toxicity to brine shrimp Artemia salina.

    Science.gov (United States)

    Hisem, Daniel; Hrouzek, Pavel; Tomek, Petr; Tomšíčková, Jana; Zapomělová, Eliška; Skácelová, Kateřina; Lukešová, Alena; Kopecký, Jiří

    2011-01-01

    Heterocytous cyanobacteria from various habitats were screened for toxicity to brine shrimp Artemia salina and the murine lymphoblastic cell line Sp/2 in order to compare these two testing models for evaluation of risk posed by cyanobacteria to human health. Methanol extracts of biomass and cultivation media were tested for toxicity and selected extracts were fractionated to determine the active fraction. We found a significant toxic effect to A. salina and to Sp/2 cells in 5.2% and 31% of studied extracts, respectively. Only 8.6% of the tested strains were highly toxic to both A. salina and the Sp/2 cell line, and only two of the tested strains were toxic to A. salina and not to the murine cell line. Therefore, it is likely that the toxic effect of cyanobacterial secondary metabolites mostly targets basal metabolic pathways present in mammal cells and so is not manifested in A. salina. We conclude that it is insufficient to monitor cytotoxicity of cyanobacteria using only the brine shrimp bioassay as was usual in the past, since cytotoxicity is a more frequent feature in cyanobacteria in comparison with toxicity to A. salina. A. salina toxicity test should not be used when estimating the possible health risk for humans. We suggest that in vitro mammal cells be used for these purposes.

  2. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  3. IDENTIFIKASI DAN UJI TOKSISITAS EKSTRAK ETANOL SPONS Hyrtios erecta TERHADAP LARVA UDANG Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Rr. Anisa Hernindya

    2014-05-01

    Full Text Available ABSTRAK: Spons merupakan biota laut paling dominan dalam filum Porifera yang memiliki potensi biologis sebagai antikanker. Telah dilakukan identifikasi dan uji toksisitas pada ekstrak etanol Spons H. erecta menggunakan metode Brine Shrimp Lethality Test (BSLT dengan bioindikator larva udang Artemia salina Leach. Tujuan penelitian ini adalah untuk mengetahui tingkat toksisitas ekstrak etanol Spons H. erecta sebagai antikanker. Partisi dari 10,8 gram ekstrak etanol menggunakan n-heksan, kloroform, dan air kemudian diuapkan menghasilkan ekstrak n-heksan sebanyak 3,13 gram, ekstrak kloroform sebanyak 1,63 gram, dan ekstrak air sebanyak 9,25 gram. Hasil uji toksisitas menunjukkan ekstrak n-heksan memiliki toksisitas paling tinggi dengan nilai LC50 316,22 ppm. Selanjutnya  dilakukan pemisahan dan pemurnian dengan kromatografi  kolom menggunakan eluen n-heksan: kloroform (2:8 sehingga menghasilkan empat fraksi yaitu FA, FB, FC, dan FD. Uji toksisitas pada semua fraksi menunjukkan bahwa fraksi C (FC adalah yang paling toksik dengan LC50 50,11 ppm dan berdasarkan uji fitokimia diduga merupakan gabungan senyawa alkaloid, steroid dan polifeniol.   Kata  kunci:  Spons Hyrtios erecta, uji toksisitas, Artemia  salina  Leach.             ABSTRACT: Sponges are the most dominant marine life in the phylum Porifera which have biological activities as anticancer. Identification and the toxicity test of ethanol extract of H. erecta sponges using Brine Shrimp Lethality Test ( BSLT with bio-indicators of Artemia salina Leach has been conducted. The purpose of this study was to determine the level of toxicity of the ethanol extract of H. erecta sponges as anticancer. Partition of 10,8 grams of ethanol extract using n-hexane, chloroform, and water followed by evaporation leaved n-hexane extracts, chloroform extract, and water extract of 3,13 grams, 1,63 grams, and 9,25 grams, respectively. The results of toxicity tests showed that n-hexane extract has

  4. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay

    National Research Council Canada - National Science Library

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50 < 100 µg/ml...

  5. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  6. Toxic Assessment of Triclosan and Triclocarban on Artemia salina.

    Science.gov (United States)

    Xu, Xiaolu; Lu, Yin; Zhang, Deyong; Wang, Yinyin; Zhou, Xianshan; Xu, Huiying; Mei, Yu

    2015-12-01

    In this study, we investigated the possible acute toxic and genotoxic effects of triclosan (TCS) and triclocarban (TCC) on Artemia salina. Genotoxicity was evaluated using single-cell gel electrophoresis and apoptotic frequency assays (Annexin V-FITC/PI assay). Acute toxicity test results showed that TCC (LC50-24 h = 17.8 µg/L) was more toxic than TCS (LC50-24 h = 171.1 µg/L). Significant increases in both genotoxic biomarkers were observed at 24 h after initial exposure, indicating that these two chemicals are potentially dangerous for this aquatic biological model. Although further studies are required, a comparison of data both in vitro and in vivo allowed us to suggest possible mechanisms of action for TCS and TCC in this sentinel organism.

  7. Síntese, toxicidade frente a Artemia salina Leach e avaliação da atividade antimicrobiana de 1,2,4-oxadiazóis-3,5-difenilclorados - DOI: 10.4025/actascitechnol.v27i2.1452

    Directory of Open Access Journals (Sweden)

    Silvio Luiz Machado

    2005-03-01

    Full Text Available Os oxadiazóis 3,5-bis-(fenil-1,2,4-oxadiazol (3a e 3-(4-clorofenil-5-fenil-1,2,4-oxadiazol (3b, já descritos na literatura, e, os 1,2,4-oxadiazóis-3,5-fenilclorados inéditos 3c-e, foram sintetizados pela reação de bezamidoximas com um cloreto de ácido apropriado, seguido da ciclização do intermediário O-acilíco resultante. Os compostos obtidos foram caracterizados com base nas análises dos dados espectroscópicos de IV, EM e RMN (uni- e bidimensionais. Os compostos 3a-e foram submetidos a bioensaios para avaliação de atividade antimicrobiana e, de toxicidade frente ao microcrustáceo Artemia salina Leach

  8. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  9. Toxicity of some glucose/mannose-binding lectins to Biomphalaria glabrata and Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir Feitosa; Cavada, Benildo Sousa; da Rocha, Bruno Anderson Matias; do Nascimento, Kyria Santiago; Sant'Ana, Antônio Euzébio Goulart

    2010-01-01

    Schistosomiasis or bilharzia, which affects millions of people living in Africa, Asia and Latin America, is closely associated with certain species of aquatic snails. One way of attacking the disease is to eradicate the host snails. Molluscicidal activities of natural compounds are especially important in the widespread control of this tropical disease. As part of our search for natural compounds with molluscicidal properties for the vector control of schistosomiasis, we are now evaluating for the first time the toxicity of the plant lectins from Canavalia brasiliensis (ConBr), Cratylia floribunda (CFL), Dioclea guianensis (Dgui), Dioclea grandiflora (DGL) and Dioclea virgata (Dvir) to Biomphalaria glabrata Say and Artemia salina Leach. Results indicate that all the samples were toxic to A. salina Leach, some of them with values of lethal concentration that kills 90% of the population (LC(90))<10 microg mL(-1). They are also active against B. glabrata Say, killing 100% of adult snails, at a concentration of 50 microg mL(-1). The lectins CFL and Dgui possess properties lethal to mollusks, with values of LC(90)=50.3 microg mL(-1) and LC(90)=41.0 microg mL(-1), respectively.

  10. Iron metallodrugs: stability, redox activity and toxicity against Artemia salina.

    Science.gov (United States)

    Vitorino, Hector Aguilar; Mantovanelli, Luca; Zanotto, Flavia Pinheiro; Espósito, Breno Pannia

    2015-01-01

    Iron metallodrugs comprise mineral supplements, anti-hypertensive agents and, more recently, magnetic nanomaterials, with both therapeutic and diagnostic roles. As biologically-active metal compounds, concern has been raised regarding the impact of these compounds when emitted to the environment and associated ecotoxicological effects for the fauna. In this work we assessed the relative stability of several iron compounds (supplements based on glucoheptonate, dextran or glycinate, as well as 3,5,5-trimethylhexanoyl (TMH) derivatives of ferrocene) against high affinity models of biological binding, calcein and aprotransferrin, via a fluorimetric method. Also, the redox-activity of each compound was determined in a physiologically relevant medium. Toxicity toward Artemia salina at different developmental stages was measured, as well as the amount of lipid peroxidation. Our results show that polymer-coated iron metallodrugs are stable, non-redox-active and non-toxic at the concentrations studied (up to 300 µM). However, TMH derivatives of ferrocene were less stable and more redox-active than the parent compound, and TMH-ferrocene displayed toxicity and lipid peroxidation to A. salina, unlike the other compounds. Our results indicate that iron metallodrugs based on polymer coating do not present direct toxicity at low levels of emission; however other iron species (eg. metallocenes), may be deleterious for aquatic organisms. We suggest that ecotoxicity depends more on metal speciation than on the total amount of metal present in the metallodrugs. Future studies with discarded metallodrugs should consider the chemical speciation of the metal present in the composition of the drug.

  11. Purification and characterization of a carboxymethyl cellulase from Artemia salina.

    Science.gov (United States)

    Zin, Hyun Woo; Park, Kwang-Hyun; Choi, Tae Jin

    2014-01-03

    Brine shrimp (Artemia salina) belong to a group of crustaceans that feed on microalgae and require a cellulase enzyme that can be used in ethanol production from marine algae. Protein with potential cellulase activity was purified and the activity analyzed under different conditions. After initial identification of cellulase activity by CMC cellulase, surface sterilization and PCR using 16s rRNA primers was conducted to confirm that the cellulase activity was not produced from contaminating bacteria. The enzyme was purified by ammonium sulfate fractionation, gel filtration, and ion exchange chromatography. After the final purification, a 70-fold increase in specific enzyme activity was observed. SDS-PAGE results revealed that the cellulase enzyme had a molecular mass of 96 kDa. Temperature, pH, and salinity values were found to be optimal at 55 °C, pH 8.0, and 600 mM NaCl, respectively. Specifically, the enzyme showed a fivefold increase in enzyme activity in seawater compared to 600 mM NaCl in phosphate buffer. Further analysis of the purified enzyme by molecular spectrometry showed no match to known cellulases, indicating this enzyme could be a novel halophilic cellulase that can be used for the production of bioethanol from marine macroalgae.

  12. Acute toxicity of TBT and IRGAROL in Artemia salina.

    Science.gov (United States)

    Panagoula, Bakoulia; Panayiota, Marcouli; Iliopoulou-Georgudaki, Joan

    2002-01-01

    A 24-hour LC(50) bioassay method was carried out to study acute toxicity of Tributyltin (TBT) and IRGAROL (C(11)H(19)N(5)S) in Artemia salina. Five graded levels of both biocides were tested. According to the range test, the doses of TBT were 11.6 ng x l(-1), 21.0 ng x l(-1), 37.3 ng x l(-1), 65.2 ng x l(-1), and 116.5 ng x l(-1), and for IRGAROL were 1.0 mg x l(-1), 1.8 mg x l(-1), 3.2 mg x l(-1), 5.6 mg x l(-1), and 10 mg x l(-1). The determined LC(50) values were 41.41 ng x l(-1) and 1.62 mg x l(-1) respectively. These results indicate that in this system TBT is acutely more toxic than IRGAROL; however, both are proven environmentally toxic substances.

  13. Estudo fitoquímico e bioensaio toxicológico frente a larvas de Artemia salina Leach. de três espécies medicinais do gênero Phyllanthus (Phyllanthaceae

    Directory of Open Access Journals (Sweden)

    J. E. NASCIMENTO

    2009-02-01

    Full Text Available

    Avaliou-se o perfil fitoquímico e a toxicidade de três espécies do gênero Phyllanthus (P. niruri, P. amarus e P. tenellus, coletadas em diferentes localidades do estado de Pernambuco, nordeste do Brasil. Os extratos brutos das três espécies foram submetidos a testes convencionais por cromatografia em camada delgada analítica para verificação das classes de metabólitos presentes, e testados frente a larvas de Artemia salina para obtenção das concentrações letais médias (CL50. Os testes fitoquímicos demonstraram a presença de flavonóides, saponinas, terpenos, naftoquinonas, alcalóides, antraquinonas, lignanas e taninos. As três espécies de Phyllanthus apresentaram variações na composição fitoquímica e na toxicidade frente a A. salina. Dependendo do local de coleta, os valores de CL50 variaram de 404,43 ± 49,64 µg/mL a 770,84 ± 51,78 µg/mL para P. niruri, 837,65 ± 61,45 µg/mL a 1075,89 ± 70,72 µg/mL para P. amarus e 534,60 ± 46,83 µg/mL a 1003,62 ± 65,15 µg/mL para P. tenellus. Palavras-chave: Phyllanthus niruri; Phyllanthus amarus,/i>; Phyllanthus tenellus; análise fitoquímica preliminar; bioensaio toxicológico; CL50

  14. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    Directory of Open Access Journals (Sweden)

    Juan Manuel Pérez Agudelo

    2015-06-01

    Full Text Available Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20 y el grupo control fue expuesto a agua destilada (n=20 la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (Pearson para determinar la diferencia en mortalidad de los grupos.Resultados:El Grupo Control no presentó mortalidad, en tanto el Grupo Apitoxina presentó una mortalidad del 95%. Se demostró una asociación estadísticamente significativa con un p<0,05(IC: 95% entre la mortalidad de la Artemia salina y la administración de apitoxina.Conclusión:El extracto acuoso de apitoxina presenta toxicidad a una concentración de 0.35 en el modelo de Artemia salina. Palabras Clave: Apitoxina, Artemia salina, Toxicidad

  15. Artemia Salina L. (Anostraca): uma opção para a aquicultura do Nordeste do Brasil

    OpenAIRE

    1982-01-01

    Inoculations made with cysts of Artemia salina from San Francisco Bay (California, USA) in Macau, Rio Grande do Norte, Brazil, in 1977, have dispersed this crustacean in all neighboring salt work areas. Favourable environmental conditions which have successfully contributed to this inoculation, together with suggestions for a rational utilization of similar areas for Artemia salina cultivation, are analyzed and commented.

  16. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    OpenAIRE

    Juan Manuel Pérez Agudelo; Juan Felipe Salazar Espinosa; Jorge Hernán Hernández Guevara

    2015-01-01

    Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20) y el grupo control fue expuesto a agua destilada (n=20) la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (...

  17. [Determination of Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus toxicity over Artemia salina].

    Science.gov (United States)

    Nieto R, Ivonne J; Salama, Ahmed M; Cataño P, Jorge E; Chegwin A, Carolina

    2008-09-30

    We report the toxicity of ethanolic extracts in Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus over that obtained in Artemia salina. P. involutus showed the highest toxicity (LC50 = 94.4 microg/ml), similar to that detected using potassium dichromate pattern. P. pulmonarius and P. ostreatus did not show toxicity over A. salina in concentrations lower than 1,000 microg/ml.

  18. Characterisation of cholinesterases and evaluation of the inhibitory potential of chlorpyrifos and dichlorvos to Artemia salina and Artemia parthenogenetica.

    Science.gov (United States)

    Varó, I; Navarro, J C; Amat, F; Guilhermino, L

    2002-08-01

    In this study, the acute toxicity of the organophosphorous pesticides dichlorvos and chlorpyrifos to two different species of Artemia (A. salina and A. parthenogenetica) was evaluated. In addition, the in vivo effect of these two pesticides on cholinesterase (ChE) activity of both A. salina and A. parthenogenetica was also determined. The characterisation of the ChE, using different substrates and specific inhibitors, and the normal range of activity in non-exposed individuals were previously investigated for both species. The results obtained indicate that the ChE of A. salina is different from that of A. parthenogenetica and that both enzymes cannot be classified neither as acetylcholinesterase nor as butyrylcholinesterase since they show intermediary characteristics between the two vertebrate forms. The range of normal ChE activity was 2.65+/-0.15 U/mg protein for A. salina, and 3.69+/-0.17 U/mg protein for A. parthenogenetica. Significant in vivo effects of both pesticides on Artemia ChE activity were found, at concentrations between 5.38 and 9.30 mg/l for dichlorvos and between 1.85 and 3.19 mg/l for chlorpyrifos. Both Artemia species are resistant to these pesticides and they are able to survive with more than 80% ChE inhibition. However, A. parthenogenetica is more resistant than A. salina, with about a 95% reduction in its ChE activity respect to the control for nauplii exposed to the median lethal concentrations (LC50), without lethal effects after 24 h of exposure.

  19. Variation in fatty acid composition of Artemia salina nauplii enriched with microalgae and baker's yeast for use in larviculture.

    Science.gov (United States)

    Chakraborty, Rekha D; Chakraborty, Kajal; Radhakrishnan, E V

    2007-05-16

    The high content of the essential fatty acids in some microalgae and baker's yeast has made them excellent diets for boosting the fatty acid content of livefood Artemia. The influences of baker's yeast (Saccharomyces cerevisiae) and three microalgae, viz., Chlorella salina, Chaetoceros calcitrans, and Nannochloropsis salina, were tested as diet components in marine livefeed brine shrimp Artemia salina nauplii to improve the polyunsaturated fatty acid (PUFA) composition. Artemia nauplii submerged in these diets for four different enrichment intervals (3, 6, 8, and 24 h) were found to incorporate essential fatty acids, and the percentage composition of different fatty acids was measured in the enriched Artemia nauplii and enrichment diets. N. salina produced higher levels of arachidonic acid (AA, 20:4n6, 9.50%), eicosapentaenoic acid (EPA, 20:5n3, 25.80%), and docosahexaenoic acid (DHA, 22:6n3, 4.18%) as compared to other diets. The total PUFA content of the enriched Artemia by N. salina increased by 56.50% with enrichment periods up to 8 h, followed by a significant reduction in the final 24 h. N. salina yielded Artemia nauplii with considerable EPA (8.05%), AA (14.15%), and DHA (1.85%) after 8 h of enrichment, which are significantly higher levels than in nauplii fed with the other three diets (p = 0.05). The DHA/EPA values in Artemia enriched for 6 h by N. salina and C. calcitrans were found to be, respectively, 88.46 and 25% higher than freshly hatched Artemia. Artemia enriched by C. salina and baker's yeast exhibited a reduction in PUFA content even at 6 h of enrichment. Significant relative decreases in DHA, EPA, and total PUFA in Artemia enriched with all of the diets were apparent, with a corresponding increase in the total saturated fatty acid content (26.95 +/- 9.75%) in the final stages (24 h) of enrichment (p = 0.05).

  20. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay.

    Science.gov (United States)

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50  1000 µg/ml). Our subsequent studies of conifer heartwoods with strong activity confirm the assay's value for identifying new investigational leads for materials with insecticidal and fungicidal activity.

  1. Mass marking of Leuciscus idus larvae using Artemia salina as a vector of fluorescent dyes.

    Science.gov (United States)

    Stańczak, K; Krejszeff, S; Dębowska, M; Mierzejewska, K; Woźniak, M; Hliwa, P

    2015-09-01

    A method for the mass marking of ide Leuciscus idus larvae by feeding them Artemia salina nauplii that were immersed in different solutions of alizarin red S, tetracycline hydrochloride and calcein was tested. The best quality marks were obtained after feeding fish for 4 days with nauplii that had been immersed in 200 mg l(-1) alizarin red S.

  2. 用卤虫(Artemia salina L.)评价杀虫活性%Evaluate Insecticidal Activity Using Artemia salina L.

    Institute of Scientific and Technical Information of China (English)

    王再强; 周红; 韩俊; 何月秋; 录丽平

    2011-01-01

    [Aims]Artemia salina L.is general used for preliminary assessment of pharmacological activity.However,it is necessary to evaluate the suitability of A.salina L.before it is used as a model material for screening insecticidal activity.Here, 14 insecticides with 10 different action mechanisms were selected to evaluate insecticidal activity against A.salina L.used as a model material.[Results]13 Insecticides significantly killed A.salina L., Moulting hormone agonist and compound stimulating GABA release were the most active.[Conclusions]A.salina L.is a suitable organism to evaluate insecticidal activity and the method is simple having good sensitivity to many insecticides with different action mechanisms.%[目的]以卤虫(Artemia salina L.)为模式生物对化合物的药理活性进行初步评价.对10种不同作用机制的14种杀虫剂进行了生物筛选试验.[结果]14种供试杀虫剂中有13种对卤虫有显著的毒杀效果,作用于以γ-氨基丁酸为神经递质传导系统的化合物及蜕皮激素类似物效果最为显著.[结论]用卤虫筛选杀虫剂活性的方法简便,对多种作用机制的杀虫剂灵敏.

  3. Toxicity of lapachol and isolapachol and their potassium salts against Biomphalaria glabrata, Schistosoma mansoni cercariae, Artemia salina and Tilapia nilotica.

    Science.gov (United States)

    Lima, Nadja Maria Fernandes; dos Santos, Aldenir Feitosa; Porfírio, Zenaldo; Goulart, Marília O F; Sant'Ana, Antônio Euzébio G

    2002-07-01

    The toxicity of soluble derivatives (potassium salt) of lapachol and isolapachol in different stages of the life cycle of Schistosoma mansoni is evaluated. The potassium salts of isolapachol and lapachol showed significant molluscicidal activity against the adult snail (LC90Artemia salina Leach) indicated very high toxicity for the potassium salt of isolapachol (LC90=1.54 ppm), differently from the potassium salt of lapachol that can be considered non toxic (LC90=176.3 ppm). The same tendency is observed with piscicidal activity, for which the isolapachol salt has showed higher toxicity. The obtained selectivity ratios concerning LC50 and LC90 for lapachol, in relation to Tilapia nilotica lethality assay are 2.33 and 1.26, respectively. Despite the piscicidal toxicity, the use of the salt of lapachol can be recommended for field tests in Schistosomiasis, with caution.

  4. Comparative effects and metabolism of two microcystins and nodularin in the brine shrimp Artemia salina.

    Science.gov (United States)

    Beattie, Kenneth A; Ressler, Judith; Wiegand, Claudia; Krause, Eberhard; Codd, Geoffrey A; Steinberg, Christian E W; Pflugmacher, Stephan

    2003-02-12

    The toxicity and metabolism of the cyanobacterial toxins microcystin-LR (MCLR), Dhb-microcystin-HtyR and nodularin were investigated in the cysts, nauplii and adults of the brine shrimp Artemia salina. The presence of the phase II detoxication system glutathione S-transferase (sGST) in these stages was shown using different substrates. Exposure of adult A. salina to the toxins led to an elevation of GST activity in vivo. All three toxins were conjugated to glutathione via GST, which has been shown as an initial step of microcystin and nodularin detoxication.

  5. [Detection of fungal metabolites showing toxic activity through Artemia salina bioassay].

    Science.gov (United States)

    González, Ana María; Presa, Maximiliano; Latorre, María Gabriela; Lurá, María Cristina

    2007-03-01

    The aim of this study was to detect toxic metabolites from fungi contaminating food and medicinal herbs by applying the toxicity assay to Artemia salina. According to toxicity percentages, the extracts were classified as nontoxic (NT), slightly toxic (ST), toxic (T) and highly toxic (HT). Those classified as T and HT were assayed for mycotoxins. Only 6 out of 71 strains were found to be T (8.5%) for A. salina. Penicillium brevicompactum Dierckx, isolated from sausages, was found to be HT, mainly due to the presence of ochratoxin A and two other unidentified metabolites.

  6. Artemia salina acute immobilization test: a possible tool for aquatic ecotoxicity assessment.

    Science.gov (United States)

    Kalčíková, Gabriela; Zagorc-Končan, Jana; Zgajnar Gotvajn, Andreja

    2012-01-01

    Despite the fact that the marine crustacean Artemia salina is extensively used in ecotoxicology, there is still a lack of information about its sensitivity to commonly used chemicals. In the presented study, acute toxicity of 18 commonly used chemicals - including organic solvents, industrial chemicals, metals and inorganic compounds - to A. salina was evaluated. A. salina showed a range of sensitivities to tested chemicals. Regarding all of the investigated organics, phenolic compounds expressed the highest toxicity to A. salina. Nitrite and mercury were the most toxic inorganic substances applied in the study. On the other hand, dimethyl sulfoxide, nitrate and ammonium were the least toxic. The possibility to use A. salina for interspecies correlation was assessed by comparison of sensitivities of different organisms (bacteria, fish, crustacean) to organic compounds. Correlation between various species was observed, especially between A. salina and fish. Due to the strong relation between toxicity and the logarithm of the octanol/water partition coefficient logP(OW,) lipophilicity was found to be the main factor influencing toxicity of the chosen organic compounds. No significant correlation between toxicity to A. salina and physico-chemical parameters of metals was observed.

  7. Neutron flow exposure as a test for survival of Artemia salina spores.

    Science.gov (United States)

    Matveeva, I S; Smirnov, A N; Vodennikov, B D; Popov, I M; Semenov, D S; Kolesnikov, M V; Syroeshkin, A V

    2004-11-01

    Live and heat-inactivated Artemia salina spores (samples with the same mass and filling density) were exposed to a flow of thermal neutrons from a (252)Cf radioactive source at an equivalent dose power of about 1 microSv/h. Irradiation led to a 4-fold acceleration of nauplius development and to modification of the element profiles of live spores. The difference between absorption/diffusion of thermal neutrons by live and dead spores was revealed.

  8. On the motility of living invertebrates The case of Artemia Salina

    Science.gov (United States)

    Huerta, R.; Hernández, A.; Alvarado-Gil, J. J.

    1998-08-01

    Using a laser beam deflection technique a non-destructive and non-invasive method is developed. This method is applied to monitor the motility of small invertebrates, in particular we study the important case of the crustacean Artemia Salina and the motion of its different parts. We find out that its dynamics can be explained as a superposition of several periodic motions with very well defined frequencies.

  9. Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii.

    Science.gov (United States)

    Kokkali, Varvara; Katramados, Ioannis; Newman, Jeffrey D

    2011-03-28

    This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop computer. Four nauplii were inserted into a macro cuvette, which contained copper, cadmium, iron and zinc ions at various concentrations. The nauplii were then filmed inside the dark chamber for two minutes and the video sequence was processed by a motion tracking algorithm that estimated their mobility. The results obtained by this system were compared to the mortality assay of the Artemia salina nauplii. Despite the small number of tested organisms, this system demonstrates great sensitivity in quantifying the mobility of the nauplii, which leads to significantly lower EC50 values than those of the mortality assay. Furthermore, concentrations of parts per trillion of toxic compounds could be detected for some of the metals. The main novelty of this instrument relies in the sub-pixel accuracy of the tracking algorithm that enables robust measurement of the deterioration of the mobility of Artemia salina even at very low concentrations of toxic metals.

  10. Toxicity and characterization of cholinesterase-inhibition induced by diisopropyl fluorophosphate in Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, M V

    2009-03-01

    The acute toxicity of diisopropyl fluorophosphate (DFP) on three age classes of Artemia salina was evaluated. An increase in toxicity of this organophosphorous (OP) compound was found following longer development of A. salina larvae. The effects of pretreatment with the non-selective muscarinic antagonist atropine, the two reversible acetylcholinesterase inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on DFP-induced lethality in 24h Artemia were also investigated. The lethal action of DFP was not prevented by pretreatment of 24h Artemia with atropine, physostigmine, and pyridostigmine, while 2-PAM proved effective against intoxication with this OP compound. The inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM or physostigmine were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Pretreatment with 2-PAM (10(-6)M) plus physostigmine or pyridostigmine was ineffective. These results suggest that the combinations of atropine plus 2-PAM or physostigmine are effective in the prevention of the lethal effects induced by DFP in A. salina larvae.

  11. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2008-01-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading...... to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa......) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate...

  12. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca).

    Science.gov (United States)

    Muñoz, Joaquín; Gómez, Africa; Green, Andy J; Figuerola, Jordi; Amat, Francisco; Rico, Ciro

    2008-07-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate an early Pleistocene expansion of A. salina in the Mediterranean Basin. Subsequent population isolation in a mosaic of Pleistocene refugia is suggested, with two or three refugia located in the Iberian Peninsula. Two instances of long-distance colonization were also observed. Surprisingly, given its strong phylogeographical structure, A. salina showed a signature of correlation between geographical and genetic distance. Owing to strong 'priority effects', extensive population differentiation is retained, despite dispersal via migrant birds and human management of saltpans. The foreseeable expansion of A. franciscana is likely to be followed by substantial loss of genetic diversity in Mediterranean A. salina. Large genetic divergences between Mediterranean and South African A. salina suggest that the latter deserves species status.

  13. [Immunocytochemical studies on the phase of differentiation of hatching gland cells in brine shrimp, Artemia salina].

    Science.gov (United States)

    Li, Ling; Fan, Ting Jun; Wang, Xiao Feng; Cong, Ri Shan; Yu, Qiu Tao; Zhong, Qi Wang

    2004-04-01

    Hatching enzyme (HE), synthesized in hatching gland cells (HGCs), plays vital roles in animal hatching. Immunocytochemical techniques employing anti-GST-UVS.2 antiserum, prepared from Xenopus HE and with specificity to brine shrimp HE, were first used to investigate the differentiation and variability of hatching gland cells (HGCs) in the hatching process of embryos of brine shrimp, Artemia salina, in this study. HGCs with immunoreactivity to anti-GST-UVS.2 antiserum were identified, for the first time, in brine shrimp embryos during hatching process. Immunocytochemical staining results showed that, (1) HE-positive immunoreactivity is really specific to Artemia HE, and its appearance and disappearance are closely correlated with the hatching process of Artemia salina. (2) Artemia HGCs, first appeared in embryos 5 hours before hatching and disappeared 4 hours after hatching, were also a transient type of cells, with an existence period of 9 hours. (3) The head portion of Artemia embryo is probably the initial position of HE secretion, and likely to be the main position of HE secretion as well. The detailed process and mechanism need to be studied. (4) The appearance of HGCs is in a synchronous mode from places all over the embryos, and their disappearance is also in a synchronous mode. (5) The number of HGCs increased gradually along with embryo development process and reached a maximum number at hatching. Contrarily, the number of HGCs decreased gradually after hatching, and HGCs disappeared 5 hours after hatching. However, the intensity of HE-positive reaction was almost at the same level at the period of HGCs'presence. (6) Artemia HGCs were distributed throughout the body of embryos at all time during their presence. Therefore, it can concluded that Artemia HGCs, as a transient type of cells, first appeared in embryos 4 hours before hatching and disappeared in embryos 5 hours after hatching, and with distinguished patterns of appearance, disappearance and

  14. Toxicity of cylindrospermopsin to the brine shrimp Artemia salina: comparisons with protein synthesis inhibitors and microcystins.

    Science.gov (United States)

    Metcalf, J S; Lindsay, J; Beattie, K A; Birmingham, S; Saker, M L; Törökné, A K; Codd, G A

    2002-08-01

    The Artemia salina bioassay was successfully applied to the analysis of the hepatotoxic cyanobacterial alkaloid and protein synthesis inhibitor, cylindrospermopsin. A dose-dependent response in mortality was observed for purified cylindrospermopsin and LC(50) values decreased with time from 8.1 to 0.71 microg/ml(-1), between 24 and 72 h, respectively. Cylindrospermopsin was slightly less potent than micro cystin-LR, with similar LC(50) values on a gravimetric basis, but was more toxic to A.salina than the protein synthesis inhibitors, cycloheximide, chloramphenicol and tetracycline. Cylindrospermopsin-containing strains of the cyanobacterium Cylindrospermopsis raciborskii were found to be toxic to A.salina and the LC(50) concentration for these strains over time was greater than the LC(50) for purified cylindrospermopsin, with the exception of C. raciborskii strain CR1.

  15. Assessment of toxic potential of Cerrado fruit seeds using Artemia salina bioassay

    Directory of Open Access Journals (Sweden)

    Raíza Cavalcante Fonseca

    2013-06-01

    Full Text Available Artemia salina bioassay was used to assess toxicity of seeds and kernels of Brazilian fruits from cerrado (central high plains region and other inner regions of the country. Water extracts of the kernels were filtered and added to Artemia cultures containing ten individuals per mL. Dose - response curves were constructed, and LD50 values were calculated. Pure potassium cyanide standard was used to draw a calibration curve for comparison to detect the presence of cyanide in the samples tested. Extracts of the seeds of araticum, mangaba, cagaita, jatobá, and tucumã were found toxic to Artemia salina, and some of the dose - response curves were very similar in shape to those obtained with pure potassium cyanide standards, while the samples of baru, cajá-manga, siriguela, trauma, and veludo showed no toxicity at all. The Guignard test, specific for cyanide detection, showed negative results in all toxic samples, suggesting the presence of other toxic compounds rather than cyanide. The comparison of araticum dose - response curve with those of other annonaceous fruits suggests the presence acetogenins as the main toxic compounds in the seeds. These results could be useful to prevent poisoning by industrial derivatives of the fruits studied.

  16. Acute toxicity of several organophosphorous insecticides and protection by cholinergic antagonists and 2-PAM on Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Sanz, F; Barahona, M V

    1996-10-01

    The acute toxicity of chlorpyrifos, methylchlorpyrifos, parathion and methylparathion to three age classes of Artemia salina was determined. In general, A. salina 24-h old was less sensitive to these organophosphorous insecticides (OPI) than A. salina 48-h old and A. salina 48-h old was significantly more tolerant than A. salina 72-h old, in contrast, chlorpyrifos was equally toxic to A. salina 48- and 72-h old. There were some differences among the three age classes of A. salina in the relative order of toxicity of OPI tested. The rank order of toxicity to A. salina 48-h old was methylparathion salina 24- and 72-h old it was methylparathion = parathion Artemia salina 24-h old was investigated. The lethal action of OPI tested was completely prevented by pretreatment of Artemia salina 24-h old with 2-PAM (10(-5) M) and atropine (10(-4 )M). However no concentration of hexamethonium, pirenzepine or AF-DX 116 protected 100% of the animals poisoned by LC84 of the OPI selected, maximum protection obtained was 71 to 88%. In contrast, the maximum inhibition of mortality obtained with AF-DX 116 pretreatment was about 55% because this compound was used at concentrations which were non toxic to control Artemia salina. Atropine, hexamethonium, pirenzepine, AF-DX 116 and 2-PAM afforded 50 % protection (IC50) of Artemia salina against mortality by LC84 of the OPI selected at concentrations in the range of 6.62x10(-7)-1.6x10(-6) M, 2. 38x10(-4)-2.05x10(-3)M, 8.91x10(-7)-1.24x10(-6) M, 9.66x10(-8)-1. 34x10(-7 )M, and 1.95x10(-8)-2.73x10(-8 )M, respectively. Pretreatment of atropine plus 2-PAM to determine whether this combination afforded greater inhibition of the lethality induced by four OPI tested than pretreatment with either atropine or 2-PAM alone was investigated. Atropine (10(-5) M) in combination with 2-PAM (10(-7 )M) inhibited completely the acute toxicity of all OPI tested, while the pretreatment with atropine (10(-6) M) plus 2-PAM at the same concentration gave a

  17. Monitoramento dos extratos brutos de espécies de Polygala (Polygalaceae utilizando Artemia salina

    Directory of Open Access Journals (Sweden)

    A.B.P. Montanher

    2003-01-01

    Full Text Available Extratos de duas espécies de Polygala foram submetidos a um biomonitoramento utilizando o teste de toxicidade frente a Artemia salina, com a finalidade de detectar atividade citotóxica. Os resultados obtidos para o extrato bruto, frações hexânica e diclorometano de Polygala sabulosa Aw. Benn. mostraram-se promissores. No entanto, bioensaios mais específicos devem ser encorajados nos extratos vegetais que apresentam atividade diante deste bioensaio, a fim de confirmar estas conclusões.

  18. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina Chemometric studies of pheo formulated in pluronics®: photodynamic action against Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  19. Evaluation of the photodynamic activity of xanthene dyes on Artemia salina described by chemometric approaches.

    Science.gov (United States)

    Pellosi, Diogo S; Batistela, Vagner R; Souza, Vagner R de; Scarminio, Ieda S; Caetano, Wilker; Hioka, Noboru

    2013-01-01

    The development of drugs for photodynamic therapy (PDT) is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y) with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i) photosensitizers concentration, (ii) the LED irradiation time and (iii) the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 2³ full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  20. Evaluation of the photodynamic activity of Xanthene Dyes on Artemia salina described by chemometric approaches

    Directory of Open Access Journals (Sweden)

    Diogo S. Pellosi

    2013-10-01

    Full Text Available The development of drugs for photodynamic therapy (PDT is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i photosensitizers concentration, (ii the LED irradiation time and (iii the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 23 full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  1. A bioassay using Artemia salina for detecting phototoxicity of plant coumarins.

    Science.gov (United States)

    Ojala, T; Vuorela, P; Kiviranta, J; Vuorela, H; Hiltunen, R

    1999-12-01

    Artemia salina (brine shrimp) has been successfully used for toxicity testing, and a screening test for phototoxicity has been developed based on this method. The ability of the method to test the phototoxic potential of seven known compounds was investigated. Athamantin (an angular furanocoumarin) and umbelliferone (a simple coumarin) showed no phototoxicity, while linear furanocoumarins exhibited phototoxic activity in the following order: psoralen > bergapten > peucedanin > xanthotoxin. The applicability of this method was also tested in screening the phototoxicity of plant material. Six plants from Apiaceae [Aegopodium podagraria L., Anethum graveolens L., Angelica archangelica L., Levisticum officinalis Koch, Petroselinum crispum (P. Mill) A. W. Hill., and Peucedanum palustre (L.) Moench] and one from Rutaceae (Ruta graveolens L.) were selected, all of them known to contain furanocoumarins. Extracts from leaves collected at different times during the growth period were used in the screening. Our results were in accordance with the furanocoumarin content of these plants and with the results of other phototoxicity tests. The Artemia salina method proved to be rapid, simple and inexpensive, and is therefore ideal in the initial biological screening of large numbers of samples for simultaneous detection of both toxicity and phototoxicity.

  2. [Biological and biochemical quality of the Artemia (Anostraca: Artemiidae) population from Real de Salinas saltworks, Calkiní, Campeche, Mexico].

    Science.gov (United States)

    Rodríguez-Canché, Leticia G; Maldonado-Montiel, Teresita D N J; Carrillo Navarro, Luciano A

    2006-12-01

    Cysts of Artemia spp. collected from February 1997 to February 2000 in the Real de Salinas solar saltworks, Campeche, Mexico, were compared with Artemia franciscana (batch number 8,131 Microfeast Artemia Cysts, Texas, USA). The variables determined in these two populations were: number of cysts per gram, hatching percentage, hatching efficiency, hatching rate, hatching synchrony and hatching biomass, as well as diameter of the cysts and length of the nauplii (instar I). For Salinas, the average diameters of the encapsulated and decapsulated cysts were 230.5 +/- 4.14 and 221.8 +/- 3.39 microm, respectively. The thickness of the cyst shell was 4.35 +/- 0.68 microm and the length of the nauplii was 388.11 +/- 4.39 microm, this last value is among the smallest reported in the literature. For the commercial population of A. franciscana, the average diameters of the encapsulated and decapsulated cysts were 230.21 +/- 12.49 and 216.96 +/- 13.71, respectively. With respect to the corion thickness and length of the nauplii the values were 6.62 +/- 2.72 and 424.70 +/- 30.08, respectively. The protein value of the cysts (47.91 %) and nauplii (50.5 %) of Artemia population from Real de Salinas, are considered adequate to be used as food in aquaculture. The results indicate that the population from Real de Salinas presents positive features for its use in aquaculture in the region.

  3. Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening Comparação de bioensaios com os crustáceos Artemia salina e Thamnocephalus platyurus para abordagem de extratos de plantas com toxicidade

    Directory of Open Access Journals (Sweden)

    Pablo Mayorga

    2010-12-01

    Full Text Available Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest, were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq. Kunth ex Walp., Fabaceae, Neurolaena lobata (L. Cass., Asteraceae, Petiveria alliacea L., Phytolaccaceae, and Ocimum campechianum Mill., Lamiaceae. The five others: Curatella americana L., Dilleniaceae, Prunus barbata Koehne, Rosaceae, Quercus crispifolia Trel., Fagaceae, Rhizophora mangle L., Rhizophoraceae, and Smilax domingensis Willd., Smilacaceae, do not. All plants without anti-Artemia activity had no lethal effects in both assays with A. salina. For the plants with anti-Artemia activity the Artoxkit M was not sensitive to G. sepium and the conventional Artemia test was not sensitive to S. americanum, G. sepium and N. lobata. All the plant extracts, except for that of C. americana, had lethal effects on T. platyurus and the lethal median concentration (LC50 levels for this organism were in all cases substantially lower than those of the salt-water test species. This study revealed that T. platyurus is a promising test species worth further in depth investigation for toxicity screening of plant extracts with potential medicinal properties.Três bioensaios de letalidade com o crustáceo de água salgada Artemia salina Leach, Artemiidae, (teste convencional em microplaca de 96 poós Artoxkit microbiotest M e o crustáceo de água doce Thamnocephalus platyurus Packard, Thamnocephalidae (Thamnotoxkit microbiotest F, foram comparados utilizando extratos de dez espécies de plantas da Guatemala. Foi previamente observado que cinco delas possuem atividade anti-Artemia

  4. Chronic toxicity bioassay with populations of the crustacean Artemia salina exposed to the organophosphate diazinon.

    Science.gov (United States)

    Bustos-Obregon, Eduardo; Vargas, Alvaro

    2010-01-01

    A chronic toxicity bioassay was conducted with the microcrustacean Artemia salina as the testing organism for the toxic organophosphate diazinon in order to determine if the species is an appropriate indicator of pollution in aquatic environments. Tests of animal exposure to different concentrations of the toxicant were performed for 24, 48 and 72 hours after larvae hatching. Registered mortality data was used to obtain the lethal dose 50 (LD50) of the organophosphate for each exposure time, considering the immobilization of A. salina larvae as the mortality parameter. The lethal concentration (LD50) in the same exposure times was calculated by evaluating morphological changes on the three initial stages of larval development. Both doses were determined by using probit statistical analysis. Results indicate greater dose-response exactitude after 24 hours of exposure to the toxicant. High sensitivity of the organism to the toxicant was determined, thus indicating that A. salina is an appropriate ecotoxicological bioindicator of aquatic environments polluted with pesticides, with the special consideration that this species is a natural resident of saline water bodies, and thus could be used to control pollution in these environments as a result of the unrestrained usage of such toxic substances.

  5. Assessment of toxicity of Moringa oleifera flower extract to Biomphalaria glabrata, Schistosoma mansoni and Artemia salina.

    Science.gov (United States)

    Rocha-Filho, Cláudio A A; Albuquerque, Lidiane P; Silva, Luanna R S; Silva, Patrícia C B; Coelho, Luana C B B; Navarro, Daniela M A F; Albuquerque, Monica C P A; Melo, Ana Maria M A; Napoleão, Thiago H; Pontual, Emmanuel V; Paiva, Patrícia M G

    2015-08-01

    This study reports the effect of an aqueous extract from Moringa oleifera Lam. flowers on Biomphalaria glabrata embryos and adults and on Schistosoma mansoni adult worms. The extract contains tannins, saponins, flavones, flavonols, xanthones, and trypsin inhibitor activity. The toxicity of the extract on Artemia salina larvae was also investigated to determine the safety of its use for schistosomiasis control. After incubation for 24h, the flower extract significantly (p<0.05) delayed the development of B. glabrata embryos and promoted mortality of adult snails (LC50: 2.37±0.5mgmL(-1)). Furthermore, treatment with the extract disrupted the development of embryos generated by snails, with most of them remaining in the blastula stage while control embryos were already in the gastrula stage. Flower extract killed A. salina larvae with a LC50 value (0.2±0.015mgmL(-1)) lower than that determined for snails. A small reduction (17%) in molluscicidal activity was detected when flower extract (2.37mgmL(-1)) was exposed to tropical environmental conditions (UVI index ranging from 1 to 14, temperature from 25 to 30°C, and 65% relative humidity). Toxicity to A. salina was also reduced (LC50 value of 0.28±0.01mgmL(-1)). In conclusion, M. oleifera flower extract had deleterious effects on B. glabrata adults and embryos. However, unrestricted use to control schistosomiasis should be avoided due to the toxicity of this extract on A. salina.

  6. Preliminary results of the Artemia salina experiments in biostack on LDEF

    Science.gov (United States)

    Graul, E. H.; Ruether, W.; Hiendl, C. O.

    1992-01-01

    The mosaic egg of the brine shrimp, Artemia salina, resting in blastula or gastrula state represents a system that during further development, proceeds without any further development to the larval stage, the free swimming nauplius. Therefore, injury to a single cell of the egg will be manifest in the larvae. In several experiments, it was shown that the passage of a single heavy ion through the shrimp egg damaged a cellular area large enough to disturb either embryogenesis or further development of the larvae, or the integrity of the adult individual. Emergence from the egg shell was heavily disturbed by the heavy ions as was hatching. Additional late effects, due to a hit by a heavy ion, are delayed of growth and of sexual maturity, and reduced fertility. Anomalies in the body and the extremities could be observed more frequently for the nauplii which had developed from eggs hit by heavy ions.

  7. IDENTIFIKASI DAN UJI AKTIVITAS ANTIKANKER EKSTRAK SPONS Ianthella basta TERHADAP LARVA Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Ni Wayan Sri Sukmarianti

    2013-05-01

    Full Text Available The main purpose of this research is to determine the toxicity of extracts sponge Ianthella basta against Artemia salina larvae and to identify the chemical compounds contained in those toxic isolates. The preliminary test of the anticancer activity has conducted by Brine Shrimp Letalithy (BST test. The results showed that the chloroform extract was the most toxic with LC50 value of 22,39 ppm. Futher, the cloroform extract was separated and purified by coloumn chromatography using eluent of solvent mixture of chloroform : ethyl acetate : n-hexane by 7 : 2 : 1 and 4 fractions were obtained. The most toxic fraction was the fraction C with LC50 value of 35,36 ppm. Based on the GC-MS results, the toxic isolate is allegedly containing chemicals compound of hexadecanoic methyl ester and hexadecanoic acid.

  8. Accumulation of mercury by Artemia populations of different salinas of Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The total mercury content in samples of the brine shrimp Artemia, sediments, water, suspended matter and, when available, algae, from nine salines of Portugal, was evaluated, to find out how mercury present in its natural habitat accumulates in Artemia. This study, carried out between 1990 and 1993, was part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms, including in Portugal. The following sampling sites were chosen: some salinas of the lagoon of Aveiro, situated in the northern region of Portugal and partially contaminated with mercury-, the salt-mines of Rio Maior, in the interior of the central region of the country, where there are no sediments (the floor is cemented); and salt-marshes in the Algarve, in the south of Portugal. Mercury was determined by cold vapor absorption espectrofotometry after digestion of samples with sulfuric acid and potassium permanganate, and reference materials have been used to control the analytical performance. The concentrations of total Hg varied from 0.014 to 0.36 mg/Kg in the sediments, 0 to 0.30 {micro}g/g in the Artemia, 0.17 to 0.84 {micro}g/l in the suspended matter and 0.09 to 0.56 {micro}g/l in the water. The content of mercury in the artemias was strongly related to the concentration in the sediments, except when the algae were present, because they also accumulate a significantly percentage of the mercury. No relationships could be established with the Hg in water or in suspended matter (in mass of Hg/volume of filtered water), because their, content in Hg varied a lot with time and weather conditions, such as the wind strength. The presence of Hg in the sediments was due either to significant containing Hg discharges or to the composition of the sediments, being more important in the case of clays.

  9. Purification and characterization of hatching enzyme from brine shrimp Artemia salina.

    Science.gov (United States)

    Fan, Tingjun; Wang, Jing; Yuan, Wenpeng; Zhong, Qiwang; Shi, Ying; Cong, Rishan

    2010-02-01

    By using Artemia chorion as a specific substrate, the hatching enzyme from Artemia salina (AHE) was purified by gel-filtration and ion-exchange chromatography, and characterized biochemically and enzymatically in this study. It was found that the AHE had a molecular weight of 82.2 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and often contained 73.3 kDa molecules in preparation. The AHE had obvious choriolytic activity, which was optimal at pH 7.0 and a temperature of 408C. The Km value of the AHE for dimethyl casein was 8.20 mg/ml. The AHE activity was almost completely inhibited by soybean trypsin inhibitor and p-amidinophenyl methane sulfonyl fluoride hydrochloride, greatly inhibited by N-tosyl-L-lysyl chloromethyl ketone, phenylmethanesulfonyl fluoride, and lima bean trypsin inhibitor, slightly inhibited by pepstatin, N-tosyl-L-phenylalanyl chloromethyl ketone, leupeptin, N-ethylmaleimide, and iodoacetamide, and not inhibited by chymostatin and bestatin. All these results imply that AHE is most probably a trypsin-type serine protease. Besides of these, AHE was also sensitive to EDTA and Zn21. Combined with the results that the EDTA-pre-treated HE activity could be perfectly recovered by Zn21, it is indicated that AHE might be also a kind of Zn-metalloprotease.

  10. Artemia salina as test organism for assessment of acute toxicity of leachate water from landfills.

    Science.gov (United States)

    Svensson, B M; Mathiasson, L; Mårtensson, L; Bergström, S

    2005-03-01

    Artemia salina has, for the first time, been used as test organism for acute toxicity of leachate water from three landfills (the municipal landfills at Kristianstad, Sweden and Siauliai, Lithuania, and an industrial landfill at Stena fragmenting AB, Halmstad, as well as for leachate from Kristianstad treated in different ways in a pilot plan). Artemia can tolerate the high concentrations of chloride ions found in such waters. Large differences in toxicities were found, the leachate from Siauliai being the most toxic one. To increase the selectivity in the measurements, a fractionation was done by using ion exchange to separate ammonium/ammonia and metal ions from the leachate, and activated carbon adsorbents for organic pollutants. The influence of some metals and phenol compounds on the toxicity was investigated separately. It was found that most of the toxicity emanated from the ammonium/ammonia components in the leachate. However, there was also a significant contribution n from organic pollutants, other than phenol compounds, since separate experiments had in this latter case indicated negligible impact. The concentrations of metals were at a level, shown by separate experiments, where only small contribution to the toxicity could be expected.

  11. Evaluation of alpha and gamma aluminum oxide nanoparticle accumulation, toxicity, and depuration in Artemia salina larvae.

    Science.gov (United States)

    Ates, Mehmet; Demir, Veysel; Arslan, Zikri; Daniels, James; Farah, Ibrahim O; Bogatu, Corneliu

    2015-01-01

    In this study, Artemia salina (crustacean filter feeders) larvae were used as a test model to investigate the toxicity of aluminum oxide nanoparticles (Al2O3 NPs) on marine microorganisms. The uptake, toxicity, and elimination of α-Al2O3 (50 nm and 3.5 μm) and γ-Al2O3 (5 nm and 0.4 μm) NPs were studied. Twenty-four and ninety-six hour exposures of different concentrations of Al2O3 NPs to Artemia larvae were conducted in a seawater medium. When suspended in water, Al2O3 NPs aggregated substantially with the sizes ranging from 6.3 nm to >0.3 µm for spherical NPs and from 250 to 756 nm for rod-shaped NPs. The phase contrast microscope images showed that NPs deposited inside the guts as aggregates. Inductively coupled plasma mass spectrometry analysis showed that large particles (3.5 μm α-Al2O3) were not taken up by Artemia, whereas fine NPs (0.4 μm γ-Al2O3) and ultra-fine NPs (5 nm γ-Al2O3 and 50 nm α-Al2O3) accumulated substantially. Differences in toxicity were detected as changing with NP size and morphology. The malondialdehyde levels indicated that smaller γ-Al2O3 (5 nm) NPs were more toxic than larger γ-Al2O3 (0.4 µm) particulates in 96 h. The highest mortality was measured as 34% in 96 h for γ-Al2O3 NPs (5 nm) at 100 mg/L (LC50 > 100 mg/L). γ-Al2O3 NPs were more toxic than α-Al2O3 NPs at all conditions.

  12. Selenium nanoparticle-enriched biomass of Yarrowia lipolytica enhances growth and survival of Artemia salina.

    Science.gov (United States)

    Hamza, Faseela; Vaidya, Amogh; Apte, Mugdha; Kumar, Ameeta Ravi; Zinjarde, Smita

    2017-11-01

    Controlling disease outbreaks is a major challenge in aquaculture farms and conventional methods are often ineffective. Nutritional supplementation and probiotic preparations help in reducing severity of such infections. The generally regarded as safe yeast (Yarrowia lipolytica) was used in the current study. A marine strain of Y. lipolytica exhibited tolerance towards sodium selenite and formed cell associated selenium nanoparticles (SeNPs). The synthesized nanoparticles were characterized by UV-vis spectroscopy, X-ray diffraction (XRD) and Field Emission Scanning Electron Microscope (FE-SEM) observations. Fourier transform infra-red (FTIR) spectroscopy indicated the role of carboxylic and amine groups in the synthesis of nanoparticles. This SeNP-enriched biomass was used as feed for the model aquaculture system, Artemia salina and compared with normal feed, baker's yeast (Saccharomyces cerevisiae). A. salina fed with SeNP-enriched biomass, showed increased survival rates (96.66%) as compared to those fed with S. cerevisiae (60.0%). The size of the larvae fed with SeNP-enriched biomass of Y. lipolytica was also found to be larger. Additionally, larval groups fed with SeNP-enriched biomass were better protected (70.0% survival) against V. harveyi infection when compared with groups fed with S. cerevisiae (24.44%). This combination of selenium in the nanoparticle form associated with the biomass of Y. lipolytica has potential application in improving health of aquaculture species in farms. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    Directory of Open Access Journals (Sweden)

    Sahgal Geethaa

    2013-01-01

    Full Text Available Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT] to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC 50 for the solvents were 8.5% (DMSO, 6.4% (methanol, 3.4% (ethanol and 2.5% (Tween 20. The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  14. Toxicity of organophosphates on morphology and locomotor behavior in brine shrimp, Artemia salina.

    Science.gov (United States)

    Venkateswara Rao, J; Kavitha, P; Jakka, N M; Sridhar, V; Usman, P K

    2007-08-01

    The acute toxicity and hatching success of four organophosphorus insecticides--acephate (ACEP), chlorpyrifos (CPP), monocrotophos (MCP), and profenofos (PF)--was studied in a short-term bioassay using brine shrimp, Artemia salina. Fifty percent hatchability inhibition concentration and median lethal concentration (LC(50)) values were calculated after probit transformation of the resulting data. Among the insecticides tested, CPP is found to be the most toxic and also to inhibit hatching success of A. salina cysts in a concentration-dependent manner. In addition, the effect of these pesticides on locomotor behavior (swimming speed) and morphologic differences were studied in LC(50)-exposed nauplii after 24 hours. The in vivo effect of these insecticides on acetylcholinesterase (Enzyme commission number (EC 3.1.1.7) activity was also determined in LC(50)-exposed nauplii after 24 hours. Maximum percent decrease in their swimming speed and significant morphologic alterations were noticed in CPP-exposed brine shrimps. The order of toxicity was CPP > PF > MCP > ACEP in all the parameters studied.

  15. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test.

    Science.gov (United States)

    Geethaa, Sahgal; Thavamany, Priscilla Jayanthi; Chiew, Siah Poh; Thong, Ong Ming

    2013-10-01

    Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO) are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT]) to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v) for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC50 for the solvents were 8.5% (DMSO), 6.4% (methanol), 3.4% (ethanol) and 2.5% (Tween 20). The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  16. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    Directory of Open Access Journals (Sweden)

    J.M. Lima

    2009-03-01

    Full Text Available A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qualificados no extrato aquoso, com exceção de cumarinas. Em diclorometano, verificou se a presença de saponinas, derivados triterpênicos e esteróides. No teste de toxicidade sobre Artemia salina, os dados convergiram para frações de extrato aquoso de 5.117,2 ppm, indicando ser um extrato de baixa toxicidade.Sonchus oleraceus is a common weed in Brazil, also used as a medicinal plant. Phytochemical prospecting of this species was carried out in this work using extracts obtained in ethanol, water and dichloromethane. A toxicity study of the aqueous extract was also conducted, using the micro crustaceous Artemia salina. The aqueous extract presented sugar reducers, phenolic compounds, tannins, flavonoids and coumarins in its composition. The compounds found in the aqueous extract were also detected in the ethanol extract, except for the coumarins. Saponin, triterpenes and steroids were identified in the dichloromethane extract. The toxicity test on Artemia salina pointed to aqueous extract fractions of 5,117.2 ppm, indicative of low toxicity.

  17. Protective effect induced by atropine, carbamates, and 2-pyridine aldoxime methoiodide Artemia salina larvae exposed to fonofos and phosphamidon.

    Science.gov (United States)

    Victoria Barahona, M; Sánchez-Fortún, Sebastián

    2007-01-01

    The acute toxicity of fonofos and phosphamidon on three age classes of Artemia salina was evaluated. An increase in toxicity of these organophosphorous (OP) insecticides was found following longer development of A. salina. The effects of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterease inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on OP-induced lethality in 24 h Artemia were also investigated. The lethal action of both OP insecticides was prevented by pretreatment of 24 h Artemia with atropine and 2-PAM, while physostigmine proved ineffective against intoxication with both OP insecticides and pyridostigmine exhibited a low synergic effect. In both cases, the inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Combined pretreatment of atropine (10(-5)M) plus physostigmine practically abolished the lethal effects induced by both insecticides. Pretreatment with 2-PAM (10(-6)M) plus physostigmine afforded maximal protection of 100% and 76% on the lethality induced by fonofos and phosphamidon, respectively. The data obtained suggest that the combination of atropine plus 2-PAM or physostigmine and the combined pretreatment of 2-PAM plus physostigmine are effective in the prevention of the lethal effects induced by fonofos and phosphamidon in A. salina larvae.

  18. Toxicity of four antifouling biocides and their mixtures on the brine shrimp Artemia salina.

    Science.gov (United States)

    Koutsaftis, A; Aoyama, I

    2007-11-15

    Zinc pyrithione (ZPT), Copper pyrihione (CPT), Chlorothalonil and Diuron are four of the most widely used as alternative to tributlytin (TBT) antifouling biocides in boat paints. As most previous laboratory bioassays for these biocides have been conducted solely based on acute tests with a single compound, information on the possible combined toxicity of these common biocides to marine organisms are limited. In this study, the toxicity of binary (in several proportions), ternary and quaternary mixtures were evaluated using the brine shrimp Artemia salina as test organism. Mixture toxicities were studied using the concentration addition model (isobolograms and toxic unit summation), and the mixture toxicity index (MTI). The ZPT-CPT combination had a strictly synergistic effect which requires attention because the coexistence of ZPT and CPT in the marine environment, due to transchelation of ZPT, may occur. The binary mixtures of Diuron with the metal pyrithiones exhibited various interactive effects (synergistic, antagonistic or additive) depending on concentration ratios, whereas all binary mixtures that contained Chlorothalonil exhibited antagonistic effects. The different types of combined effects subsequent to proportion variation of binary mixtures underline the importance of the combined toxicity characterization for various ratios of concentrations. The four ternary mixtures tested, also exhibited various interactive effects, and the quaternary mixture exhibited synergism. The models applied were in agreement in most cases. The observed synergistic interactions underline the requirement to review water quality guidelines, which are likely underestimating the adverse combined effects of these chemicals.

  19. Tolerance to cadmium and cadmium-binding ligands in Great Salt Lake brine shrimp (Artemia salina)

    Energy Technology Data Exchange (ETDEWEB)

    Jayasekara, S.; Drown, D.B.; Sharma, R.P.

    1986-02-01

    Information on the accumulation of cadmium in cytosolic proteins of Great Lake brine shrimp (Artemia salina) was obtained from animals collected directly from the lake and also from animal hatched and maintained in three sublethal concentrations of cadmium (0.5, 2.0, 5.0 ppm) in saltwater aquaria. Brine shrimp growth under these conditions was monitored by measuring body lengths during a 7-day exposure period. Heat-stable, cadmium-binding ligands were isolated and identified by Sephadex G-75 chromatography and atomic absorption spectrophotometry. Cadmium was found to be equally distributed between high and low molecular weight proteins in animals collected from the lake and the 0.5 ppm cadmium group. There was also a slight growth stimulation noted in the 0.5-pm group. Higher cadmium incorporation was noted in low molecular weight fractions with increasing cadmium concentration in the exposure media. Low molecular weight fractions were also found to have high uv absorption characteristics at 250 nm and low absorption at 280 nm. Molecular weight of the cadmium-binding ligands was found to be 11,000 as estimated by the gel filtration method. De novo synthesis of this protein was increased as a function of cadmium concentration in the media. However, slow accumulation of cadmium in other protein fractions was also noticed in higher cadmium exposure groups, suggesting the existence of possible tolerance mechanisms in brine shrimp exposed to suspected acute cadmium concentrations.

  20. Analyzing the movement of the Nauplius 'Artemia salina' by optical tracking of plasmonic nanoparticles.

    Science.gov (United States)

    Kirchner, Silke R; Fedoruk, Michael; Lohmüller, Theobald; Feldmann, Jochen

    2014-07-15

    We demonstrate how optical tweezers may provide a sensitive tool to analyze the fluidic vibrations generated by the movement of small aquatic organisms. A single gold nanoparticle held by an optical tweezer is used as a sensor to quantify the rhythmic motion of a Nauplius larva (Artemia salina) in a water sample. This is achieved by monitoring the time dependent displacement of the trapped nanoparticle as a consequence of the Nauplius activity. A Fourier analysis of the nanoparticle's position then yields a frequency spectrum that is characteristic to the motion of the observed species. This experiment demonstrates the capability of this method to measure and characterize the activity of small aquatic larvae without the requirement to observe them directly and to gain information about the position of the larvae with respect to the trapped particle. Overall, this approach could give an insight on the vitality of certain species found in an aquatic ecosystem and could expand the range of conventional methods for analyzing water samples.

  1. Comparative evaluation of short-term toxicity of inorganic arsenic compounds on Artemia salina.

    Science.gov (United States)

    GuŢu, Claudia Maria; Olaru, Octavian Tudorel; Purdel, Nicoleta Carmen; Ilie, Mihaela; NeamŢu, Marius Cristian; Dănciulescu Miulescu, Rucsandra; Avramescu, Elena Taina; Margină, Denisa Marilena

    2015-01-01

    The study aimed to assess the short-term effects exerted by two inorganic arsenic species (arsenite and arsenate) on Artemia salina after 24, 48 and 72 h. The dose-lethality curves obtained indicate that the lethality induced by arsenite was higher than by arsenate. The lowest observed effect concentration for arsenite (0.5 μg/mL) is similar with the no observed effect concentration for arsenate, thus indicating that the toxicity of arsenite is higher compared with arsenate. Also, the lethal concentration 50 values confirm that arsenite induced about 1.24-fold higher toxicity than arsenate at 24 h and about three-fold higher toxicity at 48 h and 72 h of exposure. Both LC50 (lethal concentration 50) values are indicating negligible effects exhibited by arsenic at this trophic level after short-term exposure. The predicted no effect concentration in the surface aquatic compartment corresponds to 10.38 μg/L, similar to the limit imposed by Directive 98/83/EC.

  2. Toxicity assessment of fumonisins using the brine shrimp (Artemia salina) bioassay.

    Science.gov (United States)

    Hartl, M; Humpf, H U

    2000-12-01

    The Fusarium mycotoxins fumonisin B(1) (FB(1)) (1) and B(2) (FB(2)) (2), their hydrolysed analogues HFB(1) (3) and HFB(2) (4) and the recently discovered fumonisin derivatives N-palmitoyl-HFB(1) (5) and N-carboxymethyl-FB(1) (6) were compared for their toxicity in a short term bioassay using brine shrimp (Artemia salina). The brine shrimp were hatched in artificial sea water and exposed to the fumonisins in microwell plates with a mortality endpoint after 48 hours. LC(50) values were calculated after Probit transformation of the resulting data. Of the substances tested, fumonisin B(1) emerged to be the most toxic whereas its N-carboxymethyl analogue was 100-fold less effective. The hydrolysed fumonisins showed a four- to sixfold reduced toxicity compared to FB(1). N-Palmitoyl-HFB(1) had a higher LC(50) value than its precursor HFB(1). The brine shrimp assay proved to be a convenient and rapid system for toxicity assessment of this group of mycotoxins.

  3. The use of a brine shrimp (Artemia salina) bioassay to assess the toxicity of diatom extracts and short chain aldehydes.

    Science.gov (United States)

    Caldwell, Gary S; Bentley, Matthew G; Olive, Peter J W

    2003-09-01

    Water soluble algal extracts, the aldehydes 2E,4E-decadienal, decanal, undecanal and the fatty acid eicosapentaenoic acid (EPA) were assayed for toxicity to hatching success and larval mortality of the brine shrimp Artemia salina. Both crude cellular extracts of the diatoms Skeletonema costatum and Nitzschia commutata and the diatom-derived short chain aldehyde decadienal were found to inhibit hatching success of A. salina cysts in a dose-dependent manner. Decadienal also significantly affected larval mortality rates in 24 and 72 h exposure incubations. The Artemia hatching success assay was the least sensitive of the three (EC50=3.94 microg ml(-1)). A greater sensitivity was observed for the 72 h compared with the 24 h exposure trials (EC50 for 24h=2.14, 72 h=0.023 microg ml(-1)). Decanal did not significantly affect survival or hatching success at the concentrations tested. Undecanal and EPA showed a limited toxic effect in naupliar mortality trials. We suggest that 72 h Artemia exposure trials represent an acceptable bioassay for diatom toxicity where alternative bioassays are unavailable.

  4. Analysis of toxicity of Anacardium occidentale L. extract submitted to ionizing radiation on embryos of Biomphalaria glabrata and Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Hianna A.M.F.; Sa, Jose L.F.; Lima, Claudia S.A.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: hiannaamfs@gmail.com, E-mail: luismuma6@gmail.com, E-mail: claudia.salima@gmail.com, E-mail: amancioff@bol.com.br, E-mail: amdemelo@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Biofisica e Radiobiologia; Ribeiro, Luanna R.S.; Santos, Gustavo H.F.; Silva, Edvane B., E-mail: luannaribeiro_lua@hotmail.com, E-mail: santosghf@hotmail.com, E-mail: edvborges@yahoo.com.br [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Energia Nuclear. Grupo de Estudos em Radioprotecao e Radioecologia

    2013-07-01

    The use of gamma radiation as a sterilization method for herbs, herbal medicines and foods, shows positive results regarding the retention of such products, economy and safety of the method. However, it is known that this method of processing plant material can cause chemical changes in these products related to the type of material, its components and the dose received. Evaluated, in the present study, the action of gamma radiation as a modifier of toxicity extract of Anacardium occidentale Linn. To evaluate the toxicity of the extract irradiated at doses of 5.0, 7.5 and 10.0 kGy and concentrations of 250, 500 and 1000 mg/L was used bioassays with Artemia salina and Biomphalaria glabrata. For the test to A. salina, 520 specimens were used divided into groups of 10 larvae. For the bioassay with B. glabrata, 3900 specimens were used divided into groups of, approximately, 100 embryos. Larvae of A. salina and embryos were subjected to extracts irradiated and unirradiated for 24 hours. The bioassay with A. salina, showed a decrease, compared to extract unirradiated and irradiated at doses of 5.0 and 7.5 kGy, of extract irradiated with 10 kGy, where the mortality did not differ from the control group. In tests with embryos was observed an increase in the toxicity of the extract at a dose of 7.5 kGy and a decrease in the dose of 10.0 kGy. The radiation promoted changes in the toxicity of leaves extracts of Anacardium occidentale Linn. on embryos of Biomphalaria glabrata and Artemia salina. (author)

  5. Avaliação da bioatividade dos extratos de cúrcuma (Curcuma longa L., Zingiberaceae em Artemia salina e Biomphalaria glabrata Bioactivity evaluation of the turmeric (Curcuma longa L., Zingiberaceae extracts in Artemia salina and Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Carlos R. M. da Silva Filho

    2009-12-01

    Full Text Available A cúrcuma é o rizoma limpo, em boas condições, seco e moído da Curcuma longa L., uma planta herbácea da família Zingiberaceae. Visando novas alternativas para o controle da esquistossomose, os extratos de Curcuma longa L. foram testados para a avaliação da atividade moluscicida contra caramujos adultos da espécie Biomphalaria glabrata, e toxicidade (ensaio de letalidade com Artemia salina. A oleoresina e o óleo essencial de cúrcuma foram ativos contra Artemia salina (CL50 = 80,43 e CL50 = 319,82 μg/mL, respectivamente e também ativos contra os indivíduos adultos de Biomphalaria glabrata (CL50 = 58,3 e CL50 = 46,73 μg/mL, respectivamente. A partir dos resultados obtidos pôde ser concluído que ambos os extratos podem constituir uma alternativa no controle da população desses caramujos e na redução da esquistossomose.The turmeric is the clean rhizome at good conditions, dried and powdered of Curcuma longa L., an herbaceous plant of Zingiberaceae family. Aiming new alternatives for Schistosomiasis control, the Curcuma longa L. extracts were tested for molluscicidal activity evaluation against adult snails of Biomphalaria glabrata specie, and the toxicity (Brine Shrimp Lethality-BSL-bioassay. The oleoresin and the essential oil of turmeric were active against Artemia salina (CL50 = 80.43 and CL50 = 319.82 μg.mL-1, respectively and also active against the adult snails of Biomphalaria glabrata (CL50 = 58.3 and CL50 = 46.73 μg.mL-1, respectively. From the obtained results it was concluded that both extracts can constitute an alternative to population control of these snails and in the reduction of Schistosomiasis.

  6. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    OpenAIRE

    LIMA, J.M. de; SILVA, C. A.; Rosa, M. B.; J.B. Santos; OLIVEIRA, T. G. de; Silva,M.B.

    2009-01-01

    A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qual...

  7. Bioatividade de três espécies vegetais nativas da Floresta Atlântica brasileira frente ao microcrustáceo Artemia salina

    Directory of Open Access Journals (Sweden)

    W.M Pompilho

    2014-09-01

    Full Text Available Este trabalho teve por objetivo a investigação fitoquímica e propriedades antioxidantes de extratos das folhas de Trigynaea oblongifolia Schltdl (Annonaceae, Ottonia frutescens Trel (Piperaceae, e Bathysa australis (St Hill Hooz (Rubiaceae, bem como avaliar, in vitro, a letalidade frente ao microcrustáceo Artemia salina Leach. Os extratos foram preparados por maceração em metanol 10% (p/v por sete dias, à temperatura ambiente. A atividade antioxidante dos extratos foi determinada pela metodologia que utiliza o radical estável DPPH. A toxicidade dos extratos foi avaliada frente ao microcrustáceo A. salina. Os extratos de O. frutescens e B. australis apresentaram as seguintes classes de metabólitos secundários: Alcalóides, Antraquinonas, Cumarinas, Polifenóis (Taninos, Saponinas. Nos extratos de T. oblongifolia, além dos metabólitos citados anteriormente, foi detectada a presença de Flavonóides. A atividade antioxidante, observada em 30 minutos na concentração de 24 µg/mL de extrato, foi de: O. frutescens - 38,3%, T. oblongifolia - 32,3%, e B. australis - 32,1%. A Concentração Letal, CL50, dos extratos em A. salina foi de: O. frutescens - 149,75 ± 1,02 µg/mL, T. oblongifolia - 148,8 ± 1,74 µg/mL, e B. australis - 684 ± 9,04 µg/mL. Neste contexto, destacamos as espécies, nativas da Floresta Atlântica, O. frutescens e T. oblongifolia de grande potencial na bioprospecção de moléculas biologicamente ativas.

  8. Ribosomal S6 kinase is activated as an early event in preemergence development of encysted embryos of Artemia salina.

    Science.gov (United States)

    Malarkey, K; Coker, K J; Sturgill, T W

    1998-01-15

    Dormant Artemia salina cysts contain desiccated gastrulae that are metabolically inactive, and physiologically arrested. Following rehydration, embryos resume development via alterations in protein expression, in the complete absence of cell division. In mammals, activation of p70 ribosomal S6 kinase (p70S6k) has been implicated in translational control, in particular the selective up-regulation of translation of mRNAs with polypyrimidine tracts at their 5' start sites. We therefore investigated ribosomal S6 kinase activity in preemergence development. We demonstrate that an S6 kinase activity is rapidly stimulated (within Artemia S6 kinase was inactivated by treatment with protein phosphatase 2A. Activation of S6 kinase activity was shown to be due to an enzymatic step(s), and not simply rehydration of stored, active enzyme. The temporal profile of activation of S6 kinase activity is compatible with a regulatory function for p70S6k in early preemergence development of encysted Artemia. These studies identify activated Artemia cysts as a system for biochemical studies of p70S6k regulation.

  9. Toxicоlogical evaluation of the plant products using Brine Shrimp (Artemia salina L. model

    Directory of Open Access Journals (Sweden)

    Меntor R. Hamidi

    2014-04-01

    Full Text Available Many natural products could serve as the starting point in the development of modern medicines because of their numerous biological and pharmacological activities. However, some of them are known to carry toxicological properties as well. In order to achieve a safe treatment with plant products, numerous research studies have recently been focused on both pharmacology and toxicity of medicinal plants. Moreover, these studies employed efforts for alternative biological assays. Brine Shrimp Lethality Assay is the most convenient system for monitoring biological activities of various plant species. This method is very useful for preliminary assessment of toxicity of the plant extracts. Rapidness, simplicity and low requirements are several advantages of this assay. However, several conditions need to be completed, especially in the means of standardized experimental conditions (temperature, pH of the medium, salinity, aeration and light. The toxicity of herbal extracts using this assay has been determined in a concentration range of 10, 100 and 1000 µg/ml of the examined herbal extract. Most toxicity studies which use the Brine Shrimp Lethality Assay determine the toxicity after 24 hours of exposure to the tested sample. The median lethal concentration (LC50 of the test samples is obtained by a plot of percentage of the dead shrimps against the logarithm of the sample concentration. LC50 values are estimated using a probit regression analysis and compared with either Meyer’s or Clarkson’s toxicity criteria. Furthermore, the positive correlation between Meyer’s toxicity scale for Artemia salina and Gosselin, Smith and Hodge’s toxicity scale for higher animal models confirmed that the Brine Shrimp Lethality Assay is an excellent predictive tool for the toxic potential of plant extracts in humans.

  10. Toxicity of tannins towards the free-living nematode Caenorhabditis elegans and the brine shrimp Artemia salina.

    Science.gov (United States)

    Yamasaki, Toru; Sato, Masashi; Mori, Tomoaki; Mohamed, Ahmed S A; Fujii, Kyoko; Tsukioka, Junko

    2002-08-01

    Toxicities of gallo- and condensed tannins towards the free-living nematode Caenorhabditis elegans is dependent on the tannins' molecular sizes. In the present paper we investigate the toxicity of ellagitannins to C elegans and the toxicity of ellagi-, gallo-, and condensed tannins to the brine shrimpArtemia salina. Ellagitannins 1 and 2 were isolated from Euphorbia supina and identified as tellimagrandin I and rugosin A methyl ester, respectively. An ellagitannin preparation from Cornus officinalis was chromatographically fractionated into ellagitannins A through H, having different molecular weights and specific rotations. Three of the ten ellagitannins, 2, G, and H produced significant toxicity towards C. elegans, showing the presence of an activity-structure relationship, as opposed to the results from tests of gallo- and condensed tannins. Ellagi-, gallo-, and condensed tannins also produced toxicity in A. salina.

  11. The use of carbamates, atropine, and 2-pyridine aldoxime methoiodide in the protection of Artemia salina against poisoning by carbophenothion.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, V

    2001-09-01

    The acute toxicity of carbophenothion to three age classes of Artemia salina was evaluated. An increase in toxicity of carbophenothion was found following longer development of A. salina. The effect of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterase-inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methochloride (2-PAM) on carbophenothion-induced lethality in 24-h-old A. salina was also investigated. The lethal action of carbophenothion was completely prevented by pretreatment of A. salina with 2-PAM. Atropine and pyridostigmine afforded a maximal protection of approximately 87% and 72%, respectively, compared to control values. In contrast, physostigmine was ineffective. The inhibitory effects of combinations of 10(-5) M atropine with physostigmine, pyridostigmine, or 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 92.58%, 100%, and 100%, respectively. In the presence of 10(-7) M atropine, neither pyridostigmine nor 2-PAM provided additional inhibition of the lethality compared to that with either drug alone, whereas the protection afforded by 10(-7) M atropine plus physostigmine increased as the concentration of carbamate increased (up to 10(-3) M). Pretreatment with pyridostigmine or physostigmine plus 2-PAM (10(-6) M) slightly enhanced the maximal inhibition of carbophenothion lethality compared to that with either drug alone. It is suggested that the most active combined pretreatment studied here was physostigmine plus atropine.

  12. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  13. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine) : The use of Brine Shrimp Artemia salina in a variably saline lagoon complex

    NARCIS (Netherlands)

    Verkuil, Y.I.; Van der Have, TM; Van der Winden, J; Chernichko, [No Value

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  14. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine): the use of brine shrimp Artemia salina in a variably saline lagoon complex.

    NARCIS (Netherlands)

    Verkuil, Y.; Have, van der T.M.; Winden, van der J.; Chernichko, I.I.

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  15. Primary Screening of the Bioactivity of Brackishwater Cyanobacteria: Toxicity of Crude Extracts to Artemia salina Larvae and Paracentrotus lividus Embryos

    Directory of Open Access Journals (Sweden)

    Viviana R. Lopes

    2010-03-01

    Full Text Available Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  16. Primary screening of the bioactivity of brackishwater cyanobacteria: toxicity of crude extracts to Artemia salina larvae and Paracentrotus lividus embryos.

    Science.gov (United States)

    Lopes, Viviana R; Fernández, Nuria; Martins, Rosário F; Vasconcelos, Vitor

    2010-03-05

    Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  17. Toxicity assessment of metabolites of fungal biocontrol agents using two different (Artemia salina and Daphnia magna) invertebrate bioassays.

    Science.gov (United States)

    Favilla, M; Macchia, L; Gallo, A; Altomare, C

    2006-11-01

    Fungal biocontrol agents (BCAs) have been marketed for control of crop pests, weeds, and diseases. However, BCAs may produce toxic metabolites, whose presence in the formulated products, in the crops and in the environment should be considered along with the associated risk. Two invertebrate models, viz. Artemia salina and Daphnia magna were used to assess the acute toxicity of seven BCA metabolites, characterized by different chemical nature and mode of action, namely alamethicin (ALA), paracelsin (PCS), antiamoebin (AAM), gliotoxin (GTX), destruxin A (DA), oosporein (OOS), and elsinochrome A (EA). The two invertebrates were very sensitive to all the metabolites examined, except OOS. The LC50s after 24 and 36 h exposures showed the following toxicity ranks: A. salina, DA > ALA > EA > GTX > AAM > PCS (LC50s ranging from 9.78 to 40.84 microg/ml at 24 h and from 2.92 to 18.56 microg/ml at 36 h); D. magna, DA > GTX = EA > ALA > PCS > AAM (LC50s ranging from 0.20 to 24.41 microg/ml at 24h and from 0.16 to 11.98 microg/ml at 36 h). LC50 of OOS to D. magna increased dramatically in 36 h exposure, compared to 24 h exposures (5.84 and 68.40 microg/ml, respectively). A. salina and D. magna proved to be suitable models for rapid and inexpensive screening of toxicity of BCAs at an early stage of product development.

  18. Salinas :

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M.; Walsh, Timothy; Bhardwaj, Manoj K.

    2009-02-01

    Salinas provides a massively parallel implementation of structural dynamics nite element analysis, required for high delity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, Users Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are speci c to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  19. Nutritional Composition, in vitro Antioxidant Activity and Artemia salina L. Lethality of Pulp and Seed of Tamarindus indica L. Extracts.

    Science.gov (United States)

    Khairunnuur, F A; Zulkhairi, A; Azrina, A; Moklas, Ma M; Khairullizam, S; Zamree, M S; Shahidan, M A

    2009-03-01

    This study was designed to examine the nutritional composition, antioxidant activity and medium lethal concentration (LC50 value) of Tamarindus indica L. pulp and seed extracts in vitro. The extraction was set at 40◦C, 60◦C and 100◦C for 12 hours, 6 hours and 15 minutes respectively to determine the optimum extraction parameter whereas the anti-oxidant activity of the extracts was measured using iron (III) reduction (FRAP) assay. Total phenolic content (TPC) of the extracts was estimated as gallic acid equivalent by Folin-Ciocalteau method. Toxicity potential of the extract was assessed in vitro by Artemia salina lethality test both in seed and pulp samples. The results showed that tamarind seed contained a higher percentage of carbohydrate, protein, fat and energy (15%, 82%, 95% and 33.13% respectively) than the pulp. On the other hand, the pulp demonstrated a high moisture (51.1%) and ash (34.84%) content than the seed. For the mineral analysis, tamarind seed contained higher Ca and C (1.0% and 50.73% respectively) than the pulp (0.27% and 40.40% respectively). No heavy metals were detected in both samples. Seed extracted at 60◦C/6 hours and 100◦C/15 minutes showed the highest TPC value and were significantly different (pseed extracted at 40◦C/12 hours. Anti-oxidant activity is positively correlated to the TPC value of the extracts (R=0.991). The pulp and seed extracted at 100◦C/15 minutes showed the highest FRAP value among its groups (216.17 ± 14.06 μmol (Fe)/g and 659.74 ± 16.40 μmol (Fe)/g respectively). This study indicates that tamarind pulp and seed extracts possess beneficial antioxidant properties and the optimum extraction parameter is 100◦C for 15 minutes. In Artemia salina lethality test, tamarind pulp caused significant mortality of the crustacean larvae with LC50 in the range of 26-28 μL/mL. Tamarind seed were not toxic to Artemia salina since the LC50 of the extracts was higher than 1000 μL/mL.

  20. Evaluation of metabolic responses of Artemia salina to oil and oil dispersant as a potential indicator of toxicant stress

    Energy Technology Data Exchange (ETDEWEB)

    Verriopoulos, G.; Moraitou-Apostolopoulou, M.; Xatzispirou, A.

    1986-03-01

    Oil represents an obvious hazard for the coastal environment and studies on its impact on marine organisms are necessary. Solvent based oil dispersants constitute one of the most important means for removing oil from shores. Although recently new dispersants have been developed, which are much less toxic than the first ones, dispersants still remain toxic substances. Since in the case of oil pollution treatment, oils and detergents are acting in combination, a realistic approach of laboratory studies must also include the combined action of these substances on marine organisms. Although acute toxicity studies are very useful for the determination of the range of animal tolerance, other effects causing physiological alterations may be detrimental to a population's survival. This paper concerns research on the effects of an oil, an oil dispersant and of the mixture of oil and dispersant on a physiological process, the respiration of the brine shrimp Artemia salina.

  1. Temperature-dose relationships with aflatoxin M1 in milk on the brine shrimp (Artemia salina larvae

    Directory of Open Access Journals (Sweden)

    Lejla Duraković

    2011-06-01

    Full Text Available Temperature-dose relationships with aflatoxin M1 (AFM1 were studied using the brine shrimp Artemia salina larvae as an biological indicator in the temperature range from 20 °C to 40 °C. Increase in the incubation temperature resulted in sensitivity increase by the brine shrimp to AFM1. Optimum sensitivity occured at 30 °C. Positive results were obtained at 0.18 μg AFM1 x L-1 of whole pasteurized milk with a mortality of over 15%. Greater than 90 % mortality occurred at dose levels of 0.9 μg AFM1 x L-1 and above. The test can be conducted during 30-60 hours.

  2. A butyrylcholinesterase in the early development of the brine shrimp (Artemia salina) larvae: a target for phthalate ester embryotoxicity?

    Science.gov (United States)

    Acey, Roger A; Bailey, Stacie; Healy, Patricia; Jo, Chang; Unger, Thomas F; Hudson, Richard A

    2002-12-13

    The phthalate ester insensitive blue-green algae (Synechococcus lividus) were used as a food source to extend the survival of synchronously hatched brine shrimp (Artemia salina) larvae allowing measurement of a reduced toxic response to phthalate esters at late post-hatching stages of development. The maximum acute toxicity due to di-n-butyl phthalate (DNBP) correlated with the expression of a phthalate ester-hydrolyzing enzyme. The purified enzyme was identified as a butyrylcholinesterase due to its rapid inactivation by low concentrations (10(-7)M) of diisopropyl fluorophosphate and inhibition by physostigmine (IC(50)=6 x 10(-7)M) and tetraisopropylpyrophosphoramide (I-OMPA, IC(50)=x 10(-6)M) but not by BW284c5. Apparently competition of the phthalates with the endogenous substrates of the enzyme led to development-dependent toxicity.

  3. The lethality of Euphorbia conspicua to adults of Biomphalaria glabrata, cercaria of Schistosoma mansoni and larvae of Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir F; de Azevedo, Denise P L; dos Santos Mata, Rosalina da C; de Mendonça, Dina I M Dinis; Sant'Ana, Antônio E Goulart

    2007-01-01

    Leaf extracts of Euphorbia conspicua (Euphorbiaceae), together with the latex and fractions derived therefrom, were evaluated for their molluscicidal and cercaricidal activities and their toxicities to brine shrimps. Whilst the leaf extracts were inactive against Biomphalaria glabrata, the latex, its triterpenic fraction and irritant fractions I and II exhibited high activities against adult snails with LC90 values of 4.87, 10.55, 0.64 and 0.10 microg/mL, respectively. The latex and its derived fractions were considered lethal to the cercaria of Schistosoma mansoni at concentrations of 100 microg/mL. The toxicities of the latex and the irritant fractions, but not of the triterpenic fraction, against Artemia salina were high with LC50 values < 10 microg/mL. The possible application of the latex of E. conspicua as an alternative natural molluscicide is considered.

  4. Effects of aqueous suspensions of titanium dioxide nanoparticles on Artemia salina: assessment of nanoparticle aggregation, accumulation, and toxicity.

    Science.gov (United States)

    Ates, Mehmet; Daniels, James; Arslan, Zikri; Farah, Ibrahim O

    2013-04-01

    Aquatic stability and impact of titanium dioxide nanoparticles (TiO2 NPs, 10-30 nm) were investigated using Artemia salina. Acute exposure was conducted on nauplii (larvae) and adults in seawater in a concentration range from 10 to 100 mg/L TiO2 NPs for 24 and 96 h. Rapid aggregation occurred in all suspensions of TiO2 NPs to form micrometer size particles. Yet, both nauplii and adults accumulated the aggregates significantly. Average TiO2 content in nauplii ranged from 0.47 to 3.19 and from 1.29 to 4.43 mg/g in 24 and 96 h, respectively. Accumulation in adults was higher ranging from 2.30 to 4.19 and from 4.38 to 6.20 mg/g in 24 and 96 h, respectively. Phase contrast microscopy images revealed that Artemia were unable to excrete the particles. Thus, the TiO2 aggregates filled inside the guts. No significant mortality or toxicity occurred within 24 h at any dose. Lipid peroxidation levels characterized with malondialdehyde concentrations were not statistically different from those of the controls (p > 0.05). These results suggested that suspensions of the TiO2 NPs were nontoxic to Artemia, most likely due to the formation of benign TiO2 aggregates in water. In contrast, both mortality and lipid peroxidation increased in extended exposure to 96 h. Highest mortality occurred in 100 mg/L TiO2 NP suspensions; 18 % for nauplii and 14 % for adults (LC50 > 100 mg/L). These effects were attributed to the particle loading inside the guts leading to oxidative stress as a result of impaired food uptake for a long period of time.

  5. TOXIC ACTIVITIES OF HEXANE EXTRACT AND COLUMN CHROMATOGRAPHY FRACTIONS OF RODENT TUBER PLANT (Typhonium flagelliforme Lodd. ON Artemia salina

    Directory of Open Access Journals (Sweden)

    Nesti F. Sianipar

    2013-04-01

    Full Text Available Rodent tuber (Typhonium flagelliforme Lodd. is a medicinal plant  particularly found in Java. The plant is used as an ingredient for  conventional cancer treatment. The aim of this study was to determine the toxic activities of crude extracts and column chromatography fractions of  rodent tuber on Artemia salina larvae. Rodent tuber plant was obtained  from the Indonesian Spice and Medicinal Crops Research Institute in  Bogor, West Java. The experiment was conducted in the Biology  Laboratory of Universitas Pelita Harapan, Tangerang, Banten. Leaves and petioles of the plant were macerated with acetone and the filtrates were evaporated (40°C to obtain crude extracts. The crude extracts were partitioned with ethyl acetate, followed with hexane, chloroform and  butanol. Toxicity test of the extracts was performed using the Brine Shrimp Lethality Test (BSLT method on A. salina larvae. Extract showing the most toxic was fractioned using column chromatography and then tested on the larvae. The experiment was designed in a completely randomized  factorial, four replicates for crude extracts and two replicates for the fractions. Treatments were different types of extracts (hexane, chloroform and butanol at various concentrations (500, 1,000 and 1,500 μg ml-1 of 5% Tween solution. Fractions of the column chromatography used were taken from the column number 1, 3 and 10, and tested their toxicities at 200, 400, 600, 800 and 1,000 μg ml-1 of 5% Tween solution. Parameters observed were the death of A. salina expressed as LC50. The study  showed that hexane extract of the petioles had the most toxic to A. salina (LC50 = 762.08 μg ml-1. Fraction number 10 showed the highest toxic (LC50 = 381.07 μg ml-1, whereas the lowest was fraction number 3 (LC50 = 653.13 μg ml-1. The study indicates that rodent tuber plant from Bogor is toxic to A. salina and further test for its cytotoxic activity is justified.

  6. Toxic effects of Microgramma vacciniifolia rhizome lectin on Artemia salina, human cells, and the schistosomiasis vector Biomphalaria glabrata.

    Science.gov (United States)

    de Albuquerque, Lidiane Pereira; Pontual, Emmanuel Viana; Santana, Giselly Maria de Sá; Silva, Luanna Ribeiro Santos; Aguiar, Jaciana dos Santos; Coelho, Luana Cassandra Breitenbach Barroso; Rêgo, Moacyr Jesus Barreto de Melo; Pitta, Maira Galdino da Rocha; da Silva, Teresinha Gonçalves; Melo, Ana Maria Mendonça de Albuquerque; Napoleão, Thiago Henrique; Paiva, Patrícia Maria Guedes

    2014-10-01

    The present study evaluated the toxicity of Microgramma vacciniifolia rhizome lectin (MvRL) to Artemia salina, human tumour cell lines (larynx epidermoid carcinoma Hep-2, NCI-H292 lung mucoepidermoid carcinoma, and chronic myelocytic leukaemia K562), and normal peripheral blood mononuclear cells (PBMCs), as well as to Biomphalaria glabrata embryos and adults. MvRL was toxic to A. salina (LC50=159.9 μg/mL), and exerted cytotoxic effects on NCI-H292 cells (IC50=25.23 μg/mL). The lectin (1-100 μg/mL) did not affect the viability of K562 and Hep-2 tumour cells, as well as of PBMCs. MvRL concentration of 1, 10, and 100 μg/mL promoted malformations (mainly exogastrulation) in 7.8%, 22.5%, and 27.7% of embryos, respectively, as well as delayed embryo development in 42.0%, 69.5%, and 54.7% of embryos, respectively. MvRL at a concentration of 100 μg/mL killed B. glabrata embryos (17.7%) and adults (25%). Further, MvRL damaged B. glabrata reproductive processes, which was evidenced by observations that snails exposed to the lectin (100 μg/mL) deposited fewer eggs than those in the control group, and approximately 40% of the deposited eggs exhibited malformations. Comparison of these results with that from A. salina assay indicates that MvRL is adulticidal at the concentration range which is toxic to environment. In conclusion, the cytotoxicity of MvRL on tumour cell and absence of toxicity to normal cell indicate its potential as chemotherapeutic drug. Also, the study revealed that the lectin is able to promote deleterious effects on B. glabrata embryos at environmentally safe concentrations.

  7. Protection against the toxicity of microcystin-LR and cylindrospermopsin in Artemia salina and Daphnia spp. by pre-treatment with cyanobacterial lipopolysaccharide (LPS).

    Science.gov (United States)

    Lindsay, J; Metcalf, J S; Codd, G A

    2006-12-15

    Purified cyanobacterial lipopolysaccharide (LPS) was not acutely toxic to three aquatic invertebrates (Artemia salina, Daphnia magna and Daphnia galeata) in immersion trials. However, pre-exposure (24 h) to 2 ngmL(-1) LPS increased the LC(50) of microcystin-LR significantly in all 3 species. Similar results were observed with A. salina pre-treated with the same concentration of cyanobacterial LPS and subsequently exposed to cylindrospermopsin, increasing the LC(50) by 8. The findings indicate the need to include exposures to defined combinations of cyanotoxins, and in defined sequences, to understand the contributions of individual cyanotoxins in accounting for cyanobacterial toxicity to invertebrates in natural aquatic environments.

  8. Observações preliminares sobre a toxicidade do ϒBHC e do cloreto de mercúrio à Artemia salina Preliminary observations on the toxicity of ϒBHC and mercuric cloride on Artemia salina

    Directory of Open Access Journals (Sweden)

    Salvador Airton Gaeta

    1983-01-01

    Full Text Available São apresentados os resultados de bioensaios com larvas de Artemia salinacolocadas em misturas de γBHC e HgCl2, a fim de se compararem os efeitos das mesmas com aqueles obtidos quando essas duas substancias atuam isoladamente. A CL50 para o yBHC foi quase que o dobro do valor para o HgCl2. O efeito da primeira dose foi observado para aproximadamente 16% da população (CL16, enquanto que, para o γBHC, o foi em 2,3% da população (CL2,3. Assim, as doses subseqüentes foram mais efetivas para o HgCl2 que para o γBHC. A dose efetiva 50% (ED50 ê mais ou menos igual para o γBHC e para o γBHC + HgCl2, mas em doses altas o YBHC seria mais efetivo, enquanto que em doses baixas a mistura e que o seria.Results of bio-assays using Artemia salina larvae in γBHC-HgCl2 mixture are presented. The results obtained are compared with those obtained using the two chemicals separately. The LC50 for γBHC was almost double that for HgCl2. The effect due to the primary dose of HgCl2 was observed for approximately 16% of the population (LC2.3 while for γBHC the population percentage was 2.3 (LC2.3. As a consequence, subsequent doses were more effective for HgCl2 than for γBHC. The effective dose 50% (ED50 is about the same for γBHC and for γBHC + HgCl2 mixture, though in higher doses BHC would be more effective, while in smaller doses the mixture would predominate.

  9. The ability of the branchiopod, Artemia salina, to graze upon harmful algal blooms caused by Alexandrium fundyense, Aureococcus anophagefferens, and Cochlodinium polykrikoides

    Science.gov (United States)

    Marcoval, M. Alejandra; Pan, Jerónimo; Tang, Yingzhong; Gobler, Christopher J.

    2013-10-01

    We present experiments that examined the grazing and survivorship of zooplankton native (Acartia tonsa) and non-native (Artemia salina) to NY (USA) estuaries when exposed to blooms and cultures of the three harmful algae native to NY, Alexandrium fundyense, Aureococcus anophagefferens (strains CCMP 1850 and CCMP 1984) and Cochlodinium polykrikoides. During experiments with cultures of A. anophagefferens, clearance rates (CR) of A. salina were significantly greater than those of A. tonsa for both algal strains examined. A. salina fed on cultures of C. polykrikoides at higher rates than all phytoplankton species examined, including the control diet (Rhodomonas salina), and faster than rates of A. tonsa fed C. polykrikoides. During experiments with A. fundyense, A. salina actively grazed all cell concentrations (250-1500 cells ml-1) while A. tonsa did not feed at any concentration. Percent mortality of A. salina and A. tonsa fed A. fundyense for 48 h were 43 ± 7.7% and 72 ± 7.8%, respectively, percentages significantly higher than those of individuals fed all other algal diets. During 25 field experiments using natural blooms of the three HAB species performed across six NY estuaries, A. salina significantly (p < 0.05) reduced cell densities of A. anophagefferens, C. polykrikoides, and A. fundyense relative to the control treatments in all but one experiment. The sum of these findings demonstrates that a failure to graze these HABs by the indigenous copepod, A. tonsa, may permit blooms to occur. In addition, the ability of A. salina to graze these HABs at densities that were inhibitory to A. tonsa suggests that A. salina could, in some circumstances, be considered as a part of mitigation strategy for these events.

  10. Chemical investigation of saponins from twelve annual Medicago species and their bioassay with the brine shrimp Artemia salina.

    Science.gov (United States)

    Tava, Aldo; Pecetti, Luciano

    2012-07-01

    The saponin and sapogenin composition of the aerial growth of 12 annual Medicago species sampled at full senescence were investigated. Saponins were extracted from the plant material and obtained in a highly pure grade by reverse-phase chromatography, with a yield ranging from 0.38 +/- 0.04% to 1.35 +/- 0.08% dry matter, depending on the species. Sapogenins were then obtained after acid hydrolysis of saponins, and evaluated by GC/FID and GC/MS methods. Different compositions of the aglycone moieties were observed in the 12 Medicago species. Medicagenic acid was the dominant aglycone in M. x blancheana, M. doliata, M. littoralis, M. rotata, M. rugosa, M. scutellata, M. tornata and M. truncatula, bayogenin and hederagenin in M. arabica and M. rigidula, echinocystic acid in M. polymorpha, and soyasapogenol B in M. aculeata. The purified saponin mixtures, characterized by different chemical compositions, were then used in a toxicity test using the brine shrimp Artemia salina. The most active compounds were the saponins from M. arabica and M. rigidula with LD50 values of 10.1 and 4.6 microg/mL, respectively. A structure-activity relationship for the tested saponin mixtures was observed.

  11. Preliminary evaluation of the toxicity of some synthetic furan derivatives in two cell lines and Artemia salina.

    Science.gov (United States)

    Amaro, María I; Monasterios, Melina; Avendaño, Milagros; Charris, Jaime

    2009-01-01

    This study describes the preliminary toxicity evaluation of five new furan derivatives, 2-[2-acetylamino-2-[(benzothiazolyl-substituted)aminocarbonyl]vinyl]-5-nitro furane (compounds A, B, D and E) and 2-[2-phenylamino-2-[benzothiazolylaminocarbonyl]vinyl]furane (compound C). Cytotoxicity was determined using the MTT (tetrazolium salt) method over BHK21 (Syrian baby hamster kidney) and Hep-2 (human larynx carcinoma) cells, which had previously been used to evaluate the cytotoxicity of the 5-nitrofuran derivatives. The lethal concentration 50 (LC(50)) was determined using brine shrimp (Artemia salina) bioassay. Nitrofurantoin was used as reference compound. The results demonstrate that BHK21 cells are more sensitive than Hep-2 cells. This structurally related serial of compounds shows a differential toxicity, which is an indication that the toxicity naturally arising from the nitro group can be modulated by the substituents over the furan ring. Additionally, compound C, the only derivative with no nitro group, was least toxic to Hep-2, but exhibits toxicity to BHK21 cells and brine shrimp. The LC(50 )brine shrimp test (BST) bioassay results were as follows: A, 654.2 microg ml(-1); B, 50.0 microg ml(-1); C, 533.4 microg ml(-1); D, 172.1 microg ml(-1); E, 76.4 microg ml(-1), and NF, >1000 microg ml(-1).

  12. Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking

    Energy Technology Data Exchange (ETDEWEB)

    Uchiumi, T.; Wahba, A.J.; Traut, R.R.

    1987-08-01

    The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO/sub 4//polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO/sub 4/ gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO/sub 4//polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1)/sub 2/ and (P2)/sub 2/ dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits.

  13. Effects of selected metal oxide nanoparticles on Artemia salina larvae: evaluation of mortality and behavioural and biochemical responses.

    Science.gov (United States)

    Gambardella, Chiara; Mesarič, Tina; Milivojević, Tamara; Sepčić, Kristina; Gallus, Lorenzo; Carbone, Serena; Ferrando, Sara; Faimali, Marco

    2014-07-01

    The aim was to investigate the toxicity of selected metal oxide nanoparticles (MO-NPs) on the brine shrimp Artemia salina, by evaluating mortality and behavioural and biochemical responses. Larvae were exposed to tin(IV) oxide (stannic oxide (SnO2)), cerium(IV) oxide (CeO2) and iron(II, III) oxide (Fe3O4) NPs for 48 h in seawater, with MO-NP suspensions from 0.01 to 1.0 mg/mL. Mortality and behavioural responses (swimming speed alteration) and enzymatic activities of cholinesterase, glutathione-S-transferase and catalase were evaluated. Although the MO-NPs did not induce any mortality of the larvae, they caused changes in behavioural and biochemical responses. Swimming speed significantly decreased in larvae exposed to CeO2 NPs. Cholinesterase and glutathione-S-transferase activities were significantly inhibited in larvae exposed to SnO2 NPs, whereas cholinesterase activity significantly increased after CeO2 NP and Fe3O4 NP exposure. Catalase activity significantly increased in larvae exposed to Fe3O4 NPs. In conclusion, swimming alteration and cholinesterase activity represent valid endpoints for MO-NP exposure, while glutathione-S-transferase and catalase activities appear to be NP-specific.

  14. Copper(II) complexes with 2-pyridineformamide-derived thiosemicarbazones: Spectral studies and toxicity against Artemia salina

    Science.gov (United States)

    Ferraz, Karina O.; Wardell, Solange M. S. V.; Wardell, James L.; Louro, Sonia R. W.; Beraldo, Heloisa

    2009-07-01

    The copper(II) complexes [Cu(H2Am4DH)Cl 2] ( 1), [Cu(H2Am4Me)Cl 2] ( 2), [Cu(H2Am4Et)Cl 2] ( 3) and [Cu(2Am4Ph)Cl] ( 4) with 2-pyridineformamide thiosemicarbazone (H2Am4DH) and its N(4)-methyl (H2Am4Me), N(4)-ethyl (H2Am4Et) and N(4)-phenyl (H2Am4Ph) derivatives were studied by means of infrared and EPR spectral techniques. The crystal structure of 4 was determined. The studied compounds proved to be toxic to Artemia salina, suggesting that they could present cytotoxic activity against solid tumors. Among the free thiosemicarbazones H2Am4Ph presented higher toxicity than all other compounds, which showed comparable effects. In the case of complexes 2 and 3 toxicity is probably attributable to the complex as an entity or to a synergistic effect involving the thiosemicarbazone and copper. H2Am4Ph and complexes 2 and 3 revealed to be the most promising compounds as potential antineoplasic agents.

  15. Comparing cestode infections and their consequences for host fitness in two sexual branchiopods: alien Artemia franciscana and native A. salina from syntopic-populations

    Directory of Open Access Journals (Sweden)

    Stella Redón

    2015-07-01

    Full Text Available The American brine shrimp Artemia franciscana is invasive in the Mediterranean region where it has displaced native species (the sexual A. salina, and the clonal A. parthenogenetica from many salt pond complexes. Artemia populations are parasitized by numerous avian cestodes whose effects have been studied in native species. We present a study from the Ebro Delta salterns (NE Spain, in a salt pond where both A. franciscana and native A. salina populations coexist, providing a unique opportunity to compare the parasite loads of the two sexual species in syntopy. The native species had consistently higher infection parameters, largely because the dominant cestode in A. salina adults and juveniles (Flamingolepis liguloides was much rarer in A. franciscana. The most abundant cestodes in the alien species were Eurycestus avoceti (in adults and Flamingolepis flamingo (in juveniles. The abundance of E. avoceti and F. liguloides was higher in the A. franciscana population syntopic with A. salina than in a population sampled at the same time in another pond where the native brine shrimp was absent, possibly because the native shrimp provides a better reservoir for parasite circulation. Infection by cestodes caused red colouration in adult and juvenile A. salina, and also led to castration in a high proportion of adult females. Both these effects were significantly stronger in the native host than in A. franciscana with the same parasite loads. However, for the first time, significant castration effects (for E. avoceti and F. liguloides and colour change (for six cestode species were observed in infected A. franciscana. Avian cestodes are likely to help A. franciscana outcompete native species. At the same time, they are likely to reduce the production of A. franciscana cysts in areas where they are harvested commercially.

  16. Comparing cestode infections and their consequences for host fitness in two sexual branchiopods: alien Artemia franciscana and native A. salina from syntopic-populations.

    Science.gov (United States)

    Redón, Stella; Amat, Francisco; Sánchez, Marta I; Green, Andy J

    2015-01-01

    The American brine shrimp Artemia franciscana is invasive in the Mediterranean region where it has displaced native species (the sexual A. salina, and the clonal A. parthenogenetica) from many salt pond complexes. Artemia populations are parasitized by numerous avian cestodes whose effects have been studied in native species. We present a study from the Ebro Delta salterns (NE Spain), in a salt pond where both A. franciscana and native A. salina populations coexist, providing a unique opportunity to compare the parasite loads of the two sexual species in syntopy. The native species had consistently higher infection parameters, largely because the dominant cestode in A. salina adults and juveniles (Flamingolepis liguloides) was much rarer in A. franciscana. The most abundant cestodes in the alien species were Eurycestus avoceti (in adults) and Flamingolepis flamingo (in juveniles). The abundance of E. avoceti and F. liguloides was higher in the A. franciscana population syntopic with A. salina than in a population sampled at the same time in another pond where the native brine shrimp was absent, possibly because the native shrimp provides a better reservoir for parasite circulation. Infection by cestodes caused red colouration in adult and juvenile A. salina, and also led to castration in a high proportion of adult females. Both these effects were significantly stronger in the native host than in A. franciscana with the same parasite loads. However, for the first time, significant castration effects (for E. avoceti and F. liguloides) and colour change (for six cestode species) were observed in infected A. franciscana. Avian cestodes are likely to help A. franciscana outcompete native species. At the same time, they are likely to reduce the production of A. franciscana cysts in areas where they are harvested commercially.

  17. Evaluation of Toxic, Cytotoxic, Mutagenic, and Antimutagenic Activities of Natural and Technical Cashew Nut Shell Liquids Using the Allium cepa and Artemia salina Bioassays

    OpenAIRE

    Aracelli de Sousa Leite; Alisson Ferreira Dantas; George Laylson da Silva Oliveira; Gomes Júnior, Antonio L.; Sidney Gonçalo de Lima; Antônia Maria das Graças Lopes Citó; Rivelilson M. de Freitas; Melo-Cavalcante, Ana Amélia de C.; José Arimateia Dantas Lopes

    2015-01-01

    The cashew nut releases a substance that is known as cashew nut shell liquid (CNSL). There are both natural (iCNSL) and technical (tCNSL) cashew nut shell liquids. This study used an Artemia salina bioassay to evaluate the toxic effects of iCNSL and tCNSL cashew nut shell liquids. It also evaluated the toxicity, cytotoxicity, and mutagenicity of CNSL and its effects on the damage induced by copper sulfate (CuSO4·5H2O) on the meristems' root of Allium cepa. Effects of the damage induced by CuS...

  18. Evaluation of toxic effects with transition metal ions, EDTA, SBTI and acrylic polymers on Aedes aegypti (L., 1762 (Culicidae and Artemia salina (Artemidae

    Directory of Open Access Journals (Sweden)

    Eduardo José de Arruda

    2011-06-01

    Full Text Available This work aimed to evaluate the toxicity of some insecticides compounds on Aedes aegypti and Artemia salina larvae. Bioassays were carried out to evaluate the toxic effect after of 24 and 72 h using the compounds or associations. The LC10, LC50 and LC90 values were obtained and utilized for toxicity comparations. For Ae. aegypti, LC50 were 32.65 mg L-1 in 24 h for Na2[EDTA-Cu(II] and total mortality in 72 h for SAP-Na2[EDTA-Cu(II].

  19. The efficiency of a new hydrodynamic cavitation pilot system on Artemia salina cysts and natural population of copepods and bacteria under controlled mesocosm conditions.

    Science.gov (United States)

    Cvetković, Martina; Grego, Mateja; Turk, Valentina

    2016-04-15

    A study of the efficiency of hydrodynamic cavitation and separation was carried out to evaluate an innovative, environmentally safe and acceptable system for ballast water treatment for reducing the risk of introducing non-native species worldwide. Mesocosm experiments were performed to assess the morphological changes and viability of zooplankton (copepods), Artemia salina cysts, and the growth potential of marine bacteria after the hydrodynamic cavitation treatment with a different number of cycles. Our preliminary results confirmed the significant efficiency of the treatment since more than 98% of the copepods and A. salina cysts were damaged, in comparison with the initial population. The efficiency increased with the number of the hydrodynamic cavitation cycles, or in combination with a separation technique for cysts. There was also a significant decrease in bacterial abundance and growth rate, compared to the initial number and growth potential.

  20. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae

    Energy Technology Data Exchange (ETDEWEB)

    Mesarič, Tina, E-mail: tina.mesaric84@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Gambardella, Chiara, E-mail: chiara.gambardella@ge.ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Milivojević, Tamara, E-mail: milivojevictamara@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Faimali, Marco, E-mail: marco.faimali@ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Drobne, Damjana, E-mail: damjana.drobne@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Centre of Excellence in Nanoscience and Nanotechnology (CO Nanocentre), Ljubljana (Slovenia); Centre of Excellence in Advanced Materials and Technologies for the Future (CO NAMASTE), Ljubljana (Slovenia); Falugi, Carla, E-mail: carlafalugi@hotmail.it [Department of Earth, Environment and Life Sciences, University of Genova, Genova (Italy); Makovec, Darko, E-mail: darko.makovec@ijs.si [Jožef Stefan Institute, Jamova 39, 1000 Ljubljana (Slovenia); Jemec, Anita, E-mail: anita.jemec@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Sepčić, Kristina, E-mail: kristina.sepcic@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia)

    2015-06-15

    Highlights: • Carbon-based nanomaterials adsorb onto the body surface of A. salina larvae. • Surface adsorption results in concentration–dependent inhibition of larval swimming. • Carbon-based nanomaterials induce no significant mortality of A. salina larvae. - Abstract: We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration–dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5 mg/mL carbon black and 0.1 mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change.

  1. Comparative study on toxicity of ZnO and TiO2 nanoparticles on Artemia salina: effect of pre-UV-A and visible light irradiation.

    Science.gov (United States)

    Bhuvaneshwari, M; Sagar, Bhawana; Doshi, Siddharth; Chandrasekaran, N; Mukherjee, Amitava

    2017-02-01

    This study evaluated the toxicity potential of ZnO and TiO2 nanoparticles under pre-UV-A irradiation and visible light condition on Artemia salina. The nanoparticle suspension was prepared in seawater medium and exposed under pre-UV-A (0.23 mW/cm(2)) and visible light (0.18 mW/cm(2)) conditions. The aggregation profiles of both nanoparticles (NPs) and dissolution of ZnO NPs under both irradiation conditions at various kinetic intervals (1, 24, 48 h) were studied. The 48-h LC50 values were found to be 27.62 and 71.63 mg/L for ZnO NPs and 117 and 120.9 mg/L for TiO2 NPs under pre-UV-A and visible light conditions. ZnO NPs were found to be more toxic to A. salina as compared to TiO2 NPs. The enhanced toxicity was observed under pre-UV-A-irradiated ZnO NPs, signifying its phototoxicity. Accumulation of ZnO and TiO2 NPs into A. salina depends on the concentration of particles and type irradiations. Elimination of accumulated nanoparticles was also evident under both irradiation conditions. Other than ZnO NPs, the dissolved Zn(2+) also had a significant effect on toxicity and accumulation in A. salina. Increased catalase (CAT) activity in A. salina indicates the generation of oxidative stress due to NP interaction. Thus, this study provides an understanding of the toxicity of photoreactive ZnO and TiO2 NPs as related to the effects of pre-UV-A and visible light irradiation.

  2. Biological screening of araripe basin medicinal plants using Artemia salina Leach and pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    José Galberto M da Costa

    2010-01-01

    Full Text Available Background: Many medicinal plant species from the Araripe Basin are widely known and used in folk medicine and for commercial manufacturing of phytotherapeutic products. Few ethnobotanical and pharmacological studies have been undertaken in this region, however, in spite of the great cultural and biological diversity found there. Materials and Methods : Extracts of 11 plant species collected from Cearα state, Brazil, were subjected to the brine shrimp lethality test in order to detect potential sources of novel cytotoxic, antitumor compounds. The larvicidal activity, based on the percentage of larval mortality, was evaluated after 24 h exposure to the treatments. Results: All species tested showed good larvicidal activity as compared to a reference compound and literature data. The extract from Vanillosmopsis arborea was the most active with an LC 50 of 3.9 μg/ml. Best results were shown by Lantana montevidensis against Pseudomonas aeruginosa [minimum inhibitory concentration (MIC 8μg/ml] and Escherichia coli (MIC 32 μg/ml, Zanthoxylum rhoifolium against E. coli (MIC, 256 μg/ml and Staphylococcus aureus (MIC 64 μg/ml and Croton zenhtneri against S. aureus (MIC 64 μg/ml. Conclusion: Chemical tests indicated that a wide variety of natural product classes was present in those extracts that showed significant activities in the bioassays.

  3. Effect of temperature and viscosity on swimming velocity of the copepod Acartia tonsa, brine shrimp Artemia salina and rotifer Brachionus plicatilis

    DEFF Research Database (Denmark)

    Larsen, Poul Scheel; Madsen, C.V.; Riisgard, H.U.

    2008-01-01

    of swimming velocity for a 10 degrees C temperature reduction) that is found to be largest for the brine shrimp Artemia salina nauplius (37 %) and the rotifer Brachionus plicatilis (26%), but negligible for the copepod Acartia tonsa (4%). We suggest that experimental data on change in swimming velocity (V......Beating cilia are important organelles for swimming in many zooplanktonic aquatic organisms, including many invertebrate larvae, rotifers and ciliates, but other planktonic organisms, such as copepods and brine shrimps, use muscle-powered swimming appendages. In recent studies we found......) due to change in kinematic viscosity (v) be correlated in terms of a power law, V proportional to v(-m). The present data on swimming velocity of copepods, brine shrimps and rotifers show values of exponent m approximate to 1.5 to 3, with a trend of decreasing values for increasing size of species...

  4. Potencial toxicológico frente Artemia Salina em plantas condimentares comercializadas no município de Campina Grande-PB

    Directory of Open Access Journals (Sweden)

    Emmanuel Moreira Pereira

    2015-03-01

    Full Text Available O conhecimento do potencial toxicológico das plantas é um fator primordial para estipular o limite consumível. Objetivou-se nesse trabalho avaliar o potencial toxicológico de plantas condimentares frente Artemia salina, expostas às concentrações dos extratos das plantas erva-doce (Pimpinella anisum L., pimenta malagueta (Capsicum frutescens, endro (Anethum graveolens L. e alecrim (Rosmarinus officinalis L.. O trabalho foi desenvolvido no Laboratório de Engenharia de Alimentos - LEA pertencente ao Centro de Tecnologia e Recursos Naturais da Universidade Federal de Campina Grande-PB. A erva doce apresentou uma baixa toxicidade, atingindo uma DL50 de 428ppm do extrato. Já a pimenta malagueta exibiu um comportamento similar, atingindo o seu potencial toxicológico máximo na terceira diluição com DL50 716,1ppm. Para o endro, observou-se uma baixa taxa de mortalidade, consequentemente foi considerada não toxica, apresentando a DL50, com 2.624,5ppm. O alecrim apresentou baixos percentuais de mortalidade em náuplios de Artemia, sendo a DL50 com 3.720,6ppm, sendo considerado não toxico. No entanto necessita-se de estudos mais aprofundados para caracterizar a composição química das plantas estudadas e um teste in vivo para as que apresentaram baixa toxicidade.

  5. Comparative evaluation of impact of Zn and ZnO nanoparticles on brine shrimp (Artemia salina) larvae: effects of particle size and solubility on toxicity.

    Science.gov (United States)

    Ates, Mehmet; Daniels, James; Arslan, Zikri; Farah, Ibrahim O; Rivera, Hilsamar Félix

    2013-01-01

    Brine shrimp (Artemia salina) larvae were exposed to different sizes of zinc (Zn) and zinc oxide (ZnO) nanoparticles (NPs) to evaluate their toxicity in marine aquatic ecosystems. Acute exposure was conducted in seawater with 10, 50 and 100 mg L(-1) concentrations of the NPs for 24 h and 96 h. Phase contrast microscope images confirmed the accumulation of the NPs inside the guts. Artemia were unable to eliminate the ingested particles, which was thought to be due to the formation of massive particles in the guts. Although the suspensions of the NPs did not exhibit any significant acute toxicity within 24 h, mortalities increased remarkably in 96 h and escalated with increasing concentration of NP suspension to 42% for Zn NPs (40-60 nm) (LC50∼ 100 mg L(-1)) and to about 34% for ZnO NPs (10-30 nm) (LC50 > 100 mg L(-1)). The suspensions of Zn NPs were more toxic to Artemia than those of ZnO NPs under comparable regimes. This effect was attributed to higher Zn(2+) levels (ca. up to 8.9 mg L(-1)) released to the medium from Zn NPs in comparison to that measured in the suspensions of ZnO NPs (ca. 5.5 mg L(-1)). In addition, the size of the nanopowders appeared to contribute to the observed toxicities. Although the suspensions possessed aggregates of comparable sizes, smaller Zn NPs (40-60 nm) were relatively more toxic than larger Zn NPs (80-100 nm). Likewise, the suspensions of 10-30 nm ZnO NPs caused higher toxicity than those of 200 nm ZnO NPs. Lipid peroxidation levels were substantially higher in 96 h (p < 0.05), indicating that the toxic effects were due to the oxidative stress.

  6. The use of a brine shrimp (Artemia salina) bioassay to assess the water quality in Hangzhou section of Beijing-Hangzhou Grand Canal.

    Science.gov (United States)

    Lu, Yin; Xu, Xiaolu; Li, Tian; Xu, Yifei; Wu, Xu

    2012-03-01

    As physical and chemical tests alone are not sufficient enough for the assessment of potential effects on aquatic organisms, bioassays are required for the integrated evaluation of water pollution. In this study, invertebrate crustacean Artemia salina (brine shrimp) was applied as an indicator to assess the water quality of Hangzhou Section of Beijing-Hangzhou Grand Canal. The percentage mortality of brine shrimp was recorded after 24-h exposure to the Canal water. The water samples were collected from five typical sites during October 2008 and April 2009. It exhibited 11% ± 8.3%, 26.7% ± 17%, 31.7% ± 8.5%, 28.0% ± 11.7%, and 4% ± 4.3% percentage mortality for the sample from Tangxi Bridge, Yi Bridge, Gongchen Bridge, Maiyu Bridge, and Gujia Bridge in 2008, respectively. And it exhibited 5.7% ± 4.2%, 10.3% ± 8.2%, 24.3% ± 12.3%, 16.0% ± 12.3%, and 0%, percentage mortality in 2009, respectively. According to the results, a relative improvement in water quality was observed, although the results were not significantly different at the p < 0.05 level. It suggested that 24-h A. salina exposure trials represent an acceptable bioassay for water toxicity when alternative bioassays were unavailable.

  7. Evaluation of Toxic, Cytotoxic, Mutagenic, and Antimutagenic Activities of Natural and Technical Cashew Nut Shell Liquids Using the Allium cepa and Artemia salina Bioassays

    Directory of Open Access Journals (Sweden)

    Aracelli de Sousa Leite

    2015-01-01

    Full Text Available The cashew nut releases a substance that is known as cashew nut shell liquid (CNSL. There are both natural (iCNSL and technical (tCNSL cashew nut shell liquids. This study used an Artemia salina bioassay to evaluate the toxic effects of iCNSL and tCNSL cashew nut shell liquids. It also evaluated the toxicity, cytotoxicity, and mutagenicity of CNSL and its effects on the damage induced by copper sulfate (CuSO4·5H2O on the meristems’ root of Allium cepa. Effects of the damage induced by CuSO4·5H2O were evaluated before (pre-, during (co-, and after (post- treatments. The iCNSL contained 94.5% anacardic acid, and the tCNSL contained 91.3% cardanol. The liquids were toxic to A. salina. Toxicity, cytotoxicity, and mutagenicity were observed with iCNSL compared with the negative control. Similarly, iCNSL failed to inhibit the toxicity and cytotoxicity of CuSO4·5H2O. The tCNSL was not toxic, cytotoxic, or mutagenic in any of the concentrations. However, the lowest iCNSL concentrations and all of the tCNSL concentrations had preventive, antimutagenic, and reparative effects on micronuclei and on chromosomal aberrations in the A. cepa. Therefore, protective, modulating, and reparative effects may be observed in the A. cepa, depending on the concentration and type of CNSL used.

  8. A new look at an old visual system: structure and development of the compound eyes and optic ganglia of the brine shrimp Artemia salina Linnaeus, 1758 (Branchiopoda, anostraca).

    Science.gov (United States)

    Wildt, Miriam; Harzsch, Steffen

    2002-08-01

    Compared to research carried out on decapod crustaceans, the development of the visual system in representatives of the entomostracan crustaceans is poorly understood. However, the structural evolution of the arthropod visual system is an important topic in the new debate on arthropod relationships, and entomostracan crustaceans play a key role in this discussion. Hence, data on structure and ontogeny of the entomostracan visual system are likely to contribute new aspects to our understanding of arthropod phylogeny. Therefore, we explored the proliferation of neuronal stem cells (in vivo incorporation of bromodeoxyuridine) and the developmental expression of synaptic proteins (immunohistochemistry against synapsins) in the developing optic neuropils of the brine shrimp Artemia salina Linnaeus, 1758 (Crustacea, Entomostraca, Branchiopoda, Anostraca) from hatching to adulthood. The morphology of the adult visual system was examined in serial sections of plastic embedded specimens. Our results indicate that the cellular material that gives rise to the visual system (compound eyes and two optic ganglia) is contributed by the mitotic activity of neuronal stem cells that are arranged in three band-shaped proliferation zones. Synapsin-like immunoreactivity in the lamina ganglionaris and the medulla externa initiated only after the anlagen of the compound eyes had already formed, suggesting that the emergence of the two optic neuropils lags behind the proliferative action of these stem cells. Neurogenesis in A. salina is compared to similar processes in malacostracan crustaceans and possible phylogenetic implications are discussed.

  9. Evaluation of toxic, cytotoxic, mutagenic, and antimutagenic activities of natural and technical cashew nut shell liquids using the Allium cepa and Artemia salina bioassays.

    Science.gov (United States)

    Leite, Aracelli de Sousa; Dantas, Alisson Ferreira; Oliveira, George Laylson da Silva; Gomes Júnior, Antonio L; de Lima, Sidney Gonçalo; Citó, Antônia Maria das Graças Lopes; de Freitas, Rivelilson M; Melo-Cavalcante, Ana Amélia de C; Dantas Lopes, José Arimateia

    2015-01-01

    The cashew nut releases a substance that is known as cashew nut shell liquid (CNSL). There are both natural (iCNSL) and technical (tCNSL) cashew nut shell liquids. This study used an Artemia salina bioassay to evaluate the toxic effects of iCNSL and tCNSL cashew nut shell liquids. It also evaluated the toxicity, cytotoxicity, and mutagenicity of CNSL and its effects on the damage induced by copper sulfate (CuSO4·5H2O) on the meristems' root of Allium cepa. Effects of the damage induced by CuSO4·5H2O were evaluated before (pre-), during (co-), and after (post-) treatments. The iCNSL contained 94.5% anacardic acid, and the tCNSL contained 91.3% cardanol. The liquids were toxic to A. salina. Toxicity, cytotoxicity, and mutagenicity were observed with iCNSL compared with the negative control. Similarly, iCNSL failed to inhibit the toxicity and cytotoxicity of CuSO4·5H2O. The tCNSL was not toxic, cytotoxic, or mutagenic in any of the concentrations. However, the lowest iCNSL concentrations and all of the tCNSL concentrations had preventive, antimutagenic, and reparative effects on micronuclei and on chromosomal aberrations in the A. cepa. Therefore, protective, modulating, and reparative effects may be observed in the A. cepa, depending on the concentration and type of CNSL used.

  10. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae.

    Science.gov (United States)

    Mesarič, Tina; Gambardella, Chiara; Milivojević, Tamara; Faimali, Marco; Drobne, Damjana; Falugi, Carla; Makovec, Darko; Jemec, Anita; Sepčić, Kristina

    2015-06-01

    We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration-dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5mg/mL carbon black and 0.1mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change.

  11. Successful Replacement of Artemia salina nauplii with Marine Rotifers (Brachionus plicatilis) in the Diet of Preadult Zebrafish (Danio rerio).

    Science.gov (United States)

    Lawrence, Christian; James, Althea; Mobley, Scottie

    2015-10-01

    Previously established rearing protocols for zebrafish begin feeding with marine rotifers (Brachionus plicatilis), followed by Artemia nauplii until the fish reach subadult stage, the developmental time point at which they can be most easily transitioned onto a processed diet. However, the inclusion of Artemia is less than ideal, given its fluctuating availability and high costs. We tested whether or not we could replace Artemia with rotifers during our normal rearing sequence and still meet published performance standards for (i) weaning fish onto a processed diet by 25 days postfertilization (dpf) and (ii) successful breeding by 60 dpf. Here, we present the results of trials where wild-type and casper zebrafish were fed exclusively with rotifers (R) or rotifers followed by Artemia (RA) for the first 25 dpf after which point all fish were transitioned to a processed diet (Gemma Micro 300). We measured growth and survival at days 25 and 60, and tested for reproductive capability at 60 dpf. While growth performance was significantly better in the RA groups, we were still able to meet goals for both weaning and generation time in the R groups without compromising survival or sex ratios.

  12. Electrospray ionization mass spectrometry (ESI-MS) monitoring of the photolysis of diazinon in aqueous solution: degradation route and toxicity of by-products against Artemia salina.

    Science.gov (United States)

    Souza, Amauri G; Cardeal, Zenilda L; Augusti, Rodinei

    2013-01-01

    The photolytic degradation of diazinon, an organophosphorus pesticide, in aqueous medium under assorted pH values was continuously monitored by direct infusion electrospray ionization mass spectrometry (ESI-MS). The results indicated that the UV radiation was quite efficient in promoting the pesticide degradation at the three pH levels evaluated (5, 7 and 8). The m/z of the most abundant ions observed in the mass spectra (MS), in conjunction with the fragmentation patterns of such ionic species (MS/MS data), made possible the proposition of chemical structures for the main by-products formed. As a result, routes for the photodegradation of diazinon in aqueous solution could thus be suggested. In the assays using Artemia salina (brine shrimp) it was verified that the photodegradation products exhibited much lower toxicity than the primary substrate. Aiming at mimicking the conditions ordinarily found in water treatment plants, an additional series of tests was conducted with a solution containing sodium hypochlorite and diazinon. This solution, when not exposed to UV radiation, exhibited high toxicity against the microorganisms. Under the influence of UV radiation, however, the toxicity rates decreased dramatically. This result is relevant because it points toward the confident application of UV radiation to neutralize the deleterious effects caused by diazinon (and perhaps other organophosphorus pesticides) as well as sodium hypochlorite to the environment.

  13. Artemia salina as a new index for assessment of acute cytotoxicity during co-composting of sewage sludge and lignocellulose waste.

    Science.gov (United States)

    El Fels, Loubna; Hafidi, Mohamed; Ouhdouch, Yedir

    2016-04-01

    Considering the necessity to constantly monitor the safety of use of sewage sludge, we have focused on evaluating the toxicity of raw sludge and sludge treated by co-composting with date palm waste using an in vitro assessment of cytotoxicity based on Artemia salina larvae as a simple new sensitive and reliable routine test. The efficiency of co-composting in decreasing sludge toxicity was evaluated in terms of cytotoxicity abatement reaching 100% by the second month of composting for mixture A (1/3 sludge+2/3 date palm waste) and the third month for mixture B (1/2 sludge+1/2 date palm waste). Cytotoxicity abatement was confirmed by the increase of germination index, which reached over 100% with positive correlation for lettuce (R(2)=0.81 and 0.86) and for turnip (R(2)=0.87 and 0.74) for mixtures A and B respectively. A strong correlation between the proposed cytotoxicity test and the evolution of regulatory physical-chemical approaches was found, (R(2)=0.88 and 0.89) for NH4(+)/NO3(-) and (R(2)=0.80 and 0.88) for C/N respectively for mixture A and B. These findings allow the inexpensive bioassay reported to be used as a highly sensitive test to determine the cytotoxicity and maturity of composts.

  14. Determination of TiO2 and AgTiO2 Nanoparticles in Artemia salina: Toxicity, Morphological Changes, Uptake and Depuration.

    Science.gov (United States)

    Ozkan, Yesim; Altinok, Ilhan; Ilhan, Hasan; Sokmen, Munevver

    2016-01-01

    In this study, aquatic stability and toxic effects of TiO2 and AgTiO2 nanoparticles (NPs) were investigated on Artemia salina nauplii. AgTiO2 was found to be more toxic to nauplii compared to TiO2. The mortality rate in nauplii increased significantly with increasing concentrations and duration of exposure. TiO2 eliminations ranged between 27.8% and 96.5% at 50 and 1 mg/L TiO2 exposed to nauplii, respectively. Accumulation and elimination of Ag in AgTiO2 exposed nauplii were similar except at 1 mg/L AgTiO2. When NPs were mixed with water, the hydrodynamic dimensions of NPs significantly increased because of aggregation in saltwater but NP size decreased over time. NPs-exposed nauplii showed changes in eye formation, enlargement of the intestine, malformations in the outer shell and antennae loss were also observed. Since accumulation and toxicity of AgTiO2 NPs was higher than TiO2 alone, inevitably release of AgTiO2 into aqueous environments can cause ecological risks.

  15. Performances zootechniques comparées de Rotifères d'eau douce Brachionus calyciflorus et de nauplii d'Artemia salina chez les larves de la perche fluviatile Perca fluviatilis

    Directory of Open Access Journals (Sweden)

    Fiogbé, ED.

    2003-01-01

    Full Text Available Zootechnic Performences Compared between Freshwater Rotifer (Brachionus calyciflorus and Nauplii Artemia salina in River Perch Perca fluviatilis L. In able to improve survival rate and growth in perch Perca fluviatilis larvae which are very small at hatching stage, larvae are submitted two days after hatching to different live food: fresh water Rotifer Brachionus calyciflorus and nauplii of Artemia salina.Thus, to avoid the big mortality which occure because of manipulation of larvae, eggs in eye stage were shared in two duplicated groups and feeding of larvae started two days after hatching. Mortality was significant in the two groups from the day 7. However, at the end of the experiment, the group fed Rotifer at the begining of feeding, exhibited the best homogeneity, the best survival and the best food convertion ratio. So, this experiment has shown clearly that at hatching time, all perch larvae are not able to ingest nauplii Artemia. It is necessary to mix their starter food with Rotifer.

  16. Motion control of a population of Artemias

    Directory of Open Access Journals (Sweden)

    L. Fortuna

    2010-06-01

    Full Text Available In this work, the collective behavior of Artemia Salina is studied both experimentally and theoretically. Several experiments have been designed to investigate the Artemia motion under different environment conditions. From the results of such experiments, a strategy to control the direction of motion of an Artemia population, by exploiting their sensitivity to light, has been derived and then implemented.

  17. Evaluation of toxic effects with transition metal ions, EDTA, SBTI and acrylic polymers on Aedes aegypti (L., 1762 (Diptera: Culicidae and Artemia salina (artemidae

    Directory of Open Access Journals (Sweden)

    Eduardo José de Arruda

    2010-04-01

    Full Text Available This work aimed to evaluate the toxicity of some insecticides compounds on Aedes aegypti and Artemia salina larvae. Bioassays were carried out to evaluate the toxic effect after of 24 and 72 h using the compounds or associations. The LC10, LC50 and LC90 values were obtained and utilized for toxicity comparations. For Ae. aegypti, LC50 were 32.65 mg L-1 in 24 h for Na2[EDTA-Cu(II] and total mortality in 72 h for SAP-Na2[EDTA-Cu(II].Aedes aegypti é inseto de grande interesse na Saúde Pública por transmitir o vírus da Dengue, Febre Amarela e Febre Hemorrágica da Dengue. No controle do mosquito utilizam-se inseticidas organoclorados, organofosforados, carbamatos e piretróides que guiam à seleção de insetos resistentes. A combinação de íons metálicos de transição, EDTA, STI e SAP são propostos como estratégia efetiva e persistente para o controle de larvas de Ae. aegypti através de danos ao sistema digestório por radicais livres. A toxicidade dos compostos foi avaliada para Ae. aegypti e A. salina (organismo não alvo. Os bioensaios foram conduzidos para avaliar o efeito tóxico dos compostos e associações após 24 e 72 horas. As CL10, CL50 e CL90 foram obtidas para comparações de toxicidade. Para Ae. aegypti a CL50 foi 32,65 mg L-1 em 24 horas para Na2[EDTA-Cu(II] e mortalidade total a 62,5 mg.L-1para quelato em polímero acrílico de liberação lenta SAP-Na2[EDTA-Cu(II] em até 72 horas.

  18. 马尾松抽出物对盐水虾幼体的致死活性%The Lethal Activity of Pinus massoniana Extracts on Artemia salina Larvae

    Institute of Scientific and Technical Information of China (English)

    洪蓉

    1998-01-01

    盐水虾(Artemia salina.L)法是-种简单、易行,对多种生物学活性都有效的生物测定法.通过实验测出活性成分和抽出物在盐水培养基中的中央致死浓度LC50(μg/m1),结果表明马尾松抽出物对盐水虾幼体具致死活性.

  19. Bioensayo General de Letalidad en Artemia Salina, a Las Fracciones del Extracto Etanólico De Psidium Guajava. L y Psidium Guineense. Sw

    Directory of Open Access Journals (Sweden)

    Lizbeth Sánchez

    2005-10-01

    Full Text Available El estudio se centró en la evaluación y verificación de la letalidad de las fracciones acetato de etilo, obtenida de los extractos etanólicos de los frutos en estado de madurez, verde y pintón, utilizando la cáscara y pulpa de las especies guayaba (Psidium guajava L y Choba (Psidium guineense Sw. La valoración se llevó a cabo mediante el bioensayo en Artemia salina, a través del cual, se evidencia el siguiente proceso: determinar la concentración letal 50 (CL50 utilizando el medio artificial a Ph 7-8, burbujear con el fin de saturar de oxígeno la solución, controlar la eclosión de los huevos a 25 °C despuésde 48 horas, preparar la solución madre y las de trabajo a concentraciones de 1500, 1000, 500,100, 10 g/ml, control positivo estricnina a 80, 70, 60, 50 g/ml, blanco solvente etanol a 80 g/ml. El ensayo biológico se realizó siguiendo las metodologías propuestas por Gualdrón, R (1994; Cyted (1995;Martínez, C (1999 y McLaughlin, J (1997. Comprobada la letalidad de las fracciones acetato del extracto etanólico de Psidium guajava. L y Psidium guineense. Sw mostró CL50 de 181.4 y 221.30g/ml respectivamente, los resultados se evaluaron según Gautret (2000.

  20. Comparative study of the assay of Artemia salina L. and the estimate of the medium lethal dose (LD50 value) in mice, to determine oral acute toxicity of plant extracts.

    Science.gov (United States)

    Logarto Parra, A; Silva Yhebra, R; Guerra Sardiñas, I; Iglesias Buela, L

    2001-09-01

    Artemia salina L. (Artemiidae), the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemical and natural products. In this study the Medium Lethal Concentrations (LC50 value) of 20 plant extracts, Aloe vera (L.) Burm. F. (Aloeaceae), Artemisia absinthium L. (Asteraceae); Citrus aurantium L. (Rutaceae); Cymbopogon citratus (DC. Ex Nees) Stapf (Poaceae); Datura stramonium L. (Solanaceae); Justicia pectoralis Jacq. (Acanthaceae); Musa x paradisiaca L. (Musaceae); Ocimum basilicum L.; O. gratissimum L.; O. tenuiflorum L. (Lamiaceae); Pimenta dioica (L.) Merr. (Myrtaceae); Piper auritum Kunth (Piperaceae); Plantago major L. (Plantaginaceae); Plectranthus amboinicus (Lour.) Spreng. (Lamiaceae); Ruta graveolens L. (Rutaceae); Senna alata (L.) Roxb. (Fabaceae); Stachytarpheta jamaicensis (L.) Vahl (Verbenaceae); and Thuja occidentalis L. (Cupressaceae), were determined using Artemia salina L. (Artemiidae), with the objective of relating the results to the LD50 values reported in mice (tested at three concentrations: 10, 100, and 1000 microg/mL, for each extract). We found good correlation between the in vivo and the in vitro tests (r = 0.85 p < 0.05), and this method is a useful tool for predicting oral acute toxicity in plant extracts.

  1. Avaliação da atividade tóxica em Artemia salina e Biomphalaria glabrata de extratos de quatro espécies do gênero Eleocharis (Cyperaceae

    Directory of Open Access Journals (Sweden)

    A.L.T.G. Ruiz

    2005-06-01

    Full Text Available O gênero Eleocharis R. Br. compreende cerca de 200 espécies, ocorrendo em ambientes úmidos tais como brejos e margens de rios e lagos. Procurando novos agentes moluscicidas, os extratos de Eleocharis acutangula (Roxb. Schult., Eleocharis interstincta (Vahl Roem. & Schult., Eleocharis maculosa (Vahl Roem. & Schult. e Eleocharis sellowiana Kunth foram testados para atividade moluscicida, contra caramujos adultos e desovas, e toxicidade (ensaio de letalidade com Artemia salina. O extrato hexânico de Eleocharis acutangula (parte subterrânea fresca foi ativo contra Artemia salina (CL50 = 476,00 mg/mL, enquanto os demais extratos apresentaram CL50 >> 10³ mg/mL, sugerindo baixa toxicidade. O extrato hidro-etanólico de Eleocharis sellowiana (parte subterrânea fresca foi ativo contra desovas de Biomphalaria glabrata (CL50 = 24,27 mg/mL mas inativo contra indivíduos adultos. Os demais extratos testados não apresentaram atividade moluscicida.

  2. Estudo fitoquímico de Unonopsis lindmanii - Annonaceae, biomonitorado pelo ensaio de toxicidade sobre a Artemia salina leach

    Directory of Open Access Journals (Sweden)

    Siqueira João Máximo de

    1998-01-01

    Full Text Available Extracts obtained from leaves, seeds and bark of Unonopsis lindmanii were evaluated by means of Brine Shrimp Lethality test (BSL. Through bioassay-guided chromatographic fractionation, liriodenine, an oxoaporphine alkaloid, was isolated from the bark extracts as the bioactive compound. Two additional inactive known alkaloids, unonopsine and lysicamine were also isolated from the bark extracts.

  3. The genus Artemia Leach, 1819 (Crustacea: Branchiopoda: I. True and false taxonomical descriptions El género Artemia Leach, 1819 (Crustacea: Branchiopoda: I. Descripciones taxonómicas verdaderas y falsas

    Directory of Open Access Journals (Sweden)

    Alireza Asem

    2010-01-01

    Full Text Available The brine shrimp Artemia is important for aquaculture since it is bighly nutritious. It is also used widely in biological studies because it is easy to culture. The aim of the present study is to review the literature on the taxonomical nomenclature of Artemia. The present study indicates the existence of seven species: three living in the Americas, one in Europe, and three in Asia.El camarón de salmuera Artemia es importante para la acuicultura por su alta calidad nutricional y es muy utilizado para estudios biológicos por ser de fácil cultivo. El objetivo del presente estudio es revisar la literatura sobre la nomenclatura taxonómica de Artemia. Se determina la existencia de siete especies; tres de ellas viven en América, una en Europa y tres en Asia.

  4. Brine shrimp bioassay of some species of Solanum from Northestern Brazil Bioatividade em Artemia salina de várias espécies de Solanum do Nordeste Brasileiro

    Directory of Open Access Journals (Sweden)

    Tania Maria S. Silva

    2007-03-01

    Full Text Available The methanolic extracts of 13 Specieis of the genus Solanum (Solanaceae have been tested for bioactivity in Artemia salina. The extracts investigated were prepared from various parts (aerial parts, roots and fruits of S. asperum, S. capsicoides, S. palinacantum, S. paludosum, S. paniculatum, S. paraibanum, S. sisymbriifolium, S. crinitum, S. diamantinense, S. megalonyx, S. torvum, S. asterophorum and S. stipulaceum. The lethal concentrations were determined for the extracts and among thirteen plants tested, four appear to be inactive. The extracts of the fruits of S. asperum (LC50 = 420.5 µg/mL and S. paludosum (LC50 = 548.0 µg/mL, aerial parts of S. diamantinense (LC50 = 481.0 µg/mL and S. sisymbrifolium (LC50 = 382.7 µg/mL, and the roots of S. asperum (LC50 = 593.4 µg/mL and S. stipulaceum (LC50 = 823.1 µg/mL, all of which previously showed molluscicidal activity against Biomphalaria glabrata were also found to be active in the present study with brine shrimp.Os extratos metanólicos de 13 espécies de Solanum (Solanaceae foram testados para verifificação da bioatividade em Artemia salina. As espécies testadas (partes aéreas, raízes e frutos foram: S. asperum, S. capsicoides, S. palinacantum, S. paludosum, S. paniculatum, S. paraibanum, S. sisymbriifolium, S. crinitum, S. diamantinense, S. megalonyx, S. torvum, S. asterophorum e S. stipulaceum. Das treze espécies testadas, quatro foram inativas. Os extratos dos frutos de S. asperum (CL50 = 420,5 µg/mL e S. paludosum (CL50 = 548,0 µg/mL, partes aéreas de S. diamantinense (CL50 = 481,0 µg/mL e S. sisymbrifolium (CL50 = 382,7 µg/mL, e das raízes S. asperum (CL50 = 593,4 µg/mL e S. stipulaceum (CL50 = 823,1 µg/mL que mostraram atividade moluscicida contra Biomphalaria glabrata também mostraram atividade tóxica em Artemia salina.

  5. 高原盐湖盐藻和卤虫资源的开发和利用%Development and Utilization of Salt Algae (Dunaliella salina) and Brine Shrimp (Artemia spp.) in the Plateau Salt Lake of China

    Institute of Scientific and Technical Information of China (English)

    印象初; 印红; 周可新; 张道川; 施鉴屏

    2001-01-01

    叙述了我国高原盐湖的名称、地理位置、面积、水深、海拔和盐湖类型等基本情况;盐湖中盐藻和卤虫的种类、生物学和生态学特性。并对它们的经济价值和开发利用作了初步的讨论。%In the paper, the name, geographical position, area, depth ofwater, altitude, brine type of salt lake from Plateau; ecology, biology and economy of salt algae (Dunaliella salina) and brine shrimp (Artemia spp.) are described. The development and utilization of the sources of salt lake are preliminarily discussed.

  6. A PRELIMINARY OBSERVATION OF THE EFFECTS OF Artemia salina ON THE CULTURE OF MICROALGAES%卤虫在单细胞藻类培养中作用的初步观察

    Institute of Scientific and Technical Information of China (English)

    于琳江

    1999-01-01

    在扁藻(Tetraselmis sp.和Platymonas sp.)藻液中接种适量的卤虫(Artemia salina), 通过卤虫对藻液中细菌及原生动物等敌害生物的捕食作用,可以有效地控制敌害生物对藻类的危害.通过卤虫对藻液中衰老及死亡的藻细胞的捕食,可以使藻种得以优化.而且,通过卤虫的代谢作用, 藻类生长所必需的营养元素得以还原.

  7. Complexity in a population of Artemia

    Energy Technology Data Exchange (ETDEWEB)

    Ali, A.A., E-mail: abduladem1@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Fortuna, L., E-mail: lfortuna@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Frasca, M., E-mail: mfrasca@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Rashid, M.T., E-mail: mofid76@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Xibilia, M.G., E-mail: mxibilia@ingegneria.unime.i [DiSIA, Faculty of Engineering, University of Messina (Italy)

    2011-04-15

    Highlights: Experiments on collective motion of populations of animals (Artemia salina). Design of low-cost experimental setup for complex systems. Control of collective motion of populations of Artemia. Models of collective motion of populations of Artemia. - Abstract: Artemia salina belongs to a genus of very primordial crustaceans, whose behavior is not widely investigated in literature. Their collective behavior is studied in this paper both experimentally and theoretically. Different experiments have been designed to control the direction of motion of an Artemia population by exploiting their sensitivity to light and to measure the response of the population to light at different wavelengths. Mathematical models have been also derived, explaining the mechanisms underlying Artemia flocking formation when a light spot is applied to the system. The results obtained allow to develop new strategies for distributed control of agents and to test them in a simple and low cost experimental setup.

  8. Evaluation of the toxicity of the methanolic extract of Caesalpinia Pyramidalis, subjected to gamma radiation, compared to saline artemias; Avaliacao da toxicidade do extrato metanolico de Caesalpinia Pyramidalis, submetido a radiacao gama, frente a artemias salinas

    Energy Technology Data Exchange (ETDEWEB)

    Pessoa, Juanna G.; Santos, Mariana L.O.; Costa, Michelle C.A.; Siqueira, Williams N.; Silva, Luanna R.S.; Cabral, Daniela L.V.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: marianasantos_ufpe@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil)

    2013-07-01

    The present study aimed to investigate the possible effect of irradiation of 60 Co in methanol extract of Caesalpinia pyramidalis (catingueira) with function of reducing the toxicity of the extract at concentrations of 1000, 500, 250 and 125 ppm irradiating them with doses of 5 kGy 7 kGy and 10 kGy, using lethality tests with saline Artemias.

  9. Phytochemistry study from bark of stem of Duguetia Glabriuscula - Annonaceae, using toxicity assays for Artemia salina; Estudo fitoquimico das cascas do caule de Duguetia Glabriuscula - Annonaceae, biomonitorado pelo ensaio de toxicidade frente a Artemia salina leach

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Joao Maximo de; Ziminiani, Maria Graziela [Mato Grosso do Sul Univ., Campo Grande, MS (Brazil). Dept. de Farmacia Bioquimica]. E-mail: jmaximo@nin.ufms.br; Resende, Ubirazilda Maria [Mato Grosso do Sul Univ., Campo Grande, MS (Brazil). Dept. de Biologia; Boaventura, Maria Amelia Diamantino [Minas Gerais Univ., Belo Horizonte, MG (Brazil). Dept. de Quimica

    2001-04-01

    The extract obtained from stem bark of Duguetia glabriuscula - Annonaceae was evaluated by Brine Shrimp Lethality test (BSL). The bioactive compounds, oxobufoline and lanuginosine, two oxoaporphine alkaloids were isolated by activity-guided fractionation. In addition, the compounds asaraldehyde, (+)-allo-aromadendrane-10 {beta}, 14-diol, and two aporphine alkaloids, polyalthine and oliveridine were also obtained. (author)

  10. Effects of sonication and advanced chemical oxidants on the unicellular green alga Dunaliella tertiolecta and cysts, larvae and adults of the brine shrimp Artemia salina: a prospective treatment to eradicate invasive organisms from ballast water.

    Science.gov (United States)

    Gavand, Meghana R; McClintock, James B; Amsler, Charles D; Peters, Robert W; Angus, Robert A

    2007-11-01

    Uptake and release of ship-borne ballast water is a major factor contributing to introductions of aquatic phytoplankton and invasive macroinvertebrates. Some invasive unicellular algae can cause harmful algal blooms and produce toxins that build up in food chains. Moreover, to date, few studies have compared the efficacy of ballast water treatments against different life history phases of aquatic macroinvertebrates. In the present study, the unicellular green alga Dunaliella tertiolecta, and three discrete life history phases of the brine shrimp Artemia salina, were independently used as model organisms to study the efficacy of sonication as well as the advanced oxidants, hydrogen peroxide and ozone, as potential ballast water treatments. Algal cells and brine shrimp cysts, nauplii, and adults were subjected to individual and combined treatments of sonication and advanced oxidants. Combined rather than individual treatments consistently yielded the highest levels of mortality in algal cells (100% over a 2 min exposure) and in brine shrimp (100% and 95% for larvae and adults, respectively, over a 2 min exposure). In contrast, mortality levels in brine shrimp cysts (66% over 2 min; increased to 92% over a 20 min exposure) were moderately high but consistently lower than that detected for larval or adult shrimp. Our results indicate that a combination of sonication and advanced chemical oxidants may be a promising method to eradicate aquatic unicellular algae and macroinvertebrates in ballast water.

  11. Toxicity assessment of textile effluents treated by advanced oxidative process (UV/TiO2 and UV/TiO2/H2O2) in the species Artemia salina L.

    Science.gov (United States)

    Garcia, Juliana Carla; de Souza Freitas, Thábata Karoliny Formicoly; Palácio, Soraya Moreno; Ambrósio, Elizangela; Souza, Maísa Tatiane Ferreira; Santos, Lídia Brizola; de Cinque Almeida, Vitor; de Souza, Nilson Evelázio

    2013-03-01

    Textile industry wastes raise a great concern due to their strong coloration and toxicity. The objective of the present work was to characterize the degradation and mineralization of textile effluents by advanced oxidative processes using either TiO(2) or TiO(2)/H(2)O(2) and to monitor the toxicity of the products formed during 6-h irradiation in relation to that of the in natura effluent. The results demonstrated that the TiO(2)/H(2)O(2) association was more efficient in the mineralization of textile effluents than TiO(2), with high mineralized ion concentrations (NH (4) (+) , NO (3) (-) , and SO (4) (2-) ) and significantly decreased organic matter ratios (represented by the chemical oxygen demand and total organic carbon). The toxicity of the degradation products after 4-h irradiation to Artemia salina L. was not significant (below 10 %). However, the TiO(2)/H(2)O(2) association produced more toxicity under irradiation than the TiO(2) system, which was attributed to the increased presence of oxidants in the first group. Comparatively, the photogenerated products of both TiO(2) and the TiO(2)/H(2)O(2) association were less toxic than the in natura effluent.

  12. Photolysis and photocatalysis of ibuprofen in aqueous medium: characterization of by-products via liquid chromatography coupled to high-resolution mass spectrometry and assessment of their toxicities against Artemia salina.

    Science.gov (United States)

    da Silva, Júlio César Cardoso; Teodoro, Janaina Aparecida Reis; Afonso, Robson José de Cássia Franco; Aquino, Sérgio Francisco; Augusti, Rodinei

    2014-02-01

    The degradation of the pharmaceutical compound ibuprofen (IBP) in aqueous solution induced by direct photolysis (UV-A and UV-C radiation) and photocatalysis (TiO2 /UV-A and TiO2 /UV-C systems) was evaluated. Initially, we observed that whereas photocatalysis (both systems) and direct photolysis with UV-C radiation were able to cause an almost complete removal of IBP, the mineralization rates achieved for all the photodegradation processes were much smaller (the highest value being obtained for the TiO2 /UV-C system: 37.7%), even after an exposure time as long as 120 min. Chemical structures for the by-products formed under these oxidative conditions (11 of them were detected) were proposed based on the data from liquid chromatography coupled to high-resolution mass spectrometry (LC-HRMS) analyses. Taking into account these results, an unprecedented route for the photodegradation of IBP could thus be proposed. Moreover, a fortunate result was achieved herein: tests against Artemia salina showed that the degradation products had no higher ecotoxicities than IBP, which possibly indicates that the photocatalytic (TiO2 /UV-A and TiO2 /UV-C systems) and photolytic (UV-C radiation) processes can be conveniently employed to deplete IBP in aqueous media.

  13. Avaliação de extratos de macroalgas bênticas do litoral catarinense utilizando o teste de letalidade para Artemia salina Evaluation of macroalgae from Santa Catarina’s coast with the brine shrimp assay

    Directory of Open Access Journals (Sweden)

    Cintia Lhullier

    2006-06-01

    Full Text Available Foram coletadas amostras de algas marinhas de 19 espécies (sendo 4 pertencentes ao filo Chlorophyta, 5 ao filo Phaeophyta e 10 ao filo Rhodophyta em dois locais do litoral catarinense. Os extratos etanólicos foram submetidos ao teste de letalidade para larvas de Artemia salina com objetivo de realizar uma triagem das espécies. Dos 26 extratos testados, 25 apresentaram toxicidade significativa em pelo menos uma das 3 concentrações testadas. O grupo de algas vermelhas (Rhodophyta foi o que obteve maior porcentagem de extratos com resultados estatisticamente significativos pelo método do qui-quadrado e também menores valores de CL50, com destaque para Acanthophora spicifera, Hypnea musciformis e Pterocladiella capillacea. Observaram-se diferenças entre as espécies de um mesmo gênero (Codium decorticatum e Codium isthmocladium e também a influência de fatores ambientais (Hypnea musciformis na toxicidade dos extratos.Samples of 19 macroalgae species (4 Chlorophyta, 5 Phaeophyta and 10 Rhodophyta have been collected from two points of Santa Catarina's coast. The ethanolic extracts were avaluated with the brine shrimp assay in order to perform a screening for potential toxicity. A total of 25 extracts presented significant results in one or more of the tested concentrations. The phylum Rhodophyta presented more statistically significant results with the chi-square test, as well as lower values of LC50. The extracts of Acanthophora spicifera (from Canasvieiras and Ilha do Francês, Hypnea musciformis and Pterocladiella capillacea (both from Ilha do Francês presented LC50 below 50 mg/mL. Differences between the species of same genus (Codium decorticatum and Codium isthmocladium and the influence of environmental factors (Hypnea musciformis were observed.

  14. Portuguese native Artemia parthenogenetica resisting invasion by Artemia franciscana - Assessing reproductive parameters under different environmental conditions

    Science.gov (United States)

    Pinto, Pedro M.; Hontoria, Francisco; Vieira, Natividade; Bio, Ana

    2014-05-01

    There is widespread interest in the conservation of native Artemia biodiversity. In Portugal, only two known populations of native Artemia remain: one in the Rio Maior salina, the other in the Aveiro salina complex, both of the diploid Artemia parthenogenetica species. All other Portuguese hypersaline environments where Artemia can be found have been invaded by Artemia franciscana, which has eradicated the native strains. Invasiveness and resilience of, respectively, exotic and indigenous species are thought to depend on strain-specific traits and adaptation to local conditions. This work evaluates the reproductive performance of the two Portuguese native strains and the invasive species exposed to different salinities, temperatures, photoperiods and food supplies. Reproduction periods, quantity and quality of offspring varied significantly, depending on both the Artemia strain and environmental conditions. A. parthenogenetica from Rio Maior reproduced better than A. franciscana at high salinity (150) and low food supply, which may reflect an adaptation to its biotope that aids its resistance to invasion. But A. parthenogenetica form Aveiro performed much worse than its invasive competitor, under most of the conditions tested. It is unlikely that A. franciscana has not been introduced in this salina by chance alone. Other biological traits of the local A. parthenogenetica or adaptation to unstudied local factors (e.g. pollution) are probably responsible for this strain's survival. Further knowledge on specific local conditions and trait-specific tolerances to biotic and abiotic conditions are needed to understand (non-)invasion patterns and preserve the remaining native populations.

  15. Factors influencing Artemia populations in Antillean salines

    NARCIS (Netherlands)

    Kristensen, Ingvar; Hulscher-Emeis, T. Marian

    1972-01-01

    In the Netherlands Antilles two extreme “forms” of Artemia salina, f. arietina and f. milhauseni, show all intermediate gradations. They hybridize constantly. When forma arietina is moved from lower concentrations into highly concentrated brine it will produce offspring that exhibit characteristics

  16. Factors influencing Artemia populations in Antillean salines

    NARCIS (Netherlands)

    Kristensen, Ingvar; Hulscher-Emeis, T. Marian

    1972-01-01

    In the Netherlands Antilles two extreme “forms” of Artemia salina, f. arietina and f. milhauseni, show all intermediate gradations. They hybridize constantly. When forma arietina is moved from lower concentrations into highly concentrated brine it will produce offspring that exhibit characteristics

  17. The influence of different rotifer and Artemia enrichment diets on growth, survival and pigmentation in turbot (Scophthalmus maximus L.) larvae

    DEFF Research Database (Denmark)

    Støttrup, Josianne; Attramadal, Y.

    1992-01-01

    , approximately seven days after hatching, the larvae were fed newly-hatched Artemia salina nauplii (AT-1; Brazil strain). From day 10, enriched Great Salt Lake Artemia nauplii were introduced. Each set of seven tansk was further subdivided and the larvae fed Artemia nauplii enriched with one of four enrichment...

  18. Brine shrimp bioassay: importance of correct taxonomic identification of Artemia (Anostraca) species.

    Science.gov (United States)

    Ruebhart, David R; Cock, Ian E; Shaw, Glen R

    2008-08-01

    Despite the common use of the brine shrimp bioassay in toxicology, there is confusion in the literature regarding citation of the correct taxonomic identity of the Artemia species used. The genus Artemia, once thought to be represented by a single species Artemia salina, is now known to be composed of several bisexual species as well as parthenogenetic populations. Artemia franciscana is the best studied of the Artemia species and is considered to represent the vast majority of studies in which Artemia is used as an experimental test organism. We found that in studies referring to the use of A. salina, the zoogeography of the cyst harvest site indicated that the species used was actually A. franciscana. Those performing bioassays with Artemia need to exercise diligence in assigning correct species identification, as the identity of the test organism is an important parameter in assuring the validity of the results of the assay.

  19. Composição química, atividade antibacteriana in vitro e toxicidade em Artemia salina do óleo essencial das inflorescências de Ocimum gratissimum L., Lamiaceae Chemical composition, antibacterial activity in vitro and brine-shrimp toxicity of the essential oil from inflorescences of Ocimum gratissimum L., Lamiaceae.

    Directory of Open Access Journals (Sweden)

    Lenise L. Silva

    2010-11-01

    Full Text Available O óleo essencial das inflorescências de Ocimum gratissimum L., Lamiaceae foi obtido por hidrodestilação e analisado por CG/EM. Os constituintes majoritários identificados foram eugenol (81,94% e γ-muuroleno (12,58%. O óleo essencial das inflorescências demonstrou atividade antibacteriana frente a todas as cepas bacterianas testadas pelo método de microdiluição em caldo. Merece destaque a atividade verificada frente às cepas resistentes de Enterococcus faecalis, Staphylococcus aureus e Escherichia coli. Os valores obtidos de concentração inibitória mínima (CIM e a concentração bactericida mínima (CBM variaram, respectivamente, entre 0,5-2 mg/mL e 1-4 mg/mL. Valores de CL50 de 233,8 (200,7-272,0 µg/mL para o óleo essencial e 186,1 (144,1-228,5 µg/mL para o eugenol, utilizado como controle positivo, foram observados frente à Artemia salina L.The essential oil obtained by hydrodistillation of the inflorescences of Ocimum gratissimum L. was analyzed by GC/MS. The main constituents were eugenol (81.94% and γ-muurolene (12.58%. Antibacterial activity was shown against all assayed strains by the broth microdilution method. It's worth noting the activity against resistant strains of Enterococcus faecalis, Staphylococcus aureus and Escherichia coli. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values ranged between 0.5-2 mg/mL and 1-4 mg/mL, respectively. Preliminary toxicity assayed by the brine-shrimp (Artemia salina L. test showed LC50 values of 233.8 (200.7 - 272.0 µg/mL and 186.1 (144.1 - 228.5 µg/mL, respectively for the essential oil and eugenol (positive control.

  20. 米氏凯伦藻对褶皱臂尾轮虫、卤虫和黑褐新糠虾存活的影响%Effect of Karenia mikimotoi on the survival of rotifer Brachionus plicatilis, brine shrimp Artemia salina, and Neomysis awatschensis

    Institute of Scientific and Technical Information of China (English)

    孙科; 颜天; 周名江; 何建宗

    2010-01-01

    初步研究了一株米氏凯伦藻对褶皱臂尾轮虫(Brachionus plicatilis)、卤虫(Artemia salina)幼体和黑褐新糠虾(Neomysis awatschensis)的毒性效应和机制.研究发现米氏凯伦藻(Karenia mikimotoi)在较低密度下就能明显减少轮虫的种群数量, 24 h EC50仅为20个/mL左右; 该藻的各组分毒性比较结果显示, 只有藻液和细胞重悬液有这种毒害作用, 而去藻过滤液和藻细胞破碎液的影响不明显, 表明这种毒害作用可能是由于活的藻细胞引起的; 在米氏凯伦藻中卤虫和黑褐新糠虾的存活数量也明显下降.结果表明, 米氏凯伦藻赤潮可能通过直接影响存活从而对浮游动物产生影响.

  1. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae

    Directory of Open Access Journals (Sweden)

    PATRICIO R DE LOS RIOS

    2000-03-01

    Full Text Available Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos, A. persimilis (Argentina y Artemia sp. (Chile, cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile y entre A. persimilis y Artemia sp. de Torres del Paine (Chile. Se discuten en el presente trabajo los factores geográficos, ecológicos y genéticos que determinaron la especiación de Artemia en Chile y Argentina, y como ésta se manifiesta en distintos patrones morfométricosThe frontal knob diameter and its relationship with the total body lenght among populations of Artemia franciscana (Chile and U.S.A, A. persimilis (Argentina, and Artemia sp. (Chile, were asessed. All populations were cultured under laboratory conditions. Significant differences in both parameters between A. franciscana and Artemia sp. from Salina el Convento (Chile, and between A. persimilis and Artemia sp. from Amarga Lagoon (Chile were recorded.Geographical, ecological and genetic aspects which affected the speciation of Artemia populations in Chile and Argentina, and their expression in morphometric characters are discussed

  2. de Salinas

    Directory of Open Access Journals (Sweden)

    Ma. Dolores París

    2003-01-01

    Full Text Available A diferencia de otros pueblos indígenas de Oaxaca como los mixtecos o los zapotecos que tienen una larga tradición migratoria en Estados Unidos, la migración de los triquis puede considerarse como un nuevo grupo migratorio. Por ejemplo, la mayoría de las familias asentadas en el Valle de Salinas, situado en la costa central de California, llegaron hace menos de cinco años. En otros lugares, como en los valles centrales o en las ciudades del sur (San Diego y Los Ángeles vivían unos pocos hombres triquis hacia los años ochenta. Algunos de esos contados pioneros lograron regularizar su situación migratoria a fines de esa misma década; muchos hombres y la enorme mayoría de las mujeres triquis que viven en California son indocumentados.

  3. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae) Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae)

    OpenAIRE

    PATRICIO R DE LOS RIOS; OSCAR ZUÑIGA

    2000-01-01

    Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos), A. persimilis (Argentina) y Artemia sp. (Chile), cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile) y entre A. persimilis y Artemia sp. de Torres del Paine (Chile). Se discuten en el presente trab...

  4. Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA.

    Science.gov (United States)

    Ciesiolka, J; Nurse, K; Klein, J; Ofengand, J

    1985-06-18

    The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by "Z"-gel analysis [Ehresmann, C., & Ofengand, J. (1984) Biochemistry 23, 438-445].(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Salinas : theory manual.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, User's Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programer-notes manual, the user's notes and of course the material in the open literature.

  6. Salinas : theory manual.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2011-11-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas, we refer the reader to Salinas, User's Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  7. Global biodiversity and geographical distribution of diapausing aquatic invertebrates: the case of the cosmopolitan brine shrimp, Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Pacios, Fernando

    2010-01-01

    and geographic information. Our results indicate there are three Artemia complexes, A. franciscana, A. tibetiana and A. salina, suggesting at least three undescribed, and one unidentified to date, highly isolated lineages, to be re-evaluated taxonomically. Additionally, at a global scale, our data set shows two......The genus Artemia comprises passively dispersed anostracan species with a distribution all around the world, except in Antarctica. We used both published and personal data to assess and update existing knowledge on the diversity and distribution of Artemia, in particular compiling also genetic...

  8. Biomass production and nutritional value of Artemia sp. (Anostraca: Artemiidae) in Campeche, México.

    Science.gov (United States)

    Maldonado-Montiel, Teresita D N J; Rodríguez-Canché, Leticia G

    2005-01-01

    Biomass of the crustacean Artemia sp. has multiple uses. The biochemical composition and biomass production of Artemia grown from cysts produced by a native population from Real de Salinas were evaluated under laboratory conditions. Nauplii (instar I) were stocked at density of 10 nauplii/ml in 1.5 l tanks, fed with rice bran from day 2 to day 6, and with the microalgae Tetraselmis suecica from day 7 to day 15. At the end of the trial (day 15) the average length was 5.34 mm, biomass production was 15.72 g/l (wet weight), and survival was 79%. The proximal analysis and biochemical composition of Artemia biomass indicated that its nutrient percentages are closely similar to Artemia from other regions, making this species a suitable food for cultured fish and crustacean.

  9. Biomass production and nutritional value of Artemia sp. (Anostraca: Artemiidae in Campeche, México

    Directory of Open Access Journals (Sweden)

    Teresita D.N.J Maldonado-Montiel

    2005-09-01

    Full Text Available Biomass of the crustacean Artemia sp. has multiple uses. The biochemical composition and biomass production of Artemia grown from cysts produced by a native population from Real de Salinas were evaluated under laboratory conditions. Nauplii (instar I were stocked at density of 10 nauplii/ml in 1.5 l tanks, fed with rice bran from day 2 to day 6, and with the microalgae Tetraselmis suecica from day 7 to day 15. At the end of the trial (day 15 the average length was 5.34 mm, biomass production was 15.72 g/l (wet weight, and survival was 79%. The proximal analysis and biochemical composition of Artemia biomass indicated that its nutrient percentages are closely similar to Artemia from other regions, making this species a suitable food for cultured fish and crustacean. Rev. Biol. Trop. 53(3-4: 447-454. Epub 2005 Oct 3.El crustáceo Artemia spp. tiene múltiples usos en acuicultura. El potencial de producción de biomasa de Artemia sp. de Real de Salinas, Campeche, México en condiciones controladas es desconocida. En el presente trabajo, se evaluó la producción de biomasa de la población de Real de Salinas en condiciones de laboratorio y su composición bioquímica. Los nauplios (instar I fueron sembrados a una densidad de 10/ml en unidades experimentales (tres de 1.5 l. Del día 2 al 6 del experimento, los animales fueron alimentados con salvado de arroz y del día 7 al final del ensayo (día 15 con la microalga T. suecica. La longitud total promedio de Artemia al final del ensayo fue de 5.34 mm, la producción de biomasa fue de 15.72 g/l (peso húmedo y una sobrevivencia de 79%. El análisis proximal y la composición bioquímica de la biomasa de Artemia, indicó que el porcentaje de nutrientes son adecuados para ser utilizada como alimento de peces y crustáceos.

  10. High prevalence of cestodes in Artemia spp. throughout the annual cycle: relationship with abundance of avian final hosts

    Science.gov (United States)

    Sánchez, Marta I.; Nikolov, Pavel N.; GEorgieva, Darina D.; Georgiev, Boyko B.; Vasileva, Gergana P.; Pankov, Plamen; Paracuellos, Mariano; Lafferty, Kevin D.; Green, Andy J.

    2013-01-01

    Brine shrimp, Artemia spp., act as intermediate hosts for a range of cestode species that use waterbirds as their final hosts. These parasites can have marked influences on shrimp behavior and fecundity, generating the potential for cascading effects in hypersaline food webs. We present the first comprehensive study of the temporal dynamics of cestode parasites in natural populations of brine shrimp throughout the annual cycle. Over a 12-month period, clonal Artemia parthenogenetica were sampled in the Odiel marshes in Huelva, and the sexual Artemia salina was sampled in the Salinas de Cerrillos in Almería. Throughout the year, 4–45 % of A. parthenogenetica were infected with cestodes (mean species richness = 0.26), compared to 27–72 % of A. salina (mean species richness = 0.64). Ten cestode species were recorded. Male and female A. salina showed similar levels of parasitism. The most prevalent and abundant cestodes were those infecting the most abundant final hosts, especially the Greater Flamingo Phoenicopterus ruber. In particular, the flamingo parasite Flamingolepis liguloides had a prevalence of up to 43 % in A. parthenogenetica and 63.5 % in A. salina in a given month. Although there was strong seasonal variation in prevalence, abundance, and intensity of cestode infections, seasonal changes in bird counts were weak predictors of the dynamics of cestode infections. However, infection levels of Confluaria podicipina in A. parthenogenetica were positively correlated with the number of their black-necked grebe Podiceps nigricollis hosts. Similarly, infection levels of Anomotaenia tringae and Anomotaenia microphallos in A. salina were correlated with the number of shorebird hosts present the month before. Correlated seasonal transmission structured the cestode community, leading to more multiple infections than expected by chance.

  11. High prevalence of cestodes in Artemia spp. throughout the annual cycle: relationship with abundance of avian final hosts.

    Science.gov (United States)

    Sánchez, Marta I; Nikolov, Pavel N; Georgieva, Darina D; Georgiev, Boyko B; Vasileva, Gergana P; Pankov, Plamen; Paracuellos, Mariano; Lafferty, Kevin D; Green, Andy J

    2013-05-01

    Brine shrimp, Artemia spp., act as intermediate hosts for a range of cestode species that use waterbirds as their final hosts. These parasites can have marked influences on shrimp behavior and fecundity, generating the potential for cascading effects in hypersaline food webs. We present the first comprehensive study of the temporal dynamics of cestode parasites in natural populations of brine shrimp throughout the annual cycle. Over a 12-month period, clonal Artemia parthenogenetica were sampled in the Odiel marshes in Huelva, and the sexual Artemia salina was sampled in the Salinas de Cerrillos in Almería. Throughout the year, 4-45 % of A. parthenogenetica were infected with cestodes (mean species richness = 0.26), compared to 27-72 % of A. salina (mean species richness = 0.64). Ten cestode species were recorded. Male and female A. salina showed similar levels of parasitism. The most prevalent and abundant cestodes were those infecting the most abundant final hosts, especially the Greater Flamingo Phoenicopterus ruber. In particular, the flamingo parasite Flamingolepis liguloides had a prevalence of up to 43 % in A. parthenogenetica and 63.5 % in A. salina in a given month. Although there was strong seasonal variation in prevalence, abundance, and intensity of cestode infections, seasonal changes in bird counts were weak predictors of the dynamics of cestode infections. However, infection levels of Confluaria podicipina in A. parthenogenetica were positively correlated with the number of their black-necked grebe Podiceps nigricollis hosts. Similarly, infection levels of Anomotaenia tringae and Anomotaenia microphallos in A. salina were correlated with the number of shorebird hosts present the month before. Correlated seasonal transmission structured the cestode community, leading to more multiple infections than expected by chance.

  12. Cestode parasitism in invasive and native brine shrimps (Artemia spp.) as a possible factor promoting the rapid invasion of A. franciscana in the Mediterranean region.

    Science.gov (United States)

    Georgiev, B B; Sánchez, M I; Vasileva, G P; Nikolov, P N; Green, A J

    2007-11-01

    Artemia franciscana is an invasive crustacean expanding its range in hypersaline wetlands in the Mediterranean region and replacing native Artemia parthenogenetica and Artemia salina. Native brine shrimps are known as intermediate hosts of cestodes; infected individuals exhibit changes in their behaviour and appearance, thus facilitating the parasite transmission to the avian hosts by predation. To assess whether invasive brine shrimps participate in the cestode life cycles to the same extent as the native species, we examined the natural infections in seven populations of Artemia spp. along the southern coast of Spain and Portugal: three populations of each A. franciscana and A. parthenogenetica and one population of A. salina. Ten cestode species were found in A. parthenogenetica, while only six were recorded in each of A. salina and A. franciscana. The overall infection was consistently higher in native than in invasive populations. For a particular cestode species, the prevalence or abundance was significantly higher in a native population for 54 pairwise comparisons and only higher for an invasive population for 4 pairwise comparisons. These results suggest that cestodes may influence competitive interactions between native and invasive brine shrimps, thus partly explaining the invasive success of A. franciscana.

  13. Contribución a la caracterización molecular, citogenética, morfométrica y bioquímica del camarón de salmuera artemia de cuba y sur de México

    OpenAIRE

    Tizol Correa, Rafael Antonio

    2006-01-01

    Poblaciones de Artemia de salinas tropicales de América Central y el Caribe, provenientes de ocho localidades de México [Celestún (YCE), San Crisanto (YSC), Xtampú (YX) y Chuburna (YC), en Yucatán, Laguna La Colorada en Oaxaca (OX) y Real de Salinas en Campeche (CP)] y dos sitios de Cuba [salina El Real, Camagüey (CM) y Frank País, Guantánamo (CGA)], fueron evaluadas para determinar su posición sistemática y relaciones filogenéticas. Para ello se utilizaron análisis moleculares (secuencias de...

  14. Effect of ultra-high pressure on small animals, tardigrades and Artemia

    Directory of Open Access Journals (Sweden)

    Fumihisa Ono

    2016-12-01

    Full Text Available This research shows that small animals, tardigrades (Milnesium tardigradum in tun (dehydrated state and Artemia salina cists (dried eggs can tolerate the very high hydrostatic pressure of 7.5 GPa. It was really surprising that living organisms can survive after exposure to such a high pressure. We extended these studies to the extremely high pressure of 20 GPa by using a Kawai-type octahedral anvil press. After exposure to this pressure for 30 min, the tardigrades were soaked in pure water and investigated under a microscope. Their bodies regained metabolic state and no serious injury could be seen. But they were not alive. A few of Artemia eggs went part of the way to hatching after soaked in sea water, but they never grew any further. Comparing with the case of blue-green alga, these animals are weaker under ultra-high pressure.

  15. Carotenoid fluorescence in Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Es, van M.A.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2010-01-01

    Dunaliella salina is a halotolerant green alga that is well known for its carotenoid producing capacity. The produced carotenoids are mainly stored in lipid globules. For various research purposes, such as production and extraction kinetics, we would like to determine and/or localise the carotenoid

  16. Salinas. Theory Manual Version 2.8

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Walsh, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bhardwaj, Manoj K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2009-02-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of structural systems. This manual describes the theory behind many of the constructs in Salinas. For a more detailed description of how to use Salinas , we refer the reader to Salinas, Users Notes. Many of the constructs in Salinas are pulled directly from published material. Where possible, these materials are referenced herein. However, certain functions in Salinas are specific to our implementation. We try to be far more complete in those areas. The theory manual was developed from several sources including general notes, a programmer notes manual, the user's notes and of course the material in the open literature.

  17. Laboratory scale photobioreactor for high production of microalgae Rhodomonas salina used as food for intensive copepod cultures

    DEFF Research Database (Denmark)

    Thuy, Minh Vu Thi; Jepsen, Per Meyer; Hansen, Benni Winding

    Introduction Microalgae are essential feeds for many cultured molluscs, larvae of marine fishes, crustaceans as well as other important live feeds including rotifers, Artemia and copepods (Muller-Feuga, 2000). Microalgae are grown either in open culture systems (ponds) or closed systems...... (photobioreactor - PBR). There is an increasing interest in using closed PBRs for algae cultivation since this culture system provides a better control of cultivation conditions and enables higher algae productivity. Among the marine microalgae, the cryptophyte Rhodomonas salina is one of the optimal feed...... for copepods (Støttrup and Jensen, 1990; Zhang et al., 2013). Despite the benefit of using R. salina in cultivation of copepods, to our knowledge, there is no report on the production of this microalga at industrial scale to supply sufficient food for mass production of copepods. We intend to conduct the basic...

  18. Artemia cyst production in Russia

    Science.gov (United States)

    Litvinenko, Liudmila I.; Litvinenko, Aleksandr I.; Boiko, Elena G.; Kutsanov, Kirill

    2015-11-01

    In Western Siberia (Russia) there are about 100 Artemia lakes with total area over 1 600 km2. Geographically these lakes are located between 51°-56°N and 61°-82°E. In general these lakes are shallow (depth less than 1.5 m), small or medium size (0.1 to 10 km2); they are chloride; their total salinity is from 40 to 250 g/L. The harvesting of cysts per year is only in 20-40 lakes. In Russia 550 tons of dry Artemia cysts (14%-18% of the world production) were harvested annually. This includes about 350 tons in the Altai region and 200 tons in other regions. During our regular 20-year study period the cyst harvest was: 95 tons in Kurgan; 65 tons in Omsk, 20 tons in Novosibirsk, 20 tons in Tyumen. Ways of increasing cyst harvest in Russia are considered in this article. During the last 30 years the harvest of cysts in Russia has increased from 7-20 to 500-600 tons. A significant influence of dryness of the year was found on productivity in selected lakes, but taken for all the lakes together, the relationship was not significant. The optimal salinity for productivity of cysts in the lakes was determined. Analysis of productivity of the lakes and the harvesting results showed that the stocks of cysts are underutilized by approximately 1.7 times.

  19. Adult Artemia as food for juvenile prawns

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Feeding experiments on three commercially important shrimps Penaues indicus, Metapenaeus dobsoni and M. monoceros were carried out using adult Artemia as feed. Good growth and food conversion efficiencies were recorded at 15% feeding level in all...

  20. Alkaloid presence and brine shrimp (Artemia salina) bioassay of medicinal species of eastern Nicaragua.

    Science.gov (United States)

    Coe, Felix G; Parikh, Dimpi M; Johnson, Caley A

    2010-04-01

    We used an alkaloid test and a brine shrimp bioassay to assess the bioactivity of the medicinal plants used by eastern Nicaraguan healers in traditional medicine. Ethnomedicinal uses were obtained from interviews of traditional healers. Aqueous extracts derived from 30 species of angiosperms were assayed for the presence of alkaloids and toxicity. Species tested are distributed in 30 genera and 21 families. Of the 30 species tested for alkaloids with Dragendorff's reagent, 29 contained alkaloids. Toxicological analysis was conducted using the brine shrimp lethal assay (BSLA). Biological activity using BSLA was recorded as the median lethal concentration (LC50) that kills 50% of the larvae within 24 h of contact with the aqueous plant extracts. The LC50 of the shrimp was less than 2500 microg/mL for 3 (10%) species, 2500-5000 microg/mL for 9 (30%), 5001-7500 microg/mL for 7 (23%), 7501-10000 microg/mL for 3 (10%), and greater than 10000 microg/mL for 8 (27%) of the species. The members of the orders Santales and Rubiales in general contained species with greater toxicity than any other group. Struthanthus cassythoides (Struthanthus cassythoides Millsp.(Loranthaceae)). (LC50 1574 microg/mL) and Alibertia edulis (Rich.) A. Rich. (Rubiaceae) (LC50 1741 microg/mL) were the most toxic.

  1. Toxicity testing of restorative dental materials using brine shrimp larvae (Artemia salina).

    Science.gov (United States)

    Milhem, Manar M; Al-Hiyasat, Ahmad S; Darmani, Homa

    2008-01-01

    This study investigated the effect of extracts of different composites, glass ionomer cement (GIC)s and compomers on the viability of brine shrimp larvae. Ethanolic extracts of four dental composites (Z-100; Solitaire 2; Filtek P60 and Synergy), a conventional GIC (Ketac-Fil), a resin-modified glass ionomer cement (Vitremer), two compomers (F2000; Dyract AP), and a flowable compomer (Dyract Flow) were prepared from each material. Following evaporation of the ethanol, the extracts were resuspended in distilled water, which was then used to test the effects on the viability of brine shrimp larvae. For the composites, the extract of Synergy was the least toxic (88% viability) followed by the extracts of Solitaire 2, Z100 and P60 (75%, 67.5% and 50% viability, respectively). One-way ANOVA revealed highly significant differences between the resin composite materials (pbrine shrimp larvae followed by GICs and then composites.

  2. Flavonóides e triterpenos de Baccharis pseudotenuifolia: bioatividade sobre Artemia salina

    Directory of Open Access Journals (Sweden)

    Moreira Francisco de Paula Madeira

    2003-01-01

    Full Text Available The phytochemical investigation of the chloroformic and methanolic extracts of the Baccharis pseudotenuifolia led to the isolation of triterpenes, steroids and flavonoids. From chloroformic extract were isolated oleanolic acid and alpha-spinasterol while from methanolic extract were isolated the flavonoids: hispidulin, naringenin, 3'-methoxy-luteolin, apigenin, kaempferol, eriodyctiol, aromadendrin, quercetin, 3'-methoxy-quercetin, quercetin-3-O-rhamnoside and quercetin-3-O-glucoside. The structure of these compounds were identified by IR, CG/MS, ¹H and 13C NMR spectral analysis and comparison with literature. In addition, the extracts were evaluated by means of Brine Shrimp Lethality test and the highier activity was observed in the chloroformic extract.

  3. Toxicological investigations of Aloe ferox Mill. extracts using Brine shrimp (Artemia salina L.) assay.

    Science.gov (United States)

    Abosede, Wintola Olubunmi; Sunday, Arowosegbe; Jide, Afolayan Anthony

    2015-03-01

    Cytotoxicity of the extracts of Aloe ferox using brine shrimp was evaluated. Effects of the extracts on hatchability and lethality of brine shrimps were reported in terms of minimum inhibitory concentration and LD(50) respectively. The hatching success was in the order: aqueous root extract (39.8%) >aqueous leaf (26.5%) >acetone leaf (13.7%) > ethanol leaf extracts (2.5%). Hatchability in incubations of ethanol and acetone extracts was found to be dose - dependent, with hatching success decreasing as the concentration of the extracts increased. The lethality of extracts was in the order: aqueous leaf extract (4.7%) >aqueous root extract (4.2%) >acetone leaf extract (3.5%) >ethanol root extract (2.6%) > ethanol leaf extract (1.8%) >acetone root extract (0.7%). Mean mortality of nauplii in the control was higher (6.7%) than that of all the extracts. Based on Meyer's index of toxicity, the acetone leaf extract with LD(50) >1.0mg/mL could be considered as non toxic, while the ethanol root extract (LD(50) brine shrimp. Since the extracts of A. ferox have consistently exhibited significant pharmaceutical properties in-vitro, the non-toxic extracts could further be exploited for the development of plant-based pharmaceuticals.

  4. Toxicological investigations of Aloe ferox Mill. extracts using Brine shrimp (Artemia salina L.) assay

    National Research Council Canada - National Science Library

    Abosede, Wintola Olubunmi; Sunday, Arowosegbe; Jide, Afolayan Anthony

    2015-01-01

    Cytotoxicity of the extracts of Aloe ferox using brine shrimp was evaluated. Effects of the extracts on hatchability and lethality of brine shrimps were reported in terms of minimum inhibitory concentration and LD(50) respectively...

  5. Toxicity of some bis Mannich bases and corresponding piperidinols in the brine shrimp (Artemia salina) bioassay.

    Science.gov (United States)

    Gul, H Inci; Gul, Mustafa; Erciyas, Ercin

    2003-01-01

    Some acetophenone-derived bis Mannich bases were synthesized: bis[beta-benzoylethyl]ethylamine hydrochloride (IIa), bis[beta-(p-methylbenzoyl)ethyl]ethylamine hydrochloride (IIb), bis[beta-(p-chlorobenzoyl)ethyl]ethy- lamine hydrochloride (IId), bis[(2-thienylcarbonyl)ethyl]ethylamine hydrochloride (IIe); some corresponding piperidinol derivatives: 3-benzoyl-1-ethyl-4-phenyl-4-piperidinol hydrochloride (IIIa), 1-ethyl-3-(p-methyl- benzoyl)-4-(p-methylphenyl)-4-piperidinol hydrochloride (IIIb), 1-ethyl-3-(p-methoxybenzoyl)-4-(p-methoxy- phenyl)-4-piperidinol hydrochloride (IIIc), 1-ethyl-3-(p-chlorobenzoyl)-4-(p-chlorophenyl)-4-piperidinol hydrochloride (IIId), 1-ethyl-4-(2-thienyl)-3-(2-thienylcarbonyl)-4-piperidinol hydrochloride (IIIe); and some representative quaternary piperidinols: 3-benzoyl-1-ethyl-4-hydroxy-1-methyl-4-phenylpiperidinium iodide (IIIf), 1-ethyl-4-hydroxy-1-methyl-3-(p-methylbenzoyl)-4-(p-methylphenyl)piperidinium iodide (IIIg). Toxicity was tested by the brine shrimp bioassay as an intermediate test before further in vivo animal experiments. Piperidine derivatives were found to be more potent than bis Mannich bases. Quaternary piperidine derivatives IIIf and IIIg and also non-quaternary piperidine derivatives IIIb, IIIe, IIIc and IIId were more toxic than 5-fluorouracil in brine shrimp bioassay. Except for IIe, bis Mannich bases were not effective. Quaternization and conversion of bis Mannich bases to corresponding piperidines improved the toxicity. The lipid solubility of the compounds may not affect the toxicity. From these findings the quaternary piperidine derivatives IIIf and IIIg could be used in further drug development and also for in vivo experiments.

  6. Biological screening of Annonaceous Brazilian Medicinal Plants using Artemia salina (brine shrimp test).

    Science.gov (United States)

    Santos Pimenta, L P; Pinto, G B; Takahashi, J A; e Silva, L G F; Boaventura, M A D

    2003-03-01

    Eighteen different extracts from five Annona species collected in Minas Gerais state, Brazil, were submitted to the brine shrimp lethality test in order to detect potential sources of novel cytotoxic, antitumor, pesticidal and anti-Trypanosoma cruzi compounds. All of the Annonaceous species tested showed good larvicidal activity as compared to a reference compounds and literature data.

  7. Combined toxicity of four toxicants (Cu, Cr, oil, oil dispersant) to Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Verriopoulos, G.; Moraitou-Apostolopoulou, M.; Milliou, E.

    1987-03-01

    In sea waters multicontaminant pollution appears to be the rule rather than the exception. For a realistic approach to pollution effects it is essential to estimate the combined toxicity of two or more chemicals. There is a need to understand the mechanisms of quantify the effects of multiple toxicity in order to provide responsible authorities with rational estimate of the effects of chemical mixtures. Thus the potential toxic effects of mixtures of toxicants has recently become a subject of growing scientific interest. In this paper the authors have tried to estimate the joint toxicity of some pollutants commonly found in nearshore polluted waters: two metals, copper and chromium; an oil (Tunesian crude oil zarzaitine type); and an oil dispersant (Finasol OSR-2).

  8. Toxicity Testing of Restorative Dental Materials Using Brine Shrimp Larvae (Artemia salina

    Directory of Open Access Journals (Sweden)

    Manar M. Milhem

    2008-08-01

    Full Text Available This study investigated the effect of extracts of different composites, glass ionomer cement (GICs and compomers on the viability of brine shrimp larvae. Ethanolic extracts of four dental composites (Z-100; Solitaire 2; Filtek P60 and Synergy, a conventional GIC (Ketac-Fil, a resin-modified glass ionomer cement (Vitremer, two compomers (F2000; Dyract AP, and a flowable compomer (Dyract Flow were prepared from each material. Following evaporation of the ethanol, the extracts were resuspended in distilled water, which was then used to test the effects on the viability of brine shrimp larvae. For the composites, the extract of Synergy was the least toxic (88% viability followed by the extracts of Solitaire 2, Z100 and P60 (75%, 67.5% and 50% viability, respectively. One-way ANOVA revealed highly significant differences between the resin composite materials (p<0.001. Follow-up comparison between the composite groups by Tukey's pairwise multiple-comparison test (α =0.05 showed that the extract of Synergy was significantly less toxic than the extracts of all the other materials except that of Solitaire 2. The compomers showed 100% lethality, while the percentage of viable larvae for the extracts of Ketac-Fil, and Vitremer were 32.3%, and 37.0%, respectively. One-way ANOVA revealed highly significant differences between the groups of materials (p<0.001. Follow-up comparison between the groups by Tukey's test (α = 0.05 showed that the toxic effect of the extracts of the compomers were significantly greater than that of Ketac-Fil, and Vitremer. The differences in the toxic effects of Vitremer and Ketac-Fil were not statistically significant. In conclusion, the toxicity of composite materials varied according to their chemical composition. Compomers were the most lethal materials to brine shrimp larvae followed by GICs and then composites.

  9. Organisms for Teaching: "Artemia salina": An Easily Cultured Invertebrate Ideally Suited for Ecological Studies.

    Science.gov (United States)

    Ward-Booth, Kirsty; Reiss, Michael

    1988-01-01

    This paper includes a general account of the biology of the brine shrimp, instructions on how the organism may be cultured, the results of some experiments on the ecology and population biology of the species, and some suggestions for further studies. (Author/CW)

  10. 卤虫属分类研究进展%Progress on Researches of Taxonomy on Genus Artemia

    Institute of Scientific and Technical Information of China (English)

    张伟峰; 郝浩永; 陈莉

    2008-01-01

    卤虫(Anemia)属于节肢动物门(Phylum Arthropoda),甲壳纲(Class Crustacea),鳃足亚纲(SubclassBranchiopoda),无甲目(Order Anostraca),卤虫科(Family Artemidae).世界卤虫根据生殖方式可分为两性生殖卤虫和孤雌生殖卤虫两大类.利用生殖隔离实验将世界两性卤虫分为8个种:Anemiafranciscana Kellogg、Artemia persimilis Piccinelli et Prosdoeimi、Anemia rnonica Verrill、Anemia salina Linnaeus、Artemia urmianaGünther、Anemia tunisiana Bowen et Sterling、Anemia sinica Cai和Anemia tibetiana Abatzopouios,Zhang et Sorge-loos.其中,我国发现有A.sinica和A.tibetiana两种两性卤虫.孤雌生殖卤虫统称为Artemia parthenogenetica,并在其后加上产地的地名以示区别.

  11. Evaluation of toxicity of polluted marine sediments from Bahia Salina Cruz, Mexico.

    Science.gov (United States)

    Gonzalez-Lozano, Maria Cristina; Mendez-Rodriguez, Lia C; Maeda-Martinez, Alejandro M; Murugan, Gopal; Vazquez-Botello, Alfonso

    2010-01-01

    Bahia Salina Cruz, Oaxaca, Mexico is a major center of oil and refined product distribution on the Mexican Pacific coast. From the start of oil industry operations in 1979, negative effects from discharges of treated effluents in the bay have been a constant concern for local communities. We analyzed 28 surface sediment samples obtained in June, 2002 to evaluate the level of toxicity in the littoral zone, port-harbor, and La Ventosa estuary in Bahia Salina Cruz. The extractable organic matter concentration was high (1,213 to 7,505 micro g g(-1)) in 5 of 7 stations from the port and harbor, whereas it was low in 12 of 16 stations in the littoral zone (36 to 98 micro g g(-1)). The total aromatic hydrocarbon concentration was highest (57 to 142 micro g g(-1)) in the port and harbor compared to the La Ventosa estuary and the littoral zone. Among the heavy metals analyzed, cadmium exceeded the effects range-low values associated with adverse biological effects. The geo-accumulation index of sediments was moderate to strong contamination at 5 stations in the nonlittoral and 6 stations in the littoral zone. The enrichment of lead, zinc, and cadmium at 5 stations from the littoral, port, and harbor suggest that these metals are of anthropogenic origin. Bioassay tests of elutriates of sediments on nauplii of Artemia franciscana and Artemia sp. showed that the port and harbor were more toxic than the La Ventosa estuary and the coastal zone. The Microtox test (Vibrio fischeri) did not show a similar response with the solid phase of the sediments. The results of this study indicate that the high levels of organic content and metals in the sediments of port-harbor and the La Ventosa estuary are mainly caused by anthropogenic activities.

  12. The occurrence of an exotic bisexual Artemia species, Artemia franciscana, in two coastal salterns of Shandong Province, China

    Science.gov (United States)

    Zheng, Bo; Sun, Shichun; Ma, Lin

    2004-10-01

    The alien halophilous Artemia species, Artemia franciscana, was found in Chengkou Saltern and Yangkou Saltern of Shandong Province, P.R. China. Although the indigenous parthenogenetic Artemia is detectable, the exotic species is dominant in both salterns. The cross-breeding tests between the exotic A. franciscana and 5 bisexual Artemia species were conducted. The results of hybridization and morphological observations on the exotic A. franciscana are briefly presented in this short communication.

  13. The Occurrence of an Exotic Bisexual Artemia Species, Artemia franciscana, in Two Coastal Salterns of Shandong Province, China

    Institute of Scientific and Technical Information of China (English)

    ZHENG Bo; SUN Shichun; MA Lin

    2004-01-01

    The alien halophilous Artemia species, Artemia franciscana, was found in Chengkou Saltern and Yangkou Saltern of Shandong Province, P.R. China. Although the indigenous parthenogenetic Artemia is detectable, the exotic species is dominant in both salterns. The cross-breeding tests between the exotic A. franciscana and 5 bisexual Artemia species were conducted. The results of hybridization and morphological observations on the exotic A. franciscana are briefly presented in this short communication.

  14. The case of Artemia spp. in nanoecotoxicology.

    Science.gov (United States)

    Libralato, Giovanni

    2014-10-01

    Artemia spp. is one of the most widespread saltwater organism suitable for ecotoxicity testing, but no internationally standardised methods exist. Several endpoints can be considered with Artemia spp. including short-term (24-48 h) and long-term (14 days) mortality, cysts and nauplii hatchability, biomass productivity, biomarkers' expression/inhibition and bioaccumulation on larvae as well as organisms' reproductive ability. Recently, Artemia spp. started to be used as a reference biological model in nanoecotoxicology with both inorganic and organic engineered nanomaterials (ENMs) also in combination with traditional environmental stressors looking for potential interactive effects. Criticisms were detected about the use of Artemia spp. in relation to the hatching phase, the toxicity test design, the occasional use only of reference toxicants and the way testing solution/suspensions were prepared thus potentially compromising the reliability of nanoecotoxicological results. A full list of compulsory information that must accompany Artemia nanoecotoxicity data is provided with positive feedbacks also for other toxicity bioassays. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Larval helminths in the invasive American brine shrimp Artemia franciscana throughout its annual cycle.

    Science.gov (United States)

    Georgiev, Boyko B; Angelov, Aleksandar; Vasileva, Gergana P; Sánchez, Marta I; Hortas, Francisco; Mutafchiev, Yasen; Pankov, Plamen; Green, Andy J

    2014-09-01

    One of the best examples of rapid displacement of native species by an invader is the eradication of native Artemia salina and A. parthenogenetica in the Mediterranean by the introduced American A. franciscana. Previous studies based on sampling from limited time periods suggest that the success of the American species as a competitor may be due partly to different parasite burden, since native Artemia spp. have high cestode infection rates regulating their density. The aim of this study is to test the hypothesis that the helminth infection in A. franciscana in its invasive range is low throughout its annual life cycle. Samples of A. franciscana were collected every second month from La Tapa saltern (Andalusia) during one year. Five helminth species were recorded: cestodes Flamingolepis liguloides, F. flamingo, Gynandrotaenia stammeri (all flamingo parasites), Eurycestus avoceti (a shorebird parasite) and larval spirurids of the Acuariinae (the first record of nematodes in Artemia). The overall infection rate was low, with total prevalence 5.9% and prevalence of individual parasite species between 0.2 and 3.2%. The mean abundance of helminths was 0.005-0.155 (av. 0.068), 5-13 times lower than in native congeners. Waterbird counts indicate that the low infection rates cannot be explained by lack of definitive hosts. The results are consistent with the hypothesis that helminths have no regulating effect on the invasive brine shrimp in the Mediterranean. The replacement of the native populations by the invader can be partially explained by a competition mediated by parasites/predators through a differential impact on host fitness.

  16. Functional rare males in diploid parthenogenetic Artemia.

    Science.gov (United States)

    Maccari, M; Gómez, A; Hontoria, F; Amat, F

    2013-09-01

    Functional males that are produced occasionally in some asexual taxa - called 'rare males' - raise considerable evolutionary interest, as they might be involved in the origin of new parthenogenetic lineages. Diploid parthenogenetic Artemia produce rare males, which may retain the ability to mate with females of related sexual lineages. Here, we (i) describe the frequency of male progeny in populations of diploid parthenogenetic Artemia, (ii) characterize rare males morphologically, (iii) assess their reproductive role, using cross-mating experiments with sexual females of related species from Central Asia and characterize the F1 hybrid offspring viability and (iv) confirm genetically both the identity and functionality of rare males using DNA barcoding and microsatellite loci. Our result suggests that these males may have an evolutionary role through genetic exchange with related sexual species and that diploid parthenogenetic Artemia is a good model system to investigate the evolutionary transitions between sexual species and parthenogenetic strains.

  17. Salinas - User's Notes

    Energy Technology Data Exchange (ETDEWEB)

    ALVIN,KENNETH F.; BHARDWAJ,MANOJ K.; DRIESSEN,BRIAN; REESE,GARTH M.; SEGALMAN,DANIEL J.

    1999-11-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis, required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. This document provides a users guide to the input for Salinas. Details of input specifications for the different solution types, output options, element types and parameters are included. The appendices contain detailed examples, and instructions for running the software on parallel platforms.

  18. (AJST) INSECTICIDAL ACTIVITY OF EXTRACTS DERIVED FROM ...

    African Journals Online (AJOL)

    opiyo

    of the brine shrimp Artemia salina (Leach). Antifeedant ... The pool of plants possessing insecticidal substances is enormous ... The most economically important of the natural plant ... processing and application of the product inexpensive. In.

  19. Mitochondrial genome sequences of Artemia tibetiana and Artemia urmiana: assessing molecular changes for high plateau adaptation.

    Science.gov (United States)

    Zhang, Hangxiao; Luo, Qibin; Sun, Jing; Liu, Fei; Wu, Gang; Yu, Jun; Wang, Weiwei

    2013-05-01

    Brine shrimps, Artemia (Crustacea, Anostraca), inhabit hypersaline environments and have a broad geographical distribution from sea level to high plateaus. Artemia therefore possess significant genetic diversity, which gives them their outstanding adaptability. To understand this remarkable plasticity, we sequenced the mitochondrial genomes of two Artemia tibetiana isolates from the Tibetan Plateau in China and one Artemia urmiana isolate from Lake Urmia in Iran and compared them with the genome of a low-altitude Artemia, A. franciscana. We compared the ratio of the rate of nonsynonymous (Ka) and synonymous (Ks) substitutions (Ka/Ks ratio) in the mitochondrial protein-coding gene sequences and found that atp8 had the highest Ka/Ks ratios in comparisons of A. franciscana with either A. tibetiana or A. urmiana and that atp6 had the highest Ka/Ks ratio between A. tibetiana and A. urmiana. Atp6 may have experienced strong selective pressure for high-altitude adaptation because although A. tibetiana and A. urmiana are closely related they live at different altitudes. We identified two extended termination-associated sequences and three conserved sequence blocks in the D-loop region of the mitochondrial genomes. We propose that sequence variations in the D-loop region and in the subunits of the respiratory chain complexes independently or collectively contribute to the adaptation of Artemia to different altitudes.

  20. Nonhatching Decapsulated Artemia Cysts As a Replacement to Artemia Nauplii in Juvenile and Adult Zebrafish Culture.

    Science.gov (United States)

    Tye, Marc; Rider, Dana; Duffy, Elizabeth A; Seubert, Adam; Lothert, Brogen; Schimmenti, Lisa A

    2015-12-01

    Feeding Artemia nauplii as the main nutrition source for zebrafish is a common practice for many research facilities. Culturing live feed can be time-consuming and requires additional equipment to be purchased, maintained, and cleaned. Nonhatching decapsulated Artemia cysts (decaps) are a commercially available product that can be fed directly to fish. Several other ornamental fish species have been successfully cultured using decaps. Replacing Artemia nauplii with decaps could reduce the overall time and costs associated with the operation of a zebrafish facility. The objective of this study was to determine if decaps could be a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture. Wild-type zebrafish were fed one of three dietary treatments: decaps only, nauplii only, or a standard consisting of nauplii plus a commercially prepared pellet food. Survival, growth (length and weight), and embryo production were analyzed between the treatments. Fish receiving the decap diet demonstrated a significantly higher growth and embryo production when compared to the fish receiving the nauplii-only diet. When comparing the decap fish to the standard fish, no significant difference was found in mean survival, mean weight at 90 days postfertilization, or mean embryo production. It was determined that nonhatching decapsulated Artemia cysts can be used as a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture.

  1. Continuous production of carotenoids from Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2011-01-01

    During the in situ extraction of ß-carotene from Dunaliella salina, the causal relationship between carotenoid extraction and cell death indicated that cell growth and cell death should be at equilibrium for a continuous in situ extraction process. In a flat-panel photobioreactor that was operated a

  2. The Selectivity of Milking of Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2010-01-01

    The process of the simultaneous production and extraction of carotenoids, milking, of Dunaliella salina was studied. We would like to know the selectivity of this process. Could all the carotenoids produced be extracted? And would it be possible to vary the profile of the produced carotenoids and,

  3. Continuous production of carotenoids from Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2011-01-01

    During the in situ extraction of ß-carotene from Dunaliella salina, the causal relationship between carotenoid extraction and cell death indicated that cell growth and cell death should be at equilibrium for a continuous in situ extraction process. In a flat-panel photobioreactor that was operated

  4. Prospects of Artemia culture in the coastal zone

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.

    The importance of the brine shrimp Artemia as live feed in shrimp hatcheries has been pointed out. The paper deals with the resource potential and status of cyst production in India. There is a need for setting up a Pilot Project for Artemia cyst...

  5. Cryptic microsporidian parasites differentially affect invasive and native Artemia spp.

    Science.gov (United States)

    Rode, Nicolas O; Lievens, Eva J P; Segard, Adeline; Flaven, Elodie; Jabbour-Zahab, Roula; Lenormand, Thomas

    2013-09-01

    We investigated the host specificity of two cryptic microsporidian species (Anostracospora rigaudi and Enterocytospora artemiae) infecting invasive (Artemia franciscana) and native (Artemia parthenogenetica) hosts in sympatry. Anostracospora rigaudi was on average four times more prevalent in the native host, whereas E. artemiae was three times more prevalent in the invasive host. Infection with An. rigaudi strongly reduced female reproduction in both host species, whereas infection with E. artemiae had weaker effects on female reproduction. We contrasted microsporidian prevalence in native A. franciscana populations (New World) and in both invaded and non-invaded Artemia populations (Old World). At a community level, microsporidian prevalence was twice as high in native compared with invasive hosts, due to the contrasting host-specificity of An. rigaudi and E. artemiae. At a higher biogeographical level, microsporidian prevalence in A. franciscana did not differ between the invaded populations and the native populations used for the introduction. Although E. artemiae was the only species found both in New and Old World populations, no evidence of its co-introduction with the invasive host was found in our experimental and phylogeographic tests. These results suggest that the success of A. franciscana invasion is probably due to a lower susceptibility to virulent microsporidian parasites rather than to decreased microsporidian prevalence compared with A. parthenogenetica or to lower microsporidian virulence in introduced areas.

  6. Uptake of metronidazole in Artemia at different developmental life stages.

    Science.gov (United States)

    Rodriguez, Loretta; Livengood, Elisa J; Miles, Richard D; Chapman, Frank A

    2011-06-01

    The purpose of this study was to examine the capacity of live brine shrimp Artemia spp. to accumulate metronidazole at different developmental life stages. Metronidazole is used in fish as an antiparasitic medication. An effective drug delivery method is to enrich the Artemia with metronidazole and offer them as live feed to the infected fish, usually ornamental species and other small fishes. Artemia cysts were hatched and then soaked in a metronidazole solution (0.05%) at instars 1-3 of larval development. Our findings indicated that Artemia were able to accumulate metronidazole at levels considered therapeutic to other animals and humans (25-100 mg/kg). However, the levels varied depending on the stage of larval development. Artemia accumulated the highest levels of metronidazole (137-143 mg/kg) when they started filter feeding (instar 2), whereas newly hatched Artemia (instar 1) contained the lowest level (85 mg/kg). Based on this study and a review of the literature, a new protocol recommended for enriching Artemia with metronidazole consists of soaking the Artemia in a 0.05% metronidazole solution for 3 h at room temperature. Because metronidazole is relatively insoluble in water, it must first be dissolved in warm water with continuous stirring.

  7. Use of the genus Artemia in ecotoxicity testing

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, Bruno S. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal) and Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal)]. E-mail: bruno@ufp.pt; Carvalho, Felix D. [REQUIMTE, Departamento de Toxicologia da Faculdade de Farmacia da Universidade do Porto, Rua Anibal Cunha, 164, 4050-047 Porto (Portugal); Guilhermino, Lucia M. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal); Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal); Van Stappen, Gilbert [Laboratory of Aquaculture and Artemia Reference Centre, Ghent University, Rozier 44, B-9000 Ghent (Belgium)

    2006-11-15

    Information related to varied uses of several species of the genus Artemia (commonly known as brine shrimp), is dispersed among literature from several scientific areas, such as Ecology, Physiology, Ecotoxicology, Aquaculture and Genetics. The present paper reviews information related to Artemia that may be considered relevant for ecotoxicity testing. Integration of different areas of scientific knowledge concerning biology, life cycle and environmental needs of Artemia is of crucial importance when considering the interpretation of results drawn from tests involving this genus. Furthermore, this paper provides suggestions to overcome problems related to toxicity assessment with the use of Artemia as test organism in bioassays, under the scope of estuarine, marine and hypersaline environments. Aspects related to variability in results, adoptable toxicity end-points, culture conditions, characteristics of species and strains, influence of geographical origins over physiological features and responses to exposure to chemical agents are considered. - The physiology, reproductive processes and general use of Artemia in modern ecotoxicological testing are reviewed.

  8. Porting salinas to the windows platform.

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Garth M.; Wilson, Christopher Riley

    2006-06-01

    The ASC program has enabled significant development of high end engineering applications on massively parallel machines. There is a great benefit in providing these applications on the desktop of the analysts and designers, at least insofar as the small models may be run on these platforms, thus providing a tool set that spans the application needs. This effort documents the work of porting Salinas to the WINDOWS{trademark} platform. Selection of the tools required to compile, link, test and run Salinas in this environment is discussed. Significant problems encountered along the way are listed along with an estimation of the overall cost of the port. This report may serve as a baseline for streamlining further porting activities with other ASC codes.

  9. Pedro Salinas: la letra y la persona

    Directory of Open Access Journals (Sweden)

    Escartín Gual, Montserrat

    2002-12-01

    Full Text Available This article is a Pedro Salinas's homage in the fifty anniversary of his death. Here, we analise his attitude in front of life and his securities through his poems, personal letters and essais. The poet criticizes the materialistic american stil of life, where he should live during his exile until his death (1936-1951. Against the hurry, the profitable things, the technology, the money..., Salinas believes in his language, slowness, friendship, contemplation of countryside, art, spiritualism, optimism, etc. Son of the Institución Libre de Enseñanza's ideas, his personal ethics looked for the biggest perfection trought the will.Este artículo es un homenaje a Pedro Salinas al cumplirse el cincuentenario de su muerte. En él, se analiza su actitud ante la vida y sus valores a través de sus poesías, cartas personales y ensayos. El poeta critica el materialismo del modelo americano en el que se vio obligado a vivir desde que se exilió hasta su muerte (1936-1951. Frente a la prisa, lo rentable, la tecnología, el dinero...; Salinas cree en su idioma, la lentitud, la amistad, la contemplación del paisaje, el arte, lo espiritual, el optimismo, etc. Hijo de las ideas de la Institución Libre de Enseñanza, su ética personal buscó la mayor perfección a través de la voluntad.

  10. Helminth parasites of Artemia franciscana (Crustacea: Branchiopoda) in the Great Salt Lake, Utah: first data from the native range of this invader of European wetlands.

    Science.gov (United States)

    Redon, Stella; Berthelemy, Nicole J; Mutafchiev, Yasen; Amat, Francisco; Georgiev, Boyko B; Vasileva, Gergana P

    2015-06-02

    The present study is the first survey on the role of Artemia franciscana Kellogg as intermediate host of helminth parasites in its native geographical range in North America (previous studies have recorded nine cestode and one nematode species from this host in its invasive habitats in the Western Mediterranean). Samples of Artemia franciscana were collected from four sites in the Great Salt Lake (GSL), Utah, across several months (June-September 2009). A. franciscana serves as intermediate host of five helminth species in this lake. Four of them are cestodes: three hymenolepidids, i.e. Confluaria podicipina (Szymanski, 1905) (adults parasitic in grebes), Hymenolepis (sensu lato) californicus Young, 1950 (adults parasitic in gulls), Wardium sp. (definitive host unknown, probably charadriiform birds), and one dilepidid, Fuhrmannolepis averini Spassky et Yurpalova, 1967 (adults parasitic in phalaropes). In addition, an unidentified nematode of the family Acuariidae was recorded. Confluaria podicipina is the most prevalent and abundant parasite at all sampling sites, followed by H. (s. l.) californicus. The species composition of the parasites and the spatial variations in their prevalence and abundance reflect the abundance and distribution of aquatic birds serving as their definitive hosts. The temporal dynamics of the overall helminth infections exhibits the highest prevalence in the last month of study at each site (August or September). This native population of A. franciscana from GSL is characterised with higher prevalence, intensity and abundance of the overall cestode infection compared to the introduced populations of this species in the Palaearctic Region. The values of the infection descriptors in the native population of A. franciscana are slightly lower or in some cases similar to those of the Palaearctic species Artemia parthenogenetica Barigozzi (diploid populations) and Artemia salina (Linnaeus) in their native habitats.

  11. Pedro Salinas y el teatro desde dentro (Pedro Salinas and Theatre from Within

    Directory of Open Access Journals (Sweden)

    Benítez Vega, Yolanda

    2013-12-01

    Full Text Available Resumen: Pedro Salinas y el teatro, desde dentro es el título de este artículo cuya finalidad consiste en realizar un recorrido por la vocación teatral de Pedro Salinas desde sus primeros años hasta el final de sus días: su asistencia a representaciones teatrales, sus contactos con el teatro y sus proyectos como autor dramático tanto los que se realizaron como los que no llegaron a materializarse. El propósito es adentrarnos en el alma teatral del poeta: cómo, cuándo, por qué surge su vocación por el arte escénico, insistiendo en la necesidad de rescatar la faceta de dramaturgo de Pedro Salinas como una constante más en la labor del poeta, profesor y crítico. Abstract: "Pedro Salinas and the theatre, from inside " it is the title of this article which purpose consists of realizing a tour for Pedro Salinas's theatrical vocation from his first years until the end of his days: his assistance to theatrical representations, his contacts with the theatre and his projects like dramatic author so much those who were realized as those who did not manage to materialize. The intention is to enter the theatrical soul of the poet: how, when, why his vocation arises for the scenic art, insisting on the need to rescue the playwright's facet of Pedro Salinas as one more constant in the labor of the poet, teacher and critic.

  12. Pedro Salinas y el teatro desde dentro (Pedro Salinas and Theatre from Within

    Directory of Open Access Journals (Sweden)

    Yolanda Benítez Vega

    2013-12-01

    Full Text Available Resumen: Pedro Salinas y el teatro, desde dentro” es el título de este artículo cuya finalidad consiste en realizar un recorrido por la vocación teatral de Pedro Salinas desde sus primeros años hasta el final de sus días: su asistencia a representaciones teatrales, sus contactos con el teatro y sus proyectos como autor dramático tanto los que se realizaron como los que no llegaron a materializarse. El propósito es adentrarnos en el alma teatral del poeta: cómo, cuándo, por qué surge su vocación por el arte escénico, insistiendo en la necesidad de rescatar la faceta de dramaturgo de Pedro Salinas como una constante más en la labor del poeta, profesor y crítico.Abstract: "Pedro Salinas and the theatre, from inside " it is the title of this article which purpose consists of realizing a tour for Pedro Salinas's theatrical vocation from his first years until the end of his days: his assistance to theatrical representations, his contacts with the theatre and his projects like dramatic author so much those who were realized as those who did not manage to materialize. The intention is to enter the theatrical soul of the poet: how, when, why his vocation arises for the scenic art, insisting on the need to rescue the playwright's facet of Pedro Salinas as one more constant in the labor of the poet, teacher and critic.

  13. 镰刀菌Fusarium solani菌株对卤虫Artemia salina的毒性%Toxicity of Fusarium solani Strains on Brine Shrimp (Artemia salina)

    Institute of Scientific and Technical Information of China (English)

    Shagufia Hameed; Viqar Sultana; Jehan Ara; Syed Ehteshamul-Haque; Mohammad Athar4

    2009-01-01

    寻找能杀伤肿瘤细胞而对正常细胞无毒的抗癌药物极具挑战性.具有细胞毒性的植物或者真菌可能含有抗肿瘤的化合物.卤虫无节幼体的致死性可作为筛选抗肿瘤化合物的试验.本研究运用从不同农作物种子分离的8株镰刀菌(Fusarium solani)培养滤液来测试卤虫的细胞毒性效果.结果表明,5株菌株(TS、S-29、B-17、C-10和W-5)对卤虫显示高毒性;3株菌株(SR、T-9和L-25)显示低毒性,且毒性随着培养滤液的稀释而减弱.5株菌株(TS、B-17、SR、T-9和L-25)按照1:10稀释能导致30%以上的死亡率.NaOH中和后的滤液毒性略微降低,表明培养滤液的pH值可能影响毒性.这些菌株冻干的滤液相对于未冻干的滤液毒性较低.只在3株温和毒性的菌株中得到正己烷可溶萃取物;氯仿可溶萃取物的鼍极微而不能作进一步处理.各菌株的毒性效果各小相同.从镰刀菌(F.solani)分离的化合物可开发为毒性化合物.%Discovery of anticancer drugs that must kill or disable tumor cells in the presence of normal cells without undue toxicity is an extraordinary challenge. Cytotoxicity of plant or fungal materials is considered as the presence of antitumor compounds. Brine shrimp lethality for larvae (nauplii) is used as prescreening test for the antitumor compounds. In this study, culture filtrates of eight strains of Fusarium solani isolated from seeds of various crops were tested for the toxic effect on brine shrimp. Five of the strains (TS, S-29, B-17, C-10, W-5) showed highest toxic effect and three of the strains (SR, T-9, L-25) showed low toxic activity on brine shrimp. Toxic activity reduced when culture filtrates were diluted. However, F. solani strains TS, B-17, SR, T-9 and L-25 caused more than 30% mortality at 1:10 dilution. Toxic activity was slightly reduced when the filtrates were neutralized with sodium hydroxide indicating possible role of pH of culture filtrate on toxicity. Lyophilized filtrates of these strains showed less activity as compared to un-lyophilized filtrates, n-Hexane soluble fraction was obtained only in three strains which showed mild toxicity whereas chloroform soluble fraction was obtained in negligible quantity and could not further be proceeded. Toxic effect of these strains showed variation from strain to strain. Compounds from F. solani could be exploited for the development of toxic compounds.

  14. Embryonic diapause in two species of brine shrimp: Artemia monica and Artemia franciscana

    Energy Technology Data Exchange (ETDEWEB)

    Drinkwater, L.E.

    1986-01-01

    The brine shrimp, Artemia, has the capacity to produce encysted embryos which are resistant to severe environmental conditions. Upon release from the ovisac, these embryos, or cysts, do not hatch, but remain in a state of developmental arrest imposed by some unknown endogenous mechanism. However, once the proper abiotic signal is received, the embryo is free to resume development. Regulation of this embryonic diapause in two related species of brine shrimp, Artemia franciscana and Artemia monica, is studied. The abiotic cues which terminate diapause and the possibility of a regulatory mechanism involving depressed intracellular pH (pH/sub i/) are investigated. /sup 31/P-NMR studies show that pH/sub i/ of diapause cysts of both species is alkaline, greater than or equal to 7.9, essentially the same as that of activated cysts. A franciscana, which inhabits an unpredictable environment, is activated by several cues: low temperature, dehydration, and elevated levels of CO/sub 2/. A. monica, found in a fairly stable body of water with regular seasonal changes in temperature, breaks diapause only upon exposure to low temperature. Induction of anoxybiosis in diapause and activated cysts is studied using /sup 31/P-NMR to reveal that diapause cysts acidify rapidly in response to anoxia; pH/sub i/ falls to about 7.2 in 30 minutes, much like activated cysts, indicating the presence of a fairly active metabolism. The effects of salinity on cyst activation, hatching, water content, and carbohydrate metabolism are examined.

  15. Strong environmental tolerance of Artemia under very high pressure

    Science.gov (United States)

    Minami, K.; Ono, F.; Mori, Y.; Takarabe, K.; Saigusa, M.; Matsushima, Y.; Saini, N. L.; Yamashita, M.

    2010-03-01

    It was shown by the present authors group that a tardigrade in its tun-state can survive after exposed to 7.5 GPa for 13 hours. We have extended this experiment to other tiny animals searching for lives under extreme conditions of high hydrostatic pressure. Artemia, a kind of planktons, in its dried egg-state have strong environmental tolerance. Dozens of Artemia eggs were sealed in a small Teflon capsule together with a liquid pressure medium, and exposed to the high hydrostatic pressure of 7.5 GPa. After the pressure was released, they were soaked in seawater to observe hatching rate. It was proved that 80-90% of the Artemia eggs were alive and hatched into Nauplii after exposed to the maximum pressure of 7.5 GPa for up to 48 hours. Comparing with Tardigrades, Artemia are four-times stronger against high pressure.

  16. Cyst quality and hatching in parthenogenetic brine shrimp, Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.; Ramaiah, N.

    Data on cyst size, naupliar size, biochemical constituents (carbohydrate, protein and lipid) and hatching characteristics (in relation to temperature, salinity, different glycerol concentrations and antibiotics) of Artemia collected from Balamba...

  17. Groundwater recharge on east side soils of the Salinas Valley

    Science.gov (United States)

    After four years of drought, groundwater levels in the Salinas Valley are at historically low levels which threaten to adversely affect farming in the Salinas Valley. Given the prospect of a strong El Niño this coming winter, it seems prudent to plan to capture as much of the rainfall as possible to...

  18. Réplica a Maximiliano Salinas

    OpenAIRE

    2011-01-01

    En relación con la crítica que Maximialiano Salinas hace de mi libro Misticismo e Inquisición en el virreinato peruano. Los procesos a los alumbrados de Santiago de Chile 1710-1736, debo indicar que ella deja en evidencia una actitud bastante especial de parte de su autor. En el fondo, hace caso omiso de la tesis central del libro y se limita a señalar algunas obras que se habrían omitido y a reiterar su propia interpretación del fenómeno estudiado, que había expuesto de manera sucinta h...

  19. Harvesting of Dunaliella salina by membrane filtration at pilot scale

    KAUST Repository

    Monte, Joana

    2017-09-02

    The microalgae Dunaliella salina is industrially produced due to its high content in carotenoids induced by low nitrogen and high salinity conditions. D. salina with low carotenoids content also produces other added value compounds, however its recovery have hardly been studied. This work aims to examine the potential of pre-concentrating D. salina by membrane processing prior to a final harvesting step by low-shear centrifugation. The aim is to minimize the overall energy expenditure and reduce capital costs, while assuring a minimal loss of cell integrity. This task is challenging, considering the sensitivity of D. salina to shear. Harvesting of D. salina by ultrafiltration allowed reaching a final concentration factor of 5.9, with an average permeate flux of 31 L/(m2 h). The Total Cost of Ownership and energy consumption for harvesting are respectively 52% and 45% lower when applying a two-step approach with pre-concentration (ultrafiltration) compared to only harvesting by centrifugation.

  20. Toxicity effect of silver nanoparticles in brine shrimp Artemia.

    Science.gov (United States)

    Arulvasu, Chinnasamy; Jennifer, Samou Michael; Prabhu, Durai; Chandhirasekar, Devakumar

    2014-01-01

    The present study revealed the toxic effect of silver nanoparticles (AgNPs) in Artemia nauplii and evaluated the mortality rate, hatching percentage, and genotoxic effect in Artemia nauplii/cysts. The AgNPs were commercially purchased and characterized using field emission scanning electron microscope with energy dispersive X-ray spectroscopy. Nanoparticles were spherical in nature and with size range of 30-40 nm. Artemia cysts were collected from salt pan, processed, and hatched in sea water. Artemia nauplii (II instar) were treated using silver nanoparticles of various nanomolar concentrations and LC50 value (10 nM) and mortality rate (24 and 48 hours) was evaluated. Hatching percentage of decapsulated cysts treated with AgNPs was examined. Aggregation of AgNPs in the gut region of nauplii was studied using phase contrast microscope and apoptotic cells in nauplii stained with acridine orange were observed using fluorescence microscope. DNA damage of single cell of nauplii was determined by comet assay. This study showed that as the concentration of AgNPs increased, the mortality rate, aggregation in gut region, apoptotic cells, and DNA damage increased in nauplii, whereas the percentage of hatching in Artemia cysts decreased. Thus this study revealed that the nanomolar concentrations of AgNPs have toxic effect on both Artemia nauplii and cysts.

  1. Study on the acute toxicity of Hg2+ to nauplius of Artemia Salina%Hg2+对卤虫无节幼体(Artemia Salina)的急性毒性

    Institute of Scientific and Technical Information of China (English)

    王作敏

    2004-01-01

    研究了Hg2+对卤虫无节幼体的急性毒性.试验结果表明,卤虫无节幼体在不喂食条件下死亡率对Hg2+的剂量反应关系的离散度较大,相关系数为0.813~0.894,48h-LC50值为0.006~0.016mg/L.在喂食条件下,可降低离散度,相关系数提高至0.918~0.986,死亡率和Hg2+的剂量反应关系可用线性关系描述,24h-LC50值为0.008~0.020mg/L.

  2. ASSESSMENT OF CYTOTOXIC ACTIVITY OF TWO MEDICINAL PLANTS USING BRINE SHRIMP ( ARTEMIA SALINA AS AN EXPERIMENTAL TOOL

    Directory of Open Access Journals (Sweden)

    Apurba Sarker Apu*, S. H. Bhuyan, F. Khatun, M. Sultana Liza, M. Matin, Md. Faruq Hossain

    2013-03-01

    Full Text Available ABSTRACT: Solanum sisymbriifolium (Solanaceae and Jatropha gossypifolia (Euphorbiaceae have long been used in folkloric medicine for the treatment of various ailments. The purpose of the present study was to evaluate the cytotoxic activity of the plants and to make available the process of data analysis of cytotoxic studies to the researchers. A general toxicity of the extracts was assessed by a simple and low cost assay using brine shrimp lethality as an indicator of toxicity. Ethanol crude extract and fractions of the extract of leaves of Solanum sisymbriifolium exhibited relatively mild cytotoxic activity compared to that of flowers and fruits against brine shrimp larvae with median lethal concentration, LC50 values ranging from 10.10 – 321.35 and 13.19 – 80.16 μg/ml, respectively. Methanol crude extract and fractions of the extract of leaves of Jatropha gossypifolia exhibited significant toxicity against the shrimps (LC50 values 17.19 – 98.19 μg/ml, while that of potassium permanganate, a positive control, was 11.27 μg/ml. Among the fractions of the crude extracts of both plants, non-polar fractions such as n-hexane, chloroform, dichloromethane were the most cytotoxic. These results warrant follow-up through bioassay directed isolation of the active principles.

  3. Roles and potentials of Artemia in coastal saltworks

    OpenAIRE

    Sorgeloos, P; Tackaert, W.

    1991-01-01

    The recent developments in aquaculture production of fish and shrimp have resulted in increased demands for Artemia cysts and biomass as valuable sources of life food. Solar salt works are suitable biotopes for the integrated exploitation of salt, Artemia and eventually fish or shrimp. Artemia may be present as a natural resource in local saltworks; however in some situations characteristics of the endemic strain might justify the introduction of another Artemia species to increase productivity.

  4. Biomass production of Artemia in air-water-lift raceway system

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Vijayaraghavan, S.; Krishnakumari, L.

    for the supply of Spirulina dry powder for feeding. They areals() thankful to the pirector; NIO for the facilities. . - - . - - - REFERENCES Bossuyt, E. and P. Sorgcloos, 1980. Technological aspects of batch culturing of Artemia. The brine shrimp Artemia, vol. 3.... Krishna Kumari, 1987. Adult Artemia as food for juvenile prawns. Mahasagar-Bulletin of the National Institute ofOceanog raphy,20 : 109-113. Sorgeloos, P., 1980. The use of brine shrimp in aquaculture. In : The brine shrimp Artemia, vol. 3. Ecology...

  5. Nitrate Leaching Management

    Science.gov (United States)

    Nitrate (NO3) leaching is a significant nitrogen (N) loss process for agriculture that must be managed to minimize NO3 enrichment of groundwater and surface waters. Managing NO3 leaching should involve the application of basic principles of understanding the site’s hydrologic cycle, avoiding excess ...

  6. Nitrate Leaching Index

    Science.gov (United States)

    The Nitrate Leaching Index is a rapid assessment tool that evaluates nitrate (NO3) leaching potential based on basic soil and climate information. It is the basis for many nutrient management planning efforts, but it has considerable limitations because of : 1) an oversimplification of the processes...

  7. Proyecto y plan de marketing hacia salinas 2000

    OpenAIRE

    Merlo Veintimilla, Zenaida; Pastor, Bolivar

    2009-01-01

    El presente trabajo titulado “Proyecto y Plan de Marketing Hacia Salinas 2000”, es un plan de mercadotecnia turístico, que busca cultivar una cultura turística en el cantón Salinas, con miras a reactivar la actividad turística y comercial en el balneario. Salinas representa en la actualidad uno de los balnearios más visitados por turistas nacionales en la época de invierno, llegando incluso a su saturación total, provocando el colapso de los servicios básicos y a la degradación del medio ...

  8. Regulation and function of lysine-substituted Na,K pumps in salt adaptation of Artemia franciscana.

    Science.gov (United States)

    Jorgensen, Peter Leth; Amat, Francisco

    2008-01-01

    The brine shrimp Artemia thrives at extreme conditions of up to 300 g/l salt in hypersaline lakes, but the molecular aspects of this salt adaptation are not clarified. To examine the influence of salt on the expression of two isoforms of Na,K-ATPase, adult Artemia franciscana were cultured for 39 days with the microalga Dunaliella salina as fodder at increasing salt from 30 to 280 g/l. Quantitative reverse-transcriptase polymerase chain reaction showed that the abundance of mRNA of the lysine-substituted alpha(2)(KK)-subunit was very low at 30 g/l salt but rose steeply in the range of 70-200 g/l to a level at 200-280 g/l salt, similar to the abundance of the mRNA of the alpha(1)(NN)-subunit, which was insignificantly affected by increasing salt. Site-directed mutagenesis showed that Asn324Lys and Asn776Lys in the alpha(1)-subunit of pig kidney Na,K-ATPase reduced the stoichiometry of (204)Tl binding from 2 to about 1 Tl(+)(K(+)) per alpha-subunit and Na(+)-dependent phosphorylation from ATP to 25-30%. In structure models, the epsilon-amino group of Lys776 is located at cation site 1 in the E(1)P form and near cation site 2 in the E(2) conformation, while the side chain of Lys324 points away from the cation sites. Salt-induced expression of the alpha(2)(KK)-subunit Na,K-ATPase in A. franciscana may reduce the Na(+)/ATP ratio and enable the Na,K pump to extrude Na(+) against steeper gradients and, thus, contribute to salt adaptation.

  9. Effect of different microcystin profiles on toxin bioaccumulation in common carp (Cyprinus carpio) larvae via Artemia nauplii.

    Science.gov (United States)

    El Ghazali, Issam; Saqrane, Sanaa; Carvalho, António Paulo; Ouahid, Youness; Del Campo, Francisca F; Oudra, Brahim; Vasconcelos, Vitor

    2010-07-01

    In this study, a 12-day growth trial was conducted to compare the effect of the variation in microcystin (MC) composition in two Microcystis aeruginosa bloom samples on the growth performance and MC accumulation/transfer in the common carp (Cyprinus carpio L.) larvae. Fish were fed Artemia salina nauplii that had been preexposed to extracts from two M. aeruginosa natural blooms with different microcystins (MCs) profiles. Bloom A had MC-LR as major toxin (74.05%) while bloom B had a diversity of MC (MC-RR; MC-(H4)YR; MC-YR; MC-LR; MC-FR; MC-WR) with no dominance of MC-LR. Newly-hatched Artemia nauplii were exposed separately to the two M. aeruginosa extracts A and B (100 microg L(-1)EqMC-LR) for 2h. The MC concentration in the nauplii was 73.60+/-7.88ngEqMC-LRg(-1)FW (n=4, mean+/-SE) for bloom A and 87.04+/-10.31ngEqMC-LRg(-1)FW for bloom B. These contaminated nauplii were given at the same ration to different groups (A and B) of fish larvae. Larval weight and length from day 9 were significantly different between groups A and B, and in both cases lower than that of a control group fed non-exposed nauplii. MCs accumulation by larvae, inversely correlated with the growth performance, was also significantly different between groups A and B (37.43+/-2.61 and 54.55+/-3.01ngEqMC-LRg(-1) FW, respectively, at the end of the experimental period). These results indicate that MC profile of a bloom may have differential effects on toxin accumulation/transfer and toxicity. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  10. Réplica a Maximiliano Salinas

    Directory of Open Access Journals (Sweden)

    RENÉ MILLAR C.

    2011-10-01

    Full Text Available En relación con la crítica que Maximialiano Salinas hace de mi libro Misticismo e Inquisición en el virreinato peruano. Los procesos a los alumbrados de Santiago de Chile 1710-1736, debo indicar que ella deja en evidencia una actitud bastante especial de parte de su autor. En el fondo, hace caso omiso de la tesis central del libro y se limita a señalar algunas obras que se habrían omitido y a reiterar su propia interpretación del fenómeno estudiado, que había expuesto de manera sucinta hace algún tiempo.

  11. Smart SfM: Salinas Archaeological Museum

    Science.gov (United States)

    Inzerillo, L.

    2017-08-01

    In these last years, there has been an increasing use of the Structure from Motion (SfM) techniques applied to Cultural Heritage. The accessibility of SfM software can be especially advantageous to users in non-technical fields or to those with limited resources. Thanks to SfM using, everyone can make with a digital camera a 3D model applied to an object of both Cultural Heritage, and physically Environment, and work arts, etc. One very interesting and useful application can be envisioned into museum collection digitalization. In the last years, a social experiment has been conducted involving young generation to live a social museum using their own camera to take pictures and videos. Students of university of Catania and Palermo were involved into a national event #digitalinvasion (2015-2016 editions) offering their personal contribution: they realized 3D models of the museums collection through the SfM techniques. In particular at the National Archaeological Museum Salinas in Palermo, it has been conducted an organized survey to recognize the most important part of the archaeological collection. It was a success: in both #digitalinvasion National Event 2015 and 2016 the young students of Engineering classes carried out, with Photoscan Agisoft, more than one hundred 3D models some of which realized by phone camera and some other by reflex camera and some other with compact camera too. The director of the museum has been very impressed from these results and now we are going to collaborate at a National project to use the young generation crowdsourcing to realize a semi-automated monitoring system at Salinas Archaeological Museum.

  12. SMART SfM: SALINAS ARCHAEOLOGICAL MUSEUM

    Directory of Open Access Journals (Sweden)

    L. Inzerillo

    2017-08-01

    Full Text Available In these last years, there has been an increasing use of the Structure from Motion (SfM techniques applied to Cultural Heritage. The accessibility of SfM software can be especially advantageous to users in non-technical fields or to those with limited resources. Thanks to SfM using, everyone can make with a digital camera a 3D model applied to an object of both Cultural Heritage, and physically Environment, and work arts, etc. One very interesting and useful application can be envisioned into museum collection digitalization. In the last years, a social experiment has been conducted involving young generation to live a social museum using their own camera to take pictures and videos. Students of university of Catania and Palermo were involved into a national event #digitalinvasion (2015-2016 editions offering their personal contribution: they realized 3D models of the museums collection through the SfM techniques. In particular at the National Archaeological Museum Salinas in Palermo, it has been conducted an organized survey to recognize the most important part of the archaeological collection. It was a success: in both #digitalinvasion National Event 2015 and 2016 the young students of Engineering classes carried out, with Photoscan Agisoft, more than one hundred 3D models some of which realized by phone camera and some other by reflex camera and some other with compact camera too. The director of the museum has been very impressed from these results and now we are going to collaborate at a National project to use the young generation crowdsourcing to realize a semi-automated monitoring system at Salinas Archaeological Museum.

  13. Kinetic properties and heme pocket structure of two domains of the polymeric hemoglobin of Artemia in comparison with the native molecule.

    Science.gov (United States)

    Borhani, Heshmat Akbari; Berghmans, Herald; Trashin, Stanislav; De Wael, Karolien; Fago, Angela; Moens, Luc; Habibi-Rezaei, Mehran; Dewilde, Sylvia

    2015-10-01

    In this project, we studied some physicochemical properties of two different globin domains of the polymeric hemoglobin of the brine shrimp Artemia salina and compared them with those of the native molecule. Two domains (AsHbC1D1 and AsHbC1D5) were cloned and expressed in BL21(DE3)pLysS strain of Escherichia coli. The recombinant proteins as well as the native hemoglobin (AfHb) were purified from bacteria and frozen Artemia, respectively by standard chromatographic methods and assessed by SDS-PAGE. The heme environment of these proteins was studied by optical spectroscopy and ligand-binding kinetics (e.g. CO association and O2 binding affinity) were measured for the two recombinant proteins and the native hemoglobin. This indicates that the CO association rate for AsHbC1D1 is higher than that of AsHbC1D5 and AfHb, while the calculated P50 value for AsHbC1D1 is lower than that of AsHbC1D5 and AfHb. The geminate and bimolecular rebinding parameters indicate a significant difference between both domains. Moreover, EPR results showed that the heme pocket in AfHb is in a more closed conformation than the heme pocket in myoglobin. Finally, the reduction potential of -0.13V versus the standard hydrogen electrode was determined for AfHb by direct electrochemical measurements. It is about 0.06V higher than the potential of the single domain AsHbC1D5. This work shows that each domain in the hemoglobin of Artemia has different characteristics of ligand binding.

  14. The Trail Inventory of Salinas River NWR [Cycle 2

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Salinas River National Wildlife Refuge. Trails in this inventory are...

  15. Salinas River National Wildlife Refuge: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Salinas River NWR for the next 15 years. This plan outlines the Refuge vision and...

  16. Studies on experimental culture of a marine ciliate Fabrea salina

    Digital Repository Service at National Institute of Oceanography (India)

    Rattan, R.; Ansari, Z.A.; Chatterji, A.

    Studies were conducted on the culture of a marine ciliate, Fabrea salina in the laboratory condition. Three types of inert feed; commercial yeast, fermented wheat bran and fermented rise bran were tested to study their suitability as artificial feed...

  17. Artemia biodiversity in Asia with the focus on the phylogeography of the introduced American species Artemia franciscana Kellogg, 1906.

    Science.gov (United States)

    Eimanifar, Amin; Van Stappen, Gilbert; Marden, Brad; Wink, Michael

    2014-10-01

    Asia harbors a diverse group of sexual and asexual Artemia species, including the invasive Artemia franciscana, which is native to the Americas. The phylogeny of Asian Artemia species and the phylogeography of the introduced A. franciscana from 81 sampling localities in Eurasia, Africa and America were elucidated using mitochondrial (COI) and nuclear DNA (ITS1) sequences. According to a COI phylogeny, 6 distinctive genetic groups were recognized, with a complex phylogeographic structure among Asian Artemia. A haplotype complex which includes parthenogenetic lineages is distributed in 39 inland geographical localities in Asia, illustrating a wide distribution with a narrow genetic structure on this continent. The invasive A. franciscana was discovered in 31 geographical localities along the southern and eastern coastal regions of Asia. Three sexual species (A. sinica, A. tibetiana and A. urmiana) have a restricted distribution in certain geographical localities in Asia. In contrast to COI phylogeny reconstruction, ITS1 sequences showed inconsistency with the COI tree, indicating incomplete lineage sorting which provided the low genetic divergence in the Asian clade. Asian A. franciscana showed higher haplotype diversity as compared to the source population from the Great Salt Lake (USA), which could be attributed to multiple introductions by mass dispersal in Asia via human activities. The invasive success of A. franciscana in Asia could lead to a long-term biodiversity disturbance of the autochthonous Artemia species on the continent.

  18. In vitro radical-scavenging activity, toxicity against A. salina, and nmr profiles of extracts of lichens collected from Brazil and Antarctica

    Directory of Open Access Journals (Sweden)

    Luciana M. Ravaglia

    2014-07-01

    Full Text Available Extracts of six lichen species collected from Brazil and Antarctica were investigated for their potential toxicity and radical-scavenging properties. The composition of the extracts was investigated using TLC and NMR, leading to identification of atranorin (1, along with salazinic (2, barbatic (3, α-alectoronic (4, α-collatolic (5, cryptochlorophaeic (6, caperatic (7, lobaric (8, and protolichesterinic (9 acids. All acetone extracts were evaluated for their 2,2'-diphenyl-1-picrylhydrazyl (DPPH radical scavenging ability and subjected to Artemia salina bioassay. The free-radical-scavenging activities of each extract (100 µg ranged from 8.9 ± 0.1% to 38.7 ± 2.5% and the EC50 values ranged from 0.24 ± 2.10 to 3.54 ± 0.28 mg mL-1, while the toxicity of the extracts against A. salina were low (151.0 to >600 µg mL-1.

  19. VT Nitrate Leaching Index

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) Nitrate Leaching Index data for the state of Vermont. This is a derivative product based on the SSURGO soils data for all counties except Essex...

  20. Efficiency of Artemia cysts removal as a model invasive spore using a continuous microwave system with heat recovery.

    Science.gov (United States)

    Balasubramanian, Sundar; Ortego, Jeffrey; Rusch, Kelly A; Boldor, Dorin

    2008-12-15

    A continuous microwave system to treat ballast water inoculated with Artemia salina cysts as a model invasive spore was tested for its efficacy in inactivating the cysts present. The system was tested at two different flow rates (1 and 2 L x min(-1)) and two different power levels (2.5 and 4.5 kW). Temperature profiles indicate that the system could deliver heating loads in excess of 100 degrees C in a uniform and near-instantaneous manner when using a heat recovery system. Except for a power and flow rate combination of 2.5 kW and 2 L x min(-1), complete inactivation of the cysts was observed at all combinations at holding times below 100 s. The microwave treatment was better or equal to the control treatment in inactivating the cysts. Use of heat exchangers increased the power conversion efficiency and the overall efficiency of the treatment system. Cost economics analysis indicates that in the present form of development microwave treatment costs are higher than the existing ballast water treatment methods. Overall, tests results indicated that microwave treatment of ballast water is a promising method that can be used in conjunction with other methods to form an efficient treatment system that can prevent introduction of potentially invasive spore forming species in non-native waters.

  1. Effects of the diets on growth and reproduction of Artemia sp.%饵料对卤虫生长和生殖的影响

    Institute of Scientific and Technical Information of China (English)

    张登沥; 刘其根

    2000-01-01

    The different groups of Artemia sp. were cultured using three diets of Dunaliella salina, Saccharomyces cerevisiae and wheatbran. The results showed a significant difference of growth rate among the groups of Arterra sp. (p<0.05). The group of Artemia sp. fed on wheat-bran (group W) was the fastest in growth, While the group fed on Saccharomyces cerevisiae (group S) was the poorest. It was 8 days shorter to reach sexual maturity for the group W than for the others. Besides, The effects of diets on the survival rate was also significantly different (p<0.01). Upon to sexual maturity, the group fed on D. salina (group D) attained the highest survival rate, Group S was the lowest. Further more, The differences of the reproductivity among the groups were great significant (p<0.01). The reproduction frenquency, total numbers of offspring and the average numbers of offspring at each batch of reproduction of group W (5, 320 and 64 respectively) were all higher than those of group S (1.5, 63 and 42). The Artemia sp. of group D didn't reproduce in this experiment. It could be therefore concluded that wheat-bran was the best food to culture Artemia sp. and most beneficial to both the growth of the individual Artemia sp. and the population propagation.%试验用盐藻、酵母、麸皮三种饵料培养卤虫,结果表明,卤虫生长速度的差异显著(p<0.05)。其中,麸皮组最好,其次是盐藻组,最差的是酵母组。麸皮组的卤虫提早8d达到性成熟,其体长分别是盐藻组的1.23倍、酵母组的1.27倍。三种饵料对卤虫成活率的影响差异极显著(p<0.01)。在达到性成熟时成活率最高的为盐藻组,其次为麸皮组,最差的为酵母组,其均值分别为86%、67%、27%。三种饵料对卤虫生殖的影响差异也极显著(p<0.01),麸皮组的生殖次数、生殖总量和平均每次生殖量均最高,分别为5、320、64;其次的是酵母组,分别为1.5、63、42

  2. Field culture of American strain of Artemia in India

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Pilot scale culture of Artemia was carried out in a 0.22 ha condenser unit of salt pans. Pond was fertilized with inorganic salts. The nauplii of San Francisco Bay, USA strain were inoculated. Within a period of 5 months a production of 20.6 kg dry...

  3. The brine shrimp artemia: adapted to critical life conditions.

    Science.gov (United States)

    Gajardo, Gonzalo M; Beardmore, John A

    2012-01-01

    The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological) to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry-out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst) capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to "perceive" forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity) when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity) that are able to maintain the population under suitable conditions. At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism). The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress response of

  4. Origin and Genetic Diversity of Diploid Parthenogenetic Artemia in Eurasia

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages. PMID:24376692

  5. Origin and genetic diversity of diploid parthenogenetic Artemia in Eurasia.

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages.

  6. Impact of brine acidification on hatchability, survival and reproduction of Artemia parthenogenetica and Artemia franciscana in salt ponds, Bohai Bay, China

    Science.gov (United States)

    Sui, Liying; Deng, Yuangao; Wang, Jing; Sorgeloos, Patrick; Van Stappen, Gilbert

    2014-01-01

    We studied the effect of pH (pH 5, 6, 7 and 8) on the hatching percentage, survival and reproduction of Artemia strains in Bohai Bay salt ponds. Strains included parthenogenetic Artemia from Bohai Bay (BHB), Artemia franciscana from San Francisco Bay, and A. franciscana artificially produced in salt ponds in Vietnam. The latter was included as a potential inoculum for biological management of salt ponds. The hatching percentage of cysts after 24 h and the survival rate of the tested Artemia strains were significantly reduced when exposed to a culture medium at pH 5 for 18 d ( PArtemia to 48 h acid exposure varied with developmental stage, increasing in the following order: juvenile, nauplii, pre-adult, with maximum tolerance in adults. All strains of Artemia tested could not reproduce at pH 5. At pH levels from pH 6-8, a higher pH generally resulted in a shorter brood interval and enhanced ovoviviparity. Hence, we suggest that brine acidification has a negative impact on Artemia populations in the Bohai Bay saltworks. Inoculation of Artemia with either local parthenogenetic Artemia or exotic A. franciscana should be feasible at pH 7-8.

  7. Assessment of the role of brine shrimp Artemia in white spot syndrome virus (WSSV) transmission.

    Science.gov (United States)

    Zhang, Jia-Song; Dong, Shuang-Lin; Dong, Yun-Wei; Tian, Xiang-Li; Cao, Yi-Cheng; Li, Zuo-Jia; Yan, Dong-Chun

    2010-01-01

    Challenge tests with Artemia four different development stages (nauplii, metanauplii, pseudoadults and adults) to white spot syndrome virus was carried out by immersion challenge and virus-phytoplankton adhesion route in order to asses the possibility of Artemia acting as a vector of WSSV to penaeid shrimp Litopenaeus vannamei postlarvae. The WSSV succeeded in infecting four stages Artemia, and nested-PCR detection for WSSV revealed positive results to virus-phytoplankton adhesion route. No mass mortalities were observed in penaeid shrimp postlarvae fed with WSSV-positive Artemia which exposed to WSSV by virus-phytoplankton adhesion route, whereas WSSV DNA detected in penaeid shrimp postlarvae by nested-PCR. By contrary, no WSSV-positive was detected in any animal fed with WSSV-negative Artemia. These results indicated that Artemia could serve as a vector in WSSV transmission.

  8. Binding of white spot syndrome virus to Artemia sp. cell membranes.

    Science.gov (United States)

    Feng, Shuying; Li, Guangda; Feng, Wenpo; Huang, Jie

    2013-10-01

    Using differential velocity centrifugation, cell membranes of Artemia sp. were prepared, and their binding to white spot syndrome virus (WSSV) was analyzed in vitro. The results indicated that WSSV can specifically bind to Artemia cell membranes, and that WSSV receptor very likely existed in this membrane, which suggested that Artemia sp. may be a reservoir of WSSV. This study investigated the specific WSSV binding site by performing competitive inhibition experiments using shrimp gill cell membranes to bind WSSV to Artemia cell membranes. The results showed that shrimp gill cell membranes had a distinct inhibition effect on the specific binding of Artemia cell membranes to WSSV. Thus, potentially similar WSSV receptors or binding sites existed on Artemia sp. cell membranes and shrimp gill cell membranes. Taken together, these findings may provide experimental basis for the development of an effective approach to controlling WSSV, and theoretical basis for the study of WSSV receptors.

  9. On a parthenogenetic population of Artemia (Crustacea, Branchiopoda) from Algeria (El-Bahira, Sétif)

    OpenAIRE

    Mounia Amarouayache; Naim Belakri

    2015-01-01

    The brine shrimp Artemia is a small crustacean of hypersaline lakes which is commonly used in larviculture. The parthenogenetic population of Artemia from El-Bahira Lake (10 ha area), situated in the High Plateaus of Northeastern Algeria (1034 m alt), has been characterized and surveyed during two hydroperiods of 2009 and 2013. Contrary to other known parthenogenetic populations, which develop in hot seasons and reproduce by ovoviviparity, Artemia from El-Bahira was found to develop only i...

  10. Use of decapsulated Artemia cysts in ornamental fish culture

    OpenAIRE

    L C Lim; Cho, Y.L.; Dhert, P.; Wong, C C; Nelis, H.; Sorgeloos, P

    2002-01-01

    Two series of feeding experiments were conducted to study the feasibility of using decapsulated Artemia cysts for direct feeding to ornamental fish. The first series evaluated the dietary values of the dried and the brine decapsulated Artemia cysts against two conventional live feeds, Artemia nauplii and Moina for adults and fry of the guppy, Poecilia reticulata Peters. In the second series, brine cysts were used for feeding to fry of four other important ornamental fish species, viz. platy, ...

  11. 添加碳源提高卤虫生物量和改善水质%Improving Artemia Biomass Output and Water Quality Through Carbon Supplementation

    Institute of Scientific and Technical Information of China (English)

    隋丽英; 王娇; 高美荣; 曾衍

    2015-01-01

    在零换水养殖系统中,研究不同碳源及碳氮比(C/N)对高盐水体中卤虫生物量产出、营养质量和水质的影响.实验一在正常(NF,100%)、较低(LF,60%)和极低(VLF,30%)3个杜氏盐藻(Dunaliella salina)投喂水平下,分别添加蔗糖和淀粉两种碳源,C/N为20.实验二杜氏盐藻投喂水平为 LF,分别添加蔗糖和淀粉两种碳源,C/N 分别为20和40.单位养殖水体积1,000,mL,初始卤虫密度1.5,mL-1,养殖盐度50,温度24~25,℃,养殖周期14,d.结果表明,在相同单胞藻投喂水平下,添加碳源显著提高卤虫生物量(P<0.05);水体中总氨氮(TAN)、2NO−、3NO−和总氮(TN)水平大幅度减少,pH 有所降低,黏度保持稳定;脂肪酸 C16:1n7含量有所增加,而 C20﹕5n3含量有所降低.碳源对卤虫生物量的促进作用与卤水中生物絮团的形成密切相关,这一点可由相同单胞藻投喂水平下,添加碳源显著提高卤虫生物量和降低水中氮浓度等得到证明.比较蔗糖与淀粉两种碳源,分子结构简单的蔗糖作用效果较好.提高C/N对卤虫生物量的影响不显著.%Effects of carbon sources and C/N ratio on the output and nutritional quality of Artemia biomass and water qual-ity were studied in zero-water exchange culture system. In Experiment I,microalgae Dunaliella salina were fed to Artemia at 100% normal feeding(NF),60% low feeding(LF)and 30% very low feeding(VLF)of the feeding levels,respectively. Su-crose and starch were supplemented in the culture area at a C/N ratio of 20. In Experiment Ⅱ,sucrose and starch were sup-plemented at a C/N ratio of 20,and 40,respectively,and D. salina was fed at low feeding level(LF). Artemia were cultured in 1 L brine water with an initial density of 1.5 mL-1 for 14 days;the salinity was 50 and temperature 24-25,℃. The results showed that the supplementation of sucrose and starch in culture medium significantly enhanced

  12. The swimming behavior of Artemia (Anostraca): new experimental and observational data.

    Science.gov (United States)

    Anufriieva, Elena V; Shadrin, Nickolai V

    2014-12-01

    Artemia (Anostraca) is among the most primitive and ancient groups of crustaceans. Artemia spp. play a dominant role in the ecosystems of hypersaline waters, and often they are the only animals in these extreme biotopes. Most ethological studies on Artemia have been conducted on nauplii and metanauplii. We made ethological observations on Artemia under laboratory conditions and in the natural waters of Crimea, where we studied growth and ontogenetic changes of swimming behavior. Growth occurred during the first 50 days up to a size of 9.5-10.5mm, after which time the size did not increase (some females lived up to 6.5 months). A strong positive relation was found between maximal speed and individual length, which varied between 0.4 and 10.5mm; it may be approximated by the power equation: Vmax=1.205·K(0.820), where Vmax is the maximal speed of Artemia (in mms(-1)) of the length K (in mm). There is no similar relation between average speed and length of Artemia. The average speed of adults was 40-60% lower in environments with microalgae compared to media without food. The duration of the "riding position" for mating pairs of Artemia urmiana in our experiments varied from 10 to 27 days. In lakes we observed different Artemia aggregations varying in size and form. We conclude that the swimming behavior of Artemia is quite complex and diverse, and develops during ontogeny.

  13. Bioencapsulation of metronidazole in adult brine shrimp (Artemia sp.).

    Science.gov (United States)

    Allender, Matthew C; Kastura, Mike; George, Robert; Bulman, Frank; Yarbrough, Jason; Cox, Sherry

    2011-06-01

    A description of bioencapsulation of metronidazole in adult brine shrimp (Artemia) for 2.5 g/L, 5 g/L, and 10 g/L treatment baths is presented. Metronidazole was detected in adult brine shrimp tissue after enrichment periods of 15 min, 30 min, 1 hr, 2 hr, 4 hr, 8 hr, 12 hr, and 24 hr. The assays were performed using high performance liquid chromatography. There was a positive relationship in both dose and time. When evaluating percent uptake, all three baths demonstrated a similar pattern. All three bath concentrations had a high initial concentration that fell at 30 min and slowly began to increase through the end of the study. Survival of shrimp was not affected by bath concentration but decreased over time in all treatment baths comparatively. It can be concluded that metronidazole can be successfully bioencapsulated in adult Artemia.

  14. Why join groups? Lessons from parasite-manipulated Artemia.

    Science.gov (United States)

    Rode, Nicolas O; Lievens, Eva J P; Flaven, Elodie; Segard, Adeline; Jabbour-Zahab, Roula; Sanchez, Marta I; Lenormand, Thomas

    2013-04-01

    Grouping behaviours (e.g. schooling, shoaling and swarming) are commonly explicated through adaptive hypotheses such as protection against predation, access to mates or improved foraging. However, the hypothesis that aggregation can result from manipulation by parasites to increase their transmission has never been demonstrated. We investigated this hypothesis using natural populations of two crustacean hosts (Artemia franciscana and Artemia parthenogenetica) infected with one cestode and two microsporidian parasites. We found that swarming propensity increased in cestode-infected hosts and that red colour intensity was higher in swarming compared with non-swarming infected hosts. These effects likely result in increased cestode transmission to its final avian host. Furthermore, we found that microsporidian-infected hosts had both increased swarming propensity and surfacing behaviour. Finally, we demonstrated using experimental infections that these concurrent manipulations result in increased spore transmission to new hosts. Hence, this study suggests that parasites can play a prominent role in host grouping behaviours.

  15. The brine shrimp Artemia: adapted to critical life conditions

    Directory of Open Access Journals (Sweden)

    Gonzalo M Gajardo

    2012-06-01

    Full Text Available The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to perceive forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity that are able to maintain the population under suitable conditions.At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism. The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress

  16. Understanding Environmental Factors that Affect Violence in Salinas, California

    Science.gov (United States)

    2009-12-01

    Norteños are primarily second- or third-generation Mexican- American gangsters in northern California.9 The Nuestra Familia (NF) prison gang, which... Oriented Policing Service Youth Firearms Violence Initiative. Salinas used this grant to make their anti-gang task force a full-time effort and formed a

  17. Phase toxicity of dodecane on the microalga Dunaliella salina

    NARCIS (Netherlands)

    Kleinegris, D.M.M.; Es, van M.; Janssen, M.G.J.; Brandenburg, W.A.; Wijffels, R.H.

    2011-01-01

    In the so-called milking process of Dunaliella salina carotenoids are extracted and simultaneously produced by the culture, whilst the biomass concentration remains constant. Different theories exist about the extraction mechanisms although none have been proven yet. In this research, direct contact

  18. Anaerobic biodegradation of lipids of the marine microalga Nannochloropsis salina

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Grossi, V.; Blokker, P.

    2001-01-01

    In order to determine the susceptibility to anaerobic biodegradation of the different lipid biomarkers present in a marine microalga containing algaenan, portions of one large batch of cultured Nannochloropsis salina (Eustigmatophyceae) were incubated in anoxic sediment slurries for various times. A

  19. Laboratory sulfurisation of the marine microalga Nannochloropsis salina

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Gelin, F.; Kok, M.D.; Leeuw, J.W. de

    1998-01-01

    To understand more fully the mode of preservation of organic matter in marine sediments, laboratory sulfurisation of intact cells of the cultured microalga Nannochloropsis salina was performed using inorganic polysulfides in seawater at 50°C. Solvent extractable and non-extractable materials were an

  20. Hypoosmotic shock induces a stateⅠtransition of photosynthetic apparatus in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    LIU Xiande; SHEN Yungang

    2004-01-01

    The effects of hypoosmotic shock on statetransition in darkness in Dunaliella salina were studied.When the concentration of NaCl in culture medium wasdropped from 1.5 to 0.5 mol/L abruptly, the photosyntheticrate of D. salina declined, but the respiratory rate and in-tracellular ATP content increased in the dark. The FPSⅡ/FPSⅠratio at 77 K of D. salina cells exposed to hypoosmotic shockwas higher than that of control cells, indicating that moreexcitation energy was distributed to PSⅡ in stressedD. salina cells upon illumination. A decrease in LHCⅡ pho-sphorylation level was also observed when D. salina was exposed to hypoosmotic shock. Thus a stateⅠtransition ofphotosynthetic apparatus occurs when D. salina suffershypoosmotic shock in darkness, which is supposed to berelated to an enhancement of respiration and an increase inATP content in stressed D. salina cells.

  1. Molecular phylogenetics and asexuality in the brine shrimp Artemia.

    Science.gov (United States)

    Baxevanis, Athanasios D; Kappas, Ilias; Abatzopoulos, Theodore J

    2006-09-01

    Explaining cases of long-term persistence of parthenogenesis has proven an arduous task for evolutionary biologists. Interpreting sexual-asexual interactions though has recently advanced owing to methodological design, increased taxon sampling and choice of model organisms. We inferred the phylogeny of Artemia, a halophilic branchiopod genus of sexual and parthenogenetic forms with cosmopolitan distribution, marked geographic patterns and ecological partitioning. Joint analysis of newly derived ITS1 sequences and 16S RFLP markers from global isolates indicates significant interspecific divergence as well as pronounced diversity for parthenogens, matching that of sexual ancestors. Maximum parsimony, maximum likelihood, and Bayesian methods were largely congruent in reconstructing the phylogeny of the genus. Given the current sampling, at least four independent origins of parthenogenesis are deduced. Molecular clock calibrations based on biogeographic landmarks indicate that the lineage leading to A. persimilis diverged from the common ancestor of all Artemia species between 80 and 90 MYA at the time of separation of Africa from South America, whereas parthenogenesis first appeared at least 3 MYA. Common mitochondrial DNA haplotypes delineate A. urmiana and A. tibetiana as possible maternal parents of several clonal lineages. A novel topological placement of A. franciscana as a sister clade to all Asian Artemia and parthenogenetic forms is proposed and also supported by ITS1 length and other existing data.

  2. [Composition of fat acids in three Mexican populations of Artemia franciscana from epicontinental waters].

    Science.gov (United States)

    Malpica Sánchez, Aída; Castro Barrera, Thalía; Sandoval Trujillo, Horacio; Castro Mejía, Jorge; De Lara Andrade, Ramón; Castro Mejía, Germán

    2004-03-01

    In this paper is presented the percentage of fatty acids composition of three Artemia franciscana Mexican populations of epicontinentals waters; two are from natural environments (Coahuila and San Luis Potosf) and one (Texcoco) is a culture fed with Spirulina. Determination of fatty acids composition in each population, was performed by extraction of total lipid by the soxhlet method and the fatty acids methyl esters were determined by gas chromatography. The results show that Artemia of Texcoco contains the six fatty acids recommended for the culture of fish and crustaceans (16:0; 16:1; 18:1; 18:2w6; 18:3w3 and 20:5w3); Artemia from San Luis Potosi showed the poorest content in these acids and Artemia from Coahuila, although it showed a wide profile, it lacks the linolenic acid. When comparing results among the three populations with ecological data that have been published, it can be pointed out that the environment is decisive for this crustacean; Artemia from Texcoco fed with Spirulina showed the largest variety of fatty acids; the other two populations are wild, and lives in different habitats, Artemia of Coahuila is found in waters that are rich in sulfates and Artemia of San Luis Potosf lives in evaporation saltern ponds, built with stone blocks and therefore with scarce phytoplankton growth. Both Artemia populations showed deficiencies in essential fatty acids, mainly the last one.

  3. Priming the prophenoloxidase system of Artemia franciscana by heat shock proteins protects against Vibrio campbellii challenge.

    Science.gov (United States)

    Baruah, Kartik; Ranjan, Jayant; Sorgeloos, Patrick; Macrae, Thomas H; Bossier, Peter

    2011-07-01

    Like other invertebrates, the brine shrimp Artemia franciscana relies solely on innate immunity, which by definition lacks adaptive characteristics, to combat against invading pathogens. One of the innate mechanisms is melanisation of bacteria mediated by the activation of the prophenoloxidase (proPO) system. The 70 kDa heat shock proteins (Hsp70) derived from either prokaryote (Escherichia coli) or eukaryote (Artemia), well conserved and immune-dominant molecules, protect Artemia against Vibrio campbellii. However, the molecular mechanisms by which these proteins protect Artemia against Vibrio campbellii infection are unknown. Here we demonstrated that feeding gnotobiotically grown Artemia with either Artemia Hsp70 or the E. coli Hsp70 equivalent DnaK, each overproduced in E. coli, followed by V. campbellii challenge enhanced the proPO system, at both mRNA and protein activity levels. Additionally, the Artemia fed with these proteins survived well in a Vibrio challenge assay. These results indicated that Hsp70s derived from either prokaryotic or eukaryotic sources generate protective immunity in the crustacean Artemia against V. campbellii infection by priming the proPO system. This is apparently the first in vivo report on priming activity of Hsp70 in an invertebrate.

  4. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Green, Andy J.; Figuerola, Jordi;

    2009-01-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many...

  5. Artemia (Crustacea, Anostraca in Chile: a review of basic and applied biology Artemia Crustacea, Anostraca en Chile: revisión de la biología básica y aplicada

    Directory of Open Access Journals (Sweden)

    Patricio De los Rios-Escalante

    2012-09-01

    Full Text Available The brine shrimp Artemia in Chile has been studied since the 1980s, initially on populations inhabiting shallow coastal and inland mountain ponds, and saltworks in northern and central Chile. Based on morphometric and molecular evidence, these populations were identified as A. franciscana. In the 1990s, A. persimilis was recorded from southern Patagonia, a species previously considered endemic to Argentina. Recently, two new populations of A.franciscana have been recorded, from one saline coastal pond in northern Chile and from a saltwork in central Chile. The scope for further research to increase both understanding of the strain characterization and basic population ecology descriptions of the Chilean brine shrimps and improve their conservation status is discussed. It is suggested that future studies should investigate first the management of local brine shrimp population for local aquaculture or conservation resources, other direction would be the effects of ultraviolet radiation (UVR exposition that is notoriously high in brine shrimp habitats. This last factor is very important because the UVR is an important mutagen on the genetic structure of the populations. In this scenario, it is suggest a carefully management for introduced brine shrimp populations for local aquaculture for avoid alterations in native populations that due their genetic isolation would need conservation procedures for avoid local extinctions.El camarón de salmuera o Artemia ha sido estudiado en Chile desde la década de 1980, las primeras descripciones de poblaciones fueron para lagunas someras en zonas costeras y de montana, y en salinas artificiales en la zona central y norte de Chile. Sobre la base de evidencias morfométricas y moleculares estas poblaciones fueron descritas como A. franciscana. En la década de 1990, se describió la presencia de A. persimilis en la zona sur de la Patagonia, lo cual fue una ampliación del rango de distribución significativa

  6. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca).

    Science.gov (United States)

    Muñoz, J; Green, A J; Figuerola, J; Amat, F; Rico, C

    2009-03-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many hypersaline aquatic ecosystems of other continents. Parthenogenetic Artemia lineages occur only in the Old World. Ten and five microsatellite markers were developed to characterize two populations for A. franciscana and two populations for diploid parthenogenetic Artemia, respectively. For A. franciscana the number of alleles ranged from 11 to 58 per locus, while for parthenogens the number of alleles ranged from three to 10. The levels of heterozygosity in A. franciscana and in parthenogens ranged from 0.115 to 0.976 and from 0.000 to 0.971, respectively. These microsatellite loci showed a high population assignment power, which will be useful for future studies of population genetics and invasive processes in Artemia.

  7. Effect of Artemia franciscana on the removal of nickel by bioaccumulation.

    Science.gov (United States)

    Devi, S Sujatha; Sethu, M; Priya, P Gomathi

    2014-01-01

    The present study evaluates the feasibility of using Artemia franciscana in reducing the Ni concentration of synthetic wastewater by the process of bioaccumulation. Metallothionein protein plays a key role in the uptake of nickel by Artemia. Artemia (Brine shrimp) was exposed to an initial nickel concentration of 40 mg/L. Gradual decrease of nickel was observed from 40 mg/L to 5 mg/L with a removal efficiency of 87.5%. The number of organisms were varied to determine the number for the maximum removal efficiency. Metallothionein protein in Artemia was estimated by the silver saturation method. The physical parameters such as pH were maintained in an alkaline condition of 9-10, temperature was maintained at room temperature and salinity at 30-35‰. These were found to be the optimal conditions for the survival and reduction of nickel by Artemia.

  8. Leaching From Biomass Gasification Residues

    DEFF Research Database (Denmark)

    Allegrini, Elisa; Boldrin, Alessio; Polletini, A.

    2011-01-01

    The aim of the present work is to attain an overall characterization of solid residues from biomass gasification. Besides the determination of chemical and physical properties, the work was focused on the study of leaching behaviour. Compliance and pH-dependence leaching tests coupled with geoche......The aim of the present work is to attain an overall characterization of solid residues from biomass gasification. Besides the determination of chemical and physical properties, the work was focused on the study of leaching behaviour. Compliance and pH-dependence leaching tests coupled...

  9. Longitudinal Analysis of Microbiota in Microalga Nannochloropsis salina Cultures.

    Science.gov (United States)

    Geng, Haifeng; Sale, Kenneth L; Tran-Gyamfi, Mary Bao; Lane, Todd W; Yu, Eizadora T

    2016-07-01

    Large-scale open microalgae cultivation has tremendous potential to make a significant contribution to replacing petroleum-based fuels with biofuels. Open algal cultures are unavoidably inhabited with a diversity of microbes that live on, influence, and shape the fate of these ecosystems. However, there is little understanding of the resilience and stability of the microbial communities in engineered semicontinuous algal systems. To evaluate the dynamics and resilience of the microbial communities in microalgae biofuel cultures, we conducted a longitudinal study on open systems to compare the temporal profiles of the microbiota from two multigenerational algal cohorts, which include one seeded with the microbiota from an in-house culture and the other exogenously seeded with a natural-occurring consortia of bacterial species harvested from the Pacific Ocean. From these month-long, semicontinuous open microalga Nannochloropsis salina cultures, we sequenced a time-series of 46 samples, yielding 8804 operational taxonomic units derived from 9,160,076 high-quality partial 16S rRNA sequences. We provide quantitative evidence that clearly illustrates the development of microbial community is associated with microbiota ancestry. In addition, N. salina growth phases were linked with distinct changes in microbial phylotypes. Alteromonadeles dominated the community in the N. salina exponential phase whereas Alphaproteobacteria and Flavobacteriia were more prevalent in the stationary phase. We also demonstrate that the N. salina-associated microbial community in open cultures is diverse, resilient, and dynamic in response to environmental perturbations. This knowledge has general implications for developing and testing design principles of cultivated algal systems.

  10. Leaching Test Relationships, Laboratory-to-Field Comparisons and Recommendations for Leaching Evaluation using the Leaching Environmental Assessment Framework (LEAF)

    Science.gov (United States)

    This report presents examples of the relationships between the results of laboratory leaching tests, as defined by the Leaching Environmental Assessment Framework (LEAF) or analogous international test methods, and leaching of constituents from a broad range of materials under di...

  11. Coupling leaching of sphalerite concentrate

    Institute of Scientific and Technical Information of China (English)

    彭鹏; 谢惠琴; 卢立柱

    2004-01-01

    Coupling process of sphalerite concentrate leaching in H2 SO4-HNO3 and tetrachloroethylene extracting of sulfur was investigated. Effects of leaching temperature, leaching time, mass ratio of liquid to solid and tetrachloroethylene addition on zinc leaching processes were examined separately. SEM images of sphalerite concentrate and residues were performed by using JEM-6700F field emission scanning electron microscope. The relationship between the number of recycling and extraction ratio of zinc was studied. The results indicate that 99.6 % zinc is obtained after leaching for 3 h at 85 ℃ and pressure of 0.1 MPa O2, with 20 g sphalerite concentrate in 200 mL leaching solution containing 2.0 mol/L H2SO4 and 0.2 mol/L HNO3, in the presence of 10 mL C2Cl4. The leaching time of zinc is 50% shorter than that in the common leaching. The coupling effect is distinct. The recycled C2Cl4 exerts little influence on extraction ratio of zinc.

  12. Growth and survival of Hippocampus erectus (Perry, 1810 juveniles fed on Artemia with different HUFA levels

    Directory of Open Access Journals (Sweden)

    Nicolás Vite-Garcia

    2014-03-01

    Full Text Available Survival during first months after birth is one of the bottlenecks for consolidating the seahorse farming industry. In this work, Artemia metanauplii enriched with two highly unsaturated fatty acids (HUFA rich commercial emulsions with different docosahexaenoic acid (DHA levels (63% and 14% of total lipids, a vegetable oil with no DHA, and non-enriched Artemia as control, were used to feed 5-day-old juvenile Hippocampus erectus for 60 days. Enriched Artemia had similar levels of DHA (13% and 9%, despite great differences of DHA in the emulsions, with traces of DHA in non-enriched and vegetable oil enriched Artemia. More than 20% of DHA was found in 24 h starved juveniles fed both DHA-enriched treatments, similar to values in newly born juveniles, but those fed vegetable oil enriched Artemia or non-enriched Artemia had 5% of DHA. Total lipid and protein levels were similar in juveniles from the four treatments. The n-3/n-6 ratio was almost four-fold higher in seahorses fed DHA-enriched treatments compared to juveniles fed the non-enriched treatments. Survival of seahorses only partially reflected the DHA levels: it was lower in the vegetable oil treatment, similar in the seahorses fed Artemia with higher DHA and in the control treatment, and higher in seahorses fed the HUFA-enriched Artemia with lower DHA levels, although growth was similar in the two DHA-enriched Artemia treatments. Juvenile H. erectus seahorses perform better when they have at least 20% of DHA in their tissues, and these levels can be attained with no more than 14% of DHA in emulsions, eliminating the need for more expensive emulsions with higher DHA levels.

  13. Automixis in Artemia: solving a century-old controversy.

    Science.gov (United States)

    Nougué, O; Rode, N O; Jabbour-Zahab, R; Ségard, A; Chevin, L-M; Haag, C R; Lenormand, T

    2015-12-01

    Parthenogenesis (reproduction through unfertilized eggs) encompasses a variety of reproduction modes with (automixis) or without (apomixis) meiosis. Different modes of automixis have very different genetic and evolutionary consequences but can be particularly difficult to tease apart. In this study, we propose a new method to discriminate different types of automixis from population-level genetic data. We apply this method to diploid Artemia parthenogenetica, a crustacean whose reproductive mode remains controversial despite a century of intensive cytogenetic observations. We focus on A. parthenogenetica from two western Mediterranean populations. We show that they are diploid and that markers remain heterozygous in cultures maintained up to ~36 generations in the laboratory. Moreover, parallel patterns of population-wide heterozygosity levels between the two natural populations strongly support the conclusion that diploid A. parthenogenetica reproduce by automictic parthenogenesis with central fusion and low, but nonzero recombination. This settles a century-old controversy on Artemia, and, more generally, suggests that many automictic organisms harbour steep within-chromosome gradients of heterozygosity due to a transition from clonal transmission in centromere-proximal regions to a form of inbreeding similar to self-fertilization in centromere-distal regions. Such systems therefore offer a new avenue for contrasting the genomic consequences of asexuality and inbreeding.

  14. Embryogenesis, hatching and larval development of Artemia during orbital spaceflight

    Science.gov (United States)

    Spooner, B. S.; Debell, L.; Armbrust, L.; Guikema, J. A.; Metcalf, J.; Paulsen, A.

    1994-01-01

    Developmental biology studies, using gastrula-arrested cysts of the brine shrimp Artemia franciscana, were conducted during two flights of the space shuttle Atlantis (missions STS-37 and STS-43) in 1991. Dehydrated cysts were activated, on orbit, by addition of salt water to the cysts, and then development was terminated by the addition of fixative. Development took place in 5 ml syringes, connected by tubing to activation syringes, containing salt water, and termination syringes, containing fixative. Comparison of space results with simultaneous ground control experiments showed that equivalent percentages of naupliar larvae hatched in the syringes (40%). Thus, reactivation of development, completion of embryogenesis, emergence and hatching took place, during spaceflight, without recognizable alteration in numbers of larvae produced. Post-hatching larval development was studied in experiments where development was terminated, by introduction of fixative, 2 days, 4 days, and 8 days after reinitiation of development. During spaceflight, successive larval instars or stages, interrupted by molts, occurred, generating brine shrimp at appropriate larval instars. Naupliar larvae possessed the single naupliar eye, and development of the lateral pair of adult eyes also took place in space. Transmission electron microscopy revealed extensive differentiation, including skeletal muscle and gut endoderm, as well as the eye tissues. These studies demonstrate the potential value of Artemia for developmental biology studies during spa ceflight, and show that extensive degrees of development can take place in this microgravity environment.

  15. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  16. Evaluation de l'efficacité de l'extrait éthanolique de Maytenus undata ...

    African Journals Online (AJOL)

    user

    d`étudier les activités biologiques de l`extrait ethanolique des écorces de tronc de .... sitosterol, beturin et leurs structures chimiques ont été établi (9). Ces ... Brine Schrimp portaient sur les oeufs de brine schrimp, Artemia salina. (Leach), un ...

  17. Diffusive properties of water in Artemia cysts as determined from quasi-elastic neutron scattering spectra. [Artemia shrimp

    Energy Technology Data Exchange (ETDEWEB)

    Trantham, E.C.; Rorschach, H.E.; Clegg, J.S.; Hazlewood, C.F.; Nicklow, R.M.; Wakabayashi, N.

    1984-05-01

    Results have been obtained on the quasi-elastic spectra of neutrons scattered from pure water, 20% agarose gel (hydration four grams H/sub 2/O per gram of dry solid) and cysts of the brine shrimp Artemia for hydrations between 0.10 and 1.2 grams H/sub 2/O per gram of dry solids. The spectra were interpreted using a two-component model that included contributions from the covalently bonded protons and the hydration water, and a mobile water fraction. The mobile fraction was described by a jump-diffusion correlation function for the translation motion and a simple diffusive orientational correlation function. The results for the line widths ..gamma..(Q/sup 2/) for pure water were in good agreement with previous measurements. The agarose results were consistent with NMR measurements that show a slightly reduced translational diffusion for the mobile water fraction. The Artemia results show that the translational diffusion coefficient of the mobile water fraction was greatly reduced from that of pure water. The line width was determined mainly by the rotational motion, which was also substantially reduced from the pure water value as determined from dielectric relaxation studies. The translational and rotational diffusion parameters were consistent with the NMR measurements of diffusion and relaxation. Values for the hydration fraction and the mean square thermal displacement as determined from the Q-dependence of line areas were also obtained.

  18. Leaching From Biomass Gasification Residues

    DEFF Research Database (Denmark)

    Allegrini, Elisa; Boldrin, Alessio; Polletini, A.

    2011-01-01

    The aim of the present work is to attain an overall characterization of solid residues from biomass gasification. Besides the determination of chemical and physical properties, the work was focused on the study of leaching behaviour. Compliance and pH-dependence leaching tests coupled...... with geochemical modelling were carried out both on fresh and aged samples. The results showed that the material is comparable to residues from wood combustion and the leaching behaviour was dominated by Ca-containing minerals and solid solutions. Heavy metals were detected in very low concentrations in the bulk...

  19. Optimization of photosynthesis, growth, and biochemical composition of the microalga Rhodomonas salina

    DEFF Research Database (Denmark)

    Thuy, Minh Vu Thi; Douëtte, Claire; Rayner, Thomas Allan

    2016-01-01

    The cryptophyte Rhodomonas salina is widely used as feed for copepod cultures. However, culturing conditions to obtain high-quality algae have not yet been efficiently optimized. Therefore, we aimed to develop a cultivation protocol for R. salina to optimize its nutritional value and provide tech...

  20. Increasing silver leaching rate from leaching-resistant zinc residues by thiourea leaching method with pressurized preoxidation process

    Institute of Scientific and Technical Information of China (English)

    胡天觉; 曾光明; 黄国和; 袁兴中; 李建兵

    2003-01-01

    As for the leaching-resistant zinc residues, the silver leaching rate can be over 98% through the processof pressurized preoxidation and thiourea leaching. Compared with the method of extracting the silver directly fromthe leaching-resistant zinc residues, the silver leaching rate is greatly improved. The optimum preoxidation condi-tions are: particle size range 40 - 60 μm, oxygen partial pressure 106 Pa, temperature 80 - 90 ℃, pH= 1.0, andleaching time 5 h. After pretreatment, the time of thiourea leaching silver is shortened to 1.5 h, and the thioureaconsumption is reduced greatly. The oxidation mechanism and the thiourea leaching kinetics were also explored.

  1. Comparison live adult Artemia and squid meat on the growth of Penaeid shrimp Metapenaeus dobsoni (Miers)

    Digital Repository Service at National Institute of Oceanography (India)

    Nair, S.R.S.; Achuthankutty, C.T.; Royan, J.P.

    fed with squids. The intermoult period significantly differred between the diets. It is suggested that the presently unutilised rich source of adult Artemia in salt pans and salt lakes could be used as an important ingredient in the preparation...

  2. Laboratory and field studies on an Indian strain of the brine shrimp Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.

    The Tuticorin strain of the brine shrimp @iArtemia@@ was studied under both laboratory and field conditions. Studies on the survival of the nauplii at different temperatures and salinities revealed that the nauplii preferred a salinity of 35 ppt...

  3. Biochemical studies on sphingolipids of Artemia franciscana: novel neutral glycosphingolipids.

    Science.gov (United States)

    Kojima, Hisao; Shimizu, Takemasa; Sugita, Mutsumi; Itonori, Saki; Fujita, Norihisa; Ito, Masahiro

    2011-02-01

    Neutral glycosphingolipids containing one to six sugars in their oligosaccharide chains have been isolated from cysts of the brine shrimp Artemia franciscana. The structures of these glycolipids were identified by methylation analysis, partial acid hydrolysis, gas-liquid chromatography, combined gas-liquid chromatography-mass spectrometry, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and proton nuclear magnetic resonance spectroscopy to be Glcβ1-Cer, Manβ1-4Glcβ1-Cer, Fucα1-3Manβ1-4Glcβ1-Cer, GlcNAcβ1-3Manβ1-4Glcβ1-Cer, GlcNAcα1-2Fucα1-3Manβ1-4Glcβ1-Cer, GalNAcβ1-4GlcNAcβ1-3Manβ1-4Glcβ1-Cer, GalNAcβ1-4(Fucα1-3)GlcNAcβ1-3Manβ1-4Glcβ1-Cer (CPS), and GalNAcβ1-4(GlcNAcα1-2Fucα1-3)GlcNAcβ1-3Manβ1-4Glcβ1-Cer (CHS). Two glycosphingolipids, CPS and CHS, were characterized as novel structures. Because Artemia contains a certain series of glycosphingolipids (-Fucα3Manβ4GlcβCer), which differ from the core sugar sequences reported thus far, we tentatively designated the glycosphingolipids characterized as nonarthro-series ones. Furthermore, CHS exhibited a hybrid structure of arthro-series and nonarthro-series sugar chain. Two novel glycosphingolipids were characterized from the brine shrimp Artemia franciscana; one was composed of arthrotetraose and a branching fucose attached to N-acetylglucosamine residue, and the other was composed of CPS with an additional N-acetylglucosamine residue attached to the branching fucose.

  4. Crime Trend Prediction Using Regression Models for Salinas, California

    Science.gov (United States)

    2012-06-01

    Mafia (La Eme) and Nuestra Familia (NF)” (Sureños, 2005). The original members of the gang were associated with the urban Hispanic population...Morales et al., 2008, p. 8). The Norteños are associated with the Nuestra Familia gang. The Norteños, Spanish for “Our Family,” are rumored to have... Familia in Salinas. Monterey Herald. 55 San Francisco Citizen. (2010, 22 April). Jerry Brown Takes Down: “Operation Knockout” Arrests 94 Norteños

  5. Potentials of converting microalgae into brine shrimp Artemia

    OpenAIRE

    Sorgeloos, P.

    1985-01-01

    High densities of brine shrimp Artemia can be cultured in flow-through systems using the effluent of microalgae cultures as a combined source of culture medium and food. It has been proven at the "St. Croix Artificial Upwelling Mariculture Project" that in comparison with the fast growing clam Tapes japonica, brine shrimp assure a much more efficient conversion of plant into animal biomass. It appears from the given examples that microalgae conversion into brine shrimp Artemia offers efficien...

  6. Development of transgenic zooplankton Artemia as a bioreactor to produce exogenous protein.

    Science.gov (United States)

    Chang, Shih-Hung; Lee, Ben-Chang; Chen, Yan-Da; Lee, Yin-Chou; Tsai, Huai-Jen

    2011-10-01

    Although the crustacean Artemia has been commonly used as an experimental organism and served as a live bait feed for aquaculture, gene transfer system on Artemia sp. to generate stable lines is not well developed. In this study, we optimized a condition for cyst-eletroporation and generated stable lines of transgenic A. sinica. Two expression plasmids directed by the hybrid promoters of cytomegalovirus (CMV) and medaka β-actin (Mβ) were co-electroporated on decapsulated cysts: pCMV-Mβ-GFP contained GFP reporter gene and pCMV-Mβ-ypGH contained yellowfin porgy GH (ypGH) cDNA. We examined the GFP shown in the Artemia larvae and found that the expression rate was 13.3% (3,219 out of 24,054 examined). We then chose 200 G0 founders which strongly expressed GFP to generate transgenic lines. Homozygotic strains derived from F4 generation of each transgenic line, A3 and A8, were obtained. We proved that transgenic lines A3 and A8 also harbored pCMV-Mβ-ypGH and produced recombinant ypGH with a concentration of 0.089 and 0.032 μg per 50 homozygotic nauplii, respectively. Ten live Artemia nauplii were fed daily to zebrafish larvae during 25 to 35 days of post-fertilization. The average body length gain rates of zebrafish larvae fed transgenic Artemia were 16-20% greater than those of control group, indicating the exogenous ypGH produced by transgenic Artemia is functional. Therefore, we concluded that the transgenesis on Artemia is developed, and transgenic Artemia might be highly potentially useful as a new bioreactor material for application in aquaculture and biological researches.

  7. Bacteria associated with Artemia spp. along the salinity gradient of the solar salterns at Eilat (Israel).

    Science.gov (United States)

    Tkavc, Rok; Ausec, Luka; Oren, Aharon; Gunde-Cimerman, Nina

    2011-08-01

    The crustacean genus Artemia naturally inhabits various saline and hypersaline environments and is the most frequently laboratory-hatched animal for live feed in mari- and aquaculture. Because of its high economic importance, Artemia-bacteria interactions were so far studied mostly in laboratory strains. In this study, we focused our attention on the Artemia-associated microbiota in its natural environment in the solar salterns of Eilat, Israel. We applied a culture-independent method (clone libraries) to investigate the bacterial community structure associated with Artemia in five evaporation ponds with salinities from slightly above seawater (5%) to the point of saturation (32%), in two different developmental stages: in nauplii and in the intestine of adult animals. Bacteria found in naupliar and adult stages were classified within the Proteobacteria, Bacteroidetes, Firmicutes, Actinobacteria and Cyanobacteria. The halophilic proteobacterial genera Halomonas spp. and Salinivibrio spp. dominated the Artemia microbiota in both stages in all ponds. We also analysed a clone library of entire adult animals, revealing a novel bacterial phylogenetic lineage. This is the first molecular study of bacteria associated with two developmental stages of Artemia along a salinity gradient.

  8. Determination in oocytes of the reproductive modes for the brine shrimp Artemia parthenogenetica.

    Science.gov (United States)

    Dai, Zhong-Min; Li, Ran; Dai, Li; Yang, Jin-Shu; Chen, Su; Zeng, Qing-Guo; Yang, Fan; Yang, Wei-Jun

    2011-02-01

    The brine shrimp, Artemia, reproduces either oviparously, producing encysted embryos (diapause cysts), or ovoviviparously, producing free-swimming nauplii. Environmental factors, such as photoperiod, have been applied to control the reproduction mode of Artemia, but when the determination of a reproductive mode occurs remains unknown. We analysed the differential gene expression between oocytes from oviparous and ovoviviparous Artemia reared under different photoperiods. A total of 692 qualified cDNA clones were obtained by subtractive hybridization, 327 of which matched GenBank® Nucleotide Sequence Database entries. Gene expressions of 44 cDNAs (representing 56 clones) were analysed in oocytes using real-time PCR. Among these genes, 11 (21 clones) were significantly (PArtemia oocytes that subsequently enter diapause. Remarkably, known diapause-related proteins such as ArHsp22 (Artemia heat-shock protein 22) and chitin-binding proteins are found to be already differentially expressed. Furthermore, RNAi (RNA interference) knockdown of a differentially expressed gene, polo-like kinase 1, in oocyte of ovoviviparous Artemia led to the production of white embryos rather than free-swimming nauplii. In summary, our results provide evidence at the molecular level that the reproductive mode of Artemia is already determined at the oocyte stage of their life cycle.

  9. Use of Probiotic Bacillus spp. in Rotifer (Brachionus plicatilis) and Artemia (Artemia urmiana) Enrichment: Effects on Growth and Survival of Pacific White Shrimp, Litopenaeus vannamei, Larvae.

    Science.gov (United States)

    Jamali, Hadi; Imani, Ahmad; Abdollahi, Daruosh; Roozbehfar, Reza; Isari, Amin

    2015-06-01

    This study was to evaluate the effect of a preparation of Bacillus probiotic (Bacillus licheniformis and B. subtilis, 1:1) on growth and survival rate of Pacific white shrimp, Litopenaeus vannamei larvae. The larvae were fed on Artemia urmiana nauplii and Brachionus plicatilis enriched with the probiotic preparation at 1 × 10(6) CFU mL(-1) rate. The experimental setup was completely randomized design comprised of six treatments, namely solo Artemia nauplii (A) or rotifer (R), Artemia nauplii and rotifer without any enrichment (A + R), Artemia nauplii enrichment with probiotic bacilli (Bacillus licheniformis and B. subtilis) (A + B), rotifer enrichment with probiotic bacilli (R + B) and enriched Artemia nauplii and rotifer (A + R + B). All treatments were performed in triplicate. Chemical parameters of rearing water viz. pH, salinity and temperature were 7.5-8, 30-31 ppt and 31-32 °C, respectively. Photoperiod was 16L:8D. Shrimp larvae were fed Artemia nauplii and rotifers at 5-20 and 10-40 individuals per shrimp larvae four times a day, respectively. Growth and survival rate of larvae were determined at MII, MIII, PL1, PL4, PL7 and PL10 stages. Larvae in A + R + B treatment showed the highest total length (10.89 ± 0.51 mm), weight (674 ± 73 μg) and survival rate (65% ± 3.5). Lowest total length, weight and survival rate (7.96 ± 0.63 mm, 493 ± 52 μg and 24.5 ± 2.4%, respectively) were recorded in treatment B larvae. We concluded that Bacillus probiotic can improve growth and survival rate of Pacific white shrimp larvae without conceivably undesirable effects.

  10. Mercury accumulation and its effects an Artemia franciscana

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The effects of mercury accumulation on the brine shrimp Artemia franciscona were studied by long term (1--2 months) laboratory bioassays, using mercury chloride as the contaminant and the algae, Tetraselmis suecica as the food. These experiments were part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms. This also happens on the lagoon of Aveiro, Portugal, which is partially contaminated with mercury. The first assays were conducted with concentrations of HgCl{sub 2} of the order of magnitude of those found in the waters of the lagoon of Aveiro (1.4 and 2.8 {micro}g/l). In further bioassays ranges of concentrations with observable effects have been used, from 0.02 to 1 mo. In the different assays the HgCl{sub 2} was: (a) simultaneously added to all the tanks or along the time, to evaluate the effects over different life stages (b) added directly to the tanks and then to the algae, at the same or in different quantities, to find out which was the more important pathway of contamination (c) removed from the feed stream after a certain time, to find out if detoxification would occur. The bioassays were carried out in five 100 l tanks under controlled temperature, pH, dissolved oxygen, salinity and feeding rate. Besides the content in mercury, size and number of the organisms have also been measured, as well as their content in total proteins, carbohydrates and fats.

  11. Metabolic engineering of Dunaliella salina for production of ketocarotenoids.

    Science.gov (United States)

    Anila, N; Simon, Daris P; Chandrashekar, Arun; Ravishankar, G A; Sarada, R

    2016-03-01

    Dunaliella is a commercially important marine alga producing high amount of β-carotene. The use of Dunaliella as a potential transgenic system for the production of recombinant proteins has been recently recognized. The present study reports for the first time the metabolic engineering of carotenoid biosynthesis in Dunaliella salina for ketocarotenoid production. The pathway modification included the introduction of a bkt gene from H. pluvialis encoding β-carotene ketolase (4,4'β-oxygenase) along with chloroplast targeting for the production of ketocarotenoids. The bkt under the control of Dunaliella Rubisco smaller subunit promoter along with its transit peptide sequence was introduced into the alga through standardized Agrobacterium-mediated transformation procedure. The selected transformants were confirmed using GFP and GUS expression, PCR and southern blot analysis. A notable upregulation of the endogenous hydroxylase level of transformants was observed where the BKT expression was higher in nutrient-limiting conditions. Carotenoid analysis of the transformants through HPLC and MS analysis showed the presence of astaxanthin and canthaxanthin with maximum content of 3.5 and 1.9 µg/g DW, respectively. The present study reports the feasibility of using D. salina for the production of ketocarotenoids including astaxanthin.

  12. Estudo fitoquímico e avaliação da toxicidade frente a Artemia salina e da atividade antimicrobiana de Calycorectes psidiiflorus (O. Berg Sobral, Myrtaceae

    Directory of Open Access Journals (Sweden)

    Elaine A. Domingues

    2010-03-01

    Full Text Available O estudo fitoquímico das folhas de Calycorectes psidiiflorus (O. Berg Sobral, Myrtaceae, resultou no isolamento e identificação de: sesquiterpeno [8-hidroxicalameneno (1], triterpenos [α-amirina (2a e β-amirina (2b], flavonóide [3-O-α-ramnopiranosil-7-O-bglucopiranosil canferol (3], e alcalóide [1,2,3,4-tetraidro-1-metil-β-carbolina (4]. As estruturas das substâncias isoladas foram elucidadas com base nos seus dados de RMN em comparação com os da literatura. A substância 8-hydroxicalameneno apresentou atividade antibacteriana (MIC = 7,8 µg/mL e antifúngica (MIC = 15,6 µg/mL.

  13. Further data on the production of beauvericin, enniatins and fusaproliferin and toxicity to Artemia salina by Fusarium species of Gibberella fujikuroi species complex.

    Science.gov (United States)

    Moretti, A; Mulè, G; Ritieni, A; Logrieco, A

    2007-09-15

    The knowledge of toxigenic profiles of fungal plant pathogens is of extreme importance for evaluating the potential toxicity of infected plant products. Ninety-six fungal isolates belonging to 28 species in the Gibberella fujikuroi complex were studied for the production of beauvericin, enniatins and fusaproliferin in rice cultures. Toxin production ranged from 5 to 3000 microg/g for beauvericin, 2 to 131 microg/g for enniatins, and 4 to 440 microg/g for fusaproliferin. Beauvericin was the most common metabolite produced by 16 species followed by fusaproliferin with 11 species and enniatins with 4 species. The production of beauvericin by F. bulbicola, F. denticulatum, F. lactis, F. phyllophilum, F. pseudocircinatum, and F. succisae and fusaproliferin by F. antophilum, F. begoniae, F. bulbicola, F. circinatum, F. concentricum, F. succisae, and F. udum is reported here for the first time. Brine shrimp larvae were most sensitive to culture extracts of F. acutatum (up to 94+/-3%), F. concentricum (up to 99+/-1%), F. denticuatum (up to 100%) and F. sacchari (up to 100%). Toxicity towards brine shrimp was significantly correlated with the beauvericin content of the fungal extracts with few exceptions. These data indicate that beauvericin and fusaproliferin are common metabolites of species of the G. fujikuroi complex and pose a risk for a possible toxin accumulation in their respective host plant products. However, data from the brine shrimp bioassay showed that further toxic metabolites within this complex need to be characterized.

  14. Relaciones entre biomasa, tasa de crecimiento, respiración y respiración potencial en el crustáceo "Artemia salina"

    OpenAIRE

    Martínez, I. (Izaskun)

    2007-01-01

    Programa de Doctorado en Oceanografía [ES] El metabolismo respiratorio y la biomasa del zooplancton son parámetros clave para el entendimiento del flujo de energía, abundancia de la población, estructura de la comunidad, así como otras variables de comunidades planctónicas marinas. La actividad respiratoria del transporte de electrones del zooplancton (ETS) mide la respiración potencial (Ф) y es una aproximación para el consumo de oxígeno en la respiración y la biomasa. No e...

  15. Acute toxicity impacts of Euphorbia hirta L extract on behavior, organs body weight index and histopathology of organs of the mice and Artemia salina

    Directory of Open Access Journals (Sweden)

    Mohammad Abu Basma Rajeh

    2012-01-01

    Full Text Available Background: The methanol extract of Euphorbia hirta L (Euphorbiaceae, which is used in traditional medicines, was tested for in vivo toxicity. Materials and Methods: In vivo brine shrimp lethality assay and oral acute toxicity study at single high dose of 5000 mg/kg and observation for 14 days in mice were used to study the toxic effect of E. hirta. Results: Brine shrimp lethality assay was used to calculate the median lethal concentration (LC 50 of E. hirta (for leaves, stems, flowers and roots methanolic extracts at concentrations from 100 to 0.07 mg/ml. The LC 50 values of 1.589, 1.420, 0.206 and 0.0827 mg/ml were obtained for stems, leaves, flowers and roots, respectively. Potassium dichromate (the positive control had LC 50 value of 0.00758 mg/ml. The acute oral toxicity study of the leaf extract resulted in one third mortality and mild behavioral changes among the treated mice. No significant statistical differences found between body weight, relative (% and absolute (g organ weights of treated and untreated groups (P> 0.05. Gross and microscopic examination of the vital organ tissues revealed no differences between control and treated mice. All the tissues appeared normal. Conclusions : E. hirta leaves methanol extract has exhibited mild toxic effects in mice.

  16. Antioxidant status of Penaeus monodon fed with Dunaliella salina supplemented diet and resistance against WSSV

    Directory of Open Access Journals (Sweden)

    M. MADHUMATHI

    2011-10-01

    Full Text Available The present study investigates the protection of shrimp Penaeus monodon against white spot syndrome virus (WSSV using Dunaliella salina algal cells which contains an antioxidant betacarotene for the shrimp nonspecific immunity. To determine the antioxidant activity, the shrimp were treated in vivo (orally with feed methods at the concentration of 0.5 %, 1.0 % and 2 % D. salina incorporated with pellet feed, respectively. In the present study, anti-WSSV activity of D. salina incorporated diet by in vivo methods showed strongantioxidant activity and the immunological parameters such as proPO, SOD,catalase were higher in the WSSVinfected shrimp treated with D. salina incorporated diet when compared to control groups. These results strongly indicate that in vivo of D. salina incorporated diet enhances immunity of the shrimp. Based on the present data and the advantages of harvesting D. salina at low price, we believe that oral administration of D. salina live cells along with the pellet feed is a potential prophylactic agent against WSSV infection of shrimp tosome extent.

  17. Acute toxicity of Chattonella Marina on Artemia Sinica%海洋卡盾藻对卤虫的急性毒性效应

    Institute of Scientific and Technical Information of China (English)

    徐艳红; 江涛; 沈萍萍; 王锐; 吴霓; 江天久

    2012-01-01

    研究了海洋卡盾藻在不同生长阶段和不同密度下对卤虫的急性毒性效应.结果表明,海洋卡盾藻的含藻培养液和除藻过滤液均对卤虫有致死作用,且前者毒性大于后者.对数生长初期的海洋卡盾藻含藻培养液的毒性作用最强,卤虫暴露在3.0×104 cells/mL藻液48h后,死亡率达到83%;对数生长后期海洋卡盾藻含藻培养液也具有较强的毒性,48 h卤虫死亡率为73%;衰亡期含藻培养液毒性最弱,48 h卤虫死亡率为33%.海洋卡盾藻含藻培养液和除藻过滤液(对数生长期,10 d)的浓度对数与卤虫的死亡机率单位呈线性关系,含藻培养液对卤虫24h半致死浓度(LD50)为1.92×104cells/mL,而除藻过滤液对卤虫的24 h LD50为3.34×104cells/mL.卤虫在海洋卡盾藻含藻培养液中的暴露时间(48 h内)与死亡率呈线性相关关系,在藻密度为3.75×104cells/mL时,海洋卡盾藻含藻培养液对卤虫的半致死时间(LT50)为17.3 h.%The acute toxicity of Chattonella marina at different growth phases and concentrations on Artemia Sinica was investigated in the present study. The results showed that the maximum toxicity of C. marina on A. salina appeared at the early stage of logarithmic phase, and the death rate of A. sinica reached 83% after 48 h when it was exposed to the algae cell suspension at density of 3. 0 x 104 cells/ mL. The lowest toxicity of C. marina on A. sinica appeared in the decline phase with death rate of 33% . Interestingly, the filtered cell-free cultures of Chattonella marina were also toxic to A. sinica, but less toxic than the cell-suspended cultures. The probit mortality of A. salina was closely correlated to the log dose of cell-suspended and cell-free culture of C. marina (10 d). The 24 - h LD50 of the cell suspension and cell-free culture of C. marina was 1. 92 x 10 and 3. 34 x 10 cells/mL, respectively. The probit mortality of A. salina was also correlated with time and the LT50 of A. salina

  18. Nutritional Content of Artemia sp. Fed with Chaetoceros calcitrans and Skeletonema costatum

    Directory of Open Access Journals (Sweden)

    VIVI ENDAR HERAWATI

    2014-12-01

    Full Text Available Artemia sp. is a natural food with high protein content, especially amino acid. Nowadays, Indonesia still relies on import for its supply. Hence, the utilization of local Artemia sp. as an alternative to the imported product is recommended as it contains more protein and less expensive. The advantages of local Artemia sp. is its better crystal quality as it is still fresh. It also provides better income for salt farmers because waste water from salt farm can be used to culture Artemia sp.. This research is aimed at determining the quality of locally-produced Artemia sp., by evaluation of its essential amino acid and fatty acid profiles after treatments. Our results indicated that Artemia sp. cysts with good quality were produced after 8 hours and Artemia sp. reaches a hatching rate of 1,320,000 cysts (95% after 27 hours. We also found an indication that the best feed concentration was a mix of 60% Chaetoceros calcitrans with 40% Skeletonema costatum. Fatty acid profile analyses showed that the highest SAFA (12.86% and PUFA (29.91% were gained after feeding with Chaetoceros calcitrans, whereas the highest HUFA (4.93% was gained after feeding with Skeletonemacostatum. Essential amino acid profile analyses revealed the highest content of amino acid (18912.62 ppm was after feeding with a combination of Chaetoceros calcitrans and Skeletonema costatum. Finally, the proper water quality during research was at 25-30 oC of temperature, 30-31 ppt of salinity, pH 7.8-8.9, and DO was at 3.0-4.4 mg/L.

  19. Salinas - An implicit finite element structural dynamics code developed for massively parallel platforms

    Energy Technology Data Exchange (ETDEWEB)

    BHARDWAJ, MANLJ K.; REESE,GARTH M.; DRIESSEN,BRIAN; ALVIN,KENNETH F.; DAY,DAVID M.

    2000-04-06

    As computational needs for structural finite element analysis increase, a robust implicit structural dynamics code is needed which can handle millions of degrees of freedom in the model and produce results with quick turn around time. A parallel code is needed to avoid limitations of serial platforms. Salinas is an implicit structural dynamics code specifically designed for massively parallel platforms. It computes the structural response of very large complex structures and provides solutions faster than any existing serial machine. This paper gives a current status of Salinas and uses demonstration problems to show Salinas' performance.

  20. Continuous flocculation-sedimentation for harvesting Nannochloropsis salina biomass.

    Science.gov (United States)

    Chatsungnoen, Tawan; Chisti, Yusuf

    2016-03-20

    A continuous flow process is developed for recovery of the biomass of the marine microalga Nannochloropsis salina. Flocculation-sedimentation is used to recover the biomass from an algal suspension with an initial dry biomass concentration of 0.5 g L(-1), as would be typical of a raceway-based biomass production system. More than 85% of the biomass initially in suspension could be settled by gravity in a flocculation-sedimentation device with a total residence time of ∼148 min. Aluminum sulfate was used as an inexpensive, readily available and safe flocculant. The optimal flocculant dosage (as Al2(SO4)3) was 229 mg L(-1). Relative to a highly effective 62-min batch flocculation-sedimentation process for the same alga and flocculant, the continuous flow operation took longer and required nearly double the flocculant dose. The design of the flocculation-sedimentation system is explained.

  1. Cultivation of Nannochloropsis salina in municipal wastewater or digester centrate.

    Science.gov (United States)

    Dong, Bingfeng; Ho, Nam; Ogden, Kimberly L; Arnold, Robert G

    2014-05-01

    Meaningful use of biofuels for transportation depends on utilization of water from non-traditional, non-potable resources. Here it is hypothesized that (i) reclaimed wastewater or nutrient-rich side streams derived from municipal wastewater treatment are suitable for that purpose and (ii) use of those waters for algal growth can promote water quality through nutrient management. Experiments showed that metals levels in municipal wastewaters are unlikely to inhibit algal growth and lipid production, at least by metals tolerant microalgae like Nannochloropsis salina. Cells grew without inhibition in treated municipal wastewater or centrate derived from wastewater treatment at additions up to 75 percent v/v in their normal growth medium minus nitrogen and phosphorus. Although wastewater provides a suitable nutrient source for algal growth, not enough municipal wastewater is available to support a meaningful biofuels industry without efficient water recycling and nutrient recovery/reuse from spent algae. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Zinc leaching from tire crumb rubber.

    Science.gov (United States)

    Rhodes, Emily P; Ren, Zhiyong; Mays, David C

    2012-12-04

    Because tires contain approximately 1-2% zinc by weight, zinc leaching is an environmental concern associated with civil engineering applications of tire crumb rubber. An assessment of zinc leaching data from 14 studies in the published literature indicates that increasing zinc leaching is associated with lower pH and longer leaching times, but the data display a wide range of zinc concentrations, and do not address the effect of crumb rubber size or the dynamics of zinc leaching during flow through porous crumb rubber. The present study was undertaken to investigate the effect of crumb rubber size using the synthetic precipitation leaching procedure (SPLP), the effect of exposure time using quiescent batch leaching tests, and the dynamics of zinc leaching using column tests. Results indicate that zinc leaching from tire crumb rubber increases with smaller crumb rubber and longer exposure time. Results from SPLP and quiescent batch leaching tests are interpreted with a single-parameter leaching model that predicts a constant rate of zinc leaching up to 96 h. Breakthrough curves from column tests displayed an initial pulse of elevated zinc concentration (~3 mg/L) before settling down to a steady-state value (~0.2 mg/L), and were modeled with the software package HYDRUS-1D. Washing crumb rubber reduces this initial pulse but does not change the steady-state value. No leaching experiment significantly reduced the reservoir of zinc in the crumb rubber.

  3. Artemia parthenogenetica (Branchiopoda: Anostraca) from the Large Aral Sea: Abundance, distribution, population structure and cyst production

    Science.gov (United States)

    Arashkevich, Elena G.; Sapozhnikov, P. V.; Soloviov, K. A.; Kudyshkin, T. V.; Zavialov, P. O.

    2009-03-01

    The brine shrimp Artemia parthenogenetica appeared in the Large Aral Sea (Central Asia) in 1998 when mineralization reached 63 ppt. Data on Artemia abundance and biomass, along with temperature and salinity measurements were collected in the western basin during 2002-2006, primarily in the autumn. During the study period, population density grew progressively, both in terms of number, from 250 to 1260 individuals per m 3, and in terms of biomass, from 0.3 to 1.3 g per m 3. In 2005, the population density and spatial distribution in the different parts of the sea (western and eastern basins and strait) was assessed. The horizontal distribution of the Artemia population was uniform in the deep central part of the western basin, although the distribution was quite patchy in the shallow coastal zone. Depth habitat of Artemia was restricted to the upper 20-25 m of depth, as the oxygen depletion and formation of anoxic layer prevented distribution of Artemia to the deeper waters. In autumn, all females reproduced oviparously, with an average clutch size of 30-35 eggs per female. The number of eggs in a clutch was positively correlated with female body length ( r2 = 0.36-0.44).

  4. Assessment of the production potential of an emerging Artemia population in the Aral Sea, Uzbekistan

    Science.gov (United States)

    Marden, Brad; Van Stappen, Gilbert; Musaev, Ablatdyin; Mirabdullayev, Iskandar; Joldasova, Iliya; Sorgeloos, Patrick

    2012-04-01

    The objective of this study was to provide information on the developing parthenogenetic Artemia population in the Uzbek part of the Aral Sea, and to assess its potential for commercial exploitation. A sampling campaign was designed for abiotic factors (temperature, salinity, transparency) and Artemia population parameters at least once monthly in the period March-October of the years 2005-2007. By 2007 salinity in both basins had increased to values above 100 g l - 1 . Moreover, by 2007, desiccation had rendered the eastern Aral basin practically inaccessible for sampling or cyst harvesting. The volume of the western basin remained considerable, given its depth, with a relatively accessible shoreline. Average Artemia population parameters (e.g. adult abundance Artemia sites of commercial importance. A gradual gain in population size in the western basin was observed over the period 2005-2007. The data further suggest that the low Artemia productivity is not genetically determined, but is largely the result of food limitation. The western basin may approach the threshold where a small-scale commercial operation is justified.

  5. Functional differentiation of small heat shock proteins in diapause-destined Artemia embryos.

    Science.gov (United States)

    King, Allison M; Toxopeus, Jantina; MacRae, Thomas H

    2013-10-01

    Encysted embryos of Artemia franciscana cease development and enter diapause, a state of metabolic suppression and enhanced stress tolerance. The development of diapause-destined Artemia embryos is characterized by the coordinated synthesis of the small heat shock proteins (sHsps) p26, ArHsp21 and ArHsp22, with the latter being stress inducible in adults. The amounts of sHsp mRNA and protein varied in Artemia cysts, suggesting transcriptional and translational regulation. By contrast to p26, knockdown of ArHsp21 by RNA interference had no effect on embryo development. ArHsp21 provided limited protection against stressors such as desiccation and freezing but not heat. ArHsp21 may have a non-essential or unidentified role in cysts. Injection of Artemia adults with amounts of ArHsp22 double-stranded RNA less than those used for other sHsps killed females and males, curtailing the analysis of ArHsp22 function in developing embryos and cysts. The results indicate that diapause-destined Artemia embryos synthesize varying amounts of sHsps as a result of differential gene expression and mRNA translation and also suggest that these sHsps have distinctive functions.

  6. Stress tolerance during diapause and quiescence of the brine shrimp, Artemia.

    Science.gov (United States)

    MacRae, Thomas H

    2016-01-01

    Oviparously developing embryos of the brine shrimp, Artemia, arrest at gastrulation and are released from females as cysts before entering diapause, a state of dormancy and stress tolerance. Diapause is terminated by an external signal, and growth resumes if conditions are permissible. However, if circumstances are unfavorable, cysts enter quiescence, a dormant stage that continues as long as adverse conditions persist. Artemia embryos in diapause and quiescence are remarkably resistant to environmental and physiological stressors, withstanding desiccation, cold, heat, oxidation, ultraviolet radiation, and years of anoxia at ambient temperature when fully hydrated. Cysts have adapted to stress in several ways; they are surrounded by a rigid cell wall impermeable to most chemical compounds and which functions as a shield against ultraviolet radiation. Artemia cysts contain large amounts of trehalose, a non-reducing sugar thought to preserve membranes and proteins during desiccation by replacing water molecules and/or contributing to vitrification. Late embryogenesis abundant proteins similar to those in seeds and other anhydrobiotic organisms are found in cysts, and they safeguard cell organelles and proteins during desiccation. Artemia cysts contain abundant amounts of p26, a small heat shock protein, and artemin, a ferritin homologue, both ATP-independent molecular chaperones important in stress tolerance. The evidence provided in this review supports the conclusion that it is the interplay of these protective elements that make Artemia one of the most stress tolerant of all metazoan organisms.

  7. Brine shrimp Artemia in coastal saltworks: inexpensive source of food for vertically integrated aquaculture

    OpenAIRE

    Sorgeloos, P

    1983-01-01

    Proper Artemia introduction and management should lead not only to optimal salt production outputs but at the same time provide opportunities for the exploitation of valuable by-products, i.e. Artemia cysts and adult biomass as cheap sources of high quality food for intensive fish or crustacean farming.

  8. De productie van Artemia-cysten, hoeksteen lokale economie in ontwikkelingslanden : ontwikkelingsmodel Tual ( Kleine Keï-eiland, Ind.)

    NARCIS (Netherlands)

    Scheerboom, J.; Leenstra, S.H.; Rothuis, A.J.

    2014-01-01

    De wereldwijde groei van de aquacultuur had een toename tot gevolg van de vraag naar cysten van Artemia (voor het voeden van larven van vissen en garnalen in een hatchery). Mondiaal worden cysten van zoutwaterkreeftje Artemia gewonnen in natuurlijke, zoute wateren. De beschikbaarheid van cysten is e

  9. Phototoxicity activity of Psoralea drupacea L. using Atremia salina bioassay system

    Directory of Open Access Journals (Sweden)

    Mohammad Ramezani

    2011-07-01

    Conclusion: The result showed that P. drupacea methanolic extract and chloroform fraction have phototoxicity in A. salina bioassay system and their toxic effect is related to phototoxic constituents such as psoralen.

  10. Ecology of a heterotrichous ciliate Fabrea salina from salterns of Bombay Coast, India

    Digital Repository Service at National Institute of Oceanography (India)

    Rattan, P.; Ansari, Z.A; Sreepada, R.A

    The abundance and population size structure of a heterotrichous ciliate @iFabrea salina@@, was studied in relation to hydrochemical and hydrobiological variables in three hypersaline ponds of Bombay, west coast of India There was a clear seasonal...

  11. Accelerated leach test of paraffin waste forms

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Heui Joo; Kim, Ju Youl; Cho, Young Ok; Park, Joo Wan [Nuclear Environment Technology Institute, KEPCO, Taejon (Korea, Republic of)

    1999-07-01

    Leach test for the paraffin waste forms, which was recently introduced to immobilize the dry radioactive waste concentrates at the nuclear power plants in Korea, was conducted in accordance with the Accelerated Leach Test adopted by ASTM as Standard Test Method. The specimens were made of 22 w% paraffin, 78 w% boric acid, and little amount of Co, Sr. and Cs to determine the leaching mechanism. Leach tests for the specimens with different amounts of additives were conducted at three temperatures to investigate the effect of additives on the leach rates. The leach rates of boric acid, Co, Sr, and Cs were measured. The results showed that boric acid and Co leached congruently. The leaching rates are dependent on the temperature as expected. The ALT computer program was used to simulate the experimental data. The ALT program calculation shows that the diffusion can not explain the experimental data. (author)

  12. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  13. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  14. Gamma Radiation Reduced Toxicity of Azoxystrobin Tested on Artemia franciscana.

    Science.gov (United States)

    Dvorak, P; Zdarsky, M; Benova, K; Falis, M; Tomko, M

    2016-06-01

    Fungicide azoxystrobin toxicity was monitored by means of a 96-h biotest with Artemia franciscana nauplius stages after exposure to solutions with concentrations of 0.2, 0.4, 0.6 and 0.8 mg L(-1) irradiated with (60)Co gamma radiation with doses of 1, 2.5, 5 and 10 kGy. The effects of ionization radiation on azoxystrobin toxicity were mainly manifested by a statistically significant reduction of lethality after 72- and 96-h exposure. A maximum reduction of lethality of 72 % was achieved using doses of 1-5 kGy for an azoxystrobin initial concentration of 0.4 mg L(-1) and after 72 h of exposure. At a 96-h exposure, a difference of lethal effects reached up to 70 % for a dose of 10 kGy. The observed effect of gamma ionizing radiation on azoxystrobin toxicity suggest that this approach can be applied as an alternative for a reduction of azoxystrobin residua in food.

  15. Pengaruh Medium Tercemar Logam Pb dan Cu terhadap Pertumbuhan Nannochloropsis Salina

    OpenAIRE

    Abd.Wahid Wahab; Yusafir Hala; Fibiyanthy

    2013-01-01

    Penelitian ini dilakukan dengan tujuan memanfaatkan fitoplankton Nannochloropsis salina sebagai biosorben untuk ion logam Pb dan Cu di perairan. Pada penelitian ini pemaparan ion logam Pb dan Cu dengan variasi konsentrasi masing-masing 10, 30, dan 50 ppm dilakukan di awal masa pertumbuhan fitoplankton N. salina dalam Medium Conwy pada salinitas 30 ???, aerasi dan pencahayaan kontinyu, serta suhu ruangan 20 ??C. Konsentrasi ion logam ditentukan dengan menggunakan spektrofotometer serapan atom ...

  16. Interspecific competition and allelopathic interaction between Karenia mikimotoi and Dunaliella salina in laboratory culture

    Science.gov (United States)

    He, Dong; Liu, Jiao; Hao, Qiang; Ran, Lihua; Zhou, Bin; Tang, Xuexi

    2016-03-01

    Algal allelopathy is a manifold ecological/physiological phenomenon that is focused on chemical interactions and autotoxicity. We investigated the allelopathic interactions between Karenia mikimotoi and Dunaliella salina in laboratory cultures based on diff erent temperature (15°C, 20°C, and 25°C) and lighting (40, 80, and 160 μmol/(m2·s)) conditions. The growth of D. salina in bi-algae culture (1:1 size/density) was significantly restrained. The results of cell-free filtrate culture indicate that direct cell-tocell contact was not necessary in interspecific competition. Further experimental results demonstrated that allelochemicals released from K. mikimotoi were markedly influenced by both temperature ( P =0.013) and irradiance ( P =0.003), resulting in diff erent growth characteristics of D. salina in filtrate mediums. Compared with the plateau period, K. mikimotoi exudates in the exponential phase had a stronger short-term inhibition effect on D. salina in normal conditions. A clear concentration-dependent relationship was observed in the effect of allelochemicals released from K. mikimotoi with low-promoting and high-repressing effects on D. Salina in a short time-scale. In addition, allelopathic substances remain stable and effective under high temperature and pressure stress. Many flocculent sediments adhering with D. salina cells were observed in all filtrate mediums, while the quantity and color depended on the original culture conditions.

  17. Utility of the pat gene as a selectable marker gene in production of transgenic Dunaliella salina

    Directory of Open Access Journals (Sweden)

    Hyo Sun Jung

    2016-09-01

    Full Text Available Abstract Background The objective of this study was to develop an efficient selectable marker for transgenic Dunaliella salina. Results Tests of the sensitivity of D. salina to the antibiotic chloramphenicol and the herbicide Basta® showed that cells (1.0 × 106 cells/ml treated with 1000 or 1500 μg/ml chloramphenicol died in 8 or 6 days, respectively, whereas D. salina cells (1.0 × 106 cells/ml treated with 5, 10, 20, or 40 μg/ml Basta® died in 2 days. Therefore, D. salina is more sensitive to Basta® than to chloramphenicol. To examine the possibility of using the phosphinothricin N-acetyltransferase (pat gene as a selectable marker gene, we introduced the pat genes into D. salina with particle bombardment system under the condition of helium pressure of 900 psi from a distance of 3 cm. PCR analysis confirmed that the gene was stably inserted into the cells and that the cells survived in 5 μg/ml Basta®, the medium used to select the transformed cells. Conclusions The findings of this study suggest that the pat gene can be used as an efficient selectable marker when producing transgenic D. salina.

  18. Cestodes change the isotopic signature of brine shrimp, Artemia, hosts: implications for aquatic food webs.

    Science.gov (United States)

    Sánchez, Marta I; Varo, Nico; Matesanz, Cristina; Ramo, Cristina; Amat, Juan A; Green, Andy J

    2013-01-01

    To reach the final host (greater flamingos), the cestode Flamingolepis liguloides alters the behaviour of its intermediate host, the brine shrimp, Artemia parthenogenetica, causing it to spend more time close to the water surface. During summer 2010, we showed that the prevalence of this cestode was consistently higher at the top of the water column in the Odiel salt pans in south-western Spain. We used stable nitrogen (N) and carbon (C) isotopic analysis to test the hypothesis that cestodes also alter resource use by Artemia. In early summer, we compared stable isotopes in infected hosts at the surface with those from uninfected hosts at the bottom of the water column. In late summer, we compared infected and uninfected Artemia from the bottom. δ(15)N was consistently enriched in infected individuals compared with uninfected hosts, especially in Artemia with multiple infections of F. liguloides (family Hymenolepididae) and those with mixed infections of F. liguloides and cestodes of the family Dilepididae. Infected individuals from the surface were enriched in δ(13)C compared with uninfected ones from the bottom, but the opposite was found when comparing uninfected and infected Artemia from the same depth. This may be caused by the increase in lipid concentration in infected Artemia. Isolated cysticercoids of F. liguloides were significantly enriched in δ(13)C compared with cysticercoids in infected hosts, but surprisingly were not enriched in N. Our findings illustrate the way cestodes can alter food webs and highlight the importance of considering the parasitic status of prey in studies of trophic ecology in saline wetlands. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  19. ARTEMIA SALINA КАК БИОИНДИКАТОР ИНТЕГРАЛЬНОЙ ДОЗОВОЙ НАГРУЗКИ ПРИ ВОЗДЕЙСТВИИ ГАЛАКТИЧЕСКИХ КОСМИЧЕСКИХ ЛУЧЕЙ НА АВИАПАССАЖИРОВ

    OpenAIRE

    2014-01-01

    Толстоскорлуповые цисты жаброногого рачка A. salina предложены в качестве биосенсора для оценки интегральной дозовой нагрузки от ГКЛ. Проведен ряд экспериментов по облучению цист A. salina космическими лучами. Показано, что образцы цист, получивших наименьшую дозу ИИ, наиболее способны к прорастанию. Разработаны практические рекомендации по использованию DDW авиапассажирами в качестве средства профилактики стохастических последствий воздействия космических лучей....

  20. [Artemia sp. (Crustacea, Anostracea) as intermediate host of Eurycestus avoceti Clark, 1954 (Cestoda, Cyclophyllidea) (author's transl)].

    Science.gov (United States)

    Gabrion, C; MacDonald, G

    1980-01-01

    Examination of Artemia sp. (Crustacé, Anostracé) for natural infection by cysticercoids of Flamingolepis liguloides, Cestode of the Flamingo (Phoenicopterus ruber) shows the presence of three other cysticercoids of cestode parasites of the Flamingo in the hemocoele of the Branchiopode. A fourth one is reported as the cysticercoid of Eurycestus avoceti, Clark, 1954, which parasitizes the Avocet (Recurvirostra avosetta). The systematic position of this Cestode is always unknown. This report shows the importance of Artemia in the life cycle of Cestodes of Anseriforms and Charadriiforms birds in saline lagoons.

  1. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica.

    Science.gov (United States)

    Fan, Tingjun; Jing, Zhao; Fan, Xianyuan; Yu, Miaomiao; Jiang, Guojian

    2011-09-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ion-exchange chromatography, and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate. Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass. The optimal pH value and temperature are 7.0 and 50°C, respectively, for its PO activity. The AsPO had an apparent K(m) value of 4.2 mM on L-DOPA, and 10.9 mM on catechol, respectively. Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid, sodium sulfite, and citric acid; and was very sensitive to cysteine, benzoic acid, and 1-phenyl-2-thiourea. Combined with its specific enzyme activity on L-DOPA and catechol, it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase. Its PO activity was also sensitive to metal ions and chelators, and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu(2+), indicating that AsPO is most probably a copper-containing metalloenzyme. All these data about specific substrate, sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing O-diphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  2. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Tingjun Fan; Zhao Jing; Xianyuan Fan; Miaomiao Yu; Guojian Jiang

    2011-01-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ionexchange chromatography,and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate.Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass.The optimal pH value and temperature are 7.0 and 50℃,respectively,for its PO activity.The AsPO had an apparent Km value of 4.2 mM on L-DOPA,and 10.9 mM on catechol,respectively.Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid,sodium sulfite,and citric acid; and was very sensitive to cysteine,benzoic acid,and l-phenyl-2-thiourea.Combined with its specific enzyme activity on L-DOPA and catechol,it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase.Its PO activity was also sensitive to metal ions and chelators,and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu2+,indicating that AsPO is most probably a copper-containing metalloenzyme.All these data about specific substrate,sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing Odiphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  3. Survival of the probiotic bacteria Lactobacillus rhamnosus in seawater and its bioencapsulation in the brine shrimp Artemia

    Directory of Open Access Journals (Sweden)

    Claudia Ofelio

    2014-06-01

    The results obtained in the first test showed that the L. rhamnosus was able to survive in seawater during the whole experiment (30h, maintaining densities of 10e7 CFU/ml during the first 6h although decreasing progressively afterwards (10e3 CFU/ml at 30h. This allows adequate levels at sufficient time for Artemia to incorporate the probiotic. In fact, bioencapsulation test demonstrated that Artemia metanauplii were able to bioencapsulate the probiotic, reaching the highest concentration in Artemia after 30 min of bioencapsulation (10e4 CFU/Artemia. A slight further decrease (10e3 CFU/Artemia was observed after 24h. Interestingly, L. rhamnosus reduced in 1Log total Vibrionaceae bacteria in Artemia during the 3 first hours. Therefore, 3 hours was the time established for the bioencapsulation protocol and further studies are in progress to determine the ability of Artemia metanauplii to maintain bioencapsulated L. rhamnosus once transferred to rearing tanks. Also, the capability of the probiotic to inhibit potential pathogenic or opportunistic bacteria will be assessed.

  4. Therapeutic effect of Artemia enriched with Escherichia coli expressing double-stranded RNA in the black tiger shrimp Penaeus monodon.

    Science.gov (United States)

    Thammasorn, Thitiporn; Somchai, Parinyachat; Laosutthipong, Chaowanee; Jitrakorn, Sarocha; Wongtripop, Somjai; Thitamadee, Siripong; Withyachumnarnkul, Boonsirm; Saksmerprome, Vanvimon

    2013-10-01

    We exploited Artemia as a double-stranded (ds)RNA-delivery system to combat viral diseases in shrimp. First, the transformed Escherichia coli (E. coli) expressing red fluorescent protein (RFP) was tested in the Artemia enrichment process. RFP signals detectable in the gut of Artemia under confocal microscope were evident for the successful encapsulation. Second, the Artemia enrichment process was performed using E. coli producing Laem-Singh virus (LSNV)-specific dsRNA, which has been previously shown to inhibit the viral infection in the black tiger shrimp Penaeus monodon by intramuscular injection and oral administration. The enriched Artemia nauplii were confirmed to contain dsRNA-LSNV by RT-PCR, and were subjected to the feeding test with P. monodon postlarvae. Quantitative RT-PCR indicated that a number of LSNV copies in most of the treated shrimp were, at least, 1000-fold lower than the untreated controls. During 11-17weeks after feeding, average body weight of the treated group was markedly increased relative to the control group. A smaller differential growth rate of the treated group as compared to the control was also noticed. These results suggested that feeding shrimp with the dsRNA-enriched Artemia can eliminate LSNV infection, which is the cause of retarded growth in P. monodon. The present study reveals for the first time the therapeutic effect of dsRNA-enriched Artemia for shrimp disease control.

  5. Effect of artificial regulations of Artemia n-3 HUFA content on growth and survival of black seabream ( Sparus macrocephalus) larvae

    Science.gov (United States)

    Liu, Jing-Ke

    1998-06-01

    The requirement for dietary n-3 HUFA (highly unsaturated fatty acid) for growth and survival of black seabream ( Sparus macrocephalus) larvae was tested using Artemia with various levels of n-3 HUFA. Four treatments with Artemia differing in their n-3 HUFA were prepared by feeding them various oil emulsions. The results indicated that dietary n-3 HUFA significantly influences fish n-3 HUFA levels and are necessary for good growth and survival of black seabream larvae. The proper value of n-3 HUFA level and DHA, EPA level in Artemia should be 4.273% and 0.873% (wet weight) for good growth and survival in black seabream larvae respectively.

  6. Phylogenetic analysis of brine shrimp (Artemia) in China using DNA barcoding.

    Science.gov (United States)

    Wang, Weiwei; Luo, Qibin; Guo, Haiyan; Bossier, Peter; Van Stappen, Gilbert; Sorgeloos, Patrick; Xin, Naihong; Sun, Qishi; Hu, Songnian; Yu, Jun

    2008-12-01

    DNA barcoding is a powerful approach for characterizing species of organisms, especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China. Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  7. Unique chimeric composition of the trehalase gene from brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Tanaka, Shin; Nambu, Fumiko; Nambu, Ziro

    2010-03-01

    To investigate the exon/intron structure of the Artemia trehalase gene, four overlapping clones were isolated from a genome library derived from an inbred strain of crustacean Artemia franciscana, and a 49 kb genetic area was re-constructed. The re-constructed area contained eight exons corresponding to the trehalase cDNA sequence that we had previously reported [1]. Comparative analysis of the Artemia trehalase gene with other animal trehalase genes revealed the existence of conserved exon/intron boundaries among different phyla. Comparison of the 5' UTR region of trehalase mRNA obtained by the 5' RACE method with the trehalase genes indicated the existence of a novel exon/intron boundary in the region designated "Exon I". Surprisingly, a part of a mitochondrial ribosomal protein gene (MRP-S33) was found to be inserted in the 5' UTR region of the trehalase gene. This sequence had the same polyadenylation signal that the Artemia MRP-S33 cDNAs did. Using the 3' RACE method, it was demonstrated that the poly (A) additional signal is still functional and that the chimeric mRNAs composed of the 5' UTR of the trehalase mRNA and of the 3' end derived from the MRP-S33 gene are transcribed.

  8. Evaluation of different feeds for optimal growth and survival of parthenogenetic brine shrimp, Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Sumitra-Vijayaraghavan; Krishnakumari, L.; Royan, J.P.

    Four types of food, each at 5 levels were evaluated for optimal growth and survival of Artemia larvae (1-4 d and 4-8 d), under laboratory conditions. The food types used were rice bran and 3 species of algae (Porphyra vietnamensis, Enteromorpha...

  9. Assessment of cyst production potential of a natural population of brine shrimp Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Studies on a natural population of Artemia in the salterns of Jamnagar indicated that the population is parthenogenetic. These shrimps reach a maximum size of 9 mm. Number of cysts per brood varies from 10-32. Adults form about 68% of the total...

  10. Nutritional evaluation of Artemia Nauplii for the culture of marine crustacean Mysidopsis bahia (M.)

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Zemmouri, A; Sorgeloos, P.; Leger, Ph.

    A standard bioassay was carried out for the nutritional evaluation of Artemia nauplii of Indian and Sri Lankan strains using newly released juveniles of Mysidopsis bahia. After 12 d, results on survival (91-97%), length (4911-5430 mu m), individual...

  11. Potential utilization of Artemia franciscana eggs as food for Coleomegilla maculata

    Science.gov (United States)

    We tested the hypothesis that Artemia franciscana Kellogg (brine shrimp, Anostraca: Artemiidae) eggs are suitable factitious, i.e., alternative, food to support the life history of a predatory ladybird beetle, Coleomegilla maculata DeGeer (Coleoptera: Coccinellidae). Using progeny from a stock colo...

  12. Phylogenetic Analysis of Brine Shrimp (Artemia) in China Using DNA Barcoding

    Institute of Scientific and Technical Information of China (English)

    Weiwei Wang; Jun Yu; Qibin Luo; Haiyan Guo; Peter Bossier; Gilbert Van Stappen; Patrick Sorgeloos; Naihong Xin; Qishi Sun; Songnian Hu

    2008-01-01

    DNA barcoding is a powerful approach for characterizing species of organisms,especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China.Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  13. Marine Lactobacillus pentosus H16 protects Artemia franciscana from Vibrio alginolyticus pathogenic effects.

    Science.gov (United States)

    Garcés, M E; Sequeiros, C; Olivera, N L

    2015-02-10

    Vibrio alginolyticus is an opportunistic pathogen which may affect different aquatic organisms. The aim of this study was to assess the probiotic properties and the protective mode of action of Lactobacillus pentosus H16 against V. alginolyticus 03/8525, through in vitro and in vivo studies using Artemia franciscana (hereafter Artemia). This strain showed antimicrobial activity against V. alginolyticus 03/8525 and Aeromonas salmonicida subsp. salmonicida ATCC33658 possibly related to lactobacilli organic acid production. It was able to survive at high rainbow trout bile concentrations and showed high selective adhesion to rainbow trout mucus (1.2×10(5)±8.0×10(3) cells cm(-2)). H16 outcompeted V. alginolyticus 03/8525 and A. salmonicida subsp. salmonicida ATCC33658, greatly reducing their adherence to rainbow trout mucus (64.8 and 74.1%, respectively). Moreover, H16 produced a cell-bound biosurfactant which caused an important decrease in the surface tension. H16 also protected Artemia nauplii against mortality when it was administered previous to V. alginolyticus 03/8525 inoculation. Furthermore, H16 bioencapsulated in Artemia, suggesting that it is possible to use live carriers in its administration. We conclude that the ability of L. pentosus H16 to selectively adhere to mucosal surfaces and produce cell-bound biosurfactants, displacing pathogenic strains, in addition to its antimicrobial activity, confer H16 competitive advantages against pathogens as demonstrated in in vivo challenge experiments. Thus, L. pentosus H16, a marine bacterium from the intestinal tract of hake, is an interesting probiotic for Artemia culture and also has the potential to prevent vibriosis in other aquaculture activities such as larvae culture and fish farming.

  14. Feeding truncated heat shock protein 70s protect Artemia franciscana against virulent Vibrio campbellii challenge.

    Science.gov (United States)

    Baruah, Kartik; Norouzitallab, Parisa; Shihao, Li; Sorgeloos, Patrick; Bossier, Peter

    2013-01-01

    The 70 kDa heat shock proteins (Hsp70s) are highly conserved in evolution, leading to striking similarities in structure and composition between eukaryotic Hsp70s and their homologs in prokaryotes. The eukaryotic Hsp70 like the DnaK (Escherichia coli equivalent Hsp70) protein, consist of three functionally distinct domains: an N-terminal 44-kDa ATPase portion, an 18-kDa peptide-binding domain and a C-terminal 10-kDa fragment. Previously, the amino acid sequence of eukaryotic (the brine shrimp Artemia franciscana) Hsp70 and DnaK proteins were shown to share a high degree of homology, particularly in the peptide-binding domain (59.6%, the putative innate immunity-activating portion) compared to the N-terminal ATPase (48.8%) and the C-terminal lid domains (19.4%). Next to this remarkable conservation, these proteins have been shown to generate protective immunity in Artemia against pathogenic Vibrio campbellii. This study, aimed to unravel the Vibrio-protective domain of Hsp70s in vivo, demonstrated that gnotobiotically cultured Artemia fed with recombinant C-terminal fragment (containing the conserved peptide binding domain) of Artemia Hsp70 or DnaK protein were well protected against subsequent Vibrio challenge. In addition, the prophenoloxidase (proPO) system, at both mRNA and protein activity levels, was also markedly induced by these truncated proteins, suggesting epitope(s) responsible for priming the proPO system and presumably other immune-related genes, consequently boosting Artemia survival upon challenge with V. campbellii, might be located within this conserved region of the peptide binding domain.

  15. 40 CFR 799.2475 - 2-Mercaptobenzothiazole.

    Science.gov (United States)

    2010-07-01

    ... newly-hatched brine shrimp nauplii (Artemia salina) three times a day ad libitum, with excess food siphoned off daily. The minnow fry shall be fed live newly-hatched brine shrimp nauplii (Artemia salina)...

  16. 卤虫(Artemia salina)孵化腺细胞分化时相的免疫细胞化学研究(简报)%IMMUNOCYTOCHEMICAL STUDIES ON THE PHASE OF DIFFERENTIATION OF HATCHING GLAND CELLS IN BRINE SHRIMP, ARTEMIA SALINA

    Institute of Scientific and Technical Information of China (English)

    李凌; 樊廷俊; 汪小锋; 丛日山; 于秋涛; 钟其旺

    2004-01-01

    动物孵化酶(hatching enzyme HE)是早期胚胎在特定发育阶段由孵化腺细胞产生和分泌的,在动物早期胚胎孵化中具有关键性作用[4]。孵化腺细胞(hatching gland cell,HGC)一般为单细胞腺体,是从胚胎发育到特定阶段(孵化前)出现、至胚胎孵出后的特定时期消失的一时性细胞(transient type of

  17. Nitrate leaching from Silage Maize

    OpenAIRE

    Hansen, Elly Møller; Eriksen, Jørgen

    2009-01-01

    During the last 20 years the area with maize in Denmark has increased dramatically and reached 163,000 ha in 2008. Silage maize is easy to grow, is a suitable fodder for cows and goes well with grass-clover in the diet. This means that silage maize is often found in crop rotations with grass-clover on sandy soils in western Denmark. The ploughing in of grass-clover fields poses a serious risk of increased nitrate leaching on a coarse sandy soil, even when carried out in spring. With increased...

  18. Hydrothermal liquefaction of Spirulina and Nannochloropsis Salina under subcritical and supercritical water conditions

    DEFF Research Database (Denmark)

    Toor, Saqib; Reddy, H.; Deng, S.

    2013-01-01

    Six hydrothermal liquefaction experiments on Nannochloropsis salina and Spirulina platensis at subcritical and supercritical water conditions (220-375 °C, 20-255 bar) were carried out to explore the feasibility of extracting lipids from wet algae, preserving nutrients in lipid-extracted algae solid...... residue, and recycling process water for algae cultivation. GC-MS, elemental analyzer, FT-IR, calorimeter and nutrient analysis were used to analyze bio-crude, lipid-extracted algae and water samples produced in the hydrothermal liquefaction process. The highest bio-crude yield of 46% was obtained...... on Nannochloropsis salina at 350 °C and 175 bar. For Spirulina platensis algae sample, the optimal hydrothermal liquefaction condition appears to be at 310 °C and 115 bar, while the optimal condition for Nannochloropsis salina is at 350 °C and 175 bar. Preliminary data also indicate that a lipid-extracted algae...

  19. Use of Pseudomonas stutzeri and Candida utilis in the improvement of the conditions of Artemia culture and protection against pathogens

    Directory of Open Access Journals (Sweden)

    Mahdhi Abdelkarim

    2010-03-01

    Full Text Available To evaluate the effect of two bacterial strains isolated from Artemia cysts and yeast (Candida utilis on the survival, growth and total biomass production of its larvae, challenge tests were performed with Candida utilis, Pseudomonas stutzeri and Pasteurella haemolityca. In addition, a pathogenic strain of Vibrio alginolyticus was tested for comparative purposes. Pseudomonas stutzeri and Candida utilis have no impact on survival, but enhance growth and total biomass production of the larvae. However, we noted that Pasteurella haemolityca affect negatively Artemia larvae. The adhesion and antagonism assay demonstrates that Candida utilis and Pseudomonas stutzeri are fairly adherent and play an important role in the enhancement of the protection of Artemia culture against pathogens. On the basis of these results, it's suggested that it's possible to use Candida utilis and Pseudomonas stutzeri, potential candidates, as probiotic for the culture of Artemia larvae.

  20. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    CHAI Yurong; LU Yumin; WANG Tianyun; HOU Weihong; XUE Lexun

    2006-01-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficientpromoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase (CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics.Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  1. Production, utilization and manipulation of Artemia as food source for shrimp and fish larvae

    OpenAIRE

    Lavens, P.; Léger, P.; Sorgeloos, P

    1986-01-01

    Larval culture of fish and shrimp can be seriously improved thanks to the results of recent research and development in the field of Artemia production and utilization. The present article summarizes the most recent techniques for optimation in production and use of different stages of Artemia in aquaculture:- cyst selection in function of hatching quality, purity, biometric characteristics, etc. - nauplii production: techniques for hatching, disinfection and decapsulation;- nutritional value...

  2. Una punta de lanza decorada de la necrópolis de El Puntal (Salinas, Alicante)

    OpenAIRE

    2000-01-01

    Este trabajo pretende dar a conocer la decoración damasquinada presente en una punta de lanza de la necrópolis ibérica de El Puntal (Salinas, Alicante), datada en el s. IV a.C. Se señala asimismo la importancia que adquiere la sepultura en la que aparece, que sobresale del conjunto para convertirse en el lugar de enterramiento de un personaje destacado. Ce travail veut presenter la décoration damasquinée trouvée sur une lance de la nécropole ibérique du Puntal (Salinas, Alicant...

  3. Circuito turístico Guayaquil – salinas – puerto cayo

    OpenAIRE

    Vaca Viteri, Maria Soledad; Ortiz Franco, Samantha

    2009-01-01

    Bajo el concepto de Circuito de Turismo, este documento, busca integrar a la cosmopolita y moderna ciudad de Guayaquil con el conjunto de balnearios que se recorre en la ruta Salinas – Puerto Cayo. Tal Circuito resultaría de gran competitividad, a nivel nacional e internacional, frente a otros destinos similares. Dado esto, la ciudad de Guayaquil y la ruta Salinas – Puerto Cayo serian un solo atractivo turístico. Otorgando a la ciudad de Guayaquil una imagen renovada para...

  4. Influence of Chemical Parameters on Artemia sp. (Crustacea: Anostraca Population in Al Wathba Lake in the Abu Dhabi Emirate, UAE

    Directory of Open Access Journals (Sweden)

    Anitha Saji

    2016-04-01

    Full Text Available Long term monitoring programme on Brine shrimp (Artemia sp. is being carried out by the Environment Agency, Abu Dhabi, United Arab Emirates (EAD with the prime purpose of understanding the population dynamics, ecology and habitat requirements of Artemia at Al Wathba Lake, situated within Al Wathba Wetland Reserve, which is an artificial wetland near Abu Dhabi City. The present study, being a component of this programme, intends to understand the influence of chemical parameters such as dissolved oxygen, nitrate, nitrite, phosphate, ammonia and total organic carbon on Artemia biomass and cyst production at different sites of the Al Wathba Lake. The study was carried out by sampling lake water quarterly for a period of 5 years from 2010 to 2014. The Artemia population was found to have direct impact of the above mentioned parameters on its abundance. The abundance was highest during the year 2010. Further, temperature, dissolved oxygen, nitrate and cadmium were found to be the most crucial parameters for production of Artemia. The study further aimed to determine the significant relationship between physico-chemical parameters and Artemia sp. population dynamics and cyst production.

  5. Acetylation of Chromatin-Associated Histone H3 Lysine 56 Inhibits the Development of Encysted Artemia Embryos.

    Directory of Open Access Journals (Sweden)

    Rong Zhou

    Full Text Available As a response to harsh environments, the crustacean artemia produces diapause gastrula embryos (cysts, in which cell division and embryonic development are totally arrested. This dormant state can last for very long periods but be terminated by specific environmental stimuli. Thus, artemia is an ideal model organism in which to study cell cycle arrest and embryonic development.Our study focuses on the roles of H3K56ac in the arrest of cell cycle and development during artemia diapause formation and termination. We found that the level of H3K56ac on chromatin increased during diapause formation, and decreased upon diapause termination, remaining basal level throughout subsequent embryonic development. In both HeLa cells and artemia, blocking the deacetylation with nicotinamide, a histone deacetylase inhibitor, increased the level of H3K56ac on chromatin and induced an artificial cell cycle arrest. Furthermore, we found that this arrest of the cell cycle and development was induced by H3K56ac and dephosphorylation of the checkpoint protein, retinoblastoma protein.These results have revealed the dynamic change in H3K56ac on chromatin during artemia diapause formation and termination. Thus, our findings provide insight into the regulation of cell division during arrest of artemia embryonic development and provide further insight into the functions of H3K56ac.

  6. USE OF BRINE SHRIMP (ARTEMIA IN THE FEEDING OF STURGEON JUVENILES (ACIPENSERIDAE (REVIEW

    Directory of Open Access Journals (Sweden)

    M. Simon

    2016-06-01

    Full Text Available Purpose. To review scientific sources on the technological and biological characteristics of the use of brine shrimp (Artemia in the feeding of sturgeon juvenilse (Acipenseridae. To highlight the common biotechnological bases of the enrichment of brine shrimp with biologically active substances necessary for the full development of sturgeon juveniles. Findings. The review of scientific papers showed that the technology is the use of brine shrimp in the feeding of sturgeon speices not only had not lost its relevance in aquaculture, but also continued to evolve in response to new challenges. The review contains a description of the peculiarities of the biological structure of brine shrimp eggs and methods of their quality assessment in the field. It describes the nutritional characteristics of Artemia. It is shown that brine shrimp is the best food organism for the use in the feeding of sturgeon fingerlings. The calculation scheme for Artemia decapsulation and incubation is provided. The main technological stages of of the preparation of shrimps before their use in feeding – activation, hydration, decapsulation, incubation, dehydration were described. The effect of brine shrimp nauplia enriched with biologically active substances enriched brine shrimp on sturgeon juveniles was highlighted. Practical value. Fish farm owners search for cost-effective, easy to use, and available food that is preferred by sturgeon juveniles (Acipenseridae. Brine shrimp nauplii obtained from cysts can be readil used to feed fish just after one-day incubation. Instar I (the nauplii that just hatched and contain large yolk reserves in their body and instar II nauplii (the nauplii after first moult and with functional digestive tracts are more widely used in aquaculture, because they are easy for operation, rich in nutrients, and small, which makes them suitable for feeding fish larvae as live feed or after drying. The generalized information will be important for

  7. A biometric and ecologic comparison between Artemia from Mexico and Chile.

    Science.gov (United States)

    Castro, Thalía B; Gajardo, Gonzalo; Castro, Jorge M; Castro, Germán M

    2006-11-24

    A preliminary biometric and ecologic database for the brine shrimp Artemia from Mexico and Chile is presented. The area abounds in small and seasonal ponds and large inland lakes, the latter mainly located in Mexico, although relatively large and isolated lakes are found in complex hydrological settings in pre-high plateau areas of Chile. This paper summarizes research efforts aimed at the localization, characterization, and evaluation of the aquaculture potential of Artemia populations in Mexico and Chile, which exhibit great habitat diversity (ponds, salterns, coastal lagoons, sea arms, coastal and inland lakes), contrasting weather conditions and different levels of isolation and human intervention. This study covered locations between 29 degrees north latitude (Baja California, Mexico) to 50 degrees south latitude (Puerto Natales, Chile). Biological characteristics considered are species name, reproductive mode, cyst diameter, chorion thickness, and nauplius length, whereas ecological data include pond size, pH, salinity, temperature, and water ionic composition. Artemia franciscana is the only species found in Mexico, it exists together with A. persimilis in Chile, though separated geographically. Ecological differences in habitat exist between both regions but also within countries, a pattern particularly clear with regard to water composition. Surprisingly, a Mexican (Cuatro Ciénegas, A. franciscana) and a Chilean location (Torres del Paine, A. persimilis) share habitat characteristics, at least for the period when data were collected. The discriminant analysis for cyst diameter and nauplius length shows that Artemia from only one location match in cyst diameter with those from San Francisco Bay (SFB) (Point Lobos), and one (Marquez) is far apart from SFB and all the others. The Chilean locations (Pampilla, Cejar, Cahuil, Llamara, Yape) share cyst diameter, but tend to differ from SFB. The remaining Mexican locations (Juchitan, Ohuira, Yavaros) are well

  8. Atrazine leaching from biochar-amended soils.

    Science.gov (United States)

    Delwiche, Kyle B; Lehmann, Johannes; Walter, M Todd

    2014-01-01

    The herbicide atrazine is used extensively throughout the United States, and is a widespread groundwater and surface water contaminant. Biochar has been shown to strongly sorb organic compounds and could be used to reduce atrazine leaching. We used lab and field experiments to determine biochar impacts on atrazine leaching under increasingly heterogeneous soil conditions. Application of pine chip biochar (commercially pyrolyzed between 300 and 550 °C) reduced cumulative atrazine leaching by 52% in homogenized (packed) soil columns (p=0.0298). Biochar additions in undisturbed soil columns did not significantly (p>0.05) reduce atrazine leaching. Mean peak groundwater atrazine concentrations were 53% lower in a field experiment after additions of 10 t ha(-1) acidified biochar (p=0.0056) relative to no biochar additions. Equivalent peat applications by dry mass had no effect on atrazine leaching. Plots receiving a peat-biochar mixture showed no reduction, suggesting that the peat organic matter may compete with atrazine for biochar sorption sites. Several individual measurement values outside the 99% confidence interval in perched groundwater concentrations indicate that macropore structure could contribute to rare, large leaching events that are not effectively reduced by biochar. We conclude that biochar application has the potential to decrease peak atrazine leaching, but heterogeneous soil conditions, especially preferential flow paths, may reduce this impact. Long-term atrazine leaching reductions are also uncertain.

  9. Properties of Leach-Flessas-Gorringe polynomials

    Science.gov (United States)

    Pursey, D. L.

    1990-09-01

    A generating function is obtained for the polynomials recently introduced by Leach, Flessas, and Gorringe [J. Math. Phys. 30, 406 (1989)], and is then used to relate the Leach-Flessas-Gorringe (or LFG) polynomials to Hermite polynomials. The generating function is also used to express a number of integrals involving the LFG polynomials as finite sums of parabolic cylinder functions.

  10. LEACHING OF METALS FROM MINERAL PROCESSING WASTE

    Science.gov (United States)

    The purpose of this project is to test the leaching of Mineral Processing Waste (MPW) contaminated with heavy metals using scientifically defendable leaching tests other than TCLP. Past experience and literature have shown that TCLP underestimates the levels of metals such as oxo...

  11. Pseudomonas salina sp. nov., isolated from a salt lake.

    Science.gov (United States)

    Zhong, Zhi-Ping; Liu, Ying; Hou, Ting-Ting; Liu, Hong-Can; Zhou, Yu-Guang; Wang, Fang; Liu, Zhi-Pei

    2015-09-01

    A Gram-staining-negative, facultatively aerobic bacterium, strain XCD-X85(T), was isolated from Xiaochaidan Lake, a salt lake (salinity 9.9%, w/v) in Qaidam basin, Qinghai province, China. Its taxonomic position was determined by using a polyphasic approach. Cells of strain XCD-X85(T) were non-endospore-forming rods, 0.4-0.6 μm wide and 1.0-1.6 μm long, and motile by means of a single polar flagellum. Strain XCD-X85(T) was catalase- and oxidase-positive. Growth was observed in the presence of 0-12.0% (w/v) NaCl (optimum, 1.0-2.0%) and at 4-35 °C (optimum, 25-30 °C) and pH 6.5-10.5 (optimum, pH 8.0-8.5). Strain XCD-X85(T) contained (>10%) summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c), C12 : 0, C16 : 0 and summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c) as the predominant fatty acids. The major respiratory quinone was ubiquinone 9 (Q-9). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content was 57.4 mol%. Phylogenetic trees based on 16S rRNA gene sequences showed that strain XCD-X85(T) was associated with the genus Pseudomonas, and showed highest 16S rRNA gene sequence similarities to Pseudomonas pelagia CL-AP6(T) (99.0%) and Pseudomonas bauzanensis BZ93(T) (96.8%). DNA-DNA relatedness of strain XCD-X85T to P. pelagia JCM 15562(T) was 19 ± 1%. On the basis of the data presented above, it is concluded that strain XCD-X85(T) represents a novel species of the genus Pseudomonas, for which the name Pseudomonas salina sp. nov. is proposed. The type strain is XCD-X85(T) ( = CGMCC 1.12482(T) = JCM 19469(T)).

  12. PRESERVATIVE LEACHING FROM WEATHERED CCA-TREATED WOOD

    Science.gov (United States)

    Disposal of discarded CCA-treated wood in landfills raises concerns with respect to leaching of preservative compounds. When unweathered CCA-treated wood is leached using the toxicity characteristic leaching procedure (TCLP), arsenic concentrations exceed the toxicity characteris...

  13. LEACH Algorithm Based on Load Balancing

    Directory of Open Access Journals (Sweden)

    Wangang Wang

    2013-09-01

    Full Text Available This paper discusses advantages of LEACH Algorithm and the existing improved model which takes the famous hierarchy clustering routing protocol LEACH Algorithm as researching object. Then the paper indicates the problem that in the algorithm capacity factor of cluster head node is not taken into account leading the structure of clusters to be not so reasonable. This research discusses an energy-uniform cluster and cluster head selecting mechanism in which “Pseudo cluster head” concept is introduced in order to coordinate with “Load Monitor” Mechanism and “Load Leisure” Mechanism to maintain load balancing of cluster head character and stability of network topology. On the basis of LEACH Protocol improving algorithm of LEACH-C, CEFL and DCHS. NS2 simulation instrument is applied to do simulation analysis on the improved algorithm. Simulation result shows that LEACH-P Protocol effectively increase energy utilization efficiency, lengthens network lifetime and balances network load.  

  14. Phosphorus leaching in a soil textural gradient

    DEFF Research Database (Denmark)

    Glæsner, Nadia; Kjærgaard, Charlotte; Rubæk, Gitte Holton;

    2009-01-01

    Texture is a major factor influencing mobilization and transport of P in soil owing partly to differences in adsorptive properties, and partly to differences in pore-size distribution and pore organization. Slurry application strategies may be important mitigation measures for reducing agricultural...... P leaching. We propose diverse interactions between dominant flow pathways and cattle slurry: - Injection of slurry reduces P leaching compared to surface application in soils with preferential flow behaviour - Injection of slurry has less impact on P leaching compared to surface application...... in soils with matrix dominated flow behaviour We tested these hypotheses on three textural soil classes (Olsen-P 1.6 mg P 100 g-1) on intact soil columns (20*20 cm) and compared them to in situ P leaching before slurry application. In a loamy sand P leaching with both slurry application techniques slightly...

  15. Rule of oxygen transmission in dump leaching

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    According to the chemical equations, the flux and concentration of oxygen required during bacterial leaching sulfuric mineral were investigated; the rule of air bubble transmitted in granular was researched in the Dump Leaching Plant of Dexing Copper Mine. The results show that lack of oxygen in dump leaching is the critical factor of restricting leaching reaction. Pyrite is the primary oxygen-consuming mineral in bioleaching. When its content is too high, it needs a great deal of oxygen for reaction and competes for the finite oxygen with objective minerals, and thus the leaching velocity decreases greatly. The average size of ore particles and diameter of bubbles are the key parameters affecting the mass transfer coefficient. Reverse analysis was adopted, and it shows that 44.8 m3 air per unit ore can meet the requirement of production if the molar ratio of pyrite to chalcopyrite is 10.

  16. Leaching of heavy metals from steelmaking slags

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, J. F. P.; Pino, C. G.

    2006-07-01

    Leaching tests with EAF and Ladle slags were performed, using a flow through tests and the standard batch test DIN 38414-S4. The previous method was used to simulate the leaching behaviour of steel slags under landfill. the chemical analysis of the leachates during this period shows, in general, for both types of slag, and increase of heavy metal releases with ageing. Standard test method DIN 38414-S4 was used to evaluate leachability of heavy metals by water in unprocessed slags. After more than one year of trials, slang samples submitted to these trials presented very low total leaching levels. The most extracted elements are calcium and magnesium. Nevertheless, in flow-though test, calcium and magnesium leached from solid slags are below 0.5% and all other metals below 0.1%. Leachates obtained with DIN 38414-S4 present, as expected, higher leaching values; however, these are inferior to 5% (Ca) and 1% (other elements). (Author) 12 refs.

  17. Microbial leaching of marmatite by Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans

    Institute of Scientific and Technical Information of China (English)

    WANG Jun; QIU Guan-zhou; QIN Wen-qing; ZHANG Yan-sheng

    2006-01-01

    The bioleaching of marmatite in shaken flasks was studied. After leaching for 29 days, the leaching ratio of zinc was 91%.Three kinds of bacteria, mixture-based bacteria, 9K-based bacteria and sulfur-based bacteria were used in marmatite leaching, of which the mixture-based bacteria have the best leaching result while the sulfur-based bacteria have the worst. By analyzing the leaching residue using SEM and EDXA, the marmatite leaching mechanism was discussed.

  18. Dynamic leaching test of personal computer components.

    Science.gov (United States)

    Li, Yadong; Richardson, Jay B; Niu, Xiaojun; Jackson, Ollie J; Laster, Jeremy D; Walker, Aaron K

    2009-11-15

    A dynamic leaching test (DLT) was developed and used to evaluate the leaching of toxic substances for electronic waste in the environment. The major components in personal computers (PCs) including motherboards, hard disc drives, floppy disc drives, and compact disc drives were tested. The tests lasted for 2 years for motherboards and 1.5 year for the disc drives. The extraction fluids for the standard toxicity characteristic leaching procedure (TCLP) and synthetic precipitation leaching procedure (SPLP) were used as the DLT leaching solutions. A total of 18 elements including Ag, Al, As, Au, Ba, Be, Cd, Cr, Cu, Fe, Ga, Ni, Pd, Pb, Sb, Se, Sn, and Zn were analyzed in the DLT leachates. Only Al, Cu, Fe, Ni, Pb, and Zn were commonly found in the DLT leachates of the PC components. Their leaching levels were much higher in TCLP extraction fluid than in SPLP extraction fluid. The toxic heavy metal Pb was found to continuously leach out of the components over the entire test periods. The cumulative amounts of Pb leached out of the motherboards in TCLP extraction fluid reached 2.0 g per motherboard over the 2-year test period, and that in SPLP extraction fluid were 75-90% less. The leaching rates or levels of Pb were largely affected by the content of galvanized steel in the PC components. The higher was the steel content, the lower the Pb leaching rate would be. The findings suggest that the obsolete PCs disposed of in landfills or discarded in the environment continuously release Pb for years when subjected to landfill leachate or rains.

  19. Neutral lipid production in Dunaliella salina during osmotic stress and adaptation

    DEFF Research Database (Denmark)

    Yao, Shuo; Lu, Jingquan; Sárossy, Zsuzsa

    2016-01-01

    The salt-tolerant green microalga Dunaliella salina can survive both hyper- and hypo-osmotic shock. Upon osmotic shock, the cells transiently and rapidly decreased or increased in size within minutes and slowly over hours acquired their original cell size and volume. Cell size distribution differs...

  20. Podosphaera xanthii but not Golovinomyces cichoracearum infects Cucurbits in a Greenhouse at Salinas, California

    Science.gov (United States)

    Two fungal species are the primary causes of cucurbit powdery mildew (CPM): Podosphaera xanthii and Golovinomyces cichoracearum. CPM on melon (Cucumis melo L.), cucumber (C. sativus L.) and summer squash (Cucurbita pepo L.) in a greenhouse at Salinas, California in winter 2011 was confirmed to be in...

  1. Antioxidant activity of three microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbana clone Tahiti

    Science.gov (United States)

    Widowati, Ita; Zainuri, Muhammad; Pancasakti Kusumaningrum, Hermien; Susilowati, Ragil; Hardivillier, Yann; Leignel, Vincent; Bourgougnon, Nathalie; Mouget, Jean-Luc

    2017-02-01

    Natural alternatives antioxidant source has become a trending topic in the past decades to replace synthetic antioxidant. Microalgae have been mentioned to show interesting bioactive properties and one of them is its antioxidant activity. This study aims to evaluate the potential of three microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbanaas new source of natural antioxidant. Proximate analysis and total phenolic content of D. salina, T. chuii and I. galbanas were determined. Antioxidant activity of methanolic extracts of these three species prepared in different concentration (50, 100, 250, 500, and 1000 ppm) was performed through DPPH assay. I. galbana clone Tahiti demonstrated a highest antioxidant potential with 61.64 of inhibition at 50 ppm followed by D. salina with 58.45 % of inhibition and T. chuii with 52.58 % of inhibition. I. galbana clone Tahiti was the best antioxidant with total phenol content of 17.798 mg GAE g-1 extract at 50 ppm; followed by T. chuii 16.868 mg GAE g-1 extract and the lowest was D. salina with 4.672 mg GAE g-1 extract. Results suggest that these microalgae posses antioxidant potential which could be considered for future applications in medicine, dietary supplements, cosmetics or food industries.

  2. Hepatoprotective and antioxidant activity of dunaliella salina in paracetamol-induced acute toxicity in rats

    Directory of Open Access Journals (Sweden)

    Fedekar F Madkour

    2013-01-01

    Full Text Available Paracetamol has a reasonable safety profile when taken in therapeutic doses. However, it could induce hepatotoxicity and even more severe fatal acute hepatic damage when taken in an overdose. The green alga, Dunaliella salina was investigated for hepatoprotective and antioxidant activity against paracetamol-induced liver damage in rats. Male albino Wistar rats overdosed with paracetamol showed liver damage and oxidative stress as indicated by significantly (P<0.05 increased serum levels of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide. At the same time, there were decreased activities of serum superoxide dismutase and total antioxidant capacity compared with the control group. Treatment with D. salina methanol extract at doses of 500 and 1000 mg/kg body weight or silymarin could significantly (P<0.05 decrease the liver damage marker enzymes, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide levels and increase the activities of superoxide dismutase and total antioxidant capacity in serum when compared with paracetamol intoxicated group. Liver histopathology also showed that D. salina reduced the centrilobular necrosis, congestion and inflammatory cell infiltration evoked by paracetamol overdose. These results suggest that D. salina exhibits a potent hepatoprotective effect on paracetamol-induced liver damage in rats, which may be due to both the increase of antioxidant enzymes activity and inhibition of lipid peroxidation.

  3. Hepatoprotective and Antioxidant Activity of Dunaliella salina in Paracetamol-induced Acute Toxicity in Rats.

    Science.gov (United States)

    Madkour, Fedekar F; Abdel-Daim, M M

    2013-11-01

    Paracetamol has a reasonable safety profile when taken in therapeutic doses. However, it could induce hepatotoxicity and even more severe fatal acute hepatic damage when taken in an overdose. The green alga, Dunaliella salina was investigated for hepatoprotective and antioxidant activity against paracetamol-induced liver damage in rats. Male albino Wistar rats overdosed with paracetamol showed liver damage and oxidative stress as indicated by significantly (P<0.05) increased serum levels of aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide. At the same time, there were decreased activities of serum superoxide dismutase and total antioxidant capacity compared with the control group. Treatment with D. salina methanol extract at doses of 500 and 1000 mg/kg body weight or silymarin could significantly (P<0.05) decrease the liver damage marker enzymes, total and direct bilirubin, malondialdehyde, cholesterol and nitric oxide levels and increase the activities of superoxide dismutase and total antioxidant capacity in serum when compared with paracetamol intoxicated group. Liver histopathology also showed that D. salina reduced the centrilobular necrosis, congestion and inflammatory cell infiltration evoked by paracetamol overdose. These results suggest that D. salina exhibits a potent hepatoprotective effect on paracetamol-induced liver damage in rats, which may be due to both the increase of antioxidant enzymes activity and inhibition of lipid peroxidation.

  4. Construction of a System for the Stable Expression of Foreign Genes in Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    GENGDe-Gui; HANYan; WANGYi-Qin; WANGPeng; ZHANGLi-Ming; LIWen-Bin; SUNYong-Ru

    2004-01-01

    A stable transformation system for the expression of foreign genes in the unicellular greenmarine alga (Dunaliella salina Teod.) was established. Using electroporation, the alga was transformed witha plasmid containing the hepatitis B surface antigen (HBsAg) gene and the chloramphenicol acetyltransferase(CAT) gene as a selectable gene. PCR and Southern blotting analysis indicated that the HBsAEgene wasintegrated into the D. salina genome. Northern dotting analysis showed that the HBsAg gene was expressedat the mRNA level. The stable expression of HBsAg protein in transformants was confirmed by HBsAgenzyme-linked immunosorbent assay (HBsAg EUSA) and Western blotting analysis. Also, PCR and Southernblotting analyses showed that the CA Tgene was integrated into the D, salina genome, and CAT EUSAindicated that CAT protein was stably expressed in the cells. The introduced HBsAg DNA and HBsAgprotein expression were stably maintained for at least 60 generations in media devoid of chloramphenicol.This is the first report of the stable expression of foreign genes in D. salina.

  5. First report of plant-parasitic nematode Meloidoderita salina in the Netherlands

    NARCIS (Netherlands)

    Ashrafi, S.; Helder, J.; Elsen, van den S.J.J.; Jansen, M.; Karssen, G.

    2014-01-01

    After the description of the root-parasitic nematode Meloidoderita salina from a tidal salt marsh in France (1), an additional sampling was carried out to search for the presence of this unusual nematode in a tidal salt marsh area close to Sint-Annaland, province Zeeland in the Netherlands. In Augus

  6. Dichotomosiphon salina sp. nov. - a new marine algal form from Goa estuary, India

    Digital Repository Service at National Institute of Oceanography (India)

    Untawale, A; Jagtap, T.G.; Dhargalkar, V.K.

    A new species Dichotomosiphon salina sp. of family Vaucheriaceae has been reported from brackish water areas of Goa. The high salinity tolerance of 40 ppt and the variation in size as well as shape of the reproductive organs are the main...

  7. Spatial scale and the diversity of benthic cyanobacteria and diatoms in a salina

    DEFF Research Database (Denmark)

    Nübel, U.; Garcia-Pichel, F.; Kühl, Michael

    1999-01-01

    We characterized the richness of benthic cyanobacteria and diatoms in a salina system using traditional and molecular biological methods. After determining the different morphotypes and 16S rRNA genes present in various localities within this hypersaline system, an analysis of the increase...

  8. RIBONUCLEASE ACTIVITY OF DUNALIELLA SALINA (CHLOROPHYTA) UNDER HYPEROSMOTIC SHOCKS

    Institute of Scientific and Technical Information of China (English)

    LuShan; ZhangXiaoning; XiaZhonghao; LiuZhili

    1998-01-01

    The unicellular green alga Dunaliella salina Teod. can acclimate to and grow over a wide range of salinities ,from that less than seawater to saturated. The alga responds to osmotic shocks by the metabolisms of intracellular glycerol,and can change the cell volume

  9. Selective extraction of carotenoids from microalga Dunadiella salina with retention of viability

    NARCIS (Netherlands)

    Hejazi, M.A.; Lamarliere, de C.; Rocha, J.M.S.; Vermuë, M.; Tramper, J.; Wijffels, R.H.

    2002-01-01

    Simultaneous production and selective extraction of -carotene from living cells of Dunaliella salina in a two-phase system of aqueous and organic phases has been investigated. Solvents with values of log Poctanol, which denotes hydrophobicity of a compound, ranging from 3 to 9 were used as organic

  10. Exploring and exploiting carotenoid accumulation in Dunaliella salina for cell-factory applications

    NARCIS (Netherlands)

    Lamers, P.P.; Janssen, M.G.J.; Vos, de C.H.; Bino, R.J.; Wijffels, R.H.

    2008-01-01

    The unicellular alga Dunaliella salina is the most interesting cell factory for the commercial production of ß-carotene because this species accumulates carotenoids to high concentrations. Nevertheless, little is known about the underlying mechanisms of carotenoid accumulation. Here, we review the

  11. Selective extraction of carotenoids from microalga Dunadiella salina with retention of viability

    NARCIS (Netherlands)

    Hejazi, M.A.; Lamarliere, de C.; Rocha, J.M.S.; Vermuë, M.; Tramper, J.; Wijffels, R.H.

    2002-01-01

    Simultaneous production and selective extraction of -carotene from living cells of Dunaliella salina in a two-phase system of aqueous and organic phases has been investigated. Solvents with values of log Poctanol, which denotes hydrophobicity of a compound, ranging from 3 to 9 were used as organic p

  12. Milking microalga Dunaliella salina for Beta-carotene production in two-phase bioreactors

    NARCIS (Netherlands)

    Hejazi, M.; Holwerda, E.; Wijffels, R.H.

    2004-01-01

    A new method was developed for production of beta-carotene from Dunaliella salina. Cells were grown in low light intensity and then transferred to a production bioreactor illuminated at a higher light intensity. It was a two-phase bioreactor consisting of an aqueous and a biocompatible organic phase

  13. Carbon source utilization by the marine Dendryphiella species D. arenaria and D. salina.

    Science.gov (United States)

    dela Cruz, Thomas Edison E; Schulz, Barbara E; Kubicek, Christian P; Druzhinina, Irina S

    2006-12-01

    Carbon utilization by the marine Dendryphiella species, D. arenaria and D. salina, was investigated to detect differences in utilization and traits associated with their adaptation to the marine habitat. Fifty-four strains were isolated world-wide and tested for the utilization of various carbon sources using BIOLOG phenotype MicroArray (PM) and for the production of extracellular enzymes on solid culture media and on API ZYM assay strips. PM analysis showed that the fastest growth occurred on several monosaccharides and amino acids, 2-keto-d-gluconic acid, succinamide and turanose. Some polyols were poor carbon sources. However, the two species differed in their utilization rates of carbon sources, forming three major clusters: two separate clusters for D. arenaria and D. salina and a third cluster in which strains of the two species formed separate subclades that correlated with geographic origin. Several carbon sources were also found useful in differentiating the two speices. Dendryphiella salina did not utilize xylitol and quinic acid, whereas D. arenaria grew well on these substrates. The latter failed to grow on sorbitol and grew slowly on mannitol, both were good substrates for the former. There were also no qualitative differences between the extracellular enzymes produced, although laccase and peroxidase activities were confined only to some strains. The physiological similarities exhibited by the two species support the close relationship between D. arenaria and D. salina.

  14. [Study of a DNA sequence from brine shrimp artemia containing a novel DM domain].

    Science.gov (United States)

    Zeng, Hui; Song, Wen Qin; Chen, Rui Yang

    2004-10-01

    Sex-determining mechanisms are highly variable between phyla. However, there is an apparent exception in which structurally and functionally related genes control sex determination in different phyla: the sexual regulators DSX of Drosophila melanogaster and MAB-3 of Caenorhabditis elegans both containing a DNA-binding motif, DM domain. Proteins containing the domain may also play a role in sexual development of vertebrates. For examples, both the human DMRT1 (doublesex and mab-3 related transcription factor 1) gene and mouse Dmrt1 gene are necessary for male development. In this paper, through the degenerated PCR, a DNA fragment ADM was amplified out from genomic DNA of brine shrimp, Artemia sinica from YunCheng Salt Lake, Shanxi, China and Artemia parthenogenetica from GaHai, Qinghai, China, respectively. ADM encodes 47 amino acids and is highly homologous to amino acid sequence of the known DM domains. By comparing total of 27 DM domains in distant related species, a phylogenic tree of DM domain was constructed. In the tree, these DM domains were divided into different branches according to their subtypes. Among the DM domains that were compared, ADM is most homologous to the DM domain contained in human DMRT3 and mouse Dmrt3, which shares 83% identity between them. In addition, the same length of ADM could also be amplified out from cDNA of Artemia sinica and Artemia parthenogenetica, which indicated that ADM was expressed and located in one exon. The DM domain in brine shrimp reported here would make it possible for cloning the full-length cDNA containing the DM domain and further elucidating their functions.

  15. The transcription factor p8 regulates autophagy during diapause embryo formation in Artemia parthenogenetica.

    Science.gov (United States)

    Lin, Cheng; Jia, Sheng-Nan; Yang, Fan; Jia, Wen-Huan; Yu, Xiao-Jian; Yang, Jin-Shu; Yang, Wei-Jun

    2016-07-01

    Autophagy is an essential homeostatic process by which cytoplasmic components, including macromolecules and organelles, are degraded by lysosome. Increasing evidence suggests that phosphorylated AMP-activated protein kinase (p-AMPK) and target of rapamycin (TOR) play key roles in the regulation of autophagy. However, the regulation of autophagy in quiescent cells remains unclear, despite the fact that autophagy is known to be critical for normal development, regeneration, and degenerative diseases. Here, crustacean Artemia parthenogenetica was used as a model system because they produced and released encysted embryos that enter a state of obligate dormancy in cell quiescence to withstand various environmental threats. We observed that autophagy was increased before diapause stage but dropped to extremely low level in diapause cysts in Artemia. Western blot analyses indicated that the regulation of autophagy was AMPK/TOR independent during diapause embryo formation. Importantly, the level of p8 (Ar-p8), a stress-inducible transcription cofactor, was elevated at the stage just before diapause and was absent in encysted embryos, indicating that Ar-p8 may regulate autophagy. The results of Ar-p8 knockdown revealed that Ar-p8 regulated autophagy during diapause formation in Artemia. Moreover, we observed that activating transcription factors 4 and 6 (ATF4 and ATF6) responded to Ar-p8-regulated autophagy, indicating that autophagy targeted endoplasmic reticulum (ER) during diapause formation in Artemia. Additionally, AMPK/TOR-independent autophagy was validated in human gastric cancer MKN45 cells overexpressing Ar-p8. The findings presented here may provide insights into the role of p8 in regulating autophagy in quiescent cells.

  16. Groundwater quality in the Monterey Bay and Salinas Valley groundwater basins, California

    Science.gov (United States)

    Kulongoski, Justin T.; Belitz, Kenneth

    2011-01-01

    The Monterey-Salinas study unit is nearly 1,000 square miles and consists of the Santa Cruz Purisima Formation Highlands, Felton Area, Scotts Valley, Soquel Valley, West Santa Cruz Terrace, Salinas Valley, Pajaro Valley, and Carmel Valley groundwater basins (California Department of Water Resources, 2003; Kulongski and Belitz, 2011). These basins were grouped into four study areas based primarily on geography. Groundwater basins in the north were grouped into the Santa Cruz study area, and those to the south were grouped into the Monterey Bay, the Salinas Valley, and the Paso Robles study areas (Kulongoski and others, 2007). The study unit has warm, dry summers and cool, moist winters. Average annual rainfall ranges from 31 inches in Santa Cruz in the north to 13 inches in Paso Robles in the south. The study areas are drained by several rivers and their principal tributaries: the Salinas, Pajaro, and Carmel Rivers, and San Lorenzo Creek. The Salinas Valley is a large intermontane valley that extends southeastward from Monterey Bay to Paso Robles. It has been filled, up to a thickness of 2,000 feet, with Tertiary and Quaternary marine and terrestrial sediments that overlie granitic basement. The Miocene-age Monterey Formation and Pliocene- to Pleistocene-age Paso Robles Formation, and Pleistocene to Holocene-age alluvium contain freshwater used for supply. The primary aquifers in the study unit are defined as those parts of the aquifers corresponding to the perforated intervals of wells listed in the California Department of Public Health database. Public-supply wells are typically drilled to depths of 200 to 650 feet, consist of solid casing from the land surface to depths of about 175 to 500 feet, and are perforated below the solid casing. Water quality in the primary aquifers may differ from that in the shallower and deeper parts of the aquifer system. Groundwater movement is generally from the southern part of the Salinas Valley north towards the Monterey Bay

  17. Essential oils of Nigella sativa protects Artemia from the pathogenic effect of Vibrio parahaemolyticus Dahv2.

    Science.gov (United States)

    Manju, Sivalingam; Malaikozhundan, Balasubramanian; Withyachumnarnkul, Boonsirm; Vaseeharan, Baskaralingam

    2016-05-01

    The anti-Vibrio activity of essential oils (EOs) of nine medicinal plants was tested against 28 Vibrio spp. isolated from diseased Fenneropenaeus indicus. EO of Nigella sativa exhibited anti-Vibrio activity against all Vibrio spp. and greater inhibition was noted for the isolate V2 which was identified as Vibrio parahaemolyticus Dahv2. Further, EO of N. sativa effectively inhibited V. parahaemolyticus Dahv2 with an inhibition zone of 23.9mm at 101.2μgml(-1). Moreover, EO of N. sativa revealed anti-biofilm activity at 101.2μgml(-1) against V. parahaemolyticus Dahv2 and inhibited the growth of V. parahaemolyticus Dahv2 at 100μgml(-1).In vivo experimental infection studies showed that the survival of Artemia spp. infected with V. parahaemolyticus Dahv2 at 1×10(3)cfuml(-1) was only 40%. However, the survival of Artemia spp. was significantly increased after challenge with 100μgml(-1) of EO of N. sativa. EO of N. sativa showed higher anti-oxidant potential and total phenol content than other EOs tested. The anti-oxidant activity of EO of N. sativa was highly correlated to their total phenolic contents (r=0.836, P<0.05). This observation suggests that EO of N. sativa protected the Artemia spp. after experimental infection of V. parahaemolyticus Dahv2. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. On a parthenogenetic population of Artemia (Crustacea, Branchiopoda from Algeria (El-Bahira, Sétif

    Directory of Open Access Journals (Sweden)

    Mounia Amarouayache

    2015-12-01

    Full Text Available The brine shrimp Artemia is a small crustacean of hypersaline lakes which is commonly used in larviculture. The parthenogenetic population of Artemia from El-Bahira Lake (10 ha area, situated in the High Plateaus of Northeastern Algeria (1034 m alt, has been characterized and surveyed during two hydroperiods of 2009 and 2013. Contrary to other known parthenogenetic populations, which develop in hot seasons and reproduce by ovoviviparity, Artemia from El-Bahira was found to develop only in cold seasons (winter and spring, even if the lake doesn’t dry in summer. It reproduces by oviparity and produces few cysts (5.69 ± 3.6 and 98.00 ± 28.32 offsprings/brood. Individual density was much lower during the hydroperiod of 2013, whereas fecundity was higher than in the previous hydroperiod (2009. Cyst reserve was estimated at 133.13 kg of dry weight which corresponds to a rate of 13.31 kg.ha-1.

  19. The study of fkbp and ubiquitin reveals interesting aspects of Artemia stress history.

    Science.gov (United States)

    Maniatsi, Stefania; Farmaki, Theodora; Abatzopoulos, Theodore J

    2015-08-01

    Research on stress responses in animals has increased greatly during the last decades. Though most studies focus on the cellular and molecular bases of the stress response mechanisms, the ecological and evolutionary aspects of stress responses gain more and more interest. Here, we use species and parthenogenetic strains of the genus Artemia, an extremophile model organism, to study, for the first time, a protein well known for its chaperone activity and its involvement in stress responses. More specifically, transcription and protein accumulation of an FK506-Binding Protein (FKBP) homologue were investigated under heat and salt stresses. Additionally, the mRNA levels of ubiquitin, a heat-inducible protein related to the proteasomal pathway, were quantitated under these conditions. Biochemical and phylogenetic analyses showed that the studied FKBP orthologue is a typical representative of the family that clusters with other crustacean sequences. The expression was increased in both fkbp and ubiquitin genes after salt and heat stresses. However, our results in combination with the fact that Artemia species and parthenogenetic strains, selected for this study, exhibit different heat or salt tolerance provide useful hints about the evolutionary significance of FKBP and ubiquitin. Regarding FKBP, mRNA expression and protein accumulation seem to depend on the environmental conditions and the evolutionary history of each Artemia population while ubiquitin has a clear and more conserved role under heat shock.

  20. Mechanisms associated with cellular desiccation tolerance of Artemia encysted embryos from locations around the world.

    Science.gov (United States)

    Hengherr, Steffen; Schill, Ralph O; Clegg, J S

    2011-10-01

    Using differential scanning calorimetry we demonstrated the presence of biological glasses and measured the glass transition temperatures (Tg) in dry encysted gastrula embryos (cysts) of the brine shrimp, Artemia, from eleven different locations, two of which provided cysts from parthenogenetic animals. Values for Tg were highest, by far, in Artemia franciscana cysts from the Mekong Delta, Vietnam (VN), these cysts having been produced from previous sequential inoculations into growth ponds of cysts from the San Francisco Bay, California, USA. Tg values for three groups of A. franciscana cysts were significantly higher than those of other cysts (except those of Artemia persimilis) studied here, as well as all other desiccation-tolerant animal systems studied to date. We also measured three stress proteins (hsc70, artemin and p26) in all these cysts as well as the total alcohol soluble carbohydrates (ASC), about 90% of which is the disaccharide trehalose, a known component of biological glasses. We interpret the results in terms of mechanisms involved with desiccation tolerance and, to some extent, with thermal conditions at the sites of cyst collection.

  1. Automatic Estimation of Artemia Hatching Rate Using an Object Discrimination Method

    Directory of Open Access Journals (Sweden)

    Sung Kim

    2013-09-01

    Full Text Available Digital image processing is a process to analyze a large volume of information on digital images. In this study, Artemia hatching rate was measured by automatically classifying and counting cysts and larvae based on color imaging data from cyst hatching experiments using an image processing technique. The Artemia hatching rate estimation consists of a series of processes; a step to convert the scanned image data to a binary image data, a process to detect objects and to extract their shape information in the converted image data, an analysis step to choose an optimal discriminant function, and a step to recognize and classify the objects using the function. The function to classify Artemia cysts and larvae is optimally estimated based on the classification performance using the areas and the plan-form factors of the detected objects. The hatching rate using the image data obtained under the different experimental conditions was estimated in the range of 34-48%. It was shown that the maximum difference is about 19.7% and the average root-mean squared difference is about 10.9% as the difference between the results using an automatic counting (this study and a manual counting were compared. This technique can be applied to biological specimen analysis using similar imaging information.

  2. Regulation of trehalase expression inhibits apoptosis in diapause cysts of Artemia.

    Science.gov (United States)

    Yang, Fan; Chen, Su; Dai, Zhong-Min; Chen, Dian-Fu; Duan, Ru-Bing; Wang, Hong-Liang; Jia, Sheng-Nan; Yang, Wei-Jun

    2013-12-01

    Trehalase, which specifically hydrolyses trehalose into glucose, plays an important role in the metabolism of trehalose. Large amounts of trehalose are stored in the diapause encysted embryos (cysts) of Artemia, which are not only vital to their extraordinary stress resistance, but also provide a source of energy for development after diapause is terminated. In the present study, a mechanism for the transcriptional regulation of trehalase was described in Artemia parthenogenetica. A trehalase-associated protein (ArTAP) was identified in Artemia-producing diapause cysts. ArTAP was found to be expressed only in diapause-destined embryos. Further analyses revealed that ArTAP can bind to a specific intronic segment of a trehalase gene. Knockdown of ArTAP by RNAi resulted in the release of cysts with coarse shells in which two chitin-binding proteins were missing. Western blotting showed that the level of trehalase was increased and apoptosis was induced in these ArTAP-knockdown cysts compared with controls. Taken together, these results show that ArTAP is a key regulator of trehalase expression which, in turn, plays an important role in trehalose metabolism during the formation of diapause cysts.

  3. Laboratory generation of new parthenogenetic lineages supports contagious parthenogenesis in Artemia

    Directory of Open Access Journals (Sweden)

    Marta Maccari

    2014-06-01

    Full Text Available Contagious parthenogenesis—a process involving rare functional males produced by a parthenogenetic lineage which mate with coexisting sexual females resulting in fertile parthenogenetic offspring—is one of the most striking mechanisms responsible for the generation of new parthenogenetic lineages. Populations of the parthenogenetic diploid brine shrimp Artemia produce fully functional males in low proportions. The evolutionary role of these so-called Artemia rare males is, however, unknown. Here we investigate whether new parthenogenetic clones could be obtained in the laboratory by mating these rare males with sexual females. We assessed the survival and sex ratio of the hybrid ovoviviparous offspring from previous crosses between rare males and females from all Asiatic sexual species, carried out cross-mating experiments between F1 hybrid individuals to assess their fertility, and estimated the viability and the reproductive mode of the resulting F2 offspring. Molecular analysis confirmed the parentage of hybrid parthenogenetic F2. Our study documents the first laboratory synthesis of new parthenogenetic lineages in Artemia and supports a model for the contagious spread of parthenogenesis. Our results suggest recessive inheritance but further experiments are required to confirm the likelihood of the contagious parthenogenesis model.

  4. Characterizing the Leaching Behavior of Coal Combustion Residues using the Leaching Environmental Assessment Framework (LEAF) to Inform Future Management Decisions

    Science.gov (United States)

    Abstract for presentation on Characterizing the Leaching Behavior of Coal Combustion Residues using the Leaching Environmental Assessment Framework (LEAF) to Inform Future Management Decisions. The abstract is attached.

  5. Garcilaso de la Vega y Pedro Salinas: la voz a ti debida

    Directory of Open Access Journals (Sweden)

    Escarpín Gual, Montserrat

    2008-12-01

    Full Text Available This paper shows the relationship between two Spanish writers: Garcilaso de la Vega and Pedro Salinas; or better, the influence of the former over the latter. This influence may be noticed in different levels: the use of literary genres (eclogues, elegies or collections of verse, the conception of love, the use of myths and topics, the music of verse, etc. Some characteristics of Salinas’s style come clearly from Garcilaso (the intimacy, simplicity, orality, the dialogue, the use of the present tense and the first person, etc.. Our essay studies the influence of Garcilaso on the book Largo lamento, 1937?, written by Salinas at the same time as an essay about the renaissance poet —in addition of other unpublished works and his personal correspondence—, in order to show the presence of Garcilaso in his mind and all of his production.El artículo muestra la relación entre dos escritores españoles: Garcilaso de la Vega y Pedro Salinas; o mejor, la influencia del primero sobre el segundo. Esta puede observarse en diferentes niveles: el uso de géneros literarios (églogas, elegías o cancioneros, la concepción del amor, el uso de mitos y tópicos, la música del verso, etc. Algunas características del estilo de Salinas proceden claramente de Garcilaso (el intimismo, la sencillez, la oralidad, el empleo del diálogo, el presente verbal, la primera persona, etc.. Nuestro ensayo estudia la incidencia de Garcilaso en el libro Largo lamento, 1937?, que Salinas escribió en paralelo a un ensayo sobre el poeta renacentista —además de otros trabajos inéditos y su correspondencia personal—, para mostrar la presencia de Garcilaso en su pensamiento y en su producción.

  6. Leaching from municipal solid waste incineration residues

    Energy Technology Data Exchange (ETDEWEB)

    Hyks, J.

    2008-02-15

    Leaching of pollutants from Municipal Solid Waste Incineration (MSWI) residues has been investigated combining a range of laboratory leaching experiments with geochemical modeling. Special attention was paid to assessing the applicability of laboratory data for subsequent modeling with respect to presumed full-scale conditions; both sample pretreatment and actual influence of leaching conditions on the results of laboratory experiments were considered. It was shown that sample pretreatment may have large impact on leaching test data. In particular, a significant fraction of Pb was shown mobile during the washing of residues with water. In addition, drying of residues (i.e. slow oxidation) prior to leaching experiments increased the leaching of Cr significantly. Significant differences regarding the leaching behavior of individual elements with respect to (non)equilibrium conditions in column percolation experiments were observed in the study. As a result, three groups of elements were identified based on the predominant leaching control and the influence of (non)equilibrium on the results of the laboratory column experiments: I. Predominantly availability-controlled elements (e.g. Na, K, Cl) II. Solubility-controlled elements (e.g. Ca, S, Si, Al, Ba, and Zn) III. Complexation-controlled elements (e.g. Cu and Ni) With respect to the above groups it was suggested that results of laboratory column experiments can, with consideration, be used to estimate full-scale leaching of elements from Group I and II. However, in order to avoid large underestimations in the assessment of leaching from Group III, it is imperative to describe the time-dependent transport of dissolved organic carbon (DOC) in the tested system or to minimize the physical non-equilibrium during laboratory experiments (e.g. bigger column, slower flow velocity). Forward geochemical modeling was applied to simulate long-term release of elements from a MSWI air-pollution-control residue. Leaching of a

  7. Environmental Quality Research-Fate of Toxic Jet Fuel Components in Aquatic Systems

    Science.gov (United States)

    1981-12-01

    literature suggests that the maximum growt rate of Chlorella vulgaris is almost certainly between 1.5 and 2.5 days at water temperatures near 25°C...and D.A. Bengtson. 1980. Nutrition in aquatic toxicology: diet quality of geographical strains of brine shrimp, Artemia app. Proc. Symp. Aquatic...et physiologique sur le d6veloppement d’Artemia salina Leach. Archs. Zool. exp. gen. 99: 1-134. Goulden, C.E. and L.L. Hornig. 1980. The nutrition of

  8. Cytological, molecular and life cycle characterization of Anostracospora rigaudi n. g., n. sp. and Enterocytospora artemiae n. g., n. sp., two new microsporidian parasites infecting gut tissues of the brine shrimp Artemia.

    Science.gov (United States)

    Rode, Nicolas Olivier; Landes, Julie; Lievens, Eva J P; Flaven, Elodie; Segard, Adeline; Jabbour-Zahab, Roula; Michalakis, Yannis; Agnew, Philip; Vivarès, Christian P; Lenormand, Thomas

    2013-08-01

    Two new microsporidia, Anostracospora rigaudi n. g., n. sp., and Enterocytospora artemiae n. g., n. sp. infecting the intestinal epithelium of Artemia parthenogenetica Bowen and Sterling, 1978 and Artemia franciscana Kellogg, 1906 in southern France are described. Molecular analyses revealed the two species belong to a clade of microsporidian parasites that preferentially infect the intestinal epithelium of insect and crustacean hosts. These parasites are morphologically distinguishable from other gut microsporidia infecting Artemia. All life cycle stages have isolated nuclei. Fixed spores measure 1·3×0·7 μm with 5-6 polar tube coils for A. rigaudi and 1·2×0·9 μm with 4 polar tube coils for E. artemiae. Transmission of both species is horizontal, most likely through the ingestion of spores released with the faeces of infected hosts. The minute size of these species, together with their intestinal localization, makes their detection and identification difficult. We developed two species-specific molecular markers allowing each type of infection to be detected within 3-6 days post-inoculation. Using these markers, we show that the prevalence of these microsporidia ranges from 20% to 75% in natural populations. Hence, this study illustrates the usefulness of molecular approaches to study prevalent, but cryptic, infections involving microsporidian parasites of gut tissues.

  9. Preliminary study of the molluscicidal and larvicidal properties of some essential oils and phytochemicals from medicinal plants Estudo preliminar das propriedades moluscicidas e larvicidas de alguns óleos essenciais e fitoconstituintes de plantas medicinais

    OpenAIRE

    Leite,Aristides M.; Lima, Edeltrudes de O.; Evandro L. de Souza; Margareth de F. F. M. Diniz; Sônia Pereira Leite; Aline L. Xavier; Medeiros,Isac A. de

    2009-01-01

    This study aimed to evaluate the molluscicidal and larvicidal activity of some essential oils and phytochemicals from medicinal plants. Molluscicide and larvicidal activity were determined by, respectively, the lethality bioassays using Artemia salina Leach. Artemiidae and Aedes aegypti L. Culicidae larvae. Essential oils from Eugenia uniflora L. Myrtaceae, Laurus nobilis L. Lauraceae, Origanum vulgare L. Lamiaceae and the phytochemicals α-pinene and eugenol presented citotoxicity toward...

  10. Preliminary study of the molluscicidal and larvicidal properties of some essential oils and phytochemicals from medicinal plants

    OpenAIRE

    Leite,Aristides M.; Lima, Edeltrudes de O.; Evandro L. de Souza; Margareth de F. F. M. Diniz; Leite, Sônia Pereira; Aline L. Xavier; Medeiros,Isac A. de

    2009-01-01

    This study aimed to evaluate the molluscicidal and larvicidal activity of some essential oils and phytochemicals from medicinal plants. Molluscicide and larvicidal activity were determined by, respectively, the lethality bioassays using Artemia salina Leach. Artemiidae and Aedes aegypti L. Culicidae larvae. Essential oils from Eugenia uniflora L. Myrtaceae, Laurus nobilis L. Lauraceae, Origanum vulgare L. Lamiaceae and the phytochemicals α-pinene and eugenol presented citotoxicity toward...

  11. Bioensayos en especies de bodens con actividad terapéutica

    OpenAIRE

    Gorriti Gutiérrez, Arilmi; Zárate Otarola, Rosa; Jurado Texeira, Bertha

    2014-01-01

    Bidens pilosa L. and Bidens pilosa variedad minor of Asteraceae family, are known by the common name of 'amor seco'. The biological assays were started with bioassay of Artemia salina Leach, the Biden species showed both, in aqueous and ethanolic extracts bioactivity. In these species it was carried out the pharmacognosy screening that featured the chemical principies of samples. It was identified carbohidrates, condensed tannins, phenolic compounds, flavonoids, steroids and sesquiterpenic la...

  12. La columna, el circulo y sus variantes en la poesia primera de Pedro Salinas (The Vertical Line, the Circle, and other Geometric Varieties in the Early Poetry of Pedro Salinas)

    Science.gov (United States)

    De Armas, Jose R.

    1970-01-01

    Interprets Salinas' use of geometric figures for depicting concepts of time and infinity, and for portraying idealism and realism (the vertical line is idealism, perfection; the circle stands for reality and imperfection). (DS)

  13. La columna, el circulo y sus variantes en la poesia primera de Pedro Salinas (The Vertical Line, the Circle, and other Geometric Varieties in the Early Poetry of Pedro Salinas)

    Science.gov (United States)

    De Armas, Jose R.

    1970-01-01

    Interprets Salinas' use of geometric figures for depicting concepts of time and infinity, and for portraying idealism and realism (the vertical line is idealism, perfection; the circle stands for reality and imperfection). (DS)

  14. Watchdog-LEACH: A new method based on LEACH protocol to Secure Clustered Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Rohbanian

    2013-07-01

    Full Text Available Wireless sensor network comprises of small sensor nodes with limited resources. Clustered networks have been proposed in many researches to reduce the power consumption in sensor networks. LEACH is one of the most interested techniques that offer an efficient way to minimize the power consumption in sensor networks. However, due to the characteristics of restricted resources and operation in a hostile environment, WSNs are subjected to numerous threats and are vulnerable to attacks. This research proposes a solution that can be applied on LEACH to increase the level of security. In Watchdog-LEACH, some nodes are considered as watchdogs and some changes are applied on LEACH protocol for intrusion detection. Watchdog-LEACH is able to protect against a wide range of attacks and it provides security, energy efficiency and memory efficiency. The result of simulation shows that in comparison to LEACH, the energy overhead is about 2% so this method is practical and can be applied to WSNs.

  15. Efficacy of heterologous and homologous heat shock protein 70s as protective agents to Artemia franciscana challenged with Vibrio campbellii.

    Science.gov (United States)

    Baruah, Kartik; Ranjan, Jayant; Sorgeloos, Patrick; Bossier, Peter

    2010-11-01

    The Hsp70 class of heat shock proteins (Hsps) has been implicated at multiple points in the immune response of both vertebrates and invertebrates. This class of chaperones is highly conserved in both sequence and structure, from prokaryotes to higher eukaryotes. In view of their high degree of homology, it was assumed that these Hsp70 proteins derived either from the prokaryotes or eukaryotes would have similar functions, especially in relation to their protective ability in a challenge assay. To verify this, we compared two evolutionary diverse Hsp70s, Artemia Hsp70 and Escherichia coli Hsp70 equivalent DnaK (each overproduced in E.coli), for their ability to protect Artemia against Vibrio challenge. Results showed that Artemia fed with E. coli producing Artemia Hsp70 or DnaK proteins, as assessed by immune-probing in western blots, survived better in a Vibrio challenge assay. The observed effects could be due to enhancement of the Artemia immune system as phenoloxidase activity was found to be increased by these proteins. These two Hsp70 proteins exhibit a high degree of homology, particularly in the peptide-binding domain (the putative innate immunity-activating portion) with 59.6% identity, indicating that the observed protective capacity of homologous or heterologous Hsp70 proteins might reside within this peptide-binding domain.

  16. Effect of Tetrachloroethylene on Sphalerite Leaching

    Institute of Scientific and Technical Information of China (English)

    王兴尧; 彭鹏; 谢慧琴; 卢立柱

    2004-01-01

    The effects of tetrachloroethylene (C2C14) on sphalerite leaching in FeCl3-HCl wereinvestigated in view of simultaneous mass transfer and reaction, and the leaching models with andwithout organic solvent C2Cl4 were derived. The leaching experiments and the SEM results show thatC2C14 is an effective organic solvent for sphalerite leaching in FeC13-HC1 system to be accelerated andfor the sulfur to be separated. Adding C2C14 in the FeCl3-HC1 medium will turn the kinetic modelcontrolled by sulfur layer diffusion with process activation energy of 67.9 kJ/mol into mixed diffusionwith the energy reduced to 55.1 kJ/mol when 20 ml of C2C14 was added.

  17. YACON INULIN LEACHING DURING HOT WATER BLANCHING

    National Research Council Canada - National Science Library

    Scher, Caroline Fenner; Brandelli, Adriano; Noreña, Caciano Zapata

    2015-01-01

    .... However, inulin is very soluble in water. The loss of this important nutrient during blanching is caused mainly by diffusion or leaching, which might be diminished if blanching temperature - time conditions are correctly employed...

  18. Feeding of the brine shrimp Artemia on yeast: effect of mechanical disturbance, animal density, water quality and light intensity

    OpenAIRE

    Coutteau, P. (Peter); Sorgeloos, P.

    1989-01-01

    Details are given of experiments conducted to determine the effects of tank culture conditions on the feeding of Artemia. Mechanical disturbance, animal density and water quality were found to affect the feeding rate of Artemia. The importance of culture conditions in maintaining a rate of food consumption which does not limit the growth of the brine shrimp is stressed.

  19. The effects of feeding with synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia on skin mucus immune responses, stress resistance, intestinal microbiota and performance of angelfish (Pterophyllum scalare).

    Science.gov (United States)

    Azimirad, Mahmood; Meshkini, Saeed; Ahmadifard, Nasrollah; Hoseinifar, Seyed Hossein

    2016-07-01

    The aim of this study was to evaluate the effects of feeding on synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia franciscana on skin mucus immune responses, stress resistance, intestinal microbiota and growth performance of angelfish (Pterophyllum scalare). Three hundred and sixty fish with initial weight 3.2 ± 0.13 g were randomly divided into twelve aquaria (50 L) assigned to four groups in triplicates. Fish were fed for 7 weeks with dietary treatments, including treatment 1: feeding adult Artemia without enrichment (control group), treatment 2: feeding adult Artemia enriched with lyophilised probiotic P. acidilactici (700 mg L(-1)), 3: feeding adult Artemia enriched with prebiotic fructooligosaccharide (FOS) (100 mg L(-1)), group 4: feeding adult Artemia enriched with synbiotic (P. acidilactici (700 mg L(-1)) + FOS (100 mg L(-1))). Skin mucus immune responses (lysozyme activity, total Immunoglobulin and protease), stress resistance against environmental stress (acute decrease of temperature and increase salinity), intestinal microbiota as well as growth indices were measured at the end of feeding trial. Artemia enriched with synbiotic significantly improved growth performance compared to other treatments (P Artemia enriched with synbiotic (P Artemia was more effective than singular enrichment with probiotics or prebiotics.

  20. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Directory of Open Access Journals (Sweden)

    Behnam Shekarchi

    2016-02-01

    Full Text Available Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME (3.5% v/v. Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P < 0.05. So, the results showed that Artemia urmiana adults individuals that fed with 2MEtreated yeasts had the highest growth and total length. These results were confirmed with growth measurement in adult individuals of Artemia. Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  1. [Ellicott Slough National Wildlife Refuge, Farallon National Wildlife Refuge, Salinas River National Wildlife Refuge: Annual Narrative Report: Calendar Year 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Ellicott Slough National Wildlife Refuge, Farallon National Wildlife Refuge, and Salinas River National Wildlife Refuge outlines...

  2. Salt-induced redox-independent phosphorylation of light harvesting chlorophyll a/b proteins in Dunaliella salina thylakoid membranes.

    Science.gov (United States)

    Liu, Xian-De; Shen, Yun-Gang

    2005-02-17

    This study investigated the regulation of the major light harvesting chlorophyll a/b protein (LHCII) phosphorylation in Dunaliella salina thylakoid membranes. We found that both light and NaCl could induce LHCII phosphorylation in D. salina thylakoid membranes. Treatments with oxidants (ferredoxin and NADP) or photosynthetic electron flow inhibitors (DCMU, DBMIB, and stigmatellin) inhibited LHCII phosphorylation induced by light but not that induced by NaCl. Furthermore, neither addition of CuCl(2), an inhibitor of cytochrome b(6)f complex reduction, nor oxidizing treatment with ferricyanide inhibited light- or NaCl-induced LHCII phosphorylation, and both salts even induced LHCII phosphorylation in dark-adapted D. salina thylakoid membranes as other salts did. Together, these results indicate that the redox state of the cytochrome b(6)f complex is likely involved in light- but not salt-induced LHCII phosphorylation in D. salina thylakoid membranes.

  3. Arsenate toxicity and metabolism in the halotolerant microalga Dunaliella salina under various phosphate regimes.

    Science.gov (United States)

    Wang, Ya; Zheng, Yanheng; Liu, Cong; Xu, Pingping; Li, Hao; Lin, Qiaoyun; Zhang, Chunhua; Ge, Ying

    2016-06-15

    Microalgae play an important role in arsenic (As) biogeochemical cycles as they are capable of accumulating and metabolizing this metalloid efficiently. This study aimed to investigate the toxicity, accumulation and transformation of arsenate (As(v)) in Dunaliella salina, an exceptionally halotolerant microalga, under various phosphate (PO4(3-)) regimes. The results of the 72-h toxicity test showed that D. salina was tolerant to As(v). In addition, the toxicity of As(v) was mitigated by an increased PO4(3-) supply. D. salina resisted the adverse effects of As(v) through the suppression of As uptake, enhancement of As reduction, methylation in the cell and excretion from the cell. Our study revealed that D. salina reduced As(v) toxicity using different strategies, i.e., reduction of As uptake upon acute As stress (24 h) and increase of As efflux following chronic As exposure (9 day). Moreover, PO4(3-) strongly affected the adsorption, uptake and transformation of As(v) in D. salina. As(v) reduction, DMA production and As excretion were enhanced under P-limited conditions (0.112 mg L(-1)) or upon higher As(v) exposure (1120 μg L(-1)). Furthermore, PO4(3-) had a significant influence on the As removal ability of D. salina. A high As removal efficiency (>95.6%) was observed in the 5-day cultures at an initial As concentration of 11.2 μg L(-1) and PO4(3-) of 0.112 and 1.12 mg L(-1). However, only 10.9% of total As was removed under 11.2 mg L(-1) PO4(3-) after 9 days of incubation. The findings of this study illustrate the pivotal roles of extracellular PO4(3-) in As(v) toxicity and metabolism, and the results may be relevant for future research on the minimization of As contamination in algal products as well as on the enhancement of As removal from the environment.

  4. Treatment of cadmium dust with two-stage leaching process

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The treatment of cadmium dust with a two-stage leaching process was investigated to replace the existing sulphation roast-leaching processes. The process parameters in the first stage leaching were basically similar to the neutralleaching in zinc hydrometallurgy. The effects of process parameters in the second stage leaching on the extraction of zincand cadmium were mainly studied. The experimental results indicated that zinc and cadmium could be efficiently recoveredfrom the cadmium dust by two-stage leaching process. The extraction percentages of zinc and cadmium in two stage leach-ing reached 95% and 88% respectively under the optimum conditions. The total extraction percentage of Zn and Cdreached 94%.

  5. Heat transfer law in leaching dump

    Institute of Scientific and Technical Information of China (English)

    WU Ai-xiang; WANG Hong-jiang; XI Yong; YANG Bao-hua; LI Jian-feng; YIN Sheng-hua; ZHA Ke-bing

    2005-01-01

    Based on the law of temperature changes in the leaching dump and the forming process of heat flux, the basic balance equation of heat flow in dump was established, the dissipated heat flow from dump to the atmosphere was analyzed to estimate the surface temperature of the ore particle in dump and discover the law of forced heat convection of heat flow transfer in dump. And the lixiviate flow formula taking a certain heat flow out of dump was deduced by using the inversion method. Through theoretic analysis, combining Dexing copper mine heap leaching production practice, the results show that the heat flow of chalcopyrite leaching emitted is not so great, but the heat flow of pyrite leaching and sulphur oxidation produced take up a higher proportion of total heat flow; the dissipated heat flow takes up a lower proportion, and most of heat flow is absorbed by itself, thus the inside temperature rises gradually; and the saturation flow form for leaching is adopted, which makes the lixiviate seepage in the transitional flow or even in the turbulent flow, so as to accelerate the heat flow diffusing and keep the leaching dump temperature suitable for bacteria living.

  6. Zinc Leaching from Tire Crumb Rubber

    Science.gov (United States)

    Rhodes, E. P.; Ren, J.; Mays, D. C.

    2010-12-01

    Recent estimates indicate that more than 2 billion scrap tires are currently stockpiled in the United States and approximately 280 million more tires are added annually. Various engineering applications utilize recycled tires in the form of shredded tire crumb rubber. However, the use of tire crumb rubber may have negative environmental impacts, especially when the rubber comes into contact with water. A review of the literature indicates that leaching of zinc from tire crumb rubber is the most significant water quality concern associated with using this material. Zinc is generally used in tire manufacturing, representing approximately 1.3% of the final product by mass. This study will report results from the U.S. Environmental Protection Agency’s (EPA’s) Synthetic Precipitation Leaching Procedure, batch leaching tests, and column leaching tests performed to quantify the process by which zinc leaches from tire crumb rubber into water. Results are interpreted with a first-order kinetic attachment/detachment model, implemented with the U.S. Agricultural Research Service software HYDRUS-1D, in order to determine the circumstances when zinc leaching from tire crumb rubber would be expected to comply with the applicable discharge limits. One potential application for recycled tires is replacing sand with tire crumb rubber in granular media filters used for stormwater pollution control. For this to be a viable application, the total zinc in the stormwater discharge must be below the EPA’s benchmark value of 0.117 mg/L.

  7. Can the halophilic ciliate Fabrea salina be used as a bio-control of microalgae blooms in solar salterns?

    Science.gov (United States)

    Hong, Hyun Pyo; Choi, Joong Ki

    2015-09-01

    The microlage Dunaliella salina, a major producer in salterns, is a serious problem for salt production. In this study we tried to assess if Fabrea salina can control D. salina. By parameterising numerical and functional response (growth and grazing vs prey abundance, respectively) at 90 psu and 30°C, where the ciliate is abundant and grows well, we developed a predator-prey model. The model is used to explore how change in microalga growth rate affect the dynamics, and the functional response is used in combination with field data to assess the potential impact of F. salina on D. salina. Over the 20 d simulation the ciliate controlled the prey population under all prey growth rates; although once D. salina were exhausted below the threshold level, F. salina died due to starvation, allowing the alga to increase in abundance, resulting in one or two predatorprey cycle, depending on prey growth rate. In general, the model predicted trends observed by others in the field, suggesting that it provided a good prediction of what may occur under the conditions we examined. Likewise we show that the ciliate can have a high impact on microalgal populations in the field. Finally, a literature review indicated that F. salina could be a good competitor with other protozoa and metazoan in salterns, depending on salinity and temperature, which requires further study and attention. In summary, we encourage continued studies on this unique ciliate on solar salterns and suggest that it may be useful in the bio-control of micoalgae.

  8. Una pequeña historia el cine: Sergio Salinas, promotor de la cultura cinematográfica en Chile

    OpenAIRE

    Hans Stange-Marcus; Claudio Salinas-Muñoz

    2013-01-01

    El crítico de cine Sergio Salinas afirmaba que no existen películas de arte sino "espacios" de arte, que propician una apreciación reflexiva y crítica de los filmes. El ensayo revisa tres de estos espacios desarrollados por el propio Salinas en Santiago de Chile: el cine club Nexo y las salas de cine arte Toesca y Normandie.

  9. Considerações sobre biologia e utilização de Artemia sp. (CRUSTACEA: BRANCHIOPODA: ANOSTRACA – considerations about biology and use of Artemia sp. (CRUSTACEA: BRANCHIOPODA: ANOSTRACA

    Directory of Open Access Journals (Sweden)

    Jean Michel Corrêa1

    2011-12-01

    Full Text Available ResumoA produção do microcrustáceo Artemia sp. no Brasil encontra-se voltada para uso em cultivos de larvas de crustáceos e peixes, de elevado valor comercial, sendo utilizadas vivas, como náuplios ou adultos, comobiomassa congelada e também microencapsulada.Abstract The production of microcrustacean Artemia sp. in Brazil is aimed for use in fish and crustacean larvae culture, with high commercial value, being used live, as nauplii or adults, as frozen biomass and microencapsulated.

  10. Building Chinese Cars in Mexico: The Grupo Salinas-FAW Alliance

    Directory of Open Access Journals (Sweden)

    Álvaro Cuervo-Cazurra

    2014-09-01

    Full Text Available Ricardo Salinas Pliego was the CEO of Grupo Salinas, one of the largest business groups in Mexico, and in 2009 he faced a challenge. Two years earlier, he had negotiated with the Chinese car company FAW to import Chinese cars into Mexico as an initial step towards their manufacturing. However, the global crisis of 2008 made him question the viability of the project and he had to decide whether to close the operation or continue in the hope of a quick recovery. This was a difficult decision because the group had sold several thousand cars and established a network of car dealers. Closing the operation would mean not only losing the investment in the network while having to continue servicing the cars, but would also result in a blow to the reputation of the group. He was pondering what the best option would be.

  11. Facile sand enhanced electro-flocculation for cost-efficient harvesting of Dunaliella salina.

    Science.gov (United States)

    Xiong, Qiong; Pang, Qi; Pan, Xinwei; Chika, A Okonkwo; Wang, Liqing; Shi, Jia; Jia, Lishan; Chen, Changping; Gao, Yahui

    2015-01-01

    Energy consumption and water resource in the cultivation and harvesting steps still need to be minimized for the popularization of the microalgae-based products. An efficient electro-flocculation method for harvesting Dunaliella Salina integrated with local sand has been successfully applied. Sand was effective for speeding up the processes of flocculation and sedimentation of algal flocs and the electrolytic hydroxides was essential to bridge the sand and small flocs into large dense flocs. The maximal recovery effective improved from 95.13% in 6min to 98.09% in 4.5min and the optimal electrical energy consumption decreased 51.03% compared to conventional electro-flocculation in a laboratory ambient condition. Furthermore, reusing the flocculated medium in cultivation of the D. Salina with nitrogen supplemented performed no worse than using fresh medium. This sand enhanced electro-flocculation (SEF) technology provides a great potential for saving time and energy associated with improving microalgae harvesting.

  12. Dunaliella salina as marine microalga highly tolerant to but a poor remover of cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Folgar, S. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Torres, E., E-mail: torres@udc.es [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Perez-Rama, M.; Cid, A.; Herrero, C.; Abalde, J. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain)

    2009-06-15

    Cadmium tolerance and removal in the marine microalga Dunaliella salina were studied in cultures exposed to different metal concentrations (5-120 mg Cd l{sup -1}) for 96 h. This microalga can be included in the group of microalgal species most tolerant to cadmium due to the high value of EC50 that it possesses (48.9 mg Cd l{sup -1} at 96 h of culture). The greater percentage of cadmium removed was obtained in cultures exposed to 5 mg Cd l{sup -1} at 96 h, but removing only 11.3% of the added cadmium. In all cultures, the quantity of cadmium removed intracellularly was much lower than the bioadsorbed quantity and it was proportional to the sulfhydryl group levels. Both the Freundlich and Langmuir adsorption models were suitable for describing the short-term biosorption of cadmium by living cells of D. salina.

  13. Activation of an AMP-activated protein kinase is involved in post-diapause development of Artemia franciscana encysted embryos

    Directory of Open Access Journals (Sweden)

    Dai Jie-Qiong

    2009-03-01

    Full Text Available Abstract Background Cysts of Artemia can remain in a dormant state for long periods with a very low metabolic rate, and only resume their development with the approach of favorable conditions. The post-diapause development is a very complicated process involving a variety of metabolic and biochemical events. However, the intrinsic mechanisms that regulate this process are unclear. Results Herein we report the specific activation of an AMP-activated protein kinase (AMPK in the post-diapause developmental process of Artemia. Using a phospho-AMPKα antibody, AMPK was shown to be phosphorylated in the post-diapause developmental process. Results of kinase assay analysis showed that this phosphorylation is essential for AMPK activation. Using whole-mount immunohistochemistry, phosphorylated AMPK was shown to be predominantly located in the ectoderm of the early developed embryos in a ring shape; however, the location and shape of the activation region changed as development proceeded. Additionally, Western blotting analysis on different portions of the cyst extracts showed that phosphorylated AMPKα localized to the nuclei and this location was not affected by intracellular pH. Confocal microscopy analysis of immunofluorescent stained cyst nuclei further showed that AMPKα localized to the nuclei when activated. Moreover, cellular AMP, ADP, and ATP levels in developing cysts were determined by HPLC, and the results showed that the activation of Artemia AMPK may not be associated with cellular AMP:ATP ratios, suggesting other pathways for regulation of Artemia AMPK activity. Conclusion Together, we report evidence demonstrating the activation of AMPK in Artemia developing cysts and present an argument for its role in the development-related gene expression and energy control in certain cells during post-diapause development of Artemia.

  14. Integrated assessment of the impacts of agricultural drainwater in the Salinas River (California, USA)

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, B.S.; Hunt, J.W.; Phillips, B.M.; Nicely, P.A.; Vlaming, V. de; Connor, V.; Richard, N.; Tjeerdema, R.S

    2003-08-01

    Invertebrate mortality was correlated with levels of water and sediment contaminatioin in the Salinas River. - The Salinas River is the largest of the three rivers that drain into the Monterey Bay National Marine Sanctuary in central California. Large areas of this watershed are cultivated year-round in row crops and previous laboratory studies have demonstrated that acute toxicity of agricultural drainwater to Ceriodaphnia dubia is caused by the organophosphate (OP) pesticides chlorpyrifos and diazinon. In the current study, we used a combination of ecotoxicologic tools to investigate incidence of chemical contamination and toxicity in waters and sediments in the river downstream of a previously uncharacterized agricultural drainage creek system. Water column toxicity was investigated using a cladoceran C. dubia while sediment toxicity was investigated using an amphipod Hyalella azteca. Ecological impacts of drainwater were investigated using bioassessments of macroinvertebrate community structure. The results indicated that Salinas River water downstream of the agricultural drain is acutely toxic to Ceriodaphnia, and toxicity to this species was highly correlated with combined toxic units (TUs) of chlorpyrifos and diazinon. Laboratory tests were used to demonstrate that sediments in this system were acutely toxic to H. azteca, which is a resident genus. Macroinvertebrate community structure was moderately impacted downstream of the agricultural drain input. While the lowest macroinvertebrate abundances were measured at the station demonstrating the greatest water column and sediment toxicity and the highest concentrations of pesticides, macroinvertebrate metrics were more significantly correlated with bank vegetation cover than any other variable. Results of this study suggest that pesticide pollution is the likely cause of laboratory-measured toxicity in the Salinas River samples and that this factor may interact with other factors to impact the

  15. Una punta de lanza decorada de la necrópolis de El Puntal (Salinas, Alicante

    Directory of Open Access Journals (Sweden)

    Hernández Alcaraz, Laura

    2000-12-01

    Full Text Available Not Available

    Este trabajo pretende dar a conocer la decoración damasquinada presente en una punta de lanza de la necrópolis ibérica de El Puntal (Salinas, Alicante, datada en el s. IV a.C. Se señala asimismo la importancia que adquiere la sepultura en la que aparece, que sobresale del conjunto para convertirse en el lugar de enterramiento de un personaje destacado.

  16. Leaching of lead from zinc leach residue in acidic calcium chloride aqueous solution

    Science.gov (United States)

    Wang, Le; Mu, Wen-ning; Shen, Hong-tao; Liu, Shao-ming; Zhai, Yu-chun

    2015-05-01

    A process with potentially reduced environmental impacts and occupational hazards of lead-bearing zinc plant residue was studied to achieve a higher recovery of lead via a cost-effective and environmentally friendly process. This paper describes an optimization study on the leaching of lead from zinc leach residue using acidic calcium chloride aqueous solution. Six main process conditions, i.e., the solution pH value, stirring rate, concentration of CaCl2 aqueous solution, liquid-to-solid (L/S) ratio, leaching temperature, and leaching time, were investigated. The microstructure and components of the residue and tailing were characterized using scanning electron microscopy (SEM) and X-ray diffraction (XRD). On the basis of experimental results, the optimum reaction conditions were determined to be a solution pH value of 1, a stirring rate of 500 r·min-1, a CaCl2 aqueous solution concentration of 400 g·L-1, a liquid-to-solid mass ratio of 7:1, a leaching temperature of 80°C, and a leaching time of 45 min. The leaching rate of lead under these conditions reached 93.79%, with an iron dissolution rate of 19.28%. Silica did not take part in the chemical reaction during the leaching process and was accumulated in the residue.

  17. Sex-dependent transcriptome analysis and single nucleotide polymorphism (SNP) discovery in the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Valenzuela-Miranda, Diego; Gallardo-Escárate, Cristian; Valenzuela-Muñoz, Valentina; Farlora, Rodolfo; Gajardo, Gonzalo

    2014-10-29

    In order to enhance genomic resources for the brine shrimp Artemia franciscana, RNA-Seq analysis was conducted for adult females and males. Through de novo assembly, 36,896 high quality contigs were obtained, of which 13,749 sequences were annotated with arthropod sequences. Just 4.5% matched against previously reported sequences for Artemia spp. Additionally, different transcriptional patterns between males and females were found, evidencing sex-related transcriptional responses. Furthermore, 221 and 534 putative SNPs were identified exclusively in males and females, respectively. These results will build the foundation for further genomic studies in A. franciscana.

  18. Influence of a long duration exposure, 69 months, to the space flight factors in Artemia cysts, tobacco and rice seeds

    Science.gov (United States)

    Planel, H.; Gaubin, Y.; Pianezzi, B.; Delpoux, M.; Bayonove, J.; Bès, J. C.; Heilmann, C.; Gasset, G.

    1994-10-01

    Three french laboratories have participated in the Free Flyer Biostack experiment. Artemia cysts, tobacco seeds and rice caryopsis and embryos were used. Biological objects in monolayers were dead. In opposite, a large fraction of samples used in bulk survived. A stimulatory effect occurred in the first steps of development in Artemia cysts. In fact, the larval survival was unchanged or slightly reduced. In tobacco a drastic decrease in germination and survival rate was observed. Space flight did not induce genetic changes. In rice, results depend on the variety which was investigated; the growth rate stimulation in flight samples is discussed with respect to controls.

  19. Hydrothermal liquefaction of Spirulina and Nannochloropsis salina under subcritical and supercritical water conditions.

    Science.gov (United States)

    Toor, Saqib S; Reddy, Harvind; Deng, Shuguang; Hoffmann, Jessica; Spangsmark, Dorte; Madsen, Linda B; Holm-Nielsen, Jens Bo; Rosendahl, Lasse A

    2013-03-01

    Six hydrothermal liquefaction experiments on Nannochloropsis salina and Spirulina platensis at subcritical and supercritical water conditions (220–375 °C, 20–255 bar) were carried out to explore the feasibility of extracting lipids from wet algae, preserving nutrients in lipid-extracted algae solid residue, and recycling process water for algae cultivation. GC–MS, elemental analyzer, FT-IR, calorimeter and nutrient analysis were used to analyze bio-crude, lipid-extracted algae and water samples produced in the hydrothermal liquefaction process. The highest bio-crude yield of 46% was obtained on N. salina at 350 °C and 175 bar. For S. platensis algae sample, the optimal hydrothermal liquefaction condition appears to be at 310 °C and 115 bar, while the optimal condition for N. salina is at 350 °C and 175 bar. Preliminary data also indicate that a lipid-extracted algae solid residue sample obtained in the hydrothermal liquefaction process contains a high level of proteins.

  20. Expression and characterization of the JAK kinase and STAT protein from brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Cheng, Chia-Hsiung; Chen, Gen-Der; Yeh, Maw-Sheng; Chu, Cheng-Ying; Hsu, Ya-Li; Hwang, Pung-Pung; Huang, Fore-Lien; Huang, Chang-Jen

    2010-01-01

    In this study, we isolated and characterized both JAK and STAT genes from Artemia, Artemia franciscana. Although AfJAK showed only 19% identity (33% similarity) to the Drosophila Hop protein, AfJAK contained the characteristic JAK homology domain (JH domain) from JH1 to JH7. On the other hand, AfSTAT showed higher identity (30%) to Drosophila STAT (STAT92E). The low identities of AfJAK and AfSTAT to Drosophila Hop and STAT92E suggest that JAK and STAT proteins are unique in each different species of invertebrate. RT-PCR analysis showed that both AfJAK and AfSTAT transcripts were ubiquitously expressed in the embryo, which is similar to the expression patterns of Drosophila Hop and STAT92E mRNAs during development. In addition, we generated a constitutively active form of AfSTAT by fusing the JH1 domain of AfJAK to the C-terminal end of AfSTAT. This fusion protein, AfSTAT-HA-JH1, autophosphorylated on its tyrosine residue and was able to bind to specific DNA motifs including the STAT-binding motifs in the Drosophila Raf promoter. Both AfJAK and AfSTAT proteins elicited the transactivation potential toward the fly Raf promoter in Sf9 cells. However, tyrosine phosphorylation of AfSTAT was not detected, which is consistent with the cellular localization analysis that most AfSTAT proteins were in the cytoplasm. Our results demonstrate that both JAK and STAT are present in the genome of Artemia, which can serve as the basis for further investigations to explore the role of the JAK/STAT signal pathway in the development and immune response of brine shrimp.

  1. Effects of rotenone and other mitochondrial complex I inhibitors on the brine shrimp Artemia.

    Science.gov (United States)

    Vehovszky, Agnes; Szabó, Henriette; Acs, A; Gyori, J; Farkas, Anna

    2010-12-01

    (Artemia) nauplii was used to asses the toxicity of rotenone, MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), MP+ (1-methyl-4-phenylpyridinium) and the effect of L-DOPA co-treatment with rotenone. Rotenone had a dose dependent effect on mortality (LC₅₀: 0.37 ± 0.04 μM mean ± S E, n = 24), while MPTP and MP+ proved to be toxic in millimolar range (LC₅₀: 0.21 ± 0.09 mM and 0.20 ± 0.08 mM, respectively, n = 4). L-DOPA (50-200 μM) co-treatment increased the survival of the rotenone-treated animals (LC₅₀: 0.51 ± 0.23 μM, 1.03 ± 0.66 μM, and 0.76 ± 0.52 μM, respectively). In the whole body tissue homogenates of Artemia, sublethal (up to 0.3 μM) concentrations of rotenone increased the glutathione S-transferase (GST) activity by up to 50 about percent (LC₅₀: 53.3 ± 6.8 nM/min/mg protein, against 34.7 ± 3.6 nM/min/mg protein, n = 4). Nauplii treated in 100 mM L-DOPA and rotenone together showed further increase of GST activity all across the range of rotenone concentrations. These results on Artemia nauplii show similarities with other animal models, when complex I inhibitors were tested. Biochemical measurements suggest a protective role of L-DOPA by increasing the GST activity as part of the intracellular defences during toxin-evoked oxidative stress.

  2. Toxicity of Five Phenolic Compounds to Brine Shrimp Artemia sinica(Crustacea:Artemiidae)

    Institute of Scientific and Technical Information of China (English)

    Ali Shaukat; LIU Guangxing; LI Zhengyan; XU Donghui; HUANG Yousong; CHEN Hongju

    2014-01-01

    The acute toxicity of five phenolic compounds each to 15 d old Artemia sinica was determined in this study. The brine shrimp A. sinica was hatched from the encysted dry eggs (Bohai Bay Brand) produced by Dongying Ocean Artemia Co., Ltd., China at 27℃± 1℃in pre-filtered (through pores of 0.45 µm in diameter) and autoclaved seawater (salinity 31, pH 7.5-8.0) in a cilindroconical glass beaker (2000 mL in volume) under continuous illumination (provided by a side set 20 W fluorescent lamp) with slight aeration. Ten Artemia individuals from the same batch of the hatched were cultured in 10 mL toxicant solution prepared with seawater (salinity 31, pH 7.5-8.0) at room temperature (about 20℃) to determine 24 h, 48 h and 72 h medium lethal concentration (LC50) of 5 phenolic compounds each. It was found that the toxicity of n-heptylphenol was the highest followed by nonylphenol, t-butylphenol, 2,4-dichlorophenol and bisphenol A in order. The LC50 values of the 5 compounds were calculated with regression analysis. The real concentration (in µg L-1) of 5 phenolic compounds each in toxicant solutions was measured with GC/MS analysis. Significant loss of phenolic compounds caused by either adsorption or desorption was not found. The significant difference of LC50 values was found among the five compounds 3 exposure times each. The range between the highest no-observed-effect concentration (NOEC) and 100%death causing concentration of five phenolic compounds each was determined. The toxicity in term of 24 h LC50 value of n-HP was 9.10 times higher than that of BPA, 1.71 times higher than t-BP, 1.53 times higher than 2,4-DCP and 1.36 times higher than NP, respectively.

  3. Evolutionary origin and phylogeography of the diploid obligate parthenogen Artemia parthenogenetica (Branchiopoda: Anostraca.

    Directory of Open Access Journals (Sweden)

    Joaquín Muñoz

    Full Text Available BACKGROUND: Understanding the evolutionary origin and the phylogeographic patterns of asexual taxa can shed light on the origin and maintenance of sexual reproduction. We assessed the geographic origin, genetic diversity, and phylogeographic history of obligate parthenogen diploid Artemia parthenogenetica populations, a widespread halophilic crustacean. METHODOLOGY/PRINCIPAL FINDINGS: We analysed a partial sequence of the Cytochrome c Oxidase Subunit I mitochondrial gene from an extensive set of localities (including Eurasia, Africa, and Australia, and examined their phylogeographic patterns and the phylogenetic relationships of diploid A. parthenogenetica and its closest sexual relatives. Populations displayed an extremely low level of mitochondrial genetic diversity, with one widespread haplotype shared by over 79% of individuals analysed. Phylogenetic and phylogeographic analyses indicated a multiple and recent evolutionary origin of diploid A. parthenogenetica, and strongly suggested that the geographic origin of parthenogenesis in Artemia was in Central Asia. Our results indicate that the maternal sexual ancestors of diploid A. parthenogenetica were an undescribed species from Kazakhstan and A. urmiana. CONCLUSIONS/SIGNIFICANCE: We found evidence for multiple origin of parthenogenesis in Central Asia. Our results indicated that, shortly after its origin, diploid A. parthenogenetica populations underwent a rapid range expansion from Central Asia towards the Mediterranean region, and probably to the rest of its current geographic distribution. This contrasts with the restricted geographic distribution, strong genetic structure, and regional endemism of sexual Artemia lineages and other passively dispersed sexual continental aquatic invertebrates. We hypothesize that diploid parthenogens might have reached their current distribution in historical times, with a range expansion possibly facilitated by an increased availability of suitable

  4. May arsenic pollution contribute to limiting Artemia franciscana invasion in southern Spain?

    Directory of Open Access Journals (Sweden)

    Marta I. Sánchez

    2016-02-01

    Full Text Available Limited information exists regarding the complex interactions between biological invasions, pollution, and climate change. Most studies indicate that pollution tends to favor invasive species. Here, we provide evidence that arsenic (As pollution may have a role in limiting the invasion of the exotic brine shrimp Artemia franciscana. We tested As toxicity in natural populations of Artemia parthenogenetica (a native taxon and A. franciscana from localities in southern Spain with differing degrees of As contamination. Tests were conducted both under current mean temperature conditions (25 °C, and as per a future climate scenario (i.e., an increase in mean temperature of 4 °C. Acute toxicity was estimated on the basis of the median lethal concentration (at 24 h, and chronic toxicity was evaluated by measuring Artemia survival and growth under sublethal exposures (after 26 days. At 25 °C, native A. parthenogenetica from the highly polluted Odiel and Tinto estuary was much more resistant to acute As stress (LC50-24 h, 24.67 mg L−1 than A. franciscana (15.78 mg L−1 and A. parthenogenetica from unpolluted sites (12.04 mg L−1–suggesting that local adaptation to polluted conditions may occur. At 29 °C, resistance of A. parthenogenetica from Odiel decreased significantly, and there were no statistical differences in sensitivity between the three species/populations, suggesting that climate change may enhance the probability of invasion. Resistance increased with developmental stage from nauplii to adults, and was extremely high in cysts which still hatched at As concentrations of up to 6400 mg L−1. Under sublethal chronic exposure A. franciscana performed better (survival and growth than A. parthenogenetica, and both species experienced a faster growth when exposed to As, compared with unexposed (control individuals, probably due to the hormesis. We discuss the ecological implications of our results.

  5. Leaching Behavior of Heavy Metals from Cement Pastes Using a Modified Toxicity Characteristic Leaching Procedure (TCLP).

    Science.gov (United States)

    Huang, Minrui; Feng, Huajun; Shen, Dongsheng; Li, Na; Chen, Yingqiang; Shentu, Jiali

    2016-03-01

    As the standard toxicity characteristic leaching procedure (TCLP) can not exhaust the acid neutralizing capacity of the cement rotary kiln co-processing solid wastes products which is particularly important for the assessment of the leaching concentrations of heavy metals. A modified TCLP was proposed. The extent of leaching of heavy metals is low using the TCLP and the leaching performance of the different metals can not be differentiated. Using the modified TCLP, however, Zn leaching was negligible during the first 180 h and then sharply increased (2.86 ± 0.18 to 3.54 ± 0.26 mg/L) as the acidity increased (pH cement rotary kiln co-processing products.

  6. Long-term lessons on pesticide leaching obtained via the Danish Pesticide Leaching Assessment Programme

    DEFF Research Database (Denmark)

    Rosenbom, Anette E.; Olsen, Preben; Plauborg, Finn

    To avoid any unacceptable influence on the environment posed by pesticides and their degradation products, all pesticides used in the European Union needs authorization. The authorization procedure includes assessing the leaching risk of both pesticides and their degradation products...... to the groundwater. There are shortcomings to the procedure, however, as revealed by the results of the Danish Pesticide Leaching Assessment Programme from the period 1990/2000 to 2012 (app. twelve years). This monitoring program has for this period assessed leaching into groundwater via the variably-saturated zone...... of 43 pesticides applied in accordance with current regulations on sandy and loamy agricultural fields, and 47 of their degradation products. Three types of leaching scenario were not fully captured by the authorization procedure: i) long-term leaching of degradation products of pesticides applied...

  7. Mercury antagonists: loss of photoactive response in the brine shrimp Artemia and its prevention by thiamine

    Energy Technology Data Exchange (ETDEWEB)

    Yaeger, E.; Siegel, B.Z.; Siegel, S.M.; Lasconia, M.; Correal, T.

    1986-01-01

    The positive photoatactic behavior of Artemia was disturbed when larvae cultured in 0.25 M NaCl were introduced into 10/sup -7/ to 10/sup -5/ M HgCl/sub 2/. At 10/sup -8/ M, and in controls, Hg had no effect either on orientation or mortality, and 65% of the larvae were collected at the light source in 30 min or less. In contrast, at 10/sup -6/ M, only 29% were able to do so. The presence of 10/sup -4/ M thiamine hydrochloride in the excystment medium prevented fully the loss of light-sensitivity.

  8. The brine shrimp ( Artemia parthenogenetica) as encapsulation organism for prophylactic chemotherapy of fish and prawn

    Science.gov (United States)

    Cao, Ji-Xiang; Bian, Bo-Zhong; Li, Ming-Ren

    1996-06-01

    Brine shrimp ( Artemia parthenogenetica) which had ingested three water-insoluble antibacterial drugs i.e. sulfadiazine(SD), oxytetracycline (OTC) and erythromycin estolate (ERY-Es) were fed to Tilapia and Mysis III of Penaeus orientalis K. The drug contents in the predators were then determined. After administration of drugs to Tilapia and Mysis III, through the bio-encapsulation of the brine shrimp, efficacious therapeutical concentration of OTC and ERY-Es (but not SD) in the predators could be reached and maintained for more than 8 hours.

  9. Sharp phylogeographic breaks and patterns of genealogical concordance in the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Maniatsi, Stefania; Kappas, Ilias; Baxevanis, Athanasios D; Farmaki, Theodora; Abatzopoulos, Theodore J

    2009-12-18

    Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI) and two nuclear (ITS1, p26) markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a result of slower coalescence or male-mediated dispersal. Our findings capture the genealogical interval between gene splitting and population divergence. In this sense, strong indications are provided in favour of a superspecies status and ongoing speciation in A. franciscana.

  10. Toxicidad del Metilparabeno en Artemia franciscana y sus implicacines en acuicultura

    OpenAIRE

    Comeche Sanz, Amparo; Varó, Inmaculada

    2015-01-01

    La dependencia total de la acuicultura marina en los quistes de Artemia cosechados en grandes ecosistemas hipersalinos hace que las condiciones fisicoquímicas de estos lugares sean cruciales para el desarrollo de esta actividad. En la actualidad existen en el mercado diversos productos de la industria cosmética, farmacéutica o alimentaria, que contienen parabenos (PBs) en su composición; lo que ha dado lugar a la aparición de estos compuestos en el medio ambiente. Se ha demostr...

  11. Phaeobacter inhibens as Probiotic Bacteria in Non-Axenic Artemia and Algae Cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; D'Alvise, Paul; Bentzon-Tilia, Mikkel;

    2015-01-01

    Bacterial diseases are a major constraint in aquaculture, especially in larviculture. Antibiotics that can control pathogens should be avoided due to risk of antibiotic resistance. We have shown in axenic systems of live larval feed that marine Roseobacter clade bacteria can antagonize fish patho...... demonstrates that probiotic bacteria can be introduced at the stage of live feed and have a pathogen reducing effect in both an Artemia and a D. tertiolecta challenge setup. This can potentially limit the subsequent use of antibiotics for control of pathogenic bacteria....

  12. Investigation of Copper Ammonia Leaching from Smelter Slags: Characterization, Leaching and Kinetics

    Science.gov (United States)

    Bidari, Ehsan; Aghazadeh, Valeh

    2015-10-01

    Although ammonia leaching of copper from slags has been reported generally as a part of copper slag utilization methods, but no detailed studies have been reported in the literature. In this research, we tried to investigate the effect of different parameters on ammonia leaching of copper from copper smelting slag by identifying different copper-bearing phases and following them during leaching time. Mineralogical characterization of the smelting slag (1.7 pct Cu) was done using X-ray fluorescence, X-ray diffraction, optical microscopy, diagnostic leaching tests, and scanning electron microscopy. The characterization studies indicated that main copper-bearing species are soluble copper oxides and chalcocite along with minor amount of covellite, bornite, blister copper particles, and chalcopyrite. It was also found that only approximately 0.2 pct Cu was present in the insoluble bulk silicate phases. These results suggest that approximately 88 pct of the total copper of slag could be extracted by ammonia sulfide leaching. Leaching tests were carried out and the effects of various parameters, namely pH, ammonia concentration, temperature, presence of oxygen, stirring speed, and pulp density were examined on copper leaching. The temperature and stirring speed had the most pronounced effect on the copper leaching, whereas ammonia affected the leaching yield at low concentrations of ammonia. It was found that 78 pct of Cu could be extracted within 4 hours and under optimum conditions: T = 343 K (70 °C), 2M ammonia, pH 10.5, stirring speed = 900 rpm, pulp density = 10 pct ( w s/ v). The kinetic data were analyzed with the shrinking core models, and it was found that the leaching process is controlled by both the interfacial transfer and diffusion across the product layer and the activation energy is calculated to be 49.4 kJ mol-1.

  13. Molecular cloning and expression analysis of the retinoid X receptor (RXR) gene in golden pompano Trachinotus ovatus fed Artemia nauplii with different enrichments.

    Science.gov (United States)

    Yang, Qibin; Zheng, Panlong; Ma, Zhenhua; Li, Tao; Jiang, Shigui; Qin, Jian G

    2015-12-01

    The retinoid X receptors (RXRs) are involved in the skeletal development and other biological process such as blood vessel formation and metabolism. Partial sequences of RXRα and β genes were obtained, and their expressions were quantified on golden pompano Trachinotus ovatus at 28 days post hatching (DPH) to explore the molecular response to nutritional manipulation in fish larvae. As live food, Artemia nauplii were separately enriched with Nannochloropsis and Algamac 3080 and non-enriched Artemia nauplii (control) for fish feeding. The expressions of RXRs were detected in the embryos and fish larvae at early stages, suggesting that the skeletal development in golden pompano initiated before yolk re-sorption completion. Fish fed non-enriched Artemia nauplii ended up with higher jaw malformation. The highest specific growth rate was obtained when fish were fed with the Artemia nauplii enriched with Algamac 3080, and the lowest growth rate was observed when fish were fed with unenriched Artemia nauplii. The highest survival was obtained when fish were fed with non-enriched or Nannochloropsis-enriched Artemia nauplii. This study indicates that the use of enriched formula for Artemia nauplii can significantly affect the expression levels of RXRs and jaw malformation of golden pompano larvae, but there is no clear correlation between RXRs expressions and malformation rates when fish are subjected to nutrient challenge.

  14. Kinetics of Leaching Calcium from Dolomite

    Directory of Open Access Journals (Sweden)

    Azizi, A.

    2011-06-01

    Full Text Available Magnesia is obtained from magnesite ore and the production process applied should remove accompanying minerals that reduce its refractoriness. Given that magnesite reservoirs are more exploited and largely exhausted, there is a growing need for production of magnesia on the basis of other magnesium minerals. Dolomite is a promising source of magnesia because it forms large deposits, is easy to exploit, and generally contains a small quantity of impurities.The kinetics of calcium leaching from dolomite by magnesium-nitrate solution has been studied. The research program included the influence of temperature, mass fraction of magnesium nitrate in solution, dolomite particle size and leaching time. Time dependence of calcium leaching is described by relevant kinetic equations. Rate coefficients, their temperature dependence and Arrhenius activation energy have been determined.

  15. Arbuscular mycorrhizas reduce nitrogen loss via leaching.

    Directory of Open Access Journals (Sweden)

    Hamid R Asghari

    Full Text Available The capacity of mycorrhizal and non-mycorrhizal root systems to reduce nitrate (NO₃⁻ and ammonium (NH₄⁺ loss from soils via leaching was investigated in a microcosm-based study. A mycorrhiza defective tomato mutant and its mycorrhizal wildtype progenitor were used in this experiment in order to avoid the indirect effects of establishing non-mycorrhizal control treatments on soil nitrogen cycling and the wider soil biota. Mycorrhizal root systems dramatically reduced nitrate loss (almost 40 times less via leaching, compared to their non-mycorrhizal counterparts, following a pulse application of ammonium nitrate to experimental microcosms. The capacity of AM to reduce nutrient loss via leaching has received relatively little attention, but as demonstrated here, can be significant. Taken together, these data highlight the need to consider the potential benefits of AM beyond improvements in plant nutrition alone.

  16. Arbuscular mycorrhizas reduce nitrogen loss via leaching.

    Science.gov (United States)

    Asghari, Hamid R; Cavagnaro, Timothy R

    2012-01-01

    The capacity of mycorrhizal and non-mycorrhizal root systems to reduce nitrate (NO₃⁻) and ammonium (NH₄⁺) loss from soils via leaching was investigated in a microcosm-based study. A mycorrhiza defective tomato mutant and its mycorrhizal wildtype progenitor were used in this experiment in order to avoid the indirect effects of establishing non-mycorrhizal control treatments on soil nitrogen cycling and the wider soil biota. Mycorrhizal root systems dramatically reduced nitrate loss (almost 40 times less) via leaching, compared to their non-mycorrhizal counterparts, following a pulse application of ammonium nitrate to experimental microcosms. The capacity of AM to reduce nutrient loss via leaching has received relatively little attention, but as demonstrated here, can be significant. Taken together, these data highlight the need to consider the potential benefits of AM beyond improvements in plant nutrition alone.

  17. Behavior of calcium silicate in leaching process

    Institute of Scientific and Technical Information of China (English)

    刘桂华; 李小斌; 彭志宏; 周秋生

    2003-01-01

    Based on the thermodynamic calculation, the mole ratio of CaO to SiO2, temperature and A/S of bauxitehave a profound influence on the mole ratio of 2CaO @ SiO2 to CaO @ SiO2 in sinter. CaO @ SiO2 and β-2CaO @ SiO2appear stable in caustic solution but unstable in soda solution, and CaO @ SiO2 is more stable than β-2CaO @ SiO2 un-der the same leaching condition. Compared with the conventional sinter, the rate of alumina extraction of the newsinter is large and the secondary reaction is restricted in the leaching, which might be mainly due to the more contentof CaO @ SiO2 in sinter and better stability of CaO @ SiO2 in leaching.

  18. Saltstone Oxidation Study: Leaching Method

    Energy Technology Data Exchange (ETDEWEB)

    Langton, C. A.; Stefanko, D. B.; Burns, H. H.

    2013-02-24

    Cementitious waste forms can be designed to chemically stabilize selected contaminants, such as Tc{sup +7} and Cr{sup +6}, by chemically reduction to lower valance states, Tc{sup +4} and Cr{sup +3}, respectively, and precipitation of these species in alkaline media as low solubility solid phases. Data for oxidation of this type of cementitious waste form cured under field conditions as a function of time is required for predicting the performance of the waste form and disposal facility. The rate of oxidation (oxidation front advancement) is an important parameter for predicting performance because the solubilities of some radionuclide contaminants, e.g., technetium, are a function of the oxidation state. A non-radioactive experiment was designed for quantifying the oxidation front advancement using chromium, as an approximate redox-sensitive surrogate (Cr{sup +6} / Cr{sup +3}) for technetium (Tc{sup +7} / Tc{sup +4}). Nonradioactive cementitious waste forms were prepared in the laboratory and cured under both laboratory and ?field conditions.? Laboratory conditions were ambient temperature and sealed sample containers. Field conditions were approximated by curing samples in open containers which were placed inside a plastic container stored outdoors at SRS. The container had a lid and was instrumented with temperature and humidity probes. Subsamples as thin as 0.2 mm were taken as a function of distance from the exposed surface of the as-cast sample. The subsamples were leached and the leachates were analyzed for chromium, nitrate, nitrite and sodium. Nitrate, nitrite, and sodium concentrations were used to provide baseline data because these species are not chemically retained in the waste form matrix to any significant extent and are not redox sensitive. ?Effective? oxidation fronts for Cr were measured for samples containing 1000, 500 and 20 mg/kg Cr added as soluble sodium chromate, Na{sub 2}CrO{sub 4}. For a sample cured for 129 days under field conditions

  19. Intentional introduction of Artemia sinica (Anostraca) in the high-altitude Tibetan lake Dangxiong Co: the new population and consequences for the environment and for humans

    Science.gov (United States)

    Jia, Qinxian; Anufriieva, Elena; Liu, Xifang; Kong, Fanjing; Shadrin, Nickolai

    2015-11-01

    The imbalance between supply and demand of Artemia cysts in China and around the world is increasing now. Salt lakes in Tibet may contribute to the solution of the problem. In Northern Tibet there are 26 saline lakes whose salinity and temperature may support Artemia survival at an altitude of 4 000-5 100 m. We found Artemia in 15 of these lakes. The saline lakes with Artemia populations mainly belong to the shallow basin lakes, and the majority of these lakes are small in area. The total area of lakes without Artemia is more than 1 000 km2. Lake Dangxiong Co (Co means lake in Tibet) was chosen for the intentional introduction of Artemia sinica. In 2004, 850 g of A. sinica cysts, originating from Qinghai, were introduced in the lake. Surveys in 2006-2014 showed that the average abundance of Artemia adults in the lake gradually increased from 20 ind./m3 in 2006 to 1950 ind./m3 in 2013. We assume that two subpopulations of A. sinica, separated by depth, may exist in the lake. The new Artemia population caused an increase in the number of species of phytoplankton and heterotrophic protozoa with a decrease of their total abundance. Water transparency also increased. Dominance in phytoplankton passed from cyanobacteria to diatoms. Changes occurred not only in the lake ecosystem; the number of water birds using the lakes also dramatically increased. Preliminary calculations showed that is it possible to harvest at least about 150 t cysts per year from the lake as well as 3.2 thousand tons of frozen or 350 t of dried biomass of adult Artemia.

  20. Alkaline leaching of metal melting industry wastes dseparation of zinc and lead in the leach solution

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    In this work, a thorough examinations on the extractability of zinc and lead present in the steelmaking dusts using alkaline leaching process and the effectiveness of the zinc and lead separation in the resultant leaching solutions using sulfide precipitation method were made. It was found that only about 53% of zinc and over 70% of the lead could be leached out of the dusts, while the other 47% of zinc and 306 of lead were left in the leaching residues. The zinc and lead in the resultant leaching solution can be effectively and selectively separated. When the weight ratio of sodium sulfide (M. W. = 222-240) to Pb was kept at 1.8, the lead in the solution could be precipitated out quantitatively while all the zinc was remained in the solution. The zinc left in the solution can be further recovered by the addition of extra sodium sulfide with a weight ratio of sodium sulfide to the zinc over 2.6. The resultant filtrate can be recycled to the leaching of dust in the next leaching process.

  1. Life cycle assessment and residue leaching: The importance of parameter, scenario and leaching data selection

    Energy Technology Data Exchange (ETDEWEB)

    Allegrini, E., E-mail: elia@env.dtu.dk [Technical University of Denmark, Department of Environmental Engineering, Building 115, 2800 Lyngby (Denmark); Butera, S. [Technical University of Denmark, Department of Environmental Engineering, Building 115, 2800 Lyngby (Denmark); Kosson, D.S. [Vanderbilt University, Department of Civil and Environmental Engineering, Box 1831 Station B, Nashville, TN 37235 (United States); Van Zomeren, A. [Energy Research Centre of the Netherlands (ECN), Department of Environmental Risk Assessment, P.O. Box 1, 1755 ZG Petten (Netherlands); Van der Sloot, H.A. [Hans van der Sloot Consultancy, Dorpsstraat 216, 1721 BV Langedijk (Netherlands); Astrup, T.F. [Technical University of Denmark, Department of Environmental Engineering, Building 115, 2800 Lyngby (Denmark)

    2015-04-15

    Highlights: • Relevance of metal leaching in waste management system LCAs was assessed. • Toxic impacts from leaching could not be disregarded. • Uncertainty of toxicity, due to background activities, determines LCA outcomes. • Parameters such as pH and L/S affect LCA results. • Data modelling consistency and coverage within an LCA are crucial. - Abstract: Residues from industrial processes and waste management systems (WMSs) have been increasingly reutilised, leading to landfilling rate reductions and the optimisation of mineral resource utilisation in society. Life cycle assessment (LCA) is a holistic methodology allowing for the analysis of systems and products and can be applied to waste management systems to identify environmental benefits and critical aspects thereof. From an LCA perspective, residue utilisation provides benefits such as avoiding the production and depletion of primary materials, but it can lead to environmental burdens, due to the potential leaching of toxic substances. In waste LCA studies where residue utilisation is included, leaching has generally been neglected. In this study, municipal solid waste incineration bottom ash (MSWI BA) was used as a case study into three LCA scenarios having different system boundaries. The importance of data quality and parameter selection in the overall LCA results was evaluated, and an innovative method to assess metal transport into the environment was applied, in order to determine emissions to the soil and water compartments for use in an LCA. It was found that toxic impacts as a result of leaching were dominant in systems including only MSWI BA utilisation, while leaching appeared negligible in larger scenarios including the entire waste system. However, leaching could not be disregarded a priori, due to large uncertainties characterising other activities in the scenario (e.g. electricity production). Based on the analysis of relevant parameters relative to leaching, and on general results

  2. Cytotoxicity of Dorema auchri, Achillea millefolium and Artemisia aucheri by Artemia

    Directory of Open Access Journals (Sweden)

    M Ghavamizadeh

    2013-09-01

    Full Text Available Abstract Background & aim: Nowadays, toxic compounds derived from plants used against microbes and cancer cells. The aim of this study was to evaluate cytotoxicity of Dorema aucheri, Achillea millefollium and Artemisia aucheri using brine shrimp, Artemia urmiana, lethality test. Methods: In this experimental study, the plants were collected from the Kohgiluyeh and Boyer-Ahmad Province, then identified by a botanist. Clean and air-dried aerial parts of plants were extracted with suitable solvents. Cytotoxicity evaluation was performed using larvae hatched cysts were purchased from Urmia. Live larvae were exposed to different concentrations of extract and the numbers of live and dead larvae were counted after 24 hours. Mean of LC 50 of any extracts from control and exposed live larvae were examined. The data were analyzed using the Finney’s Probit analysis. Results: Hydro ethanol and chloroform extracts of Achillea millefolium, Dorema aucheri and Artemisia aucheri exhibited potent brine shrimp lethality with LC50 67.8±0.53μg.ml-1, 76.50±0.60μg.ml-1, 92.70±6.05μg.ml-1 respectively. The degree of lethality was found to be directly proportional to the concentration of extracts. Conclusion: According to BSLT, LC50 of D. aucheri, A. millefolium and A. aucheri, they were considered as toxic. So these plants could be a source of new compounds with biological activity. Key words: Artemia urmiana, Dorema auchri, Achillea millefolium, Artemisia aucheri, Cytotoxicity

  3. A proteomic study on postdiapaused embryonic development of brine shrimp (Artemia franciscana).

    Science.gov (United States)

    Wang, Weiwei; Meng, Bo; Chen, Weihua; Ge, Xiaomeng; Liu, Siqi; Yu, Jun

    2007-10-01

    Encysted gastrula of brine shrimp (Artemia, Crustacea, and Anostraca) provides an excellent model for studying molecular processes of diapause. We report a proteomic study on early molecular responses of Artemia's postdiapaused cysts and found that dehydrated cysts actually store more proteins, in both kind and amount, than developing cysts. We identified 75 differentially expressed proteins over a course of cyst development, and also exploited PTMs of dehydrate cysts. We further surveyed gene expression of postdiapaused cysts in early developmental phases in a 0.5 h interval up to the seventh hour, and discovered that the activation of cellular activities is ignited as early as 0.5 h after rehydration. We traced nine differentially expressed proteins (COXI, COXIII, heat shock proteins (HSP26, HSP60, and HSP70), CDC48, late embryogenesis abundant (LEA), GS1-like protein, and cathepsin L-associated protein (CLAP)) for quantitative transcriptional changes, monitored by real-time PCR, and found these proteins exhibiting distinct expression patterns that suggest complex gene regulations for cyst reactivation after diapause breakage. Future experiments should be designed to focus on early activation concerning signal transduction, energy generation, and PTMs.

  4. Assessment of endemic microalgae as potential food for Artemia franciscana culture

    Directory of Open Access Journals (Sweden)

    Juan M Pacheco-Vega

    2015-03-01

    Full Text Available In this study, five microalgal strains were isolated from Bahía de La Paz, Baja California Sur, Mexico and identified as Grammatophora sp., Navícula sp., Rhabdonema sp., Schizochytrium sp., and Nitzschia sp., and their evaluation as potential food for Artemia franciscana. The isolated strains were cultured outdoors and harvested after four days. Chaetoceros muelleri was cultured under laboratory conditions and used as control. The protein, lipid, and carbohydrate composition and the fatty acid profiles of the strains were determined by gas chromatography. To assess the effect of microalgal strains on A. franciscana, decapsulated cysts were cultured at outdoor conditions in 15 L containers. The experiment was conducted for twelve days. Samples from the five different feeding treatments were taken at the beginning and end of the experiment to assess number, size, and weight of Artemia larvae. Treatment with Rhabdonema sp. showed larvae with a lower percentage of polyunsaturated fatty acids (PUFAs while Grammatophora sp. showed those with the greatest PUFA proportion, even more than those fed Chaetoceros muelleri (control. Larvae consuming Schizochytrium sp. had no docosahexanoic (DHA nor eicosapentaenoic (EPA fatty acid content. Growth and survival of A. franciscana did not show significant differences among feed treatments, except when it was fed Nitzschia sp., showing lower survival and dry weight. Treatment based on Schizochytrium sp. and Rhabdonema sp. had a greater A. franciscana size but reduced dry weight; additional tests including two or more algal species for every treatment should be carried out to determine the best yield.

  5. Habitat diversity and adaptation to environmental stress in encysted embryos of the crustacean Artemia

    Indian Academy of Sciences (India)

    Joshua A Tanguay; Reno C Reyes; James S Clegg

    2004-12-01

    Encysted embryos (cysts) of the brine shrimp, Artemia, provide excellent opportunities for the study of biochemical and biophysical adaptation to extremes of environmental stress in animals. Among other virtues, this organism is found in a wide variety of hypersaline habitats, ranging from deserts, to tropics, to mountains. One adaptation implicated in the ecological success of Artemia is p26, a small heat shock protein that previous evidence indicates plays the role of a molecular chaperone in these embryos. We add to that evidence here. We summarize recently published work on thermal tolerance and stress protein levels in embryos from the San Francisco Bay (SFB) of California inoculated into experimental ponds in southern Vietnam where water temperatures are much higher. New results on the relative contents of three stress proteins (hsp70, artemin and p26) will be presented along with data on cysts of A. tibetiana collected from the high plateau of Tibet about 4.5 km above sea level. Unpublished results on the stress protein artemin are discussed briefly in the context of this paper, and its potential role as an RNA chaperone. Interestingly, we show that the substantial tolerance of A. franciscana embryos to ultraviolet (UV) light does not seem to result from intracellular biochemistry but, rather, from their surrounding thick shell, a biophysical adaptation of considerable importance since these embryos receive heavy doses of UV in nature.

  6. Peningkatan Kuantitas dan Kualitas Kista Artemia franciscana setelah Pemberian Silase Ikan

    Directory of Open Access Journals (Sweden)

    ENDAH BUDI SULISTYOWATI

    2007-11-01

    Full Text Available Artemia is one of live feed needed in aquaculture as fishes and crustacean. Commercially, Artemia usually sold in dry cysts which can kept for years. The aim of this research were to know increasing quantity and quality A. franciscana cysts after exposing various concentration of fish silage as artificial food and to know optimal concentration of fish silage that can increase quantity and quality A. franciscana cysts. This research was done in Laboratory of Live Feed BBPBAP Jepara Central Java. This research was conducted by 5 treatments. Treatments were grouped based on amount of concentration given, i.e: control (coconut cake with concentrate 10 g/m3, fish silage concentrate 10, 20, 30, and 40 g/m3. Parameter investigated were number of cysts produced by individual female A. franciscana, diameter of A. franciscana cysts, hatching percentage, and hatching rate of A. franciscana cysts. Data were analyzed using ANOVA and continued using Tukeys test at significant level 5%. The result of this research showed that exposing fish silage can increase quantity and quality A. franciscana cysts. They were increase number of cysts production by individual females, decrease cysts diameter, increase hatching percentage and hatching rate. Optimal concentration of fish silage on increase quantity and quality of A. franciscana cysts was 20 g/m3.

  7. Cloning and Expression Analysis of p26 Gene in Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Lijuan JIANG; Lin HOU; Xiangyang ZOU; Ruifeng ZHANG; Jiaqing WANG; Wenjing SUN; Xintao ZHAO; Jialu AN

    2007-01-01

    The protein p26 is a small heat shock protein that functions as a molecular chaperone to protect embryos by preventing irreversible protein damage during embryonic development. A 542 bp fragment of the p26 gene was cloned and sequenced. The fragment encoded 174 amino acid residues and the amino acid sequence contained the α-crystallin domain. Phylogenetic analysis showed that eight Artemia populations were divided into four major groups. Artemia sinica (YC) belonged to the East Asia bisexual group. Expression of the p26 gene at different developmental stages of A. sinica was quantified using real-time quantitative polymerase chain reaction followed by cloning and sequencing. The relationship between the quantity of p26 gene expression and embryonic development was analyzed. The results indicated that massive amounts of p26 were expressed during the development of A. sinica. At the developmental stage of 0 h, A. sinica expressed the highest level of p26. As development proceeded, expression levels of the p26 gene reduced significantly. There was a small quantity of p26 gene expression at the developmental stages of 16 h and 24 h. We concluded that p26 might be involved in protecting the embryo from physiological stress during embryonic development.

  8. Molecular approaches for improving desiccation tolerance: insights from the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Hand, Steven C; Menze, Michael A

    2015-08-01

    We have evaluated the endogenous expression and molecular properties of selected Group 3 LEA proteins from Artemia franciscana , and the capacity of selected Groups 1 and 3 proteins transfected into various desiccation-sensitive cell lines to improve tolerance to drying. Organisms inhabiting both aquatic and terrestrial ecosystems frequently are confronted with the problem of water loss for multiple reasons--exposure to hypersalinity, evaporative water loss, and restriction of intracellular water due to freezing of extracellular fluids. Seasonal desiccation can become severe and lead to the production of tolerant propagules and entry into the state of anhydrobiosis at various stages of the life cycle. Such is the case for gastrula-stage embryos of the brine shrimp, Artemia franciscana. Physiological and biochemical responses to desiccation are central for survival and are multifaceted. This review will evaluate the impact of multiple late embryogenesis abundant proteins originating from A. franciscana, together with the non-reducing sugar trehalose, on prevention of desiccation damage at multiple levels of biological organization. Survivorship of desiccation-sensitive cells during water stress can be improved by use of the above protective agents, coupled to metabolic preconditioning and rapid cell drying. However, obtaining long-term stability of cells in the dried state at room temperature has not been accomplished and will require continued efforts on both the physicochemical and biological fronts.

  9. PEP Support: Laboratory Scale Leaching and Permeate Stability Tests

    Energy Technology Data Exchange (ETDEWEB)

    Russell, Renee L.; Peterson, Reid A.; Rinehart, Donald E.; Buchmiller, William C.

    2010-05-21

    This report documents results from a variety of activities requested by the Hanford Tank Waste Treatment and Immobilization Plant (WTP). The activities related to caustic leaching, oxidative leaching, permeate precipitation behavior of waste as well as chromium (Cr) leaching are: • Model Input Boehmite Leaching Tests • Pretreatment Engineering Platform (PEP) Support Leaching Tests • PEP Parallel Leaching Tests • Precipitation Study Results • Cr Caustic and Oxidative Leaching Tests. Leaching test activities using the PEP simulant provided input to a boehmite dissolution model and determined the effect of temperature on mass loss during caustic leaching, the reaction rate constant for the boehmite dissolution, and the effect of aeration in enhancing the chromium dissolution during caustic leaching. Other tests were performed in parallel with the PEP tests to support the development of scaling factors for caustic and oxidative leaching. Another study determined if precipitate formed in the wash solution after the caustic leach in the PEP. Finally, the leaching characteristics of different chromium compounds under different conditions were examined to determine the best one to use in further testing.

  10. A specific DNA fragment of Gahai parthenogenesis Artemia genome%尕海孤雌生殖卤虫基因组的特异DNA片段

    Institute of Scientific and Technical Information of China (English)

    曾辉; 陈成彬; 刘凤岐; 宋文芹; 陈瑞阳

    2004-01-01

    Artemia is not only valuable for aquaculture but also exhibits unique biological characters. In this study, based on the silkworm Bmdsx gene, a pair of primers was designed. After amplification with these primers, a DNA fragment Apdsx900 from parthenogenesis Artemia genomic DNA was obtained. The following Southern blotting and FISH analysis also proved the fragment was specific for Gahai parthenogenesis Artemia genome. To our knowledge, this is the first report of parthenogenesis genome specific DNA fragments. Apdsxg00 shares little similarity with the silkworm Bmdsx gene. [Acta Zoologica Sinica 50 (3): 470-474, 2004].

  11. Sudden weaning of angel fish pterophyllum scalare (Lichtenstein) (Pisces; Cichlidae) larvae from brine shrimp (Artemia sp) nauplii to formulated larval feed

    OpenAIRE

    2013-01-01

    This study investigated the effects of sudden weaning of angel fish larvae (Pteraphylum scalari) from Artemia nauplii to commercial larval feed. Four days post hatch (DPH) larvae were reared in four different weaning protocols (TR1-TR4) with triplicates in a complete randomize design. Larvae in TR1 and TR4 were exclusively fed Artemia nauplii and dry feed respectively. In TR2 and TR3, larvae were initially fed Artemia nauplii and suddenly wean to formulated feed on 14 DPH and 7 DPH respective...

  12. Formation of diapause cyst shell in brine shrimp, Artemia parthenogenetica, and its resistance role in environmental stresses.

    Science.gov (United States)

    Liu, Yu-Lei; Zhao, Yang; Dai, Zhong-Min; Chen, Han-Min; Yang, Wei-Jun

    2009-06-19

    Artemia has attracted much attention for its ability to produce encysted embryos wrapped in a protective shell when subject to extremely harsh environmental conditions. However, what the cyst shell is synthesized from and how the formative process is performed remains, as yet, largely unknown. Over 20 oviparous specifically expressed genes were identified through screening the subtracted cDNA library enriched between oviparous and ovoviviparous Artemia ovisacs. Among them, a shell gland-specifically expressed gene (SGEG) has been found to be involved in the cyst shell formation. Lacking SGEG protein (by RNA interference) caused the cyst shell to become translucent and the chorion layer of the shell to become less compact and pultaceous and to show a marked decrease of iron composition within the shell. The RNA interference induced defective diapause cysts with a totally compromised resistibility to UV irradiation, extremely large temperature differences, osmotic pressure, dryness, and organic solvent stresses. In contrast, the natural cyst would provide adequate protection from all such factors. SGEG contains a 345-bp open reading frame, and its consequentially translated peptide consists of a 33-amino acid residue putative signal peptide and an 81-amino acid residue mature peptide. The results of Northern blotting and in situ hybridization indicate that the gene is specifically expressed in the cells of shell glands during the period of diapause cyst formation of oviparous Artemia. This investigation adds strong insight into the mechanism of cyst shell formation of Artemia and may be applicable to other areas of research in extremophile biology.

  13. Post-prandial protease activity in the digestive tract of African catfish, Clarias gariepinus, larvae fed decapsulated cysts of Artemia

    NARCIS (Netherlands)

    García Ortega, A.; Verreth, J.; Segner, H.

    2000-01-01

    The alkaline proteolytic activity in the gut of African catfish larvae was studied during short time ranges from 30 min to 4 h after ingestion of decapsulated Artemia cysts. The variation in total protease and trypsin activities during the day was monitored during starvation, after one single meal i

  14. Morphological differentiation of seven parthenogenetic Artemia (Crustacea: Branchiopoda) populations from China, with special emphasis on ploidy degrees.

    Science.gov (United States)

    Asem, Alireza; Sun, Shi-Chun

    2016-04-01

    Parthenogenetic Artemia from seven Chinese locations with different elevations and various ploidies are characterized by phenotypic and morphometric analyses. Our findings show that the studied populations exhibit dissimilar patterns of ovisac. Four phenotypic patterns of furca are qualified and one of them is shared among di-, tetra- and pentaploid Artemia. Results of discriminant analysis based on morphometric data reveal that tetra- and pentaploid populations are grouped together, but the Aqqikkol Lake population is clearly differentiated. Previous hypothesis/conclusion that polyploid Artemia are larger than diploids is only partly supported by the present results, which show that pentaploid and tetraploid populations are larger than the mostly diploid populations in terms of the total length, but the body size of the Aibi Lake triploids has not significant difference with the sympatric diploids and the mostly diploid Aqqikkol population that inhabit in very high altitude has the largest body size among all parthenogenetic populations. The founding confirms that body size of Artemia is following with Bergmann's rule.

  15. Does a change from whole to powdered food (Artemia franciscana eggs) increase oviposition in the ladybird Coleomegilla maculata

    Science.gov (United States)

    The limited availability of alternative foods to replace natural prey hinders cost-effective mass production of ladybird beetles for augmentative biological control. We compared the effects of powdered versus whole Artemia franciscana (brine shrimp) eggs with or without a dietary supplement on devel...

  16. Nutrient enrichment of Artemia with free methionine%蛋氨酸对卤虫营养强化

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

    Methionine is indispensable of an essential amino acid for fish growing development , Artemia nauplii is commonly used as the start feed on fish larvae stage. But Artemia in vivo amino acid imbalance, especially methionine deficiency can not meet the nutritional needs of nutrition. Methionine is of great importance to nutrient enrichment of Artemia. Methionine is a common nutritional fortifier . This paper mainly introduces the purpose, methods and results of nutrient enrichment, and discuss the impact of enrichment of Artemia with free methionine.%  蛋氨酸是鱼类生长发育不可缺少的必需氨基酸,仔稚鱼时期常常用卤虫作为仔稚鱼的开口饵料,但卤虫的体内的氨基酸不平衡,尤其是蛋氨酸缺乏难以满足仔稚鱼的营养需求,因此蛋氨酸对卤虫的营养强化有很重要的意义。蛋氨酸是常用的营养强化剂,文章综述了蛋氨酸强化的目的、方法和结果,并讨论了影响蛋氨酸营养强化的因素。

  17. Evaluation of commercial Artemia enrichment products on growth, survival, stress tolerance, and fatty acid composition of larval Florida pompano

    Science.gov (United States)

    Rearing live feed organisms represents the majority of time and labor associated with larviculture operations vital to the seed stock supply of marine finfish aquaculture production facilities. No information exists with respect to optimal Artemia enrichment protocols for Florida pompano Trachinotu...

  18. ALUMINUM AND CHROMIUM LEACHING WORKSHOP WHITEPAPER

    Energy Technology Data Exchange (ETDEWEB)

    McCabe, D; Jeff Pike, J; Bill Wilmarth, B

    2007-04-25

    A workshop was held on January 23-24, 2007 to discuss the status of processes to leach constituents from High Level Waste (HLW) sludges at the Hanford and Savannah River Sites. The objective of the workshop was to examine the needs and requirements for the HLW flowsheet for each site, discuss the status of knowledge of the leaching processes, communicate the research plans, and identify opportunities for synergy to address knowledge gaps. The purpose of leaching of non-radioactive constituents from the sludge waste is to reduce the burden of material that must be vitrified in the HLW melter systems, resulting in reduced HLW glass waste volume, reduced disposal costs, shorter process schedules, and higher facility throughput rates. The leaching process is estimated to reduce the operating life cycle of SRS by seven years and decrease the number of HLW canisters to be disposed in the Repository by 1000 [Gillam et al., 2006]. Comparably at Hanford, the aluminum and chromium leaching processes are estimated to reduce the operating life cycle of the Waste Treatment Plant by 20 years and decrease the number of canisters to the Repository by 15,000-30,000 [Gilbert, 2007]. These leaching processes will save the Department of Energy (DOE) billions of dollars in clean up and disposal costs. The primary constituents targeted for removal by leaching are aluminum and chromium. It is desirable to have some aluminum in glass to improve its durability; however, too much aluminum can increase the sludge viscosity, glass viscosity, and reduce overall process throughput. Chromium leaching is necessary to prevent formation of crystalline compounds in the glass, but is only needed at Hanford because of differences in the sludge waste chemistry at the two sites. Improving glass formulations to increase tolerance of aluminum and chromium is another approach to decrease HLW glass volume. It is likely that an optimum condition can be found by both performing leaching and improving

  19. From Infancy to Adolescence: The Kansas University School of Medicine-Salina: A Rural Medical Campus Story.

    Science.gov (United States)

    Cathcart-Rake, William; Robinson, Michael; Paolo, Anthony

    2017-05-01

    The University of Kansas School of Medicine established a rural regional campus in Salina, Kansas, in 2011. The creation of a four-year medical campus of only 32 total students in a town of less than 50,000 inhabitants appeared to contradict all previous practices where medical schools have been situated in large metropolitan cities with student bodies frequently in the hundreds. The rationale to open the Salina campus was to attract medical students with a desire to train in a rural environment, hoping that many would eventually elect to practice primary care in rural Kansas. The authors evaluated the admission demographics, academic performance, campus satisfaction, and graduate medical education choices of students at Kansas University School of Medicine-Salina (KUSM-S) during its first four years of existence. To date, the Salina campus has succeeded in its mission to train students from rural communities in a rural environment to eventually become rural-based physicians. KUSM-S students have adjusted well to the rigors of medical school, have shown steady improvement in academic performance as measured by United States Medical Licensing Examination scores, and have been overwhelmingly positive about the Salina medical education program. The initial cohort of students has now successfully graduated and secured residency training positions, and most KUSM-S graduates are either continuing their training in primary care in Kansas or intend to return to Kansas to practice following residency training.

  20. From Infancy to Adolescence: The Kansas University School of Medicine–Salina: A Rural Medical Campus Story

    Science.gov (United States)

    Robinson, Michael; Paolo, Anthony

    2017-01-01

    The University of Kansas School of Medicine established a rural regional campus in Salina, Kansas, in 2011. The creation of a four-year medical campus of only 32 total students in a town of less than 50,000 inhabitants appeared to contradict all previous practices where medical schools have been situated in large metropolitan cities with student bodies frequently in the hundreds. The rationale to open the Salina campus was to attract medical students with a desire to train in a rural environment, hoping that many would eventually elect to practice primary care in rural Kansas. The authors evaluated the admission demographics, academic performance, campus satisfaction, and graduate medical education choices of students at Kansas University School of Medicine–Salina (KUSM-S) during its first four years of existence. To date, the Salina campus has succeeded in its mission to train students from rural communities in a rural environment to eventually become rural-based physicians. KUSM-S students have adjusted well to the rigors of medical school, have shown steady improvement in academic performance as measured by United States Medical Licensing Examination scores, and have been overwhelmingly positive about the Salina medical education program. The initial cohort of students has now successfully graduated and secured residency training positions, and most KUSM-S graduates are either continuing their training in primary care in Kansas or intend to return to Kansas to practice following residency training. PMID:27805948

  1. Comparative analysis on the key enzymes of the glycerol cycle metabolic pathway in Dunaliella salina under osmotic stresses.

    Science.gov (United States)

    Chen, Hui; Lu, Yan; Jiang, Jian-Guo

    2012-01-01

    The glycerol metabolic pathway is a special cycle way; glycerol-3-phosphate dehydrogenase (G3pdh), glycerol-3-phosphate phosphatase (G3pp), dihydroxyacetone reductase (Dhar), and dihydroxyacetone kinase (Dhak) are the key enzymes around the pathway. Glycerol is an important osmolyte for Dunaliella salina to resist osmotic stress. In this study, comparative activities of the four enzymes in D. salina and their activity changes under various salt stresses were investigated, from which glycerol metabolic flow direction in the glycerol metabolic pathway was estimated. Results showed that the salinity changes had different effects on the enzymes activities. NaCl could stimulate the activities of all the four enzymes in various degrees when D. salina was grown under continuous salt stress. When treated by hyperosmotic or hypoosmotic shock, only the activity of G3pdh in D. salina was significantly stimulated. It was speculated that, under osmotic stresses, the emergency response of the cycle pathway in D. salina was driven by G3pdh via its response to the osmotic stress. Subsequently, with the changes of salinity, other three enzymes started to respond to osmotic stress. Dhar played a role of balancing the cycle metabolic pathway by its forward and backward reactions. Through synergy, the four enzymes worked together for the effective flow of the cycle metabolic pathways to maintain the glycerol requirements of cells in order to adapt to osmotic stress environments.

  2. Leaching of Main Elements of Glass Immersed in Beishan Groundwater

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>The leaching quantities of the elements from the HLW are very important parameters for the safety assessments of the repository of high level radioactive wastes. It is necessary to study the leaching

  3. Spent LWR fuel leach tests: Waste Isolation Safety Assessment program

    Energy Technology Data Exchange (ETDEWEB)

    Katayama, Y.B.

    1979-04-01

    Spent light-water-reactor (LWR) fuels with burnups of 54.5, 28 and 9 MWd/kgU were leach-tested in deionized water at 25/sup 0/C. Fuel burnup has no apparent effect on the calculated leach rates based upon the behavior of /sup 137/Cs and /sup 239 +240/Pu. A leach test of 54.5 MWd/kgU spent fuel in synthetic sea brine showed that the cesium-based leach rate is lower in sea brine than in deionized water. A rise in the leach rate was observed after approximately 600 d of cumulative leaching. During the rise, the leach rate for all the measured radionuclides become nearly equal. Evidence suggests that exposure of new surfaces to the leachant may cause the increase. As a result, experimental work to study leaching mechanisms of spent fuel has been initiated. 22 figures.

  4. Two p90 ribosomal S6 kinase isoforms are involved in the regulation of mitotic and meiotic arrest in Artemia.

    Science.gov (United States)

    Duan, Ru-Bing; Zhang, Li; Chen, Dian-Fu; Yang, Fan; Yang, Jin-Shu; Yang, Wei-Jun

    2014-06-06

    There are multiple isoforms of p90 ribosomal S6 kinase (RSK), which regulate diverse cellular functions such as cell growth, proliferation, maturation, and motility. However, the relationship between the structures and functions of RSK isoforms remains undetermined. Artemia is a useful model in which to study cell cycle arrest because these animals undergo prolonged diapauses, a state of obligate dormancy. A novel RSK isoform was identified in Artemia, which was termed Ar-Rsk2. This isoform was compared with an RSK isoform that we previously identified in Artemia, termed Ar-Rsk1. Ar-Rsk2 has an ERK-docking motif, whereas Ar-Rsk1 does not. Western blot analysis revealed that Ar-Rsk1 was activated by phosphorylation, which blocked meiosis in oocytes. Knockdown of Ar-Rsk1 reduced the level of phosphorylated cdc2 and thereby suppressed cytostatic factor activity. This indicates that Ar-Rsk1 regulates the cytostatic factor in meiosis. Expression of Ar-Rsk2 was down-regulated in Artemia cysts in which mitosis was arrested. Knockdown of Ar-Rsk2 resulted in decreased levels of cyclin D3 and phosphorylated histone H3, and the production of pseudo-diapause cysts. This indicates that Ar-Rsk2 regulates mitotic arrest. PLK and ERK RNAi showed that Ar-Rsk2, but not Ar-Rsk1, could be activated by PLK-ERK in Artemia. This is the first study to report that RSK isoforms with and without an ERK-docking motif regulate mitosis and meiosis, respectively. This study provides insight into the relationship between the structures and functions of RSK isoforms.

  5. Gold and Silver Extraction from Leach Solutions

    OpenAIRE

    Bagdaulet K. Kenzhaliyev; Renata R. Iskhakova; Zamzagul D. Dosymbaeva; Esen N. Sulejmenov

    2014-01-01

    There has been carried out an investigation on the extraction of gold and silver from thiosulfate solutions: standard test and technological solutions of chemical and electrochemical leaching. The influence of related metals on the process of extracting gold from solution was studied. There has been conducted a comparative study of the IR spectra of solutions after the sorption of gold, silver and related metals.

  6. Leaching of Plastic Additives to Marine Organisms

    NARCIS (Netherlands)

    Koelmans, A.A.; Besseling, E.; Foekema, E.M.

    2014-01-01

    It is often assumed that ingestion of microplastics by aquatic species leads to increased exposure to plastic additives. However, experimental data or model based evidence is lacking. Here we assess the potential of leaching of nonylphenol (NP) and bisphenol A (BPA) in the intestinal tracts of Areni

  7. Leaching of toluene-neoprene adhesive wastes.

    Science.gov (United States)

    Font, R; Sabater, M C; Martínez, M A

    2001-03-01

    This work consists of the study of the extraction of solvent (toluene) from a polymeric (neoprene) substrate during a leaching process. Total organic carbon (TOC) is the main contaminant parameter in the leaching of these systems due to the solution of the toluene and the dispersion of the polymer. The toxicity of the extracts was measured with a Microtox equipment, using Photobacteria phosphoreum, deducing that the toxicity of the extracts is low due to the low solubility of toluene but that the toxicity of toluene is high. On the basis of the experimental results, the amount of toluene diffused vs time in plane sheet systems was studied. A kinetic model has been developed considering two stages: In the first stage, the toluene diffuses into the system across the neoprene chains at a constant rate, not depending on the initial toluene concentration. This fact is explained by considering that there is a constant difference of the toluene concentration between the interface with the water and the inner part of the sample. In the second stage, the dispersion of the polymer with the corresponding amount of toluene takes place. The diffusion of toluene in the leaching process is compared and analyzed considering the diffusion of toluene in a desorption process in air so that the difference of toluene concentration between the interface and the interior can be estimated. A mathematical model is also proposed for considering the leaching process in other operating conditions.

  8. Duality properties of Gorringe Leach equations

    Science.gov (United States)

    Grandati, Yves; Bérard, Alain; Mohrbach, Hervé

    2009-02-01

    In the category of motions preserving the angular momentum direction, Gorringe and Leach exhibited two classes of differential equations having elliptical orbits. After enlarging slightly these classes, we show that they are related by a duality correspondence of the Arnold Vassiliev type. The specific associated conserved quantities (Laplace Runge Lenz vector and Fradkin Jauch Hill tensor) are then dual reflections of each other.

  9. Leaching of Plastic Additives to Marine Organisms

    NARCIS (Netherlands)

    Koelmans, A.A.; Besseling, E.; Foekema, E.M.

    2014-01-01

    It is often assumed that ingestion of microplastics by aquatic species leads to increased exposure to plastic additives. However, experimental data or model based evidence is lacking. Here we assess the potential of leaching of nonylphenol (NP) and bisphenol A (BPA) in the intestinal tracts of Areni

  10. Column leaching from biomass combustion ashes

    DEFF Research Database (Denmark)

    Maresca, Alberto; Astrup, Thomas Fruergaard

    2015-01-01

    The utilization of biomass combustion ashes for forest soil liming and fertilizing has been addressed in literature. Though, a deep understanding of the ash chemical composition and leaching behavior is necessary to predict potential benefits and environmental risks related to this practice...

  11. Enhancements of LEACH Algorithm for Wireless Networks: A Review

    Directory of Open Access Journals (Sweden)

    M. Madheswaran

    2013-12-01

    Full Text Available Low Energy Adaptive Clustering Hierarchy (LEACH protocol is the first hierarchical cluster based routing protocol successfully used in the Wireless Sensor Networks (WSN. In this paper, various enhancements used in the original LEACH protocol are examined. The basic operations, advantages and limitations of the modified LEACH algorithms are compared to identify the research issues to be solved and to give the suggestions for the future proposed routing algorithms of wireless networks based on LEACH routing algorithm.

  12. Chalcopyrite leaching: The rate controlling factors

    Science.gov (United States)

    Li, J.; Kawashima, N.; Kaplun, K.; Absolon, V. J.; Gerson, A. R.

    2010-05-01

    The processes that determine the rate of chalcopyrite leaching are central to understanding how chalcopyrite (CuFeS 2) behaves under the environmentally adverse conditions of acid rock drainage. To this end the effect of the acid anion on chalcopyrite leach rates using a variety of acidic media (H 2SO 4, HClO 4, HCl and H 2SO 4 with 0.25 M NaCl) under carefully controlled solution conditions (pH 1 and 2, Eh 750 mV (SHE) and 75 °C) has been examined. These conditions have been chosen to enable sufficient leach rates for accurate experimental determination and to compare to the previous mechanistic analysis carried out by Harmer et al. (2006). Extensive surface analysis of leach residues demonstrated that variations in the surface speciation could not be responsible for the observed variations in leach rate. The rate of Cu release, however, was found to be first order with respect to Fe 3+ activity and inversely proportional with respect to H + activity to the power of 0.7: {1}/{S}{dC}/{dt}=(2.0±0.2){a}/{aH0.7} where S is the relative surface area, C is concentration of Cu in the solution (M), t is the time (h), 2.0 is the rate constant (M 0.7 h -1) and a and a are Fe 3+ and H + activities, respectively (M). The rate model was further validated against additional leaches carried out in H 2SO 4 media with the initial addition of Fe 3+ (8 mM as Fe 2(SO 4) 3) at 75 °C under various pH and Eh regimes. The only condition under which this rate model was found not to hold was at simultaneously low a and high a, that is at pH 1 and a<5×10-5M, where the concentration of dissolved O 2 may be leach rate determining.

  13. Leaching of used CANDU fuel: Results from a 19-year leach test under oxidizing conditions

    Energy Technology Data Exchange (ETDEWEB)

    Stroes-Gascoyne, S.; Johnson, L.H.; Tait, J.C.; McConnell, J.L.; Porth, R.J. [AECL, Pinawa, Manitoba (Canada). Whiteshell Labs.

    1997-12-31

    A fuel leaching experiment has been in progress since 1977 to study the dissolution behavior of used CANDU fuel in aerated aqueous solution. The experiment involves exposure of 50-mm clad segments of an outer element of a Pickering fuel bundle (burnup 610 GJ/kg U; linear and peak power ratings 53 and 58 kW/m, respectively), to deionized distilled water (DDH{sub 2}O, {approximately}2 mg/L carbonate) and tapwater ({approximately}50 mg/L carbonate). In 1992, it was observed that the fuel in at least one of the leaching solutions showed some signs of deterioration and, therefore, in 1993, parts of the fuel samples were sacrificed for a detailed analysis of the physical state of the fuel, using SEM and optical microscopy. Leaching results to date show that even after >6900 days only 5 to 7.7% of the total calculated inventory of {sup 137}Cs has leached out preferentially and that leach rates suggest a development towards congruent dissolution. Total amounts of {sup 137}Cs and {sup 90}Sr leached are slightly larger in tapwater than in DDH{sub 2}O. SEM examinations of leached fuel surface fragments indicate that the fuel surface exposed to DDH{sub 2}O is covered in a needle-like precipitate. The fuel surface exposed to tapwater shows evidence of leaching but no precipitate, likely because uranium is kept in solution by carbonate. Detailed optical and SEM microscopy examinations on fuel cross sections suggest that grain-boundary dissolution in DDH{sub 2}O is not prevalent, and in tapwater appears to be limited to the outer {approximately}0.5 mm (pellet/cladding) region of the fuel. Grain boundary attack seems to be limited to microcracks at or near the surface of the fuel. It thus appears that grain-boundary attack occurs only near the fuel pellet surface and is prevalent only in the presence of carbonate in solution.

  14. High temperatures and inverted metamorphism in the schist of Sierra de Salinas, California

    Science.gov (United States)

    Kidder, Steven; Ducea, Mihai N.

    2006-01-01

    New field and thermobarometric work in the Californian Salinian block clarifies current and pre-Tertiary relationships between the schist of Sierra de Salinas and Cretaceous arc-related granitic rocks. The contact is variably preserved as a brittle fault and high-temperature mylonite zone, the Salinas shear zone, which represents the contact between North America and sediments accreted above the Farallon slab between ˜ 76 Ma and ˜ 70 Ma. Near granulite facies, prograde replacement of hornblende with clinopyroxene is associated with deformation of plutonic rocks at the base of the upper plate. In the lower plate, the schist of Sierra de Salinas, garnet-biotite thermometry indicates decreasing temperatures down-section from at least 714 °C to ˜ 575 °C over an exposed thickness of ˜ 2.5 km, consistent with petrologic evidence of an inverted metamorphic gradient. The measured temperatures are significantly higher than observed at shallow levels above subducting slabs or predicted by 2D computational models assuming low shear stresses. Previous workers have called upon shear heating to explain similar observations in the correlative Pelona schist, an unlikely scenario given the results of recent rock deformation experiments which predict that feldspar-quartz-mica aggregates are far too weak to withstand stresses of ˜ 70 MPa required by the shear heating hypothesis. As an alternative, we propose that high temperatures resulted from conductive heating while the leading edge of the schist traveled ˜ 150 km beneath the recently active Salinian continental arc during the initiation of shallow subduction. Weakening of the schist due to high temperatures helped facilitate the collapse of the Salinian arc as the schist was emplaced. Schist emplacement coincided with loss of lower, mafic portions of the arc, and therefore evolution of the Southern California crust towards a more felsic composition.

  15. LIPID PRODUCTION BY DUNALIELLA SALINA IN BATCH CULTURE: EFFECTS OF NITROGEN LIMITATION AND LIGHT INTENSITY

    Energy Technology Data Exchange (ETDEWEB)

    Weldy, C.S.; Huesemann, M.

    2007-01-01

    Atmospheric carbon dioxide (CO2) concentrations are increasing and may cause unknown deleterious environmental effects if left unchecked. The Intergovernmental Panel on Climate Change (IPCC) has predicted in its latest report a 2°C to 4°C increase in global temperatures even with the strictest CO2 mitigation practices. Global warming can be attributed in large part to the burning of carbon-based fossil fuels, as the concentration of atmospheric CO2 is directly related to the burning of fossil fuels. Biofuels which do not add CO2 to the atmosphere are presently generated primarily from terrestrial plants, i.e., ethanol from corn grain and biodiesel from soybean oil. The production of biofuels from terrestrial plants is severely limited by the availability of fertile land. Lipid production from microalgae and its corresponding biodiesel production have been studied since the late 1970s but large scale production has remained economically infeasible due to the large costs of sterile growing conditions required for many algal species. This study focuses on the potential of the halophilic microalgae species Dunaliella salina as a source of lipids and subsequent biodiesel production. The lipid production rates under high light and low light as well as nitrogen suffi cient and nitrogen defi cient culture conditions were compared for D. salina cultured in replicate photobioreactors. The results show (a) cellular lipid content ranging from 16 to 44% (wt), (b) a maximum culture lipid concentration of 450mg lipid/L, and (c) a maximum integrated lipid production rate of 46mg lipid/L culture*day. The high amount of lipids produced suggests that D. salina, which can be mass-cultured in non-sterile outdoor ponds, has strong potential to be an economically valuable source for renewable oil and biodiesel production.

  16. Gestión de la Hilandería Intercomunal Salinas. Proyecto de cooperación al desarrollo en la comunidad andina de Salinas de Guaranda, Ecuador

    OpenAIRE

    Kimball Zurbano, Mark

    2012-01-01

    En este proyecto final de carrera hago una descripción de los diferentes puntos de actuación en los que trabajé en la Hilandería Intercomunal Salinas (Ecuador). Al final hago una reflexión del mundo de la cooperación según mi experiencia vivida. Las nueve partes en las que he dividido mi trabajo son Salinas: un ejemplo de economía solidaria, estudio de los procesos productivos, cálculo de costes de producción, fijación de precios, plan de producción, medio ambiente, materia prima, e...

  17. Some observations on the growth and cyst production characteristics of the brine shrimp Artemia sp. (Gujarat strain) in pond culture and its potential for import substitution

    OpenAIRE

    Gopalakrishnan, P.; Krishna Raju, V.; Thaker, S R

    1989-01-01

    Experimental culture of the brine shrimp Artemia sp. (Gujarat strain) and production of cyst is discussed. The qualitative and quantitative aspects of the cyst and its economic potential for import substitution are highlighted.

  18. SNP detection in Na/K ATP-ase gene α1 subunit of bisexual and parthenogenetic Artemia strains by RFLP screening.

    Science.gov (United States)

    Manaffar, R; Zare, S; Agh, N; Abdolahzadeh, N; Soltanian, S; Sorgeloos, P; Bossier, P; Van Stappen, G

    2011-01-01

    In order to find a marker for differentiating between a bisexual and a parthenogenetic Artemia strain, Exon-7 of the Na/K ATPase α(1) subunit gene was screened by RFLP technique. The results revealed a constant synonymous SNP (single nucleotide polymorphism) in digestion by the Tru1I enzyme that was consistent with these two types of Artemia. This SNP was identified as an accurate molecular marker for discrimination between bisexual and parthenogenetic Artemia. According to the Nei's genetic distance (1973), the lowest genetic distance was found between individuals from Artemia urmiana Günther 1890 and parthenogenetic populations, making the described marker the first marker to easily distinguish between these two cooccurring species.

  19. Survival and retention of the probiotic properties of Bacillus sp. strains under marine stress starvation conditions and their potential use as a probiotic in Artemia culture.

    Science.gov (United States)

    Mahdhi, Abdelkarim; Esteban, Maria Ángeles; Hmila, Zeineb; Bekir, Karima; Kamoun, Fathi; Bakhrouf, Amina; Krifi, Boubaker

    2012-12-01

    The probiotic properties of Bacillus strains isolated from Artemia culture and the effect of marine stress on viability and survival were investigated, as well as the changes occurring in their properties. Analyses showed that these bacteria corresponded to the genus Bacillus sp. Antagonism and adherence assays revealed that Bacillus strains have an inhibitory effect against tested pathogenic bacteria and are fairly adherent. Normal and starved cells showed different enzymatic profiles. Challenge tests performed with Artemia larvae provided evidence that the tested Bacillus strains were neither pathogenic nor toxic to the host and conferred protection for Artemia culture against pathogens. The tested strains maintained their viability and their probiotic properties during the period of study. The results suggest that the tested strains have suffered changes allowing them to survive in seawater in the absence of nutrients and outside their natural host, identifying them as potential probiotic candidates for Artemia culture.

  20. Multigenerational demographic responses of sexual and asexual Artemia to chronic genotoxicity by a reference mutagen.

    Science.gov (United States)

    Sukumaran, Sandhya; Grant, Alastair

    2013-11-15

    Genotoxins are capable of multigenerational impacts on natural populations via DNA damage and mutations. Sexual reproduction is assumed to reduce the long term consequences of genotoxicity for individual fitness and should therefore reduce population level effects. However, rather few empirical studies have quantified the magnitude of this effect. We tried to analyse the multigenerational demographic responses of sexual Artemia franciscana and asexual Artemia parthenogenetica due to chronic genotoxicity by a reference mutagen, ethyl methane sulfonate (EMS). A prospective (elasticity analysis) and retrospective (differences and contributions) perturbation analysis was carried out to understand the interactions of life history traits with population growth rate λ by comparing elasticities, differences and contributions of vital rates to λ. None of the previous studies have compared the effects of chronic genotoxicity using prospective and retrospective perturbation analyses in a sexual and asexual species over generations. The behaviour of a population with lower growth rate in the presence of genotoxicants in the field was studied by simulating reduced fertilities in the LTRE design. The results of prospective and retrospective perturbation analyses of effects on λ showed that population growth rate was proportionally more sensitive to juvenile survival whereas the effect of EMS on juvenile fertility contributed more to the variations in population growth rate in both the species and this effect was due to the high growth rate of Artemia. Simulations of lower population growth rate in the model showed that adult fertility and survival are also of importance. Sexual reproduction substantially mitigated the long term consequences of genetic damage, although these would be greater if population growth rate were lower. So multigenerational population level consequences of genotoxicity were much greater in an asexual species. So asexual species, and those with a

  1. Effects of elevated pCO2 on physiological performance of marine microalgae Dunaliella salina (Chlorophyta, Chlorophyceae)

    Science.gov (United States)

    Hu, Shunxin; Wang, You; Wang, Ying; Zhao, Yan; Zhang, Xinxin; Zhang, Yongsheng; Jiang, Ming; Tang, Xuexi

    2017-06-01

    The present study was conducted to determine the effects of elevated pCO2 on growth, photosynthesis, dark respiration and inorganic carbon acquisition in the marine microalga Dunaliella salina. To accomplish this, D. salina was incubated in semi-continuous cultures under present-day CO2 levels (390 μatm, pHNBS: 8.10), predicted year 2100 CO2 levels (1 000 μatm, pHNBS: 7.78) and predicted year 2300 CO2 levels (2 000 μatm, pHNBS: 7.49). Elevated pCO2 significantly enhanced photosynthesis (in terms of gross photosynthetic O2 evolution, effective quantum yield (ΔF/F' m ), photosynthetic efficiency (α), maximum relative electron transport rate (rETRmax) and ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activity) and dark respiration of D. salina, but had insignificant effects on growth. The photosynthetic O2 evolution of D. salina was significantly inhibited by the inhibitors acetazolamide (AZ), ethoxyzolamide (EZ) and 4,4'-diisothiocyanostilbene-2,2'-disulfonate (DIDS), indicating that D. salina is capable of acquiring HCO3 - via extracellular carbonic anhydrase and anion-exchange proteins. Furthermore, the lower inhibition of the photosynthetic O2 evolution at high pCO2 levels by AZ, EZ and DIDS and the decreased carbonic anhydrase showed that carbon concentrating mechanisms were down-regulated at high pCO2. In conclusion, our results show that photosynthesis, dark respiration and CCMs will be affected by the increased pCO2/low pH conditions predicted for the future, but that the responses of D. salina to high pCO2/low pH might be modulated by other environmental factors such as light, nutrients and temperature. Therefore, further studies are needed to determine the interactive effects of pCO2, temperature, light and nutrients on marine microalgae.

  2. Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates.

    Science.gov (United States)

    Defoirdt, Tom; Crab, Roselien; Wood, Thomas K; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

    2006-09-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests.

  3. La teoría armónica después de Francisco de Salinas

    OpenAIRE

    2014-01-01

    [ES] Francisco de Salinas ha sido considerado siempre como uno de los grandes teóricos musicales de todos los tiempos, aunque su mayor fama se debe a la famosa «Oda a Salinas» de fray Luis de León. Como buen humanista, nuestro autor pretende abarcar todos los aspectos musicales conocidos de su época. Para ello le asiste, no solo su pericia como instrumentista sino su conocimiento del latín y el griego, que le permitía acceder a las fuentes clásicas, muchas de las cuales estaban ap...

  4. Leaching of metals from steel samples in peracetic acid

    Science.gov (United States)

    Yabutani, Tomoki; Nakamura, Takamasa; Takayabagi, Toshio

    2015-03-01

    In this paper, leaching behavior of metallic species from steel samples in peracetic acid was investigated. We compared the leaching efficiency between peracetic acid and acetic acid to estimate the role of peroxo functional group for the leaching. As a result, peracetic acid enhanced the leaching ability of metallic species from the high speed steel and the alloy steel samples. MoO3, Mo, MO2C, W, WO3, VC and MnO2 were effectively leached by peracetic acid, while the stainless steel had a high resistance against corrosion by peracetic acid.

  5. Radiological investigation of phosphate fertilizers: Leaching studies.

    Science.gov (United States)

    Hegedűs, Miklós; Tóth-Bodrogi, Edit; Németh, Szabolcs; Somlai, János; Kovács, Tibor

    2017-07-01

    The raw materials of the phosphate fertilizer industry are the various apatite minerals. Some of these have high levels of natural radionuclides, and thus phosphate fertilizers contain significant amounts of U-238, K-40 and Ra-226. These can leach out of the fertilizers used in large quantities for resupplying essential nutrients in the soil and can then enter the food chain through plants, thereby increasing the internal dose of the affected population. In the current study, the radiological risk of eight commercially available phosphate fertilizers (superphosphate, NPK, PK) and their leaching behaviours were investigated using different techniques (gamma and alpha spectrometry), and the dose contributions of using these fertilizers were estimated. To characterize the leaching behaviour, two leaching procedures were applied and compared -the MSZ 21470-50 (Hungarian standard) and the Tessier five-step sequential extraction method. Based on the evaluation of the gamma-spectra, it is found that the level of Th-232 in the samples was low (max.7 ± 6 Bq kg(-1)), the average Ra-226 activity concentration was 309 ± 39 Bq kg(-1) (min. 10 ± 8 Bq kg(-1), max. 570 ± 46 Bq kg(-1)), while the K-40 concentrations (average 3139 ± 188 Bq kg(-1), min. 51 ± 36 Bq kg(-1)) could be as high as 7057 ± 427 Bq kg(-1). The high K-40 can be explained by reference to the composition of the investigated fertilizers (NPK, PK). U concentrations were between 15 and 361 Bq kg(-1), with the average of 254 Bq kg(-1), measured using alpha spectrometry. The good correlation between P2O5 content and radioactivity reported previously is not found in our data. The leaching studies reveal that the mobility of the fertilizer's uranium content is greatly influenced by the parameters of the leaching methods. The availability of U to water ranged between 3 and 28 m/m%, while the Lakanen-Erviö solution mobilized between 10 and 100% of the U content. Copyright © 2016

  6. Effects of salinity and ultraviolet radiation on the bioaccumulation of mycosporine-like amino acids in Artemia from Lake Urmia (Iran).

    Science.gov (United States)

    Khosravi, Sanaz; Khodabandeh, Saber; Agh, Naser; Bakhtiarian, Mahdieh

    2013-01-01

    We investigated the effects of salinity and artificial UV radiation on the accumulation of mycosporine-like amino acids (MAAs) in sexual and parthenogenetic Artemia from Lake Urmia. The nauplii hatched from the cysts were cultured until adulthood under two salinities (150 and 250 g L(-1) ) and two light treatments (PAR and PAR+UVR) in the laboratory. Finally, the Artemia were analyzed for their concentration of MAAs. In most of the cases, the higher salinity level applied was found to increase the MAA concentrations in both Artemia populations significantly. The acquisition efficiency of MAAs in both Artemia populations increased under exposure to UVR-supplemented photosynthetically active radiation (PAR) compared to those raised under PAR, except for Porphyra-334. It was observed that combination of UV radiation and elevated salinity significantly increased the bioaccumulation of MAAs. Thus, the presence of these compounds in these populations of Artemia may increase their adaptability for living in high-UV and high-salinity conditions prevailing in Lake Urmia. Higher concentrations of MAAs in the parthenogenetic population of Artemia could be probably attributed to its mono sex nature and higher adaptation capacities to extreme environmental conditions.

  7. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Institute of Scientific and Technical Information of China (English)

    Behnam Shekarchi; Ali Nekuiefard; Ramin Manaffar

    2016-01-01

    Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME) (3.5% v/v). Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms) were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate) in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  8. Genetic variation in parthenogenetic Artemia from the Shandong Peninsula, P.R.C.

    Science.gov (United States)

    King, Charles E.; Zhao, Yuqi; Liu, Xin; Li, Mingren

    1988-06-01

    Results are presented of a survey of isozyme frequencies in parthenogenetic Artimia from six salterns in the Shandong Peninsula, P.R.C. Three of the eleven enzymes we scored using polyacryamide gel electrophoresis proved to be useful for analysis of electromorph frequency variation. These enzymes are tetrazolium oxidase (TO), lactate dehydrogenase (LDH), and malate dehydrogenase (MDH). Each of these systems showed extensive isozyme variation both within and between salterns. In addition, we have examined the possibility that electromorph frequencies may vary as the result of natural selection for adaptation to specific salinity, or salinity-associated environmental conditions. An indication of clinal variation was found in two series of ponds differing in salinity, however more extensive data are needed before it is possible to conclude that these patterns are the result of natural selection. Finally, the use of isozyme analyses such as ours, for unraveling taxonomic problems in Artemia is discussed.

  9. Sharp Phylogeographic Breaks and Patterns of Genealogical Concordance in the Brine Shrimp Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Theodora Farmaki

    2009-12-01

    Full Text Available Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI and two nuclear (ITS1, p26 markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a result of slower coalescence or male-mediated dispersal. Our findings capture the genealogical interval between gene splitting and population divergence. In this sense, strong indications are provided in favour of a superspecies status and ongoing speciation in A. franciscana.

  10. Identification of a novel DNA methyltransferase 2 from the brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Feng, Chen-Zhuo; Zhu, Xiao-Jing; Dai, Zhong-Min; Liu, Feng-Qi; Xiang, Jian-Hai; Yang, Wei-Jun

    2007-06-01

    DNA methyltransferase 2 (Dnmt2) is a dual-specificity DNA methyltransferase, which contains a weak DNA methyltransferase and novel tRNA methyltransferase activity. However, its biological function is still enigmatic. To elucidate the expression profiles of Dnmt2 in Artemia franciscana, we isolated the gene encoding a Dnmt2 from A. franciscana and named it as AfDnmt2. The cDNA of AfDnmt2 contained a 1140-bp open reading frame that encoded a putative Dnmt2 protein of 379 amino acids exhibiting 32% approximately 39% identities with other known Dnmt2 homologs. This is the first report of a DNA methyltransferase gene in Crustacean. By using semi-quantitative RT-PCR, AfDnmt2 was found to be expressed through all developmental stages and its expression increased during resumption of diapause cysts development. Southern blot analysis indicated the presence of multiple copies of AfDnmt2 genes in A. franciscana.

  11. Interactive effect of selenium and mercury on development and mortality of brine shrimp, Artemia sp.

    Energy Technology Data Exchange (ETDEWEB)

    Forsythe, B.L. II; Bailey, F.C.; Klaine, S.J. [Clemson Univ., Pendleton, SC (United States)

    1994-12-31

    The interactions between organic mercury and selenium derivatives are well documented. Inorganic mercury has been shown to have a deleterious effect on the development of brine shrimp, Artemia franciscana while selenate has no effect. In this study, concentrations as low as 0.1 mg/l Hg (as Hg(NO{sub 3})2) slowed the rate of development. Selenate concentrations ranging from 0.1 to 5.0 mg/l as Se decreased the effect of Hg on brine shrimp developmental rate. Both selenate and inorganic mercury alone produced a dose-response with respect to nauplii mortality. Preliminary data suggest that combinations of selenate and inorganic mercury act antagonistically to lower this mortality.

  12. Can Artemia Hatching Assay Be a (Sensitive) Alternative Tool to Acute Toxicity Test?

    Science.gov (United States)

    Rotini, A; Manfra, L; Canepa, S; Tornambè, A; Migliore, L

    2015-12-01

    Artemia sp. is extensively used in ecotoxicity testing, despite criticisms inherent to both acute and long-term tests. Alternative endpoints and procedures should be considered to support the use of this biological model. The hatching process comprises several developmental steps and the cyst hatchability seems acceptable as endpoint criterion. In this study, we assessed the reliability of the hatching assay on A. franciscana by comparing with acute and long-term mortality tests, using two chemicals: Diethylene Glycol (DEG), Sodium Dodecyl Sulphate (SDS). Both DEG and SDS tests demonstrated a dose dependent hatching inhibition. The hatching test resulted more sensitive than acute mortality test and less sensitive than the long-term one. Results demonstrate the reliability and high sensitivity of this hatching assay on a short time lag and support its useful application in first-tier risk assessment procedures.

  13. Mechanochemical leaching of chalcopyrite concentrate by sulfuric acid

    Science.gov (United States)

    Mohammadabad, Farhad Khorramshahi; Hejazi, Sina; khaki, Jalil Vahdati; Babakhani, Abolfazl

    2016-04-01

    This study aimed to introduce a new cost-effective methodology for increasing the leaching efficiency of chalcopyrite concentrates at ambient temperature and pressure. Mechanical activation was employed during the leaching (mechanochemical leaching) of chalcopyrite concentrates in a sulfuric acid medium at room temperature and atmospheric pressure. High energy ball milling process was used during the leaching to provide the mechanochemical leaching condition, and atomic absorption spectroscopy and cyclic voltammetry were used to determine the leaching behavior of chalcopyrite. Moreover, X-ray diffraction and scanning electron microscopy were used to characterize the chalcopyrite powder before and after leaching. The results demonstrated that mechanochemical leaching was effective; the extraction of copper increased significantly and continuously. Although the leaching efficiency of chalcopyrite was very low at ambient temperature, the percentages of copper dissolved in the presence of hydrogen peroxide (H2O2) and ferric sulfate (Fe2(SO4)3) after 20 h of mechanochemical leaching reached 28% and 33%, respectively. Given the efficiency of the developed method and the facts that it does not require the use of an autoclave and can be conducted at room temperature and atmospheric pressure, it represents an economical and easy-to-use method for the leaching industry.

  14. Life cycle assessment and residue leaching: the importance of parameter, scenario and leaching data selection.

    Science.gov (United States)

    Allegrini, E; Butera, S; Kosson, D S; Van Zomeren, A; Van der Sloot, H A; Astrup, T F

    2015-04-01

    Residues from industrial processes and waste management systems (WMSs) have been increasingly reutilised, leading to landfilling rate reductions and the optimisation of mineral resource utilisation in society. Life cycle assessment (LCA) is a holistic methodology allowing for the analysis of systems and products and can be applied to waste management systems to identify environmental benefits and critical aspects thereof. From an LCA perspective, residue utilisation provides benefits such as avoiding the production and depletion of primary materials, but it can lead to environmental burdens, due to the potential leaching of toxic substances. In waste LCA studies where residue utilisation is included, leaching has generally been neglected. In this study, municipal solid waste incineration bottom ash (MSWI BA) was used as a case study into three LCA scenarios having different system boundaries. The importance of data quality and parameter selection in the overall LCA results was evaluated, and an innovative method to assess metal transport into the environment was applied, in order to determine emissions to the soil and water compartments for use in an LCA. It was found that toxic impacts as a result of leaching were dominant in systems including only MSWI BA utilisation, while leaching appeared negligible in larger scenarios including the entire waste system. However, leaching could not be disregarded a priori, due to large uncertainties characterising other activities in the scenario (e.g. electricity production). Based on the analysis of relevant parameters relative to leaching, and on general results of the study, recommendations are provided regarding the use of leaching data in LCA studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Removal of phosphorus from iron ores by chemical leaching

    Institute of Scientific and Technical Information of China (English)

    JIN Yong-shi; JIANG Tao; YANG Yong-bin; LI Qian; LI Guang-hui; GUO Yu-feng

    2006-01-01

    Alkali-leaching and acid-leaching were proposed for the dephosphorization of Changde iron ore, which contains an average of 1.12% for phosphorus content. Sodium hydroxide, sulfuriced, hydrochloric and nitric acids were used for the preparation of leach solutions. The results show that phosphorus occurring as apatite phase could be removed by alkali-leaching, but those occurring in the iron phase could not. Sulfuric acid is the most effective among the three kinds of acid. 91.61% phosphorus removal was attained with 1% sulfuric acid after leaching for 20 min at room temperature. Iron loss during acid-leaching can be negligible, which was less than 0.25%.The pH value of solution after leaching with 1% sulfuric acid was about 0.86, which means acid would not be exhausted during the process and it could be recycled, and the recycle of sulfuric acid solution would make the dephosphorization process more economical.

  16. Further characterization of the cathepsin L-associated protein and its gene in two species of the brine shrimp, Artemia.

    Science.gov (United States)

    Liu, Liqian; Warner, Alden H

    2006-12-01

    The major cysteine protease in embryos and larvae of the brine shrimp Artemia franciscana is a heterodimer composed of a cathepsin L-like polypeptide of 28.5 kDa and a 31.5 kDa polypeptide called the cathepsin L-associated protein or CLAP. In a previous study, CLAP was shown to be a cell adhesion protein containing two Fas I domains and two GTP/ATP binding sites known as Walker A and B motifs. Here, we have characterized CLAP and its genes to better understand the role of this protein in Artemia development. The polymerase chain reaction was used to investigate the structure of the CLAP gene in two species of Artemia, the New World bisexual diploid A. franciscana and the Old World parthenogenetic tetraploid Artemia parthenogenetica. The protein coding region of the CLAP gene from each species was 99.5% identical for a protein of 332 amino acids, while the 3' non-coding region, representing nearly 45% of the gene, was only 86% identical between the two related species. However, while the CLAP gene is intronless in A. franciscana, in A. parthenogenetica the gene contained a mini-intron of 30 base pairs in the 3' non-coding region. The sequences representing the CLAP gene in A. franciscana and A. parthenogenetica have been entered into the NCBI database as AY757920 and DQ100385, respectively. Northern blot analysis showed that while the cathepsin L gene is expressed constitutively in Artemia franciscana embryos and young larvae, the CLAP gene is not expressed in late embryos and young larvae. In contrast, Western blots indicated that CLAP is present in developing embryos and young larvae, at least to the first larval molt, supporting results obtained previously showing CLAP's resistance to degradation by its dimeric partner, cathepsin L. At the protein level we showed that the GTP/ATP binding sites in CLAP are functional with rate constants of 0.024 and 0.022 for GTP and ATP hydrolase activity, respectively. GTP but not ATP also had a slight stimulatory effect on

  17. Maladaptive Sex Ratio Adjustment in the Invasive Brine Shrimp Artemia franciscana.

    Science.gov (United States)

    Lievens, Eva J P; Henriques, Gil J B; Michalakis, Yannis; Lenormand, Thomas

    2016-06-06

    Sex allocation theory is often hailed as the most successful area of evolutionary theory due to its striking success as a predictor of empirical observations [1]. Most naturally occurring sex ratios can be explained by the principle of equal investment in the sexes [2-4] or by cases of "extraordinary" sex allocation [5]. Deviations from the expected sex ratio are often correlated with weak selection or low environmental predictability (e.g., [6, 7]); true cases of aberrant sex allocation are surprisingly rare [8]. Here, we present a case of long-lasting maladaptive sex allocation, which we discovered in invasive populations of the exclusively sexual brine shrimp Artemia franciscana. A. franciscana was introduced to Southern France roughly 500 generations ago [9]; since then, it has coexisted with the native asexual species Artemia parthenogenetica [10]. Although we expect A. franciscana to produce balanced offspring sex ratios, we regularly observed extremely male-biased sex ratios in invasive A. franciscana, which were significantly correlated to the proportion of asexuals in the overall population. We experimentally proved that both invasive- and native-range A. franciscana overproduced sons when exposed to excess females, without distinguishing between conspecific and asexual females. We conclude that A. franciscana adjust their offspring sex ratio in function of the adult sex ratio but are information limited in the presence of asexual females. Their facultative adjustment trait, which is presumably adaptive in their native range, has thus become maladaptive in the invasive range where asexuals occur. Despite this, it has persisted unchanged for hundreds of generations.

  18. Involvement of cyclin K posttranscriptional regulation in the formation of Artemia diapause cysts.

    Directory of Open Access Journals (Sweden)

    Yang Zhao

    Full Text Available BACKGROUND: Artemia eggs tend to develop ovoviviparously to yield nauplius larvae in good rearing conditions; while under adverse situations, they tend to develop oviparously and encysted diapause embryos are formed instead. However, the intrinsic mechanisms regulating this process are not well understood. PRINCIPAL FINDING: This study has characterized the function of cyclin K, a regulatory subunit of the positive transcription elongation factor b (P-TEFb in the two different developmental pathways of Artemia. In the diapause-destined embryo, Western blots showed that the cyclin K protein was down-regulated as the embryo entered dormancy and reverted to relatively high levels of expression once development resumed, consistent with the fluctuations in phosphorylation of position 2 serines (Ser2 in the C-terminal domain (CTD of the largest subunit (Rpb1 of RNA polymerase II (RNAP II. Interestingly, the cyclin K transcript levels remained constant during this process. In vitro translation data indicated that the template activity of cyclin K mRNA stored in the postdiapause cyst was repressed. In addition, in vivo knockdown of cyclin K in developing embryos by RNA interference eliminated phosphorylation of the CTD Ser2 of RNAP II and induced apoptosis by inhibiting the extracellular signal-regulated kinase (ERK survival signaling pathway. CONCLUSIONS/SIGNIFICANCE: Taken together, these findings reveal a role for cyclin K in regulating RNAP II activity during diapause embryo development, which involves the post-transcriptional regulation of cyclin K. In addition, a further role was identified for cyclin K in regulating the control of cell survival during embryogenesis through ERK signaling pathways.

  19. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Institute of Scientific and Technical Information of China (English)

    Ana Dors; Mara Carmen Bartolom; Sebastin Snchez-Fortn

    2014-01-01

    Objective:To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods:Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI)-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results:Biotoxin equivalent values obtained by immunodetection were (2.12±0.10), (8.60±1.30) and (4.32±1.67) pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions:These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  20. Leaching of Electronic Waste Using Biometabolised Acids

    Institute of Scientific and Technical Information of China (English)

    M. Saidan; B. Brown; M. Valix

    2012-01-01

    The revolution in information and communication technology has brought huge technical benefits and wealth, but has created a major global problem: the generation of vast amounts of electronic waste, or e-waste through product obsolesce. The challenge in managing e-waste will be in developing sustainable recycling tech- nologies that are able to address the volume and complexity of this waste using cost effective and ecologically sen-sitive methods. In this study, the capability or microorganism metabolic acids in dissolving the metallic tractions from waste printed circuit boards was examined. Several factors were considered in the examination of the activityof the acids-including secondary reactions, solution pH, temperature and the nature of ligands in solutions (or bioacid constituents). The leaching tests were cgnducted ex-situ, using synthetic organic acids. Leaching was performed for periods of up to 6 hat 70-90 ℃ and 1000 r-min-1.