WorldWideScience

Sample records for artemia daphnia tenebrio

  1. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  2. Protection against the toxicity of microcystin-LR and cylindrospermopsin in Artemia salina and Daphnia spp. by pre-treatment with cyanobacterial lipopolysaccharide (LPS).

    Science.gov (United States)

    Lindsay, J; Metcalf, J S; Codd, G A

    2006-12-15

    Purified cyanobacterial lipopolysaccharide (LPS) was not acutely toxic to three aquatic invertebrates (Artemia salina, Daphnia magna and Daphnia galeata) in immersion trials. However, pre-exposure (24 h) to 2 ngmL(-1) LPS increased the LC(50) of microcystin-LR significantly in all 3 species. Similar results were observed with A. salina pre-treated with the same concentration of cyanobacterial LPS and subsequently exposed to cylindrospermopsin, increasing the LC(50) by 8. The findings indicate the need to include exposures to defined combinations of cyanotoxins, and in defined sequences, to understand the contributions of individual cyanotoxins in accounting for cyanobacterial toxicity to invertebrates in natural aquatic environments.

  3. Toxicity assessment of metabolites of fungal biocontrol agents using two different (Artemia salina and Daphnia magna) invertebrate bioassays.

    Science.gov (United States)

    Favilla, M; Macchia, L; Gallo, A; Altomare, C

    2006-11-01

    Fungal biocontrol agents (BCAs) have been marketed for control of crop pests, weeds, and diseases. However, BCAs may produce toxic metabolites, whose presence in the formulated products, in the crops and in the environment should be considered along with the associated risk. Two invertebrate models, viz. Artemia salina and Daphnia magna were used to assess the acute toxicity of seven BCA metabolites, characterized by different chemical nature and mode of action, namely alamethicin (ALA), paracelsin (PCS), antiamoebin (AAM), gliotoxin (GTX), destruxin A (DA), oosporein (OOS), and elsinochrome A (EA). The two invertebrates were very sensitive to all the metabolites examined, except OOS. The LC50s after 24 and 36 h exposures showed the following toxicity ranks: A. salina, DA > ALA > EA > GTX > AAM > PCS (LC50s ranging from 9.78 to 40.84 microg/ml at 24 h and from 2.92 to 18.56 microg/ml at 36 h); D. magna, DA > GTX = EA > ALA > PCS > AAM (LC50s ranging from 0.20 to 24.41 microg/ml at 24h and from 0.16 to 11.98 microg/ml at 36 h). LC50 of OOS to D. magna increased dramatically in 36 h exposure, compared to 24 h exposures (5.84 and 68.40 microg/ml, respectively). A. salina and D. magna proved to be suitable models for rapid and inexpensive screening of toxicity of BCAs at an early stage of product development.

  4. Motion control of a population of Artemias

    Directory of Open Access Journals (Sweden)

    L. Fortuna

    2010-06-01

    Full Text Available In this work, the collective behavior of Artemia Salina is studied both experimentally and theoretically. Several experiments have been designed to investigate the Artemia motion under different environment conditions. From the results of such experiments, a strategy to control the direction of motion of an Artemia population, by exploiting their sensitivity to light, has been derived and then implemented.

  5. Complexity in a population of Artemia

    Energy Technology Data Exchange (ETDEWEB)

    Ali, A.A., E-mail: abduladem1@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Fortuna, L., E-mail: lfortuna@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Frasca, M., E-mail: mfrasca@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Rashid, M.T., E-mail: mofid76@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Xibilia, M.G., E-mail: mxibilia@ingegneria.unime.i [DiSIA, Faculty of Engineering, University of Messina (Italy)

    2011-04-15

    Highlights: Experiments on collective motion of populations of animals (Artemia salina). Design of low-cost experimental setup for complex systems. Control of collective motion of populations of Artemia. Models of collective motion of populations of Artemia. - Abstract: Artemia salina belongs to a genus of very primordial crustaceans, whose behavior is not widely investigated in literature. Their collective behavior is studied in this paper both experimentally and theoretically. Different experiments have been designed to control the direction of motion of an Artemia population by exploiting their sensitivity to light and to measure the response of the population to light at different wavelengths. Mathematical models have been also derived, explaining the mechanisms underlying Artemia flocking formation when a light spot is applied to the system. The results obtained allow to develop new strategies for distributed control of agents and to test them in a simple and low cost experimental setup.

  6. Trealose e trealase em tenebrio molitor L Trehalose and Trehalase in Tenebrio molitor L

    Directory of Open Access Journals (Sweden)

    Cristina Piedras Lopes

    1972-01-01

    Full Text Available Foi estudada a concentração em trealose e a atividade em trealase do Tenebrio molitor L. durante as tres fases da metamorfose (larva, ninfa, imago. Verificou-se que na larva e no adulto os valores são mais elevados conforme a curva da fig. 3. A trealose foi expressa em mg/g de Tenebrio e a trealose por µg de glicose/mg proteina.Trehalose and trehalase were determined in the Tenebrio molitor L., using larva, pupa and imago. A total number of 895 animals was analyzed. A growth curve up to the end of the larval stage was established (Fig. 1 and compared with the normal one obtained by Fraenkel. It was shown that trehalose and trehalase are more concentrated in the larva and imago presenting a curve with two arms as depicted in the Fig. 3. Trehalase was expressed in mg/g of Tenebrio and trehalase in µg of glucose /mg proteín.

  7. Artemia cyst production in Russia

    Science.gov (United States)

    Litvinenko, Liudmila I.; Litvinenko, Aleksandr I.; Boiko, Elena G.; Kutsanov, Kirill

    2015-11-01

    In Western Siberia (Russia) there are about 100 Artemia lakes with total area over 1 600 km2. Geographically these lakes are located between 51°-56°N and 61°-82°E. In general these lakes are shallow (depth less than 1.5 m), small or medium size (0.1 to 10 km2); they are chloride; their total salinity is from 40 to 250 g/L. The harvesting of cysts per year is only in 20-40 lakes. In Russia 550 tons of dry Artemia cysts (14%-18% of the world production) were harvested annually. This includes about 350 tons in the Altai region and 200 tons in other regions. During our regular 20-year study period the cyst harvest was: 95 tons in Kurgan; 65 tons in Omsk, 20 tons in Novosibirsk, 20 tons in Tyumen. Ways of increasing cyst harvest in Russia are considered in this article. During the last 30 years the harvest of cysts in Russia has increased from 7-20 to 500-600 tons. A significant influence of dryness of the year was found on productivity in selected lakes, but taken for all the lakes together, the relationship was not significant. The optimal salinity for productivity of cysts in the lakes was determined. Analysis of productivity of the lakes and the harvesting results showed that the stocks of cysts are underutilized by approximately 1.7 times.

  8. The occurrence of an exotic bisexual Artemia species, Artemia franciscana, in two coastal salterns of Shandong Province, China

    Science.gov (United States)

    Zheng, Bo; Sun, Shichun; Ma, Lin

    2004-10-01

    The alien halophilous Artemia species, Artemia franciscana, was found in Chengkou Saltern and Yangkou Saltern of Shandong Province, P.R. China. Although the indigenous parthenogenetic Artemia is detectable, the exotic species is dominant in both salterns. The cross-breeding tests between the exotic A. franciscana and 5 bisexual Artemia species were conducted. The results of hybridization and morphological observations on the exotic A. franciscana are briefly presented in this short communication.

  9. The Occurrence of an Exotic Bisexual Artemia Species, Artemia franciscana, in Two Coastal Salterns of Shandong Province, China

    Institute of Scientific and Technical Information of China (English)

    ZHENG Bo; SUN Shichun; MA Lin

    2004-01-01

    The alien halophilous Artemia species, Artemia franciscana, was found in Chengkou Saltern and Yangkou Saltern of Shandong Province, P.R. China. Although the indigenous parthenogenetic Artemia is detectable, the exotic species is dominant in both salterns. The cross-breeding tests between the exotic A. franciscana and 5 bisexual Artemia species were conducted. The results of hybridization and morphological observations on the exotic A. franciscana are briefly presented in this short communication.

  10. The ecoresponsive genome of Daphnia pulex

    Energy Technology Data Exchange (ETDEWEB)

    Colbourne, John K.; Pfrender, Michael E.; Gilbert, Donald; Thomas, W. Kelley; Tucker, Abraham; Oakley, Todd H.; Tokishita, Shinichi; Aerts, Andrea; Arnold, Georg J.; Basu, Malay Kumar; Bauer, Darren J.; Caceres, Carla E.; Carmel, Liran; Casola, Claudio; Choi, Jeong-Hyeon; Detter, John C.; Dong, Qunfeng; Dusheyko, Serge; Eads, Brian D.; Frohlich, Thomas; Geiler-Samerotte, Kerry A.; Gerlach, Daniel; Hatcher, Phil; Jogdeo, Sanjuro; Krijgsveld, Jeroen; Kriventseva, Evgenia V; Kültz, Dietmar; Laforsch, Christian; Lindquist, Erika; Lopez, Jacqueline; Manak, Robert; Muller, Jean; Pangilinan, Jasmyn; Patwardhan, Rupali P.; Pitluck, Samuel; Pritham, Ellen J.; Rechtsteiner, Andreas; Rho, Mina; Rogozin, Igor B.; Sakarya, Onur; Salamov, Asaf; Schaack, Sarah; Shapiro, Harris; Shiga, Yasuhiro; Skalitzky, Courtney; Smith, Zachary; Souvorov, Alexander; Sung, Way; Tang, Zuojian; Tsuchiya, Dai; Tu, Hank; Vos, Harmjan; Wang, Mei; Wolf, Yuri I.; Yamagata, Hideo; Yamada, Takuji; Ye, Yuzhen; Shaw, Joseph R.; Andrews, Justen; Crease, Teresa J.; Tang, Haixu; Lucas, Susan M.; Robertson, Hugh M.; Bork, Peer; Koonin, Eugene V.; Zdobnov, Evgeny M.; Grigoriev, Igor V.; Lynch, Michael; Boore, Jeffrey L.

    2011-02-04

    This document provides supporting material related to the sequencing of the ecoresponsive genome of Daphnia pulex. This material includes information on materials and methods and supporting text, as well as supplemental figures, tables, and references. The coverage of materials and methods addresses genome sequence, assembly, and mapping to chromosomes, gene inventory, attributes of a compact genome, the origin and preservation of Daphnia pulex genes, implications of Daphnia's genome structure, evolutionary diversification of duplicated genes, functional significance of expanded gene families, and ecoresponsive genes. Supporting text covers chromosome studies, gene homology among Daphnia genomes, micro-RNA and transposable elements and the 46 Daphnia pulex opsins. 36 figures, 50 tables, 183 references.

  11. The case of Artemia spp. in nanoecotoxicology.

    Science.gov (United States)

    Libralato, Giovanni

    2014-10-01

    Artemia spp. is one of the most widespread saltwater organism suitable for ecotoxicity testing, but no internationally standardised methods exist. Several endpoints can be considered with Artemia spp. including short-term (24-48 h) and long-term (14 days) mortality, cysts and nauplii hatchability, biomass productivity, biomarkers' expression/inhibition and bioaccumulation on larvae as well as organisms' reproductive ability. Recently, Artemia spp. started to be used as a reference biological model in nanoecotoxicology with both inorganic and organic engineered nanomaterials (ENMs) also in combination with traditional environmental stressors looking for potential interactive effects. Criticisms were detected about the use of Artemia spp. in relation to the hatching phase, the toxicity test design, the occasional use only of reference toxicants and the way testing solution/suspensions were prepared thus potentially compromising the reliability of nanoecotoxicological results. A full list of compulsory information that must accompany Artemia nanoecotoxicity data is provided with positive feedbacks also for other toxicity bioassays.

  12. Enantioselective bioaccumulation of diniconazole in Tenebrio molitor larvae.

    Science.gov (United States)

    Liu, Chen; LV, Xiao Tian; Zhu, Wen Xue; QU, Hao Yang; Gao, Yong Xin; Guo, Bao Yuan; Wang, Hui Li

    2013-12-01

    The enantioselective bioaccumulation of diniconazole in Tenebrio molitor Linne larva was investigated with liquid chromatography tandem mass spectrometry based on the ChiralcelOD-3R[cellulose tri-(3,5-dimethylphenyl carbamate)] column. In this study we documented the effects of dietary supplementation with wheat bran contaminated by racemic diniconazole at two dose levels of 20 mg kg(-1) and 2 mg kg(-1) (dry weight) in Tenebrio molitor. The results showed that both doses of diniconazole were taken up by Tenebrio molitor rapidly in the first few days, the concentrations of R-enantiomer and S-enantiomer at high doses reached the highest level of 0.55 mg kg(-1) and 0.48 mg kg(-1) , respectively, on the 1(st) d, and the concentrations of them obtained a maxima of 0.129 mg kg(-1) and 0.128 mg kg(-1) at low dose, respectively, on the 3(rd) d, which means that the concentration of diniconazole was proportional to the time of achieving the highest accumulated level. It afterwards attained equilibrium after a sharp decline at both 20 mg kg(-1) and 2 mg kg(-1) of diniconazole. The determination results from the feces of Tenebrio molitor demonstrated that the extraction recovery (ER) values of the high dose group were higher than that of the low dose group and the values were all above 1; therefore, it could be inferred that enantiomerization existed in Tenebrio molitor. Additionally, the biota accumulation factor was used to evaluate the bioaccumulation of diniconazole enantiomers, showing that the bioaccumulation of diniconazole in Tenebrio molitor was enantioselective with preferential accumulation of S-enantiomer.

  13. Tenebrio beetles use magnetic inclination compass

    Science.gov (United States)

    Vácha, Martin; Drštková, Dana; Půžová, Tereza

    2008-08-01

    Animals that guide directions of their locomotion or their migration routes by the lines of the geomagnetic field use either polarity or inclination compasses to determine the field polarity (the north or south direction). Distinguishing the two compass types is a guideline for estimation of the molecular principle of reception and has been achieved for a number of animal groups, with the exception of insects. A standard diagnostic method to distinguish a compass type is based on reversing the vertical component of the geomagnetic field, which leads to the opposite reactions of animals with two different compass types. In the present study, adults of the mealworm beetle Tenebrio molitor were tested by means of a two-step laboratory test of magnetoreception. Beetles that were initially trained to memorize the magnetic position of the light source preferred, during the subsequent test, this same direction, pursuant geomagnetic cues only. In the following step, the vertical component was reversed between the training and the test. The beetles significantly turned their preferred direction by 180°. Our results brought until then unknown original findings that insects, represented here by the T. molitor species, use—in contrast to another previously researched Arthropod, spiny lobster—the inclination compass.

  14. Functional rare males in diploid parthenogenetic Artemia.

    Science.gov (United States)

    Maccari, M; Gómez, A; Hontoria, F; Amat, F

    2013-09-01

    Functional males that are produced occasionally in some asexual taxa - called 'rare males' - raise considerable evolutionary interest, as they might be involved in the origin of new parthenogenetic lineages. Diploid parthenogenetic Artemia produce rare males, which may retain the ability to mate with females of related sexual lineages. Here, we (i) describe the frequency of male progeny in populations of diploid parthenogenetic Artemia, (ii) characterize rare males morphologically, (iii) assess their reproductive role, using cross-mating experiments with sexual females of related species from Central Asia and characterize the F1 hybrid offspring viability and (iv) confirm genetically both the identity and functionality of rare males using DNA barcoding and microsatellite loci. Our result suggests that these males may have an evolutionary role through genetic exchange with related sexual species and that diploid parthenogenetic Artemia is a good model system to investigate the evolutionary transitions between sexual species and parthenogenetic strains.

  15. Comparison of the Artemia salina and Artemia fransiscana bioassays for toxicity of Indian medicinal plants

    Institute of Scientific and Technical Information of China (English)

    Thangapandi Veni; Thambusamy Pushpanathan

    2014-01-01

    Objective:To evaluate leaves extract of Azima tetracantha and Gmelina asiatica for lethality to brine shrimp larvae (Artemia salina and Artemia fransiscana). Methods: The plant materials were extracted based on polarity gradients of petroleum ether, benzene, chloroform, acetone, ethanol and methanol. The extracts were investigated for their cytotoxic potential. Results: In the brine shrimp lethality assay of all extracts, exception of acetone, ethanol and petroleum ether extracts Gmelina asiatica displayed 100%mortality at 1 000 μg/mL by Artemia salina and Artemia fransiscana. Chloroform extract was the most potent and presented the highest percentage of mortality with the lowest LC50 values by both assay too. Conclusions:The results of the present study suggest the presence of photochemical possessing cytotoxic agents.

  16. Morphometric analysis of instar variation in Tenebrio molitor (Coleoptera: Tenebrionidae)

    Science.gov (United States)

    Measurements of head capsule, mandible, metanotum, and body weight were done on larvae of Tenebrio molitor L. (Coleoptera: Tenebrionide) from the second to the last instar. Instar number varied from 14 to 18, but 15 or 16 instars were the most common. The value of dimensional measurements was evalua...

  17. Enantiomerization and enantioselective bioaccumulation of metalaxyl in Tenebrio molitor larvae.

    Science.gov (United States)

    Gao, Yongxin; Wang, Huili; Qin, Fang; Xu, Peng; Lv, Xiaotian; Li, Jianzhong; Guo, Baoyuan

    2014-02-01

    The enantiomerization and enantioselective bioaccumulation of metalaxyl by a single dose of exposure to Tenebrio molitor larvae under laboratory condition were studied by high-performance liquid chromatography tandem mass spectroscopy (HPLC-MS/MS) based on a ChiralcelOD-3R [cellulosetris-tris-(3, 5-dichlorophenyl-carbamate)] column. Exposure of enantiopure R-metalaxyl and S-metalaxyl in Tenebrio molitor larvae exhibited significant enantiomerization, with formation of the R enantiomers from the S enantiomers, and vice versa, which might be attributed to the chiral pesticide catalyzed by a certain enzyme in Tenebrio molitor larvae. Enantiomerization was not observed in wheat bran during the period of 21 d. In addition, bioaccumulation of rac-metalaxyl in Tenebrio molitor larvae was enantioselective with a preferential accumulation of S-metalaxyl. These results showed that enantioselectivity was caused not only by actual degradation and metabolism but also by enantiomerization, which was an important process in the environmental fate and behavior of metalaxyl enantiomers.

  18. A nuptially transmitted Ichthyosproean symbiont of Tenebrio molitor (Coleoptera: Tenebrionidae)

    Science.gov (United States)

    The yellow mealworm, Tenebrio molitor, harbors a symbiont that has spores with a thick, laminated wall and infects the fat body and ventral nerve chord of adult and larval beetles. In adult males, there is heavy infection of the epithelial cells of the testes and between testes lobes with occasional...

  19. Rapid bioassay to screen potential biopesticides in Tenebrio molitor larvae

    Science.gov (United States)

    A simplified assay was devised to evaluate the response of Tenebrio molitor larvae to potential insect control products. The assay incorporates punched disks of flattened whole-grain bread placed in 96-well plates, with treatments applied topically, and neonate larvae added to each well. To evalua...

  20. Portuguese native Artemia parthenogenetica resisting invasion by Artemia franciscana - Assessing reproductive parameters under different environmental conditions

    Science.gov (United States)

    Pinto, Pedro M.; Hontoria, Francisco; Vieira, Natividade; Bio, Ana

    2014-05-01

    There is widespread interest in the conservation of native Artemia biodiversity. In Portugal, only two known populations of native Artemia remain: one in the Rio Maior salina, the other in the Aveiro salina complex, both of the diploid Artemia parthenogenetica species. All other Portuguese hypersaline environments where Artemia can be found have been invaded by Artemia franciscana, which has eradicated the native strains. Invasiveness and resilience of, respectively, exotic and indigenous species are thought to depend on strain-specific traits and adaptation to local conditions. This work evaluates the reproductive performance of the two Portuguese native strains and the invasive species exposed to different salinities, temperatures, photoperiods and food supplies. Reproduction periods, quantity and quality of offspring varied significantly, depending on both the Artemia strain and environmental conditions. A. parthenogenetica from Rio Maior reproduced better than A. franciscana at high salinity (150) and low food supply, which may reflect an adaptation to its biotope that aids its resistance to invasion. But A. parthenogenetica form Aveiro performed much worse than its invasive competitor, under most of the conditions tested. It is unlikely that A. franciscana has not been introduced in this salina by chance alone. Other biological traits of the local A. parthenogenetica or adaptation to unstudied local factors (e.g. pollution) are probably responsible for this strain's survival. Further knowledge on specific local conditions and trait-specific tolerances to biotic and abiotic conditions are needed to understand (non-)invasion patterns and preserve the remaining native populations.

  1. Mitochondrial genome sequences of Artemia tibetiana and Artemia urmiana: assessing molecular changes for high plateau adaptation.

    Science.gov (United States)

    Zhang, Hangxiao; Luo, Qibin; Sun, Jing; Liu, Fei; Wu, Gang; Yu, Jun; Wang, Weiwei

    2013-05-01

    Brine shrimps, Artemia (Crustacea, Anostraca), inhabit hypersaline environments and have a broad geographical distribution from sea level to high plateaus. Artemia therefore possess significant genetic diversity, which gives them their outstanding adaptability. To understand this remarkable plasticity, we sequenced the mitochondrial genomes of two Artemia tibetiana isolates from the Tibetan Plateau in China and one Artemia urmiana isolate from Lake Urmia in Iran and compared them with the genome of a low-altitude Artemia, A. franciscana. We compared the ratio of the rate of nonsynonymous (Ka) and synonymous (Ks) substitutions (Ka/Ks ratio) in the mitochondrial protein-coding gene sequences and found that atp8 had the highest Ka/Ks ratios in comparisons of A. franciscana with either A. tibetiana or A. urmiana and that atp6 had the highest Ka/Ks ratio between A. tibetiana and A. urmiana. Atp6 may have experienced strong selective pressure for high-altitude adaptation because although A. tibetiana and A. urmiana are closely related they live at different altitudes. We identified two extended termination-associated sequences and three conserved sequence blocks in the D-loop region of the mitochondrial genomes. We propose that sequence variations in the D-loop region and in the subunits of the respiratory chain complexes independently or collectively contribute to the adaptation of Artemia to different altitudes.

  2. Nonhatching Decapsulated Artemia Cysts As a Replacement to Artemia Nauplii in Juvenile and Adult Zebrafish Culture.

    Science.gov (United States)

    Tye, Marc; Rider, Dana; Duffy, Elizabeth A; Seubert, Adam; Lothert, Brogen; Schimmenti, Lisa A

    2015-12-01

    Feeding Artemia nauplii as the main nutrition source for zebrafish is a common practice for many research facilities. Culturing live feed can be time-consuming and requires additional equipment to be purchased, maintained, and cleaned. Nonhatching decapsulated Artemia cysts (decaps) are a commercially available product that can be fed directly to fish. Several other ornamental fish species have been successfully cultured using decaps. Replacing Artemia nauplii with decaps could reduce the overall time and costs associated with the operation of a zebrafish facility. The objective of this study was to determine if decaps could be a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture. Wild-type zebrafish were fed one of three dietary treatments: decaps only, nauplii only, or a standard consisting of nauplii plus a commercially prepared pellet food. Survival, growth (length and weight), and embryo production were analyzed between the treatments. Fish receiving the decap diet demonstrated a significantly higher growth and embryo production when compared to the fish receiving the nauplii-only diet. When comparing the decap fish to the standard fish, no significant difference was found in mean survival, mean weight at 90 days postfertilization, or mean embryo production. It was determined that nonhatching decapsulated Artemia cysts can be used as a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture.

  3. Factors influencing Artemia populations in Antillean salines

    NARCIS (Netherlands)

    Kristensen, Ingvar; Hulscher-Emeis, T. Marian

    1972-01-01

    In the Netherlands Antilles two extreme “forms” of Artemia salina, f. arietina and f. milhauseni, show all intermediate gradations. They hybridize constantly. When forma arietina is moved from lower concentrations into highly concentrated brine it will produce offspring that exhibit characteristics

  4. Historical Notes on Artemia salina (L.)

    NARCIS (Netherlands)

    Kuenen, D.J.

    1938-01-01

    Although an abundant literature exists on Artemia salina, there are still interesting facts in the first history of the discovery of this remarkable animal and in the first study of its habits, which seem to be now forgotten. It is generally considered that Rackett (1812) was the first to give a dra

  5. Dinucleosidasetetraphosphatase in rat liver and Artemia salina.

    Science.gov (United States)

    Vallejo, C G; Lobaton, C D; Quintanilla, M; Sillero, A; Sillero, M A

    1976-06-07

    A comparative study of an enzymatic activity present in Artemia salina and rat liver which specifically splits dinucleoside tetraphosphates is presented. All the purine and pyrimidine dinucleoside tetraphosphates tested, i.e. diadenosine, diguanosine, dixanthosine and diuridine tetraphosphates, were substrates of both enzymes with similar maximum velocities and Km values, (around 10 muM). The inhibition by nucleotides of the enzyme from the two sources is also similar. Particularly relevant is the strong inhibition caused by nucleoside tetraphosphates which have Ki values in the nanomolar range. The Artemia enzyme has a slightly lower molecular weight (17 500) than the liver enzyme (21 000) and is more resistant to acidic pH. Based on previous findings, the enzyme from Artemia salina was named diguanosinetetraphosphatase (EC 3.6.1.17) by the Enzyme Commission. The results presented in this paper show that the liver and Artemia enzymes are similar, and we propose to name this enzyme as dinucleosidetetraphosphatase or dinucleoside-tetraphosphate nucleotidehydrolase.

  6. A note on the biogeographical origin of the brine shrimp Artemia urmiana Günther, 1899 from Urmia Lake, Iran.

    Science.gov (United States)

    Eimanifar, Amin; Asem, Alireza; Djamali, Morteza; Wink, Michael

    2016-03-30

    The brine shrimp Artemia urmiana, an abundant inhabitant of the hypersaline Urmia Lake in northwestern Iran, has recently been described from Lake Koyashskoe, also a shallow hypersaline lake that is located on the Black Sea coast of the Crimean Peninsula (Ukraine). This discovery has questioned the endemicity of A. urmiana in Urmia Lake and has also brought into question the biogeographical origin of this species. In the present study, we combined recent genetic divergence data (mtDNA-COI) with palaeoecological evidence to address the biogeographical origin of A. urmiana. Calibration of the molecular clock of the COI region was set by assigning the age of the micro-crustacean Daphnia pulex minimally at 145 Mya. The divergence age of A. urmiana in Urmia Lake dates back to 383,000 years, whereas Ukrainian Artemia reflects a very young populations that diverged about 196,000 years ago. Palaeoecological evidence suggests that the age of the major habitat of A. urmiana i.e. Urmia Lake goes back to the Tertiary Period while the Ukranian habitats of the species are very young, by virtue of geological features of the Holocene age. We conclude that the biogeographical origin of A. urmiana is outside of Europe and the current state of knowledge strongly suggests that Urmia Lake has been the major source of its expansion into its modern habitats in Europe.

  7. Cryptic microsporidian parasites differentially affect invasive and native Artemia spp.

    Science.gov (United States)

    Rode, Nicolas O; Lievens, Eva J P; Segard, Adeline; Flaven, Elodie; Jabbour-Zahab, Roula; Lenormand, Thomas

    2013-09-01

    We investigated the host specificity of two cryptic microsporidian species (Anostracospora rigaudi and Enterocytospora artemiae) infecting invasive (Artemia franciscana) and native (Artemia parthenogenetica) hosts in sympatry. Anostracospora rigaudi was on average four times more prevalent in the native host, whereas E. artemiae was three times more prevalent in the invasive host. Infection with An. rigaudi strongly reduced female reproduction in both host species, whereas infection with E. artemiae had weaker effects on female reproduction. We contrasted microsporidian prevalence in native A. franciscana populations (New World) and in both invaded and non-invaded Artemia populations (Old World). At a community level, microsporidian prevalence was twice as high in native compared with invasive hosts, due to the contrasting host-specificity of An. rigaudi and E. artemiae. At a higher biogeographical level, microsporidian prevalence in A. franciscana did not differ between the invaded populations and the native populations used for the introduction. Although E. artemiae was the only species found both in New and Old World populations, no evidence of its co-introduction with the invasive host was found in our experimental and phylogeographic tests. These results suggest that the success of A. franciscana invasion is probably due to a lower susceptibility to virulent microsporidian parasites rather than to decreased microsporidian prevalence compared with A. parthenogenetica or to lower microsporidian virulence in introduced areas.

  8. Uptake of metronidazole in Artemia at different developmental life stages.

    Science.gov (United States)

    Rodriguez, Loretta; Livengood, Elisa J; Miles, Richard D; Chapman, Frank A

    2011-06-01

    The purpose of this study was to examine the capacity of live brine shrimp Artemia spp. to accumulate metronidazole at different developmental life stages. Metronidazole is used in fish as an antiparasitic medication. An effective drug delivery method is to enrich the Artemia with metronidazole and offer them as live feed to the infected fish, usually ornamental species and other small fishes. Artemia cysts were hatched and then soaked in a metronidazole solution (0.05%) at instars 1-3 of larval development. Our findings indicated that Artemia were able to accumulate metronidazole at levels considered therapeutic to other animals and humans (25-100 mg/kg). However, the levels varied depending on the stage of larval development. Artemia accumulated the highest levels of metronidazole (137-143 mg/kg) when they started filter feeding (instar 2), whereas newly hatched Artemia (instar 1) contained the lowest level (85 mg/kg). Based on this study and a review of the literature, a new protocol recommended for enriching Artemia with metronidazole consists of soaking the Artemia in a 0.05% metronidazole solution for 3 h at room temperature. Because metronidazole is relatively insoluble in water, it must first be dissolved in warm water with continuous stirring.

  9. Prospects of Artemia culture in the coastal zone

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.

    The importance of the brine shrimp Artemia as live feed in shrimp hatcheries has been pointed out. The paper deals with the resource potential and status of cyst production in India. There is a need for setting up a Pilot Project for Artemia cyst...

  10. Use of the genus Artemia in ecotoxicity testing

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, Bruno S. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal) and Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal)]. E-mail: bruno@ufp.pt; Carvalho, Felix D. [REQUIMTE, Departamento de Toxicologia da Faculdade de Farmacia da Universidade do Porto, Rua Anibal Cunha, 164, 4050-047 Porto (Portugal); Guilhermino, Lucia M. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal); Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal); Van Stappen, Gilbert [Laboratory of Aquaculture and Artemia Reference Centre, Ghent University, Rozier 44, B-9000 Ghent (Belgium)

    2006-11-15

    Information related to varied uses of several species of the genus Artemia (commonly known as brine shrimp), is dispersed among literature from several scientific areas, such as Ecology, Physiology, Ecotoxicology, Aquaculture and Genetics. The present paper reviews information related to Artemia that may be considered relevant for ecotoxicity testing. Integration of different areas of scientific knowledge concerning biology, life cycle and environmental needs of Artemia is of crucial importance when considering the interpretation of results drawn from tests involving this genus. Furthermore, this paper provides suggestions to overcome problems related to toxicity assessment with the use of Artemia as test organism in bioassays, under the scope of estuarine, marine and hypersaline environments. Aspects related to variability in results, adoptable toxicity end-points, culture conditions, characteristics of species and strains, influence of geographical origins over physiological features and responses to exposure to chemical agents are considered. - The physiology, reproductive processes and general use of Artemia in modern ecotoxicological testing are reviewed.

  11. Toxicity of cypermethrin to Daphnia magna HB

    Institute of Scientific and Technical Information of China (English)

    SHENG Xiu-mei; XIONG Li; WU Zhen-bin; TANG Hong-feng; LIU Tao; WANG Yuan

    2004-01-01

    The acute toxic effect of the pesticide cypermethrin to Daphnia magna HB was examined. D. magna HB was exposed to cypermethrin at concentrations of 0, 1, 3, 5, 7, and 9 mg/L for 24 h. Data showed that the 24 h-LC50 of cypermthrin on D. magna HB was 4.81 mg/L. In contrast, the 24 h-LC50 of K2Cr2O7(the national standard toxicant) to Daphnia magna was 0.38 mg/L in the current study. Results indicated that the Daphnia magna was very sensitive to pesticides. In addition, the effects of the culture condition(such as hardness, temperature and DO etc.) on Daphnia magna HB was also studied.

  12. Competition in natural populations of Daphnia

    NARCIS (Netherlands)

    Boersma, M.

    1995-01-01

    I investigated the competitive relationships between two species of Daphnia, D. galeata and D. cucullata, and their interspecific hybrid. The term hemispecific competition was introduced to describe competition between parental species and hybrids. In eutrophic Tjeukemeer both parental species were

  13. Complete mitochondrial genome of yellow meal worm(Tenebrio molitor)

    OpenAIRE

    Liu, Li-Na; Wang, Cheng-Ye

    2014-01-01

    The yellow meal worm(Tenebrio molitor L.) is an important resource insect typically used as animal feed additive. It is also widely used for biological research. The first complete mitochondrial genome of T. molitor was determined for the first time by long PCR and conserved primer walking approaches. The results showed that the entire mitogenome of T. molitor was 15 785 bp long, with 72.35% A+T content [deposited in GenBank with accession number KF418153]. The gene order and orientation were...

  14. Embryonic diapause in two species of brine shrimp: Artemia monica and Artemia franciscana

    Energy Technology Data Exchange (ETDEWEB)

    Drinkwater, L.E.

    1986-01-01

    The brine shrimp, Artemia, has the capacity to produce encysted embryos which are resistant to severe environmental conditions. Upon release from the ovisac, these embryos, or cysts, do not hatch, but remain in a state of developmental arrest imposed by some unknown endogenous mechanism. However, once the proper abiotic signal is received, the embryo is free to resume development. Regulation of this embryonic diapause in two related species of brine shrimp, Artemia franciscana and Artemia monica, is studied. The abiotic cues which terminate diapause and the possibility of a regulatory mechanism involving depressed intracellular pH (pH/sub i/) are investigated. /sup 31/P-NMR studies show that pH/sub i/ of diapause cysts of both species is alkaline, greater than or equal to 7.9, essentially the same as that of activated cysts. A franciscana, which inhabits an unpredictable environment, is activated by several cues: low temperature, dehydration, and elevated levels of CO/sub 2/. A. monica, found in a fairly stable body of water with regular seasonal changes in temperature, breaks diapause only upon exposure to low temperature. Induction of anoxybiosis in diapause and activated cysts is studied using /sup 31/P-NMR to reveal that diapause cysts acidify rapidly in response to anoxia; pH/sub i/ falls to about 7.2 in 30 minutes, much like activated cysts, indicating the presence of a fairly active metabolism. The effects of salinity on cyst activation, hatching, water content, and carbohydrate metabolism are examined.

  15. Larvicidal activity of some marine macrophytes against Artemia salina

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    and Microdictyon pseudohapteron, seagrasses (Halophila ovalis and Syringodium isoetifolium and lichens (Umbilicaria arpina) were tested for larvicidal activity using Artemia salina nauplii. The LC50 values for the PE-fraction of M. pseudohapteron and A. muscoides...

  16. Strong environmental tolerance of Artemia under very high pressure

    Science.gov (United States)

    Minami, K.; Ono, F.; Mori, Y.; Takarabe, K.; Saigusa, M.; Matsushima, Y.; Saini, N. L.; Yamashita, M.

    2010-03-01

    It was shown by the present authors group that a tardigrade in its tun-state can survive after exposed to 7.5 GPa for 13 hours. We have extended this experiment to other tiny animals searching for lives under extreme conditions of high hydrostatic pressure. Artemia, a kind of planktons, in its dried egg-state have strong environmental tolerance. Dozens of Artemia eggs were sealed in a small Teflon capsule together with a liquid pressure medium, and exposed to the high hydrostatic pressure of 7.5 GPa. After the pressure was released, they were soaked in seawater to observe hatching rate. It was proved that 80-90% of the Artemia eggs were alive and hatched into Nauplii after exposed to the maximum pressure of 7.5 GPa for up to 48 hours. Comparing with Tardigrades, Artemia are four-times stronger against high pressure.

  17. Toxicity effect of silver nanoparticles in brine shrimp Artemia.

    Science.gov (United States)

    Arulvasu, Chinnasamy; Jennifer, Samou Michael; Prabhu, Durai; Chandhirasekar, Devakumar

    2014-01-01

    The present study revealed the toxic effect of silver nanoparticles (AgNPs) in Artemia nauplii and evaluated the mortality rate, hatching percentage, and genotoxic effect in Artemia nauplii/cysts. The AgNPs were commercially purchased and characterized using field emission scanning electron microscope with energy dispersive X-ray spectroscopy. Nanoparticles were spherical in nature and with size range of 30-40 nm. Artemia cysts were collected from salt pan, processed, and hatched in sea water. Artemia nauplii (II instar) were treated using silver nanoparticles of various nanomolar concentrations and LC50 value (10 nM) and mortality rate (24 and 48 hours) was evaluated. Hatching percentage of decapsulated cysts treated with AgNPs was examined. Aggregation of AgNPs in the gut region of nauplii was studied using phase contrast microscope and apoptotic cells in nauplii stained with acridine orange were observed using fluorescence microscope. DNA damage of single cell of nauplii was determined by comet assay. This study showed that as the concentration of AgNPs increased, the mortality rate, aggregation in gut region, apoptotic cells, and DNA damage increased in nauplii, whereas the percentage of hatching in Artemia cysts decreased. Thus this study revealed that the nanomolar concentrations of AgNPs have toxic effect on both Artemia nauplii and cysts.

  18. The swimming mechanics of Artemia Salina

    Science.gov (United States)

    Ruiz-Angulo, A.; Ramos-Musalem, A. K.; Zenit, R.

    2013-11-01

    An experimental study to analyze the swimming strategy of a small crustacean (Artemia Salina) was conducted. This animal has a series of eleven pairs of paddle-like appendices in its thorax. These legs move in metachronal-wave fashion to achieve locomotion. To quantify the swimming performance, both high speed video recordings of the legs motion and time-resolved PIV measurements of the induced propulsive jet were conducted. Experiments were conducted for both tethered and freely swimming specimens. We found that despite their small size, the propulsion is achieved by an inertial mechanism. An analysis of the efficiency of the leg wave-like motion is presented and discussed. A brief discussion on the mixing capability of the induced flow is also presented.

  19. Specific anion effects in Artemia salina.

    Science.gov (United States)

    Lo Nostro, Pierandrea; Ninham, Barry W; Carretti, Emiliano; Dei, Luigi; Baglioni, Piero

    2015-09-01

    The specific anion effect on the vitality of Artemia salina was investigated by measuring the Lethal Time LT50 of the crustaceans in the presence of different sodium salts solutions at room temperature and at the same ionic strength as natural seawater. Fluoride, thiocyanate and perchlorate are the most toxic agents, while chloride, bromide and sulfate are well tolerated. The rates of oxygen consumption of brine shrimps were recorded in mixed NaCl+NaF or NaCl+NaSCN solutions as a function of time. The results are discussed in terms of the Hofmeister series, and suggest that, besides the biochemical processes that involve F(-), SCN(-) and ClO4(-), the different physico-chemical properties of the strong kosmotropic and chaotropic anions may contribute in determining their strong toxicity for A. salina.

  20. Predation on Daphnia pulex by Lepidurus arcticus

    DEFF Research Database (Denmark)

    Christoffersen, Kirsten Seestern

    2001-01-01

    when swimming in the water. Experiments were set up to test how efficiently Lepidurus hunts Daphnia and if a functional response between predator and prey exists. It was also tested if temperature and Lepidurus size played a significant role for the predation rate. Lepidurus and Daphnia were sampled...... from ponds at Zackenberg in northeast Greenland (74° N, 21° E) in August 1998 and were placed in small containers (0.5 l) at desired temperatures. Lepidurus was capable of consuming 5–15 Daphnia per hour at ambient temperatures (5–20 °C) and changes in the temperature had apparently no significant...... effects on the predation rates. There was, however, a clear difference in feeding activity between size groups, the rates of larger Lepidurus (> 12.5 mm) being two to three times greater than that of smaller specimens (8–10 mm). For both size classes, the predation rates rose with increasing prey...

  1. A nuptially transmitted ichthyosporean symbiont of Tenebrio molitor (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Lord, Jeffrey C; Hartzer, Kris L; Kambhampati, Srinivas

    2012-01-01

    The yellow mealworm, Tenebrio molitor, harbors a symbiont that has spores with a thick, laminated wall and infects the fat body and ventral nerve chord of adult and larval beetles. In adult males, there is heavy infection of the epithelial cells of the testes and between testes lobes with occasional penetration of the lobes. Spores are enveloped in the spermatophores when they are formed at the time of mating and transferred to the female's bursa copulatrix. Infection has not been found in the ovaries. The sequence of the nuclear small subunit rDNA indicates that the symbiont is a member of the Ichthyosporea, a class of protists near the animal-fungi divergence.

  2. Pesticide contamination of Tenebrio molitor (Coleoptera: Tenebrionidae) for human consumption.

    Science.gov (United States)

    Houbraken, Michael; Spranghers, Thomas; De Clercq, Patrick; Cooreman-Algoed, Margot; Couchement, Tasmien; De Clercq, Griet; Verbeke, Sarah; Spanoghe, Pieter

    2016-06-15

    The use of pesticides contributes to the productivity and the quality of the cultivated crop. A large portion of the agricultural produce is not consumed as it is not an edible part or the quality of the product is too low. This waste of agricultural produce can be valorised as a substrate for the production of certain insects for human consumption. However, pesticides applied on the plants might accumulate during the life cycle of the insects fed on the waste materials and may cause a health risk to humans consuming the insects. Pesticide residues in larvae of the yellow mealworm, Tenebrio molitor, were investigated. We monitored the accumulation of pesticides in the larvae upon consumption of contaminated fresh produce. An increased uptake rate by the insects was found for pesticides with higher Kow-values. Excretion of pesticides by the insect was inversely related to the log(Kow) values of the pesticides.

  3. Roles and potentials of Artemia in coastal saltworks

    OpenAIRE

    Sorgeloos, P; Tackaert, W.

    1991-01-01

    The recent developments in aquaculture production of fish and shrimp have resulted in increased demands for Artemia cysts and biomass as valuable sources of life food. Solar salt works are suitable biotopes for the integrated exploitation of salt, Artemia and eventually fish or shrimp. Artemia may be present as a natural resource in local saltworks; however in some situations characteristics of the endemic strain might justify the introduction of another Artemia species to increase productivity.

  4. Physiological characteristics and stress resistance of great sturgeon (Huso huso) juveniles fed with vitamins C, E, and HUFA-enriched Artemia urmiana nauplii.

    Science.gov (United States)

    Jalali, Mohammad Ali; Hosseini, Seyed Abbas; Imanpour, Mohammad Reza

    2010-09-01

    This study was carried out to examine the effect of Artemia urmiana nauplii enriched with HUFA, and vitamins C and E on stress tolerance, hematocrit, and biochemical parameters of great sturgeon, Huso huso juveniles. Cod liver oil (EPA 18% and DHA 12%), ascorbyl-6-palmitate and alpha-tocopherol acetate were used as lipid, and vitamin C and E sources, respectively. Beluga juveniles at the stage of first feeding (69.7 +/- 5.9 mg body weight) were randomly divided into five treatments and three tanks were assigned to each diet. All fish groups were fed non-enriched Artemia for the initial 5 days and then fed enriched Artemia for 7 days. Juveniles were fed with Artemia enriched with HUFA + 20% vitamin C (C group); HUFA + 20% vitamin E-enriched Artemia nauplii (E group); HUFA + 20% vitamin C + 20% vitamin E (C and E group); HUFA without vitamins (HUFA) and non-enriched Artemia (control). After the period of enrichment, Juveniles were fed with Daphnia sp. from the 13th to the 40th day. At day 40, the fish were transferred directly from fresh water (0.5 ppt) to brackish water (6 ppt for 4 days and 12 ppt for 2 days) and warm water (from 27 to 33 degrees C) to evaluate juvenile resistance to salinity and thermal shocks. Moreover, all treatments were separately exposed to freshwater in tanks with the same capacity as used for osmotic and thermal tests (as fresh water control). The addition of vitamins C, E, and C + E to HUFA significantly increased fish resistance to 12 ppt salinity and temperature stress tests, whereas survival was not significantly different among challenges at 6 ppt. There was no significant difference in the hematocrit index under stress conditions. Enrichment had significant influence on plasma Na(+) level in the C group on the 4th day at 6 ppt. Na(+) and Ca(2+) concentrations in C, E, and C and E groups on the 1st day at 12 ppt, and Ca(2+) level in E group on the 2nd day at 12 ppt were lower than the other groups. The glucose level in the C and C and

  5. Can Daphnia lumholtzi invade European lakes?

    Directory of Open Access Journals (Sweden)

    Meike Wittmann

    2013-03-01

    Full Text Available The cladoceran Daphnia lumholtzi is a subtropical and tropical zooplankter, and an invasive species in North America. Thus far, D. lumholtzi has not been detected in Europe. Here we investigated whether a hypothetical introduction to Europe could result in a successful invasion, either now or in the near future when facilitated by climate change. In laboratory experiments, we tested whether different clones of D. lumholtzi can invade a resident community consisting of native Daphnia from lake Klostersee, Germany, and how invasion success depends on temperature and the presence or absence of planktivorous fish. In some treatments, invasion success was consistently high, and D. lumholtzi reached densities similar to the native competitors by the end of the experiment. The presence of a planktivorous fish reduced the invasion success of D. lumholtzi, and a clone with an inducible defense against fish predation was a more successful invader than a permanently defended clone. Of the three temperatures tested in this study (15, 20, and 24 °C, invasion success was highest at 20 °C. To understand the competitive interaction between native and introduced Daphnia, we fit a Lotka-Volterra-type competition model to the population dynamics. Our experimental and modeling results suggest that D. lumholtzi can invade European lakes and can cause substantial declines in the population size of native Daphnia, with potential consequences for higher trophic levels.

  6. Artemia biodiversity in Asia with the focus on the phylogeography of the introduced American species Artemia franciscana Kellogg, 1906.

    Science.gov (United States)

    Eimanifar, Amin; Van Stappen, Gilbert; Marden, Brad; Wink, Michael

    2014-10-01

    Asia harbors a diverse group of sexual and asexual Artemia species, including the invasive Artemia franciscana, which is native to the Americas. The phylogeny of Asian Artemia species and the phylogeography of the introduced A. franciscana from 81 sampling localities in Eurasia, Africa and America were elucidated using mitochondrial (COI) and nuclear DNA (ITS1) sequences. According to a COI phylogeny, 6 distinctive genetic groups were recognized, with a complex phylogeographic structure among Asian Artemia. A haplotype complex which includes parthenogenetic lineages is distributed in 39 inland geographical localities in Asia, illustrating a wide distribution with a narrow genetic structure on this continent. The invasive A. franciscana was discovered in 31 geographical localities along the southern and eastern coastal regions of Asia. Three sexual species (A. sinica, A. tibetiana and A. urmiana) have a restricted distribution in certain geographical localities in Asia. In contrast to COI phylogeny reconstruction, ITS1 sequences showed inconsistency with the COI tree, indicating incomplete lineage sorting which provided the low genetic divergence in the Asian clade. Asian A. franciscana showed higher haplotype diversity as compared to the source population from the Great Salt Lake (USA), which could be attributed to multiple introductions by mass dispersal in Asia via human activities. The invasive success of A. franciscana in Asia could lead to a long-term biodiversity disturbance of the autochthonous Artemia species on the continent.

  7. Brine shrimp bioassay: importance of correct taxonomic identification of Artemia (Anostraca) species.

    Science.gov (United States)

    Ruebhart, David R; Cock, Ian E; Shaw, Glen R

    2008-08-01

    Despite the common use of the brine shrimp bioassay in toxicology, there is confusion in the literature regarding citation of the correct taxonomic identity of the Artemia species used. The genus Artemia, once thought to be represented by a single species Artemia salina, is now known to be composed of several bisexual species as well as parthenogenetic populations. Artemia franciscana is the best studied of the Artemia species and is considered to represent the vast majority of studies in which Artemia is used as an experimental test organism. We found that in studies referring to the use of A. salina, the zoogeography of the cyst harvest site indicated that the species used was actually A. franciscana. Those performing bioassays with Artemia need to exercise diligence in assigning correct species identification, as the identity of the test organism is an important parameter in assuring the validity of the results of the assay.

  8. Toxin-binding proteins isolated from yellow mealworm Tenebrio molitor and wax moth Galleria mellonella.

    Science.gov (United States)

    Bulushova, N V; Zhuzhikov, D P; Lyutikova, L I; Kirillova, N E; Zalunin, I A; Chestukhina, G G

    2011-02-01

    A 67-kDa protein that can specifically bind the activated Cry9A endotoxin under ligand-blotting conditions was purified from midgut epithelium apical membranes of wax moth Galleria mellonella by affinity chromatography. N-Terminal amino acid sequencing enabled identification of this protein as aminopeptidase N. In similar experiments, 66- and 58-kDa proteins specific to endotoxin Cry3A were isolated from the midgut epithelium apical membranes of Tenebrio molitor larvae. Mass spectrometry showed close similarity of the 58-kDa protein to the Tenebrio molitor α-amylase.

  9. Complete mitochondrial genome of yellow meal worm (Tenebrio molitor).

    Science.gov (United States)

    Liu, Li-Na; Wang, Cheng-Ye

    2014-11-18

    The yellow meal worm (Tenebrio molitor L.) is an important resource insect typically used as animal feed additive. It is also widely used for biological research. The first complete mitochondrial genome of T. molitor was determined for the first time by long PCR and conserved primer walking approaches. The results showed that the entire mitogenome of T. molitor was 15 785 bp long, with 72.35% A+T content [deposited in GenBank with accession number KF418153]. The gene order and orientation were the same as the most common type suggested as ancestral for insects. Two protein-coding genes used atypical start codons (CTA in ND2 and AAT in COX1), and the remaining 11 protein-coding genes started with a typical insect initiation codon ATN. All tRNAs showed standard clover-leaf structure, except for tRNA(Ser) (AGN), which lacked a dihydrouridine (DHU) arm. The newly added T. molitor mitogenome could provide information for future studies on yellow meal worm.

  10. A digestive prolyl carboxypeptidase in Tenebrio molitor larvae.

    Science.gov (United States)

    Goptar, Irina A; Shagin, Dmitry A; Shagina, Irina A; Mudrik, Elena S; Smirnova, Yulia A; Zhuzhikov, Dmitry P; Belozersky, Mikhail A; Dunaevsky, Yakov E; Oppert, Brenda; Filippova, Irina Yu; Elpidina, Elena N

    2013-06-01

    Prolyl carboxypeptidase (PRCP) is a lysosomal proline specific serine peptidase that also plays a vital role in the regulation of physiological processes in mammals. In this report, we isolate and characterize the first PRCP in an insect. PRCP was purified from the anterior midgut of larvae of a stored product pest, Tenebrio molitor, using a three-step chromatography strategy, and it was determined that the purified enzyme was a dimer. The cDNA of PRCP was cloned and sequenced, and the predicted protein was identical to the proteomic sequences of the purified enzyme. The substrate specificity and kinetic parameters of the enzyme were determined. The T. molitor PRCP participates in the hydrolysis of the insect's major dietary proteins, gliadins, and is the first PRCP to be ascribed a digestive function. Our collective data suggest that the evolutionary enrichment of the digestive peptidase complex in insects with an area of acidic to neutral pH in the midgut is a result of the incorporation of lysosomal peptidases, including PRCP.

  11. Field culture of American strain of Artemia in India

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Pilot scale culture of Artemia was carried out in a 0.22 ha condenser unit of salt pans. Pond was fertilized with inorganic salts. The nauplii of San Francisco Bay, USA strain were inoculated. Within a period of 5 months a production of 20.6 kg dry...

  12. Acute toxicity of organic solvents on Artemia salina

    Energy Technology Data Exchange (ETDEWEB)

    Barahona-Gomariz, M.V.; Sanz-Barrera, F.; Sanchez-Fortun, S. (Complutense Univ. of Madrid (Spain))

    1994-05-01

    Organic solvents can make their way into the environment as industrial wastes and components of pesticide formulation. In laboratory bioassays, the use of organic formulations. In laboratory bioassays, the use of organic solvents is often unavoidable, since many pesticides and organic pollutants have low water solubility and must be dissolved in organic solvents prior to addition into experimental systems. In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species are of recent interest as test models due to the need for developing nonmammalian test systems. Toxic effects of organic solvents have been tested with a few aquatic species, but information on the comparative toxicity of solvents towards Artemia salina is not available. Artemia salina have, within recent years, gained popularity as test organisms for short-term toxicity testing. Because Artemia salina exhibit rapid development and growth within 48 hr after hatch, their potential as a model organism for toxicology screening has been considered. To do this, synchronous populations of Artemia salina at different development intervals must be available.

  13. Telomerase activity and telomere length in Daphnia.

    Science.gov (United States)

    Schumpert, Charles; Nelson, Jacob; Kim, Eunsuk; Dudycha, Jeffry L; Patel, Rekha C

    2015-01-01

    Telomeres, comprised of short repetitive sequences, are essential for genome stability and have been studied in relation to cellular senescence and aging. Telomerase, the enzyme that adds telomeric repeats to chromosome ends, is essential for maintaining the overall telomere length. A lack of telomerase activity in mammalian somatic cells results in progressive shortening of telomeres with each cellular replication event. Mammals exhibit high rates of cell proliferation during embryonic and juvenile stages but very little somatic cell proliferation occurs during adult and senescent stages. The telomere hypothesis of cellular aging states that telomeres serve as an internal mitotic clock and telomere length erosion leads to cellular senescence and eventual cell death. In this report, we have examined telomerase activity, processivity, and telomere length in Daphnia, an organism that grows continuously throughout its life. Similar to insects, Daphnia telomeric repeat sequence was determined to be TTAGG and telomerase products with five-nucleotide periodicity were generated in the telomerase activity assay. We investigated telomerase function and telomere lengths in two closely related ecotypes of Daphnia with divergent lifespans, short-lived D. pulex and long-lived D. pulicaria. Our results indicate that there is no age-dependent decline in telomere length, telomerase activity, or processivity in short-lived D. pulex. On the contrary, a significant age dependent decline in telomere length, telomerase activity and processivity is observed during life span in long-lived D. pulicaria. While providing the first report on characterization of Daphnia telomeres and telomerase activity, our results also indicate that mechanisms other than telomere shortening may be responsible for the strikingly short life span of D. pulex.

  14. Daphnia as an Emerging Epigenetic Model Organism

    OpenAIRE

    2012-01-01

    Daphnia offer a variety of benefits for the study of epigenetics. Daphnia’s parthenogenetic life cycle allows the study of epigenetic effects in the absence of confounding genetic differences. Sex determination and sexual reproduction are epigenetically determined as are several other well-studied alternate phenotypes that arise in response to environmental stressors. Additionally, there is a large body of ecological literature available, recently complemented by the genome sequence of one sp...

  15. Origin and genetic diversity of diploid parthenogenetic Artemia in Eurasia.

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages.

  16. Origin and Genetic Diversity of Diploid Parthenogenetic Artemia in Eurasia

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages. PMID:24376692

  17. Origin and genetic diversity of diploid parthenogenetic Artemia in Eurasia.

    Directory of Open Access Journals (Sweden)

    Marta Maccari

    Full Text Available There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia. Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages.

  18. The brine shrimp artemia: adapted to critical life conditions.

    Science.gov (United States)

    Gajardo, Gonzalo M; Beardmore, John A

    2012-01-01

    The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological) to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry-out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst) capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to "perceive" forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity) when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity) that are able to maintain the population under suitable conditions. At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism). The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress response of

  19. Impact of brine acidification on hatchability, survival and reproduction of Artemia parthenogenetica and Artemia franciscana in salt ponds, Bohai Bay, China

    Science.gov (United States)

    Sui, Liying; Deng, Yuangao; Wang, Jing; Sorgeloos, Patrick; Van Stappen, Gilbert

    2014-01-01

    We studied the effect of pH (pH 5, 6, 7 and 8) on the hatching percentage, survival and reproduction of Artemia strains in Bohai Bay salt ponds. Strains included parthenogenetic Artemia from Bohai Bay (BHB), Artemia franciscana from San Francisco Bay, and A. franciscana artificially produced in salt ponds in Vietnam. The latter was included as a potential inoculum for biological management of salt ponds. The hatching percentage of cysts after 24 h and the survival rate of the tested Artemia strains were significantly reduced when exposed to a culture medium at pH 5 for 18 d ( PArtemia to 48 h acid exposure varied with developmental stage, increasing in the following order: juvenile, nauplii, pre-adult, with maximum tolerance in adults. All strains of Artemia tested could not reproduce at pH 5. At pH levels from pH 6-8, a higher pH generally resulted in a shorter brood interval and enhanced ovoviviparity. Hence, we suggest that brine acidification has a negative impact on Artemia populations in the Bohai Bay saltworks. Inoculation of Artemia with either local parthenogenetic Artemia or exotic A. franciscana should be feasible at pH 7-8.

  20. Swimming behaviour of Daphnia clones: differentiation through predator infochemicals

    NARCIS (Netherlands)

    Weber, A.; Van Noordwijk, A.J.

    2002-01-01

    We studied variation in small-scale swimming behavior (SSB) in four clones of Daphnia galeata (water flea) in response to predator infochemicals. The aim of this study was 3-fold. First, we tested for differences in SSB in Daphnia; second, we examined the potential of differences in SSB to explain s

  1. Immune function responds to selection for cuticular colour in Tenebrio molitor

    DEFF Research Database (Denmark)

    Armitage, Sophie Alice Octavia; Siva-Jothy, M. T.

    2005-01-01

    Cuticular colour in the mealworm beetle (Tenebrio molitor) is a quantitative trait, varying from tan to black. Population level variation in cuticular colour has been linked to pathogen resistance in this species and in several other insects: darker individuals are more resistant to pathogens...

  2. Parasitization by Scleroderma guani influences expression of superoxide dismutase genes in Tenebrio molitor

    Science.gov (United States)

    Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor....

  3. Protein identification and in vitro digestion of fractions from Tenebrio molitor

    NARCIS (Netherlands)

    Yi, Liya; Boekel, van M.A.J.S.; Boeren, Sjef; Lakemond, Catriona M.M.

    2016-01-01

    The nutritional value of insect protein is evaluated not only in amino acid composition, but also in protein digestibility. The general amino acid composition of Tenebrio molitor has been reported before, but limited knowledge is available on its digestibility. The objective of this study was to

  4. Impact of Adult Weight, Density, and Age on Reproduction of Tenebrio molitor (Coleoptera: Tenebrionidae)

    Science.gov (United States)

    The impact of adult weight, age, and density on reproduction of Tenebrio molitor L. (Coleoptera: Tenebrionidae) was studied. The impact of adult weight on reproduction was determined in two ways: 1) counting the daily progeny of individual adult pairs of known weight and analyzing the data with line...

  5. Use of nutrient self selection as a diet refining tool in Tenebrio molitor (Coleoptera: Tenebrionidae)

    Science.gov (United States)

    A new method to refine existing dietary supplements for improving production of the yellow mealworm, Tenebrio molitor L. (Coleoptera: Tenebrionidae), was tested. Self selected ratios of 6 dietary ingredients by T. molitor larvae were used to produce a dietary supplement. This supplement was compared...

  6. Dipeptidyl peptidase 4 – an important digestive peptidase in Tenebrio molitor larvae

    Science.gov (United States)

    Dipeptidyl peptidase 4 (DPP 4) is a proline specific serine peptidase that plays an important role in different regulatory processes in mammals. In this report, we isolated and characterized a unique secreted digestive DPP 4 from the anterior midgut of a stored product pest, Tenebrio molitor larvae ...

  7. Localization of two post-proline cleaving peptidases in the midgut of Tenebrio molitor larvae

    Science.gov (United States)

    Two soluble post-proline cleaving peptidase activities, PPCP1 and PPCP2, were demonstrated in the midgut of Tenebrio molitor larvae with the substrate benzyloxycarbonyl-L-alanyl-L-proline p-nitroanilide. Both activities were serine peptidases. PPCP1 was active in acidic buffers, with maximum activit...

  8. Binding of white spot syndrome virus to Artemia sp. cell membranes.

    Science.gov (United States)

    Feng, Shuying; Li, Guangda; Feng, Wenpo; Huang, Jie

    2013-10-01

    Using differential velocity centrifugation, cell membranes of Artemia sp. were prepared, and their binding to white spot syndrome virus (WSSV) was analyzed in vitro. The results indicated that WSSV can specifically bind to Artemia cell membranes, and that WSSV receptor very likely existed in this membrane, which suggested that Artemia sp. may be a reservoir of WSSV. This study investigated the specific WSSV binding site by performing competitive inhibition experiments using shrimp gill cell membranes to bind WSSV to Artemia cell membranes. The results showed that shrimp gill cell membranes had a distinct inhibition effect on the specific binding of Artemia cell membranes to WSSV. Thus, potentially similar WSSV receptors or binding sites existed on Artemia sp. cell membranes and shrimp gill cell membranes. Taken together, these findings may provide experimental basis for the development of an effective approach to controlling WSSV, and theoretical basis for the study of WSSV receptors.

  9. Assessment of the role of brine shrimp Artemia in white spot syndrome virus (WSSV) transmission.

    Science.gov (United States)

    Zhang, Jia-Song; Dong, Shuang-Lin; Dong, Yun-Wei; Tian, Xiang-Li; Cao, Yi-Cheng; Li, Zuo-Jia; Yan, Dong-Chun

    2010-01-01

    Challenge tests with Artemia four different development stages (nauplii, metanauplii, pseudoadults and adults) to white spot syndrome virus was carried out by immersion challenge and virus-phytoplankton adhesion route in order to asses the possibility of Artemia acting as a vector of WSSV to penaeid shrimp Litopenaeus vannamei postlarvae. The WSSV succeeded in infecting four stages Artemia, and nested-PCR detection for WSSV revealed positive results to virus-phytoplankton adhesion route. No mass mortalities were observed in penaeid shrimp postlarvae fed with WSSV-positive Artemia which exposed to WSSV by virus-phytoplankton adhesion route, whereas WSSV DNA detected in penaeid shrimp postlarvae by nested-PCR. By contrary, no WSSV-positive was detected in any animal fed with WSSV-negative Artemia. These results indicated that Artemia could serve as a vector in WSSV transmission.

  10. On a parthenogenetic population of Artemia (Crustacea, Branchiopoda) from Algeria (El-Bahira, Sétif)

    OpenAIRE

    Mounia Amarouayache; Naim Belakri

    2015-01-01

    The brine shrimp Artemia is a small crustacean of hypersaline lakes which is commonly used in larviculture. The parthenogenetic population of Artemia from El-Bahira Lake (10 ha area), situated in the High Plateaus of Northeastern Algeria (1034 m alt), has been characterized and surveyed during two hydroperiods of 2009 and 2013. Contrary to other known parthenogenetic populations, which develop in hot seasons and reproduce by ovoviviparity, Artemia from El-Bahira was found to develop only i...

  11. The swimming behavior of Artemia (Anostraca): new experimental and observational data.

    Science.gov (United States)

    Anufriieva, Elena V; Shadrin, Nickolai V

    2014-12-01

    Artemia (Anostraca) is among the most primitive and ancient groups of crustaceans. Artemia spp. play a dominant role in the ecosystems of hypersaline waters, and often they are the only animals in these extreme biotopes. Most ethological studies on Artemia have been conducted on nauplii and metanauplii. We made ethological observations on Artemia under laboratory conditions and in the natural waters of Crimea, where we studied growth and ontogenetic changes of swimming behavior. Growth occurred during the first 50 days up to a size of 9.5-10.5mm, after which time the size did not increase (some females lived up to 6.5 months). A strong positive relation was found between maximal speed and individual length, which varied between 0.4 and 10.5mm; it may be approximated by the power equation: Vmax=1.205·K(0.820), where Vmax is the maximal speed of Artemia (in mms(-1)) of the length K (in mm). There is no similar relation between average speed and length of Artemia. The average speed of adults was 40-60% lower in environments with microalgae compared to media without food. The duration of the "riding position" for mating pairs of Artemia urmiana in our experiments varied from 10 to 27 days. In lakes we observed different Artemia aggregations varying in size and form. We conclude that the swimming behavior of Artemia is quite complex and diverse, and develops during ontogeny.

  12. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  13. Functional analysis of C1 family cysteine peptidases in the larval gut of Tenebrio molitor and Tribolium castaneum

    Science.gov (United States)

    We studied protein digestion the tenebrionids Tenebrio molitor and Tribolium castaneum, pests of stored grains and grain products, to identify potential targets for biopesticide development. Tenebrionid larvae have highly compartmentalized guts, with primarily cysteine peptidases in the acidic anter...

  14. Is there a relationship between insect metabolic rate and mortality of mealworms Tenebrio molitor L. after insecticide exposure?

    OpenAIRE

    Justyna MALISZEWSKA; TĘGOWSKA, Eugenia

    2016-01-01

    Pesticides are known to affect insects metabolic rate and CO2 release patterns. In the presented paper metabolic rate and mortality of mealworms Tenebrio molitor L. exposed to four different insecticides was evaluated, to find out whether there is a relationship between mealworms sensitivity to pesticides and their metabolic rate. Tenebrio molitor mortality was determined after intoxication with pyrethroid, oxadiazine, neonicotinoid and organophosphate. Metabolic rate before and after intoxic...

  15. Why join groups? Lessons from parasite-manipulated Artemia.

    Science.gov (United States)

    Rode, Nicolas O; Lievens, Eva J P; Flaven, Elodie; Segard, Adeline; Jabbour-Zahab, Roula; Sanchez, Marta I; Lenormand, Thomas

    2013-04-01

    Grouping behaviours (e.g. schooling, shoaling and swarming) are commonly explicated through adaptive hypotheses such as protection against predation, access to mates or improved foraging. However, the hypothesis that aggregation can result from manipulation by parasites to increase their transmission has never been demonstrated. We investigated this hypothesis using natural populations of two crustacean hosts (Artemia franciscana and Artemia parthenogenetica) infected with one cestode and two microsporidian parasites. We found that swarming propensity increased in cestode-infected hosts and that red colour intensity was higher in swarming compared with non-swarming infected hosts. These effects likely result in increased cestode transmission to its final avian host. Furthermore, we found that microsporidian-infected hosts had both increased swarming propensity and surfacing behaviour. Finally, we demonstrated using experimental infections that these concurrent manipulations result in increased spore transmission to new hosts. Hence, this study suggests that parasites can play a prominent role in host grouping behaviours.

  16. Bioencapsulation of metronidazole in adult brine shrimp (Artemia sp.).

    Science.gov (United States)

    Allender, Matthew C; Kastura, Mike; George, Robert; Bulman, Frank; Yarbrough, Jason; Cox, Sherry

    2011-06-01

    A description of bioencapsulation of metronidazole in adult brine shrimp (Artemia) for 2.5 g/L, 5 g/L, and 10 g/L treatment baths is presented. Metronidazole was detected in adult brine shrimp tissue after enrichment periods of 15 min, 30 min, 1 hr, 2 hr, 4 hr, 8 hr, 12 hr, and 24 hr. The assays were performed using high performance liquid chromatography. There was a positive relationship in both dose and time. When evaluating percent uptake, all three baths demonstrated a similar pattern. All three bath concentrations had a high initial concentration that fell at 30 min and slowly began to increase through the end of the study. Survival of shrimp was not affected by bath concentration but decreased over time in all treatment baths comparatively. It can be concluded that metronidazole can be successfully bioencapsulated in adult Artemia.

  17. The mysid Siriella armata as a model organism in marine ecotoxicology: comparative acute toxicity sensitivity with Daphnia magna.

    Science.gov (United States)

    Pérez, Sara; Beiras, Ricardo

    2010-01-01

    Siriella armata (Crustacea, Mysidacea) is a component of the coastal zooplankton that lives in swarms in the shallow waters of the European neritic zone, from the North Sea to the Mediterranean. Juveniles of this species were examined as standard test organisms for use in marine acute toxicity tests. The effects of reference toxicants, three trace metals (Copper, Cadmium and Zinc), and one surfactant, sodium dodecyl sulfate (SDS) were studied on S. armata neonates (\\24 h) reared in the laboratory. Acute toxicity tests were carried out with filtered sea water on individual chambers (microplate wells for metals or glass vials for SDS) incubated in an isothermal room at 20 degrees C, with 16 h light: 8 h dark photoperiod for 96 h. Each neonate was fed daily with 10-15 nauplii of Artemia salina. Acute (96 h) LC50 values, in increasing order, were 46.9 lg/L for Cu, 99.3 lg/L for Cd, 466.7 lg/L for Zn and 8.5 mg/L for SDS. The LC(10), NOEC and LOEC values were also calculated. Results were compared with Daphnia magna, a freshwater cladoceran widely used as a standard ecotoxicological test organism. Acute (48 h) LC(50) values were 56.2 lg/L for Cu, 571.5 lg/L for Cd, 1.3 mg/L for Zn and 27.3 mg/L for SDS. For all the reference toxicants studied, the marine mysid Siriella armata showed higher sensitivity than the freshwater model organism Daphnia magna, validating the use of Siriella mysids as model organisms in marine acute toxicity tests.

  18. The brine shrimp Artemia: adapted to critical life conditions

    Directory of Open Access Journals (Sweden)

    Gonzalo M Gajardo

    2012-06-01

    Full Text Available The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to perceive forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity that are able to maintain the population under suitable conditions.At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism. The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress

  19. Molecular phylogenetics and asexuality in the brine shrimp Artemia.

    Science.gov (United States)

    Baxevanis, Athanasios D; Kappas, Ilias; Abatzopoulos, Theodore J

    2006-09-01

    Explaining cases of long-term persistence of parthenogenesis has proven an arduous task for evolutionary biologists. Interpreting sexual-asexual interactions though has recently advanced owing to methodological design, increased taxon sampling and choice of model organisms. We inferred the phylogeny of Artemia, a halophilic branchiopod genus of sexual and parthenogenetic forms with cosmopolitan distribution, marked geographic patterns and ecological partitioning. Joint analysis of newly derived ITS1 sequences and 16S RFLP markers from global isolates indicates significant interspecific divergence as well as pronounced diversity for parthenogens, matching that of sexual ancestors. Maximum parsimony, maximum likelihood, and Bayesian methods were largely congruent in reconstructing the phylogeny of the genus. Given the current sampling, at least four independent origins of parthenogenesis are deduced. Molecular clock calibrations based on biogeographic landmarks indicate that the lineage leading to A. persimilis diverged from the common ancestor of all Artemia species between 80 and 90 MYA at the time of separation of Africa from South America, whereas parthenogenesis first appeared at least 3 MYA. Common mitochondrial DNA haplotypes delineate A. urmiana and A. tibetiana as possible maternal parents of several clonal lineages. A novel topological placement of A. franciscana as a sister clade to all Asian Artemia and parthenogenetic forms is proposed and also supported by ITS1 length and other existing data.

  20. The influence of different rotifer and Artemia enrichment diets on growth, survival and pigmentation in turbot (Scophthalmus maximus L.) larvae

    DEFF Research Database (Denmark)

    Støttrup, Josianne; Attramadal, Y.

    1992-01-01

    , approximately seven days after hatching, the larvae were fed newly-hatched Artemia salina nauplii (AT-1; Brazil strain). From day 10, enriched Great Salt Lake Artemia nauplii were introduced. Each set of seven tansk was further subdivided and the larvae fed Artemia nauplii enriched with one of four enrichment...

  1. Characterization and processing of superoxide dismutase-fused vitellogenin in the diapause embryo formation: a special developmental pathway in the brine shrimp, Artemia parthenogenetica.

    Science.gov (United States)

    Chen, Su; Chen, Dian-Fu; Yang, Fan; Nagasawa, Hiromichi; Yang, Wei-Jun

    2011-07-01

    To withstand environmental stress, Artemia release diapause cysts via an oviparous pathway instead of producing swimming nauplius larvae by the ovoviviparous pathway. Encased in such a cyst, the embryos at diapause can survive for many years. Vitellogenin (Vtg), the precursor of vitellins, the main yolk proteins, is crucial for embryonic development. This study compares vitellogenesis between oviparity and ovoviviparity, the two reproductive modes occurring in A. parthenogenetica. A Vtg gene was cloned, based on N-terminal amino acid sequence analysis, PCR amplification, and cDNA library construction and screening, and was found to consist of 6778 bp with a 6657 bp open reading frame encoding 2219 amino acids. From the deduced primary structure, Artemia vitellogenin (ArVtg) was found to possess six copies of the consensus cleavage site, R-X-X-R, and to contain a superoxide dismutase (SOD)-like domain at the N-terminus. This is an unusual finding for crustacean Vtg proteins, having been reported only in one previous crustacean, Daphnia magna. Using Northern blot analysis and in situ hybridization, ArVtg gene expression was observed at early stages of vitellogenesis in the connective tissue located in the cephalothorax, with trace expression in the ovary. Western blot analysis and several N-terminal sequences revealed that ArVtg was cleaved at each consensus cleavage site and that more than 10 subunits were formed during posttranslational processing in ovarian maturation. Of these, only the SOD-containing subunits (∼90 and 60 kDa) showed different profiles between the oviparous and ovoviviparous pathways. This suggests that these high concentration components have an important function for the encysted diapaused embryos during long-term cell-cycle arrest, which has remained unknown up until now.

  2. Comparison live adult Artemia and squid meat on the growth of Penaeid shrimp Metapenaeus dobsoni (Miers)

    Digital Repository Service at National Institute of Oceanography (India)

    Nair, S.R.S.; Achuthankutty, C.T.; Royan, J.P.

    An experiment lasting 14 weeks was conducted to compare the efficiency of live adult Artemia with fresh squid meat on growth of penaeid shrimp Metapenaeus dobsoni. The shrimps were found actively feeding on live Artemia and grew 84% more than those...

  3. Priming the prophenoloxidase system of Artemia franciscana by heat shock proteins protects against Vibrio campbellii challenge.

    Science.gov (United States)

    Baruah, Kartik; Ranjan, Jayant; Sorgeloos, Patrick; Macrae, Thomas H; Bossier, Peter

    2011-07-01

    Like other invertebrates, the brine shrimp Artemia franciscana relies solely on innate immunity, which by definition lacks adaptive characteristics, to combat against invading pathogens. One of the innate mechanisms is melanisation of bacteria mediated by the activation of the prophenoloxidase (proPO) system. The 70 kDa heat shock proteins (Hsp70) derived from either prokaryote (Escherichia coli) or eukaryote (Artemia), well conserved and immune-dominant molecules, protect Artemia against Vibrio campbellii. However, the molecular mechanisms by which these proteins protect Artemia against Vibrio campbellii infection are unknown. Here we demonstrated that feeding gnotobiotically grown Artemia with either Artemia Hsp70 or the E. coli Hsp70 equivalent DnaK, each overproduced in E. coli, followed by V. campbellii challenge enhanced the proPO system, at both mRNA and protein activity levels. Additionally, the Artemia fed with these proteins survived well in a Vibrio challenge assay. These results indicated that Hsp70s derived from either prokaryotic or eukaryotic sources generate protective immunity in the crustacean Artemia against V. campbellii infection by priming the proPO system. This is apparently the first in vivo report on priming activity of Hsp70 in an invertebrate.

  4. [Composition of fat acids in three Mexican populations of Artemia franciscana from epicontinental waters].

    Science.gov (United States)

    Malpica Sánchez, Aída; Castro Barrera, Thalía; Sandoval Trujillo, Horacio; Castro Mejía, Jorge; De Lara Andrade, Ramón; Castro Mejía, Germán

    2004-03-01

    In this paper is presented the percentage of fatty acids composition of three Artemia franciscana Mexican populations of epicontinentals waters; two are from natural environments (Coahuila and San Luis Potosf) and one (Texcoco) is a culture fed with Spirulina. Determination of fatty acids composition in each population, was performed by extraction of total lipid by the soxhlet method and the fatty acids methyl esters were determined by gas chromatography. The results show that Artemia of Texcoco contains the six fatty acids recommended for the culture of fish and crustaceans (16:0; 16:1; 18:1; 18:2w6; 18:3w3 and 20:5w3); Artemia from San Luis Potosi showed the poorest content in these acids and Artemia from Coahuila, although it showed a wide profile, it lacks the linolenic acid. When comparing results among the three populations with ecological data that have been published, it can be pointed out that the environment is decisive for this crustacean; Artemia from Texcoco fed with Spirulina showed the largest variety of fatty acids; the other two populations are wild, and lives in different habitats, Artemia of Coahuila is found in waters that are rich in sulfates and Artemia of San Luis Potosf lives in evaporation saltern ponds, built with stone blocks and therefore with scarce phytoplankton growth. Both Artemia populations showed deficiencies in essential fatty acids, mainly the last one.

  5. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Green, Andy J.; Figuerola, Jordi;

    2009-01-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many...

  6. Ecotoxicity tests based on phototactic behaviour in Daphnia magna; Saggi di ecotossicita` con Daphnia magna basati sul comportamento fototattico

    Energy Technology Data Exchange (ETDEWEB)

    Dojmi di Delupis, Gianluigi [Istituto Superiore di Sanita`, Rome (Italy). Lab. di Tossicologia Comparata ed Ecotossicologia

    1997-03-01

    Zooplankton behaviour depending on light, such as phototaxis, is important, mainly in terms of its ecological significance, as, for example, in the role of phototaxis in the diurnal vertical migration of Daphnia magna, and its possible involvement in predator-prey relations. In Daphnia magna chemicals were found to induce roughly three types of phototaxis alteration: depression, enhancement and sign change. These phenomena are based on mechanisms that require further investigation. In spite of the complex photobehaviour of Daphnia magna and the scarce knowledge of toxic effects, it was possible to set up rapid and easy ecotoxicity tests by fixing certain experimental conditions.

  7. Effect of Artemia franciscana on the removal of nickel by bioaccumulation.

    Science.gov (United States)

    Devi, S Sujatha; Sethu, M; Priya, P Gomathi

    2014-01-01

    The present study evaluates the feasibility of using Artemia franciscana in reducing the Ni concentration of synthetic wastewater by the process of bioaccumulation. Metallothionein protein plays a key role in the uptake of nickel by Artemia. Artemia (Brine shrimp) was exposed to an initial nickel concentration of 40 mg/L. Gradual decrease of nickel was observed from 40 mg/L to 5 mg/L with a removal efficiency of 87.5%. The number of organisms were varied to determine the number for the maximum removal efficiency. Metallothionein protein in Artemia was estimated by the silver saturation method. The physical parameters such as pH were maintained in an alkaline condition of 9-10, temperature was maintained at room temperature and salinity at 30-35‰. These were found to be the optimal conditions for the survival and reduction of nickel by Artemia.

  8. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca).

    Science.gov (United States)

    Muñoz, J; Green, A J; Figuerola, J; Amat, F; Rico, C

    2009-03-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many hypersaline aquatic ecosystems of other continents. Parthenogenetic Artemia lineages occur only in the Old World. Ten and five microsatellite markers were developed to characterize two populations for A. franciscana and two populations for diploid parthenogenetic Artemia, respectively. For A. franciscana the number of alleles ranged from 11 to 58 per locus, while for parthenogens the number of alleles ranged from three to 10. The levels of heterozygosity in A. franciscana and in parthenogens ranged from 0.115 to 0.976 and from 0.000 to 0.971, respectively. These microsatellite loci showed a high population assignment power, which will be useful for future studies of population genetics and invasive processes in Artemia.

  9. Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor

    OpenAIRE

    Harley Nonato de Oliveira; Dirceu Pratissoli; Eder Pin Pedruzzi; Marcelo Curitiba Espindula

    2004-01-01

    Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae) têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae), uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em la...

  10. Do high concentrations of microcystin prevent Daphnia control of phytoplankton?

    Science.gov (United States)

    Chislock, Michael F; Sarnelle, Orlando; Jernigan, Lauren M; Wilson, Alan E

    2013-04-15

    Toxin-producing cyanobacteria have frequently been hypothesized to limit the ability of herbivorous zooplankton (such as Daphnia) to control phytoplankton biomass by inhibiting feeding, and in extreme cases, causing zooplankton mortality. Using limnocorral experiments in hyper-eutrophic ponds located in Alabama and Michigan (U.S.A.), we tested the hypothesis that high levels of cyanobacteria and microcystin, a class of hepatotoxins produced by several cyanobacterial genera, prevent Daphnia from strongly reducing phytoplankton abundance. At the start of the first experiment (Michigan), phytoplankton communities were dominated by toxic Microcystis and Anabaena (∼96% of total phytoplankton biomass), and concentrations of microcystin were ∼3 μg L⁻¹. Two weeks after adding Daphnia pulicaria from a nearby eutrophic lake, microcystin levels increased to ∼6.5 μg L⁻¹, yet Daphnia populations increased exponentially (r = 0.24 day⁻¹). By the third week, Daphnia had suppressed phytoplankton biomass by ∼74% relative to the no Daphnia controls and maintained reduced phytoplankton biomass until the conclusion of the five-week experiment. In the second experiment (Alabama), microcystin concentrations were greater than 100 μg L⁻¹, yet a mixture of three D. pulicaria clones from eutrophic lakes in southern MI increased and again reduced phytoplankton biomass, in this case by over 80%. The ability of Daphnia to increase in abundance and suppress phytoplankton biomass, despite high initial levels of cyanobacteria and microcystin, indicates that the latter does not prevent strong control of phytoplankton biomass by Daphnia genotypes that are adapted to environments with abundant cyanobacteria and associated cyanotoxins.

  11. CRISPR/Cas-mediated targeted mutagenesis in Daphnia magna.

    Directory of Open Access Journals (Sweden)

    Takashi Nakanishi

    Full Text Available The water flea Daphnia magna has been used as an animal model in ecology, evolution, and environmental sciences. Thanks to the recent progress in Daphnia genomics, genetic information such as the draft genome sequence and expressed sequence tags (ESTs is now available. To investigate the relationship between phenotypes and the available genetic information about Daphnia, some gene manipulation methods have been developed. However, a technique to induce targeted mutagenesis into Daphnia genome remains elusive. To overcome this problem, we focused on an emerging genome editing technique mediated by the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas system to introduce genomic mutations. In this study, we targeted a functionally conserved regulator of eye development, the eyeless gene in D. magna. When we injected Cas9 mRNAs and eyeless-targeting guide RNAs into eggs, 18-47% of the survived juveniles exhibited abnormal eye morphology. After maturation, up to 8.2% of the adults produced progenies with deformed eyes, which carried mutations in the eyeless loci. These results showed that CRISPR/Cas system could introduce heritable mutations into the endogenous eyeless gene in D. magna. This is the first report of a targeted gene knockout technique in Daphnia and will be useful in uncovering Daphnia gene functions.

  12. Daphnia as an Emerging Epigenetic Model Organism

    Directory of Open Access Journals (Sweden)

    Kami D. M. Harris

    2012-01-01

    Full Text Available Daphnia offer a variety of benefits for the study of epigenetics. Daphnia’s parthenogenetic life cycle allows the study of epigenetic effects in the absence of confounding genetic differences. Sex determination and sexual reproduction are epigenetically determined as are several other well-studied alternate phenotypes that arise in response to environmental stressors. Additionally, there is a large body of ecological literature available, recently complemented by the genome sequence of one species and transgenic technology. DNA methylation has been shown to be altered in response to toxicants and heavy metals, although investigation of other epigenetic mechanisms is only beginning. More thorough studies on DNA methylation as well as investigation of histone modifications and RNAi in sex determination and predator-induced defenses using this ecologically and evolutionarily important organism will contribute to our understanding of epigenetics.

  13. Characterisation of cholinesterases and evaluation of the inhibitory potential of chlorpyrifos and dichlorvos to Artemia salina and Artemia parthenogenetica.

    Science.gov (United States)

    Varó, I; Navarro, J C; Amat, F; Guilhermino, L

    2002-08-01

    In this study, the acute toxicity of the organophosphorous pesticides dichlorvos and chlorpyrifos to two different species of Artemia (A. salina and A. parthenogenetica) was evaluated. In addition, the in vivo effect of these two pesticides on cholinesterase (ChE) activity of both A. salina and A. parthenogenetica was also determined. The characterisation of the ChE, using different substrates and specific inhibitors, and the normal range of activity in non-exposed individuals were previously investigated for both species. The results obtained indicate that the ChE of A. salina is different from that of A. parthenogenetica and that both enzymes cannot be classified neither as acetylcholinesterase nor as butyrylcholinesterase since they show intermediary characteristics between the two vertebrate forms. The range of normal ChE activity was 2.65+/-0.15 U/mg protein for A. salina, and 3.69+/-0.17 U/mg protein for A. parthenogenetica. Significant in vivo effects of both pesticides on Artemia ChE activity were found, at concentrations between 5.38 and 9.30 mg/l for dichlorvos and between 1.85 and 3.19 mg/l for chlorpyrifos. Both Artemia species are resistant to these pesticides and they are able to survive with more than 80% ChE inhibition. However, A. parthenogenetica is more resistant than A. salina, with about a 95% reduction in its ChE activity respect to the control for nauplii exposed to the median lethal concentrations (LC50), without lethal effects after 24 h of exposure.

  14. Growth and survival of Hippocampus erectus (Perry, 1810 juveniles fed on Artemia with different HUFA levels

    Directory of Open Access Journals (Sweden)

    Nicolás Vite-Garcia

    2014-03-01

    Full Text Available Survival during first months after birth is one of the bottlenecks for consolidating the seahorse farming industry. In this work, Artemia metanauplii enriched with two highly unsaturated fatty acids (HUFA rich commercial emulsions with different docosahexaenoic acid (DHA levels (63% and 14% of total lipids, a vegetable oil with no DHA, and non-enriched Artemia as control, were used to feed 5-day-old juvenile Hippocampus erectus for 60 days. Enriched Artemia had similar levels of DHA (13% and 9%, despite great differences of DHA in the emulsions, with traces of DHA in non-enriched and vegetable oil enriched Artemia. More than 20% of DHA was found in 24 h starved juveniles fed both DHA-enriched treatments, similar to values in newly born juveniles, but those fed vegetable oil enriched Artemia or non-enriched Artemia had 5% of DHA. Total lipid and protein levels were similar in juveniles from the four treatments. The n-3/n-6 ratio was almost four-fold higher in seahorses fed DHA-enriched treatments compared to juveniles fed the non-enriched treatments. Survival of seahorses only partially reflected the DHA levels: it was lower in the vegetable oil treatment, similar in the seahorses fed Artemia with higher DHA and in the control treatment, and higher in seahorses fed the HUFA-enriched Artemia with lower DHA levels, although growth was similar in the two DHA-enriched Artemia treatments. Juvenile H. erectus seahorses perform better when they have at least 20% of DHA in their tissues, and these levels can be attained with no more than 14% of DHA in emulsions, eliminating the need for more expensive emulsions with higher DHA levels.

  15. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae

    Directory of Open Access Journals (Sweden)

    PATRICIO R DE LOS RIOS

    2000-03-01

    Full Text Available Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos, A. persimilis (Argentina y Artemia sp. (Chile, cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile y entre A. persimilis y Artemia sp. de Torres del Paine (Chile. Se discuten en el presente trabajo los factores geográficos, ecológicos y genéticos que determinaron la especiación de Artemia en Chile y Argentina, y como ésta se manifiesta en distintos patrones morfométricosThe frontal knob diameter and its relationship with the total body lenght among populations of Artemia franciscana (Chile and U.S.A, A. persimilis (Argentina, and Artemia sp. (Chile, were asessed. All populations were cultured under laboratory conditions. Significant differences in both parameters between A. franciscana and Artemia sp. from Salina el Convento (Chile, and between A. persimilis and Artemia sp. from Amarga Lagoon (Chile were recorded.Geographical, ecological and genetic aspects which affected the speciation of Artemia populations in Chile and Argentina, and their expression in morphometric characters are discussed

  16. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  17. Automixis in Artemia: solving a century-old controversy.

    Science.gov (United States)

    Nougué, O; Rode, N O; Jabbour-Zahab, R; Ségard, A; Chevin, L-M; Haag, C R; Lenormand, T

    2015-12-01

    Parthenogenesis (reproduction through unfertilized eggs) encompasses a variety of reproduction modes with (automixis) or without (apomixis) meiosis. Different modes of automixis have very different genetic and evolutionary consequences but can be particularly difficult to tease apart. In this study, we propose a new method to discriminate different types of automixis from population-level genetic data. We apply this method to diploid Artemia parthenogenetica, a crustacean whose reproductive mode remains controversial despite a century of intensive cytogenetic observations. We focus on A. parthenogenetica from two western Mediterranean populations. We show that they are diploid and that markers remain heterozygous in cultures maintained up to ~36 generations in the laboratory. Moreover, parallel patterns of population-wide heterozygosity levels between the two natural populations strongly support the conclusion that diploid A. parthenogenetica reproduce by automictic parthenogenesis with central fusion and low, but nonzero recombination. This settles a century-old controversy on Artemia, and, more generally, suggests that many automictic organisms harbour steep within-chromosome gradients of heterozygosity due to a transition from clonal transmission in centromere-proximal regions to a form of inbreeding similar to self-fertilization in centromere-distal regions. Such systems therefore offer a new avenue for contrasting the genomic consequences of asexuality and inbreeding.

  18. Embryogenesis, hatching and larval development of Artemia during orbital spaceflight

    Science.gov (United States)

    Spooner, B. S.; Debell, L.; Armbrust, L.; Guikema, J. A.; Metcalf, J.; Paulsen, A.

    1994-01-01

    Developmental biology studies, using gastrula-arrested cysts of the brine shrimp Artemia franciscana, were conducted during two flights of the space shuttle Atlantis (missions STS-37 and STS-43) in 1991. Dehydrated cysts were activated, on orbit, by addition of salt water to the cysts, and then development was terminated by the addition of fixative. Development took place in 5 ml syringes, connected by tubing to activation syringes, containing salt water, and termination syringes, containing fixative. Comparison of space results with simultaneous ground control experiments showed that equivalent percentages of naupliar larvae hatched in the syringes (40%). Thus, reactivation of development, completion of embryogenesis, emergence and hatching took place, during spaceflight, without recognizable alteration in numbers of larvae produced. Post-hatching larval development was studied in experiments where development was terminated, by introduction of fixative, 2 days, 4 days, and 8 days after reinitiation of development. During spaceflight, successive larval instars or stages, interrupted by molts, occurred, generating brine shrimp at appropriate larval instars. Naupliar larvae possessed the single naupliar eye, and development of the lateral pair of adult eyes also took place in space. Transmission electron microscopy revealed extensive differentiation, including skeletal muscle and gut endoderm, as well as the eye tissues. These studies demonstrate the potential value of Artemia for developmental biology studies during spa ceflight, and show that extensive degrees of development can take place in this microgravity environment.

  19. [Acute Toxicity of Coptis chinensis Rhizome Extracts to Daphnia carinata].

    Science.gov (United States)

    Chen, Ya-nan; Yuan, Ling

    2015-10-01

    Coptis chinensis rhizome and preparations were widely used for the treatment of fish diseases in aquaculture. the acute toxicological effect of CRE on lethal, movement and phototaxis was studied on Daphnia carinata monoclone as a test animal in the present experiment. The results showed that CRE was acute toxic to this animal and alkaloids berberine concentrations in CRE changed in the following sequence: half lethal > half inhibitory > limitable, which led to a significant change in phototaxis index of Daphnia carinata. The concentration of CRE for the significant change in phototaxis index was 4.27 mg x L(-1), which was lower than the concentration in water to cure the fish diseases and this conclusion indicated an ecological risk of this antibiotic to Daphnia carinata in aquaculture. In addition, the concentration of CRE in phototaxis index was changed from 30.62 times at 48th hour to 36.51 times at 24th hour that were lower than half lethal concentration. Detecting phototaxis index was easy and only 3 hours was required, so utilizing the quickly change of Daphnia carinata phototaxis can be an effective method to monitor the toxicity effect of CRE on Daphnia carinata. The abuse of rhizome or preparations in aquaculture might destroy the aquatic food chain, resulting in an imbalance of aquatic ecosystems.

  20. Using Daphnia bio-sensor for random number generation

    Directory of Open Access Journals (Sweden)

    Đorđević Đorđe

    2013-01-01

    Full Text Available One of the most used bioassays for toxicity screening of chemicals and for toxicity monitoring of effluents and contaminated waters is the acute toxicity test performed with Daphnia Magna. Standard methods have been developed and gradually improved by national and international organizations dealing with toxicity testing procedure, in view of its application within a regulatory framework. As for all toxicity tests, the organisms used for the acute Daphnia magna assay have to be obtained from live stocks which are cultured in the laboratory on live food (micro-algae. The technical and biological problems inherent in year-round culturing and the culturing/maintenance costs of live stocks restricts its application to a limited number of highly specialized laboratories. This bottleneck in toxicity testing triggered investigations forward the concept of "microbiotests" or "small-scale" toxicity tests. This paper deals with the measurement of changes in the behavior of Daphniae using device BIOTOXINOMER, awarded by Ministry for Science and Technological Development of Republic Serbia with Diploma for best Innovation idea in year 2010 in category Medicine, Health, and Ecology. Actually, the main topic is digitalization of bio-monitoring results and random number generating on the base of Daphniae movement (distance. The on-line monitoring is available on site www.dundjer.co.rs/Daphniae and open-source software support is available on the same site. [Projekat Ministarstva nauke Republike Srbije, br. III44006 i br. TR37003

  1. Nitrates and herbicides cause higher mortality than the traditional organic fertilizers on the grain beetle, Tenebrio molitor.

    Science.gov (United States)

    Castilla, Aurora M; Dauwe, Tom; Mora, Isabel; Malone, Jim; Guitart, Raimon

    2010-01-01

    We examined experimentally whether fertilizers or herbicides commonly used by farmers affect mortality of the adult grain beetle Tenebrio molitor. After a period of 4 weeks in direct contact with all treatments, a higher percentage of mortality occurred in contact with nitrates than with pig manure or turkey litter. Herbicides (a mixture of glyphosate and 2,4-D: ) caused 100% mortality. Our results also indicate that more beetles escaped from the herbicides and nitrate treatments than from the others, suggesting some kind of behavioural avoidance of toxic environments. The traditional organic fertilizers appear to be less toxic than inorganic fertilizers for Tenebrio molitor.

  2. Diffusive properties of water in Artemia cysts as determined from quasi-elastic neutron scattering spectra. [Artemia shrimp

    Energy Technology Data Exchange (ETDEWEB)

    Trantham, E.C.; Rorschach, H.E.; Clegg, J.S.; Hazlewood, C.F.; Nicklow, R.M.; Wakabayashi, N.

    1984-05-01

    Results have been obtained on the quasi-elastic spectra of neutrons scattered from pure water, 20% agarose gel (hydration four grams H/sub 2/O per gram of dry solid) and cysts of the brine shrimp Artemia for hydrations between 0.10 and 1.2 grams H/sub 2/O per gram of dry solids. The spectra were interpreted using a two-component model that included contributions from the covalently bonded protons and the hydration water, and a mobile water fraction. The mobile fraction was described by a jump-diffusion correlation function for the translation motion and a simple diffusive orientational correlation function. The results for the line widths ..gamma..(Q/sup 2/) for pure water were in good agreement with previous measurements. The agarose results were consistent with NMR measurements that show a slightly reduced translational diffusion for the mobile water fraction. The Artemia results show that the translational diffusion coefficient of the mobile water fraction was greatly reduced from that of pure water. The line width was determined mainly by the rotational motion, which was also substantially reduced from the pure water value as determined from dielectric relaxation studies. The translational and rotational diffusion parameters were consistent with the NMR measurements of diffusion and relaxation. Values for the hydration fraction and the mean square thermal displacement as determined from the Q-dependence of line areas were also obtained.

  3. Comparative Developmental Staging of Female and Male Water Fleas Daphnia pulex and Daphnia magna During Embryogenesis.

    Science.gov (United States)

    Toyota, Kenji; Hiruta, Chizue; Ogino, Yukiko; Miyagawa, Shinichi; Okamura, Tetsuro; Onishi, Yuta; Tatarazako, Norihisa; Iguchi, Taisen

    2016-02-01

    The freshwater crustacean genus Daphnia has been used extensively in ecological, developmental and ecotoxicological studies. Daphnids produce only female offspring by parthenogenesis under favorable conditions, but in response to various unfavorable conditions and external stimuli, they produce male offspring. Although we reported that exogenous exposure to juvenile hormones and their analogs can induce male offspring even under female-producing conditions, we recently established a male induction system in the Daphnia pulex WTN6 strain simply by changing day-length. This male and female induction system is suitable for understanding the innate mechanisms of sexual dimorphic development in daphnids. Embryogenesis has been described as a normal plate (developmental staging) in various daphnid species; however, all studies have mainly focused on female development. Here, we describe the developmental staging of both sexes during embryogenesis in two representative daphnids, D. pulex and D. magna, based on microscopic time-course observations. Our findings provide the first detailed insights into male embryogenesis in both species, and contribute to the elucidation of the mechanisms underlying sexual differentiation in daphnids.

  4. Biomass production and nutritional value of Artemia sp. (Anostraca: Artemiidae) in Campeche, México.

    Science.gov (United States)

    Maldonado-Montiel, Teresita D N J; Rodríguez-Canché, Leticia G

    2005-01-01

    Biomass of the crustacean Artemia sp. has multiple uses. The biochemical composition and biomass production of Artemia grown from cysts produced by a native population from Real de Salinas were evaluated under laboratory conditions. Nauplii (instar I) were stocked at density of 10 nauplii/ml in 1.5 l tanks, fed with rice bran from day 2 to day 6, and with the microalgae Tetraselmis suecica from day 7 to day 15. At the end of the trial (day 15) the average length was 5.34 mm, biomass production was 15.72 g/l (wet weight), and survival was 79%. The proximal analysis and biochemical composition of Artemia biomass indicated that its nutrient percentages are closely similar to Artemia from other regions, making this species a suitable food for cultured fish and crustacean.

  5. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  6. Aspects of cuticular sclerotization in the locust, Scistocerca gregaria, and the beetle, Tenebrio molitor.

    Science.gov (United States)

    Andersen, Svend Olav; Roepstorff, Peter

    2007-03-01

    The number of reactive amino groups in cuticular proteins decreases during the early period of insect cuticular sclerotization, presumably due to reaction with oxidation products of N-acetyldopamine (NADA) and N-beta-alanyldopamine (NBAD). We have quantitated the decrease in cuticular N-terminal amino groups and lysine epsilon-amino groups during the first 24h of sclerotization in adult locusts, Schistocerca gregaria, and in larval and adult beetles, Tenebrio molitor, as well as the increase in beta-alanine amino groups in Tenebrio cuticle. The results indicate that nearly all glycine N-terminal groups and a significant part of the epsilon-amino groups from lysine residues are involved in the sclerotization process in both locusts and Tenebrio. A pronounced increase in the amount of free beta-alanine amino groups was observed in cuticle from adult Tenebrio and to a lesser extent also in Tenebrio larval cuticle, but from locust cuticle no beta-alanine was obtained. Hydrolysis of sclerotized cuticles from locusts and Tenebrio by dilute hydrochloric acid released a large number of compounds containing amino acids linked to catecholic moieties. Products have been identified which contain histidine residues linked via their imidazole group to the beta-position of various catechols, such as dopamine, 3,4-dihydroxyphenyl-ethanol (DOPET), and 3,4-dihydroxyphenyl-acetaldehyde (DOPALD), and a ketocatecholic compound has also been identified composed of lysine linked via its epsilon-amino group to the alpha-carbon atom of 3,4-dihydroxyacetophenone. Some of the hydrolysis products have previously been obtained from sclerotized pupal cuticle of Manduca sexta [Xu, R., Huang, X., Hopkins, T.L., Kramer, K.J., 1997. Catecholamine and histidyl protein cross-linked structures in sclerotized insect cuticle. Insect Biochemistry and Molecular Biology 27, 101-108; Kerwin, J.L., Turecek, F., Xu, R., Kramer, K.J., Hopkins, T.L., Gatlin, C.L., Yates, J.R., 1999. Mass spectrometric analysis

  7. Ingestion of microcystins by Daphnia: Intestinal uptake and toxic effects

    DEFF Research Database (Denmark)

    Rohrlack, T.; Christoffersen, K.; Dittmann, E.;

    2005-01-01

    We investigated the intestinal uptake and adverse effects of microcystins ingested with Microcystis on Daphnia galeata. The gut structure, blood microcystin concentration, appearance, and movements of Daphnia fed Microcystis PCC 7806 or a microcystin-deficient PCC 7806 mutant were monitored over...... time. Microcystins were rapidly taken up from the digestive cavity into the blood. This process apparently required a preceding disruption of the gut epithelium by an as-yet-unknown Microcystis factor. Once microcystins entered the blood, they affected the neuromuscular communication or another life...... suggest that an ingestion of between 10.2 ng and 18.3 ng of microcystin per 1 mg of Daphnia body fresh weight is sufficient to kill D. galeata within 2 d....

  8. Biochemical studies on sphingolipids of Artemia franciscana: novel neutral glycosphingolipids.

    Science.gov (United States)

    Kojima, Hisao; Shimizu, Takemasa; Sugita, Mutsumi; Itonori, Saki; Fujita, Norihisa; Ito, Masahiro

    2011-02-01

    Neutral glycosphingolipids containing one to six sugars in their oligosaccharide chains have been isolated from cysts of the brine shrimp Artemia franciscana. The structures of these glycolipids were identified by methylation analysis, partial acid hydrolysis, gas-liquid chromatography, combined gas-liquid chromatography-mass spectrometry, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and proton nuclear magnetic resonance spectroscopy to be Glcβ1-Cer, Manβ1-4Glcβ1-Cer, Fucα1-3Manβ1-4Glcβ1-Cer, GlcNAcβ1-3Manβ1-4Glcβ1-Cer, GlcNAcα1-2Fucα1-3Manβ1-4Glcβ1-Cer, GalNAcβ1-4GlcNAcβ1-3Manβ1-4Glcβ1-Cer, GalNAcβ1-4(Fucα1-3)GlcNAcβ1-3Manβ1-4Glcβ1-Cer (CPS), and GalNAcβ1-4(GlcNAcα1-2Fucα1-3)GlcNAcβ1-3Manβ1-4Glcβ1-Cer (CHS). Two glycosphingolipids, CPS and CHS, were characterized as novel structures. Because Artemia contains a certain series of glycosphingolipids (-Fucα3Manβ4GlcβCer), which differ from the core sugar sequences reported thus far, we tentatively designated the glycosphingolipids characterized as nonarthro-series ones. Furthermore, CHS exhibited a hybrid structure of arthro-series and nonarthro-series sugar chain. Two novel glycosphingolipids were characterized from the brine shrimp Artemia franciscana; one was composed of arthrotetraose and a branching fucose attached to N-acetylglucosamine residue, and the other was composed of CPS with an additional N-acetylglucosamine residue attached to the branching fucose.

  9. Role of allatostatin-like factors from the brain of Tenebrio molitor females.

    Science.gov (United States)

    Wasielewski, O; Skonieczna, M; Kodrík, D

    2009-08-01

    The effect of brain extract from females of freshly emerged Tenebrio molitor on ovary, oocyte development, total protein content of hemolymph, and ovary was studied in 4-day-old adult mealworm females. Injections of extracts of 2-brain equivalents into intact (unligatured) Tenebrio females did not affect ovarian and oocyte development. Injections of ligated females, however, with 2-brain equivalents on day 1 and 2 after adult emergence strongly inhibited ovarian growth and oocyte development. At day 4, ligated and injected females did not develop their ovaries and pre-vitellogenic oocytes were not found. The changes in ovarian development correlated with an increase in the concentration of soluble proteins in the hemolymph as compared with the saline-injected controls. Additionally, a strong reduction of total protein content in ovarian tissue was observed. Reverse phase HPLC separation of a methanolic brain extract of T. molitor females showed that fraction 5 has a similar retention time to synthetic cockroach allatostatin. Fraction 5 was eluted at 12.88 min, which was closest to the internal standard Dippu-AST I, which eluted at 12.77 min. An ELISA of fraction 5 from the methanolic brain extract using antibodies against allatostatins Grybi-AST A1 and Grybi-AST B1 from cricket Gryllus bimaculatus showed that fraction 5 cross-reacted with Grybi-AST A1 antibodies. The cross-reactivity was similar to the synthetic allatostatin from D. punctata, which was used as a positive control. These observations demonstrate a possible role for allatostatin-like brain factor(s) in regulating the reproductive cycle of Tenebrio molitor.

  10. Development of transgenic zooplankton Artemia as a bioreactor to produce exogenous protein.

    Science.gov (United States)

    Chang, Shih-Hung; Lee, Ben-Chang; Chen, Yan-Da; Lee, Yin-Chou; Tsai, Huai-Jen

    2011-10-01

    Although the crustacean Artemia has been commonly used as an experimental organism and served as a live bait feed for aquaculture, gene transfer system on Artemia sp. to generate stable lines is not well developed. In this study, we optimized a condition for cyst-eletroporation and generated stable lines of transgenic A. sinica. Two expression plasmids directed by the hybrid promoters of cytomegalovirus (CMV) and medaka β-actin (Mβ) were co-electroporated on decapsulated cysts: pCMV-Mβ-GFP contained GFP reporter gene and pCMV-Mβ-ypGH contained yellowfin porgy GH (ypGH) cDNA. We examined the GFP shown in the Artemia larvae and found that the expression rate was 13.3% (3,219 out of 24,054 examined). We then chose 200 G0 founders which strongly expressed GFP to generate transgenic lines. Homozygotic strains derived from F4 generation of each transgenic line, A3 and A8, were obtained. We proved that transgenic lines A3 and A8 also harbored pCMV-Mβ-ypGH and produced recombinant ypGH with a concentration of 0.089 and 0.032 μg per 50 homozygotic nauplii, respectively. Ten live Artemia nauplii were fed daily to zebrafish larvae during 25 to 35 days of post-fertilization. The average body length gain rates of zebrafish larvae fed transgenic Artemia were 16-20% greater than those of control group, indicating the exogenous ypGH produced by transgenic Artemia is functional. Therefore, we concluded that the transgenesis on Artemia is developed, and transgenic Artemia might be highly potentially useful as a new bioreactor material for application in aquaculture and biological researches.

  11. Potentials of converting microalgae into brine shrimp Artemia

    OpenAIRE

    Sorgeloos, P.

    1985-01-01

    High densities of brine shrimp Artemia can be cultured in flow-through systems using the effluent of microalgae cultures as a combined source of culture medium and food. It has been proven at the "St. Croix Artificial Upwelling Mariculture Project" that in comparison with the fast growing clam Tapes japonica, brine shrimp assure a much more efficient conversion of plant into animal biomass. It appears from the given examples that microalgae conversion into brine shrimp Artemia offers efficien...

  12. Effects of some sesquiterpenes on the stored-product insect Tenebrio molitor (Coleoptera: Tenebrionidae Efectos de algunos sesquiterpenos sobre el insecto de productos almacenados, Tenebrio molitor (Coleoptera: Tenebrionidae

    Directory of Open Access Journals (Sweden)

    Matías García

    2003-12-01

    Full Text Available In order to evaluate the allelochemical activity of some sesquiterpenes isolated from the native plant Tessaria absinthioides (Hook. et Arn. DC, and some semi synthetic derivatives against Tenebrio molitor L. larvae, we have developed bioassays directed to quantify repellency, larval mortality, and its effects on the development. Although costic aldehyde caused the maximum repellent effect, all the compounds showed a significant effect at some dose or time, indicating behavioral avoidance. The topical application of costic aldehyde produced the largest increase on the duration of the pupal stage. Tessaric acid exhibited the highest toxicity by topical application at the experiment closure. Both eremophilane-1(10,2,11(13-triene-12-oic, and -costic acids induced some morphological deformities.Con el objeto de evaluar sesquiterpenos aislados de la planta nativa Tessaria absinthioides (Hook et Arn y algunos derivados semisintéticos frente a larvas de Tenebrio molitor L., se desarrollaron bioensayos orientados a la cuantificación de la repelencia, mortalidad de larvas y efectos sobre el desarrollo. Aldehído cóstico produjo el mayor incremento en la duración del estado pupal por aplicación tópica. Acido tessárico exhibió el más alto porcentaje de mortalidad al finalizar el período de experimentación. Los productos eremophilan-1(10,2, 11(13-trien-12-oico y ácido -cóstico dieron lugar al mayor número de malformaciones. Si bien aldehído cóstico mostró la máxima actividad de repelencia, todos los compuestos evaluados produjeron efectos significativos en el ensayo de elección.

  13. Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Harley Nonato de Oliveira

    2004-10-01

    Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae, uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural.Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae, in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae, one of the most damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

  14. Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor.

    OpenAIRE

    Oliveira,Harley Nonato de; Pratissoli, Dirceu; Pedruzzi,Eder Pin; Espindula,Marcelo Curitiba

    2004-01-01

    Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae) têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae), uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em la...

  15. Experimental assessment of environmental influences on the stable isotopic composition of Daphnia pulicaria and their ephippia

    Directory of Open Access Journals (Sweden)

    J. Schilder

    2015-02-01

    δ15N values of ephippia and Daphnia between the 12 °C and 20 °C treatments, but the δ18O values of Daphnia and ephippia were on average 1.2‰ lower at 20 °C compared with 12 °C. We conclude that the stable isotopic composition of Daphnia ephippia provides information on that of the parent Daphnia and of the food and water they were exposed to, with small offsets between Daphnia and ephippia relative to variations in Daphnia stable isotopic composition reported from downcore studies. However, our experiments also indicate that temperature may have a minor influence on the δ13C, δ15N and δ18O values of Daphnia body tissue and ephippia. This aspect deserves attention in further controlled experiments.

  16. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae) Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae)

    OpenAIRE

    PATRICIO R DE LOS RIOS; OSCAR ZUÑIGA

    2000-01-01

    Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos), A. persimilis (Argentina) y Artemia sp. (Chile), cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile) y entre A. persimilis y Artemia sp. de Torres del Paine (Chile). Se discuten en el presente trab...

  17. Bacteria associated with Artemia spp. along the salinity gradient of the solar salterns at Eilat (Israel).

    Science.gov (United States)

    Tkavc, Rok; Ausec, Luka; Oren, Aharon; Gunde-Cimerman, Nina

    2011-08-01

    The crustacean genus Artemia naturally inhabits various saline and hypersaline environments and is the most frequently laboratory-hatched animal for live feed in mari- and aquaculture. Because of its high economic importance, Artemia-bacteria interactions were so far studied mostly in laboratory strains. In this study, we focused our attention on the Artemia-associated microbiota in its natural environment in the solar salterns of Eilat, Israel. We applied a culture-independent method (clone libraries) to investigate the bacterial community structure associated with Artemia in five evaporation ponds with salinities from slightly above seawater (5%) to the point of saturation (32%), in two different developmental stages: in nauplii and in the intestine of adult animals. Bacteria found in naupliar and adult stages were classified within the Proteobacteria, Bacteroidetes, Firmicutes, Actinobacteria and Cyanobacteria. The halophilic proteobacterial genera Halomonas spp. and Salinivibrio spp. dominated the Artemia microbiota in both stages in all ponds. We also analysed a clone library of entire adult animals, revealing a novel bacterial phylogenetic lineage. This is the first molecular study of bacteria associated with two developmental stages of Artemia along a salinity gradient.

  18. Determination in oocytes of the reproductive modes for the brine shrimp Artemia parthenogenetica.

    Science.gov (United States)

    Dai, Zhong-Min; Li, Ran; Dai, Li; Yang, Jin-Shu; Chen, Su; Zeng, Qing-Guo; Yang, Fan; Yang, Wei-Jun

    2011-02-01

    The brine shrimp, Artemia, reproduces either oviparously, producing encysted embryos (diapause cysts), or ovoviviparously, producing free-swimming nauplii. Environmental factors, such as photoperiod, have been applied to control the reproduction mode of Artemia, but when the determination of a reproductive mode occurs remains unknown. We analysed the differential gene expression between oocytes from oviparous and ovoviviparous Artemia reared under different photoperiods. A total of 692 qualified cDNA clones were obtained by subtractive hybridization, 327 of which matched GenBank® Nucleotide Sequence Database entries. Gene expressions of 44 cDNAs (representing 56 clones) were analysed in oocytes using real-time PCR. Among these genes, 11 (21 clones) were significantly (PArtemia oocytes that subsequently enter diapause. Remarkably, known diapause-related proteins such as ArHsp22 (Artemia heat-shock protein 22) and chitin-binding proteins are found to be already differentially expressed. Furthermore, RNAi (RNA interference) knockdown of a differentially expressed gene, polo-like kinase 1, in oocyte of ovoviviparous Artemia led to the production of white embryos rather than free-swimming nauplii. In summary, our results provide evidence at the molecular level that the reproductive mode of Artemia is already determined at the oocyte stage of their life cycle.

  19. Toxic Assessment of Triclosan and Triclocarban on Artemia salina.

    Science.gov (United States)

    Xu, Xiaolu; Lu, Yin; Zhang, Deyong; Wang, Yinyin; Zhou, Xianshan; Xu, Huiying; Mei, Yu

    2015-12-01

    In this study, we investigated the possible acute toxic and genotoxic effects of triclosan (TCS) and triclocarban (TCC) on Artemia salina. Genotoxicity was evaluated using single-cell gel electrophoresis and apoptotic frequency assays (Annexin V-FITC/PI assay). Acute toxicity test results showed that TCC (LC50-24 h = 17.8 µg/L) was more toxic than TCS (LC50-24 h = 171.1 µg/L). Significant increases in both genotoxic biomarkers were observed at 24 h after initial exposure, indicating that these two chemicals are potentially dangerous for this aquatic biological model. Although further studies are required, a comparison of data both in vitro and in vivo allowed us to suggest possible mechanisms of action for TCS and TCC in this sentinel organism.

  20. Use of Probiotic Bacillus spp. in Rotifer (Brachionus plicatilis) and Artemia (Artemia urmiana) Enrichment: Effects on Growth and Survival of Pacific White Shrimp, Litopenaeus vannamei, Larvae.

    Science.gov (United States)

    Jamali, Hadi; Imani, Ahmad; Abdollahi, Daruosh; Roozbehfar, Reza; Isari, Amin

    2015-06-01

    This study was to evaluate the effect of a preparation of Bacillus probiotic (Bacillus licheniformis and B. subtilis, 1:1) on growth and survival rate of Pacific white shrimp, Litopenaeus vannamei larvae. The larvae were fed on Artemia urmiana nauplii and Brachionus plicatilis enriched with the probiotic preparation at 1 × 10(6) CFU mL(-1) rate. The experimental setup was completely randomized design comprised of six treatments, namely solo Artemia nauplii (A) or rotifer (R), Artemia nauplii and rotifer without any enrichment (A + R), Artemia nauplii enrichment with probiotic bacilli (Bacillus licheniformis and B. subtilis) (A + B), rotifer enrichment with probiotic bacilli (R + B) and enriched Artemia nauplii and rotifer (A + R + B). All treatments were performed in triplicate. Chemical parameters of rearing water viz. pH, salinity and temperature were 7.5-8, 30-31 ppt and 31-32 °C, respectively. Photoperiod was 16L:8D. Shrimp larvae were fed Artemia nauplii and rotifers at 5-20 and 10-40 individuals per shrimp larvae four times a day, respectively. Growth and survival rate of larvae were determined at MII, MIII, PL1, PL4, PL7 and PL10 stages. Larvae in A + R + B treatment showed the highest total length (10.89 ± 0.51 mm), weight (674 ± 73 μg) and survival rate (65% ± 3.5). Lowest total length, weight and survival rate (7.96 ± 0.63 mm, 493 ± 52 μg and 24.5 ± 2.4%, respectively) were recorded in treatment B larvae. We concluded that Bacillus probiotic can improve growth and survival rate of Pacific white shrimp larvae without conceivably undesirable effects.

  1. Mercury accumulation and its effects an Artemia franciscana

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The effects of mercury accumulation on the brine shrimp Artemia franciscona were studied by long term (1--2 months) laboratory bioassays, using mercury chloride as the contaminant and the algae, Tetraselmis suecica as the food. These experiments were part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms. This also happens on the lagoon of Aveiro, Portugal, which is partially contaminated with mercury. The first assays were conducted with concentrations of HgCl{sub 2} of the order of magnitude of those found in the waters of the lagoon of Aveiro (1.4 and 2.8 {micro}g/l). In further bioassays ranges of concentrations with observable effects have been used, from 0.02 to 1 mo. In the different assays the HgCl{sub 2} was: (a) simultaneously added to all the tanks or along the time, to evaluate the effects over different life stages (b) added directly to the tanks and then to the algae, at the same or in different quantities, to find out which was the more important pathway of contamination (c) removed from the feed stream after a certain time, to find out if detoxification would occur. The bioassays were carried out in five 100 l tanks under controlled temperature, pH, dissolved oxygen, salinity and feeding rate. Besides the content in mercury, size and number of the organisms have also been measured, as well as their content in total proteins, carbohydrates and fats.

  2. Linear solvation energy relationships for toxicity of selected organic chemicals to Daphnia pulex and Daphnia magna

    Science.gov (United States)

    Passino, Dora R.M.; Hickey, James P.; Frank, Anthony M.

    1988-01-01

    In the Laurentian Great Lakes, more than 300 contaminants have been identified in fish, other biota, water, and sediment. Current hazard assessment of these chemicals by the National Fisheries Research Center-Great Lakes is based on their toxicity, occurrence in the environment, and source. Although scientists at the Center have tested over 70 chemicals with the crustacean Daphnia pulex, the number of experimental data needed to screen the huge array of chemicals in the Great Lakes exceeds the practical capabilities of conducting bioassays. This limitation can be partly circumvented, however, by using mathematical models based on quantitative structure-activity relationships (QSAR) to provide rapid, inexpensive estimates of toxicity. Many properties of chemicals, including toxicity, bioaccumulation and water solubility are well correlated and can be predicted by equations of the generalized linear solvation energy relationships (LSER). The equation we used to model solute toxicity is Toxicity = constant + mVI/100 + s (π* + dδ) + bβm + aαm where VI = intrinsic (Van der Waals) molar volume; π* = molecular dipolarity/polarizability; δ = polarizability 'correction term'; βm = solute hydrogen bond acceptor basicity; and αm = solute hydrogen bond donor acidity. The subscript m designates solute monomer values for α and β. We applied the LSER model to 48-h acute toxicity data (measured as immobilization) for six classes of chemicals detected in Great Lakes fish. The following regression was obtained for Daphnia pulex (concentration = μM): log EC50 = 4.86 - 4.35 VI/100; N = 38, r2 = 0.867, sd = 0.403 We also used the LSER modeling approach to analyze to a large published data set of 24-h acute toxicity for Daphnia magna; the following regression resulted, for eight classes of compounds (concentration = mM): log EC50 = 3.88 - 4.52 VI/100 - 1.62 π* + 1.66 βm - 0.916 αm; N = 62, r2 = 0.859, sd = 0.375 In addition we developed computer software that identifies

  3. Nutritional value of pupae versus larvae of Tenebrio molitor (Coleoptera: Tenebrionidae) as food for rearing Podisus maculiventris (Heteroptera: Pentatomidae)

    Science.gov (United States)

    Factitious prey are often more suitable for use in mass production of beneficial insects than natural prey. Life table analysis yielded demographic parameter values that indicate Tenebrio molitor (L.) pupae are promising as factitious prey to mass produce Podisus maculiventris (Say) and are more sui...

  4. Extracting Tenebrio molitor protein while preventing browning: effect of pH and NaCl on protein yield

    NARCIS (Netherlands)

    Yi, L.; Boekel, van T.; Lakemond, C.M.M.

    2016-01-01

    The potential of insects as an alternative protein source for food applications was investigated by studying the effect of pH and NaCl on extraction yield of water-soluble proteins from Tenebrio molitor, while preventing browning due to polyphenol oxidation. Minimum protein solubility (29.6%) was at

  5. Developmental plasticity in Tenebrio molitor (Coleoptera: Tenebrionidae): Analysis of Instar Variation in Number and Development Time under Different Diets

    Science.gov (United States)

    The variation in instar number and the pattern of sequential instar development time of Tenebrio molitor L. (Coleoptera: Tenebrionidae) was studied under 4 different diet regimes. Addition of dietary supplements consisting of dry potato or a mix of dry potato and dry egg whites significantly reduced...

  6. Simulación de un Robot Hexápodo Bioinspirado en el Tenebrio

    Directory of Open Access Journals (Sweden)

    Juan Pablo Rodríguez-Calderón

    2015-06-01

    Full Text Available Los insectos son base fundamental en el estudio de la robótica reactiva ya que estos poseen características biológicas y motrices que son de interés para ser implementadas en robots bioinspirados, teniendo en cuenta el desempeño de éstos en diferentes áreas. Por otra parte los animales hexápodos poseen omnidireccionalidad y estabilidad, debido a la formación del trípode de apoyo, el cual se crea en sus patas al dar un paso, lo cual les permite sobrepasar diferentes obstáculos con facilidad y velocidad constante. En este proyecto se implementa el sistema locomotor del insecto Tenebrio debido a la facilidad con que se pueden apreciar sus movimientos. Se analiza el desplazamiento de las patas del insecto en diferentes trayectorias, vistas y terreno plano, posteriormente se encontraron los parámetros, ecuaciones y restricciones que limitan los diferentes eslabones de cada una de las patas del Tenebrio, esto se realizó por medio de un análisis de imágenes. Finalmente la información recogida se implementa en la plataforma MATLAB para determinar las características de movimiento, estabilidad y desplazamiento.

  7. Pleiotropic effects of the neuropeptides CCAP and myosuppressin in the beetle, Tenebrio molitor L.

    Science.gov (United States)

    Wasielewski, O; Skonieczna, M

    2008-09-01

    Biological activities of crustacean cardioactive peptide (CCAP; PFCNAFTGCa) and leucomyosuppressin (Lem-MS; pQDVDHVFLRFa) were studied in heterologous bioassays in the larvae and adults of Tenebrio molitor. CCAP exerted a reversible and dose-dependent cardio-stimulatory effect on the semi-isolated heart of the experimental beetles at a concentration of >10(-7) M and induced an effect similar to the endogenic cardio-stimulatory peptide, proctolin. Injections of CCAP (10(-9)-10(-3) M) into 4-day-old adult reproductive females increased the concentration of soluble proteins in hemolymph in comparison to the saline injected controls. Electrophoretic analyses indicated significant increase in the level of two proteins 130 and 170 kDa, and a partial increase of the level of 67-kDa protein. The studies indicated that CCAP increased also free hemolymph sugar concentration in young larvae and adults of the mealworm beetle. The cardio-inhibitory peptide Lem-MS exerted the opposite effect: at concentration 10(-7)-10(-6) M, it significantly decreased the heartbeat frequency. The induced changes were dose-dependent and reversible, but at higher concentrations (>10(-5) M) the stimulatory effect disappeared. Injections of the Lem-MS into young larvae at concentrations 10(-9)-10(-3) M, also increased the free hemolymph sugar level similarly to the CCAP. This work demonstrates the pleiotropic effects of CCAP and Lem-MS in Tenebrio molitor.

  8. Stereoselectivity in bioaccumulation and excretion of epoxiconazole by mealworm beetle (Tenebrio molitor) larvae.

    Science.gov (United States)

    Lv, Xiaotian; Liu, Chen; Li, Yaobin; Gao, Yongxin; Wang, Huili; Li, Jianzhong; Guo, Baoyuan

    2014-09-01

    Stereoselectivity in bioaccumulation and excretion of stereoisomers of epoxiconazole by mealworm beetle (Tenebrio molitor) larvae through dietary exposure was investigated. Liquid chromatography tandem mass spectrometry (HPLC-MS/MS) method that use a ChiralcelOD-3R[cellulosetris-Tris-(3, 5-dichlorophenyl-carbamate)] chromatography column was applied to carry out chiral separation of the stereoisomers. Wheat bran was spiked with racemic epoxiconazole at two dose levels of 20mg/kg and 2mg/kg (dry weight) to feed T. molitor larvae. The results showed that both the doses of epoxiconazole were taken up by Tenebrio molitor larvae rapidly at the initial stages. There was a significant trend of stereoselective bioaccumulation in the larvae with a preferential accumulation of (-)-epoxiconazole in the 20mg/kg dose. The stereoselectivity in bioaccumulation in the 2mg/kg dosage was not obvious compared to the 20mg/kg group. Results of excretion indicated an active excretion is an important pathway for the larvae to eliminate epoxiconazole which was a passive transport process with non stereoselectivity. The faster elimination might be the reason for the low accumulation of epoxiconazole, as measured by bioaccumulation factor (BAF).

  9. Bioaccumulation and excretion of enantiomers of myclobutanil in Tenebrio molitor larvae through dietary exposure.

    Science.gov (United States)

    Lv, Xiaotian; Liu, Chen; Li, Yaobin; Gao, Yongxin; Guo, Baoyuan; Wang, Huili; Li, Jianzhong

    2013-12-01

    The bioaccumulation and excretion of enantiomers of myclobutanil in Tenebrio molitor larvae through dietary exposure under laboratory conditions were investigated using high-performance liquid chromatography tandem mass spectrometry (HPLC-MS/MS) based on a ChiralcelOD-3R [cellulosetris-tris-(3, 5-dichlorophenyl-carbamate)] column. The wheat bran fed to Tenebrio molitor larvae was spiked with racemic myclobutanil at two dose levels of 20 mg/kg and 2 mg/kg (dry weight). The results showed that there was a significant trend of enantioselective bioaccumulation in the larvae with a preferential accumulation of (-)-myclobutanil in 20 mg/kg dose exposure, but it was not obviously observed in the 2 mg/kg dose group. A kinetic model considering enantiomerization between the two enantiomers based on first-order reactions was built and the rate constants were estimated to discuss the kinetic reason for the different concentrations of individual enantiomers in the larvae. The approximations implied an inversion between the two enantiomers with a relatively higher rate of the inversion from (-)-myclobutanil to (+)-myclobutanil. Meanwhile, analysis of data of excretion samples suggested the active excretion is probably an important pathway for the insect to eliminate myclobutanil rapidly with nonenantioselectivity as a passive transport process, which was consistent with the low accumulation efficiency of myclobutanil measured by BAF (bioaccumulation factor).

  10. Uptake and depuration of gold nanoparticles in Daphnia magna

    DEFF Research Database (Denmark)

    Skjolding, Lars Michael; Kern, Kristina; Hjorth, Rune

    2014-01-01

    This study presents a series of short-term studies (total duration 48 h) of uptake and depuration of engineered nanoparticles (ENP) in neonate Daphnia magna. Gold nanoparticles (Au NP) were used to study the influence of size, stabilizing agent and feeding on uptake and depuration kinetics...

  11. Evaluation of MWNT toxic effects on daphnia and zebrafish embryos

    Energy Technology Data Exchange (ETDEWEB)

    Olasagasti, Maider; Rainieri, Sandra [AZTI-TECNALIA, Parque Tecnologico de Bizkaia 609, 48160 Derio (Spain)], E-mail: srainieri@azti.es; Alvarez, Noelia; Vera, Carolina [INASMET-TECNALIA, Mikeletegi pasealekua, 2, Parque Tecnologico, 20009 San Sebastian (Spain)

    2009-05-01

    Organisms of daphnia (Daphnia magna) and zebrafish (Danio rerio) embryos were exposed to a range of different concentrations of COOH-functionalized MWCNT suspended in an aqueous solution of Tween 20. Immobilization of daphnia and growth retardation, inhibition and malformation of zebrafish embryos were the endpoints tested after 24 and 48 hours. Immobilization of daphnia could be observed from 3 to 16 ppm and an increasing mortality of zebrafish embryo was detected at all the concentration tested. To identify more subtle toxic effects, we took advantage of the extensive information available on the zebrafish genome and monitored by RT-PCR the expression patterns of different zebrafish genes that could act as toxicity bio-markers. At some of the concentrations tested, changes in the expression profiles of the genes examined were detected. Our results suggest that MWCNT could potentially represent a risk to human health and environment, therefore a wider range of concentrations and further testing of this molecules should be carried out to define possible limitations in their use.

  12. wFleaBase: the Daphnia genome database

    Directory of Open Access Journals (Sweden)

    Singan Vasanth R

    2005-03-01

    Full Text Available Abstract Background wFleaBase is a database with the necessary infrastructure to curate, archive and share genetic, molecular and functional genomic data and protocols for an emerging model organism, the microcrustacean Daphnia. Commonly known as the water-flea, Daphnia's ecological merit is unequaled among metazoans, largely because of its sentinel role within freshwater ecosystems and over 200 years of biological investigations. By consequence, the Daphnia Genomics Consortium (DGC has launched an interdisciplinary research program to create the resources needed to study genes that affect ecological and evolutionary success in natural environments. Discussion These tools include the genome database wFleaBase, which currently contains functions to search and extract information from expressed sequenced tags, genome survey sequences and full genome sequencing projects. This new database is built primarily from core components of the Generic Model Organism Database project, and related bioinformatics tools. Summary Over the coming year, preliminary genetic maps and the nearly complete genomic sequence of Daphnia pulex will be integrated into wFleaBase, including gene predictions and ortholog assignments based on sequence similarities with eukaryote genes of known function. wFleaBase aims to serve a large ecological and evolutionary research community. Our challenge is to rapidly expand its content and to ultimately integrate genetic and functional genomic information with population-level responses to environmental challenges. URL: http://wfleabase.org/.

  13. Calcium interacts with temperature to influence Daphnia movement rates

    Science.gov (United States)

    Roszell, Jordan; Heyland, Andreas; Fryxell, John M.

    2016-01-01

    Predicting the ecological responses to climate change is particularly challenging, because organisms might be affected simultaneously by the synergistic effects of multiple environmental stressors. Global warming is often accompanied by declining calcium concentration in many freshwater ecosystems. Although there is growing evidence that these changes in water chemistry and thermal conditions can influence ecosystem dynamics, little information is currently available about how these synergistic environmental stressors could influence the behaviour of aquatic organisms. Here, we tested whether the combined effects of calcium and temperature affect movement parameters (average speed, mean turning frequency and mean-squared displacement) of the planktonic Daphnia magna, using a full factorial design and exposing Daphnia individuals to a range of realistic levels of temperature and calcium concentration. We found that movement increased with both temperature and calcium concentration, but temperature effects became considerably weaker when individuals were exposed to calcium levels close to survival limits documented for several Daphnia species, signalling a strong interaction effect. These results support the notion that changes in water chemistry might have as strong an effect as projected changes in temperature on movement rates of Daphnia, suggesting that even sublethal levels of calcium decline could have a considerable impact on the dynamics of freshwater ecosystems. PMID:28083097

  14. Acute and chronic toxicity of veterinary antibiotics to Daphnia magna

    DEFF Research Database (Denmark)

    Wollenberger, Leah; Halling-Sørensen, B.; Kusk, Kresten Ole

    2000-01-01

    The acute and chronic toxicity of nine antibiotics used both therapeutically and as growth promoters in intensive farming was investigated on the freshwater crustacean Daphnia magna. The effect of the antibiotics metronidazole (M), olaquindox (OL), oxolinic acid (OA), oxytetracycline (OTC), strep...

  15. Nutritional Content of Artemia sp. Fed with Chaetoceros calcitrans and Skeletonema costatum

    Directory of Open Access Journals (Sweden)

    VIVI ENDAR HERAWATI

    2014-12-01

    Full Text Available Artemia sp. is a natural food with high protein content, especially amino acid. Nowadays, Indonesia still relies on import for its supply. Hence, the utilization of local Artemia sp. as an alternative to the imported product is recommended as it contains more protein and less expensive. The advantages of local Artemia sp. is its better crystal quality as it is still fresh. It also provides better income for salt farmers because waste water from salt farm can be used to culture Artemia sp.. This research is aimed at determining the quality of locally-produced Artemia sp., by evaluation of its essential amino acid and fatty acid profiles after treatments. Our results indicated that Artemia sp. cysts with good quality were produced after 8 hours and Artemia sp. reaches a hatching rate of 1,320,000 cysts (95% after 27 hours. We also found an indication that the best feed concentration was a mix of 60% Chaetoceros calcitrans with 40% Skeletonema costatum. Fatty acid profile analyses showed that the highest SAFA (12.86% and PUFA (29.91% were gained after feeding with Chaetoceros calcitrans, whereas the highest HUFA (4.93% was gained after feeding with Skeletonemacostatum. Essential amino acid profile analyses revealed the highest content of amino acid (18912.62 ppm was after feeding with a combination of Chaetoceros calcitrans and Skeletonema costatum. Finally, the proper water quality during research was at 25-30 oC of temperature, 30-31 ppt of salinity, pH 7.8-8.9, and DO was at 3.0-4.4 mg/L.

  16. Effects of food type on the life history of Daphnia clones from lakes differing in trophic state. I. Daphnia galeata feeding on Scenedesmus and Oscillatoria

    NARCIS (Netherlands)

    Repka, S.

    1997-01-01

    1. Effects of the green alga Scenedesmus obliquus and the filamentous cyanobacterium Oscillatoria limnetica as food sources on the growth and reproduction of nine Daphnia galeata clones were studied. A high concentration of these two algae species was fed to Daphnia clones collected from four lakes

  17. Toxic effect of selenium on the zooplankton, Daphnia magna and Daphnia pulicaria, in water and the food source (Chlamydomonas reinhardtii)

    Energy Technology Data Exchange (ETDEWEB)

    Boyum, K.W.

    1984-01-01

    Acute and chronic toxicity experiments were performed on the zooplankton, Daphnia magna and Daphnia pulicaria, to investigate the toxicity of selenium on these aquatic invertebrates. The acute 48 h LC/sub 50/ of sodium selenate for Daphnia magna and Daphnia pulicaria were 1.01 and 0.25 mg Se/1, respectively. The 48 h LC/sub 50/ of sodium selenite for D. magna and D. pulicaria were 0.45 and 0.006 mg Se/1, respectively. Chronic 28-day toxicity tests were performed on D. magna at 0.05, 0.10, 0.50, and 1.00 mg Se/1 as sodium selenate in the water and with two food types. One food type was algae raised in clean Lake Michigan water and the second treatment was algae raised in media with selenium concentrations corresponding to those in the water cited above. When compared to Daphnia fed selenium-free algae, D. magna fed selenium-laden algae had greater survival, a greater number of offspring produced, and a greater intrinsic growth rate, r, at the toxicant concentration in the water of 0.05, 0.10, and 0.50 mg Se/1. These parameters were, however, lower than those observed in the controls. Uptake of /sup 75/Se as sodium selenate in D. magna was reduced in the presence of selenium-laden algae and DL-selenomethionine, while L-methionine increased the uptake of /sup 75/Se. Selenium bound to an amino acid such as Dl-selenomethionine or organically bound within an algal food source appears to be preferentially incorporated thereby reducing the uptake of inorganic forms from the water.

  18. [Immunocytochemical studies on the phase of differentiation of hatching gland cells in brine shrimp, Artemia salina].

    Science.gov (United States)

    Li, Ling; Fan, Ting Jun; Wang, Xiao Feng; Cong, Ri Shan; Yu, Qiu Tao; Zhong, Qi Wang

    2004-04-01

    Hatching enzyme (HE), synthesized in hatching gland cells (HGCs), plays vital roles in animal hatching. Immunocytochemical techniques employing anti-GST-UVS.2 antiserum, prepared from Xenopus HE and with specificity to brine shrimp HE, were first used to investigate the differentiation and variability of hatching gland cells (HGCs) in the hatching process of embryos of brine shrimp, Artemia salina, in this study. HGCs with immunoreactivity to anti-GST-UVS.2 antiserum were identified, for the first time, in brine shrimp embryos during hatching process. Immunocytochemical staining results showed that, (1) HE-positive immunoreactivity is really specific to Artemia HE, and its appearance and disappearance are closely correlated with the hatching process of Artemia salina. (2) Artemia HGCs, first appeared in embryos 5 hours before hatching and disappeared 4 hours after hatching, were also a transient type of cells, with an existence period of 9 hours. (3) The head portion of Artemia embryo is probably the initial position of HE secretion, and likely to be the main position of HE secretion as well. The detailed process and mechanism need to be studied. (4) The appearance of HGCs is in a synchronous mode from places all over the embryos, and their disappearance is also in a synchronous mode. (5) The number of HGCs increased gradually along with embryo development process and reached a maximum number at hatching. Contrarily, the number of HGCs decreased gradually after hatching, and HGCs disappeared 5 hours after hatching. However, the intensity of HE-positive reaction was almost at the same level at the period of HGCs'presence. (6) Artemia HGCs were distributed throughout the body of embryos at all time during their presence. Therefore, it can concluded that Artemia HGCs, as a transient type of cells, first appeared in embryos 4 hours before hatching and disappeared in embryos 5 hours after hatching, and with distinguished patterns of appearance, disappearance and

  19. De productie van Artemia-cysten, hoeksteen lokale economie in ontwikkelingslanden : ontwikkelingsmodel Tual ( Kleine Keï-eiland, Ind.)

    NARCIS (Netherlands)

    Scheerboom, J.; Leenstra, S.H.; Rothuis, A.J.

    2014-01-01

    De wereldwijde groei van de aquacultuur had een toename tot gevolg van de vraag naar cysten van Artemia (voor het voeden van larven van vissen en garnalen in een hatchery). Mondiaal worden cysten van zoutwaterkreeftje Artemia gewonnen in natuurlijke, zoute wateren. De beschikbaarheid van cysten is e

  20. Artemia Salina L. (Anostraca): uma opção para a aquicultura do Nordeste do Brasil

    OpenAIRE

    1982-01-01

    Inoculations made with cysts of Artemia salina from San Francisco Bay (California, USA) in Macau, Rio Grande do Norte, Brazil, in 1977, have dispersed this crustacean in all neighboring salt work areas. Favourable environmental conditions which have successfully contributed to this inoculation, together with suggestions for a rational utilization of similar areas for Artemia salina cultivation, are analyzed and commented.

  1. Brine shrimp Artemia in coastal saltworks: inexpensive source of food for vertically integrated aquaculture

    OpenAIRE

    Sorgeloos, P

    1983-01-01

    Proper Artemia introduction and management should lead not only to optimal salt production outputs but at the same time provide opportunities for the exploitation of valuable by-products, i.e. Artemia cysts and adult biomass as cheap sources of high quality food for intensive fish or crustacean farming.

  2. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    Directory of Open Access Journals (Sweden)

    Juan Manuel Pérez Agudelo

    2015-06-01

    Full Text Available Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20 y el grupo control fue expuesto a agua destilada (n=20 la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (Pearson para determinar la diferencia en mortalidad de los grupos.Resultados:El Grupo Control no presentó mortalidad, en tanto el Grupo Apitoxina presentó una mortalidad del 95%. Se demostró una asociación estadísticamente significativa con un p<0,05(IC: 95% entre la mortalidad de la Artemia salina y la administración de apitoxina.Conclusión:El extracto acuoso de apitoxina presenta toxicidad a una concentración de 0.35 en el modelo de Artemia salina. Palabras Clave: Apitoxina, Artemia salina, Toxicidad

  3. Artemia parthenogenetica (Branchiopoda: Anostraca) from the Large Aral Sea: Abundance, distribution, population structure and cyst production

    Science.gov (United States)

    Arashkevich, Elena G.; Sapozhnikov, P. V.; Soloviov, K. A.; Kudyshkin, T. V.; Zavialov, P. O.

    2009-03-01

    The brine shrimp Artemia parthenogenetica appeared in the Large Aral Sea (Central Asia) in 1998 when mineralization reached 63 ppt. Data on Artemia abundance and biomass, along with temperature and salinity measurements were collected in the western basin during 2002-2006, primarily in the autumn. During the study period, population density grew progressively, both in terms of number, from 250 to 1260 individuals per m 3, and in terms of biomass, from 0.3 to 1.3 g per m 3. In 2005, the population density and spatial distribution in the different parts of the sea (western and eastern basins and strait) was assessed. The horizontal distribution of the Artemia population was uniform in the deep central part of the western basin, although the distribution was quite patchy in the shallow coastal zone. Depth habitat of Artemia was restricted to the upper 20-25 m of depth, as the oxygen depletion and formation of anoxic layer prevented distribution of Artemia to the deeper waters. In autumn, all females reproduced oviparously, with an average clutch size of 30-35 eggs per female. The number of eggs in a clutch was positively correlated with female body length ( r2 = 0.36-0.44).

  4. Assessment of the production potential of an emerging Artemia population in the Aral Sea, Uzbekistan

    Science.gov (United States)

    Marden, Brad; Van Stappen, Gilbert; Musaev, Ablatdyin; Mirabdullayev, Iskandar; Joldasova, Iliya; Sorgeloos, Patrick

    2012-04-01

    The objective of this study was to provide information on the developing parthenogenetic Artemia population in the Uzbek part of the Aral Sea, and to assess its potential for commercial exploitation. A sampling campaign was designed for abiotic factors (temperature, salinity, transparency) and Artemia population parameters at least once monthly in the period March-October of the years 2005-2007. By 2007 salinity in both basins had increased to values above 100 g l - 1 . Moreover, by 2007, desiccation had rendered the eastern Aral basin practically inaccessible for sampling or cyst harvesting. The volume of the western basin remained considerable, given its depth, with a relatively accessible shoreline. Average Artemia population parameters (e.g. adult abundance Artemia sites of commercial importance. A gradual gain in population size in the western basin was observed over the period 2005-2007. The data further suggest that the low Artemia productivity is not genetically determined, but is largely the result of food limitation. The western basin may approach the threshold where a small-scale commercial operation is justified.

  5. Functional differentiation of small heat shock proteins in diapause-destined Artemia embryos.

    Science.gov (United States)

    King, Allison M; Toxopeus, Jantina; MacRae, Thomas H

    2013-10-01

    Encysted embryos of Artemia franciscana cease development and enter diapause, a state of metabolic suppression and enhanced stress tolerance. The development of diapause-destined Artemia embryos is characterized by the coordinated synthesis of the small heat shock proteins (sHsps) p26, ArHsp21 and ArHsp22, with the latter being stress inducible in adults. The amounts of sHsp mRNA and protein varied in Artemia cysts, suggesting transcriptional and translational regulation. By contrast to p26, knockdown of ArHsp21 by RNA interference had no effect on embryo development. ArHsp21 provided limited protection against stressors such as desiccation and freezing but not heat. ArHsp21 may have a non-essential or unidentified role in cysts. Injection of Artemia adults with amounts of ArHsp22 double-stranded RNA less than those used for other sHsps killed females and males, curtailing the analysis of ArHsp22 function in developing embryos and cysts. The results indicate that diapause-destined Artemia embryos synthesize varying amounts of sHsps as a result of differential gene expression and mRNA translation and also suggest that these sHsps have distinctive functions.

  6. Stress tolerance during diapause and quiescence of the brine shrimp, Artemia.

    Science.gov (United States)

    MacRae, Thomas H

    2016-01-01

    Oviparously developing embryos of the brine shrimp, Artemia, arrest at gastrulation and are released from females as cysts before entering diapause, a state of dormancy and stress tolerance. Diapause is terminated by an external signal, and growth resumes if conditions are permissible. However, if circumstances are unfavorable, cysts enter quiescence, a dormant stage that continues as long as adverse conditions persist. Artemia embryos in diapause and quiescence are remarkably resistant to environmental and physiological stressors, withstanding desiccation, cold, heat, oxidation, ultraviolet radiation, and years of anoxia at ambient temperature when fully hydrated. Cysts have adapted to stress in several ways; they are surrounded by a rigid cell wall impermeable to most chemical compounds and which functions as a shield against ultraviolet radiation. Artemia cysts contain large amounts of trehalose, a non-reducing sugar thought to preserve membranes and proteins during desiccation by replacing water molecules and/or contributing to vitrification. Late embryogenesis abundant proteins similar to those in seeds and other anhydrobiotic organisms are found in cysts, and they safeguard cell organelles and proteins during desiccation. Artemia cysts contain abundant amounts of p26, a small heat shock protein, and artemin, a ferritin homologue, both ATP-independent molecular chaperones important in stress tolerance. The evidence provided in this review supports the conclusion that it is the interplay of these protective elements that make Artemia one of the most stress tolerant of all metazoan organisms.

  7. Gamma Radiation Reduced Toxicity of Azoxystrobin Tested on Artemia franciscana.

    Science.gov (United States)

    Dvorak, P; Zdarsky, M; Benova, K; Falis, M; Tomko, M

    2016-06-01

    Fungicide azoxystrobin toxicity was monitored by means of a 96-h biotest with Artemia franciscana nauplius stages after exposure to solutions with concentrations of 0.2, 0.4, 0.6 and 0.8 mg L(-1) irradiated with (60)Co gamma radiation with doses of 1, 2.5, 5 and 10 kGy. The effects of ionization radiation on azoxystrobin toxicity were mainly manifested by a statistically significant reduction of lethality after 72- and 96-h exposure. A maximum reduction of lethality of 72 % was achieved using doses of 1-5 kGy for an azoxystrobin initial concentration of 0.4 mg L(-1) and after 72 h of exposure. At a 96-h exposure, a difference of lethal effects reached up to 70 % for a dose of 10 kGy. The observed effect of gamma ionizing radiation on azoxystrobin toxicity suggest that this approach can be applied as an alternative for a reduction of azoxystrobin residua in food.

  8. Purification and characterization of a carboxymethyl cellulase from Artemia salina.

    Science.gov (United States)

    Zin, Hyun Woo; Park, Kwang-Hyun; Choi, Tae Jin

    2014-01-03

    Brine shrimp (Artemia salina) belong to a group of crustaceans that feed on microalgae and require a cellulase enzyme that can be used in ethanol production from marine algae. Protein with potential cellulase activity was purified and the activity analyzed under different conditions. After initial identification of cellulase activity by CMC cellulase, surface sterilization and PCR using 16s rRNA primers was conducted to confirm that the cellulase activity was not produced from contaminating bacteria. The enzyme was purified by ammonium sulfate fractionation, gel filtration, and ion exchange chromatography. After the final purification, a 70-fold increase in specific enzyme activity was observed. SDS-PAGE results revealed that the cellulase enzyme had a molecular mass of 96 kDa. Temperature, pH, and salinity values were found to be optimal at 55 °C, pH 8.0, and 600 mM NaCl, respectively. Specifically, the enzyme showed a fivefold increase in enzyme activity in seawater compared to 600 mM NaCl in phosphate buffer. Further analysis of the purified enzyme by molecular spectrometry showed no match to known cellulases, indicating this enzyme could be a novel halophilic cellulase that can be used for the production of bioethanol from marine macroalgae.

  9. Acute toxicity of TBT and IRGAROL in Artemia salina.

    Science.gov (United States)

    Panagoula, Bakoulia; Panayiota, Marcouli; Iliopoulou-Georgudaki, Joan

    2002-01-01

    A 24-hour LC(50) bioassay method was carried out to study acute toxicity of Tributyltin (TBT) and IRGAROL (C(11)H(19)N(5)S) in Artemia salina. Five graded levels of both biocides were tested. According to the range test, the doses of TBT were 11.6 ng x l(-1), 21.0 ng x l(-1), 37.3 ng x l(-1), 65.2 ng x l(-1), and 116.5 ng x l(-1), and for IRGAROL were 1.0 mg x l(-1), 1.8 mg x l(-1), 3.2 mg x l(-1), 5.6 mg x l(-1), and 10 mg x l(-1). The determined LC(50) values were 41.41 ng x l(-1) and 1.62 mg x l(-1) respectively. These results indicate that in this system TBT is acutely more toxic than IRGAROL; however, both are proven environmentally toxic substances.

  10. Cyanobacterial cytotoxicity versus toxicity to brine shrimp Artemia salina.

    Science.gov (United States)

    Hisem, Daniel; Hrouzek, Pavel; Tomek, Petr; Tomšíčková, Jana; Zapomělová, Eliška; Skácelová, Kateřina; Lukešová, Alena; Kopecký, Jiří

    2011-01-01

    Heterocytous cyanobacteria from various habitats were screened for toxicity to brine shrimp Artemia salina and the murine lymphoblastic cell line Sp/2 in order to compare these two testing models for evaluation of risk posed by cyanobacteria to human health. Methanol extracts of biomass and cultivation media were tested for toxicity and selected extracts were fractionated to determine the active fraction. We found a significant toxic effect to A. salina and to Sp/2 cells in 5.2% and 31% of studied extracts, respectively. Only 8.6% of the tested strains were highly toxic to both A. salina and the Sp/2 cell line, and only two of the tested strains were toxic to A. salina and not to the murine cell line. Therefore, it is likely that the toxic effect of cyanobacterial secondary metabolites mostly targets basal metabolic pathways present in mammal cells and so is not manifested in A. salina. We conclude that it is insufficient to monitor cytotoxicity of cyanobacteria using only the brine shrimp bioassay as was usual in the past, since cytotoxicity is a more frequent feature in cyanobacteria in comparison with toxicity to A. salina. A. salina toxicity test should not be used when estimating the possible health risk for humans. We suggest that in vitro mammal cells be used for these purposes.

  11. Variation in fatty acid composition of Artemia salina nauplii enriched with microalgae and baker's yeast for use in larviculture.

    Science.gov (United States)

    Chakraborty, Rekha D; Chakraborty, Kajal; Radhakrishnan, E V

    2007-05-16

    The high content of the essential fatty acids in some microalgae and baker's yeast has made them excellent diets for boosting the fatty acid content of livefood Artemia. The influences of baker's yeast (Saccharomyces cerevisiae) and three microalgae, viz., Chlorella salina, Chaetoceros calcitrans, and Nannochloropsis salina, were tested as diet components in marine livefeed brine shrimp Artemia salina nauplii to improve the polyunsaturated fatty acid (PUFA) composition. Artemia nauplii submerged in these diets for four different enrichment intervals (3, 6, 8, and 24 h) were found to incorporate essential fatty acids, and the percentage composition of different fatty acids was measured in the enriched Artemia nauplii and enrichment diets. N. salina produced higher levels of arachidonic acid (AA, 20:4n6, 9.50%), eicosapentaenoic acid (EPA, 20:5n3, 25.80%), and docosahexaenoic acid (DHA, 22:6n3, 4.18%) as compared to other diets. The total PUFA content of the enriched Artemia by N. salina increased by 56.50% with enrichment periods up to 8 h, followed by a significant reduction in the final 24 h. N. salina yielded Artemia nauplii with considerable EPA (8.05%), AA (14.15%), and DHA (1.85%) after 8 h of enrichment, which are significantly higher levels than in nauplii fed with the other three diets (p = 0.05). The DHA/EPA values in Artemia enriched for 6 h by N. salina and C. calcitrans were found to be, respectively, 88.46 and 25% higher than freshly hatched Artemia. Artemia enriched by C. salina and baker's yeast exhibited a reduction in PUFA content even at 6 h of enrichment. Significant relative decreases in DHA, EPA, and total PUFA in Artemia enriched with all of the diets were apparent, with a corresponding increase in the total saturated fatty acid content (26.95 +/- 9.75%) in the final stages (24 h) of enrichment (p = 0.05).

  12. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2008-01-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading...... to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa......) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate...

  13. 黄粉虫Tenebrio molitor Linnaeus的生物学特性

    Institute of Scientific and Technical Information of China (English)

    白福祥; 李玲; 金志民; 郑丽波

    2004-01-01

    黄粉虫(Tenebrio molitor Linnaeus),在昆虫分类学中属于鞘翅目,拟步行甲科,粉甲属,又名面包虫,世界各地均有分布.黄粉虫原产于南美洲,约有100年的饲养历史,我国在20世纪50年代,由北京动物园从苏联引进饲养,以后传播至全国各地.其幼虫、蛹和成虫都含有丰富的蛋白质和多种

  14. Intracellular survival of Staphylococcus aureus during persistent infection in the insect Tenebrio molitor.

    Science.gov (United States)

    McGonigle, John E; Purves, Joanne; Rolff, Jens

    2016-06-01

    Survival of bacteria within host cells and tissues presents a challenge to the immune systems of higher organisms. Escape from phagocytic immune cells compounds this issue, as immune cells become potential vehicles for pathogen dissemination. However, the duration of persistence within phagocytes and its contribution to pathogen load has yet to be determined. We investigate the immunological significance of intracellular persistence within the insect model Tenebrio molitor, assessing the extent, duration and location of bacterial recovery during a persistent infection. Relative abundance of Staphylococcus aureus in both intracellular and extracellular fractions was determined over 21 days, and live S. aureus were successfully recovered from both the hemolymph and within phagocytic immune cells across the entire time course. The proportion of bacteria recovered from within phagocytes also increased over time. Our results show that to accurately estimate pathogen load it is vital to account for bacteria persisting within immune cells.

  15. Endocrine disruption of sexual selection by an estrogenic herbicide in the mealworm beetle (Tenebrio molitor).

    Science.gov (United States)

    McCallum, Malcolm L; Matlock, Makensey; Treas, Justin; Safi, Barroq; Sanson, Wendy; McCallum, Jamie L

    2013-12-01

    The role that endocrine disruption could play in sexual selection remains relatively untested, and although estrogens occur in insects, little information exists about their biological role in insect reproduction. Atrazine is a commonly applied herbicide that mimics estrogen in vertebrates. Tenebrio molitor were raised from egg to adult under a gradation of environmentally relevant atrazine exposures and a non-treated control. Atrazine was delivered in the drinking water ad libitum. Female T. molitor were provided with a choice between unrelated males raised under three levels of atrazine exposures. Female preference for males demonstrated a non-monotonic inverted U-shaped response to atrazine exposure. There was no significant difference between the control and the high exposure to atrazine. Excluding the control, female preference increased as exposure concentration increased. These results have important repercussions for nonlethal effects of endocrine disruption on populations, their capacity to interfere with sexual selection, and the role of estrogen in pheromone communication among insects.

  16. Effects of weak electromagnetic irradiation on various types of behavior in the mealworm Tenebrio molitor.

    Science.gov (United States)

    Sheiman, I M; Kreshchenko, N D

    2010-10-01

    The effects of weak electromagnetic irradiation on simple forms of behavior were studied using adult Tenebrio molitor mealworms. The beetles' motor behavior was studied in conditions of different motivations, i.e., positive (food) and negative (avoidance of light), in otherwise identical experimental conditions. The beetles had to navigate a defined space to reach their target - potato or cover from light. Experiments consisted of one trial per day for five days. Target attainment time was measured in groups of beetles. Behavior in both cases developed as follows: an initial orientation reaction appeared and was followed by adaptation to the apparatus. Exposure to weak electromagnetic irradiation led to increases in the response time at the initial stages of the experiments. The effects of irradiation were seasonal in nature and differed in the two types of behavior.

  17. Identification of candidate chemosensory genes in the antennal transcriptome of Tenebrio molitor (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Liu, Su; Rao, Xiang-Jun; Li, Mao-Ye; Feng, Ming-Feng; He, Meng-Zhu; Li, Shi-Guang

    2015-03-01

    We present the first antennal transcriptome sequencing information for the yellow mealworm beetle, Tenebrio molitor (Coleoptera: Tenebrionidae). Analysis of the transcriptome dataset obtained 52,216,616 clean reads, from which 35,363 unigenes were assembled. Of these, 18,820 unigenes showed significant similarity (E-value molitor OBPs and CSPs are closely related to those of T. castaneum. Real-time quantitative PCR assays showed that eight TmolOBP genes were antennae-specific. Of these, TmolOBP5, TmolOBP7 and TmolOBP16 were found to be predominantly expressed in male antennae, while TmolOBP17 was expressed mainly in the legs of males. Several other genes were identified that were neither tissue-specific nor sex-specific. These results establish a firm foundation for future studies of the chemosensory genes in T. molitor.

  18. Previous encapsulation response enhances within individual protection against fungal parasite in the mealworm beetle Tenebrio molitor.

    Science.gov (United States)

    Krams, Indrikis; Daukste, Janina; Kivleniece, Inese; Krama, Tatjana; Rantala, Markus J

    2013-12-01

    Immune defenses of insects show either broad reactions or specificity and durability of induced protection against attacking parasites and pathogens. In this study, we tested whether encapsulation response against nylon monofilament increases between two attempts of activation of immune system in mealworm beetles Tenebrio molitor, and whether previous exposure to nylon monofilament may also increase protection against an entomopathogenic fungus. We found that survival of beetles subjected to immune activation by nylon implant and subsequent fungal exposure a week later was significantly higher than survival of beetles which had been subjected to fungal infection only. This result suggests that previous immune activation by the nylon implant may be considered as broad spectrum "immune priming" which helps to fight not only the same intruder but also other parasites.

  19. Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.

    Science.gov (United States)

    Yue, Chang-Wu; Zhang, Yi-Zheng

    2009-03-01

    A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.

  20. [Modulating effect of weak combined magnetic fields on duration of mealworm beetle Tenebrio molitor metamorphosis stage].

    Science.gov (United States)

    Novikov, V V; Sheĭman, I M; Iablokova, E V; Fesenko, E E

    2014-01-01

    It is shown that an exposure of pupae of the mealworm beetle Tenebrio molitor to the combined static (42 μT) and very weak alternating (250 nT) magnetic fields exerts different influence, depending on the frequency of the alternating magnetic field, on duration of metamorphosis processes in these insects. For instance, an exposure of pupae to weak combined magnetic fields, adjusted to the frequency of ion cyclotron resonance for glutaminic acid (4,4 Hz), stimulates metamorphosis process--a transitional stage from pupae to imago lasts shorter. An inhibiting effect was observed when adjusted to the frequency of ion cyclotron resonance for Ca2 (32,2 Hz). At some frequencies this effect is not seen. For instance, an exposure at a frequency of ion cyclotron resonance for K+ (16,5 Hz) exerts no noticeable effect on the duration of the pupal metamorphosis stage.

  1. The Effect of Tenebrio obscurus on Elementary Preservice Teachers' Content Knowledge, Attitudes, and Self-efficacy

    Science.gov (United States)

    Weinburgh, Molly

    2007-12-01

    This study explores the extent to which an activity used in an elementary science methods course affected the preservice teachers’ content knowledge, attitudes, and self-efficacy. The participants were 172 students enrolled in five sections of elementary science methods. Students participated in a 9-week investigation on life cycles using mealworms ( Tenebrio obscurus). Multiple data sources indicate that most of the students had limited prior content knowledge about mealworms, expressed neutral attitudes toward mealworms upon first exposure to them, and were uncomfortable with the idea of having to teach with and about them. At the end of 9 weeks, content knowledge on mealworms had greatly improved. The preservice teachers’ attitudes about mealworms and their self-efficacy about using mealworms with children had also improved.

  2. Cestodes change the isotopic signature of brine shrimp, Artemia, hosts: implications for aquatic food webs.

    Science.gov (United States)

    Sánchez, Marta I; Varo, Nico; Matesanz, Cristina; Ramo, Cristina; Amat, Juan A; Green, Andy J

    2013-01-01

    To reach the final host (greater flamingos), the cestode Flamingolepis liguloides alters the behaviour of its intermediate host, the brine shrimp, Artemia parthenogenetica, causing it to spend more time close to the water surface. During summer 2010, we showed that the prevalence of this cestode was consistently higher at the top of the water column in the Odiel salt pans in south-western Spain. We used stable nitrogen (N) and carbon (C) isotopic analysis to test the hypothesis that cestodes also alter resource use by Artemia. In early summer, we compared stable isotopes in infected hosts at the surface with those from uninfected hosts at the bottom of the water column. In late summer, we compared infected and uninfected Artemia from the bottom. δ(15)N was consistently enriched in infected individuals compared with uninfected hosts, especially in Artemia with multiple infections of F. liguloides (family Hymenolepididae) and those with mixed infections of F. liguloides and cestodes of the family Dilepididae. Infected individuals from the surface were enriched in δ(13)C compared with uninfected ones from the bottom, but the opposite was found when comparing uninfected and infected Artemia from the same depth. This may be caused by the increase in lipid concentration in infected Artemia. Isolated cysticercoids of F. liguloides were significantly enriched in δ(13)C compared with cysticercoids in infected hosts, but surprisingly were not enriched in N. Our findings illustrate the way cestodes can alter food webs and highlight the importance of considering the parasitic status of prey in studies of trophic ecology in saline wetlands.

  3. Environmental gradients structure Daphnia pulex × pulicaria clonal distribution.

    Science.gov (United States)

    Pantel, J H; Juenger, T E; Leibold, M A

    2011-04-01

    The rarity of eukaryotic asexual reproduction is frequently attributed to the disadvantage of reduced genetic variation relative to sexual reproduction. However, parthenogenetic lineages that evolved repeatedly from sexual ancestors can generate regional pools of phenotypically diverse clones. Various theories to explain the maintenance of this genetic diversity as a result of environmental and spatial heterogeneity [frozen niche variation (FNV), general-purpose genotype] are conceptually similar to community ecological explanations for the maintenance of regional species diversity. We employed multivariate statistics common in community ecological research to study population genetic structure in the freshwater crustacean, Daphnia pulex × pulicaria. This parthenogenetic hybrid arose repeatedly from sexual ancestors. Daphnia pulex × pulicaria populations harboured substantial genetic variation among populations and the clonal composition at each pond corresponded to nutrient levels and invertebrate predator densities. The interclonal selection process described by the FNV hypothesis likely structured our D. pulex × pulicaria populations.

  4. Ecotoxicological testing of gas oils (daphnia magna test)

    Energy Technology Data Exchange (ETDEWEB)

    Altmann, B.R.; Mueller, J.; Wenzel, A.; Hensel, R.

    2002-02-01

    The Water Accomodated Fractions WAF of 4 diesel fuels no. 2 and 4 domestic heating fuels no. 2 of differing origin were analysed on their effect on the mobility of the freshwater crustacean Daphnia Magna. Five loadings per test substance were tested. After an exposition period of 24 h a relationship between loading rates of the WAF and immobility was found for 3 samples, while after 48 h this was observed for all samples. WAF-generation and gas oil data were documented. (orig.) [German] Von 4 Dieselkraftstoff-Gasoelen und 4 Heizoel-Gasoelen EL wurden die Water Accomodated Fractions WAF auf ihre immobilisierende Wirkung auf den Wasserfloh Daphnia Magna untersucht. Von jeder Probe wurden fuenf unterschiedliche Dosierraten geprueft. Nach einer Expositionszeit von 24 Stunden zeigte sich bei 3 Proben und nach 48 Stunden bei allen Proben eine Beziehung zwischen der Dosierrate der Probe und der Immobilitaet. Die Herstellung der WAF und die Daten der Gasoele wurden dokumentiert. (orig.)

  5. First record of Daphnia lumholtzi Sars in the Great Lakes

    Science.gov (United States)

    Muzinic, Christopher J.

    2000-01-01

    Adults of the cladoceran Daphnia lumholtzi, native to Australia, Africa, and parts of Asia, were first collected in August 1999 in Lake Erie. Individuals were collected near East Harbor State Park, Lakeside, Ohio from vertical plankton net tows. The average number of D. lumholtzi that were found (0.03/L) indicate that D. lumholtzi is beginning to establish itself in Lake Erie. The morphology of this Daphnia differs greatly from native species because of its elongated head and tail spine. This sighting is important because it acknowledges yet another exotic invader into the Great Lakes basin and it also shows that this, normally, warm water species continues to expand its range northward.

  6. TÓXICIDAD DE LA APITOXINA EN UN MODELO DE Artemia salina

    OpenAIRE

    Juan Manuel Pérez Agudelo; Juan Felipe Salazar Espinosa; Jorge Hernán Hernández Guevara

    2015-01-01

    Objetivo:Determinar la toxicidad del extracto acuoso de Apitoxina mediante bioprospección en el modelo de Artemia salina. Materiales y métodos: Previo montaje de Biorreactor, un grupo fue expuesto al extracto acuoso de Apitoxina (n=20) y el grupo control fue expuesto a agua destilada (n=20) la toxicidad se definió por la muerte de la Artemia salina a las 24 horas de administración del extracto. Se realizó análisis estadístico no paramétrico mediante la prueba de Chi cuadrado de homogeneidad (...

  7. Demographic responses of Daphnia magna fed transgenic Bt-maize

    OpenAIRE

    2009-01-01

    The food/feed quality of a variety of genetically modified (GM) maize expressing Cry1Ab Bt-toxin was tested over the life-cycle of Daphnia magna, an arthropod commonly used as model organism in ecotoxicological studies. Demographic responses were compared between animals fed GM or unmodified (UM) near isogenic maize, with and without the addition of predator smell. Age-specific data on survival and birth rates were integrated and analysed using life tables and Leslie matrices. Survival, fecun...

  8. Fertilizers for Daphnia sp. (Crustacea, Cladocera) production in experimental tanks

    OpenAIRE

    Cunha, Patrícia de Souza Lima; Lanna,Eduardo Arruda Teixeira; Bastos,Rafael Kopschitz Xavier; Quadros,Moisés; Rezende,Fabrício Pereira; Freitas,Leandro Monteiro de

    2010-01-01

    The current study was aimed at investigating the use of different fertilizers - dicalcium phosphate, biosolid and quail feces - as a strategy for water fertilization in Daphnia sp production. It was used twenty-four 100-L tanks of asbestos cement distributed in a completely randomized split-plot design with six replicates, with plots in the three kinds of fertilizers (biosolid, dicalcium phosphate, and quail feces) and a control without fertilization (WF) and subplots at the times of assessme...

  9. Development of a Chronic Toxicity Testing Method for Daphnia pulex

    Science.gov (United States)

    2015-08-01

    handling (Lewis 1985). Both acute and chronic Daphnia exposures have been used to determine the short-term toxicity of many aquatic contaminants, and...sublethal effects. Vincon vinyl clear tubing (1/4 in. inside diameter) (Pentair Aquatic Ecosystems, Part # TP30, Apopka, FL) was used to siphon the D...pipette. Exercise care not to damage the organism by minimizing turbulence. When transferring the organism to the fresh beaker, the tip ERDC/EL SR

  10. Cloning,sequencing and prokaryotic expression of cDNAs for antifreeze protein family from Beetle Tenebrio molitor

    Institute of Scientific and Technical Information of China (English)

    Zhongyuan LIU; Yun WANG; Guodong LU; Xianlei WANG; Fuchun ZHANG; Ji MA

    2008-01-01

    Partial cDNA sequences coding for antifreeze proteins in Tenebrio molitor were obtained by RT-PCR.Sequence analysis revealed nine putative cDNAs with a high degree of homology to Tenebrio molitor antifreeze protein genes published in GenBank.The recombinant pGEX-4T-l-tmafp-XJ430 was introduced into E.coli BL21 to induce a GST fusion protein by IPTG.SDS-PAGE analysis for the fusion protein shows a band of 38 kDa.pCDNA3- tmafp-XJ430 was injected into mice to generate antiserum which was later detected by indirect ELISA.The titer of the antibody was 1:2000.Western blot-ting analysis shows that the antiserum was specifically against the antifreeze protein.Our results laid the founda-tion for further studies on the properties and functions of insect antifreeze proteins.

  11. Is there a relationship between insect metabolic rate and mortality of mealworms Tenebrio molitor L. after insecticide exposure?

    Directory of Open Access Journals (Sweden)

    Justyna MALISZEWSKA

    2016-09-01

    Full Text Available Pesticides are known to affect insects metabolic rate and CO2 release patterns. In the presented paper metabolic rate and mortality of mealworms Tenebrio molitor L. exposed to four different insecticides was evaluated, to find out whether there is a relationship between mealworms sensitivity to pesticides and their metabolic rate. Tenebrio molitor mortality was determined after intoxication with pyrethroid, oxadiazine, neonicotinoid and organophosphate. Metabolic rate before and after intoxication with insecticides was also determined. The highest CO2 production and mortality rate was observed after mealworms exposition to neonicotinoid insecticide. The results suggest that high CO2 release after intoxication is adequate to the intensity of the non-specific action of the xenobiotic (e.g. hyperactivity of neuromuscular system, rather than the intensity of detoxification processes, and it is correlated with mealworms mortality.

  12. Toxicity Evaluation of Wastewater Treatment Plant Effluents Using Daphnia magna

    Directory of Open Access Journals (Sweden)

    H Movahedian, B Bina, GH Asghari

    2005-04-01

    Full Text Available Toxicity evaluation is an important parameter in wastewater quality monitoring as it provides the complete response of test organisms to all compounds in wastewater. The water flea Daphnia magna straus is the most commonly used zooplankton in toxicological tests. The objective of this study was to evaluate the acute toxicity of effluents from different units of Isfahan Wastewater Treatment Plant (IWTP. The samples were taken from four different physical and biological units. The acute toxicity tests were determined using Daphnia magna. The immobility of Daphnia was determined after 48h. Toxicity results showed that 48h-LC50 and ATU values for raw wastewater were 30% (v/v and 3.33, respectively. It was also found that LC50 values after 48 h for preliminary, primary, and secondary effluents were 32%, 52% and 85% (v/v, respectively. The ATU values for these effluents were 3.1, 1.9, and 1.8, correspondingly. The efficiency levels of preliminary, primary, and secondary units for removal of toxicity were found as 6%, 38.9% and 8%, in that order. Overall, the present investigation indicated that toxicity removal by up to 50% might be achieved in IWPT. Based on the obtained results and regarding the improvement of water quality standards, coupled with public expectations in Iran, it is necessary to consider more stringent water quality policies for regular monitoring and toxicity assessment.

  13. Thermal variation and factors influencing vertical migration behavior in Daphnia populations.

    Science.gov (United States)

    Glaholt, Stephen P; Kennedy, Meghan L; Turner, Elizabeth; Colbourne, John K; Shaw, Joseph R

    2016-08-01

    The antipredator behavior diel vertical migration (DVM), common in aquatic keystone species Daphnia, involves daily migration from warmer surface waters before dawn to cooler deeper waters after dusk. Plasticity in Daphnia DVM behavior optimizes fitness via trade-offs between growth, reproduction, and predator avoidance. Migration behavior is affected by co-varying biotic and abiotic factors, including light, predator cues, and anthropogenic stressors making it difficult to determine each factor's individual contribution to the variation in this behavior. This study aims to better understand this ecologically significant behavior in Daphnia by: (1) determining how Daphnia pulicaria thermal preferences vary within and among natural populations; (2) distinguishing the role of temperature verses depth in Daphnia vertical migration; and (3) defining how two anthropogenic stressors (copper and nickel) impact Daphnia migratory behavior. Simulated natural lake stratification were constructed in 8L (0.5m tall, 14.5cm wide) water columns to monitor under controlled laboratory conditions the individual effects of temperature gradients, depth, and metal stressors on Daphnia vertical migration. Three major findings are reported. First, while no difference in thermal preference was found among the four populations studied, within lake populations variability among isolates was high. Second, decoupling temperature and depth revealed that depth was a better predictor of Daphnia migratory patterns over temperature. Third, exposure to environmentally relevant concentrations of copper or nickel inhibited classic DVM behavior. These findings revealed the high variability in thermal preference found within Daphnia populations, elucidated the individual roles that depth and temperature have on migratory behavior, and showed how copper and nickel can interfere with the natural response of Daphnia to fish predator cues. Thus contributing to the body of knowledge necessary to predict how

  14. Contrasting life history responses to fish released infochemicals of two co-occurring Daphnia species that show different migration behaviour

    NARCIS (Netherlands)

    Vijverberg, J.; Doksaeter, A.; Van Donk, E.

    2006-01-01

    In a previous field study (Flik & Vijverberg 2003) we showed that in an oligotrophic-mesotrophic lake in the Netherlands (L. Maarsseveen) two co-occurring Daphnia species, Daphnia pulicaria and Daphnia galeata × hyalina performed distinct vertical migration behaviour during summer which is induced b

  15. In vitro crude protein digestibility of Tenebrio molitor and Hermetia illucens insect meals and its correlation with chemical composition traits

    Directory of Open Access Journals (Sweden)

    Stefania Marono

    2015-07-01

    Full Text Available The aims of this study were to evaluate the correlation between in vitro crude protein digestibility coefficients of insect meals from Tenebrio molitor (TI and Hermetia illucens (HI and their chemical composition traits as well as to develop regression equations able to estimate the in vitro crude protein digestibility (CPd from proximate analysis of insect meals. Twelve samples of insect meals (6 from TM larvae, TM 1-6 and 6 from HI larvae, HI 1-6 were obtained from different producers and analysed for chemical composition and in vitro crude protein digestibility by a two-step enzymatic method (digestion with pepsin and trypsin-enriched pancreatin. For both insect meal samples, CPd was negatively correlated to ADF and chitin contents, while just for HI there was a positive correlation (P<0.01 between CP percentage of the samples and CPd. For both insect meals the former variable chosen in the stepwise analysis was the chitin, explaining the 79.45% of CPd variability for Tenebrio molitor samples and the 98.30% for Hermetia illucens. In the second step, the amount of protein linked to ADF was added in the model for T. molitor and CP for H. illucens samples. The coefficients chitin is the main constituent of insect body able to affect the crude protein digestibility of Tenebrio molitor and Hermetia illucens larvae meals estimated by an in vitro enzymatic method.

  16. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Tingjun Fan; Zhao Jing; Xianyuan Fan; Miaomiao Yu; Guojian Jiang

    2011-01-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ionexchange chromatography,and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate.Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass.The optimal pH value and temperature are 7.0 and 50℃,respectively,for its PO activity.The AsPO had an apparent Km value of 4.2 mM on L-DOPA,and 10.9 mM on catechol,respectively.Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid,sodium sulfite,and citric acid; and was very sensitive to cysteine,benzoic acid,and l-phenyl-2-thiourea.Combined with its specific enzyme activity on L-DOPA and catechol,it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase.Its PO activity was also sensitive to metal ions and chelators,and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu2+,indicating that AsPO is most probably a copper-containing metalloenzyme.All these data about specific substrate,sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing Odiphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  17. Iron metallodrugs: stability, redox activity and toxicity against Artemia salina.

    Science.gov (United States)

    Vitorino, Hector Aguilar; Mantovanelli, Luca; Zanotto, Flavia Pinheiro; Espósito, Breno Pannia

    2015-01-01

    Iron metallodrugs comprise mineral supplements, anti-hypertensive agents and, more recently, magnetic nanomaterials, with both therapeutic and diagnostic roles. As biologically-active metal compounds, concern has been raised regarding the impact of these compounds when emitted to the environment and associated ecotoxicological effects for the fauna. In this work we assessed the relative stability of several iron compounds (supplements based on glucoheptonate, dextran or glycinate, as well as 3,5,5-trimethylhexanoyl (TMH) derivatives of ferrocene) against high affinity models of biological binding, calcein and aprotransferrin, via a fluorimetric method. Also, the redox-activity of each compound was determined in a physiologically relevant medium. Toxicity toward Artemia salina at different developmental stages was measured, as well as the amount of lipid peroxidation. Our results show that polymer-coated iron metallodrugs are stable, non-redox-active and non-toxic at the concentrations studied (up to 300 µM). However, TMH derivatives of ferrocene were less stable and more redox-active than the parent compound, and TMH-ferrocene displayed toxicity and lipid peroxidation to A. salina, unlike the other compounds. Our results indicate that iron metallodrugs based on polymer coating do not present direct toxicity at low levels of emission; however other iron species (eg. metallocenes), may be deleterious for aquatic organisms. We suggest that ecotoxicity depends more on metal speciation than on the total amount of metal present in the metallodrugs. Future studies with discarded metallodrugs should consider the chemical speciation of the metal present in the composition of the drug.

  18. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica.

    Science.gov (United States)

    Fan, Tingjun; Jing, Zhao; Fan, Xianyuan; Yu, Miaomiao; Jiang, Guojian

    2011-09-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ion-exchange chromatography, and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate. Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass. The optimal pH value and temperature are 7.0 and 50°C, respectively, for its PO activity. The AsPO had an apparent K(m) value of 4.2 mM on L-DOPA, and 10.9 mM on catechol, respectively. Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid, sodium sulfite, and citric acid; and was very sensitive to cysteine, benzoic acid, and 1-phenyl-2-thiourea. Combined with its specific enzyme activity on L-DOPA and catechol, it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase. Its PO activity was also sensitive to metal ions and chelators, and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu(2+), indicating that AsPO is most probably a copper-containing metalloenzyme. All these data about specific substrate, sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing O-diphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  19. Therapeutic effect of Artemia enriched with Escherichia coli expressing double-stranded RNA in the black tiger shrimp Penaeus monodon.

    Science.gov (United States)

    Thammasorn, Thitiporn; Somchai, Parinyachat; Laosutthipong, Chaowanee; Jitrakorn, Sarocha; Wongtripop, Somjai; Thitamadee, Siripong; Withyachumnarnkul, Boonsirm; Saksmerprome, Vanvimon

    2013-10-01

    We exploited Artemia as a double-stranded (ds)RNA-delivery system to combat viral diseases in shrimp. First, the transformed Escherichia coli (E. coli) expressing red fluorescent protein (RFP) was tested in the Artemia enrichment process. RFP signals detectable in the gut of Artemia under confocal microscope were evident for the successful encapsulation. Second, the Artemia enrichment process was performed using E. coli producing Laem-Singh virus (LSNV)-specific dsRNA, which has been previously shown to inhibit the viral infection in the black tiger shrimp Penaeus monodon by intramuscular injection and oral administration. The enriched Artemia nauplii were confirmed to contain dsRNA-LSNV by RT-PCR, and were subjected to the feeding test with P. monodon postlarvae. Quantitative RT-PCR indicated that a number of LSNV copies in most of the treated shrimp were, at least, 1000-fold lower than the untreated controls. During 11-17weeks after feeding, average body weight of the treated group was markedly increased relative to the control group. A smaller differential growth rate of the treated group as compared to the control was also noticed. These results suggested that feeding shrimp with the dsRNA-enriched Artemia can eliminate LSNV infection, which is the cause of retarded growth in P. monodon. The present study reveals for the first time the therapeutic effect of dsRNA-enriched Artemia for shrimp disease control.

  20. Survival of the probiotic bacteria Lactobacillus rhamnosus in seawater and its bioencapsulation in the brine shrimp Artemia

    Directory of Open Access Journals (Sweden)

    Claudia Ofelio

    2014-06-01

    The results obtained in the first test showed that the L. rhamnosus was able to survive in seawater during the whole experiment (30h, maintaining densities of 10e7 CFU/ml during the first 6h although decreasing progressively afterwards (10e3 CFU/ml at 30h. This allows adequate levels at sufficient time for Artemia to incorporate the probiotic. In fact, bioencapsulation test demonstrated that Artemia metanauplii were able to bioencapsulate the probiotic, reaching the highest concentration in Artemia after 30 min of bioencapsulation (10e4 CFU/Artemia. A slight further decrease (10e3 CFU/Artemia was observed after 24h. Interestingly, L. rhamnosus reduced in 1Log total Vibrionaceae bacteria in Artemia during the 3 first hours. Therefore, 3 hours was the time established for the bioencapsulation protocol and further studies are in progress to determine the ability of Artemia metanauplii to maintain bioencapsulated L. rhamnosus once transferred to rearing tanks. Also, the capability of the probiotic to inhibit potential pathogenic or opportunistic bacteria will be assessed.

  1. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina Chemometric studies of pheo formulated in pluronics®: photodynamic action against Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  2. Predator-released compounds, ambient temperature and competitive exclusion among differently sized Daphnia species

    NARCIS (Netherlands)

    Vijverberg, J.; Vos, Matthijs

    2006-01-01

    1. We studied the effects of fish water and temperature on mechanisms of competitive exclusion among two Daphnia species in flow-through microcosms. The large-bodied D. pulicaria outcompeted the medium sized D. galeata × hyalina in fish water, but not in the control treatment. Daphnia galeata × hyal

  3. A spontaneous mutant of microcystin biosynthesis: genetic characterization and effect on Daphnia

    DEFF Research Database (Denmark)

    Kabernick, M.; Rohrlack, T.; Christoffersen, K.

    2001-01-01

    . Regardless of microcystin content, both Daphnia exhibited significantly reduced ingestion rates when fed with either strain of M. aeruginosa compared with the green alga Scenedesmus acutus. A disruption of the molting process in both Daphnia spp. was noted when these species were fed with MRC cells...

  4. Life-history consequences for Daphnia pulex exposed to pharmaceutical carbamazepine

    NARCIS (Netherlands)

    Lürling, M.F.L.L.W.; Sargant, E.M.; Roessink, I.

    2006-01-01

    The effects of the antiepileptic, analgesic drug carbamazepine on the growth, morphology, and life-history characteristics of Daphnia pulex were examined at nominal concentrations of 0, 0.1, 1, 10, 100, and 200 mu g L-1. At 1 mu g carbamazepine L-1, Daphnia matured and reproduced slightly earlier th

  5. Making the Most of the "Daphnia" Heart Rate Lab: Optimizing the Use of Ethanol, Nicotine & Caffeine

    Science.gov (United States)

    Corotto, Frank; Ceballos, Darrel; Lee, Adam; Vinson, Lindsey

    2010-01-01

    Students commonly test the effects of chemical agents on the heart rate of the crustacean "Daphnia" magna, but the procedure has never been optimized. We determined the effects of three concentrations of ethanol, nicotine, and caffeine and of a control solution on heart rate in "Daphnia." Ethanol at 5% and 10% (v/v) reduced mean heart rate to…

  6. Effect of artificial regulations of Artemia n-3 HUFA content on growth and survival of black seabream ( Sparus macrocephalus) larvae

    Science.gov (United States)

    Liu, Jing-Ke

    1998-06-01

    The requirement for dietary n-3 HUFA (highly unsaturated fatty acid) for growth and survival of black seabream ( Sparus macrocephalus) larvae was tested using Artemia with various levels of n-3 HUFA. Four treatments with Artemia differing in their n-3 HUFA were prepared by feeding them various oil emulsions. The results indicated that dietary n-3 HUFA significantly influences fish n-3 HUFA levels and are necessary for good growth and survival of black seabream larvae. The proper value of n-3 HUFA level and DHA, EPA level in Artemia should be 4.273% and 0.873% (wet weight) for good growth and survival in black seabream larvae respectively.

  7. Global biodiversity and geographical distribution of diapausing aquatic invertebrates: the case of the cosmopolitan brine shrimp, Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Pacios, Fernando

    2010-01-01

    and geographic information. Our results indicate there are three Artemia complexes, A. franciscana, A. tibetiana and A. salina, suggesting at least three undescribed, and one unidentified to date, highly isolated lineages, to be re-evaluated taxonomically. Additionally, at a global scale, our data set shows two......The genus Artemia comprises passively dispersed anostracan species with a distribution all around the world, except in Antarctica. We used both published and personal data to assess and update existing knowledge on the diversity and distribution of Artemia, in particular compiling also genetic...

  8. Phylogenetic Analysis of Brine Shrimp (Artemia) in China Using DNA Barcoding

    Institute of Scientific and Technical Information of China (English)

    Weiwei Wang; Jun Yu; Qibin Luo; Haiyan Guo; Peter Bossier; Gilbert Van Stappen; Patrick Sorgeloos; Naihong Xin; Qishi Sun; Songnian Hu

    2008-01-01

    DNA barcoding is a powerful approach for characterizing species of organisms,especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China.Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  9. Potential utilization of Artemia franciscana eggs as food for Coleomegilla maculata

    Science.gov (United States)

    We tested the hypothesis that Artemia franciscana Kellogg (brine shrimp, Anostraca: Artemiidae) eggs are suitable factitious, i.e., alternative, food to support the life history of a predatory ladybird beetle, Coleomegilla maculata DeGeer (Coleoptera: Coccinellidae). Using progeny from a stock colo...

  10. Biomass production of Artemia in air-water-lift raceway system

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Vijayaraghavan, S.; Krishnakumari, L.

    system is fairly simple. Advantages ofculturing Artemia in raceways are many; different stages of Arternia such as nauplii, pre-adults and adults produced can be used for hatcheries and pet fishery market either in live fonn/frozen or freeze-dried fonn...

  11. Mass marking of Leuciscus idus larvae using Artemia salina as a vector of fluorescent dyes.

    Science.gov (United States)

    Stańczak, K; Krejszeff, S; Dębowska, M; Mierzejewska, K; Woźniak, M; Hliwa, P

    2015-09-01

    A method for the mass marking of ide Leuciscus idus larvae by feeding them Artemia salina nauplii that were immersed in different solutions of alizarin red S, tetracycline hydrochloride and calcein was tested. The best quality marks were obtained after feeding fish for 4 days with nauplii that had been immersed in 200 mg l(-1) alizarin red S.

  12. Assessment of cyst production potential of a natural population of brine shrimp Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Studies on a natural population of Artemia in the salterns of Jamnagar indicated that the population is parthenogenetic. These shrimps reach a maximum size of 9 mm. Number of cysts per brood varies from 10-32. Adults form about 68% of the total...

  13. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay.

    Science.gov (United States)

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50  1000 µg/ml). Our subsequent studies of conifer heartwoods with strong activity confirm the assay's value for identifying new investigational leads for materials with insecticidal and fungicidal activity.

  14. Phylogenetic analysis of brine shrimp (Artemia) in China using DNA barcoding.

    Science.gov (United States)

    Wang, Weiwei; Luo, Qibin; Guo, Haiyan; Bossier, Peter; Van Stappen, Gilbert; Sorgeloos, Patrick; Xin, Naihong; Sun, Qishi; Hu, Songnian; Yu, Jun

    2008-12-01

    DNA barcoding is a powerful approach for characterizing species of organisms, especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China. Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  15. Unique chimeric composition of the trehalase gene from brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Tanaka, Shin; Nambu, Fumiko; Nambu, Ziro

    2010-03-01

    To investigate the exon/intron structure of the Artemia trehalase gene, four overlapping clones were isolated from a genome library derived from an inbred strain of crustacean Artemia franciscana, and a 49 kb genetic area was re-constructed. The re-constructed area contained eight exons corresponding to the trehalase cDNA sequence that we had previously reported [1]. Comparative analysis of the Artemia trehalase gene with other animal trehalase genes revealed the existence of conserved exon/intron boundaries among different phyla. Comparison of the 5' UTR region of trehalase mRNA obtained by the 5' RACE method with the trehalase genes indicated the existence of a novel exon/intron boundary in the region designated "Exon I". Surprisingly, a part of a mitochondrial ribosomal protein gene (MRP-S33) was found to be inserted in the 5' UTR region of the trehalase gene. This sequence had the same polyadenylation signal that the Artemia MRP-S33 cDNAs did. Using the 3' RACE method, it was demonstrated that the poly (A) additional signal is still functional and that the chimeric mRNAs composed of the 5' UTR of the trehalase mRNA and of the 3' end derived from the MRP-S33 gene are transcribed.

  16. Marine Lactobacillus pentosus H16 protects Artemia franciscana from Vibrio alginolyticus pathogenic effects.

    Science.gov (United States)

    Garcés, M E; Sequeiros, C; Olivera, N L

    2015-02-10

    Vibrio alginolyticus is an opportunistic pathogen which may affect different aquatic organisms. The aim of this study was to assess the probiotic properties and the protective mode of action of Lactobacillus pentosus H16 against V. alginolyticus 03/8525, through in vitro and in vivo studies using Artemia franciscana (hereafter Artemia). This strain showed antimicrobial activity against V. alginolyticus 03/8525 and Aeromonas salmonicida subsp. salmonicida ATCC33658 possibly related to lactobacilli organic acid production. It was able to survive at high rainbow trout bile concentrations and showed high selective adhesion to rainbow trout mucus (1.2×10(5)±8.0×10(3) cells cm(-2)). H16 outcompeted V. alginolyticus 03/8525 and A. salmonicida subsp. salmonicida ATCC33658, greatly reducing their adherence to rainbow trout mucus (64.8 and 74.1%, respectively). Moreover, H16 produced a cell-bound biosurfactant which caused an important decrease in the surface tension. H16 also protected Artemia nauplii against mortality when it was administered previous to V. alginolyticus 03/8525 inoculation. Furthermore, H16 bioencapsulated in Artemia, suggesting that it is possible to use live carriers in its administration. We conclude that the ability of L. pentosus H16 to selectively adhere to mucosal surfaces and produce cell-bound biosurfactants, displacing pathogenic strains, in addition to its antimicrobial activity, confer H16 competitive advantages against pathogens as demonstrated in in vivo challenge experiments. Thus, L. pentosus H16, a marine bacterium from the intestinal tract of hake, is an interesting probiotic for Artemia culture and also has the potential to prevent vibriosis in other aquaculture activities such as larvae culture and fish farming.

  17. Feeding truncated heat shock protein 70s protect Artemia franciscana against virulent Vibrio campbellii challenge.

    Science.gov (United States)

    Baruah, Kartik; Norouzitallab, Parisa; Shihao, Li; Sorgeloos, Patrick; Bossier, Peter

    2013-01-01

    The 70 kDa heat shock proteins (Hsp70s) are highly conserved in evolution, leading to striking similarities in structure and composition between eukaryotic Hsp70s and their homologs in prokaryotes. The eukaryotic Hsp70 like the DnaK (Escherichia coli equivalent Hsp70) protein, consist of three functionally distinct domains: an N-terminal 44-kDa ATPase portion, an 18-kDa peptide-binding domain and a C-terminal 10-kDa fragment. Previously, the amino acid sequence of eukaryotic (the brine shrimp Artemia franciscana) Hsp70 and DnaK proteins were shown to share a high degree of homology, particularly in the peptide-binding domain (59.6%, the putative innate immunity-activating portion) compared to the N-terminal ATPase (48.8%) and the C-terminal lid domains (19.4%). Next to this remarkable conservation, these proteins have been shown to generate protective immunity in Artemia against pathogenic Vibrio campbellii. This study, aimed to unravel the Vibrio-protective domain of Hsp70s in vivo, demonstrated that gnotobiotically cultured Artemia fed with recombinant C-terminal fragment (containing the conserved peptide binding domain) of Artemia Hsp70 or DnaK protein were well protected against subsequent Vibrio challenge. In addition, the prophenoloxidase (proPO) system, at both mRNA and protein activity levels, was also markedly induced by these truncated proteins, suggesting epitope(s) responsible for priming the proPO system and presumably other immune-related genes, consequently boosting Artemia survival upon challenge with V. campbellii, might be located within this conserved region of the peptide binding domain.

  18. The genus Artemia Leach, 1819 (Crustacea: Branchiopoda: I. True and false taxonomical descriptions El género Artemia Leach, 1819 (Crustacea: Branchiopoda: I. Descripciones taxonómicas verdaderas y falsas

    Directory of Open Access Journals (Sweden)

    Alireza Asem

    2010-01-01

    Full Text Available The brine shrimp Artemia is important for aquaculture since it is bighly nutritious. It is also used widely in biological studies because it is easy to culture. The aim of the present study is to review the literature on the taxonomical nomenclature of Artemia. The present study indicates the existence of seven species: three living in the Americas, one in Europe, and three in Asia.El camarón de salmuera Artemia es importante para la acuicultura por su alta calidad nutricional y es muy utilizado para estudios biológicos por ser de fácil cultivo. El objetivo del presente estudio es revisar la literatura sobre la nomenclatura taxonómica de Artemia. Se determina la existencia de siete especies; tres de ellas viven en América, una en Europa y tres en Asia.

  19. Protective effects of ectoine on heat-stressed Daphnia magna.

    Science.gov (United States)

    Adam, Bownik; Zofia, Stępniewska; Tadeusz, Skowroński

    2014-12-01

    Ectoine (ECT) is an amino acid produced and accumulated by halophilic bacteria in stressful conditions in order to prevent the loss of water from the cell. There is a lack of knowledge on the effects of ECT in heat-stressed aquatic animals. The purpose of our study was to determine the influence of ECT on Daphnia magna subjected to heat stress with two temperature gradients: 1 and 0.1 °C/min in the range of 23-42 °C. Time to immobilisation, survival during recovery, swimming performance, heart rate, thoracic limb movement and the levels of heat shock protein 70 kDa 1A (HSP70 1A), catalase (CAT) and nitric oxide species (NOx) were determined in ECT-exposed and unexposed daphnids; we showed protective effects of ECT on Daphnia magna subjected to heat stress. Time to immobilisation of daphnids exposed to ECT was longer when compared to the unexposed animals. Also, survival rate during the recovery of daphnids previously treated with ECT was higher. ECT significantly attenuated a rapid increase of mean swimming velocity which was elevated in the unexposed daphnids. Moreover, we observed elevation of thoracic limb movement and modulation of heart rate in ECT-exposed animals. HSP70 1A and CAT levels were reduced in the presence of ECT. On the other hand, NOx level was slightly elevated in both ECT-treated and unexposed daphnids, however slightly higher NOx level was found in ECT-treated animals. We conclude that the exposure to ectoine has thermoprotective effects on Daphnia magna, however their mechanisms are not associated with the induction of HSP70 1A.

  20. Spectral SAR Ecotoxicology of Ionic Liquids: The Daphnia magna Case

    Directory of Open Access Journals (Sweden)

    Mihai V. Putz

    2007-01-01

    Full Text Available Aiming to provide a unified theory of ionic liquids ecotoxicity, the recent spectral structure activity relationship (S-SAR algorithm is employed for testing the two additive models of anionic-cationic interaction containing ionic liquid activity: the causal and the endpoint, |0+〉 and |1+〉 models, respectively. As a working system, the Daphnia magna ecotoxicity was characterized through the formulated and applied spectral chemical-ecobiological interaction principles. Specific anionic-cationic-ionic-liquid rules of interaction along the developed mechanistic hypersurface map of the main ecotoxicity paths together with the so-called resonance limitation of the standard statistical correlation analysis were revealed.

  1. Small scale mass culture of Daphnia magna Straus

    Energy Technology Data Exchange (ETDEWEB)

    Rees, J.T.; Oldfather, J.M.

    1980-02-01

    Daphnia magna Straus 1820 was raised on a defined medium in 4-liter flasks with controlled light intensity, temperature, and algal food species. Adult D. magna tolerated high levels of ammonia (up to 108 ..mu..M) at high pH (> 10), although at these levels parthenogenic reproduction may be inhibited. Scenedesmus quadricauda and Ankistrodesmus sp. were satisfactory food sources, and by utilizing Ankistrodesmus densities greater than one animal per ml were achieved. Maintaining the pH at about 7 to 8 seems to be important for successful D. magna culture.

  2. Production, utilization and manipulation of Artemia as food source for shrimp and fish larvae

    OpenAIRE

    Lavens, P.; Léger, P.; Sorgeloos, P

    1986-01-01

    Larval culture of fish and shrimp can be seriously improved thanks to the results of recent research and development in the field of Artemia production and utilization. The present article summarizes the most recent techniques for optimation in production and use of different stages of Artemia in aquaculture:- cyst selection in function of hatching quality, purity, biometric characteristics, etc. - nauplii production: techniques for hatching, disinfection and decapsulation;- nutritional value...

  3. Temperature-dependent effect of filamentous cyanobacteria on Daphnia magna life history traits

    Directory of Open Access Journals (Sweden)

    Piotr DAWIDOWICZ

    2011-08-01

    Full Text Available Filamentous cyanobacteria are unsuitable food for Daphnia due to their poor manageability, poor nutritional value and, in some cases, toxicity. As the strength of harmful effects of cyanobacteria on filter-feeding zooplankton is temperature dependent, the global warming scenarios for eutrophic lakes in temperate zone might include an escalated suppression of Daphnia populations caused by the presence of cyanobacterial filaments. To test this assumption, we conducted life-table experiments with four clones of Daphnia magna fed either a green alga Scenedesmus obliquus or a non-toxic strain of filamentous cyanobacteria Cylindrospermopsis raciborskii in two temperatures (20 °C and 24 °C. Key life history parameters of Daphnia, i.e., age and size at first reproduction, fecundity, and individual growth rate, were measured. Both food and temperature significantly affected Daphnia performance, however, the effect of interaction of these two factors was ambiguous and highly genotype-dependent. We conclude that the temperature increase within the studied range will not necessarily strengthen the suppression of Daphnia growth by filamentous cyanobacteria, but may affect clonal selection within population of Daphnia, thus possibly triggering microevolutionary changes within affected populations.

  4. Acetylation of Chromatin-Associated Histone H3 Lysine 56 Inhibits the Development of Encysted Artemia Embryos.

    Directory of Open Access Journals (Sweden)

    Rong Zhou

    Full Text Available As a response to harsh environments, the crustacean artemia produces diapause gastrula embryos (cysts, in which cell division and embryonic development are totally arrested. This dormant state can last for very long periods but be terminated by specific environmental stimuli. Thus, artemia is an ideal model organism in which to study cell cycle arrest and embryonic development.Our study focuses on the roles of H3K56ac in the arrest of cell cycle and development during artemia diapause formation and termination. We found that the level of H3K56ac on chromatin increased during diapause formation, and decreased upon diapause termination, remaining basal level throughout subsequent embryonic development. In both HeLa cells and artemia, blocking the deacetylation with nicotinamide, a histone deacetylase inhibitor, increased the level of H3K56ac on chromatin and induced an artificial cell cycle arrest. Furthermore, we found that this arrest of the cell cycle and development was induced by H3K56ac and dephosphorylation of the checkpoint protein, retinoblastoma protein.These results have revealed the dynamic change in H3K56ac on chromatin during artemia diapause formation and termination. Thus, our findings provide insight into the regulation of cell division during arrest of artemia embryonic development and provide further insight into the functions of H3K56ac.

  5. Rearing Tenebrio molitor in BLSS: Dietary fiber affects larval growth, development, and respiration characteristics

    Science.gov (United States)

    Li, Leyuan; Stasiak, Michael; Li, Liang; Xie, Beizhen; Fu, Yuming; Gidzinski, Danuta; Dixon, Mike; Liu, Hong

    2016-01-01

    Rearing of yellow mealworm (Tenebrio molitor L.) will provide good animal nutrition for astronauts in a bioregenerative life support system. In this study, growth and biomass conversion data of T. molitor larvae were tested for calculating the stoichiometric equation of its growth. Result of a respiratory quotient test proved the validity of the equation. Fiber had the most reduction in mass during T. molitor‧s consumption, and thus it is speculated that fiber is an important factor affecting larval growth of T. molitor. In order to further confirm this hypothesis and find out a proper feed fiber content, T. molitor larvae were fed on diets with 4 levels of fiber. Larval growth, development and respiration in each group were compared and analyzed. Results showed that crude-fiber content of 5% had a significant promoting effect on larvae in early instars, and is beneficial for pupa eclosion. When fed on feed of 5-10% crude-fiber, larvae in later instars reached optimal levels in growth, development and respiration. Therefore, we suggest that crude fiber content in feed can be controlled within 5-10%, and with the consideration of food palatability, a crude fiber of 5% is advisable.

  6. Trade-off between cellular immunity and life span in mealworm beetles Tenebrio molitor

    Institute of Scientific and Technical Information of China (English)

    Indrikis KRAMS; Jan(i)na DAUK(S)TE; Inese KIVLENIECE; Ants KAASIK; Tatjana KRAMA; Todd M.FREEBERG; Markus J.RANTALA

    2013-01-01

    Encapsulation is a nonspecific,cellular response through which insects defend themselves against multicellular pathogens.During this immune reaction,haemocytes recognize an object as foreign and cause other haemocytes to aggregate and form a capsule around the object,often consisting of melanized cells.The process of melanisation is accompanied by the formation of potentially toxic reactive oxygen species,which can kill not only pathogens but also host cells.In this study we tested whether the encapsulation response is costly in mealworm beetles Tenebrio molitor.We found a negative relationship between the duration of implantation via a nylon monofilament and remaining life span.We also found a negative relationship between the strength of immune response and remaining life span,suggesting that cellular immunity is costly in T.molitor,and that there is a trade-off between immune response and remaining life span.However,this relationship disappeared at 31-32 hours of implantation at 25 ± 2℃.As the disappearance of a relationship between duration of implantation and lifespan coincided with the highest values of encapsulation response,we concluded that the beetles stopped investment in the production of melanotic cells,as the implant,a synthetic parasite,was fully isolated from the host's tissues.

  7. The Effect of Chemical Composition and Bioactivity of Several Essential Oils on Tenebrio molitor (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Wang, Xuegui; Hao, Qiang; Chen, Yiqu; Jiang, Surong; Yang, Qunfang; Li, Qing

    2015-01-01

    The major chemical components of four essential oils (EOs) extracted from dry leaves of Citrus limonum, Cymbopogon citratus, Litsea cubeba, and Muristica fragrans were analyzed with gas chromatograph-mass spectrometer and their fumigant, contact, and repellent activities against 10th instar and adults of Tenebrio molitor were also assayed. The results indicated that the major constituents of C. limonum and Cy. citrates were D-limonene (38.22%) and 3,7-dimethyl-6-octenal (26.21%), while which of L. cubeba and M. fragrans were (E)-3, 7-dimethyl-2, 6-octadienal (49.78%) and (E)-cinnamaldehyde (79.31%), respectively. Contact activities of L. cubeba and C. limonum with LC50 values of 21.2 and 13.9 µg/cm(2) at 48 h and repellence activities (>89.0% repellence indexes) (P molitor compared with the control. The mainly active ingredients of L. cubeba and C. limonum, including D-limonene and β-pinene, were demonstrated to coinhibit the actives of AChE and enhance the toxicities on 10th instar of T. molitor. These results indicate that the EOs of L. cubeba and C. limonum could have great potential as botanical insecticides against T. molitor.

  8. Parasitization by Scleroderma guani influences protein expression in Tenebrio molitor pupae.

    Science.gov (United States)

    Zhu, Jia-Ying; Wu, Guo-Xing; Ze, Sang-Zi; Stanley, David W; Yang, Bin

    2014-07-01

    Ectoparasitoid wasps deposit their eggs onto the surface and inject venom into their hosts. Venoms are chemically complex and they exert substantial impact on hosts, including permanent or temporary paralysis and developmental arrest. These visible venom effects are due to changes in expression of genes encoding physiologically relevant proteins. While the influence of parasitization on gene expression in several lepidopterans has been reported, the molecular details of parasitoid/beetle relationships remain mostly unknown. This shortcoming led us to pose the hypothesis that envenomation by the ectoparasitic ant-like bethylid wasp Scleroderma guani leads to changes in protein expression in the yellow mealworm beetle Tenebrio molitor. We tested our hypothesis by comparing the proteomes of non-parasitized and parasitized host pupae using iTRAQ-based proteomics. We identified 41 proteins that were differentially expressed (32↑- and 9↓-regulated) in parasitized pupae. We assigned these proteins to functional categories, including immunity, stress and detoxification, energy metabolism, development, cytoskeleton, signaling and others. We recorded parallel changes in mRNA levels and protein abundance in 14 selected proteins following parasitization. Our findings support our hypothesis by documenting changes in protein expression in parasitized hosts.

  9. Inbreeding affects sexual signalling in males but not females of Tenebrio molitor.

    Science.gov (United States)

    Pölkki, Mari; Krams, Indrikis; Kangassalo, Katariina; Rantala, Markus J

    2012-06-23

    In many species of animals, individuals advertise their quality with sexual signals to obtain mates. Chemical signals such as volatile pheromones are species specific, and their primary purpose is to influence mate choice by carrying information about the phenotypic and genetic quality of the sender. The deleterious effects of consanguineous mating on individual quality are generally known, whereas the effect of inbreeding on sexual signalling is poorly understood. Here, we tested whether inbreeding reduces the attractiveness of sexual signalling in the mealworm beetle, Tenebrio molitor, by testing the preferences for odours of inbred and outbred (control) individuals of the opposite sex. Females were more attracted to the odours produced by outbred males than the odours produced by inbred males, suggesting that inbreeding reduces the attractiveness of male sexual signalling. However, we did not find any difference between the attractiveness of inbred and outbred female odours, which may indicate that the quality of females is either irrelevant for T. molitor males or quality is not revealed through female odours.

  10. Recognition, survival and persistence of Staphylococcus aureus in the model host Tenebrio molitor.

    Science.gov (United States)

    Dorling, Jack; Moraes, Caroline; Rolff, Jens

    2015-02-01

    The degree of specificity of any given immune response to a parasite is governed by the complexity and variation of interactions between host and pathogen derived molecules. Here, we assess the extent to which recognition and immuno-resistance of cell wall mutants of the pathogen Staphylococcus aureus may contribute to establishment and maintenance of persistent infection in the model insect host, Tenebrio molitor. The cell surface of S. aureus is decorated with various molecules, including glycopolymers such as wall teichoic acid (WTA). WTA is covalently bound to peptidoglycan (PGN) and its absence has been associated with increased recognition of PGN by host receptors (PGRPs). WTA is also further modified by other molecules such as D-alanine (D-alanylation). Both the level of WTA expression and its D-alanylation were found to be important in the mediation of the host-parasite interaction in this model system. Specifically, WTA itself was seen to influence immune recognition, while D-alanylation of WTA was found to increase immuno-resistance and was associated with prolonged persistence of S. aureus in T. molitor. These results implicate WTA and its D-alanylation as important factors in the establishment and maintenance of persistent infection, affecting different critical junctions in the immune response; through potential evasion of recognition by PGRPs and resistance to humoral immune effectors during prolonged exposure to the immune system. This highlights a mechanism by which specificity in this host-parasite interaction may arise.

  11. Cloning and expression of a novel antifreeze protein AFP72 from the beetle Tenebrio molitor.

    Science.gov (United States)

    Yan, Qing-Hua; Yang, Li; Wang, Qing; Zhang, Hui-Rong; Shao, Qiang

    2012-01-01

    A novel antifreeze protein AFP72 cDNA (GenBbank accession No. AY929389) was obtained by RT-PCR from Tenebrio molitor. The 216 bp fragment encodes a protein of 72 amino acid residues. Sequence analysis revealed that the cDNA displays a high degree of homology with T. molitor antifreeze proteins, ranging up to 90.78%. Recombinant plasmids pMAL-p2X-afp72 and pMAL-c2X-afp72 were transferred into E. coil TBI to induce a MBP fusion protein by IPTG. The target fusion protein was released from the periplasm and cytoplasm by the cold osmotic shock procedure and sonication respectively. The content of the fusion protein came up to 38.9 and 41.5% of the total dissolved protein, respectively. The fusion protein was purified through an amylose affinity column, and incised by factor Xa. Molecular sieve chromatography was used to achieve a high state of purity of the target protein. The purified target protein displayed a single band in SDS-PAGE. The fusion protein was shown to increase resistance to low temperatures in bacteria. This finding could help in further investigations of the properties and function of antifreeze proteins.

  12. Transformation of Beauveria bassiana to produce EGFP in Tenebrio molitor for use as animal feed additives.

    Science.gov (United States)

    Kim, Jae Su; Choi, Jae Young; Lee, Se Jin; Lee, Ju Hyun; Fu, Zhenli; Skinner, Margaret; Parker, Bruce L; Je, Yeon Ho

    2013-07-01

    Efforts are underway to develop more effective and safer animal feed additives. Entomopathogenic fungi can be considered practical expression platforms of functional genes within insects which have been used as animal feed additives. In this work, as a model, the enhanced green fluorescent protein (egfp) gene was expressed in yellow mealworms, Tenebrio molitor by highly infective Beauveria bassiana ERL1170. Among seven test isolates, ERL1170 treatment showed 57.1% and 98.3% mortality of mealworms 2 and 5 days after infection, respectively. The fungal transformation vector, pABeG containing the egfp gene, was inserted into the genomic DNA of ERL1170 using the restriction enzyme-mediated integration method. This resulted in the generation of the transformant, Bb-egfp#3, which showed the highest level of fluorescence. Bb-egfp#3-treated mealworms gradually turned dark brown, and in 7-days mealworm sections showed a strong fluorescence. This did not occur in the wild-type strain. This work suggests that further valuable proteins can be efficiently produced in this mealworm-based fungal expression platform, thereby increasing the value of mealworms in the animal feed additive industry.

  13. Variations of the antioxidant system during development of the cold-tolerant beetle, Tenebrio molitor.

    Science.gov (United States)

    Gulevsky, Alexander K; Relina, Liana I; Grishchenkova, Yelena A

    2006-01-01

    Data relating to the peculiarities of antioxidant enzyme activities, glutathione (GSH) level and lipid peroxidation (LP) intermediates specific to at each ontogenic stage of Tenebrio molitor are presented. Metamorphosis is accompanied by a shift of prooxidant-antioxidant balance towards oxidative processes, since pupae have the highest levels of lipid peroxidation intermediates. Cold acclimation (4 degree C) can promote oxidative stress at the cold sensitive developmental stage--imagoes, which enhance their levels of diene conjugates and ketodienes after a 2-week cold acclimation. This enhancement is accompanied by an increase in catalase (CAT) activity. GSH levels undergo no changes in imagoes after cold acclimation. Neither larval nor pupal T. molitor show significant changes in LP product contents after cold acclimation. Chilling results in a significant increase in CAT activities in pupae, but not in larvae. GSH levels are reduced both in larvae and pupae after cold exposure. However, cold acclimation does not affect superoxide dismutase (SOD) activity in any of the developmental stages of T. molitor.

  14. Trade-off between cellular immunity and life span in mealworm beetles Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Indrikis KRAMS, Janīna DAUKŠTE, Inese KIVLENIECE, Ants KAASIK, Tatjana KRAMA, Todd M. REEBERG, Markus J. RANTALA

    2013-06-01

    Full Text Available Encapsulation is a nonspecific, cellular response through which insects defend themselves against multicellular pathogens. During this immune reaction, haemocytes recognize an object as foreign and cause other haemocytes to aggregate and form a capsule around the object, often consisting of melanized cells. The process of melanisation is accompanied by the formation of potentially toxic reactive oxygen species, which can kill not only pathogens but also host cells. In this study we tested whether the encapsulation response is costly in mealworm beetles Tenebrio molitor. We found a negative relationship between the duration of implantation via a nylon monofilament and remaining life span. We also found a negative relationship between the strength of immune response and remaining life span, suggesting that cellular immunity is costly in T. molitor, and that there is a trade-off between immune response and remaining life span. However, this relationship disappeared at 31-32 hours of implantation at 25 ± 2℃. As the disappearance of a relationship between duration of implantation and lifespan coincided with the highest values of encapsulation response, we concluded that the beetles stopped investment in the production of melanotic cells, as the implant, a synthetic parasite, was fully isolated from the host’s tissues [Current Zoology 59 (3: 340–346, 2013].

  15. Quantity discrimination in Tenebrio molitor: evidence of numerosity discrimination in an invertebrate?

    Science.gov (United States)

    Carazo, P; Font, E; Forteza-Behrendt, E; Desfilis, E

    2009-05-01

    Numerosity discrimination, the ability to distinguish between sets with more and less items, is recognised as the foundation for higher numerical abilities. Understanding numerosity discrimination from a comparative perspective is hence pivotal in tracing the evolution of numerical representation systems. However, numerosity discrimination has been well studied only in vertebrates, where two innate systems of number representation have been described: an 'analog magnitude system' used to discriminate among numerosities by representing them as cardinal magnitudes and a 'parallel individualisation system' that allows precise discrimination among small arrays of items (Tenebrio molitor) by using a spontaneous two-choice procedure in which males were exposed to substrates bearing odours from different numbers of females (molitor males exhibit a marked preference for sources reflecting more female donors only when numerosity ratios are below 1:2. We discuss the functional significance of this finding and whether our pattern of results could be best explained by summation of a non-numerical continuous variable or by the existence of a numerosity discrimination mechanism with an operational signature ratio of 1:2.

  16. Hydration behavior at the ice-binding surface of the Tenebrio molitor antifreeze protein.

    Science.gov (United States)

    Midya, Uday Sankar; Bandyopadhyay, Sanjoy

    2014-05-08

    Molecular dynamics (MD) simulations have been carried out at two different temperatures (300 and 220 K) to study the conformational rigidity of the hyperactive Tenebrio molitor antifreeze protein (TmAFP) in aqueous medium and the structural arrangements of water molecules hydrating its surface. It is found that irrespective of the temperature the ice-binding surface (IBS) of the protein is relatively more rigid than its nonice-binding surface (NIBS). The presence of a set of regularly arranged internally bound water molecules is found to play an important role in maintaining the flat rigid nature of the IBS. Importantly, the calculations reveal that the strategically located hydroxyl oxygens of the threonine (Thr) residues in the IBS influence the arrangements of five sets of ordered waters around it on two parallel planes that closely resemble the basal plane of ice. As a result, these waters can register well with the ice basal plane, thereby allowing the IBS to preferentially bind at the ice interface and inhibit its growth. This provides a possible molecular reason behind the ice-binding activity of TmAFP at the basal plane of ice.

  17. [Effects of fermented cattle dung on the growth and development of Tenebrio molitor larvae].

    Science.gov (United States)

    Zeng, Xiang-Wei; Wang, Xia; Guo, Li-Yue; Zhan, Li-Jie; Bo, Wen-Jing; Li, Zhan; Wu, Guang-Lei; Jiang, Gao-Ming

    2012-07-01

    In order to make use of and industrialize the animal dung from large cattle farms, this paper explored the feasibility of using Tenebrio molitor to digest and utilize cattle dung. Cattle dung was mixed with the conventional feed (65% wheat bran, 30% corn flour, and 5% bean pulp) of T. molitor in definite proportions, and fermented with effective microorganisms (EM). The fermented products containing 60% and 80% of cattle dung (FD1 and FD2, respectively) were selected to feed T. molitor larvae, and the effects of the fermented products on the growth curve, death rate, pupation rate, and antioxidant system of the larvae were compared. Compared with CK (conventional deed), the FD1 made the developmental duration of the larvae prolonged by 10 days and the larvae's death rate upraised somewhat, but made the single larva's total food intake, average body mass, crude fat content, and ratio of unsaturated to saturated fat acids increased by 49%, 28%, 26%, and 32%, respectively (P molitor larvae had weak adaptability to FD2. Our findings suggested that using FD1 to feed the 3rd instar of T. molitor larvae would have good practical prospects in industrializing cattle dung.

  18. Effects of inbreeding on potential and realized immune responses in Tenebrio molitor.

    Science.gov (United States)

    Rantala, Markus J; Viitaniemi, Heidi; Roff, Derek A

    2011-06-01

    Although numerous studies on vertebrates suggest that inbreeding reduces their resistance against parasites and pathogens, studies in insects have found contradictory evidence. In this study we tested the effect of 1 generation of brother-sister mating (inbreeding) on potential and realized immune responses and other life-history traits in Tenebrio molitor. We found that inbreeding reduced adult mass, pre-adult survival and increased development time, suggesting that inbreeding reduced the condition of the adults and thus potentially made them more susceptible to physiological stress. However, we found no significant effect of inbreeding on the potential immune response (encapsulation response), but inbreeding reduced the realized immune response (resistance against the entomopathogenic fungi, Beauveria bassiana). There was a significant family effect on encapsulation response, but no family effect on the resistance against the entomopathogenic fungi. Given that this latter trait showed significant inbreeding depression and that the sample size for the family-effect analysis was small it is likely that the lack of a significant family effect is due to reduced statistical power, rather than the lack of a heritable basis to the trait. Our study highlights the importance of using pathogens and parasites in immunoecological studies.

  19. Parasitization by Scleroderma guani influences expression of superoxide dismutase genes in Tenebrio molitor.

    Science.gov (United States)

    Zhu, Jia-Ying; Ze, Sang-Zi; Stanley, David W; Yang, Bin

    2014-09-01

    Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor. The cDNAs for ecCuZnSOD, icCuZnSOD, and MnSOD, respectively, encode 24.55, 15.81, and 23.14 kDa polypeptides, which possess structural features typical of other insect SODs. They showed 20-94% identity to other known SOD sequences from Bombyx mori, Musca domestica, Nasonia vitripennis, Pediculus humanus corporis, and Tribolium castaneum. Expression of these genes was analyzed in selected tissues and developmental stages, and following exposure to Escherichia coli and parasitization by Scleroderma guani. We recorded expression of all three SODs in cuticle, fat body, and hemocytes and in the major developmental stages. Relatively higher expressions were detected in late-instar larvae and pupae, compared to other developmental stages. Transcriptional levels were upregulated following bacterial infection. Analysis of pupae parasitized by S. guani revealed that expression of T. molitor SOD genes was significantly induced following parasitization. We infer that these genes act in immune response and in host-parasitoid interactions.

  20. Differences in critical thermal maxima and mortality across life stages of the mealworm beetle Tenebrio molitor.

    Science.gov (United States)

    Vorhees, Ashley S; Bradley, Timothy J

    2012-07-01

    Thermal limits to activity profoundly affect the abundance and distribution of ectothermic animals. Upper thermal limits to activity are typically reported as the critical thermal maximum (CT(max)), the temperature at which activity becomes uncontrolled. Thermolimit respirometry is a new technique that allows CT(max) to be quantified in small animals, such as insects, as the point of spiracular failure by measuring CO(2) release from the animal as temperature increases. Although prior studies have reported a characteristic pattern of CO(2) release for insects during thermolimit respirometry trials, no studies have been carried out to determine the universality of this pattern across development, or at what point death occurs along this pattern. Here, we compared the CT(max) and patterns of CO(2) release among three life stages of a beetle species, Tenebrio molitor, and mapped heat death onto these patterns. Our study is the first to report distinct patterns of CO(2) release in different life stages of an insect species during thermolimit respirometry. Our results show that CT(max) was significantly higher in adult beetles than in either larvae or pupae (P<0.001) and, similarly, death occurred at higher temperatures in adults than in larvae and pupae. We also found that death during heating closely follows CT(max) in these animals, which confirms that measuring the loss of spiracular control with thermolimit respirometry successfully identifies the point of physiological limitation during heat stress.

  1. [Effects of venom from Sclerodermus sichuanensis Xiao on pupa of Tenebrio molitor].

    Science.gov (United States)

    Zhuo, Zhi-Hang; Yang, Wei; Qin, Huan; Yang, Chun-Ping; Yang, Hua; Xu, Dan-Ping

    2013-11-01

    To explore the regulatory mechanisms of parasitism of Sclerodermus sichuanensis on Tenebrio molitor, the methods of natural parasitism and venom injection were adopted to investigate the effects of the venom from S. sichuanensis on the pupa of T. molitor in the parasitic process. Under venom injection, the paralytic degree of the pupa had a positive correlation with the concentration of injected venom, and the number of recovered pupa had a negative correlation with the injected venom concentration. The T. molitor pupa was in slight and reversible paralysis when injected with 0.01 VRE (venom reservoir equivalent) of venom, and in non-reversible and complete paralysis when 0.2 VRE was injected. The pupa died massively and appeared a wide range of melanization when injected with soil bacterial suspension alone, but the melanization delayed and the mortality declined significantly when the mixed liquor of bacterium and venom was injected. The bacteriostasis of the venom on Staphylococcus aureus was significantly stronger than that on Escherichia coli. Within a definite range of temperature, the paralytic activity decreased significantly with increasing temperature, the bacteriostasis on S. aureus increased significantly, while that on E. coli was opposite. This study showed that the venom from S. sichuanensis had the effects of paralysis, bacteriostasis, inhibiting exuviations, and delaying melanization.

  2. A novel Tenebrio molitor cadherin is a functional receptor for Bacillus thuringiensis Cry3Aa toxin.

    Science.gov (United States)

    Fabrick, Jeff; Oppert, Cris; Lorenzen, Marcé D; Morris, Kaley; Oppert, Brenda; Jurat-Fuentes, Juan Luis

    2009-07-03

    Cry toxins produced by the bacterium Bacillus thuringiensis are effective biological insecticides. Cadherin-like proteins have been reported as functional Cry1A toxin receptors in Lepidoptera. Here we present data that demonstrate that a coleopteran cadherin is a functional Cry3Aa toxin receptor. The Cry3Aa receptor cadherin was cloned from Tenebrio molitor larval midgut mRNA, and the predicted protein, TmCad1, has domain structure and a putative toxin binding region similar to those in lepidopteran cadherin B. thuringiensis receptors. A peptide containing the putative toxin binding region from TmCad1 bound specifically to Cry3Aa and promoted the formation of Cry3Aa toxin oligomers, proposed to be mediators of toxicity in lepidopterans. Injection of TmCad1-specific double-stranded RNA into T. molitor larvae resulted in knockdown of the TmCad1 transcript and conferred resistance to Cry3Aa toxicity. These data demonstrate the functional role of TmCad1 as a Cry3Aa receptor in T. molitor and reveal similarities between the mode of action of Cry toxins in Lepidoptera and Coleoptera.

  3. Tenebrio molitor (Coleoptera: Tenebrionidae) as an alternative host to study fungal infections.

    Science.gov (United States)

    de Souza, Patrícia Canteri; Morey, Alexandre Tadachi; Castanheira, Gabriel Marcondes; Bocate, Karla Paiva; Panagio, Luciano Aparecido; Ito, Fabio Augusto; Furlaneto, Márcia Cristina; Yamada-Ogatta, Sueli Fumie; Costa, Idessânia Nazareth; Mora-Montes, Hector Manuel; Almeida, Ricardo Sergio

    2015-11-01

    Models of host–pathogen interactions are crucial for the analysis of microbial pathogenesis. In this context, invertebrate hosts, including Drosophila melanogaster (fruit fly), Caenorhabditis elegans (nematode) and Galleria mellonella (moth), have been used to study the pathogenesis of fungi and bacteria. Each of these organisms offers distinct benefits in elucidating host–pathogen interactions. In this study,we present a newinvertebrate infection model to study fungal infections: the Tenebrio molitor (beetle) larvae. Here we performed T. molitor larvae infection with one of two important fungal human pathogens, Candida albicans or Cryptococcus neoformans, and analyzed survival curves and larva infected tissues.We showed that increasing concentrations of inoculum of both fungi resulted in increased mortality rates, demonstrating the efficiency of the method to evaluate the virulence of pathogenic yeasts. Additionally, following 12 h post-infection, C. albicans formsmycelia, spreading its hyphae through the larva tissue,whilst GMS stain enabled the visualization of C. neoformans yeast and theirmelanin capsule. These larvae are easier to cultivate in the laboratory than G. mellonella larvae, and offer the same benefits. Therefore, this insect model could be a useful alternative tool to screen clinical pathogenic yeast strainswith distinct virulence traits or different mutant strains.

  4. Quantity estimation based on numerical cues in the mealworm beetle (Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Pau eCarazo

    2012-11-01

    Full Text Available In this study, we used a biologically relevant experimental procedure to ask whether mealworm beetles (Tenebrio molitor are spontaneously capable of assessing quantities based on numerical cues. Like other insect species, mealworm beetles adjust their reproductive behaviour (i.e. investment in mate guarding according to the perceived risk of sperm competition (i.e. probability that a female will mate with another male. To test whether males have the ability to estimate numerosity based on numerical cues, we staged matings between virgin females and virgin males in which we varied the number of rival males the experimental male had access to immediately preceding mating as a cue to sperm competition risk (from 1 to 4. Rival males were presented sequentially, and we controlled for continuous cues by ensuring that males in all treatments were exposed to the same amount of male-male contact. Males exhibited a marked increase in the time they devoted to mate guarding in response to an increase in the number of different rival males they were exposed to. Since males could not rely on continuous cues we conclude that they kept a running tally of the number of individuals they encountered serially, which meets the requirements of the basic ordinality and cardinality principles of proto-counting. Our results thus offer good evidence of ‘true’ numerosity estimation or quantity estimation and, along with recent studies in honey-bees, suggest that vertebrates and invertebrates share similar core systems of non-verbal numerical representation.

  5. Gut microbiota of Tenebrio molitor and their response to environmental change.

    Science.gov (United States)

    Jung, Jaejoon; Heo, Aram; Park, Yong Woo; Kim, Ye Ji; Koh, Hyelim; Park, Woojun

    2014-07-01

    A bacterial community analysis of the gut of Tenebrio molitor larvae was performed using pyrosequencing of the 16S rRNA gene. A predominance of genus Spiroplasma species in phylum Tenericutes was observed in the gut samples, but there was variation found in the community composition between T. molitor individuals. The gut bacteria community structure was not significantly affected by the presence of antibiotics or by the exposure of T. molitor larvae to a highly diverse soil bacteria community. A negative relationship was identified between bacterial diversity and ampicillin concentration; however, no negative relationship was identified with the addition of kanamycin. Ampicillin treatment resulted in a reduction in the bacterial community size, estimated using the 16S rRNA gene copy number. A detailed phylogenetic analysis indicated that the Spiroplasma-associated sequences originating from the T. molitor larvae were distinct from previously identified Spiroplasma type species, implying the presence of novel Spiroplasma species. Some Spiroplasma species are known to be insect pathogens; however, the T. molitor larvae did not experience any harmful effects arising from the presence of Spiroplasma species, indicating that Spiroplasma in the gut of T. molitor larvae do not act as a pathogen to the host. A comparison with the bacterial communities found in other insects (Apis and Solenopsis) showed that the Spiroplasma species found in this study were specific to T. molitor.

  6. USE OF BRINE SHRIMP (ARTEMIA IN THE FEEDING OF STURGEON JUVENILES (ACIPENSERIDAE (REVIEW

    Directory of Open Access Journals (Sweden)

    M. Simon

    2016-06-01

    Full Text Available Purpose. To review scientific sources on the technological and biological characteristics of the use of brine shrimp (Artemia in the feeding of sturgeon juvenilse (Acipenseridae. To highlight the common biotechnological bases of the enrichment of brine shrimp with biologically active substances necessary for the full development of sturgeon juveniles. Findings. The review of scientific papers showed that the technology is the use of brine shrimp in the feeding of sturgeon speices not only had not lost its relevance in aquaculture, but also continued to evolve in response to new challenges. The review contains a description of the peculiarities of the biological structure of brine shrimp eggs and methods of their quality assessment in the field. It describes the nutritional characteristics of Artemia. It is shown that brine shrimp is the best food organism for the use in the feeding of sturgeon fingerlings. The calculation scheme for Artemia decapsulation and incubation is provided. The main technological stages of of the preparation of shrimps before their use in feeding – activation, hydration, decapsulation, incubation, dehydration were described. The effect of brine shrimp nauplia enriched with biologically active substances enriched brine shrimp on sturgeon juveniles was highlighted. Practical value. Fish farm owners search for cost-effective, easy to use, and available food that is preferred by sturgeon juveniles (Acipenseridae. Brine shrimp nauplii obtained from cysts can be readil used to feed fish just after one-day incubation. Instar I (the nauplii that just hatched and contain large yolk reserves in their body and instar II nauplii (the nauplii after first moult and with functional digestive tracts are more widely used in aquaculture, because they are easy for operation, rich in nutrients, and small, which makes them suitable for feeding fish larvae as live feed or after drying. The generalized information will be important for

  7. Hybridization and the Origin of Contagious Asexuality in Daphnia pulex

    Science.gov (United States)

    Xu, Sen; Spitze, Ken; Ackerman, Matthew S.; Ye, Zhiqiang; Bright, Lydia; Keith, Nathan; Jackson, Craig E.; Shaw, Joseph R.; Lynch, Michael

    2015-01-01

    Hybridization plays a potentially important role in the origin of obligate parthenogenesis (OP) in many organisms. However, it remains controversial whether hybridization directly triggers the transition from sexual reproduction to obligate asexuality or a hybrid genetic background enables asexual species to persist. Furthermore, we know little about the specific genetic elements from the divergent, yet still hybridizing lineages responsible for this transition and how these elements are further spread to create other OP lineages. In this study, we address these questions in Daphnia pulex, where cyclically parthenogenetic (CP) and OP lineages coexist. Ancestry estimates and whole-genome association mapping using 32 OP isolates suggest that a complex hybridization history between the parental species D. pulex and D. pulicaria is responsible for the introgression of a set of 647 D. pulicaria single nucleotide polymorphism alleles that show perfect association with OP. Crossing experiments using males of OP lineages and females of CP lineages strongly support a polygenic basis for OP. Single-sperm analyses show that although normal meiotic recombination occurs in the production of haploid sperm by males of OP lineages, a significant proportion of such sperm are polyploid, suggesting that the spread of asexual elements through these males (i.e., contagious asexuality) is much less efficient than previously envisioned. Although the current Daphnia genome annotation does not provide mechanistic insight into the nature of the asexuality-associated alleles, these alleles should be considered as candidates for future investigations on the genetic underpinnings of OP. PMID:26351296

  8. Multigenerational genomic responses to dietary phosphorus and temperature in Daphnia.

    Science.gov (United States)

    Jalal, Marwa; Shala, Nita K; Wojewodzic, Marcin W; Andersen, Tom; Hessen, Dag O

    2014-08-01

    Temperature and nutrient availability are both hypothesized to affect organisms at the cellular and genomic levels. In this multigenerational study, Daphnia magna (D. magna) and Daphnia pulex (D. pulex) were maintained at high (20 °C) and low (10 °C) temperatures and nourished with phosphorus (P)-sufficient (50 μmol/L) and P-deficient (2 μmol/L) algae for up to 35 generations to assess the multigenerational impacts on genome size and nucleus size. Analysis by flow cytometry revealed significant increases in nucleus size for both species as well as genome size for D. magna in response to a low temperature. The degree of endoreplication, measured as cycle value, was species specific and responded to temperature and dietary composition. Under dietary P deficiency, D. magna, but not D. pulex, showed an apparent reduction in haploid genome size (C-value). These genomic responses are unlikely to reflect differences in nucleotide numbers, but rather structural changes affecting fluorochrome binding. While the ultimate and proximate causes of these responses are unknown, they suggest an intriguing potential for genomic responses that merits further research.

  9. Hybridization and the Origin of Contagious Asexuality in Daphnia pulex.

    Science.gov (United States)

    Xu, Sen; Spitze, Ken; Ackerman, Matthew S; Ye, Zhiqiang; Bright, Lydia; Keith, Nathan; Jackson, Craig E; Shaw, Joseph R; Lynch, Michael

    2015-12-01

    Hybridization plays a potentially important role in the origin of obligate parthenogenesis (OP) in many organisms. However, it remains controversial whether hybridization directly triggers the transition from sexual reproduction to obligate asexuality or a hybrid genetic background enables asexual species to persist. Furthermore, we know little about the specific genetic elements from the divergent, yet still hybridizing lineages responsible for this transition and how these elements are further spread to create other OP lineages. In this study, we address these questions in Daphnia pulex, where cyclically parthenogenetic (CP) and OP lineages coexist. Ancestry estimates and whole-genome association mapping using 32 OP isolates suggest that a complex hybridization history between the parental species D. pulex and D. pulicaria is responsible for the introgression of a set of 647 D. pulicaria single nucleotide polymorphism alleles that show perfect association with OP. Crossing experiments using males of OP lineages and females of CP lineages strongly support a polygenic basis for OP. Single-sperm analyses show that although normal meiotic recombination occurs in the production of haploid sperm by males of OP lineages, a significant proportion of such sperm are polyploid, suggesting that the spread of asexual elements through these males (i.e., contagious asexuality) is much less efficient than previously envisioned. Although the current Daphnia genome annotation does not provide mechanistic insight into the nature of the asexuality-associated alleles, these alleles should be considered as candidates for future investigations on the genetic underpinnings of OP.

  10. TALEN-mediated homologous recombination in Daphnia magna.

    Science.gov (United States)

    Nakanishi, Takashi; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2015-12-17

    Transcription Activator-Like Effector Nucleases (TALENs) offer versatile tools to engineer endogenous genomic loci in various organisms. We established a homologous recombination (HR)-based knock-in using TALEN in the crustacean Daphnia magna, a model for ecological and toxicological genomics. We constructed TALENs and designed the 67 bp donor insert targeting a point deletion in the eyeless mutant that shows eye deformities. Co-injection of the TALEN mRNA with donor DNA into eggs led to the precise integration of the donor insert in the germ line, which recovered eye deformities in offspring. The frequency of HR events in the germ line was 2% by using both plasmid and single strand oligo DNA with 1.5 kb and 80 nt homology to the target. Deficiency of ligase 4 involved in non-homologous end joining repair did not increase the HR efficiency. Our data represent efficient HR-based knock-in by TALENs in D. magna, which is a promising tool to understand Daphnia gene functions.

  11. [Effect of weak combined magnetic fields on the metamorphosis of the meal-worm beetle Tenebrio molitor].

    Science.gov (United States)

    Ermakov, A M; Lednev, V V

    2010-01-01

    The effects of weak combined magnetic fields adjusted to the parametric resonance for Ca2+ and K+ and extremely weak alternating magnetic field on the metamorphosis of the meal-worm beetle Tenebrio molitor have been studied. It was shown that the exposure of pupas of insects to all above-indicated types of fields stimulates the metamorphosis. However, after the exposure to weak combined magnetic fields adjusted to the parametric resonance for Ca2+ and K+, the number of insects with anomalies increases, which is not observed by the action of the weak alternating magnetic field.

  12. Identification and expression analysis of a novel R-type lectin from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Kim, Dong Hyun; Patnaik, Bharat Bhusan; Seo, Gi Won; Kang, Seong Min; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo

    2013-11-01

    We have identified novel ricin-type (R-type) lectin by sequencing of random clones from cDNA library of the coleopteran beetle, Tenebrio molitor. The cDNA sequence is comprised of 495 bp encoding a protein of 164 amino acid residues and shows 49% identity with galectin of Tribolium castaneum. Bioinformatics analysis shows that the amino acid residues from 35 to 162 belong to ricin-type beta-trefoil structure. The transcript was significantly upregulated after early hours of injection with peptidoglycans derived from Gram (+) and Gram (-) bacteria, beta-1, 3 glucan from fungi and an intracellular pathogen, Listeria monocytogenes suggesting putative function in innate immunity.

  13. Observation of two-dimensional yttrium oxide nanoparticles in mealworm beetles (Tenebrio molitor).

    Science.gov (United States)

    Chen, Yunyun; Sanchez, Carlos; Yue, Yuan; González, Jorge M; Parkinson, Dilworth Y; Liang, Hong

    2016-09-01

    Nanomaterials are being used in medicine, manufacturing and consumer products, but their effects on organisms and the environment are not well understood because of the difficulty in detecting them. Here dual-energy X-ray K-edge subtraction was used to track two-dimensional yttrium oxide nanoparticles (which can be found in such household objects as color televisions) in adult mealworms (Tenebrio molitor). The insects ingested nanoparticle-infused feed for different time periods, up to 24 h, and the nanoparticles could then be identified at several locations in the insects' head, thorax and abdomen, mostly within the digestive tract. In time, all particles were excreted.

  14. Effect of ultra-high pressure on small animals, tardigrades and Artemia

    Directory of Open Access Journals (Sweden)

    Fumihisa Ono

    2016-12-01

    Full Text Available This research shows that small animals, tardigrades (Milnesium tardigradum in tun (dehydrated state and Artemia salina cists (dried eggs can tolerate the very high hydrostatic pressure of 7.5 GPa. It was really surprising that living organisms can survive after exposure to such a high pressure. We extended these studies to the extremely high pressure of 20 GPa by using a Kawai-type octahedral anvil press. After exposure to this pressure for 30 min, the tardigrades were soaked in pure water and investigated under a microscope. Their bodies regained metabolic state and no serious injury could be seen. But they were not alive. A few of Artemia eggs went part of the way to hatching after soaked in sea water, but they never grew any further. Comparing with the case of blue-green alga, these animals are weaker under ultra-high pressure.

  15. Evolutionary Origin and Phylogeography of the Diploid Obligate Parthenogen Artemia parthenogenetica (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2010-01-01

    Background: Understanding the evolutionary origin and the phylogeographic patterns of asexual taxa can shed light on the origin and maintenance of sexual reproduction. We assessed the geographic origin, genetic diversity, and phylogeographic history of obligate parthenogen diploid Artemia...... and recent evolutionary origin of diploid A. parthenogenetica, and strongly suggested that the geographic origin of parthenogenesis in Artemia was in Central Asia. Our results indicate that the maternal sexual ancestors of diploid A. parthenogenetica were an undescribed species from Kazakhstan and A. urmiana....... Conclusions/Significance: We found evidence for multiple origin of parthenogenesis in Central Asia. Our results indicated that, shortly after its origin, diploid A. parthenogenetica populations underwent a rapid range expansion from Central Asia towards the Mediterranean region, and probably to the rest...

  16. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine.

    Science.gov (United States)

    Arcanjo, D D R; Albuquerque, A C M; Melo-Neto, B; Santana, L C L R; Medeiros, M G F; Citó, Amgl

    2012-08-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Justicia pectoralis and Equisetum sp.) against Artemia salina. Biological activity was evaluated for extracts at 1, 10, 100, and 1000 µg/mL in triplicate, and the mean lethal concentration values (LC50) were obtained by probit analysis. The species Acmella uliginosa showed the highest bioactivity, and its flower extract was more active than its leaf extract.

  17. On the motility of living invertebrates The case of Artemia Salina

    Science.gov (United States)

    Huerta, R.; Hernández, A.; Alvarado-Gil, J. J.

    1998-08-01

    Using a laser beam deflection technique a non-destructive and non-invasive method is developed. This method is applied to monitor the motility of small invertebrates, in particular we study the important case of the crustacean Artemia Salina and the motion of its different parts. We find out that its dynamics can be explained as a superposition of several periodic motions with very well defined frequencies.

  18. The transcription factor p8 regulates autophagy during diapause embryo formation in Artemia parthenogenetica.

    Science.gov (United States)

    Lin, Cheng; Jia, Sheng-Nan; Yang, Fan; Jia, Wen-Huan; Yu, Xiao-Jian; Yang, Jin-Shu; Yang, Wei-Jun

    2016-07-01

    Autophagy is an essential homeostatic process by which cytoplasmic components, including macromolecules and organelles, are degraded by lysosome. Increasing evidence suggests that phosphorylated AMP-activated protein kinase (p-AMPK) and target of rapamycin (TOR) play key roles in the regulation of autophagy. However, the regulation of autophagy in quiescent cells remains unclear, despite the fact that autophagy is known to be critical for normal development, regeneration, and degenerative diseases. Here, crustacean Artemia parthenogenetica was used as a model system because they produced and released encysted embryos that enter a state of obligate dormancy in cell quiescence to withstand various environmental threats. We observed that autophagy was increased before diapause stage but dropped to extremely low level in diapause cysts in Artemia. Western blot analyses indicated that the regulation of autophagy was AMPK/TOR independent during diapause embryo formation. Importantly, the level of p8 (Ar-p8), a stress-inducible transcription cofactor, was elevated at the stage just before diapause and was absent in encysted embryos, indicating that Ar-p8 may regulate autophagy. The results of Ar-p8 knockdown revealed that Ar-p8 regulated autophagy during diapause formation in Artemia. Moreover, we observed that activating transcription factors 4 and 6 (ATF4 and ATF6) responded to Ar-p8-regulated autophagy, indicating that autophagy targeted endoplasmic reticulum (ER) during diapause formation in Artemia. Additionally, AMPK/TOR-independent autophagy was validated in human gastric cancer MKN45 cells overexpressing Ar-p8. The findings presented here may provide insights into the role of p8 in regulating autophagy in quiescent cells.

  19. Neutron flow exposure as a test for survival of Artemia salina spores.

    Science.gov (United States)

    Matveeva, I S; Smirnov, A N; Vodennikov, B D; Popov, I M; Semenov, D S; Kolesnikov, M V; Syroeshkin, A V

    2004-11-01

    Live and heat-inactivated Artemia salina spores (samples with the same mass and filling density) were exposed to a flow of thermal neutrons from a (252)Cf radioactive source at an equivalent dose power of about 1 microSv/h. Irradiation led to a 4-fold acceleration of nauplius development and to modification of the element profiles of live spores. The difference between absorption/diffusion of thermal neutrons by live and dead spores was revealed.

  20. [Determination of Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus toxicity over Artemia salina].

    Science.gov (United States)

    Nieto R, Ivonne J; Salama, Ahmed M; Cataño P, Jorge E; Chegwin A, Carolina

    2008-09-30

    We report the toxicity of ethanolic extracts in Pleurotus ostreatus, Pleurotus pulmonarius and Paxillus involutus over that obtained in Artemia salina. P. involutus showed the highest toxicity (LC50 = 94.4 microg/ml), similar to that detected using potassium dichromate pattern. P. pulmonarius and P. ostreatus did not show toxicity over A. salina in concentrations lower than 1,000 microg/ml.

  1. [Study of a DNA sequence from brine shrimp artemia containing a novel DM domain].

    Science.gov (United States)

    Zeng, Hui; Song, Wen Qin; Chen, Rui Yang

    2004-10-01

    Sex-determining mechanisms are highly variable between phyla. However, there is an apparent exception in which structurally and functionally related genes control sex determination in different phyla: the sexual regulators DSX of Drosophila melanogaster and MAB-3 of Caenorhabditis elegans both containing a DNA-binding motif, DM domain. Proteins containing the domain may also play a role in sexual development of vertebrates. For examples, both the human DMRT1 (doublesex and mab-3 related transcription factor 1) gene and mouse Dmrt1 gene are necessary for male development. In this paper, through the degenerated PCR, a DNA fragment ADM was amplified out from genomic DNA of brine shrimp, Artemia sinica from YunCheng Salt Lake, Shanxi, China and Artemia parthenogenetica from GaHai, Qinghai, China, respectively. ADM encodes 47 amino acids and is highly homologous to amino acid sequence of the known DM domains. By comparing total of 27 DM domains in distant related species, a phylogenic tree of DM domain was constructed. In the tree, these DM domains were divided into different branches according to their subtypes. Among the DM domains that were compared, ADM is most homologous to the DM domain contained in human DMRT3 and mouse Dmrt3, which shares 83% identity between them. In addition, the same length of ADM could also be amplified out from cDNA of Artemia sinica and Artemia parthenogenetica, which indicated that ADM was expressed and located in one exon. The DM domain in brine shrimp reported here would make it possible for cloning the full-length cDNA containing the DM domain and further elucidating their functions.

  2. Assessment of toxic potential of Cerrado fruit seeds using Artemia salina bioassay

    Directory of Open Access Journals (Sweden)

    Raíza Cavalcante Fonseca

    2013-06-01

    Full Text Available Artemia salina bioassay was used to assess toxicity of seeds and kernels of Brazilian fruits from cerrado (central high plains region and other inner regions of the country. Water extracts of the kernels were filtered and added to Artemia cultures containing ten individuals per mL. Dose - response curves were constructed, and LD50 values were calculated. Pure potassium cyanide standard was used to draw a calibration curve for comparison to detect the presence of cyanide in the samples tested. Extracts of the seeds of araticum, mangaba, cagaita, jatobá, and tucumã were found toxic to Artemia salina, and some of the dose - response curves were very similar in shape to those obtained with pure potassium cyanide standards, while the samples of baru, cajá-manga, siriguela, trauma, and veludo showed no toxicity at all. The Guignard test, specific for cyanide detection, showed negative results in all toxic samples, suggesting the presence of other toxic compounds rather than cyanide. The comparison of araticum dose - response curve with those of other annonaceous fruits suggests the presence acetogenins as the main toxic compounds in the seeds. These results could be useful to prevent poisoning by industrial derivatives of the fruits studied.

  3. The study of fkbp and ubiquitin reveals interesting aspects of Artemia stress history.

    Science.gov (United States)

    Maniatsi, Stefania; Farmaki, Theodora; Abatzopoulos, Theodore J

    2015-08-01

    Research on stress responses in animals has increased greatly during the last decades. Though most studies focus on the cellular and molecular bases of the stress response mechanisms, the ecological and evolutionary aspects of stress responses gain more and more interest. Here, we use species and parthenogenetic strains of the genus Artemia, an extremophile model organism, to study, for the first time, a protein well known for its chaperone activity and its involvement in stress responses. More specifically, transcription and protein accumulation of an FK506-Binding Protein (FKBP) homologue were investigated under heat and salt stresses. Additionally, the mRNA levels of ubiquitin, a heat-inducible protein related to the proteasomal pathway, were quantitated under these conditions. Biochemical and phylogenetic analyses showed that the studied FKBP orthologue is a typical representative of the family that clusters with other crustacean sequences. The expression was increased in both fkbp and ubiquitin genes after salt and heat stresses. However, our results in combination with the fact that Artemia species and parthenogenetic strains, selected for this study, exhibit different heat or salt tolerance provide useful hints about the evolutionary significance of FKBP and ubiquitin. Regarding FKBP, mRNA expression and protein accumulation seem to depend on the environmental conditions and the evolutionary history of each Artemia population while ubiquitin has a clear and more conserved role under heat shock.

  4. Mechanisms associated with cellular desiccation tolerance of Artemia encysted embryos from locations around the world.

    Science.gov (United States)

    Hengherr, Steffen; Schill, Ralph O; Clegg, J S

    2011-10-01

    Using differential scanning calorimetry we demonstrated the presence of biological glasses and measured the glass transition temperatures (Tg) in dry encysted gastrula embryos (cysts) of the brine shrimp, Artemia, from eleven different locations, two of which provided cysts from parthenogenetic animals. Values for Tg were highest, by far, in Artemia franciscana cysts from the Mekong Delta, Vietnam (VN), these cysts having been produced from previous sequential inoculations into growth ponds of cysts from the San Francisco Bay, California, USA. Tg values for three groups of A. franciscana cysts were significantly higher than those of other cysts (except those of Artemia persimilis) studied here, as well as all other desiccation-tolerant animal systems studied to date. We also measured three stress proteins (hsc70, artemin and p26) in all these cysts as well as the total alcohol soluble carbohydrates (ASC), about 90% of which is the disaccharide trehalose, a known component of biological glasses. We interpret the results in terms of mechanisms involved with desiccation tolerance and, to some extent, with thermal conditions at the sites of cyst collection.

  5. Automatic Estimation of Artemia Hatching Rate Using an Object Discrimination Method

    Directory of Open Access Journals (Sweden)

    Sung Kim

    2013-09-01

    Full Text Available Digital image processing is a process to analyze a large volume of information on digital images. In this study, Artemia hatching rate was measured by automatically classifying and counting cysts and larvae based on color imaging data from cyst hatching experiments using an image processing technique. The Artemia hatching rate estimation consists of a series of processes; a step to convert the scanned image data to a binary image data, a process to detect objects and to extract their shape information in the converted image data, an analysis step to choose an optimal discriminant function, and a step to recognize and classify the objects using the function. The function to classify Artemia cysts and larvae is optimally estimated based on the classification performance using the areas and the plan-form factors of the detected objects. The hatching rate using the image data obtained under the different experimental conditions was estimated in the range of 34-48%. It was shown that the maximum difference is about 19.7% and the average root-mean squared difference is about 10.9% as the difference between the results using an automatic counting (this study and a manual counting were compared. This technique can be applied to biological specimen analysis using similar imaging information.

  6. Regulation of trehalase expression inhibits apoptosis in diapause cysts of Artemia.

    Science.gov (United States)

    Yang, Fan; Chen, Su; Dai, Zhong-Min; Chen, Dian-Fu; Duan, Ru-Bing; Wang, Hong-Liang; Jia, Sheng-Nan; Yang, Wei-Jun

    2013-12-01

    Trehalase, which specifically hydrolyses trehalose into glucose, plays an important role in the metabolism of trehalose. Large amounts of trehalose are stored in the diapause encysted embryos (cysts) of Artemia, which are not only vital to their extraordinary stress resistance, but also provide a source of energy for development after diapause is terminated. In the present study, a mechanism for the transcriptional regulation of trehalase was described in Artemia parthenogenetica. A trehalase-associated protein (ArTAP) was identified in Artemia-producing diapause cysts. ArTAP was found to be expressed only in diapause-destined embryos. Further analyses revealed that ArTAP can bind to a specific intronic segment of a trehalase gene. Knockdown of ArTAP by RNAi resulted in the release of cysts with coarse shells in which two chitin-binding proteins were missing. Western blotting showed that the level of trehalase was increased and apoptosis was induced in these ArTAP-knockdown cysts compared with controls. Taken together, these results show that ArTAP is a key regulator of trehalase expression which, in turn, plays an important role in trehalose metabolism during the formation of diapause cysts.

  7. Laboratory generation of new parthenogenetic lineages supports contagious parthenogenesis in Artemia

    Directory of Open Access Journals (Sweden)

    Marta Maccari

    2014-06-01

    Full Text Available Contagious parthenogenesis—a process involving rare functional males produced by a parthenogenetic lineage which mate with coexisting sexual females resulting in fertile parthenogenetic offspring—is one of the most striking mechanisms responsible for the generation of new parthenogenetic lineages. Populations of the parthenogenetic diploid brine shrimp Artemia produce fully functional males in low proportions. The evolutionary role of these so-called Artemia rare males is, however, unknown. Here we investigate whether new parthenogenetic clones could be obtained in the laboratory by mating these rare males with sexual females. We assessed the survival and sex ratio of the hybrid ovoviviparous offspring from previous crosses between rare males and females from all Asiatic sexual species, carried out cross-mating experiments between F1 hybrid individuals to assess their fertility, and estimated the viability and the reproductive mode of the resulting F2 offspring. Molecular analysis confirmed the parentage of hybrid parthenogenetic F2. Our study documents the first laboratory synthesis of new parthenogenetic lineages in Artemia and supports a model for the contagious spread of parthenogenesis. Our results suggest recessive inheritance but further experiments are required to confirm the likelihood of the contagious parthenogenesis model.

  8. Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii.

    Science.gov (United States)

    Kokkali, Varvara; Katramados, Ioannis; Newman, Jeffrey D

    2011-03-28

    This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop computer. Four nauplii were inserted into a macro cuvette, which contained copper, cadmium, iron and zinc ions at various concentrations. The nauplii were then filmed inside the dark chamber for two minutes and the video sequence was processed by a motion tracking algorithm that estimated their mobility. The results obtained by this system were compared to the mortality assay of the Artemia salina nauplii. Despite the small number of tested organisms, this system demonstrates great sensitivity in quantifying the mobility of the nauplii, which leads to significantly lower EC50 values than those of the mortality assay. Furthermore, concentrations of parts per trillion of toxic compounds could be detected for some of the metals. The main novelty of this instrument relies in the sub-pixel accuracy of the tracking algorithm that enables robust measurement of the deterioration of the mobility of Artemia salina even at very low concentrations of toxic metals.

  9. Toxicity and characterization of cholinesterase-inhibition induced by diisopropyl fluorophosphate in Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Barahona, M V

    2009-03-01

    The acute toxicity of diisopropyl fluorophosphate (DFP) on three age classes of Artemia salina was evaluated. An increase in toxicity of this organophosphorous (OP) compound was found following longer development of A. salina larvae. The effects of pretreatment with the non-selective muscarinic antagonist atropine, the two reversible acetylcholinesterase inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on DFP-induced lethality in 24h Artemia were also investigated. The lethal action of DFP was not prevented by pretreatment of 24h Artemia with atropine, physostigmine, and pyridostigmine, while 2-PAM proved effective against intoxication with this OP compound. The inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM or physostigmine were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Pretreatment with 2-PAM (10(-6)M) plus physostigmine or pyridostigmine was ineffective. These results suggest that the combinations of atropine plus 2-PAM or physostigmine are effective in the prevention of the lethal effects induced by DFP in A. salina larvae.

  10. On a parthenogenetic population of Artemia (Crustacea, Branchiopoda from Algeria (El-Bahira, Sétif

    Directory of Open Access Journals (Sweden)

    Mounia Amarouayache

    2015-12-01

    Full Text Available The brine shrimp Artemia is a small crustacean of hypersaline lakes which is commonly used in larviculture. The parthenogenetic population of Artemia from El-Bahira Lake (10 ha area, situated in the High Plateaus of Northeastern Algeria (1034 m alt, has been characterized and surveyed during two hydroperiods of 2009 and 2013. Contrary to other known parthenogenetic populations, which develop in hot seasons and reproduce by ovoviviparity, Artemia from El-Bahira was found to develop only in cold seasons (winter and spring, even if the lake doesn’t dry in summer. It reproduces by oviparity and produces few cysts (5.69 ± 3.6 and 98.00 ± 28.32 offsprings/brood. Individual density was much lower during the hydroperiod of 2013, whereas fecundity was higher than in the previous hydroperiod (2009. Cyst reserve was estimated at 133.13 kg of dry weight which corresponds to a rate of 13.31 kg.ha-1.

  11. Tenebrio molitor L. (Coleoptera: Tenebrionidae) larva ve pupasının yağ asidi bileşimi

    OpenAIRE

    Deniz TAŞKIN; AKSOYLAR, M. Yaşar

    2010-01-01

    Fatty acid compositions of last instar larvae and pupae of Tenebrio molitor were analysed by gas chromatographic methods. It was determined that total fatty acid compositions of both stages were contituted C12:0-C18:2 fatty acids. Oleic acid was found as the major fatty acid. Palmitic and linoleic acids also were high pencentage fatty acids.

  12. Comparison of toxicity of congener-153 of PCB, PBB, and PBDE to Daphnia magna.

    Science.gov (United States)

    Nakari, Tarja; Huhtala, Sami

    2008-10-01

    Acute and reproductive toxicity tests were performed to assess the effects of two polybrominated flame retardants, polybrominated biphenyl (PBB)-153, polybrominated diphenyl ether (PBDE)-153, and polychlorinated biphenyl (PCB)-153 on Daphnia magna. According to the 24-h acute toxicity test, up to concentration of 210 microg/L, these chemicals were not toxic to Daphnia. In the reproductive tests, we used concentrations of 12.5, 25, 50, and 100 microg/L. At the concentrations of 50 and 100 microg/L, the Daphnia started to die after the second test day, and there were no Daphnia alive on the fourth test day. The testing was continued using the concentrations of 12.5 and 25 microg/L. The reproductive tests were then repeated using only concentrations of 12.5 and 25 microg/L. The results, based on the weight per volume (w/v) concentrations, showed that of the three compounds we tested PCB-153 had the most severe effects on the Daphnia reproduction. PBDE-153 was the least toxic, although in this group, too, offspring production was significantly lower and mortality significantly higher than those in the control group. Also, it was observed that PCB-153 accumulated into the parent Daphnia nearly three times more actively than the two other chemicals we tested. These chemicals, although having very similar structures, seem to affect differently the reproduction of Daphnia. They also seem to accumulate differently into Daphnia. Thus, further research data are needed to understand the mechanisms responsible for the effects caused by these kinds of chemicals and to assess their risks accurately.

  13. How does the cladoceran Daphnia pulex affect the fate of Escherichia coli in water?

    Science.gov (United States)

    Burnet, Jean-Baptiste; Faraj, Tarek; Cauchie, Henry-Michel; Joaquim-Justo, Célia; Servais, Pierre; Prévost, Michèle; Dorner, Sarah M.

    2017-01-01

    The faecal indicator Escherichia coli plays a central role in water quality assessment and monitoring. It is therefore essential to understand its fate under various environmental constraints such as predation by bacterivorous zooplankton. Whereas most studies have examined how protozooplankton communities (heterotrophic nanoflagellates and ciliates) affect the fate of E. coli in water, the capacity of metazooplankton to control the faecal indicator remains poorly understood. In this study, we investigated how the common filter-feeding cladoceran, Daphnia pulex, affects the fate of E. coli under different experimental conditions. Daphnia ingested E. coli and increased its loss rates in water, but the latter rates decreased from 1.65 d-1 to 0.62 d-1 after a 1,000-fold reduction in E. coli initial concentrations, due to lower probability of encounter between Daphnia and E. coli. The combined use of culture and PMA qPCR (viability-qPCR) demonstrated that exposure to Daphnia did not result into the formation of viable but non-culturable E. coli cells. In lake water, a significant part of E. coli population loss was associated with matrix-related factors, most likely due to predation by other bacterivorous biota and/or bacterial competition. However, when exposing E. coli to a D. pulex gradient (from 0 to 65 ind.L-1), we observed an increasing impact of Daphnia on E. coli loss rates, which reached 0.47 d-1 in presence of 65 ind.L-1. Our results suggest that the filter-feeder can exert a non-negligible predation pressure on E. coli, especially during seasonal Daphnia population peaks. Similar trials using other Daphnia species as well as stressed E. coli cells will increase our knowledge on the capacity of this widespread zooplankter to control E. coli in freshwater resources. Based on our results, we strongly advocate the use of natural matrices to study these biotic interactions in order to avoid overestimation of Daphnia impact. PMID:28178322

  14. Temperature-dependent effect of filamentous cyanobacteria on Daphnia magna life history traits

    OpenAIRE

    Dawidowicz, Piotr; Joanna ŁOŚ; Anna BEDNARSKA

    2011-01-01

    Filamentous cyanobacteria are unsuitable food for Daphnia due to their poor manageability, poor nutritional value and, in some cases, toxicity. As the strength of harmful effects of cyanobacteria on filter-feeding zooplankton is temperature dependent, the global warming scenarios for eutrophic lakes in temperate zone might include an escalated suppression of Daphnia populations caused by the presence of cyanobacterial filaments. To test this assumption, we conducted life-table experiments wit...

  15. Effect of body size on toxicity of zinc in neonates of four differently sized Daphnia species

    NARCIS (Netherlands)

    Vesela, S.; Vijverberg, J.

    2007-01-01

    The sensitivity of neonates of four Daphnia species to zinc was tested in relation to their mean body size. These mean sizes of these four Daphnia spp were: D. magna, 0.813 ± 0.055 mm, D.␣pulicaria, 0.745 ± 0.063 mm, D. pulex, 0.645 ± 0.044 mm and D. galeata, 0.611 ± 0.058 mm. A positive relationshi

  16. Biogeography of the ‘water flea’ Daphnia O. F. Müller (Crustacea: Branchiopoda: Anomopoda on the Indian subcontinent

    Directory of Open Access Journals (Sweden)

    Sameer M. Padhye

    2016-06-01

    Full Text Available Studies on Daphnia distribution in Indian subcontinent have been few and regionally restricted despite Daphnia being by far the most studied cladoceran. We here present a first biogeographical assessment of the genus on the Indian subcontinent (Afghanistan, Pakistan, India, Nepal, Bhutan, Bangladesh and Sri Lanka. We collected all pertinent literature and considered nineteen bioclimatic variables along with latitude, longitude, and altitude for statistical analysis of factors governing distribution in space. Significant variables (determined by Kruskal Wallis test were tested by nonparametric multivariate analysis of variance (PERMANOVA to clarify whether Daphnia species had specific environmental requirements. Canonical correspondence analysis was used to understand how environmental variables affected distribution.  Eight Daphnia (Ctenodaphnia and 4 Daphnia s.str. occurred at 100 different localities. The variables temperature, altitude and latitude differed among species and so did their bio-climatic requirements. Daphnia distribution responded positively to altitude and negatively to a decrease in latitude and temperature.

  17. Effect of Larval Density on Food Utilization Efficiency of Tenebrio molitor (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Morales-Ramos, Juan A; Rojas, M Guadalupe

    2015-10-01

    Crowding conditions of larvae may have a significant impact on commercial production efficiency of some insects, such as Tenebrio molitor L. (Coleoptera: Tenebrionidae). Although larval densities are known to affect developmental time and growth in T. molitor, no reports were found on the effects of crowding on food utilization. The effect of larval density on food utilization efficiency of T. molitor larvae was studied by measuring efficiency of ingested food conversion (ECI), efficiency of digested food conversion (EDC), and mg of larval weight gain per gram of food consumed (LWGpFC) at increasing larval densities (12, 24, 36, 48, 50, 62, 74, and 96 larvae per dm(2)) over four consecutive 3-wk periods. Individual larval weight gain and food consumption were negatively impacted by larval density. Similarly, ECI, ECD, and LWGpFC were negatively impacted by larval density. Larval ageing, measured as four consecutive 3-wk periods, significantly and independently impacted ECI, ECD, and LWGpFC in a negative way. General linear model analysis showed that age had a higher impact than density on food utilization parameters of T. molitor larvae. Larval growth was determined to be responsible for the age effects, as measurements of larval mass density (in grams of larvae per dm(2)) had a significant impact on food utilization parameters across ages and density treatments (in number of larvae per dm(2)). The importance of mass versus numbers per unit of area as measurements of larval density and the implications of negative effects of density on food utilization for insect biomass production are discussed.

  18. Heritability of hsp70 expression in the beetle Tenebrio molitor: Ontogenetic and environmental effects.

    Science.gov (United States)

    Lardies, Marco A; Arias, María Belén; Poupin, María Josefina; Bacigalupe, Leonardo D

    2014-08-01

    Ectotherms constitute the vast majority of terrestrial biodiversity and are especially likely to be vulnerable to climate warming because their basic physiological functions such as locomotion, growth, and reproduction are strongly influenced by environmental temperature. An integrated view about the effects of global warming will be reached not just establishing how the increase in mean temperature impacts the natural populations but also establishing the effects of the increase in temperature variance. One of the molecular responses that are activated in a cell under a temperature stress is the heat shock protein response (HSP). Some studies that have detected consistent differences among thermal treatments and ontogenetic stages in HSP70 expression have assumed that these differences had a genetic basis and consequently expression would be heritable. We tested for changes in quantitative genetic parameters of HSP70 expression in a half-sib design where individuals of the beetle Tenebrio molitor were maintained in constant and varying thermal environments. We estimated heritability of HSP70 expression using a linear mixed modelling approach in different ontogenetic stages. Expression levels of HSP70 were consistently higher in the variable environment and heritability estimates were low to moderate. The results imply that within each ontogenetic stage additive genetic variance was higher in the variable environment and in adults compared with constant environment and larvae stage, respectively. We found that almost all the genetic correlations across ontogenetic stages and environment were positive. These suggest that directional selection for higher levels of expression in one environment will result in higher expression levels of HSP70 on the other environment for the same ontogenetic stage.

  19. Enantiomerization and enantioselective bioaccumulation of benalaxyl in Tenebrio molitor larvae from wheat bran.

    Science.gov (United States)

    Gao, Yongxin; Chen, Jinhui; Wang, Huili; Liu, Chen; Lv, Xiaotian; Li, Jianzhong; Guo, Baoyuan

    2013-09-25

    The enantiomerization and enatioselecive bioaccumulation of benalaxyl by dietary exposure to Tenebrio molitor larvae under laboratory conditions were studied by HPLC-MS/MS. Exposure of enantiopure R-benalaxyl and S-benalaxyl in T. molitor larvae revealed significant enantiomerization with formation of the R enantiomers from the S enantiomers, and vice versa. Enantiomerization was not observed in wheat bran during the period of 21 days. For the bioaccumulation experiment, the enantiomer fraction in T. molitor larvae was maintained approximately at 0.6, whereas the enantiomer fraction in wheat bran was maintained at 0.5; in other words, the bioaccumulation of benalaxyl was enantioselective in T. molitor larvae. Mathematical models for a process of uptake, degradation, and enantiomerization were developed, and the rates of uptake, degradation, and enantiomerization of R-benealaxyl and S-benealaxyl were estimated, respectively. The results were that the rate of uptake of R-benalaxyl (kRa = 0.052 h(-1)) was slightly lower than that of S-benalaxyl (kSa = 0.061 h(-1)) from wheat bran; the rate of degradation of R-benalaxyl (kRd = 0.285 h(-1)) was higher than that of S-benalaxyl (kSd = 0.114 h(-1)); and the rate of enantiomerization of R-benalaxyl (kRS = 0.126 h(-1)) was higher than that of S-benalaxyl (kSR = 0.116 h(-1)). It was suggested that enantioselectivtiy was caused not only by actual degradation and metabolism but also by enantiomerization, which was an important process in the environmental fate and behavior of chiral pesticides.

  20. Uptake of Cadmium, Lead and Arsenic by Tenebrio molitor and Hermetia illucens from Contaminated Substrates

    Science.gov (United States)

    van der Fels-Klerx, H. J.; Camenzuli, L.; van der Lee, M. K.; Oonincx, D. G. A. B.

    2016-01-01

    Insects have potential as a novel source of protein in feed and food production in Europe, provided they can be used safely. To date, limited information is available on the safety of insects, and toxic elements are one of the potential hazards of concern. Therefore, we aimed to investigate the potential accumulation of cadmium, lead and arsenic in larvae of two insect species, Tenebrio molitor (yellow mealworm) and Hermetia illucens (black soldier fly), which seem to hold potential as a source of food or feed. An experiment was designed with 14 treatments, each in triplicate, per insect species. Twelve treatments used feed that was spiked with cadmium, lead or arsenic at 0.5, 1 and 2 times the respective maximum allowable levels (ML) in complete feed, as established by the European Commission (EC). Two of the 14 treatments consisted of controls, using non-spiked feed. All insects per container (replicate) were harvested when the first larva in that container had completed its larval stage. Development time, survival rates and fresh weights were similar over all treatments, except for development time and total live weight of the half of the maximum limit treatment for cadmium of the black soldier fly. Bioaccumulation (bioaccumulation factor > 1) was seen in all treatments (including two controls) for lead and cadmium in black soldier fly larvae, and for the three arsenic treatments in the yellow mealworm larvae. In the three cadmium treatments, concentrations of cadmium in black soldier fly larvae are higher than the current EC maximum limit for feed materials. The same was seen for the 1.0 and 2.0 ML treatments of arsenic in the yellow mealworm larvae. From this study, it can be concluded that if insects are used as feed materials, the maximum limits of these elements in complete feed should be revised per insect species. PMID:27846238

  1. Dipeptidyl peptidase 4 - An important digestive peptidase in Tenebrio molitor larvae.

    Science.gov (United States)

    Tereshchenkova, Valeriia F; Goptar, Irina A; Kulemzina, Irina A; Zhuzhikov, Dmitry P; Serebryakova, Marina V; Belozersky, Mikhail A; Dunaevsky, Yakov E; Oppert, Brenda; Filippova, Irina Yu; Elpidina, Elena N

    2016-09-01

    Dipeptidyl peptidase 4 (DPP 4) is a proline specific serine peptidase that plays an important role in different regulatory processes in mammals. In this report, we isolated and characterized a unique secreted digestive DPP 4 from the anterior midgut of a stored product pest, Tenebrio molitor larvae (TmDPP 4), with a biological function different than that of the well-studied mammalian DPP 4. The sequence of the purified enzyme was confirmed by mass-spectrometry, and was identical to the translated RNA sequence found in a gut EST database. The purified peptidase was characterized according to its localization in the midgut, and substrate specificity and inhibitor sensitivity were compared with those of human recombinant DPP 4 (rhDPP 4). The T. molitor enzyme was localized mainly in the anterior midgut of the larvae, and 81% of the activity was found in the fraction of soluble gut contents, while human DPP 4 is a membrane enzyme. TmDPP 4 was stable in the pH range 5.0-9.0, with an optimum activity at pH 7.9, similar to human DPP 4. Only specific inhibitors of serine peptidases, diisopropyl fluorophosphate and phenylmethylsulfonyl fluoride, suppressed TmDPP 4 activity, and the specific dipeptidyl peptidase inhibitor vildagliptin was most potent. The highest rate of TmDPP 4 hydrolysis was found for the synthetic substrate Arg-Pro-pNA, while Ala-Pro-pNA was a better substrate for rhDPP 4. Related to its function in the insect midgut, TmDPP 4 efficiently hydrolyzed the wheat storage proteins gliadins, which are major dietary proteins of T. molitor.

  2. Evidence for a Phe-Gly-Leu-amide-like allatostatin in the beetle Tenebrio molitor.

    Science.gov (United States)

    Elliott, Karen L; Chan, Kuen Kuen; Stay, Barbara

    2010-03-01

    The allatostatins (ASTs) with Phe-Gly-Leu-amide C-terminal sequence are multifunctional neuropeptides discovered as inhibitors of juvenile hormone (JH) synthesis by corpora allata (CA) of cockroaches. Although these ASTs inhibit JH synthesis only in cockroaches, crickets, termites and locusts, isolation of peptides or of cDNA/genomic DNA or analysis of genomes indicates their occurrence in many orders of insects with the exception of coleopterans. The gene for these ASTs has not been found in the genome of the red flour beetle Tribolium castaneum (Family Tenebrionidae). Yet, in view of widespread occurrence of these peptides in insects, crustaceans and nematodes, they would be expected to occur in beetles. This study provides evidence for the presence of FGLa-like ASTs in the tenebrionid beetle, Tenebrio molitor, and scarabid beetle, Popillia japonica. Extract of brain from both beetles inhibited JH synthesis by cockroach CA dose dependently and reversibly. 20 brain equivalents of T. molitor and P. japonica extracts inhibited JH synthesis 64+/-5 and 65+/-0.6% respectively. Antibody against cockroach allatostatin (Diploptera punctata AST-7) used in an enzyme-linked immunosorbent assay reacted with brain extract of these beetles. Antibody against D. punctata AST-5 localized FGLa-like ASTs in the brain and subesophageal ganglion of T. molitor and P. japonica. In addition, pretreatment of T. molitor brain extract with anti-D. punctata AST-5 reduced the inhibition of JH synthesis and pretreatment of anti-D. punctata AST-5 with D. punctata AST-5 diminished the immunoreactivity of the antibody. Thus we predict that FGLa-like allatostatins will be found in beetles.

  3. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.

    Directory of Open Access Journals (Sweden)

    Jia-Ying Zhu

    Full Text Available BACKGROUND: Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. METHODOLOGY/PRINCIPAL FINDINGS: In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26% showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. CONCLUSIONS/SIGNIFICANCE: obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular

  4. Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.

    Science.gov (United States)

    Johnston, Paul R; Makarova, Olga; Rolff, Jens

    2013-12-06

    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo.

  5. Geometric analysis of nutrient balancing in the mealworm beetle, Tenebrio molitor L. (Coleoptera: Tenebrionidae).

    Science.gov (United States)

    Rho, Myung Suk; Lee, Kwang Pum

    2014-12-01

    Geometric analysis of the nutritional regulatory responses was performed on an omnivorous mealworm beetle, Tenebrio molitor L. (Coleoptera: Tenebrionidae) to test whether this beetle had the capacity to balance the intake of protein and carbohydrate. We also identified the pattern of ingestive trade-off employed when the insect was forced to balance the costs of over- and under-ingesting macronutrients. When allowed to mix their diet from two nutritionally imbalanced but complementary foods (protein-biased food: p35:c7 or p28:c5.6; carbohydrate-biased food: p7:c35 or p5.6:c28), beetles of both sexes actively regulated their intake of protein and carbohydrate to a ratio of 1:1. When confined to one of seven nutritionally imbalanced foods (p0:c42, p7:c35, p14:c28, p21:c21, p28:c14, p35:c7 or p42:c0), beetles over-ingested the excessive nutrient from these foods to such an extent that all the points of protein-carbohydrate intake aligned linearly in the nutrient space, a pattern that is characteristic of generalist feeders and omnivores. Under the restricted feeding conditions, males ate more nutrients but were less efficient at retaining their body lipids than females. Body lipid content was higher on carbohydrate-rich foods and was positively correlated with starvation resistance. Our results are consistent with the prediction based on the nutritional heterogeneity hypothesis, which links the nutritional regulatory responses of insects to their diet breadth and feeding ecology.

  6. Effects of He-Ne laser on Daphnia magna Straus manifested in subsequent generations

    Science.gov (United States)

    Vorob'yeva, O. V.; Filenko, O. F.; Isakova, E. F.; Vorobieva, N. N.; Rybaltovskii, A. O.; Yusupov, V. I.; Bagratashvili, V. N.

    2015-11-01

    The effects of He-Ne laser irradiation (including visible laser light 632.8 nm in wavelength and an attendant electromagnetic field from the laser apparatus) on the fertility, newborn quality and linear dimensions of the body of Cladocera Daphnia magna Straus were determined. It is shown that the attendant electromagnetic field generated by the laser apparatus can have significant impact on the results of low-intensity laser therapy. The laser light exposure of daphnia to a dose range of 1.7-1300 mJ cm-2 stimulates the integral functions of the daphnia’s body. At the same time, the attendant electromagnetic field (72 mA m-1 in the frequency range of 0.02-20 kHz and 400 mA m-1 in the frequency range of 3-4 MHz) causes the appearance of quickly dying and/or abnormal newborn (up to a small percent) that has never been observed in the control. Anomalies of daphnia mainly consisted of swimming antenna pathologies. Moreover, under the influence of the attendant electromagnetic field on parental daphnia only, these anomalies appear even in several subsequent generations of newborn. The negative impact on daphnia disappears completely after the suppression of the attendant electromagnetic field to laboratory background level. It is shown that laser light can partially compensate the negative impact of the attendant electromagnetic field on Daphnia.

  7. Effects of common-use pesticides on developmental and reproductive processes in Daphnia.

    Science.gov (United States)

    Kashian, Donna R; Dodson, Stanley I

    2002-06-01

    Daphnia magna were evaluated for use as a screen for pesticides that have been demonstrated to have estrogenic (o'p'-DDT, di-n-butyl phthalate, toxaphene), anti-androgenic (p'p-DDE, linuron), thyroid (acetochlor, alachlor, metribuzin), insulin (amitraz) or lutenizing hormone (2,4-D) activity in vertebrates, and to establish daphnid sensitivity to these compounds. Pesticides with unknown effects on vertebrate endocrine systems (chlorosulfuran, cyanazine, diflubenzuron, metolachlor, and diquat) were also evaluated. Compounds were assayed for six days at environmentally relevant concentrations ranging from 0.001 to 100 mirog/L, using female Daphnia and their offspring. Sublethal endpoints included offspring sex (sex determination), clutch size (fecundity), and adult size (growth rate). Toxaphene was the only compound that affected sexual differentiation, increasing male production. Daphnia fecundity declined with exposure to toxaphene, and daphnid growth rates were reduced by acetochlor exposure. Diflubenzuron, o'p'-DDT, and p'p-DDE significantly reduced Daphnia survival. No correlation existed between affected reproductive or developmental processes and specific endocrine systems or subsystems. Results from this study indicate that Daphnia make a good screen for assessing potential environmental impacts but are not a useful indicator of pesticide hormonal activity in vertebrates. This assay consistently detected sublethal but ecologically relevant effects of these pesticides on Daphnia at environmentally relevant concentrations typically below their listed EC50 value.

  8. Cytological, molecular and life cycle characterization of Anostracospora rigaudi n. g., n. sp. and Enterocytospora artemiae n. g., n. sp., two new microsporidian parasites infecting gut tissues of the brine shrimp Artemia.

    Science.gov (United States)

    Rode, Nicolas Olivier; Landes, Julie; Lievens, Eva J P; Flaven, Elodie; Segard, Adeline; Jabbour-Zahab, Roula; Michalakis, Yannis; Agnew, Philip; Vivarès, Christian P; Lenormand, Thomas

    2013-08-01

    Two new microsporidia, Anostracospora rigaudi n. g., n. sp., and Enterocytospora artemiae n. g., n. sp. infecting the intestinal epithelium of Artemia parthenogenetica Bowen and Sterling, 1978 and Artemia franciscana Kellogg, 1906 in southern France are described. Molecular analyses revealed the two species belong to a clade of microsporidian parasites that preferentially infect the intestinal epithelium of insect and crustacean hosts. These parasites are morphologically distinguishable from other gut microsporidia infecting Artemia. All life cycle stages have isolated nuclei. Fixed spores measure 1·3×0·7 μm with 5-6 polar tube coils for A. rigaudi and 1·2×0·9 μm with 4 polar tube coils for E. artemiae. Transmission of both species is horizontal, most likely through the ingestion of spores released with the faeces of infected hosts. The minute size of these species, together with their intestinal localization, makes their detection and identification difficult. We developed two species-specific molecular markers allowing each type of infection to be detected within 3-6 days post-inoculation. Using these markers, we show that the prevalence of these microsporidia ranges from 20% to 75% in natural populations. Hence, this study illustrates the usefulness of molecular approaches to study prevalent, but cryptic, infections involving microsporidian parasites of gut tissues.

  9. Purification and characterization of tenecin 4, a new anti-Gram-negative bacterial peptide, from the beetle Tenebrio molitor.

    Science.gov (United States)

    Chae, Jun-Ho; Kurokawa, Kenji; So, Young-In; Hwang, Hyun Ok; Kim, Min-Su; Park, Ji-Won; Jo, Yong-Hun; Lee, Yong Seok; Lee, Bok Luel

    2012-03-01

    The biochemical characterization of novel antimicrobial peptides (AMPs) and the determination of ligand molecules that induce AMP production are essential for understanding the host innate immune response in insects. Here, we purified a new 14-kDa AMP, named tenecin 4, from the larval hemolymph of the beetle Tenebrio molitor. Tenecin 4 contains 14% glycine residues and has moderate similarities both to the C-terminal region of Drosophila attacin and to silk-moth gloverin proteins. Purified tenecin 4 showed bactericidal activity against Gram-negative Escherichia coli but not against Gram-positive Bacillus subtilis or the fungus Candida albicans. Tenecin 4 production was induced by Toll cascade-activating ligands, such as β-1,3-glucan, lysine-type peptidoglycan and active Spätzle, and by the probable Imd pathway-activating ligand monomeric meso-diaminopimelic acid-type peptidoglycan. Taken together, these data show that tenecin 4 is a defense protein against Gram-negative pathogens and is induced by multiple ligands in Tenebrio larvae.

  10. Accumulation of mercury by Artemia populations of different salinas of Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Boia, C.M.; Duarte, A.C. [Univ. of Aveiro (Portugal)

    1995-12-31

    The total mercury content in samples of the brine shrimp Artemia, sediments, water, suspended matter and, when available, algae, from nine salines of Portugal, was evaluated, to find out how mercury present in its natural habitat accumulates in Artemia. This study, carried out between 1990 and 1993, was part of a larger research project aiming to contribute to the knowledge on mercury accumulation and its effects on Artemia. This crustacean is used worldwide for marine species feeding in aquafarms, including in Portugal. The following sampling sites were chosen: some salinas of the lagoon of Aveiro, situated in the northern region of Portugal and partially contaminated with mercury-, the salt-mines of Rio Maior, in the interior of the central region of the country, where there are no sediments (the floor is cemented); and salt-marshes in the Algarve, in the south of Portugal. Mercury was determined by cold vapor absorption espectrofotometry after digestion of samples with sulfuric acid and potassium permanganate, and reference materials have been used to control the analytical performance. The concentrations of total Hg varied from 0.014 to 0.36 mg/Kg in the sediments, 0 to 0.30 {micro}g/g in the Artemia, 0.17 to 0.84 {micro}g/l in the suspended matter and 0.09 to 0.56 {micro}g/l in the water. The content of mercury in the artemias was strongly related to the concentration in the sediments, except when the algae were present, because they also accumulate a significantly percentage of the mercury. No relationships could be established with the Hg in water or in suspended matter (in mass of Hg/volume of filtered water), because their, content in Hg varied a lot with time and weather conditions, such as the wind strength. The presence of Hg in the sediments was due either to significant containing Hg discharges or to the composition of the sediments, being more important in the case of clays.

  11. Inferring Deleterious-Mutation Parameters in Natural Daphnia Populations

    Directory of Open Access Journals (Sweden)

    Deng Hong-Wen

    1998-01-01

    Full Text Available Deng and Lynch (1, 2 proposed to characterize deleterious genomic mutations from changes in the mean and genetic variance of fitness traits upon selfing in outcrossing populations. Such observations can be readily acquired in cyclical parthenogens. Selfing and life-table experiments were performed for two such Daphnia populations. A significant inbreeding depression and an increase of genetic variance for all traits analyzed were observed. Deng and Lynch's (2 procedures were employed to estimate the genomic mutation rate (U, mean dominance coefficient ( , mean selection coefficient ( , and scaled genomic mutational variance ( . On average, , , and (^ indicates an estimate are 0.84, 0.30, 0.14 and 4.6E-4 respectively. For the true values, the and are lower bounds, and and upper bounds.

  12. Experimental assessment of environmental influences on the stable isotopic composition of Daphnia pulicaria and their ephippia

    Science.gov (United States)

    Schilder, J.; Tellenbach, C.; Möst, M.; Spaak, P.; van Hardenbroek, M.; Wooller, M. J.; Heiri, O.

    2015-02-01

    The stable isotopic composition of fossil resting eggs (ephippia) of Daphnia spp. is being used to reconstruct past environmental conditions in lake ecosystems. However, the underlying assumption that the stable isotopic composition of the ephippia reflects the stable isotopic composition of the parent Daphnia, of their diet and of the environmental water have yet to be confirmed in a controlled experimental setting. We performed experiments with Daphnia pulicaria cultures, which included a control treatment conducted at 12 °C in filtered lake water and with a diet of fresh algae, and three treatments in which we manipulated the stable carbon isotopic composition (δ13C value) of the algae, stable oxygen isotopic composition (δ18O value) of the water, and the water temperature, respectively. The stable nitrogen isotopic composition (δ15N value) of the algae was similar for all treatments. At 12 °C, differences in algal δ13C values and in δ18O values of water are reflected in those of Daphnia. The differences between ephippia and Daphnia stable isotope ratios were similar in the different treatments (δ13C: + 0.2 ± 0.4‰ (SD); δ15N: -1.6 ± 0.4‰; δ18O: -0.9 ± 0.4‰) indicating that changes in dietary δ13C and δ18O values of water are passed on to these fossilizing structures. A higher water temperature (20 °C) resulted in lower δ13C values in Daphnia and ephippia than in the other treatments with the same food source and in a minor change in the difference between δ13C values of ephippia and Daphnia (to -1.3 ± 0.3‰). This may have been due to microbial processes or increased algal respiration rates in the experimental containers, which may not affect Daphnia in natural environments. There was no significant difference in the offset between δ18O and δ15N values of ephippia and Daphnia between the 12 °C and 20 °C treatments, but the δ18O values of Daphnia and ephippia were on average 1.2‰ lower at 20 °C compared with 12 °C. We conclude

  13. Incidence of diapause varies among populations of Daphnia pulicaria.

    Science.gov (United States)

    Cáceres, Carla E; Tessier, Alan J

    2004-11-01

    Dormancy is a common way in which organisms survive environmental conditions that would be lethal to the active individual. However, while dormant, individuals forego reproduction. Hence theory suggests an optimal time in which to enter dormancy, depending on risks associated with both remaining active and entering dormancy. When these relative risks differ among habitats, dormancy strategies are predicted to vary as well. For freshwater zooplankton, it has been suggested that sensitivity to the cues that initiate dormancy should be selected against when females have the opportunity to remain in the water column year round. We tested this prediction with 12 populations of lake-dwelling Daphnia pulicaria (Crustacea: Cladocera). Differences among lakes in basin morphometry, predators and resources create a gradient of risk for Daphnia in the water column. Some populations persist in high numbers year round while others are abundant only in spring. We used this difference in persistence ability as an estimate of risk in the water-column. For 3 years of field sampling we found consistent differences among the lake populations in the incidence of dormancy. In some populations, only a small fraction of females switched to producing dormant eggs each year whereas in others the majority of eggs produced in the late spring were dormant. In general, populations that experienced predictably low abundances in the active form exhibited higher incidence of dormancy than did populations that persisted in high abundance year round, but there were exceptions. Our results confirm that the incidence of dormancy varies considerably among populations in a fashion consistent with general theory, but suggest that persistence in the water column is not the sole predictor of the diapause strategy found in any particular lake.

  14. Reproduction of Daphnia pulex in a Northern Italy pond

    Directory of Open Access Journals (Sweden)

    Valeria Rossi

    2014-04-01

    Full Text Available This paper reports on the occurrence of Daphnia pulex in a small fishless water body of Northern Italy (Bodrio del pastore III and describes its population dynamics. Bodrio is a typical water body originated by erosion from the old Po river-bed surface. During a three year study (2011-2013, D. pulex population showed an increase in density from spring to early summer, it declined in July-August and did not recover, presumably from ephippia, until the following spring. The seasonal dynamics was related to the species thermal tolerance and to invertebrate predation by Chaoborus that resulted in juvenile high mortality and in adaptive predator-avoidance cyclomorphosis. Seasonal variation was observed in the frequency of individuals, most juveniles, showing neckteeth. D. pulex population reproduces by cyclical parthenogenesis and showed a very early investment in sexual reproduction, independent of population density. Males and ephippial females appeared at the beginning of growth season before the density peak according to a typical feature of Daphnia populations from temporary habitats. This suggests a lower influence of the environmental factors on sex determination compared to populations inhabiting more permanent habitats. Lineages that produce males and ephippial females early in the season had lower growth rate than parthenogenetic ones but may preserve from selection pressure by predators a significant percentage of genetic variation linked to sex allocation so that evolution proceeds toward earlier and increased sexual reproduction. Our results suggest further investigation to verify whether the current population is the last remnant of a once much larger metapopulation eventually reduced by anthropogenic disturbances or if it represents the invasion of North American strains.

  15. Comet Assay on Daphnia magna in eco-genotoxicity testing.

    Science.gov (United States)

    Pellegri, Valerio; Gorbi, Gessica; Buschini, Annamaria

    2014-10-01

    Detection of potentially hazardous compounds in water bodies is a priority in environmental risk assessment. For the evaluation and monitoring of water quality, a series of methodologies may be applied. Among them, the worldwide used toxicity tests with organisms of the genus Daphnia is one of the most powerful. In recent years, some attempts were made to utilize Daphnia magna in genotoxicity testing as many of the new environmental contaminants are described as DNA-damaging agents in aquatic organisms. The aim of this research was to develop a highly standardized protocol of the Comet Assay adapted for D. magna, especially regarding the isolation of cells derived from the same tissue (haemolymph) from newborn organisms exposed in vivo. Several methods for haemolymph extraction and different Comet Assay parameters were compared. Electrophoretic conditions were adapted in order to obtain minimum DNA migration in cells derived from untreated organisms and, at the same time, maximum sensitivity in specimens treated with known genotoxicants (CdCl2 and H2O2). Additional tests were performed to investigate if life-history traits of the cladoceran (such as the age of adult organisms that provide newborns, the clutch size of origin, the number of generations reared in standard conditions) and the water composition as well, might influence the response of the assay. This study confirms the potential application of the Comet Assay in D. magna for assessing genotoxic loads in aqueous solution. The newly developed protocol could integrate the acute toxicity bioassay, thus expanding the possibility of using this model species in freshwater monitoring (waters, sediment and soil elutriates) and is in line with the spirit of the EU Water Framework Directive in reducing the number of bioassays that involve medium-sized species.

  16. Fertilizers for Daphnia sp. (Crustacea, Cladocera production in experimental tanks Fertilizantes para produção de Daphnia sp. (Crustacea, Cladocera em tanques experimentais

    Directory of Open Access Journals (Sweden)

    Patrícia de Souza Lima Cunha

    2010-05-01

    Full Text Available The current study was aimed at investigating the use of different fertilizers - dicalcium phosphate, biosolid and quail feces - as a strategy for water fertilization in Daphnia sp production. It was used twenty-four 100-L tanks of asbestos cement distributed in a completely randomized split-plot design with six replicates, with plots in the three kinds of fertilizers (biosolid, dicalcium phosphate, and quail feces and a control without fertilization (WF and subplots at the times of assessment (days 8 and 13. It was assessed the biomass production of Daphnia sp. and the following water quality parameters: chlorophyll a, electrical conductivity, pH, dissolved oxygen, temperature, ammonia and organic nitrogen, total phosphorus and total hardness. There was a significant correlation between the values of chlorophyll a and biomass weight of Daphnia sp, which indicates interactions between phytoplankton and zooplankton communities. The maximum weight of Daphnia sp. biomass is found in tanks fertilized with quail feces (35.98 g, followed by the biosolid (16.80 g, control without fertilization (6.75 g and dicalcium phosphate (5.24 g.Este trabalho foi conduzido com o objetivo de avaliar a utilização de fertilizantes - fosfato bicálcico, biossólido e fezes de codorna - na água de produção de Daphnia sp. Foram utilizados 24 tanques de cimento-amianto, cada um com volume útil de 100 L, em um delineamento inteiramente ao acaso em parcelas subdivididas com seis repetições, tendo nas parcelas os tipos de fertilizantes e um controle, sem adubação, e nas subparcelas as épocas de avaliação (dias 8 e 13. Foram avaliados a produção da biomassa de Daphnia sp. e os seguintes parâmetros de qualidade da água: clorofila a, condutividade elétrica, pH, oxigênio dissolvido, temperatura, nitrogênio amoniacal e orgânico, fósforo total e dureza total. Observou-se correlação significativa entre os valores de clorofila a e o peso da biomassa de Daphnia

  17. The effects of feeding with synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia on skin mucus immune responses, stress resistance, intestinal microbiota and performance of angelfish (Pterophyllum scalare).

    Science.gov (United States)

    Azimirad, Mahmood; Meshkini, Saeed; Ahmadifard, Nasrollah; Hoseinifar, Seyed Hossein

    2016-07-01

    The aim of this study was to evaluate the effects of feeding on synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia franciscana on skin mucus immune responses, stress resistance, intestinal microbiota and growth performance of angelfish (Pterophyllum scalare). Three hundred and sixty fish with initial weight 3.2 ± 0.13 g were randomly divided into twelve aquaria (50 L) assigned to four groups in triplicates. Fish were fed for 7 weeks with dietary treatments, including treatment 1: feeding adult Artemia without enrichment (control group), treatment 2: feeding adult Artemia enriched with lyophilised probiotic P. acidilactici (700 mg L(-1)), 3: feeding adult Artemia enriched with prebiotic fructooligosaccharide (FOS) (100 mg L(-1)), group 4: feeding adult Artemia enriched with synbiotic (P. acidilactici (700 mg L(-1)) + FOS (100 mg L(-1))). Skin mucus immune responses (lysozyme activity, total Immunoglobulin and protease), stress resistance against environmental stress (acute decrease of temperature and increase salinity), intestinal microbiota as well as growth indices were measured at the end of feeding trial. Artemia enriched with synbiotic significantly improved growth performance compared to other treatments (P Artemia enriched with synbiotic (P Artemia was more effective than singular enrichment with probiotics or prebiotics.

  18. Feeding of the brine shrimp Artemia on yeast: effect of mechanical disturbance, animal density, water quality and light intensity

    OpenAIRE

    Coutteau, P. (Peter); Sorgeloos, P.

    1989-01-01

    Details are given of experiments conducted to determine the effects of tank culture conditions on the feeding of Artemia. Mechanical disturbance, animal density and water quality were found to affect the feeding rate of Artemia. The importance of culture conditions in maintaining a rate of food consumption which does not limit the growth of the brine shrimp is stressed.

  19. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Directory of Open Access Journals (Sweden)

    Behnam Shekarchi

    2016-02-01

    Full Text Available Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME (3.5% v/v. Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P < 0.05. So, the results showed that Artemia urmiana adults individuals that fed with 2MEtreated yeasts had the highest growth and total length. These results were confirmed with growth measurement in adult individuals of Artemia. Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  20. Efficacy of heterologous and homologous heat shock protein 70s as protective agents to Artemia franciscana challenged with Vibrio campbellii.

    Science.gov (United States)

    Baruah, Kartik; Ranjan, Jayant; Sorgeloos, Patrick; Bossier, Peter

    2010-11-01

    The Hsp70 class of heat shock proteins (Hsps) has been implicated at multiple points in the immune response of both vertebrates and invertebrates. This class of chaperones is highly conserved in both sequence and structure, from prokaryotes to higher eukaryotes. In view of their high degree of homology, it was assumed that these Hsp70 proteins derived either from the prokaryotes or eukaryotes would have similar functions, especially in relation to their protective ability in a challenge assay. To verify this, we compared two evolutionary diverse Hsp70s, Artemia Hsp70 and Escherichia coli Hsp70 equivalent DnaK (each overproduced in E.coli), for their ability to protect Artemia against Vibrio challenge. Results showed that Artemia fed with E. coli producing Artemia Hsp70 or DnaK proteins, as assessed by immune-probing in western blots, survived better in a Vibrio challenge assay. The observed effects could be due to enhancement of the Artemia immune system as phenoloxidase activity was found to be increased by these proteins. These two Hsp70 proteins exhibit a high degree of homology, particularly in the peptide-binding domain (the putative innate immunity-activating portion) with 59.6% identity, indicating that the observed protective capacity of homologous or heterologous Hsp70 proteins might reside within this peptide-binding domain.

  1. NUTRIENT COMPOSITION DEGRADATION OF DAPHNIA PULICARIA BY A HIGHLY PREVALENT CHYTRIDIOMYCETE FUNGAL PATHOGEN (POLYCARYUM LEAVE) DURING NATURALLY OCCURRING LAKE-WIDE EPIDEMICS.

    Science.gov (United States)

    Despite evidence illustrating that chytridiomycete fungal infection can be highly prevalent in Daphnia (>80%) and that infected individuals are preferentially consumed by fish, no studies have measured the nutritional consequences of using chytrid-infected Daphnia as a food sourc...

  2. Considerações sobre biologia e utilização de Artemia sp. (CRUSTACEA: BRANCHIOPODA: ANOSTRACA – considerations about biology and use of Artemia sp. (CRUSTACEA: BRANCHIOPODA: ANOSTRACA

    Directory of Open Access Journals (Sweden)

    Jean Michel Corrêa1

    2011-12-01

    Full Text Available ResumoA produção do microcrustáceo Artemia sp. no Brasil encontra-se voltada para uso em cultivos de larvas de crustáceos e peixes, de elevado valor comercial, sendo utilizadas vivas, como náuplios ou adultos, comobiomassa congelada e também microencapsulada.Abstract The production of microcrustacean Artemia sp. in Brazil is aimed for use in fish and crustacean larvae culture, with high commercial value, being used live, as nauplii or adults, as frozen biomass and microencapsulated.

  3. Nutrition Indicators of Tenebrio Fed with Purple Sweet Potato Vine%饲喂紫红薯藤对黄粉虫营养指标的影响

    Institute of Scientific and Technical Information of China (English)

    温晓蕾; 郑国勇; 李汉臣; 吉志新; 侯东军; 李明媛; 张锐; 孟品品

    2012-01-01

    [目的]寻求新的黄粉虫(Tenebrio molitor L.)饲料资源及紫红薯藤的开发利用途径.[方法]在室内研究了不同比例的紫红薯藤对黄粉虫半干物质中粗蛋白、粗脂肪、钙、磷、粗灰分的含量及黄粉虫体重的影响.[结果]与对照全麦麸相比,采用紫红薯藤饲喂黄粉虫有利于黄粉虫半干物质中粗灰分、钙含量的增加,但不利于老熟幼虫体重及粗脂肪的积累,且随着紫红薯藤添加量的增加呈逐渐降低趋势.与对照相比,当紫红薯藤的添加量为40%时有利于粗蛋白的积累,且达到显著水平;当紫红薯藤的添加量超过20%时磷含量呈逐渐降低趋势.[结论]适量添加紫红薯藤能促进黄粉虫体内粗蛋白、粗灰分、钙、磷的积累,但不利于黄粉虫幼虫体重的增加,并直接影响粗脂肪的积累.%[ Objective ] To seek the new feed resources of Tenebrio molitor L. and the way of the development and utilization of purple sweet potato vine. [ Method] The crude protein, crude fat, Ca, P, crude ash, and weigh of Tenebrio molitor L. fed with different proportions of purple sweet potato vine were studied. [ Result] Compared with the control of whole wheat bran, feeding Tenebrio molito with purple sweet potato vine can increase the Ca and crude ash in the semi-dry matters of Tenebrio molitor, but goes against the accumulation of crude fat and weigh of Tenebrio molitor, and the content of crude ash and the weight of Tenebrio molitor were decreased gradually with the increasing addition of purple sweet potato vine. Compared with the control, 40% addition of purple sweet potato vine was beneficial to accumulation of crude protein. When the quantity of purple sweet potato vine was more than 20% , the phosphorus content was gradually decreased. [ Conclusion] The proper addition of purple sweet potato vine can increase the accumulation of crude protein, crude ash, Ca and P of Tenebrio molitor L. , but goes a-gainst the increase

  4. Yellow mealworm larvae (Tenebrio molitor, L.) as a possible alternative to soybean meal in broiler diets.

    Science.gov (United States)

    Bovera, F; Piccolo, G; Gasco, L; Marono, S; Loponte, R; Vassalotti, G; Mastellone, V; Lombardi, P; Attia, Y A; Nizza, A

    2015-01-01

    The aim of the study was to evaluate the feasibility of replacing soybean meal (SBM) with Tenebrio molitor larvae (TML) meal in broiler diets. A total of 80 30-d-old male Shaver brown broilers were divided into two groups fed on two isoproteic and isoenergetic diets differing for protein source (SBM vs. TML). Up to 62 d of age, body weight and feed intake were recorded weekly and body weight gain, feed conversion ratio (FCR), protein efficiency ratio (PER) and European efficiency factor (EEF) were calculated. At 62 d, blood samples were collected from 16 birds/group for evaluation of blood profiles. Feed intake was not different between groups considering the entire period of the trial. The FCR was more favourable in the TML than SBM group from 46 d of age and in the entire period of the trial (4.13 vs. 3.62). The PER was higher in the SBM than in the TML group (1.92 vs. 1.37) while the EEF was higher in broilers fed on the TML diet (132.6 vs. 156.2). Albumin-to-globulin ratio was higher in broilers fed on SBM than in the other group (0.44 vs. 0.30). aspartate aminotransferase and alanine aminotransferase were higher in TML than SBM (195.1 vs. 178.6 U/l and 82.07 vs. 46.71 U/l, respectively). Uric acid was higher in broilers fed on SBM than TML (5.40 vs. 4.16 mg/dl). TML did not affect feed intake and growth rate of broilers from 30 to 62 d of age when compared to an isoproteic and isoenergetic SBM diet, but FCR of the TML group was more favourable than that of the SBM group. The lowest albumin-to-globulin ratio in broilers fed on TML suggests a higher immune response, probably due to the prebiotic effects of chitin.

  5. A study of the female produced sex pheromone of Tenebrio molitor (Coleoptera: Tenebrionidae)

    Science.gov (United States)

    Mangat, Jaswinder

    Mating behaviour in the yellow mealworm beetle, Tenebrio molitor , is mediated by several pheromones, including the female-produced 4-methylnonanol (4-MNol). Mating causes a decline in the titre of 4-MNol. The overall goal of this study was to determine the biochemical mechanism(s) responsible for this decline: i.e., whether the decline was due to an inhibition of pheromone biosynthesis and/or a stimulation of pheromone degradation; whether the decline was caused by the physical effect of mating or was due to the transfer of a factor from the male; and to conduct a preliminary investigation of the regulatory and signal transduction mechanisms involved in the regulation of 4-MNol production. In vitro radioassays for 4-MNol biosynthesis and degradation were developed and used to compare the levels of 4-MNol biosynthesis and degradation in virgin and mated females. Mating caused an inhibition of 4-MNol biosynthesis within 2 hours, but did not affect the rate of pheromone degradation. Decapitation of virgin females caused an inhibition of pheromone biosynthesis and did not prevent the inhibitory effect of mating. The inhibitory effect of mating was mimicked in females that were artificially inseminated with male reproductive tract homogenates (MRTH), but not in females similarly "inseminated" with water, saline, or air. Furthermore, 4-MNol biosynthesis could be inhibited in vitro by the addition of MRTH. These findings indicate that the male transferred one or more pheromonostatic factor(s) to the female during copulation that acted directly on the pheromone-producing tissue (the ovaries). In order to investigate the biochemical basis for the inhibition of pheromone biosynthesis after mating, the role of calcium was determined by modulating the level of calcium (using a calcium chelator, an ionophore, and calcium). However, due to the precipitation of calcium with the phosphate present in the buffer solution, we were unable to determine the role of calcium in the

  6. Activation of an AMP-activated protein kinase is involved in post-diapause development of Artemia franciscana encysted embryos

    Directory of Open Access Journals (Sweden)

    Dai Jie-Qiong

    2009-03-01

    Full Text Available Abstract Background Cysts of Artemia can remain in a dormant state for long periods with a very low metabolic rate, and only resume their development with the approach of favorable conditions. The post-diapause development is a very complicated process involving a variety of metabolic and biochemical events. However, the intrinsic mechanisms that regulate this process are unclear. Results Herein we report the specific activation of an AMP-activated protein kinase (AMPK in the post-diapause developmental process of Artemia. Using a phospho-AMPKα antibody, AMPK was shown to be phosphorylated in the post-diapause developmental process. Results of kinase assay analysis showed that this phosphorylation is essential for AMPK activation. Using whole-mount immunohistochemistry, phosphorylated AMPK was shown to be predominantly located in the ectoderm of the early developed embryos in a ring shape; however, the location and shape of the activation region changed as development proceeded. Additionally, Western blotting analysis on different portions of the cyst extracts showed that phosphorylated AMPKα localized to the nuclei and this location was not affected by intracellular pH. Confocal microscopy analysis of immunofluorescent stained cyst nuclei further showed that AMPKα localized to the nuclei when activated. Moreover, cellular AMP, ADP, and ATP levels in developing cysts were determined by HPLC, and the results showed that the activation of Artemia AMPK may not be associated with cellular AMP:ATP ratios, suggesting other pathways for regulation of Artemia AMPK activity. Conclusion Together, we report evidence demonstrating the activation of AMPK in Artemia developing cysts and present an argument for its role in the development-related gene expression and energy control in certain cells during post-diapause development of Artemia.

  7. Effects of food type on the life history of Daphnia clones from lakes differing in trophic state. II. Daphnia cucullata feeding on mixed diets

    NARCIS (Netherlands)

    Repka, S.

    1997-01-01

    1. The effects of feeding on suboptimal foods were investigated in Daphnia cucullata a zooplankton common in many types of lakes. Eleven clones of D. cucullata were collected from four lakes of varying trophic levels and fed a high (1 mg C l1) concentration of one of two diets: (i) a 1 : 9 mixture o

  8. Influence of a long duration exposure, 69 months, to the space flight factors in Artemia cysts, tobacco and rice seeds

    Science.gov (United States)

    Planel, H.; Gaubin, Y.; Pianezzi, B.; Delpoux, M.; Bayonove, J.; Bès, J. C.; Heilmann, C.; Gasset, G.

    1994-10-01

    Three french laboratories have participated in the Free Flyer Biostack experiment. Artemia cysts, tobacco seeds and rice caryopsis and embryos were used. Biological objects in monolayers were dead. In opposite, a large fraction of samples used in bulk survived. A stimulatory effect occurred in the first steps of development in Artemia cysts. In fact, the larval survival was unchanged or slightly reduced. In tobacco a drastic decrease in germination and survival rate was observed. Space flight did not induce genetic changes. In rice, results depend on the variety which was investigated; the growth rate stimulation in flight samples is discussed with respect to controls.

  9. Sex-dependent transcriptome analysis and single nucleotide polymorphism (SNP) discovery in the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Valenzuela-Miranda, Diego; Gallardo-Escárate, Cristian; Valenzuela-Muñoz, Valentina; Farlora, Rodolfo; Gajardo, Gonzalo

    2014-10-29

    In order to enhance genomic resources for the brine shrimp Artemia franciscana, RNA-Seq analysis was conducted for adult females and males. Through de novo assembly, 36,896 high quality contigs were obtained, of which 13,749 sequences were annotated with arthropod sequences. Just 4.5% matched against previously reported sequences for Artemia spp. Additionally, different transcriptional patterns between males and females were found, evidencing sex-related transcriptional responses. Furthermore, 221 and 534 putative SNPs were identified exclusively in males and females, respectively. These results will build the foundation for further genomic studies in A. franciscana.

  10. 用卤虫(Artemia salina L.)评价杀虫活性%Evaluate Insecticidal Activity Using Artemia salina L.

    Institute of Scientific and Technical Information of China (English)

    王再强; 周红; 韩俊; 何月秋; 录丽平

    2011-01-01

    [Aims]Artemia salina L.is general used for preliminary assessment of pharmacological activity.However,it is necessary to evaluate the suitability of A.salina L.before it is used as a model material for screening insecticidal activity.Here, 14 insecticides with 10 different action mechanisms were selected to evaluate insecticidal activity against A.salina L.used as a model material.[Results]13 Insecticides significantly killed A.salina L., Moulting hormone agonist and compound stimulating GABA release were the most active.[Conclusions]A.salina L.is a suitable organism to evaluate insecticidal activity and the method is simple having good sensitivity to many insecticides with different action mechanisms.%[目的]以卤虫(Artemia salina L.)为模式生物对化合物的药理活性进行初步评价.对10种不同作用机制的14种杀虫剂进行了生物筛选试验.[结果]14种供试杀虫剂中有13种对卤虫有显著的毒杀效果,作用于以γ-氨基丁酸为神经递质传导系统的化合物及蜕皮激素类似物效果最为显著.[结论]用卤虫筛选杀虫剂活性的方法简便,对多种作用机制的杀虫剂灵敏.

  11. Evolutionary origin and phylogeography of the diploid obligate parthenogen Artemia parthenogenetica (Branchiopoda: Anostraca.

    Directory of Open Access Journals (Sweden)

    Joaquín Muñoz

    Full Text Available BACKGROUND: Understanding the evolutionary origin and the phylogeographic patterns of asexual taxa can shed light on the origin and maintenance of sexual reproduction. We assessed the geographic origin, genetic diversity, and phylogeographic history of obligate parthenogen diploid Artemia parthenogenetica populations, a widespread halophilic crustacean. METHODOLOGY/PRINCIPAL FINDINGS: We analysed a partial sequence of the Cytochrome c Oxidase Subunit I mitochondrial gene from an extensive set of localities (including Eurasia, Africa, and Australia, and examined their phylogeographic patterns and the phylogenetic relationships of diploid A. parthenogenetica and its closest sexual relatives. Populations displayed an extremely low level of mitochondrial genetic diversity, with one widespread haplotype shared by over 79% of individuals analysed. Phylogenetic and phylogeographic analyses indicated a multiple and recent evolutionary origin of diploid A. parthenogenetica, and strongly suggested that the geographic origin of parthenogenesis in Artemia was in Central Asia. Our results indicate that the maternal sexual ancestors of diploid A. parthenogenetica were an undescribed species from Kazakhstan and A. urmiana. CONCLUSIONS/SIGNIFICANCE: We found evidence for multiple origin of parthenogenesis in Central Asia. Our results indicated that, shortly after its origin, diploid A. parthenogenetica populations underwent a rapid range expansion from Central Asia towards the Mediterranean region, and probably to the rest of its current geographic distribution. This contrasts with the restricted geographic distribution, strong genetic structure, and regional endemism of sexual Artemia lineages and other passively dispersed sexual continental aquatic invertebrates. We hypothesize that diploid parthenogens might have reached their current distribution in historical times, with a range expansion possibly facilitated by an increased availability of suitable

  12. Evaluation of alpha and gamma aluminum oxide nanoparticle accumulation, toxicity, and depuration in Artemia salina larvae.

    Science.gov (United States)

    Ates, Mehmet; Demir, Veysel; Arslan, Zikri; Daniels, James; Farah, Ibrahim O; Bogatu, Corneliu

    2015-01-01

    In this study, Artemia salina (crustacean filter feeders) larvae were used as a test model to investigate the toxicity of aluminum oxide nanoparticles (Al2O3 NPs) on marine microorganisms. The uptake, toxicity, and elimination of α-Al2O3 (50 nm and 3.5 μm) and γ-Al2O3 (5 nm and 0.4 μm) NPs were studied. Twenty-four and ninety-six hour exposures of different concentrations of Al2O3 NPs to Artemia larvae were conducted in a seawater medium. When suspended in water, Al2O3 NPs aggregated substantially with the sizes ranging from 6.3 nm to >0.3 µm for spherical NPs and from 250 to 756 nm for rod-shaped NPs. The phase contrast microscope images showed that NPs deposited inside the guts as aggregates. Inductively coupled plasma mass spectrometry analysis showed that large particles (3.5 μm α-Al2O3) were not taken up by Artemia, whereas fine NPs (0.4 μm γ-Al2O3) and ultra-fine NPs (5 nm γ-Al2O3 and 50 nm α-Al2O3) accumulated substantially. Differences in toxicity were detected as changing with NP size and morphology. The malondialdehyde levels indicated that smaller γ-Al2O3 (5 nm) NPs were more toxic than larger γ-Al2O3 (0.4 µm) particulates in 96 h. The highest mortality was measured as 34% in 96 h for γ-Al2O3 NPs (5 nm) at 100 mg/L (LC50 > 100 mg/L). γ-Al2O3 NPs were more toxic than α-Al2O3 NPs at all conditions.

  13. Toxicity of Five Phenolic Compounds to Brine Shrimp Artemia sinica(Crustacea:Artemiidae)

    Institute of Scientific and Technical Information of China (English)

    Ali Shaukat; LIU Guangxing; LI Zhengyan; XU Donghui; HUANG Yousong; CHEN Hongju

    2014-01-01

    The acute toxicity of five phenolic compounds each to 15 d old Artemia sinica was determined in this study. The brine shrimp A. sinica was hatched from the encysted dry eggs (Bohai Bay Brand) produced by Dongying Ocean Artemia Co., Ltd., China at 27℃± 1℃in pre-filtered (through pores of 0.45 µm in diameter) and autoclaved seawater (salinity 31, pH 7.5-8.0) in a cilindroconical glass beaker (2000 mL in volume) under continuous illumination (provided by a side set 20 W fluorescent lamp) with slight aeration. Ten Artemia individuals from the same batch of the hatched were cultured in 10 mL toxicant solution prepared with seawater (salinity 31, pH 7.5-8.0) at room temperature (about 20℃) to determine 24 h, 48 h and 72 h medium lethal concentration (LC50) of 5 phenolic compounds each. It was found that the toxicity of n-heptylphenol was the highest followed by nonylphenol, t-butylphenol, 2,4-dichlorophenol and bisphenol A in order. The LC50 values of the 5 compounds were calculated with regression analysis. The real concentration (in µg L-1) of 5 phenolic compounds each in toxicant solutions was measured with GC/MS analysis. Significant loss of phenolic compounds caused by either adsorption or desorption was not found. The significant difference of LC50 values was found among the five compounds 3 exposure times each. The range between the highest no-observed-effect concentration (NOEC) and 100%death causing concentration of five phenolic compounds each was determined. The toxicity in term of 24 h LC50 value of n-HP was 9.10 times higher than that of BPA, 1.71 times higher than t-BP, 1.53 times higher than 2,4-DCP and 1.36 times higher than NP, respectively.

  14. Larval helminths in the invasive American brine shrimp Artemia franciscana throughout its annual cycle.

    Science.gov (United States)

    Georgiev, Boyko B; Angelov, Aleksandar; Vasileva, Gergana P; Sánchez, Marta I; Hortas, Francisco; Mutafchiev, Yasen; Pankov, Plamen; Green, Andy J

    2014-09-01

    One of the best examples of rapid displacement of native species by an invader is the eradication of native Artemia salina and A. parthenogenetica in the Mediterranean by the introduced American A. franciscana. Previous studies based on sampling from limited time periods suggest that the success of the American species as a competitor may be due partly to different parasite burden, since native Artemia spp. have high cestode infection rates regulating their density. The aim of this study is to test the hypothesis that the helminth infection in A. franciscana in its invasive range is low throughout its annual life cycle. Samples of A. franciscana were collected every second month from La Tapa saltern (Andalusia) during one year. Five helminth species were recorded: cestodes Flamingolepis liguloides, F. flamingo, Gynandrotaenia stammeri (all flamingo parasites), Eurycestus avoceti (a shorebird parasite) and larval spirurids of the Acuariinae (the first record of nematodes in Artemia). The overall infection rate was low, with total prevalence 5.9% and prevalence of individual parasite species between 0.2 and 3.2%. The mean abundance of helminths was 0.005-0.155 (av. 0.068), 5-13 times lower than in native congeners. Waterbird counts indicate that the low infection rates cannot be explained by lack of definitive hosts. The results are consistent with the hypothesis that helminths have no regulating effect on the invasive brine shrimp in the Mediterranean. The replacement of the native populations by the invader can be partially explained by a competition mediated by parasites/predators through a differential impact on host fitness.

  15. Expression and characterization of the JAK kinase and STAT protein from brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Cheng, Chia-Hsiung; Chen, Gen-Der; Yeh, Maw-Sheng; Chu, Cheng-Ying; Hsu, Ya-Li; Hwang, Pung-Pung; Huang, Fore-Lien; Huang, Chang-Jen

    2010-01-01

    In this study, we isolated and characterized both JAK and STAT genes from Artemia, Artemia franciscana. Although AfJAK showed only 19% identity (33% similarity) to the Drosophila Hop protein, AfJAK contained the characteristic JAK homology domain (JH domain) from JH1 to JH7. On the other hand, AfSTAT showed higher identity (30%) to Drosophila STAT (STAT92E). The low identities of AfJAK and AfSTAT to Drosophila Hop and STAT92E suggest that JAK and STAT proteins are unique in each different species of invertebrate. RT-PCR analysis showed that both AfJAK and AfSTAT transcripts were ubiquitously expressed in the embryo, which is similar to the expression patterns of Drosophila Hop and STAT92E mRNAs during development. In addition, we generated a constitutively active form of AfSTAT by fusing the JH1 domain of AfJAK to the C-terminal end of AfSTAT. This fusion protein, AfSTAT-HA-JH1, autophosphorylated on its tyrosine residue and was able to bind to specific DNA motifs including the STAT-binding motifs in the Drosophila Raf promoter. Both AfJAK and AfSTAT proteins elicited the transactivation potential toward the fly Raf promoter in Sf9 cells. However, tyrosine phosphorylation of AfSTAT was not detected, which is consistent with the cellular localization analysis that most AfSTAT proteins were in the cytoplasm. Our results demonstrate that both JAK and STAT are present in the genome of Artemia, which can serve as the basis for further investigations to explore the role of the JAK/STAT signal pathway in the development and immune response of brine shrimp.

  16. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca).

    Science.gov (United States)

    Muñoz, Joaquín; Gómez, Africa; Green, Andy J; Figuerola, Jordi; Amat, Francisco; Rico, Ciro

    2008-07-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading to their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South Africa) and to assess the extent of local endemism, the degree of population structure and the potential impact of traditional human saltpan management on this species. We also examined the phylogenetic relationships in the genus Artemia using COI sequences. Our results show extensive regional endemism and indicate an early Pleistocene expansion of A. salina in the Mediterranean Basin. Subsequent population isolation in a mosaic of Pleistocene refugia is suggested, with two or three refugia located in the Iberian Peninsula. Two instances of long-distance colonization were also observed. Surprisingly, given its strong phylogeographical structure, A. salina showed a signature of correlation between geographical and genetic distance. Owing to strong 'priority effects', extensive population differentiation is retained, despite dispersal via migrant birds and human management of saltpans. The foreseeable expansion of A. franciscana is likely to be followed by substantial loss of genetic diversity in Mediterranean A. salina. Large genetic divergences between Mediterranean and South African A. salina suggest that the latter deserves species status.

  17. May arsenic pollution contribute to limiting Artemia franciscana invasion in southern Spain?

    Directory of Open Access Journals (Sweden)

    Marta I. Sánchez

    2016-02-01

    Full Text Available Limited information exists regarding the complex interactions between biological invasions, pollution, and climate change. Most studies indicate that pollution tends to favor invasive species. Here, we provide evidence that arsenic (As pollution may have a role in limiting the invasion of the exotic brine shrimp Artemia franciscana. We tested As toxicity in natural populations of Artemia parthenogenetica (a native taxon and A. franciscana from localities in southern Spain with differing degrees of As contamination. Tests were conducted both under current mean temperature conditions (25 °C, and as per a future climate scenario (i.e., an increase in mean temperature of 4 °C. Acute toxicity was estimated on the basis of the median lethal concentration (at 24 h, and chronic toxicity was evaluated by measuring Artemia survival and growth under sublethal exposures (after 26 days. At 25 °C, native A. parthenogenetica from the highly polluted Odiel and Tinto estuary was much more resistant to acute As stress (LC50-24 h, 24.67 mg L−1 than A. franciscana (15.78 mg L−1 and A. parthenogenetica from unpolluted sites (12.04 mg L−1–suggesting that local adaptation to polluted conditions may occur. At 29 °C, resistance of A. parthenogenetica from Odiel decreased significantly, and there were no statistical differences in sensitivity between the three species/populations, suggesting that climate change may enhance the probability of invasion. Resistance increased with developmental stage from nauplii to adults, and was extremely high in cysts which still hatched at As concentrations of up to 6400 mg L−1. Under sublethal chronic exposure A. franciscana performed better (survival and growth than A. parthenogenetica, and both species experienced a faster growth when exposed to As, compared with unexposed (control individuals, probably due to the hormesis. We discuss the ecological implications of our results.

  18. Effects of rotenone and other mitochondrial complex I inhibitors on the brine shrimp Artemia.

    Science.gov (United States)

    Vehovszky, Agnes; Szabó, Henriette; Acs, A; Gyori, J; Farkas, Anna

    2010-12-01

    (Artemia) nauplii was used to asses the toxicity of rotenone, MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), MP+ (1-methyl-4-phenylpyridinium) and the effect of L-DOPA co-treatment with rotenone. Rotenone had a dose dependent effect on mortality (LC₅₀: 0.37 ± 0.04 μM mean ± S E, n = 24), while MPTP and MP+ proved to be toxic in millimolar range (LC₅₀: 0.21 ± 0.09 mM and 0.20 ± 0.08 mM, respectively, n = 4). L-DOPA (50-200 μM) co-treatment increased the survival of the rotenone-treated animals (LC₅₀: 0.51 ± 0.23 μM, 1.03 ± 0.66 μM, and 0.76 ± 0.52 μM, respectively). In the whole body tissue homogenates of Artemia, sublethal (up to 0.3 μM) concentrations of rotenone increased the glutathione S-transferase (GST) activity by up to 50 about percent (LC₅₀: 53.3 ± 6.8 nM/min/mg protein, against 34.7 ± 3.6 nM/min/mg protein, n = 4). Nauplii treated in 100 mM L-DOPA and rotenone together showed further increase of GST activity all across the range of rotenone concentrations. These results on Artemia nauplii show similarities with other animal models, when complex I inhibitors were tested. Biochemical measurements suggest a protective role of L-DOPA by increasing the GST activity as part of the intracellular defences during toxin-evoked oxidative stress.

  19. Contrasting migration behaviour of Daphnia pulicaria and D. galeata × hyalina, in avoidance of predation by 0+perch (Perca fluviatilis)

    NARCIS (Netherlands)

    Flik, B.J.G.; Vijverberg, J.

    2003-01-01

    In spring and early summer, a small population of the large-bodied Daphnia pulicaria coexists with a much larger population of the medium-sized hybrid Daphnia galeata × hyalina in the epilimnion of Lake Maarsseveen (The Netherlands). When large shoals of juvenile perch (Perca fluviatilis) appear in

  20. Monitoramento dos extratos brutos de espécies de Polygala (Polygalaceae utilizando Artemia salina

    Directory of Open Access Journals (Sweden)

    A.B.P. Montanher

    2003-01-01

    Full Text Available Extratos de duas espécies de Polygala foram submetidos a um biomonitoramento utilizando o teste de toxicidade frente a Artemia salina, com a finalidade de detectar atividade citotóxica. Os resultados obtidos para o extrato bruto, frações hexânica e diclorometano de Polygala sabulosa Aw. Benn. mostraram-se promissores. No entanto, bioensaios mais específicos devem ser encorajados nos extratos vegetais que apresentam atividade diante deste bioensaio, a fim de confirmar estas conclusões.

  1. Toxicidad del Metilparabeno en Artemia franciscana y sus implicacines en acuicultura

    OpenAIRE

    Comeche Sanz, Amparo; Varó, Inmaculada

    2015-01-01

    La dependencia total de la acuicultura marina en los quistes de Artemia cosechados en grandes ecosistemas hipersalinos hace que las condiciones fisicoquímicas de estos lugares sean cruciales para el desarrollo de esta actividad. En la actualidad existen en el mercado diversos productos de la industria cosmética, farmacéutica o alimentaria, que contienen parabenos (PBs) en su composición; lo que ha dado lugar a la aparición de estos compuestos en el medio ambiente. Se ha demostr...

  2. Atividade antibacteriana in vitro e toxicidade frente à Artemia salina Leach. de alguns compostos triazenos

    Directory of Open Access Journals (Sweden)

    Gustavo Luiz Paraginski

    2014-01-01

    Full Text Available Bacterial resistance to antibacterial agents is currently a major concern. We report the synthesis, in vitro antibacterial activity and toxicity toward Artemia salina of six diaryltriazene compounds bearing different substituent groups. Minimal Inhibitory Concentration (MIC and Minimal Bactericidal Concentration (MBC values against standard strains (ATCC and clinical isolates (including ESBL, MBL and AmpC strains were good to very good, in the range 8 to 128 mg mL-1. Results suggest that hydroxyl, 4-carboxyl and 4-phenyldiazenil groups attached to the diaryltriazenes provide enhanced activity. Toxicity results showed very low LC50 values for three compounds (10-fold lower than DTIC.

  3. Comparative effects and metabolism of two microcystins and nodularin in the brine shrimp Artemia salina.

    Science.gov (United States)

    Beattie, Kenneth A; Ressler, Judith; Wiegand, Claudia; Krause, Eberhard; Codd, Geoffrey A; Steinberg, Christian E W; Pflugmacher, Stephan

    2003-02-12

    The toxicity and metabolism of the cyanobacterial toxins microcystin-LR (MCLR), Dhb-microcystin-HtyR and nodularin were investigated in the cysts, nauplii and adults of the brine shrimp Artemia salina. The presence of the phase II detoxication system glutathione S-transferase (sGST) in these stages was shown using different substrates. Exposure of adult A. salina to the toxins led to an elevation of GST activity in vivo. All three toxins were conjugated to glutathione via GST, which has been shown as an initial step of microcystin and nodularin detoxication.

  4. [Detection of fungal metabolites showing toxic activity through Artemia salina bioassay].

    Science.gov (United States)

    González, Ana María; Presa, Maximiliano; Latorre, María Gabriela; Lurá, María Cristina

    2007-03-01

    The aim of this study was to detect toxic metabolites from fungi contaminating food and medicinal herbs by applying the toxicity assay to Artemia salina. According to toxicity percentages, the extracts were classified as nontoxic (NT), slightly toxic (ST), toxic (T) and highly toxic (HT). Those classified as T and HT were assayed for mycotoxins. Only 6 out of 71 strains were found to be T (8.5%) for A. salina. Penicillium brevicompactum Dierckx, isolated from sausages, was found to be HT, mainly due to the presence of ochratoxin A and two other unidentified metabolites.

  5. Phaeobacter inhibens as Probiotic Bacteria in Non-Axenic Artemia and Algae Cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; D'Alvise, Paul; Bentzon-Tilia, Mikkel;

    2015-01-01

    Bacterial diseases are a major constraint in aquaculture, especially in larviculture. Antibiotics that can control pathogens should be avoided due to risk of antibiotic resistance. We have shown in axenic systems of live larval feed that marine Roseobacter clade bacteria can antagonize fish patho...... demonstrates that probiotic bacteria can be introduced at the stage of live feed and have a pathogen reducing effect in both an Artemia and a D. tertiolecta challenge setup. This can potentially limit the subsequent use of antibiotics for control of pathogenic bacteria....

  6. Mercury antagonists: loss of photoactive response in the brine shrimp Artemia and its prevention by thiamine

    Energy Technology Data Exchange (ETDEWEB)

    Yaeger, E.; Siegel, B.Z.; Siegel, S.M.; Lasconia, M.; Correal, T.

    1986-01-01

    The positive photoatactic behavior of Artemia was disturbed when larvae cultured in 0.25 M NaCl were introduced into 10/sup -7/ to 10/sup -5/ M HgCl/sub 2/. At 10/sup -8/ M, and in controls, Hg had no effect either on orientation or mortality, and 65% of the larvae were collected at the light source in 30 min or less. In contrast, at 10/sup -6/ M, only 29% were able to do so. The presence of 10/sup -4/ M thiamine hydrochloride in the excystment medium prevented fully the loss of light-sensitivity.

  7. The brine shrimp ( Artemia parthenogenetica) as encapsulation organism for prophylactic chemotherapy of fish and prawn

    Science.gov (United States)

    Cao, Ji-Xiang; Bian, Bo-Zhong; Li, Ming-Ren

    1996-06-01

    Brine shrimp ( Artemia parthenogenetica) which had ingested three water-insoluble antibacterial drugs i.e. sulfadiazine(SD), oxytetracycline (OTC) and erythromycin estolate (ERY-Es) were fed to Tilapia and Mysis III of Penaeus orientalis K. The drug contents in the predators were then determined. After administration of drugs to Tilapia and Mysis III, through the bio-encapsulation of the brine shrimp, efficacious therapeutical concentration of OTC and ERY-Es (but not SD) in the predators could be reached and maintained for more than 8 hours.

  8. Sharp phylogeographic breaks and patterns of genealogical concordance in the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Maniatsi, Stefania; Kappas, Ilias; Baxevanis, Athanasios D; Farmaki, Theodora; Abatzopoulos, Theodore J

    2009-12-18

    Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI) and two nuclear (ITS1, p26) markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a result of slower coalescence or male-mediated dispersal. Our findings capture the genealogical interval between gene splitting and population divergence. In this sense, strong indications are provided in favour of a superspecies status and ongoing speciation in A. franciscana.

  9. Do Daphnia use metalimnetic organic matter in a north temperate lake? An analysis of vertical migration

    Science.gov (United States)

    Brosseau, Chase Julian; Cline, Timothy J.; Cole, Jonathan J.; Hodgson, James R.; Pace, Michael L.; Weidel, Brian C.

    2012-01-01

    Diel vertical migration of zooplankton is influenced by a variety of factors including predation, food, and temperature. Research has recently shifted from a focus on factors influencing migration to how migration affects nutrient cycling and habitat coupling. Here we evaluate the potential for Daphnia migrations to incorporate metalimnetic productivity in a well-studied northern Wisconsin lake. We use prior studies conducted between 1985 and 1990 and current diel migration data (2008) to compare day and night Daphnia vertical distributions with the depth of the metalimnion (between the thermocline and 1% light depth). Daphnia migrate from a daytime mean residence depth of between about 1.7 and 2.5 m to a nighttime mean residence depth of between 0 and 2.0 m. These migrations are consistent between the prior period and current measurements. Daytime residence depths of Daphnia are rarely deep enough to reach the metalimnion; hence, metalimnetic primary production is unlikely to be an important resource for Daphnia in this system.

  10. The " Daphnia" Lynx Mark I Suborbital Flight Experiment: Hardware Qualification at the Drop Tower Bremen

    Science.gov (United States)

    Knie, Miriam; Schoppmann, Kathrin; Eck, Hendrik; Ribeiro, Bernard Wolfschoon; Laforsch, Christian

    2016-06-01

    The Drop Tower Bremen, a ground-based facility enabling research under real microgravity conditions, is an excellent platform for testing new types of experimental hardware to ensure full performance when deployed in costly and rare flight opportunities such as suborbital flights. Here we describe the " Daphnia" experiment which will fly on XCOR Aerospace Lynx Mark I and our experience from the hardware tests with the catapult system at the drop tower. The aim of the " Daphnia" experiment is to obtain data on the biological performance of daphnids and predator-prey interactions in microgravity, which are important for the development of aquatic bioregenerative life support systems (BLSS). The experiment consists of two subunits: The first unit is dedicated to predator-prey interactions, where behavioural analysis should reveal if microgravity interfere with prey ( Daphnia) detection or feeding and therefore may interrupt the trophic cascade. The functioning of such an artificial food web is indispensable for a long-lasting BLSS suitable for long-duration manned space missions or Earth-based explorations to extreme habitats. The second unit is designed to investigate the impact of microgravity on gene expression and the cytoskeleton in Daphnia. Next to data collection, the real microgravity conditions at the drop tower have helped to identify the weak points of the " Daphnia" experimental hardware and lead to further improvement. Hence, the drop tower is ideal for testing new experimental hardware which is indispensable before the implementation in suborbital flights.

  11. Daphnias: from the individual based model to the large population equation

    CERN Document Server

    Metz, J A J

    2012-01-01

    The class of deterministic 'Daphnia' models treated by Diekmann et al. (J Math Biol 61: 277-318, 2010) has a long history going back to Nisbet and Gurney (Theor Pop Biol 23: 114-135, 1983) and Diekmann et al. (Nieuw Archief voor Wiskunde 4: 82-109, 1984). In this note, we formulate the individual based models (IBM) supposedly underlying those deterministic models. The models treat the interaction between a general size-structured consumer population ('Daphnia') and an unstructured resource ('algae'). The discrete, size and age-structured Daphnia population changes through births and deaths of its individuals and throught their aging and growth. The birth and death rates depend on the sizes of the individuals and on the concentration of the algae. The latter is supposed to be a continuous variable with a deterministic dynamics that depends on the Daphnia population. In this model setting we prove that when the Daphnia population is large, the stochastic differential equation describing the IBM can be approxima...

  12. Evaluation of acute toxicity and teratogenic effects of plant growth regulators by Daphnia magna embryo assay.

    Science.gov (United States)

    Wang, Kai-Sung; Lu, Chi-Yuan; Chang, Shih-Hsien

    2011-06-15

    This study selected common plant growth regulators (Atonik, Cytokinin, Ethephon, Gibberellic acid and Paclobutrazol) to investigate their biological toxicity to the waters of the important biological indicator Daphnia magna. The methods used in this study included traditional neonate acute toxicity test, new Daphnia embryo toxicity test, and teratogenic embryo test. The study concluded that the acute toxicity of the five PGRs to Daphnia neonate had EC(50) value range of 1.9-130.5 mg l(-1), while acute toxicity of PGRs on Daphnia embryo had EC(50) value range of 0.2-125 mg l(-1); the Daphnia embryos' LOEC values (0.05-48 mg l(-1)) for the five PGRs were lower than embryo EC(50) values. The toxic ratios of 48 h EC(50) (neonate)/48 h LOEC (embryo) for 5 PGRs were 19-512 times. The study found that teratogenic effects of Paclobutrazol and Cytokinin induced in embryo were higher than those of most other PGRs. Microscopic observation of the teratogenic effects showed that all 5 PGRs induced malformations of the second antenna, rostrum, Malpighian tube, sensory bristles, and tail spine as well as function loss and death.

  13. Process optimization for the preparation of straw feedstuff for rearing yellow mealworms (Tenebrio molitor L.) in BLSS

    Science.gov (United States)

    Li, Leyuan; Liu, lh64. Hong

    2012-07-01

    It has been confirmed in our previous work that in bioregenerative life support systems, feeding yellow mealworms (Tenebrio molitor L.) using fermented straw has the potential to provide good animal protein for astronauts, meanwhile treating with plant wastes. However, since the nitrogen content in straw is very low, T. molitor larvae can not obtain sufficient nitrogen, which results in a relatively low growth efficiency. In this study, wheat straw powder was mixed with simulated human urine before fermentation. Condition parameters, e.g. urine:straw ratio, moisture content, inoculation dose, fermentation time, fermentation temperature and pH were optimized using Taguchi method. Larval growth rate and average individual mass of mature larva increased significantly in the group of T. molitor larvae fed with feedstuff prepared with the optimized process.

  14. Crystallization and preliminary X-ray crystallographic analysis of a highly specific serpin from the beetle Tenebrio molitor.

    Science.gov (United States)

    Park, Sun Hee; Piao, Shunfu; Kwon, Hyun Mi; Kim, Eun Hye; Lee, Bok Luel; Ha, Nam Chul

    2010-02-01

    The Toll signalling pathway, which is crucial for innate immunity, is transduced in insect haemolymph via a proteolytic cascade consisting of three serine proteases. The proteolytic cascade is downregulated by a specific serine protease inhibitor (serpin). Recently, the serpin SPN48 was found to show an unusual specific reactivity towards the terminal serine protease, Spätzle-processing enzyme, in the beetle Tenebrio molitor. In this study, the mature form of SPN48 was overexpressed in Escherichia coli and purified. The purified SPN48 protein was crystallized using 14% polyethylene glycol 8000 and 0.1 M 2-(N-morpholino)ethanesulfonic acid pH 6.0 as the precipitant. The crystals diffracted X-rays to 2.1 A resolution and were suitable for structure determination. The crystals belonged to space group P2(1). The crystal structure will provide information regarding how SPN48 achieves its unusual specificity for its target protease.

  15. A behavioral study of the beetle Tenebrio molitor infected with cysticercoids of the rat tapeworm Hymenolepis diminuta

    Science.gov (United States)

    Sheiman, I. M.; Shkutin, M. F.; Terenina, N. B.; Gustafsson, M. K. S.

    2006-06-01

    The host-parasite relationship, Tenebrio molitor- Hymenolepis diminuta, was analyzed. The learning behavior of infected and uninfected (control) beetles in a T-maze was compared. The infected beetles moved much slower in the T-maze than the controls. The infected beetles reached the same level of learning as the controls. However, they needed more trials than the controls. The effect of the infection was already distinct after the first week and even higher after the second week. This indicates that the initial phase of infection caused stress in the beetles. Longer infection did not worsen their ability to learn. Thus, the parasites clearly changed the behavior of their intermediate host and probably made them more susceptible to their final host, the rat.

  16. Acute and chronic toxicity of emerging contaminants, alone or in combination, in Chlorella vulgaris and Daphnia magna.

    Science.gov (United States)

    Pablos, María Victoria; García-Hortigüela, Pilar; Fernández, Carlos

    2015-04-01

    This work presents the toxicity results of different compounds classified as emerging contaminants on primary producers and primary consumers in the aquatic compartment. The objectives were to (1) obtain acute and chronic toxicity results for algae and Daphnia magna using standardised or currently used tests, (2) study the relationship between the effects on the impaired feeding rate for daphnia and the effects of reproduction and (3) examine the responses on daphnia and algae after binary combinations of environmentally relevant compounds and perfluorooctane sulfonate (PFOS). Toxicity data on personal care products (PCPs), not reported in the scientific literature up to now, are presented. The results confirmed that the Daphnia feeding bioassay can be a sensitive, ecologically relevant endpoint to detect sublethal effects and could complement the information obtained with the reproduction test on Daphnia. The results also suggested that the concomitant occurrence of PFOS and other emerging contaminants in the aquatic compartment could affect the toxicity of some compounds according to their lipophilicity.

  17. Molecular cloning and expression analysis of the retinoid X receptor (RXR) gene in golden pompano Trachinotus ovatus fed Artemia nauplii with different enrichments.

    Science.gov (United States)

    Yang, Qibin; Zheng, Panlong; Ma, Zhenhua; Li, Tao; Jiang, Shigui; Qin, Jian G

    2015-12-01

    The retinoid X receptors (RXRs) are involved in the skeletal development and other biological process such as blood vessel formation and metabolism. Partial sequences of RXRα and β genes were obtained, and their expressions were quantified on golden pompano Trachinotus ovatus at 28 days post hatching (DPH) to explore the molecular response to nutritional manipulation in fish larvae. As live food, Artemia nauplii were separately enriched with Nannochloropsis and Algamac 3080 and non-enriched Artemia nauplii (control) for fish feeding. The expressions of RXRs were detected in the embryos and fish larvae at early stages, suggesting that the skeletal development in golden pompano initiated before yolk re-sorption completion. Fish fed non-enriched Artemia nauplii ended up with higher jaw malformation. The highest specific growth rate was obtained when fish were fed with the Artemia nauplii enriched with Algamac 3080, and the lowest growth rate was observed when fish were fed with unenriched Artemia nauplii. The highest survival was obtained when fish were fed with non-enriched or Nannochloropsis-enriched Artemia nauplii. This study indicates that the use of enriched formula for Artemia nauplii can significantly affect the expression levels of RXRs and jaw malformation of golden pompano larvae, but there is no clear correlation between RXRs expressions and malformation rates when fish are subjected to nutrient challenge.

  18. Evaluation of the toxicity of the methanolic extract of Caesalpinia Pyramidalis, subjected to gamma radiation, compared to saline artemias; Avaliacao da toxicidade do extrato metanolico de Caesalpinia Pyramidalis, submetido a radiacao gama, frente a artemias salinas

    Energy Technology Data Exchange (ETDEWEB)

    Pessoa, Juanna G.; Santos, Mariana L.O.; Costa, Michelle C.A.; Siqueira, Williams N.; Silva, Luanna R.S.; Cabral, Daniela L.V.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: marianasantos_ufpe@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil)

    2013-07-01

    The present study aimed to investigate the possible effect of irradiation of 60 Co in methanol extract of Caesalpinia pyramidalis (catingueira) with function of reducing the toxicity of the extract at concentrations of 1000, 500, 250 and 125 ppm irradiating them with doses of 5 kGy 7 kGy and 10 kGy, using lethality tests with saline Artemias.

  19. Evolutionary ecotoxicology of pesticide resistance: a case study in Daphnia.

    Science.gov (United States)

    Jansen, Mieke; Coors, Anja; Stoks, Robby; De Meester, Luc

    2011-05-01

    Natural populations that are exposed to pesticides in their environment may at the same time be exposed to natural stressors like parasites and predators, which may interact with pesticide exposure. This may not only impact target pest species but also a wide variety of non-target species. This review reports on a joint research program in the water flea Daphnia magna, a non-target species often used as model organism in ecology and ecotoxicology. The focus is on different aspects that are of key importance to understand the evolutionary ecology of pesticide exposure: (1) the capacity of natural populations to genetically adapt to pesticide exposure (2) the added complexity of synergistic effects caused by simultaneous exposure to natural stressors, and (3) the potential interference of evolutionary costs of adaptation to pesticide exposure. Our results showed that natural populations were able to rapidly evolve resistance to the pesticide carbaryl but at the expense of fitness costs. Individuals selected for carbaryl resistance had higher survival rates when exposed to the pesticide but also a greater susceptibility to the challenge imposed by the bacterial endoparasite Pasteuria ramosa. The evolved resistance to carbaryl was in some cases only expressed in the absence of fish kairomones. Further, it became clear that the responses to both exposure to single and combined stressors was for several life history variables strongly dependent upon past exposure to carbaryl. This indicates that past exposures to pesticides are important and can not be neglected when evaluating responses to current stressors.

  20. [Acute toxicity of different type pesticide surfactants to Daphnia magna].

    Science.gov (United States)

    Li, Xiu-huan; Li, Hua; Chen, Cheng-yu; Li, Jian-tao; Liu, Feng

    2013-08-01

    By using the standard test methods in Experimental Guideline for Environmental Safety Evaluation of Chemical Pesticide to aquatic organisms, a comparative study was conducted on the acute toxicity of 39 nonionic, 6 anionic, and 3 cationic surfactants to Daphnia magna. The acute toxicity of three cationic surfactants 1427, 1227 and C8-10 to D. magna belonged to virulent level, and the toxicity of 1427 was the highest, with the EC50 value being 0.97 x 10(-2) mg x L(-1). The acute toxicity of nonionic surfactants polyoxyethylene ether castor oil EL, Tween, and Span emulsifiers belonged to low level, but the toxicity of alkylphenol polyoxyethylene ether and fatty alcohol polyoxyethylene ether surfactants was relatively high, of which, AEO-7 and AEO-5 displayed high toxicity, with the EC50 value being 0.82 and 0.97 mg x L(-1), respectively. In these surfactants, the more liposolubility, the higher the toxicity was. Most of the anionic surfactants were medium in toxicity, but the acute toxicity of NNO belonged to high toxicity, with the EC50 value being 0.17 mg x L(-1).

  1. Toxicity of perfluorononanoic acid and perfluorooctane sulfonate to Daphnia magna

    Institute of Scientific and Technical Information of China (English)

    Guang-hua Lu; Jian-chao Liu; Li-sha Sun; Lu-jin Yuan

    2015-01-01

    In order to study toxicological effects of perfluorononanoic acid (PFNA), perfluorooctane sulfonate (PFOS), and their mixtures (PFNA/PFOS) on Daphnia magna (D. magna), a suite of comprehensive toxicity tests were conducted, including a 48-h acute toxicity test, a 21-day chronic test, a feeding experiment, and a biomarker assay. D. magna were exposed to aqueous solutions of PFNA and PFOS (alone and in combination) at concentrations ranging from 0.008 to 5 mg/L. The survival, growth, and reproduction of D. magna were monitored over a 21-day life cycle. The biomarkers, including acetylcholinesterase (AChE), superoxide dismutase (SOD), and catalase (CAT) activities, were determined after seven days of exposure. PFOS was more toxic than PFNA based on the results of the acute toxicity test. Perfluorinated compounds (PFCs) inhibited both growth and reproduction of D. magna during the testing period. The ingestion rates and the biomarkers, including AChE, SOD, and CAT activities, were significantly inhibited by PFCs in most cases. Moreover, the combined effects related to the growth and reproduction showed the antagonistic effects of PFCs.

  2. Bacteria-mediated effects of antibiotics on Daphnia nutrition.

    Science.gov (United States)

    Gorokhova, Elena; Rivetti, Claudia; Furuhagen, Sara; Edlund, Anna; Ek, Karin; Breitholtz, Magnus

    2015-05-05

    In polluted environments, contaminant effects may be manifested via both direct toxicity to the host and changes in its microbiota, affecting bacteria-host interactions. In this context, particularly relevant is exposure to antibiotics released into environment. We examined effects of the antibiotic trimethoprim on microbiota of Daphnia magna and concomitant changes in the host feeding. In daphnids exposed to 0.25 mg L(-1) trimethoprim for 24 h, the microbiota was strongly affected, with (1) up to 21-fold decrease in 16S rRNA gene abundance and (2) a shift from balanced communities dominated by Curvibacter, Aquabacterium, and Limnohabitans in controls to significantly lower diversity under dominance of Pelomonas in the exposed animals. Moreover, decreased feeding and digestion was observed in the animals exposed to 0.25-2 mg L(-1) trimethoprim for 48 h and then fed 14C-labeled algae. Whereas the proportion of intact algal cells in the guts increased with increased trimethoprim concentration, ingestion and incorporation rates as well as digestion and incorporation efficiencies decreased significantly. Thus, antibiotics may impact nontarget species via changes in their microbiota leading to compromised nutrition and, ultimately, growth. These bacteria-mediated effects in nontarget organisms may not be unique for antibiotics, but also relevant for environmental pollutants of various nature.

  3. Toxicity of perfluorononanoic acid and perfluorooctane sulfonate to Daphnia magna

    Directory of Open Access Journals (Sweden)

    Guang-hua LU

    2015-01-01

    Full Text Available In order to study toxicological effects of perfluorononanoic acid (PFNA, perfluorooctane sulfonate (PFOS, and their mixtures (PFNA/PFOS on Daphnia magna (D. magna, a suite of comprehensive toxicity tests were conducted, including a 48-hour acute toxicity test, a 21-day chronic test, a feeding experiment, and a biomarker assay. D. magna were exposed to aqueous solutions of PFNA and PFOS (alone and in combination at concentrations ranging from 0.008 to 5 mg/L. The survival, growth, and reproduction of D. magna were monitored over a 21-day life cycle. The biomarkers, including acetylcholinesterase (AChE, superoxide dismutase (SOD, and catalase (CAT activities, were determined after seven days of exposure. PFOS was more toxic than PFNA based on the results of the acute toxicity test. Perfluorinated compounds (PFCs inhibited both growth and reproduction of D. magna during the testing period. The ingestion rates and the biomarkers, including AChE, SOD, and CAT activities, were significantly inhibited by PFCs in most cases. Moreover, the combined effects related to the growth and reproduction showed the antagonistic effects of PFCs.

  4. Intentional introduction of Artemia sinica (Anostraca) in the high-altitude Tibetan lake Dangxiong Co: the new population and consequences for the environment and for humans

    Science.gov (United States)

    Jia, Qinxian; Anufriieva, Elena; Liu, Xifang; Kong, Fanjing; Shadrin, Nickolai

    2015-11-01

    The imbalance between supply and demand of Artemia cysts in China and around the world is increasing now. Salt lakes in Tibet may contribute to the solution of the problem. In Northern Tibet there are 26 saline lakes whose salinity and temperature may support Artemia survival at an altitude of 4 000-5 100 m. We found Artemia in 15 of these lakes. The saline lakes with Artemia populations mainly belong to the shallow basin lakes, and the majority of these lakes are small in area. The total area of lakes without Artemia is more than 1 000 km2. Lake Dangxiong Co (Co means lake in Tibet) was chosen for the intentional introduction of Artemia sinica. In 2004, 850 g of A. sinica cysts, originating from Qinghai, were introduced in the lake. Surveys in 2006-2014 showed that the average abundance of Artemia adults in the lake gradually increased from 20 ind./m3 in 2006 to 1950 ind./m3 in 2013. We assume that two subpopulations of A. sinica, separated by depth, may exist in the lake. The new Artemia population caused an increase in the number of species of phytoplankton and heterotrophic protozoa with a decrease of their total abundance. Water transparency also increased. Dominance in phytoplankton passed from cyanobacteria to diatoms. Changes occurred not only in the lake ecosystem; the number of water birds using the lakes also dramatically increased. Preliminary calculations showed that is it possible to harvest at least about 150 t cysts per year from the lake as well as 3.2 thousand tons of frozen or 350 t of dried biomass of adult Artemia.

  5. Male meiosis in Crustacea: synapsis, recombination, epigenetics and fertility in Daphnia magna.

    Science.gov (United States)

    Gómez, Rocío; Van Damme, Kay; Gosálvez, Jaime; Morán, Eugenio Sánchez; Colbourne, John K

    2016-09-01

    We present the first detailed cytological study of male meiosis in Daphnia (Crustacea: Branchiopoda: Cladocera)-an aquatic microcrustacean with a cyclical parthenogenetic life cycle. Using immunostaining of the testes in Daphnia magna for baseline knowledge, we characterized the different stages of meiotic division and spermiogenesis in relation to the distribution of proteins involved in synapsis, early recombination events and sister chromatid cohesion. We also studied post-translational histone modifications in male spermatocytes, in relation to the dynamic chromatin progression of meiosis. Finally, we applied a DNA fragmentation test to measure sperm quality of D. magna, with respect to levels of inbreeding. As a proxy for fertility, this technique may be used to assess the reproductive health of a sentinel species of aquatic ecosystems. Daphnia proves to be a model species for comparative studies of meiosis that is poised to improve our understanding of the cytological basis of sexual and asexual reproduction.

  6. Does local adaptation to resources explain genetic differentiation among Daphnia populations?

    Science.gov (United States)

    Allen, Michael R; Thum, Ryan A; Cáceres, Carla E

    2010-08-01

    Substantial genetic differentiation is frequently observed among populations of cyclically parthenogenetic zooplankton despite their high dispersal capabilities and potential for gene flow. Local adaptation has been invoked to explain population genetic differentiation despite high dispersal, but several neutral models that account for basic life history features also predict high genetic differentiation. Here, we study genetic differentiation among four populations of Daphnia pulex in east central Illinois. As with other studies of Daphnia, we demonstrate substantial population genetic differentiation despite close geographic proximity (explain genetic differentiation among these Daphnia populations and that other factors related to extinction/colonization dynamics, a long approach to equilibrium F(ST) or substantial genetic drift due to a low number of individuals hatching from the egg bank each season may explain genetic differentiation.

  7. Nutritive value and rearing methods of Tenebrio molitor in China%我国黄粉虫的营养价值和饲养方法

    Institute of Scientific and Technical Information of China (English)

    白耀宇; 程家安

    2003-01-01

    对我国黄粉虫Tenebrio molitor(L.)的人工饲养、营养价值现状以及当前开发利用研究的热点问题等方面进行了较全面的概括,并针对今后的研究工作和规模化生产提出了一些建议.

  8. Estudos quimiométricos da pheo formulada em pluronics®: ação fotodinâmica Sobre Artemia salina

    Directory of Open Access Journals (Sweden)

    Adriana Passarella Gerola

    2013-01-01

    Full Text Available The self-aggregation of pheophytin, a possible photosensitizer for Photodynamic Therapy, is solved by formulation in polymeric surfactant as P-123. The photosensitizer incorporation was found to be time dependent, exhibiting two steps: a partition at the micellar interface followed by an incorporation into the micelle core. The photodynamic efficiency of the formulation was tested by the bioassays against Artemia salina. In order to evaluate how the experimental parameters: pheophytin concentration, P-123 percentage and illumination time influenced the death of artemia, the factorial design 2³ was chosen. The illumination time was found to be the main factor contributing to the mortality of artemia.

  9. Sudden weaning of angel fish pterophyllum scalare (Lichtenstein) (Pisces; Cichlidae) larvae from brine shrimp (Artemia sp) nauplii to formulated larval feed

    OpenAIRE

    2013-01-01

    This study investigated the effects of sudden weaning of angel fish larvae (Pteraphylum scalari) from Artemia nauplii to commercial larval feed. Four days post hatch (DPH) larvae were reared in four different weaning protocols (TR1-TR4) with triplicates in a complete randomize design. Larvae in TR1 and TR4 were exclusively fed Artemia nauplii and dry feed respectively. In TR2 and TR3, larvae were initially fed Artemia nauplii and suddenly wean to formulated feed on 14 DPH and 7 DPH respective...

  10. A specific DNA fragment of Gahai parthenogenesis Artemia genome%尕海孤雌生殖卤虫基因组的特异DNA片段

    Institute of Scientific and Technical Information of China (English)

    曾辉; 陈成彬; 刘凤岐; 宋文芹; 陈瑞阳

    2004-01-01

    Artemia is not only valuable for aquaculture but also exhibits unique biological characters. In this study, based on the silkworm Bmdsx gene, a pair of primers was designed. After amplification with these primers, a DNA fragment Apdsx900 from parthenogenesis Artemia genomic DNA was obtained. The following Southern blotting and FISH analysis also proved the fragment was specific for Gahai parthenogenesis Artemia genome. To our knowledge, this is the first report of parthenogenesis genome specific DNA fragments. Apdsxg00 shares little similarity with the silkworm Bmdsx gene. [Acta Zoologica Sinica 50 (3): 470-474, 2004].

  11. Aquatic ecotoxicity of a pheromonal antagonist in Daphnia magna and Desmodesmus subspicatus.

    Science.gov (United States)

    Rosa, Esmeralda; Barata, Carlos; Damásio, Joana; Bosch, Maria Pilar; Guerrero, Angel

    2006-09-12

    Evaluation of the ecotoxicological potential of (Z)-11-hexadecenyl trifluoromethyl ketone (Z11-16:TFMK), a new biorational agent with high prospective features to control the Mediterranean corn borer Sesamia nonagrioides in infested maize fields, in comparison to the parent pheromone compound (Z)-11-hexadecenyl acetate (Z11-16:Ac) is described. Acute and sublethal toxicity tests of both compounds against the cladoceran Daphnia magna and the chlorophyte Desmodesmus subspicatus were conducted, the endpoints being immobilisation and feeding inhibition for Daphnia and growth rate inhibition for Desmodesmus. In addition, effects on B esterases including cholinesterase and carboxylesterase activities in Daphnia were also assessed to evaluate the mode of action of both chemicals. Toxicities of both compounds were moderate with EC(50) values ranging from 3.11 to 103.74mgl(-1) in algae growth, from 0.07 to 1.20mgl(-1) in Daphnia survival, and from 0.10 to 0.53mgl(-1) in Daphnia feeding rate. In all cases Z11-16:TFMK was more toxic than the naturally occurring pheromone component. Serine esterase assays showed a strong inhibition of the carboxylesterase activities in Daphnia at concentrations with apparently no effects on survival or feeding, suggesting that inhibition of other key esterases may be the possible mechanism of toxicity of this compound. The results obtained have been related with some physico-chemical properties of the compounds, such as water solubility and octanol-water partition coefficient, suggesting that Z11-16:TFMK may affect aquatic organisms at lower concentrations than expected from non-polar narcosis.

  12. Cloning and Expression Analysis of p26 Gene in Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Lijuan JIANG; Lin HOU; Xiangyang ZOU; Ruifeng ZHANG; Jiaqing WANG; Wenjing SUN; Xintao ZHAO; Jialu AN

    2007-01-01

    The protein p26 is a small heat shock protein that functions as a molecular chaperone to protect embryos by preventing irreversible protein damage during embryonic development. A 542 bp fragment of the p26 gene was cloned and sequenced. The fragment encoded 174 amino acid residues and the amino acid sequence contained the α-crystallin domain. Phylogenetic analysis showed that eight Artemia populations were divided into four major groups. Artemia sinica (YC) belonged to the East Asia bisexual group. Expression of the p26 gene at different developmental stages of A. sinica was quantified using real-time quantitative polymerase chain reaction followed by cloning and sequencing. The relationship between the quantity of p26 gene expression and embryonic development was analyzed. The results indicated that massive amounts of p26 were expressed during the development of A. sinica. At the developmental stage of 0 h, A. sinica expressed the highest level of p26. As development proceeded, expression levels of the p26 gene reduced significantly. There was a small quantity of p26 gene expression at the developmental stages of 16 h and 24 h. We concluded that p26 might be involved in protecting the embryo from physiological stress during embryonic development.

  13. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Ana D’ors

    2014-08-01

    Full Text Available Objective: To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods: Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results: Biotoxin equivalent values obtained by immunodetection were (2.12±0.10, (8.60±1.30 and (4.32±1.67 pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions: These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  14. Assessment of endemic microalgae as potential food for Artemia franciscana culture

    Directory of Open Access Journals (Sweden)

    Juan M Pacheco-Vega

    2015-03-01

    Full Text Available In this study, five microalgal strains were isolated from Bahía de La Paz, Baja California Sur, Mexico and identified as Grammatophora sp., Navícula sp., Rhabdonema sp., Schizochytrium sp., and Nitzschia sp., and their evaluation as potential food for Artemia franciscana. The isolated strains were cultured outdoors and harvested after four days. Chaetoceros muelleri was cultured under laboratory conditions and used as control. The protein, lipid, and carbohydrate composition and the fatty acid profiles of the strains were determined by gas chromatography. To assess the effect of microalgal strains on A. franciscana, decapsulated cysts were cultured at outdoor conditions in 15 L containers. The experiment was conducted for twelve days. Samples from the five different feeding treatments were taken at the beginning and end of the experiment to assess number, size, and weight of Artemia larvae. Treatment with Rhabdonema sp. showed larvae with a lower percentage of polyunsaturated fatty acids (PUFAs while Grammatophora sp. showed those with the greatest PUFA proportion, even more than those fed Chaetoceros muelleri (control. Larvae consuming Schizochytrium sp. had no docosahexanoic (DHA nor eicosapentaenoic (EPA fatty acid content. Growth and survival of A. franciscana did not show significant differences among feed treatments, except when it was fed Nitzschia sp., showing lower survival and dry weight. Treatment based on Schizochytrium sp. and Rhabdonema sp. had a greater A. franciscana size but reduced dry weight; additional tests including two or more algal species for every treatment should be carried out to determine the best yield.

  15. Peningkatan Kuantitas dan Kualitas Kista Artemia franciscana setelah Pemberian Silase Ikan

    Directory of Open Access Journals (Sweden)

    ENDAH BUDI SULISTYOWATI

    2007-11-01

    Full Text Available Artemia is one of live feed needed in aquaculture as fishes and crustacean. Commercially, Artemia usually sold in dry cysts which can kept for years. The aim of this research were to know increasing quantity and quality A. franciscana cysts after exposing various concentration of fish silage as artificial food and to know optimal concentration of fish silage that can increase quantity and quality A. franciscana cysts. This research was done in Laboratory of Live Feed BBPBAP Jepara Central Java. This research was conducted by 5 treatments. Treatments were grouped based on amount of concentration given, i.e: control (coconut cake with concentrate 10 g/m3, fish silage concentrate 10, 20, 30, and 40 g/m3. Parameter investigated were number of cysts produced by individual female A. franciscana, diameter of A. franciscana cysts, hatching percentage, and hatching rate of A. franciscana cysts. Data were analyzed using ANOVA and continued using Tukeys test at significant level 5%. The result of this research showed that exposing fish silage can increase quantity and quality A. franciscana cysts. They were increase number of cysts production by individual females, decrease cysts diameter, increase hatching percentage and hatching rate. Optimal concentration of fish silage on increase quantity and quality of A. franciscana cysts was 20 g/m3.

  16. Artemia salina as test organism for assessment of acute toxicity of leachate water from landfills.

    Science.gov (United States)

    Svensson, B M; Mathiasson, L; Mårtensson, L; Bergström, S

    2005-03-01

    Artemia salina has, for the first time, been used as test organism for acute toxicity of leachate water from three landfills (the municipal landfills at Kristianstad, Sweden and Siauliai, Lithuania, and an industrial landfill at Stena fragmenting AB, Halmstad, as well as for leachate from Kristianstad treated in different ways in a pilot plan). Artemia can tolerate the high concentrations of chloride ions found in such waters. Large differences in toxicities were found, the leachate from Siauliai being the most toxic one. To increase the selectivity in the measurements, a fractionation was done by using ion exchange to separate ammonium/ammonia and metal ions from the leachate, and activated carbon adsorbents for organic pollutants. The influence of some metals and phenol compounds on the toxicity was investigated separately. It was found that most of the toxicity emanated from the ammonium/ammonia components in the leachate. However, there was also a significant contribution n from organic pollutants, other than phenol compounds, since separate experiments had in this latter case indicated negligible impact. The concentrations of metals were at a level, shown by separate experiments, where only small contribution to the toxicity could be expected.

  17. Cytotoxicity of Dorema auchri, Achillea millefolium and Artemisia aucheri by Artemia

    Directory of Open Access Journals (Sweden)

    M Ghavamizadeh

    2013-09-01

    Full Text Available Abstract Background & aim: Nowadays, toxic compounds derived from plants used against microbes and cancer cells. The aim of this study was to evaluate cytotoxicity of Dorema aucheri, Achillea millefollium and Artemisia aucheri using brine shrimp, Artemia urmiana, lethality test. Methods: In this experimental study, the plants were collected from the Kohgiluyeh and Boyer-Ahmad Province, then identified by a botanist. Clean and air-dried aerial parts of plants were extracted with suitable solvents. Cytotoxicity evaluation was performed using larvae hatched cysts were purchased from Urmia. Live larvae were exposed to different concentrations of extract and the numbers of live and dead larvae were counted after 24 hours. Mean of LC 50 of any extracts from control and exposed live larvae were examined. The data were analyzed using the Finney’s Probit analysis. Results: Hydro ethanol and chloroform extracts of Achillea millefolium, Dorema aucheri and Artemisia aucheri exhibited potent brine shrimp lethality with LC50 67.8±0.53μg.ml-1, 76.50±0.60μg.ml-1, 92.70±6.05μg.ml-1 respectively. The degree of lethality was found to be directly proportional to the concentration of extracts. Conclusion: According to BSLT, LC50 of D. aucheri, A. millefolium and A. aucheri, they were considered as toxic. So these plants could be a source of new compounds with biological activity. Key words: Artemia urmiana, Dorema auchri, Achillea millefolium, Artemisia aucheri, Cytotoxicity

  18. Purification and characterization of hatching enzyme from brine shrimp Artemia salina.

    Science.gov (United States)

    Fan, Tingjun; Wang, Jing; Yuan, Wenpeng; Zhong, Qiwang; Shi, Ying; Cong, Rishan

    2010-02-01

    By using Artemia chorion as a specific substrate, the hatching enzyme from Artemia salina (AHE) was purified by gel-filtration and ion-exchange chromatography, and characterized biochemically and enzymatically in this study. It was found that the AHE had a molecular weight of 82.2 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and often contained 73.3 kDa molecules in preparation. The AHE had obvious choriolytic activity, which was optimal at pH 7.0 and a temperature of 408C. The Km value of the AHE for dimethyl casein was 8.20 mg/ml. The AHE activity was almost completely inhibited by soybean trypsin inhibitor and p-amidinophenyl methane sulfonyl fluoride hydrochloride, greatly inhibited by N-tosyl-L-lysyl chloromethyl ketone, phenylmethanesulfonyl fluoride, and lima bean trypsin inhibitor, slightly inhibited by pepstatin, N-tosyl-L-phenylalanyl chloromethyl ketone, leupeptin, N-ethylmaleimide, and iodoacetamide, and not inhibited by chymostatin and bestatin. All these results imply that AHE is most probably a trypsin-type serine protease. Besides of these, AHE was also sensitive to EDTA and Zn21. Combined with the results that the EDTA-pre-treated HE activity could be perfectly recovered by Zn21, it is indicated that AHE might be also a kind of Zn-metalloprotease.

  19. A proteomic study on postdiapaused embryonic development of brine shrimp (Artemia franciscana).

    Science.gov (United States)

    Wang, Weiwei; Meng, Bo; Chen, Weihua; Ge, Xiaomeng; Liu, Siqi; Yu, Jun

    2007-10-01

    Encysted gastrula of brine shrimp (Artemia, Crustacea, and Anostraca) provides an excellent model for studying molecular processes of diapause. We report a proteomic study on early molecular responses of Artemia's postdiapaused cysts and found that dehydrated cysts actually store more proteins, in both kind and amount, than developing cysts. We identified 75 differentially expressed proteins over a course of cyst development, and also exploited PTMs of dehydrate cysts. We further surveyed gene expression of postdiapaused cysts in early developmental phases in a 0.5 h interval up to the seventh hour, and discovered that the activation of cellular activities is ignited as early as 0.5 h after rehydration. We traced nine differentially expressed proteins (COXI, COXIII, heat shock proteins (HSP26, HSP60, and HSP70), CDC48, late embryogenesis abundant (LEA), GS1-like protein, and cathepsin L-associated protein (CLAP)) for quantitative transcriptional changes, monitored by real-time PCR, and found these proteins exhibiting distinct expression patterns that suggest complex gene regulations for cyst reactivation after diapause breakage. Future experiments should be designed to focus on early activation concerning signal transduction, energy generation, and PTMs.

  20. A bioassay using Artemia salina for detecting phototoxicity of plant coumarins.

    Science.gov (United States)

    Ojala, T; Vuorela, P; Kiviranta, J; Vuorela, H; Hiltunen, R

    1999-12-01

    Artemia salina (brine shrimp) has been successfully used for toxicity testing, and a screening test for phototoxicity has been developed based on this method. The ability of the method to test the phototoxic potential of seven known compounds was investigated. Athamantin (an angular furanocoumarin) and umbelliferone (a simple coumarin) showed no phototoxicity, while linear furanocoumarins exhibited phototoxic activity in the following order: psoralen > bergapten > peucedanin > xanthotoxin. The applicability of this method was also tested in screening the phototoxicity of plant material. Six plants from Apiaceae [Aegopodium podagraria L., Anethum graveolens L., Angelica archangelica L., Levisticum officinalis Koch, Petroselinum crispum (P. Mill) A. W. Hill., and Peucedanum palustre (L.) Moench] and one from Rutaceae (Ruta graveolens L.) were selected, all of them known to contain furanocoumarins. Extracts from leaves collected at different times during the growth period were used in the screening. Our results were in accordance with the furanocoumarin content of these plants and with the results of other phototoxicity tests. The Artemia salina method proved to be rapid, simple and inexpensive, and is therefore ideal in the initial biological screening of large numbers of samples for simultaneous detection of both toxicity and phototoxicity.

  1. Habitat diversity and adaptation to environmental stress in encysted embryos of the crustacean Artemia

    Indian Academy of Sciences (India)

    Joshua A Tanguay; Reno C Reyes; James S Clegg

    2004-12-01

    Encysted embryos (cysts) of the brine shrimp, Artemia, provide excellent opportunities for the study of biochemical and biophysical adaptation to extremes of environmental stress in animals. Among other virtues, this organism is found in a wide variety of hypersaline habitats, ranging from deserts, to tropics, to mountains. One adaptation implicated in the ecological success of Artemia is p26, a small heat shock protein that previous evidence indicates plays the role of a molecular chaperone in these embryos. We add to that evidence here. We summarize recently published work on thermal tolerance and stress protein levels in embryos from the San Francisco Bay (SFB) of California inoculated into experimental ponds in southern Vietnam where water temperatures are much higher. New results on the relative contents of three stress proteins (hsp70, artemin and p26) will be presented along with data on cysts of A. tibetiana collected from the high plateau of Tibet about 4.5 km above sea level. Unpublished results on the stress protein artemin are discussed briefly in the context of this paper, and its potential role as an RNA chaperone. Interestingly, we show that the substantial tolerance of A. franciscana embryos to ultraviolet (UV) light does not seem to result from intracellular biochemistry but, rather, from their surrounding thick shell, a biophysical adaptation of considerable importance since these embryos receive heavy doses of UV in nature.

  2. Morphological differentiation of seven parthenogenetic Artemia (Crustacea: Branchiopoda) populations from China, with special emphasis on ploidy degrees.

    Science.gov (United States)

    Asem, Alireza; Sun, Shi-Chun

    2016-04-01

    Parthenogenetic Artemia from seven Chinese locations with different elevations and various ploidies are characterized by phenotypic and morphometric analyses. Our findings show that the studied populations exhibit dissimilar patterns of ovisac. Four phenotypic patterns of furca are qualified and one of them is shared among di-, tetra- and pentaploid Artemia. Results of discriminant analysis based on morphometric data reveal that tetra- and pentaploid populations are grouped together, but the Aqqikkol Lake population is clearly differentiated. Previous hypothesis/conclusion that polyploid Artemia are larger than diploids is only partly supported by the present results, which show that pentaploid and tetraploid populations are larger than the mostly diploid populations in terms of the total length, but the body size of the Aibi Lake triploids has not significant difference with the sympatric diploids and the mostly diploid Aqqikkol population that inhabit in very high altitude has the largest body size among all parthenogenetic populations. The founding confirms that body size of Artemia is following with Bergmann's rule.

  3. Does a change from whole to powdered food (Artemia franciscana eggs) increase oviposition in the ladybird Coleomegilla maculata

    Science.gov (United States)

    The limited availability of alternative foods to replace natural prey hinders cost-effective mass production of ladybird beetles for augmentative biological control. We compared the effects of powdered versus whole Artemia franciscana (brine shrimp) eggs with or without a dietary supplement on devel...

  4. Nutrient enrichment of Artemia with free methionine%蛋氨酸对卤虫营养强化

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

    Methionine is indispensable of an essential amino acid for fish growing development , Artemia nauplii is commonly used as the start feed on fish larvae stage. But Artemia in vivo amino acid imbalance, especially methionine deficiency can not meet the nutritional needs of nutrition. Methionine is of great importance to nutrient enrichment of Artemia. Methionine is a common nutritional fortifier . This paper mainly introduces the purpose, methods and results of nutrient enrichment, and discuss the impact of enrichment of Artemia with free methionine.%  蛋氨酸是鱼类生长发育不可缺少的必需氨基酸,仔稚鱼时期常常用卤虫作为仔稚鱼的开口饵料,但卤虫的体内的氨基酸不平衡,尤其是蛋氨酸缺乏难以满足仔稚鱼的营养需求,因此蛋氨酸对卤虫的营养强化有很重要的意义。蛋氨酸是常用的营养强化剂,文章综述了蛋氨酸强化的目的、方法和结果,并讨论了影响蛋氨酸营养强化的因素。

  5. Evaluation of commercial Artemia enrichment products on growth, survival, stress tolerance, and fatty acid composition of larval Florida pompano

    Science.gov (United States)

    Rearing live feed organisms represents the majority of time and labor associated with larviculture operations vital to the seed stock supply of marine finfish aquaculture production facilities. No information exists with respect to optimal Artemia enrichment protocols for Florida pompano Trachinotu...

  6. Successful Replacement of Artemia salina nauplii with Marine Rotifers (Brachionus plicatilis) in the Diet of Preadult Zebrafish (Danio rerio).

    Science.gov (United States)

    Lawrence, Christian; James, Althea; Mobley, Scottie

    2015-10-01

    Previously established rearing protocols for zebrafish begin feeding with marine rotifers (Brachionus plicatilis), followed by Artemia nauplii until the fish reach subadult stage, the developmental time point at which they can be most easily transitioned onto a processed diet. However, the inclusion of Artemia is less than ideal, given its fluctuating availability and high costs. We tested whether or not we could replace Artemia with rotifers during our normal rearing sequence and still meet published performance standards for (i) weaning fish onto a processed diet by 25 days postfertilization (dpf) and (ii) successful breeding by 60 dpf. Here, we present the results of trials where wild-type and casper zebrafish were fed exclusively with rotifers (R) or rotifers followed by Artemia (RA) for the first 25 dpf after which point all fish were transitioned to a processed diet (Gemma Micro 300). We measured growth and survival at days 25 and 60, and tested for reproductive capability at 60 dpf. While growth performance was significantly better in the RA groups, we were still able to meet goals for both weaning and generation time in the R groups without compromising survival or sex ratios.

  7. Post-prandial protease activity in the digestive tract of African catfish, Clarias gariepinus, larvae fed decapsulated cysts of Artemia

    NARCIS (Netherlands)

    García Ortega, A.; Verreth, J.; Segner, H.

    2000-01-01

    The alkaline proteolytic activity in the gut of African catfish larvae was studied during short time ranges from 30 min to 4 h after ingestion of decapsulated Artemia cysts. The variation in total protease and trypsin activities during the day was monitored during starvation, after one single meal i

  8. [Biological and biochemical quality of the Artemia (Anostraca: Artemiidae) population from Real de Salinas saltworks, Calkiní, Campeche, Mexico].

    Science.gov (United States)

    Rodríguez-Canché, Leticia G; Maldonado-Montiel, Teresita D N J; Carrillo Navarro, Luciano A

    2006-12-01

    Cysts of Artemia spp. collected from February 1997 to February 2000 in the Real de Salinas solar saltworks, Campeche, Mexico, were compared with Artemia franciscana (batch number 8,131 Microfeast Artemia Cysts, Texas, USA). The variables determined in these two populations were: number of cysts per gram, hatching percentage, hatching efficiency, hatching rate, hatching synchrony and hatching biomass, as well as diameter of the cysts and length of the nauplii (instar I). For Salinas, the average diameters of the encapsulated and decapsulated cysts were 230.5 +/- 4.14 and 221.8 +/- 3.39 microm, respectively. The thickness of the cyst shell was 4.35 +/- 0.68 microm and the length of the nauplii was 388.11 +/- 4.39 microm, this last value is among the smallest reported in the literature. For the commercial population of A. franciscana, the average diameters of the encapsulated and decapsulated cysts were 230.21 +/- 12.49 and 216.96 +/- 13.71, respectively. With respect to the corion thickness and length of the nauplii the values were 6.62 +/- 2.72 and 424.70 +/- 30.08, respectively. The protein value of the cysts (47.91 %) and nauplii (50.5 %) of Artemia population from Real de Salinas, are considered adequate to be used as food in aquaculture. The results indicate that the population from Real de Salinas presents positive features for its use in aquaculture in the region.

  9. Ribosomal S6 kinase is activated as an early event in preemergence development of encysted embryos of Artemia salina.

    Science.gov (United States)

    Malarkey, K; Coker, K J; Sturgill, T W

    1998-01-15

    Dormant Artemia salina cysts contain desiccated gastrulae that are metabolically inactive, and physiologically arrested. Following rehydration, embryos resume development via alterations in protein expression, in the complete absence of cell division. In mammals, activation of p70 ribosomal S6 kinase (p70S6k) has been implicated in translational control, in particular the selective up-regulation of translation of mRNAs with polypyrimidine tracts at their 5' start sites. We therefore investigated ribosomal S6 kinase activity in preemergence development. We demonstrate that an S6 kinase activity is rapidly stimulated (within Artemia S6 kinase was inactivated by treatment with protein phosphatase 2A. Activation of S6 kinase activity was shown to be due to an enzymatic step(s), and not simply rehydration of stored, active enzyme. The temporal profile of activation of S6 kinase activity is compatible with a regulatory function for p70S6k in early preemergence development of encysted Artemia. These studies identify activated Artemia cysts as a system for biochemical studies of p70S6k regulation.

  10. Formation of diapause cyst shell in brine shrimp, Artemia parthenogenetica, and its resistance role in environmental stresses.

    Science.gov (United States)

    Liu, Yu-Lei; Zhao, Yang; Dai, Zhong-Min; Chen, Han-Min; Yang, Wei-Jun

    2009-06-19

    Artemia has attracted much attention for its ability to produce encysted embryos wrapped in a protective shell when subject to extremely harsh environmental conditions. However, what the cyst shell is synthesized from and how the formative process is performed remains, as yet, largely unknown. Over 20 oviparous specifically expressed genes were identified through screening the subtracted cDNA library enriched between oviparous and ovoviviparous Artemia ovisacs. Among them, a shell gland-specifically expressed gene (SGEG) has been found to be involved in the cyst shell formation. Lacking SGEG protein (by RNA interference) caused the cyst shell to become translucent and the chorion layer of the shell to become less compact and pultaceous and to show a marked decrease of iron composition within the shell. The RNA interference induced defective diapause cysts with a totally compromised resistibility to UV irradiation, extremely large temperature differences, osmotic pressure, dryness, and organic solvent stresses. In contrast, the natural cyst would provide adequate protection from all such factors. SGEG contains a 345-bp open reading frame, and its consequentially translated peptide consists of a 33-amino acid residue putative signal peptide and an 81-amino acid residue mature peptide. The results of Northern blotting and in situ hybridization indicate that the gene is specifically expressed in the cells of shell glands during the period of diapause cyst formation of oviparous Artemia. This investigation adds strong insight into the mechanism of cyst shell formation of Artemia and may be applicable to other areas of research in extremophile biology.

  11. Infectivity of Cordyceps taishanensis on Tenebrio molitor%泰山虫草对黄粉虫的侵染特性研究

    Institute of Scientific and Technical Information of China (English)

    韩玉梅; 金莹; 孔怡; 安秀荣; 丁爱云

    2012-01-01

    The larvae of Tenebrio molitor were injected with conida suspension of Cordyceps taishanensis in vito. By using of exracting the humoral of infected larvae, the dynamic changes of the different enzymes activities of the humoral (such as SOD,POD,CAT)at different infection times were studied. The results showed that the conida of Cordyceps taishanensis could infect Tenebrio molitor larvae and harvest the fruit body. Being infected from two days to four days, the contents and activities of different active substances (protein, soluble sugar, SOD, POD, CAT, ) of the larvae changed to different extent. These changes indicated that Tenebrio molitor had unique defense system to prevent the infection of entomogenous fungi.%报道了用泰山虫草分生孢子悬浮液接种活体黄粉虫,提取被侵染的黄粉虫体液,并测定不同侵染时间虫体液中酶活性的动态变化。结果表明:泰山虫草分生孢子能成功的侵染黄粉虫并长出子座;接种第2—4d后即可导致黄粉虫体内活性发生不同程度的变化,说明黄粉虫具有独特的防御病原微生物的侵染机制。

  12. Two p90 ribosomal S6 kinase isoforms are involved in the regulation of mitotic and meiotic arrest in Artemia.

    Science.gov (United States)

    Duan, Ru-Bing; Zhang, Li; Chen, Dian-Fu; Yang, Fan; Yang, Jin-Shu; Yang, Wei-Jun

    2014-06-06

    There are multiple isoforms of p90 ribosomal S6 kinase (RSK), which regulate diverse cellular functions such as cell growth, proliferation, maturation, and motility. However, the relationship between the structures and functions of RSK isoforms remains undetermined. Artemia is a useful model in which to study cell cycle arrest because these animals undergo prolonged diapauses, a state of obligate dormancy. A novel RSK isoform was identified in Artemia, which was termed Ar-Rsk2. This isoform was compared with an RSK isoform that we previously identified in Artemia, termed Ar-Rsk1. Ar-Rsk2 has an ERK-docking motif, whereas Ar-Rsk1 does not. Western blot analysis revealed that Ar-Rsk1 was activated by phosphorylation, which blocked meiosis in oocytes. Knockdown of Ar-Rsk1 reduced the level of phosphorylated cdc2 and thereby suppressed cytostatic factor activity. This indicates that Ar-Rsk1 regulates the cytostatic factor in meiosis. Expression of Ar-Rsk2 was down-regulated in Artemia cysts in which mitosis was arrested. Knockdown of Ar-Rsk2 resulted in decreased levels of cyclin D3 and phosphorylated histone H3, and the production of pseudo-diapause cysts. This indicates that Ar-Rsk2 regulates mitotic arrest. PLK and ERK RNAi showed that Ar-Rsk2, but not Ar-Rsk1, could be activated by PLK-ERK in Artemia. This is the first study to report that RSK isoforms with and without an ERK-docking motif regulate mitosis and meiosis, respectively. This study provides insight into the relationship between the structures and functions of RSK isoforms.

  13. The first-generation Daphnia magna linkage map

    Directory of Open Access Journals (Sweden)

    De Meester Luc

    2010-09-01

    Full Text Available Abstract Background Daphnia magna is a well-established model species in ecotoxicology, ecology and evolution. Several new genomics tools are presently under development for this species; among them, a linkage map is a first requirement for estimating the genetic background of phenotypic traits in quantitative trait loci (QTL studies and is also very useful in assembling the genome. It also enables comparative studies between D. magna and D. pulex, for which a linkage map already exists. Results Here we describe the first genetic linkage map of D. magna. We generated 214 F2 (intercross clonal lines as the foundation of the linkage analysis. The linkage map itself is based on 109 microsatellite markers, which produced ten major linkage groups ranging in size from 31.1 cM to 288.5 cM. The total size of this linkage map extends to 1211.6 Kosambi cM, and the average interval for the markers within linkage groups is 15.1 cM. The F2 clones can be used to map QTLs for traits that differ between the parental clones. We successfully mapped the location of two loci with infertility alleles, one inherited from the paternal clone (Iinb1 and the other from the maternal clone (Xinb3. Conclusions The D. magna linkage map presented here provides extensive coverage of the genome and a given density of markers that enable us to detect QTLs of moderate to strong effects. It is similar in size to the linkage map of D. pulex.

  14. Genes mirror geography in Daphnia magna.

    Science.gov (United States)

    Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

    2015-09-01

    Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history.

  15. Comparative toxicity of leachates from 52 textiles to Daphnia magna.

    Science.gov (United States)

    Dave, Göran; Aspegren, Pia

    2010-10-01

    The environmental aspects of textiles are very complex and include production, processing, transport, usage, and recycling. Textiles are made from a variety of materials and can contain a large number of chemicals. Chemicals are used during production of fibres, for preservation and colouring and they are released during normal wear and during washing. The aim of this study was to investigate the release to water of toxic chemicals from various textiles. Altogether 52 samples of textiles made from cotton (21), linen (4), cotton and linen (7), cellulose (3), synthetic fibres (7), cotton and synthetic fibres (8) and wool (2). Seven were eco-labelled. All textiles were cut into squares and placed into Petri dishes with 50 ml ISO test medium in a concentration series (4-256 cm(2)/50 ml) and tested for acute toxicity to Daphnia magna. Estimated EC50s were converted into weight/volume, and 48-h EC50s ranged between 182 g/L. It was not possible to detect any difference between fibre type and toxicity (ANOVA), but a significantly higher toxicity was found for printed versus unprinted cotton and cotton/linen textiles, while the opposite was found for synthetic textiles. Eco-labelled products were evenly distributed on a toxicity scale, which means that eco-labelling in its present form does not necessarily protect users or the environment from exposure to toxic chemicals. Therefore, the results from the present study suggest that bioassays and toxicity tests should become an integrated part of textile environmental quality control programs.

  16. SNP detection in Na/K ATP-ase gene α1 subunit of bisexual and parthenogenetic Artemia strains by RFLP screening.

    Science.gov (United States)

    Manaffar, R; Zare, S; Agh, N; Abdolahzadeh, N; Soltanian, S; Sorgeloos, P; Bossier, P; Van Stappen, G

    2011-01-01

    In order to find a marker for differentiating between a bisexual and a parthenogenetic Artemia strain, Exon-7 of the Na/K ATPase α(1) subunit gene was screened by RFLP technique. The results revealed a constant synonymous SNP (single nucleotide polymorphism) in digestion by the Tru1I enzyme that was consistent with these two types of Artemia. This SNP was identified as an accurate molecular marker for discrimination between bisexual and parthenogenetic Artemia. According to the Nei's genetic distance (1973), the lowest genetic distance was found between individuals from Artemia urmiana Günther 1890 and parthenogenetic populations, making the described marker the first marker to easily distinguish between these two cooccurring species.

  17. Survival and retention of the probiotic properties of Bacillus sp. strains under marine stress starvation conditions and their potential use as a probiotic in Artemia culture.

    Science.gov (United States)

    Mahdhi, Abdelkarim; Esteban, Maria Ángeles; Hmila, Zeineb; Bekir, Karima; Kamoun, Fathi; Bakhrouf, Amina; Krifi, Boubaker

    2012-12-01

    The probiotic properties of Bacillus strains isolated from Artemia culture and the effect of marine stress on viability and survival were investigated, as well as the changes occurring in their properties. Analyses showed that these bacteria corresponded to the genus Bacillus sp. Antagonism and adherence assays revealed that Bacillus strains have an inhibitory effect against tested pathogenic bacteria and are fairly adherent. Normal and starved cells showed different enzymatic profiles. Challenge tests performed with Artemia larvae provided evidence that the tested Bacillus strains were neither pathogenic nor toxic to the host and conferred protection for Artemia culture against pathogens. The tested strains maintained their viability and their probiotic properties during the period of study. The results suggest that the tested strains have suffered changes allowing them to survive in seawater in the absence of nutrients and outside their natural host, identifying them as potential probiotic candidates for Artemia culture.

  18. Some observations on the growth and cyst production characteristics of the brine shrimp Artemia sp. (Gujarat strain) in pond culture and its potential for import substitution

    OpenAIRE

    Gopalakrishnan, P.; Krishna Raju, V.; Thaker, S R

    1989-01-01

    Experimental culture of the brine shrimp Artemia sp. (Gujarat strain) and production of cyst is discussed. The qualitative and quantitative aspects of the cyst and its economic potential for import substitution are highlighted.

  19. Multigenerational demographic responses of sexual and asexual Artemia to chronic genotoxicity by a reference mutagen.

    Science.gov (United States)

    Sukumaran, Sandhya; Grant, Alastair

    2013-11-15

    Genotoxins are capable of multigenerational impacts on natural populations via DNA damage and mutations. Sexual reproduction is assumed to reduce the long term consequences of genotoxicity for individual fitness and should therefore reduce population level effects. However, rather few empirical studies have quantified the magnitude of this effect. We tried to analyse the multigenerational demographic responses of sexual Artemia franciscana and asexual Artemia parthenogenetica due to chronic genotoxicity by a reference mutagen, ethyl methane sulfonate (EMS). A prospective (elasticity analysis) and retrospective (differences and contributions) perturbation analysis was carried out to understand the interactions of life history traits with population growth rate λ by comparing elasticities, differences and contributions of vital rates to λ. None of the previous studies have compared the effects of chronic genotoxicity using prospective and retrospective perturbation analyses in a sexual and asexual species over generations. The behaviour of a population with lower growth rate in the presence of genotoxicants in the field was studied by simulating reduced fertilities in the LTRE design. The results of prospective and retrospective perturbation analyses of effects on λ showed that population growth rate was proportionally more sensitive to juvenile survival whereas the effect of EMS on juvenile fertility contributed more to the variations in population growth rate in both the species and this effect was due to the high growth rate of Artemia. Simulations of lower population growth rate in the model showed that adult fertility and survival are also of importance. Sexual reproduction substantially mitigated the long term consequences of genetic damage, although these would be greater if population growth rate were lower. So multigenerational population level consequences of genotoxicity were much greater in an asexual species. So asexual species, and those with a

  20. Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates.

    Science.gov (United States)

    Defoirdt, Tom; Crab, Roselien; Wood, Thomas K; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

    2006-09-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests.

  1. What goes down must come up: symmetry in light-induced migration behaviour of Daphnia

    NARCIS (Netherlands)

    Van Gool, E.; Ringelberg, J.

    2003-01-01

    During a short period of the year, Daphnia may perform a phenotypically induced diel vertical migration. For this to happen, light-induced swimming reactions must be enhanced both at dawn and at dusk. Enhanced swimming in response to light intensity increase can be elicited by fish-associated kairom

  2. What Can Molecular Markers Tell Us About the Evolutionary History of Daphnia Species Complexes

    NARCIS (Netherlands)

    Schwenk, K.; Ender, A.; Streit, B.

    1995-01-01

    Despite the wealth of information on the ecology of Daphnia species, the systematics and phylogeny of the genus is still unresolved. The taxonomic uncertainties are based in part on the phenomenon of interspecific hybridization, which has been well documented for species of the D. galeata/cucullata/

  3. Effects of medium renewal and handling stress on life history traits in Daphnia

    NARCIS (Netherlands)

    Rousseaux, S.; Vanoverbeke, J.; Aerts, J.; Declerck, S.A.J.

    2010-01-01

    The zooplankton genus Daphnia is used as a model organism in ecological, ecotoxicological and evolutionary research. It is often used in experimental laboratory setups to examine life history traits under a variety of factors inducing stress. One type of stress, handling stress because of manipulati

  4. Comparing grazing on lake seston by Dreissena and Daphnia: lessons for biomanipulation

    NARCIS (Netherlands)

    Pires, L.M.D.; Ibelings, B.W.; Brehm, Michaela; Van Donk, E.

    2005-01-01

    Biomanipulation measures in lakes, taken to diminish algal blooms, have mainly been restricted to the reduction of zooplanktivorous fish with the aim to stimulate the grazing pressure by native filter feeders such as Daphnia. However, larger filter feeders like the exotic zebra mussel, Dreissena pol

  5. A rapid bioassay for detecting saxitoxins using a Daphnia acute toxicity test

    Energy Technology Data Exchange (ETDEWEB)

    Ferrao-Filho, Aloysio da S., E-mail: aloysio@ioc.fiocruz.b [Laboratorio de Avaliacao e Promocao da Saude Ambiental, Departamento de Biologia, Instituto Oswaldo Cruz, FIOCRUZ, Av. Brasil 4365, Manguinhos, Rio de Janeiro, RJ 21045-900 (Brazil); Soares, Maria Carolina S., E-mail: mcarolsoares@gmail.co [Departamento de Engenharia Sanitaria e Ambiental Faculdade de Engenharia, Universidade Federal de Juiz de Fora, Juiz de Fora, MG 36036-900 (Brazil); Freitas de Magalhaes, Valeria, E-mail: valeria@biof.ufrj.b [Laboratorio de Ecofisiologia e Toxicologia de Cianobacterias, Instituto de Biofisica Carlos Chagas Filho, CCS, Universidade Federal do Rio de Janeiro, Ilha do Fundao, Rio de Janeiro, RJ 21949-900 (Brazil); Azevedo, Sandra M.F.O., E-mail: sazevedo@biof.ufrj.b [Laboratorio de Ecofisiologia e Toxicologia de Cianobacterias, Instituto de Biofisica Carlos Chagas Filho, CCS, Universidade Federal do Rio de Janeiro, Ilha do Fundao, Rio de Janeiro, RJ 21949-900 (Brazil)

    2010-06-15

    Bioassays using Daphnia pulex and Moina micrura were designed to detect cyanobacterial neurotoxins in raw water samples. Phytoplankton and cyanotoxins from seston were analyzed during 15 months in a eutrophic reservoir. Effective time to immobilize 50% of the exposed individuals (ET{sub 50}) was adopted as the endpoint. Paralysis of swimming movements was observed between approx0.5-3 h of exposure to lake water containing toxic cyanobacteria, followed by an almost complete recovery of the swimming activity within 24 h after being placed in control water. The same effects were observed in bioassays with a saxitoxin-producer strain of Cylindrospermopsis raciborskii isolated from the reservoir. Regression analysis showed significant relationships between ET{sub 50}vs. cell density, biomass and saxitoxins content, suggesting that the paralysis of Daphnia in lake water samples was caused by saxitoxins found in C. raciborskii. Daphnia bioassay was found to be a sensitive method for detecting fast-acting neurotoxins in natural samples, with important advantages over mouse bioassays. - A new Daphnia bioassay, as an alternative to the mouse bioassay, is able to detect effects of fast-acting, potent neurotoxins in raw water.

  6. Involvement of Daphnia pulicaria Sir2 in regulating stress response and lifespan.

    Science.gov (United States)

    Schumpert, Charles A; Anderson, Craig; Dudycha, Jeffry L; Patel, Rekha C

    2016-02-01

    The ability to appropriately respond to proteotoxic stimuli is a major determinant of longevity and involves induction of various heat shock response (HSR) genes, which are essential to cope with cellular and organismal insults throughout lifespan. The activity of NAD+-dependent deacetylase Sir2, originally discovered in yeast, is known to be essential for effective HSR and longevity. Our previous work on HSR inDaphnia pulicaria indicated a drastic reduction of the HSR in older organisms. In this report we investigate the role of Sir2 in regulating HSR during the lifespan of D. pulicaria. We cloned Daphnia Sir2 open reading frame (ORF) to characterize the enzyme activity and confirmed that the overall function of Sir2 was conserved in Daphnia. The Sir2 mRNA levels increased while the enzyme activity declined with age and considering that Sir2 activity regulates HSR, this explains the previously observed age-dependent decline in HSR. Finally, we tested the effect of Sir2 knockdown throughout adult life by using our new RNA interference (RNAi) method by feeding. Sir2 knockdown severely reduced both the median lifespan as well as significantly increased mortality following heat shock. Our study provides the first characterization and functional study of Daphnia Sir2.

  7. Cyanobacterial protease inhibitor microviridin J causes a lethal molting disruption in Daphnia pulicaria.

    Science.gov (United States)

    Rohrlack, Thomas; Christoffersen, Kirsten; Kaebernick, Melanie; Neilan, Brett A

    2004-08-01

    Laboratory experiments identified microviridin J as the source of a fatal molting disruption in Daphnia species organisms feeding on Microcystis cells. The molting disruption was presumably linked to the inhibitory effect of microviridin J on daphnid proteases, suggesting that hundreds of further cyanobacterial protease inhibitors must be considered potentially toxic to zooplankton.

  8. Acute and chronic toxicity of short chained perfluoroalkyl substances to Daphnia magna

    NARCIS (Netherlands)

    Barmentlo, S.H.; Stel, J.M.; van Doorn, M.; Eschauzier, C.; de Voogt, P.; Kraak, M.H.S.

    2015-01-01

    The aim of this study was to evaluate the aquatic toxicity of a C4-C6 chemistry based fluoroalkylated polymer and the perfluoroalkyl carboxylic acids, PFBA, PFHxA and PFOA to Daphnia magna. The acute toxicity decreased with decreasing carbon chain length, but the polymer did not show a dose related

  9. Light-induced swimming of Daphnia: can laboratory experiments predict diel vertical migration?

    NARCIS (Netherlands)

    Van Gool, E.

    1997-01-01

    Vertical displacement velocity of a Daphnia galeata x hyalina clone was quantified in relation to changes in the relative rate of light change. An increase in the latter variable triggers an enhanced swimming response, and this response is again elicited when a second increase in the rate of relativ

  10. Food mediated life history strategies in Daphnia magna: their relevance to ecotoxicological evaluations.

    NARCIS (Netherlands)

    Enserink, E.L.

    1995-01-01

    The waterflea Daphnia magna is a widely used test organism in ecotoxicological studies. Acute and chronic laboratory tests yield basic information for the development of water quality standards, assessment of potential hazards of (new) chemicals, waste water licences and sanitation measures for cont

  11. Differences in orientation behaviour underlie interclonal differences in phototaxis in Daphnia magna

    NARCIS (Netherlands)

    Van Gool, E.

    1999-01-01

    I studied the orientation direction of the body and the eye in response to contrasts in Daphnia magna. The orientation of the body was studied on pinned, but freely rotating daphnids, and on freely swimming daphnids. The orientation direction of the eye was studied on daphnids with a fixed position

  12. The effect of temperature on the sensitivity of Daphnia magna to cyanobacteria is genus dependent.

    Science.gov (United States)

    Hochmuth, Jennifer D; De Schamphelaere, Karel A C

    2014-10-01

    In the present study, the authors investigated the effects of 6 different genera of cyanobacteria on multiple endpoints of Daphnia magna in a 21-d life table experiment conducted at 3 different temperatures (15 °C, 19 °C, and 23 °C). The specific aims were to test if the effect of temperature on Daphnia's sensitivity to cyanobacteria differed among different cyanobacteria and if the rank order from most to least harmful cyanobacteria to Daphnia reproduction changed or remained the same across the studied temperature range. Overall, the authors observed a decrease in harmful effects on reproduction with increasing temperature for Microcystis, Nodularia, and Aphanizomenon, and an increase in harmful effects with increasing temperature for Anabaena and Oscillatoria. No effect of temperature was observed on Daphnia sensitivity to Cylindrospermopsis. Harmful effects of Microcystis and Nodularia on reproduction appear to be mirrored by a decrease in length. On the other hand, harmful effects of Anabaena, Aphanizomenon, and Oscillatoria on reproduction were correlated with a decrease in intrinsic rate of natural increase, which was matched by a later onset of reproduction in exposures to Oscillatoria. In addition, the results suggest that the cyanobacteria rank order of harmfulness may change with temperature. Higher temperatures may increase the sensitivity of D. magna to the presence of some cyanobacteria (Anabaena and Oscillatoria) in their diet, whereas the harmful effects of others (Microcystis, Nodularia, and Aphanizomenon) may be reduced by higher temperatures.

  13. Effects of cell-bound microcystins on survival and feeding of Daphnia spp

    DEFF Research Database (Denmark)

    Rohrlack, T; Dittmann, E; Börner, T

    2001-01-01

    The influence of cell-bound microcystins on the survival time and feeding rates of six Daphnia clones belonging to five common species was studied. To do this, the effects of the microcystin-producing Microcystis strain PCC7806 and its mutant, which has been genetically engineered to knock out mi...

  14. Inducible Defenses with a "Twist": Daphnia barbata Abandons Bilateral Symmetry in Response to an Ancient Predator.

    Science.gov (United States)

    Herzog, Quirin; Rabus, Max; Wolfschoon Ribeiro, Bernard; Laforsch, Christian

    2016-01-01

    Predation is one of the most important drivers of natural selection. In consequence a huge variety of anti-predator defenses have evolved in prey species. Under unpredictable and temporally variable predation pressure, the evolution of phenotypically plastic defensive traits is favored. These "inducible defenses", range from changes in behavior, life history, physiology to morphology and can be found in almost all taxa from bacteria to vertebrates. An important group of model organisms in ecological, evolutionary and environmental research, water fleas of the genus Daphnia (Crustacea: Cladocera), are well known for their ability to respond to predators with an enormous variety of inducible morphological defenses. Here we report on the "twist", a body torsion, as a so far unrecognized inducible morphological defense in Daphnia, expressed by Daphnia barbata exposed to the predatory tadpole shrimp Triops cancriformis. This defense is realized by a twisted carapace with the helmet and the tail spine deviating from the body axis into opposing directions, resulting in a complete abolishment of bilateral symmetry. The twisted morphotype should considerably interfere with the feeding apparatus of the predator, contributing to the effectiveness of the array of defensive traits in D. barbata. As such this study does not only describe a completely novel inducible defense in the genus Daphnia but also presents the first report of a free living Bilateria to flexibly respond to predation risk by abandoning bilateral symmetry.

  15. Inducible Defenses with a "Twist": Daphnia barbata Abandons Bilateral Symmetry in Response to an Ancient Predator.

    Directory of Open Access Journals (Sweden)

    Quirin Herzog

    Full Text Available Predation is one of the most important drivers of natural selection. In consequence a huge variety of anti-predator defenses have evolved in prey species. Under unpredictable and temporally variable predation pressure, the evolution of phenotypically plastic defensive traits is favored. These "inducible defenses", range from changes in behavior, life history, physiology to morphology and can be found in almost all taxa from bacteria to vertebrates. An important group of model organisms in ecological, evolutionary and environmental research, water fleas of the genus Daphnia (Crustacea: Cladocera, are well known for their ability to respond to predators with an enormous variety of inducible morphological defenses. Here we report on the "twist", a body torsion, as a so far unrecognized inducible morphological defense in Daphnia, expressed by Daphnia barbata exposed to the predatory tadpole shrimp Triops cancriformis. This defense is realized by a twisted carapace with the helmet and the tail spine deviating from the body axis into opposing directions, resulting in a complete abolishment of bilateral symmetry. The twisted morphotype should considerably interfere with the feeding apparatus of the predator, contributing to the effectiveness of the array of defensive traits in D. barbata. As such this study does not only describe a completely novel inducible defense in the genus Daphnia but also presents the first report of a free living Bilateria to flexibly respond to predation risk by abandoning bilateral symmetry.

  16. Genomics, transcriptomics, and peptidomics of Daphnia pulex neuropeptides and protein hormones

    DEFF Research Database (Denmark)

    Dircksen, Heinrich; Neupert, Susanne; Predel, Reinhard

    2011-01-01

    We report 43 novel genes in the water flea Daphnia pulex encoding 73 predicted neuropeptide and protein hormones as partly confirmed by RT-PCR. MALDI-TOF mass spectrometry identified 40 neuropeptides by mass matches and 30 neuropeptides by fragmentation sequencing. Single genes encode adipokinetic...

  17. Genomic integration and germline transmission of plasmid injected into crustacean Daphnia magna eggs.

    Directory of Open Access Journals (Sweden)

    Yasuhiko Kato

    Full Text Available The water flea, Daphnia, has been the subject of study in ecology, evolution, and environmental sciences for decades. Over the last few years, expressed sequence tags and a genome sequence have been determined. In addition, functional approaches of overexpression and gene silencing based on microinjection of RNAs into eggs have been established. However, the transient nature of these approaches prevents us from analyzing gene functions in later stages of development. To overcome this limitation, transgenesis would become a key tool. Here we report establishment of a transgenic line using microinjection of plasmid into Daphnia magna eggs. The green fluorescent protein (GFP gene fused with the D. magna histone H2B gene under the control of a promoter/enhancer region of the elongation factor 1α-1 (EF1α-1 gene, EF1α-1::H2B-GFP, was used as a reporter providing high resolution visualization of active chromatin. Transgenic lines were obtained from 0.67% of the total fertile adults that survived the injections. One of the transgenic animals, which exhibited fluorescence in the nuclei of cells during embryogenesis and oogenesis, had two copies of EF1α-1::H2B-GFP in a head-to-tail array. This is the first report of a transgenesis technique in Daphnia and, together with emerging genome sequences, will be useful for advancing knowledge of the molecular biology of Daphnia.

  18. Chytrid parasitism facilitates trophic transfer between bloom-forming cyanobacteria and zooplankton (Daphnia)

    Science.gov (United States)

    Agha, Ramsy; Saebelfeld, Manja; Manthey, Christin; Rohrlack, Thomas; Wolinska, Justyna

    2016-10-01

    Parasites are rarely included in food web studies, although they can strongly alter trophic interactions. In aquatic ecosystems, poorly grazed cyanobacteria often dominate phytoplankton communities, leading to the decoupling of primary and secondary production. Here, we addressed the interface between predator-prey and host-parasite interactions by conducting a life-table experiment, in which four Daphnia galeata genotypes were maintained on quantitatively comparable diets consisting of healthy cyanobacteria or cyanobacteria infected by a fungal (chytrid) parasite. In four out of five fitness parameters, at least one Daphnia genotype performed better on parasitised cyanobacteria than in the absence of infection. Further treatments consisting of purified chytrid zoospores and heterotrophic bacteria suspensions established the causes of improved fitness. First, Daphnia feed on chytrid zoospores which trophically upgrade cyanobacterial carbon. Second, an increase in heterotrophic bacterial biomass, promoted by cyanobacterial decay, provides an additional food source for Daphnia. In addition, chytrid infection induces fragmentation of cyanobacterial filaments, which could render cyanobacteria more edible. Our results demonstrate that chytrid parasitism can sustain zooplankton under cyanobacterial bloom conditions, and exemplify the potential of parasites to alter interactions between trophic levels.

  19. Toxicity of various silver nanoparticles compared to silver ions in Daphnia magna

    Directory of Open Access Journals (Sweden)

    Asghari Saba

    2012-04-01

    Full Text Available Abstract Background To better understand the potential ecotoxicological impacts of silver nanoparticles released into freshwater environments, the Daphnia magna 48-hour immobilization test was used. Methods The toxicities of silver nitrate, two types of colloidal silver nanoparticles, and a suspension of silver nanoparticles were assessed and compared using standard OECD guidelines. Also, the swimming behavior and visible uptake of the nanoparticles by Daphnia were investigated and compared. The particle suspension and colloids used in the toxicity tests were well-characterized. Results The results obtained from the exposure studies showed that the toxicity of all the silver species tested was dose and composition dependent. Plus, the silver nanoparticle powders subsequently suspended in the exposure water were much less toxic than the previously prepared silver nanoparticle colloids, whereas the colloidal silver nanoparticles and AgNO3 were almost similar in terms of mortality. The silver nanoparticles were ingested by the Daphnia and accumulated under the carapace, on the external body surface, and connected to the appendages. All the silver species in this study caused abnormal swimming by the D. magna. Conclusion According to the present results, silver nanoparticles should be classified according to GHS (Globally Harmonized System of classification and labeling of chemicals as "category acute 1" to Daphnia neonates, suggesting that the release of nanosilver into the environment should be carefully considered.

  20. Bioavailability and effect of pirimicarb on Daphnia magna in a laboratory freshwater/sediment system

    DEFF Research Database (Denmark)

    Kusk, K.O.

    1996-01-01

    In tests with newborn and one-week-old Daphnia magna, 48-h EC(50) values of 21-24 mu g/L and 16 mu g/L pirimicarb, respectively, were found. Older animals thus were as sensitive to pirimicarb as newborn animals. In an experiment with sediment included in the test system, all mother animals surviv...

  1. Food availability affects the strength of mutualistic host-microbiota interactions in Daphnia magna.

    Science.gov (United States)

    Callens, Martijn; Macke, Emilie; Muylaert, Koenraad; Bossier, Peter; Lievens, Bart; Waud, Michael; Decaestecker, Ellen

    2016-04-01

    The symbiotic gut microbial community is generally known to have a strong impact on the fitness of its host. Nevertheless, it is less clear how the impact of symbiotic interactions on the hosts' fitness varies according to environmental circumstances such as changes in the diet. This study aims to get a better understanding of host-microbiota interactions under different levels of food availability. We conducted experiments with the invertebrate, experimental model organism Daphnia magna and compared growth, survival and reproduction of conventionalized symbiotic Daphnia with germ-free individuals given varying quantities of food. Our experiments revealed that the relative importance of the microbiota for the hosts' fitness varied according to dietary conditions. The presence of the microbiota had strong positive effects on Daphnia when food was sufficient or abundant, but had weaker effects under food limitation. Our results indicate that the microbiota can be a potentially important factor in determining host responses to changes in dietary conditions. Characterization of the host-associated microbiota further showed that Aeromonas sp. was the most prevalent taxon in the digestive tract of Daphnia.

  2. Effects of UV-B irradiated algae on life history traits of Daphnia pulex

    NARCIS (Netherlands)

    De Lange, H.J.; Van Donk, E.

    1997-01-01

    1. The impact of ultraviolet-B (UVB)-irradiated phytoplankton on the life history parameters of Daphnia was studied. Three species of Chlorophyceae (Chlamydomonas reinhardtii, Scenedesmus acutus and S. subspicatus) and one species of Cryptophyceae (Cryptamonas pyrenoidifera) were cultured with and w

  3. Demographic cost and mechanisms of adaptation to environmental stress in resurrected Daphnia

    Directory of Open Access Journals (Sweden)

    Stefan Sommer

    2016-04-01

    Full Text Available A characteristic feature of the Daphnia (Crustacea: Cladocera life cycle are the so-called ephippia, which are fertilised eggs that need to undergo diapause. When they are shed by the female, they sink to the lake bottom, where they may become embedded in the sediment and may remain viable for decades. Extracting and hatching ephippia in the laboratory and subjecting resurrected lineages to conditions representative of historic lake environments allows retrospective investigation of life-history responses to environmental change. Here we reanalyse data from such a resurrection experiment (Piscia et al., 2015: Bull. Environ. Contam. Toxicol. 94:46–51. Contemporary and past lineages of Daphnia galeata Sars 1863 were obtained from Lake Orta (Italy, a deep, subalpine lake with a well-documented history of industrial copper pollution. Experimental Daphnia were subjected to three copper treatments representative of two levels of historic as well as to current (i.e., unpolluted lake conditions, and life-table data were collected. With these data at hand, we first estimated vital rates (survival, maturation, and reproduction and used these rates to project the asymptotic population growth rates (λ for each population-by-treatment combination. Next, we performed life-table response experiments (LTRE to estimate the contributions of the vital rates to observed differences in λ. Finally, we used elasticity analysis to explore the functional relationship between λ and each of the vital rates. We found that survival rates were only compromised at elevated copper levels. Moreover, past, resurrected Daphnia had a higher λ at low copper concentrations compared to unpolluted conditions, but a lower λ when exposed to high copper levels. Contemporary Daphnia, on the other hand, only reproduced successfully in unpolluted water. Under these conditions, however, they had a higher population growth rate than the past Daphnia, suggesting a cost of copper

  4. Differing Daphnia magna assimilation efficiencies for terrestrial, bacterial, and algal carbon and fatty acids.

    Science.gov (United States)

    Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula

    2014-02-01

    There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t

  5. Effects of salinity and ultraviolet radiation on the bioaccumulation of mycosporine-like amino acids in Artemia from Lake Urmia (Iran).

    Science.gov (United States)

    Khosravi, Sanaz; Khodabandeh, Saber; Agh, Naser; Bakhtiarian, Mahdieh

    2013-01-01

    We investigated the effects of salinity and artificial UV radiation on the accumulation of mycosporine-like amino acids (MAAs) in sexual and parthenogenetic Artemia from Lake Urmia. The nauplii hatched from the cysts were cultured until adulthood under two salinities (150 and 250 g L(-1) ) and two light treatments (PAR and PAR+UVR) in the laboratory. Finally, the Artemia were analyzed for their concentration of MAAs. In most of the cases, the higher salinity level applied was found to increase the MAA concentrations in both Artemia populations significantly. The acquisition efficiency of MAAs in both Artemia populations increased under exposure to UVR-supplemented photosynthetically active radiation (PAR) compared to those raised under PAR, except for Porphyra-334. It was observed that combination of UV radiation and elevated salinity significantly increased the bioaccumulation of MAAs. Thus, the presence of these compounds in these populations of Artemia may increase their adaptability for living in high-UV and high-salinity conditions prevailing in Lake Urmia. Higher concentrations of MAAs in the parthenogenetic population of Artemia could be probably attributed to its mono sex nature and higher adaptation capacities to extreme environmental conditions.

  6. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Institute of Scientific and Technical Information of China (English)

    Behnam Shekarchi; Ali Nekuiefard; Ramin Manaffar

    2016-01-01

    Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME) (3.5% v/v). Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms) were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate) in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  7. Brine shrimp (Artemia salina Leach bioassay of extracts from Lychnophoriopsis candelabrum and different Lychnophora species

    Directory of Open Access Journals (Sweden)

    Z.S Ferraz Filha

    2012-01-01

    Full Text Available The present study aimed to evaluate on Artemia salina the citotoxicity of twenty-two extracts from five species of the genus Lychnophora and one species of the genus Lychnophoriopsis. The extracts solubilized in DMSO and prepared at the final concentrations of 100, 250, 375, 500 and 600 μg mL-1 were added to tubes containing Artemia salina nauplii (10 units each and filled to 5 mL total volume with artificial salt water. Lapachol and 5% DMSO were used as positive and negative controls, respectively. The samples were kept under light and dead larvae were counted after 24 hours of contact. LC50 was calculated by using Probit software. The crude ethanol extracts from five species showed low lethality in the following order: Lychnophora trichocarpha (LC50 = 672.38 μg mL-1 > Lychnophora pinaster (LC50 = 678.73 μg mL-1 > Lychnophora ericoides (LC50 = 738.09 μg mL-1 > Lychnophoriopsis candelabrum (LC50 = 812.57 μg mL-1 > Lychnophora passerina (LC50 = 921.78 μg mL-1. All tested extracts from L. candelabrum and chloroform extract from L. staavioides showed light toxicity on A. salina. Results indicated that there are substances with potential pharmacological activity in all tested species.O presente estudo teve como objetivo avaliar a citotoxicidade sobre Artemia salina de vinte e dois extratos de cinco espécies do gênero Lychnophora e de uma espécie de Lychnophoriopsis. Os extratos solubilizados em DMSO, preparados nas concentrações finais de 100, 250, 375, 500 e 600 μg mL-1, foram adicionados a recipientes contendo náuplios de Artemia salina (10 unidades cada e completou-se o volume para 5 mL com solução marinha. Lapachol e DMSO 5% foram usados como controles positivo e negativo, respectivamente. As amostras foram mantidas sob iluminação e as larvas mortas foram contadas após 24 horas de contato. O cálculo da LC50 foi feito utilizando-se o programa Probitos. Os extratos etanólicos brutos de cinco espécies apresentaram baixa

  8. First secondary metabolites from Herissantia crispa L (Brizicky and the toxicity activity against Artemia salina Leach

    Directory of Open Access Journals (Sweden)

    Danielly Albuquerque da Costa

    2009-01-01

    Full Text Available The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-β-D-glucopyranoside, stigmasterol 3-O-β-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol, 3,5,7,3',4'-pentahydroxyflavone (quercetin, unpublished in the genus Herissantia, besides β-sitosterol, kaempferol 3-O-β-D-(6''-E-p-coumaroil (tiliroside glucopyranoside and kaempferol 3,7-di-O-α-L-ramnopyranoside (lespedin, described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, ¹H and 13C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out.

  9. Can Artemia Hatching Assay Be a (Sensitive) Alternative Tool to Acute Toxicity Test?

    Science.gov (United States)

    Rotini, A; Manfra, L; Canepa, S; Tornambè, A; Migliore, L

    2015-12-01

    Artemia sp. is extensively used in ecotoxicity testing, despite criticisms inherent to both acute and long-term tests. Alternative endpoints and procedures should be considered to support the use of this biological model. The hatching process comprises several developmental steps and the cyst hatchability seems acceptable as endpoint criterion. In this study, we assessed the reliability of the hatching assay on A. franciscana by comparing with acute and long-term mortality tests, using two chemicals: Diethylene Glycol (DEG), Sodium Dodecyl Sulphate (SDS). Both DEG and SDS tests demonstrated a dose dependent hatching inhibition. The hatching test resulted more sensitive than acute mortality test and less sensitive than the long-term one. Results demonstrate the reliability and high sensitivity of this hatching assay on a short time lag and support its useful application in first-tier risk assessment procedures.

  10. Preliminary results of the Artemia salina experiments in biostack on LDEF

    Science.gov (United States)

    Graul, E. H.; Ruether, W.; Hiendl, C. O.

    1992-01-01

    The mosaic egg of the brine shrimp, Artemia salina, resting in blastula or gastrula state represents a system that during further development, proceeds without any further development to the larval stage, the free swimming nauplius. Therefore, injury to a single cell of the egg will be manifest in the larvae. In several experiments, it was shown that the passage of a single heavy ion through the shrimp egg damaged a cellular area large enough to disturb either embryogenesis or further development of the larvae, or the integrity of the adult individual. Emergence from the egg shell was heavily disturbed by the heavy ions as was hatching. Additional late effects, due to a hit by a heavy ion, are delayed of growth and of sexual maturity, and reduced fertility. Anomalies in the body and the extremities could be observed more frequently for the nauplii which had developed from eggs hit by heavy ions.

  11. IDENTIFIKASI DAN UJI AKTIVITAS ANTIKANKER EKSTRAK SPONS Ianthella basta TERHADAP LARVA Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Ni Wayan Sri Sukmarianti

    2013-05-01

    Full Text Available The main purpose of this research is to determine the toxicity of extracts sponge Ianthella basta against Artemia salina larvae and to identify the chemical compounds contained in those toxic isolates. The preliminary test of the anticancer activity has conducted by Brine Shrimp Letalithy (BST test. The results showed that the chloroform extract was the most toxic with LC50 value of 22,39 ppm. Futher, the cloroform extract was separated and purified by coloumn chromatography using eluent of solvent mixture of chloroform : ethyl acetate : n-hexane by 7 : 2 : 1 and 4 fractions were obtained. The most toxic fraction was the fraction C with LC50 value of 35,36 ppm. Based on the GC-MS results, the toxic isolate is allegedly containing chemicals compound of hexadecanoic methyl ester and hexadecanoic acid.

  12. Genetic variation in parthenogenetic Artemia from the Shandong Peninsula, P.R.C.

    Science.gov (United States)

    King, Charles E.; Zhao, Yuqi; Liu, Xin; Li, Mingren

    1988-06-01

    Results are presented of a survey of isozyme frequencies in parthenogenetic Artimia from six salterns in the Shandong Peninsula, P.R.C. Three of the eleven enzymes we scored using polyacryamide gel electrophoresis proved to be useful for analysis of electromorph frequency variation. These enzymes are tetrazolium oxidase (TO), lactate dehydrogenase (LDH), and malate dehydrogenase (MDH). Each of these systems showed extensive isozyme variation both within and between salterns. In addition, we have examined the possibility that electromorph frequencies may vary as the result of natural selection for adaptation to specific salinity, or salinity-associated environmental conditions. An indication of clinal variation was found in two series of ponds differing in salinity, however more extensive data are needed before it is possible to conclude that these patterns are the result of natural selection. Finally, the use of isozyme analyses such as ours, for unraveling taxonomic problems in Artemia is discussed.

  13. Toxicity of cylindrospermopsin to the brine shrimp Artemia salina: comparisons with protein synthesis inhibitors and microcystins.

    Science.gov (United States)

    Metcalf, J S; Lindsay, J; Beattie, K A; Birmingham, S; Saker, M L; Törökné, A K; Codd, G A

    2002-08-01

    The Artemia salina bioassay was successfully applied to the analysis of the hepatotoxic cyanobacterial alkaloid and protein synthesis inhibitor, cylindrospermopsin. A dose-dependent response in mortality was observed for purified cylindrospermopsin and LC(50) values decreased with time from 8.1 to 0.71 microg/ml(-1), between 24 and 72 h, respectively. Cylindrospermopsin was slightly less potent than micro cystin-LR, with similar LC(50) values on a gravimetric basis, but was more toxic to A.salina than the protein synthesis inhibitors, cycloheximide, chloramphenicol and tetracycline. Cylindrospermopsin-containing strains of the cyanobacterium Cylindrospermopsis raciborskii were found to be toxic to A.salina and the LC(50) concentration for these strains over time was greater than the LC(50) for purified cylindrospermopsin, with the exception of C. raciborskii strain CR1.

  14. Sharp Phylogeographic Breaks and Patterns of Genealogical Concordance in the Brine Shrimp Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Theodora Farmaki

    2009-12-01

    Full Text Available Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI and two nuclear (ITS1, p26 markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a result of slower coalescence or male-mediated dispersal. Our findings capture the genealogical interval between gene splitting and population divergence. In this sense, strong indications are provided in favour of a superspecies status and ongoing speciation in A. franciscana.

  15. Identification of a novel DNA methyltransferase 2 from the brine shrimp, Artemia franciscana.

    Science.gov (United States)

    Feng, Chen-Zhuo; Zhu, Xiao-Jing; Dai, Zhong-Min; Liu, Feng-Qi; Xiang, Jian-Hai; Yang, Wei-Jun

    2007-06-01

    DNA methyltransferase 2 (Dnmt2) is a dual-specificity DNA methyltransferase, which contains a weak DNA methyltransferase and novel tRNA methyltransferase activity. However, its biological function is still enigmatic. To elucidate the expression profiles of Dnmt2 in Artemia franciscana, we isolated the gene encoding a Dnmt2 from A. franciscana and named it as AfDnmt2. The cDNA of AfDnmt2 contained a 1140-bp open reading frame that encoded a putative Dnmt2 protein of 379 amino acids exhibiting 32% approximately 39% identities with other known Dnmt2 homologs. This is the first report of a DNA methyltransferase gene in Crustacean. By using semi-quantitative RT-PCR, AfDnmt2 was found to be expressed through all developmental stages and its expression increased during resumption of diapause cysts development. Southern blot analysis indicated the presence of multiple copies of AfDnmt2 genes in A. franciscana.

  16. Interactive effect of selenium and mercury on development and mortality of brine shrimp, Artemia sp.

    Energy Technology Data Exchange (ETDEWEB)

    Forsythe, B.L. II; Bailey, F.C.; Klaine, S.J. [Clemson Univ., Pendleton, SC (United States)

    1994-12-31

    The interactions between organic mercury and selenium derivatives are well documented. Inorganic mercury has been shown to have a deleterious effect on the development of brine shrimp, Artemia franciscana while selenate has no effect. In this study, concentrations as low as 0.1 mg/l Hg (as Hg(NO{sub 3})2) slowed the rate of development. Selenate concentrations ranging from 0.1 to 5.0 mg/l as Se decreased the effect of Hg on brine shrimp developmental rate. Both selenate and inorganic mercury alone produced a dose-response with respect to nauplii mortality. Preliminary data suggest that combinations of selenate and inorganic mercury act antagonistically to lower this mortality.

  17. First secondary metabolites from Herissantia crispa L (Brizicky) and the toxicity activity against Artemia salina Leach

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Danielly Albuquerque da; Matias, Wemerson Neves; Lima, Igara Oliveira; Xavier, Aline Lira; Costa, Vivian Bruna Machado; Diniz, Margareth de Fatima Formiga Melo; Agra, Maria de Fatima; Batista, Leonia Maria; Souza, Maria de Fatima Vanderlei de [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Lab. de Tecnologia Farmaceutica Prof. Delby Fernandes de Medeiros; Silva, Davi Antas e [Universidade Federal Rural de Pernambuco, Serra Talhada, PE (Brazil). Dept. de Quimica

    2009-07-01

    The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-{beta}-D-glucopyranoside, stigmasterol 3-O-{beta}-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol), 3,5,7,3',4'-pentahydroxyflavone (quercetin), unpublished in the genus Herissantia, besides {beta}-sitosterol, kaempferol 3-O-{beta}-D-(6''-E-p-coumaroil) (tiliroside) glucopyranoside and kaempferol 3,7-di-O-{alpha}-L-ramnopyranoside (lespedin), described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, {sup 1}H and {sup 13}C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out. (author)

  18. Mating behaviours of Daphnia pulicaria, a cyclic parthenogen: comparisons with copepods

    Science.gov (United States)

    Brewer, M. C.

    1998-01-01

    The pre-and post-contact mating behaviours of Daphnia pulicaria are investigated by direct observations of vertical distributions, swimming behaviours and male-female interactions. Analysis of vertical distributions in a 1 m deep, thermally stratified migration chamber reveals that females were always located in the upper layer of the water column but males exhibited a bimodal depth distribution, in which an individual's depth was a function of body length and water temperature. The observed distributions of males may be the result of several interacting pressures; predation avoidance, life-history optimization, and avoidance of assortative mating. Male swimming behaviour was faster and orthogonal to that of females, which is in agreement with the predictions of encounter-rate maximization models. Video recordings of males and females interacting in a 1-litre vessel showed that males both pursued and contacted other males more often than females. Thus, there was no evidence that Daphnia are able to use water-borne chemical signals to locate and identify potential mates. However, the average duration of male-female contacts (13.8 s) was much longer than those between males (1.6 s), suggesting that males can determine the sex of contacted individuals.Daphnia mating behaviour is significantly more complex than previously acknowledged. In contrast to the conventional view of Daphnia males swimming more-or-less randomly and mating with any individual encountered, they exhibit behaviours which increase the potential of mating with females while reducing the risk of predation. Several male behaviours, such as 'scanning' and the performance of area-restricted spirals upon encounter, are similar to those reported for some copepods and may be common to zooplankton that lack sophisticated chemosensory abilities. The possibility that Daphnia may also be able to assess such important female attributes as species and reproductive status is discussed.

  19. Effects of extreme floods on the Daphnia ephippial egg bank in a long narrow reservoir

    Directory of Open Access Journals (Sweden)

    Adam PETRUSEK

    2011-08-01

    Full Text Available Ephippial egg banks are important reservoirs of dormant stages that allow the recovery of Daphnia populations after unfavourable periods. Although the contribution of hatchlings from ephippia to a population in the water column is probably of minor importance in permanent water bodies with a year-round Daphnia persistence, this may differ after major disturbances. In 2006, two 500-year floods hit the long and narrow Vranov Reservoir (Czech Republic, in which we had investigated zooplankton densities and ephippia distribution in the sediment in preceding years. In this study, we evaluated the impact of those extraordinary floods on the population of the Daphnia longispina complex, and particularly on the local dormant egg bank. We considered two alternative hypotheses related to the egg bank: that either the substantial input of new material with the flood completely buried and therefore reset the existing egg bank, or that the sediment including ephippia was redistributed in the reservoir after the flood and dormant eggs could be exposed to hatching stimuli. A year after the floods, we did not observe any sediment layer that would be devoid of ephippia. However, we observed a significant increase in the proportion of empty ephippia and a decrease in the proportion of those containing eggs. We attribute these changes to disturbance of the sediment due to the floods, which caused redistribution of ephippia stored in the sediment and those detached from the reservoir shoreline. Dormant eggs inside ephippia deposited to shallow parts of reservoir after the floods could therefore receive and respond to hatching stimuli. Hatching from ephippia may have contributed to Daphnia recovery after the spring flood; however, a significant proportion of the Daphnia population probably survived the summer flood protected in the epilimnetic refuge of the thermally stratified environment.

  20. An experimental test of the ability of Daphnia galeata resting egg production in Lake Biwa

    Directory of Open Access Journals (Sweden)

    Narumi K. Tsugeki

    2014-02-01

    Full Text Available The Daphnia galeata population in Lake Biwa (Japan had almost ceased producing resting eggs by the 1980s. To examine whether D. galeata had lost the ability to produce resting eggs, or if chemical contamination was inhibiting resting egg production, individuals collected in fall (November and late winter (March, were reared in the laboratory. More than 50% of these D. galeata individuals produced resting eggs irrespective of the month of collection, when reared with food supplied at a level lower than that available during the maternal generation. The results reflect that D. galeata in Lake Biwa have a high ability to produce resting eggs when appropriate stimuli are provided. As chemical substances, such as endocrine disrupters, are known to inhibit resting egg production in Daphnia and these accumulate in lake sediments, we tested whether Daphnia individuals produce resting eggs when reared in sediment-conditioned lake water. In sediment-conditioned lake water, only a few Daphnia that were collected in March produced resting eggs, while 50% of the individuals collected in November produced resting eggs. Thus, D. galeata collected from Lake Biwa are able to produce resting eggs, but genetic variation likely leads to variation in resting egg production in the presence of chemical contaminants. These results suggest that the recent decrease in the resting egg production of Daphnia populations in lake Biwa is mainly due to a decrease in the strength of the environmental queue that stimulates resting egg production rather than a genetic shift to strains that have a lower ability to produce resting eggs; yet, we cannot rule out the possibility that a chemical contamination plays a role in the decrease of resting egg production.

  1. Aquatic toxicity of cartap and cypermethrin to different life stages of Daphnia magna and Oryzias latipes.

    Science.gov (United States)

    Kim, Younghee; Jung, Jinyong; Oh, Sorin; Choi, Kyungho

    2008-01-01

    Cartap and cypermethrin, which are among the most widely used pesticides in many countries, are considered safe because of their low mammalian toxicity and their low persistence in the environment. However, recent findings of endocrine-disrupting effects and developmental neurotoxicity have raised concerns about the potential ecological impacts of these pesticides. We evaluated the aquatic toxicity of cartap [S,S'-(2-dimethylaminotrimethylene) bis(thiocarbamate), unspecified hydrochloride] and cypermethrin [(RS)-alpha-cyano-3-phenoxybenzyl-(1RS,3RS,1RS,3SR)-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylate], both individually and combined, on different life stages of the freshwater cladoceran Daphnia magna and a freshwater teleost, Japanese medaka (Oryzias latipes). The 96-hr Daphnia median effective concentrations (EC50s) for cartap and cypermethrin were 91.0 microg/L and 0.00061 microg/L, respectively. Rapid recovery of Daphnia was observed after short-term pulsed exposure to cartap and cypermethrin; there were no adverse effects on reproduction or survival 20 d after a 24 hr exposure to cartap up to 1240 microg/L and cypermethrin up to 1.9 microg/L. Chronic continuous exposure (for 21 d) of 7-d-old Daphnia to cypermethrin significantly reduced the intrinsic population growth rate in a concentration-dependent manner. However, because the intrinsic population growth rates were all above zero, populations did not decrease even at the highest experimental concentration of 200 ng/L. Exposure of Daphnia neonates (cartap or 40 microg/L of cypermethrin. The mixture of both compounds showed no synergistic toxicity. The extremely high acute-to-chronic ratio suggests that the standard acute lethal toxicity assessment might not reflect the true environmental hazards of these frequently used pesticides. Ecological hazard assessments of long-term low dose or pulsed exposures to cartap and cypermethrin may reveal more realistic consequences of these compounds in

  2. Further characterization of the cathepsin L-associated protein and its gene in two species of the brine shrimp, Artemia.

    Science.gov (United States)

    Liu, Liqian; Warner, Alden H

    2006-12-01

    The major cysteine protease in embryos and larvae of the brine shrimp Artemia franciscana is a heterodimer composed of a cathepsin L-like polypeptide of 28.5 kDa and a 31.5 kDa polypeptide called the cathepsin L-associated protein or CLAP. In a previous study, CLAP was shown to be a cell adhesion protein containing two Fas I domains and two GTP/ATP binding sites known as Walker A and B motifs. Here, we have characterized CLAP and its genes to better understand the role of this protein in Artemia development. The polymerase chain reaction was used to investigate the structure of the CLAP gene in two species of Artemia, the New World bisexual diploid A. franciscana and the Old World parthenogenetic tetraploid Artemia parthenogenetica. The protein coding region of the CLAP gene from each species was 99.5% identical for a protein of 332 amino acids, while the 3' non-coding region, representing nearly 45% of the gene, was only 86% identical between the two related species. However, while the CLAP gene is intronless in A. franciscana, in A. parthenogenetica the gene contained a mini-intron of 30 base pairs in the 3' non-coding region. The sequences representing the CLAP gene in A. franciscana and A. parthenogenetica have been entered into the NCBI database as AY757920 and DQ100385, respectively. Northern blot analysis showed that while the cathepsin L gene is expressed constitutively in Artemia franciscana embryos and young larvae, the CLAP gene is not expressed in late embryos and young larvae. In contrast, Western blots indicated that CLAP is present in developing embryos and young larvae, at least to the first larval molt, supporting results obtained previously showing CLAP's resistance to degradation by its dimeric partner, cathepsin L. At the protein level we showed that the GTP/ATP binding sites in CLAP are functional with rate constants of 0.024 and 0.022 for GTP and ATP hydrolase activity, respectively. GTP but not ATP also had a slight stimulatory effect on

  3. Re-description of Daphnia (Ctenodaphnia from lakes in the Khumbu Region, Nepalese Himalayas, with the erection of a new species, Daphnia himalaya, and a note on an intersex individual

    Directory of Open Access Journals (Sweden)

    Dinora Carolina PEÑALVA-ARANA

    2006-08-01

    Full Text Available We present here a detailed description of Ctenodaphnia-type Daphnia specimens collected from lakes in the Nepalese Himalayas between 1994 and 2004, including mature females and adult males. The specimens examined share certain diagnostic traits with Daphnia tibetana (Sars 1903, and others with Daphnia fusca (Gurney 1906. A re-appraisal of their previous synonymy with D. fusca and a comparison with all published descriptions of similar species from the region indicate that they represent a new species named here as Daphnia himalaya. The chance discovery of a sex intergrade of the same species allowed a description of the secondary sexual characteristics in this interesting and rare intermediate state to be reported, and its possible ecological implications to be discussed, as well.

  4. Involvement of cyclin K posttranscriptional regulation in the formation of Artemia diapause cysts.

    Directory of Open Access Journals (Sweden)

    Yang Zhao

    Full Text Available BACKGROUND: Artemia eggs tend to develop ovoviviparously to yield nauplius larvae in good rearing conditions; while under adverse situations, they tend to develop oviparously and encysted diapause embryos are formed instead. However, the intrinsic mechanisms regulating this process are not well understood. PRINCIPAL FINDING: This study has characterized the function of cyclin K, a regulatory subunit of the positive transcription elongation factor b (P-TEFb in the two different developmental pathways of Artemia. In the diapause-destined embryo, Western blots showed that the cyclin K protein was down-regulated as the embryo entered dormancy and reverted to relatively high levels of expression once development resumed, consistent with the fluctuations in phosphorylation of position 2 serines (Ser2 in the C-terminal domain (CTD of the largest subunit (Rpb1 of RNA polymerase II (RNAP II. Interestingly, the cyclin K transcript levels remained constant during this process. In vitro translation data indicated that the template activity of cyclin K mRNA stored in the postdiapause cyst was repressed. In addition, in vivo knockdown of cyclin K in developing embryos by RNA interference eliminated phosphorylation of the CTD Ser2 of RNAP II and induced apoptosis by inhibiting the extracellular signal-regulated kinase (ERK survival signaling pathway. CONCLUSIONS/SIGNIFICANCE: Taken together, these findings reveal a role for cyclin K in regulating RNAP II activity during diapause embryo development, which involves the post-transcriptional regulation of cyclin K. In addition, a further role was identified for cyclin K in regulating the control of cell survival during embryogenesis through ERK signaling pathways.

  5. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Institute of Scientific and Technical Information of China (English)

    Ana Dors; Mara Carmen Bartolom; Sebastin Snchez-Fortn

    2014-01-01

    Objective:To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods:Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI)-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results:Biotoxin equivalent values obtained by immunodetection were (2.12±0.10), (8.60±1.30) and (4.32±1.67) pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions:These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  6. Maladaptive Sex Ratio Adjustment in the Invasive Brine Shrimp Artemia franciscana.

    Science.gov (United States)

    Lievens, Eva J P; Henriques, Gil J B; Michalakis, Yannis; Lenormand, Thomas

    2016-06-06

    Sex allocation theory is often hailed as the most successful area of evolutionary theory due to its striking success as a predictor of empirical observations [1]. Most naturally occurring sex ratios can be explained by the principle of equal investment in the sexes [2-4] or by cases of "extraordinary" sex allocation [5]. Deviations from the expected sex ratio are often correlated with weak selection or low environmental predictability (e.g., [6, 7]); true cases of aberrant sex allocation are surprisingly rare [8]. Here, we present a case of long-lasting maladaptive sex allocation, which we discovered in invasive populations of the exclusively sexual brine shrimp Artemia franciscana. A. franciscana was introduced to Southern France roughly 500 generations ago [9]; since then, it has coexisted with the native asexual species Artemia parthenogenetica [10]. Although we expect A. franciscana to produce balanced offspring sex ratios, we regularly observed extremely male-biased sex ratios in invasive A. franciscana, which were significantly correlated to the proportion of asexuals in the overall population. We experimentally proved that both invasive- and native-range A. franciscana overproduced sons when exposed to excess females, without distinguishing between conspecific and asexual females. We conclude that A. franciscana adjust their offspring sex ratio in function of the adult sex ratio but are information limited in the presence of asexual females. Their facultative adjustment trait, which is presumably adaptive in their native range, has thus become maladaptive in the invasive range where asexuals occur. Despite this, it has persisted unchanged for hundreds of generations.

  7. The dichotomous oxyregulatory behaviour of the planktonic crustacean Daphnia magna.

    Science.gov (United States)

    Pirow, R; Buchen, I

    2004-02-01

    The dual function of appendage movement (food acquisition, ventilation) proved to be the key to explaining the peculiar oxyregulatory repertoire of the planktonic filter feeder Daphnia magna. Short-term hypoxic exposure experiments with normoxia-acclimated animals under varying food concentrations revealed a dichotomous response pattern with a compensatory tachycardia under food-free conditions and a ventilatory compensation prevailing under food-rich conditions. Food-free, normoxic conditions resulted in maximum appendage beating rates (fA) and half-maximum heart rates (fH), which restricted the scope for oxyregulation to the circulatory system. Food-rich conditions (10(5) algal cells ml(-1)), on the contrary, had a depressing effect on fA whereas fH increased to 83% of the maximum. In this physiological state, D. magna was able to respond to progressive hypoxia with a compensatory increase in ventilation. A conceptual and mathematical model was developed to analyse the efficiency of ventilatory and circulatory adjustments in improving oxygen transport to tissue. Model predictions showed that an increase in perfusion rate was most effective under both food-free and food-rich conditions in reducing the critical ambient oxygen tension (PO2crit) at which oxygen supply to the tissue started to become impeded. By contrast, a hypothetical increase in ventilation rate had almost no effect on PO2crit under food-free conditions, indicating that appendage movement is driven by nutritive rather than respiratory requirements. However, the model predicted a moderate reduction of PO2crit by hyperventilation under food-rich conditions. Since the regulatory scope for an adjustment in fH was found to be limited in D. magna under these conditions, the increase in ventilation rate is the means of choice for a fed animal to cope with short-term, moderate reductions in ambient oxygen availability. Under long-term and more severe hypoxic conditions, however, the increase in the

  8. Phototoxic effects of titanium dioxide nanoparticles on Daphnia magna

    Science.gov (United States)

    Mansfield, Charles M.

    Titanium dioxide nanoparticles (TiO2-NP) are one of the most abundantly utilized nanomaterials in the world. Studies have demonstrated the mechanism of acute toxicity in TiO2-NP to be the production of reactive oxygen species (ROS) leading to oxidative stress and mortality in exposed organisms. It has also been demonstrated that the anatase crystalline conformation is capable of catalyzing the cleavage of water molecules to further increase the concentration of ROS in the presence of ultraviolet radiation. This photoenhanced toxicity significantly lowers the toxicity threshold of TiO2-NP to environmentally relevant concentrations (ppb). The goal of this study was to determine whether dietary uptake and accumulation of TiO2-NP in the aquatic filter feeder Daphnia magna resulted in photoenhanced toxicity. D. magna and S. caprincornatum were exposed to aqueous solutions of 20ppm and 200ppm TiO2-NP for 24hrs and then transferred to clean moderately hard water. Samples were taken at various time points, dried, and TiO 2 quantified using ICP-MS. Toxicity assays were run on D. magna using three TiO2-NP (20ppm, 200ppm) exposure protocols and two ultraviolet radiation treatments. The first exposure group was exposed to aqueous solutions of TiO2-NP for the duration of the test. The second exposure group was exposed to TiO2-NP for an hour and then transferred to clean water. The third exposure group was fed S. capricornatum that had been allowed to adsorb TiO2-NP. All samples were then placed in an outdoor UV exposure system and exposed to either full spectrum sunlight (with UV) or filtered sunlight (no UV). Here we show that TiO2 uptake peaked at one hour of exposure likely due to sedimentation of the particles out of suspension, thus decreasing bioavailability for the duration of the test. Interestingly, when D. magna were moved to clean water, aqueous concentrations of TiO2 increase as a result of depuration from the gut tract. Data also suggests these excreted particles

  9. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    Directory of Open Access Journals (Sweden)

    J.M. Lima

    2009-03-01

    Full Text Available A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qualificados no extrato aquoso, com exceção de cumarinas. Em diclorometano, verificou se a presença de saponinas, derivados triterpênicos e esteróides. No teste de toxicidade sobre Artemia salina, os dados convergiram para frações de extrato aquoso de 5.117,2 ppm, indicando ser um extrato de baixa toxicidade.Sonchus oleraceus is a common weed in Brazil, also used as a medicinal plant. Phytochemical prospecting of this species was carried out in this work using extracts obtained in ethanol, water and dichloromethane. A toxicity study of the aqueous extract was also conducted, using the micro crustaceous Artemia salina. The aqueous extract presented sugar reducers, phenolic compounds, tannins, flavonoids and coumarins in its composition. The compounds found in the aqueous extract were also detected in the ethanol extract, except for the coumarins. Saponin, triterpenes and steroids were identified in the dichloromethane extract. The toxicity test on Artemia salina pointed to aqueous extract fractions of 5,117.2 ppm, indicative of low toxicity.

  10. Tenebrio molitor meal in rainbow trout (Oncorhynchus mykiss diets: effects on animal performance, nutrient digestibility and chemical composition of fillets

    Directory of Open Access Journals (Sweden)

    Marco Belforti

    2015-12-01

    Full Text Available This study evaluated the effects of diets containing Tenebrio molitor (TM larvae meal on growth performances, somatic indexes, nutrient digestibility, dorsal muscle proximate and fatty acid (FA compositions of rainbow trout. Three hundred sixty fish were randomly divided into three groups with four replicates each. The groups were fed diets differing in TM inclusion: 0% (TM0, 25% (TM25 and 50% (TM50 as fed weight basis. Weight gain was not affected by treatment. Feeding rate was significantly higher in TM0 than TM50. Feed conversion ratio was significantly higher in TM0 than TM25 and TM50, while an opposite trend was observed for protein efficiency ratio and specific growth rate. The survival rate was significantly lower in TM0 than TM25 and TM50. The apparent digestibility of protein was significantly lower in the TM50 group than the other groups, while the apparent digestibility of dry matter, organic matter and lipids was unaffected by treatment. If compared to control, the protein and lipid contents of fillets were respectively increased and decreased following TM inclusion in the diet. The Σn3/Σn6 FA ratio of fish dorsal muscle was linearly (TM0>TM25>TM50 reduced by TM inclusion in the diet. Results suggested that TM could be used during the growing phase in trout farming; however, additional studies on specific feeding strategies and diet formulations are needed to limit its negative effects on the lipid fraction of fillets.

  11. Do nuclear bodies in oocytes of Tenebrio molitor (Coleoptera: Polyphaga, Tenebrionidae) contain two forms of RNA polymerase II?

    Science.gov (United States)

    Bogolyubov, D; Parfenov, V

    2004-02-01

    Late vitellogenic oocytes of the mealworm beetle, Tenebrio molitor, which are transcriptionally inert, contain numerous fibrogranular nuclear bodies (NBs). Previously, we have shown that these NBs contain both unphosphorylated and phosphorylated forms of RNA polymerase II (pol II) [Tissue Cell 33 (2001) 549]. The conclusion on the presence of phosphorylated pol II was based on our immunoelectron experiments with monoclonal antibody (mAb) H5 against the phosphorylated serine-2 of the carboxy-terminal domain (CTD) of pol II. Because the specificity of mAb H5 was recently questioned by demonstration of its cross-reaction with SR-proteins [J. Struct. Biol. 140 (2002) 154], we re-examined here the occurence of pol II in T. molitor oocyte NBs using other appropriate antibodies. We confirm the presence of phosphorylated pol II in NBs using the affinity-purified polyclonal antibody against the phosphorylated CTD. Using double immunogold labeling with this antibody plus mAb 8WG16 against the unphosphorylated CTD, we confirm the presence of two forms of pol II in NBs. Additionally, the presence of pol II in NBs was verified here using mAb ARNA3 against the epitope outside CTD. We suggest that at the transcriptionally inactive stage, T. molitor oocyte NBs represent storage domains for pol II disengaged from the transcription.

  12. Repellence of plant essential oils to Dermanyssus gallinae and toxicity to the non-target invertebrate Tenebrio molitor.

    Science.gov (United States)

    George, D R; Sparagano, O A E; Port, G; Okello, E; Shiel, R S; Guy, J H

    2009-05-26

    With changes in legislation and consumer demand, alternatives to synthetic acaricides to manage the poultry red mite Dermanyssus gallinae (De Geer) in laying hen flocks are increasingly needed. These mites may cause losses in egg production, anaemia and even death of hens. It may be possible to use plant-derived products as D. gallinae repellents, especially if such products have a minimal impact on non-target organisms. An experiment was conducted with D. gallinae to assess the repellence of a range of plant essential oils, previously found to be of varying toxicity (relatively highly toxic to non-toxic) to this pest. Experiments were also undertaken to assess the toxicity of these products to mealworm beetles (Tenebrio molitor L.), a non-target invertebrate typical of poultry production systems. Results showed that all seven essential oils tested (manuka, thyme, palmarosa, caraway, spearmint, black pepper and juniper leaf) were repellent to D. gallinae at 0.14mg oil/cm(3) (initial concentration) during the first 2 days of study. Thyme essential oil appeared to be the most effective, where repellence lasted until the end of the study period (13 days). At the same concentration toxicity to T. molitor differed, with essential oils of palmarosa and manuka being no more toxic to adult beetles than the control. There was neither a significant association between the rank toxicity and repellence of oils to D. gallinae, nor the toxicity of oils to D. gallinae (as previously determined) and T. molitor.

  13. Cloning, Characterization and Effect of TmPGRP-LE Gene Silencing on Survival of Tenebrio Molitor against Listeria monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-11-01

    Full Text Available Peptidoglycan recognition proteins (PGRPs are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP-type peptidoglycan to activate both the immune deficiency (Imd and proPhenoloxidase (proPO pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  14. The selenium bioaccumulation of Tenebrio molitor larva%黄粉虫幼虫对硒的生物积累

    Institute of Scientific and Technical Information of China (English)

    高红莉; 周文宗; 张硌; 李洪涛

    2007-01-01

    在饲料中添加含硒化合物喂养黄粉虫Tenebrio molitor L.幼虫,测定幼虫硒含量、粪便硒含量和体重的变化,计算黄粉虫幼虫特定生长率及幼虫对硒生物积累系数,分析黄粉虫有效积累硒的条件.结果表明,饲料硒含量在15~20 mg/kg时,幼虫硒含量明显提高,对硒的生物积累系数高于其它试验组水平,饲料硒含量过高,幼虫硒含量降低,正常生长受到抑制.黄粉虫幼虫特定生长率、取食量、排粪量、干物质含量随着饲料硒含量的增加而降低,死亡率、粪便硒含量随着饲料硒含量的增加而增大.饲料硒含量为15~20 mg/kg时黄粉虫幼虫对硒的生物积累效果最好.

  15. Immunomodulatory effects of supercritical fluid CO2 extracts from freeze-dried powder of Tenebrio molitor larvae (yellow mealworm

    Directory of Open Access Journals (Sweden)

    QingFeng TANG

    2016-01-01

    Full Text Available Abstract In order to take full advantage of Tenebrio molitor larvae (yellow mealworm resources, the supercritical CO2 fluid freeze-dried powder of T. molitor larvae (fdTML extraction on the immune systems of mice was carried out. The results about the effects of supercritical CO2 fluid fdTML extraction on carbon expurgation and phagocytosis of peritoneal macrophages experiments of mice indicated that the fdTML extraction enhanced observably carbon expurgatory index, phagocytic rate and phagocytic index. The fdTML extraction could stimulate response of delayed hypersensitivity. The proliferation of ConA-induced mitogenic reponse for spleen lymphocyte was also increased. The amount of hemolytic antibody in mice serum increased compared with those of the control group mice. The half of hemolysis values in serum of treated mice increased compared to the control group. Furthermore, serum NO content in all treatment groups was higher than that of the control group whereas acid phosphatase and alkaline phosphatase activity was only significantly higher relative to the control group. Our findings suggest that supercritical CO2 fluid the fdTML extraction has potential as a health food supplement.

  16. Cloning, characterization and effect of TmPGRP-LE gene silencing on survival of Tenebrio molitor against Listeria monocytogenes infection.

    Science.gov (United States)

    Tindwa, Hamisi; Patnaik, Bharat Bhusan; Kim, Dong Hyun; Mun, Seulgi; Jo, Yong Hun; Lee, Bok Luel; Lee, Yong Seok; Kim, Nam Jung; Han, Yeon Soo

    2013-11-14

    Peptidoglycan recognition proteins (PGRPs) are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP)-type peptidoglycan to activate both the immune deficiency (Imd) and proPhenoloxidase (proPO) pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF) of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  17. Evaluation of Genotoxicity and 28-day Oral Dose Toxicity on Freeze-dried Powder of Tenebrio molitor Larvae (Yellow Mealworm).

    Science.gov (United States)

    Han, So-Ri; Yun, Eun-Young; Kim, Ji-Young; Hwang, Jae Sam; Jeong, Eun Ju; Moon, Kyoung-Sik

    2014-06-01

    The larval form of Tenebrio molitor (T. molitor) has been eaten in many countries and provides benefits as a new food source of protein for humans. However, no information exists regarding its safety for humans. The objective of the present study was to evaluate the genotoxicity and repeated dose oral toxicity of the freeze-dried powder of T. molitor larvae. The genotoxic potential was evaluated by a standard battery testing: bacterial reverse mutation test, in vitro chromosome aberration test, and in vivo micronucleus test. To assess the repeated dose toxicity, the powder was administered once daily by oral gavage to Sprague-Dawley (SD) rats at dose levels of 0, 300, 1000 and 3000 mg/kg/day for 28 days. The parameters which were applied to the study were mortality, clinical signs, body and organ weights, food consumption, ophthalmology, urinalysis, hematology, serum chemistry, gross findings and histopathologic examination. The freezedried powder of T. molitor larvae was not mutagenic or clastogenic based on results of in vitro and in vivo genotoxicity assays. Furthermore, no treatment-related changes or findings were observed in any parameters in rats after 28 days oral administration. In conclusion, the freeze-dried powder of T. molitor larvae was considered to be non-genotoxic and the NOAEL (No Observed Adverse Effect Level) was determined to be 3000 mg/kg/day in both sexes of SD rats under our experimental conditions.

  18. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  19. The Crystal Water Affect in the Interaction between the Tenebrio Molitor Alpha-Amylase and Its Inhibitor

    Directory of Open Access Journals (Sweden)

    Zhu Zhi-Fei

    2008-01-01

    Full Text Available Molecular dynamics simulation of the interaction between the Tenebrio molitor alpha-amylase and its inhibitor at different proportion of crystal water was carried out with OPLS force field by hyperchem 7.5 software. In the correlative study, the optimal temperature of wheat monomeric and dimeric protein inhibitors was from 273 K to 318 K. The the average temperature of experimentation is 289 K. (1 The optimal temperature of interaction between alpha-amylase and its inhibitors was 280 K without crystal water that was close to the results of experimentation. The forming of enzyme-water and inhibitor-water was easy, but incorporating third monomer was impossible. (2 Having analyzed the potential energy data, the optimal temperature of interaction energy between alpha-amylase and its inhibitors covering 9 : 1, 5 : 5, 4 : 6, and 1 : 9 proportion crystal water was 290 K. (3 We compared the correlative QSAR properties. The proportion of crystal water was close to the data of polarizability (12.4% in the QSAR properties. The optimal temperature was 280 K. This result was close to 289 K. These findings have theoretical and practical implications.

  20. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  1. [Polyadenylated RNA and mRNA export factors in extrachromosomal nuclear domains of vitellogenic oocytes of the insect Tenebrio molitor].

    Science.gov (United States)

    Bogoliubov, D S; Kiselev, A M; Shabel'nikov, S V; Parfenov, V N

    2012-01-01

    The nucleus ofvitellogenic oocytes of the yellow mealworm, Tenebrio molitor, contains a karyosphere that consists of the condensed chromatin embedded in an extrachromosomal fibrogranular material. Numerous nuclear bodies located freely in the nucleoplasm are also observed. Amongst these bodies, counterparts of nuclear speckles (= interchromatin granule clusters, IGCs) can be identified by the presence of the marker protein SC35. Microinjections of fluorescently tagged methyloligoribonucleotide probes 2'-O-Me(U)22, complementary to poly(A) tails of RNAs, revealed poly(A)+ RNA in the vast majority of IGCs. We found that all T. molitor oocyte IGCs contain heterogeneous ribonucleoprotein (hnRNP) core protein Al that localizes to IGCs in an RNA-dependent manner. The extrachromosomal material of the karyosphere and a part of nucleoplasmic IGCs also contain the adapter protein Aly that is known to provide a link between pre-mRNA splicing and mRNA export. The essential mRNA export factor/receptor NXF1 was observed to colocalize with Aly. In nucleoplasmic IGCs, NXF1 was found to localize in an RNA-dependent manner whereas it is RNA-independently located in the extrachromosomal material of the karyosphere. We believe our data suggest on a role of the nucleoplasmic IGCs in mRNA biogenesis and retention in a road to nuclear export.

  2. Identification of midgut microvillar proteins from Tenebrio molitor and Spodoptera frugiperda by cDNA library screenings with antibodies.

    Science.gov (United States)

    Ferreira, A H P; Cristofoletti, P T; Lorenzini, D M; Guerra, L O; Paiva, P B; Briones, M R S; Terra, W R; Ferreira, C

    2007-11-01

    The objective of this study was to identify midgut microvillar proteins in insects appearing earlier (Coleoptera) and later (Lepidoptera) in evolution. For this, cytoskeleton-free midgut microvillar membrane from Spodoptera frugiperda (Lepidoptera) and Tenebrio molitor (Coleoptera) were used to raise antibodies. These were used for screening midgut cDNA expression libraries. Positive clones were sequenced, assembled and searched for similarities with gene/protein databases. The predicted midgut microvillar proteins from T. molitor were: cockroach allergens (unknown function), peritrophins (peritrophic membrane proteins), digestive enzymes (aminopeptidase, alpha-mannosidase) and unknown proteins. Predicted S. frugiperda midgut proteins may be grouped into six classes: (a) proteins involved in protection of midgut (thioredoxin peroxidase, aldehyde dehydrogenase, serpin and juvenile hormone epoxide hydrolase); (b) digestive enzymes (astacin, transporter-like amylase, aminopeptidase, and carboxypeptidase); (c) peritrophins; (d) proteins associated with microapocrine secretion (gelsolin, annexin); (e) membrane-tightly bound-cytoskeleton proteins (fimbrin, calmodulin) and (f) unidentified proteins. The novel approach is compared with others and microvillar function is discussed in the light of the predicted proteins.

  3. Reducing sugar-producing bacteria from guts of Tenebrio molitor Linnaeus (yellow mealworm) for lignocellulosic waste minimization.

    Science.gov (United States)

    Qi, Wei; Chen, Chia-Lung; Wang, Jing-Yuan

    2011-01-01

    The guts of Tenebrio Molitor Linnaeus (yellow mealworm) were used as inocula to isolate reducing sugar-producing bacteria during bioconversion of lignocellulose to reducing sugars in this study. Three carbon sources, i.e., carboxymethyl cellulose (CMC), filter paper (FP), and lignocellulosic waste (LIG), were specifically selected; and two types of culturing media (M1 and M2) were used. After 6 months of sequential cultivation, lignocellulose (i.e., polysaccharides) degradation of enrichments M1-CMC (47.5%), M1-FP (73.3%), M1-LIG (70.4%), M2-CMC (55.7%), M2-FP (73.1%) and M2-LIG (71.7%) was achieved, respectively, with incubation for 48 h. Furthermore, seven bacterial strains were successfully isolated corresponding to most of the major bands detected by denaturing gradient gel electrophoresis analysis. The maximum reducing sugars yield by the combination of Agromyces sp. C42 and Stenotrophomonas sp. A10b was 56.7 mg g·LIG(-1) of 48 h, which is approximate 2-5 times higher than the original enrichments and individual microbial strains. These findings suggest that bioconversion by microorganisms from mealworm guts has great application potential for lignocellulose hydrolysis.

  4. Bacillus thuringiensis Cry3Aa protoxin intoxication of Tenebrio molitor induces widespread changes in the expression of serine peptidase transcripts.

    Science.gov (United States)

    Oppert, Brenda; Martynov, Alexander G; Elpidina, Elena N

    2012-09-01

    The yellow mealworm, Tenebrio molitor, is a pest of stored grain products and is sensitive to the Bacillus thuringiensis (Bt) Cry3Aa toxin. As digestive peptidases are a determining factor in Cry toxicity and resistance, we evaluated the expression of peptidase transcripts in the midgut of T. molitor larvae fed either a control or Cry3Aa protoxin diet for 24 h (RNA-Seq), or in larvae exposed to the protoxin for 6, 12, or 24 h (microarrays). Cysteine peptidase transcripts (9) were similar to cathepsins B, L, and K, and their expression did not vary more than 2.5-fold in control and Cry3Aa-treated larvae. Serine peptidase transcripts (48) included trypsin, chymotrypsin and chymotrypsin-like, elastase 1-like, and unclassified serine peptidases, as well as homologs lacking functional amino acids. Highly expressed trypsin and chymotrypsin transcripts were severely repressed, and most serine peptidase transcripts were expressed 2- to 15-fold lower in Cry3Aa-treated larvae. Many serine peptidase and homolog transcripts were found only in control larvae. However, expression of a few serine peptidase transcripts was increased or found only in Cry3Aa-treated larvae. Therefore, Bt intoxication significantly impacted the expression of serine peptidases, potentially important in protoxin processing, while the insect maintained the production of critical digestive cysteine peptidases.

  5. Purification, characterization and sequencing of the major beta-1,3-glucanase from the midgut of Tenebrio molitor larvae.

    Science.gov (United States)

    Genta, Fernando A; Bragatto, Ivan; Terra, Walter R; Ferreira, Clélia

    2009-12-01

    The major beta-1,3-glucanase from Tenebrio molitor (TLam) was purified to homogeneity (yield, 6%; enrichment, 113 fold; specific activity, 4.4 U/mg). TLam has a molecular weight of 50 kDa and a pH optimum of 6. It is an endoglucanase that hydrolyzes beta-1,3-glucans as laminarin and yeast beta-1,3-1,6-glucan, but is inactive toward other polysaccharides (as unbranched beta-1,3-glucans or mixed beta-1,3-1,4-glucan from cereals) or disaccharides. The enzyme is not inhibited by high substrate concentrations and has low processivity (0.6). TLam has two ionizable groups involved in catalysis, and His, Tyr and Arg residues plus a divalent ion at the active site. A Cys residue important for TLam activity is exposed after laminarin binding. The cDNA coding for this enzyme was cloned and sequenced. It belongs to glycoside hydrolase family 16, and is related to other insect glucanases and glucan-binding proteins. Sequence analysis and homology modeling allowed the identification of some residues (E174, E179, H204, Y304, R127 and R181) at the active site of the enzyme, which may be important for TLam activity. TLam efficiently lyses fungal cells, suggesting a role in making available walls and cell contents to digestion and in protecting the midgut from pathogen infections.

  6. Female choice reveals terminal investment in male mealworm beetles, Tenebrio molitor, after a repeated activation of the immune system.

    Science.gov (United States)

    Krams, I; Daukšte, J; Kivleniece, I; Krama, T; Rantala, M J; Ramey, G; Šauša, L

    2011-01-01

    Increasing evidence suggests that secondary sexual traits reflect immunocompetence of males in many animal species. This study experimentally investigated whether a parasite-like immunological challenge via a nylon implant affects sexual attractiveness of males in Tenebrio molitor L. (Coleoptera: Tenebrionidae) Although a single immunological challenge significantly reduced sexual attractiveness and locomotor activity of males, it had no adverse effect on their survival. A second immune challenge of the same males increased their attractiveness. However, it was found that the repeated challenge significantly reduced locomotor activity of males and caused higher mortality. This result indicates terminal investment on sexual signaling, which is supposedly based on a trade-off between pheromone production and energy expenditures needed for such activities as recovery of immune system and locomotor activity. When the third implantation was carried out in the same group of males, melanization of nylon implants was found to be lower in more attractive than in less attractive males. This suggests that males that became sexually attractive after the second immune challenge did not invest in recovery of their immune system.

  7. Oleic acid and linoleic acid from Tenebrio molitor larvae inhibit BACE1 activity in vitro: molecular docking studies.

    Science.gov (United States)

    Youn, Kumju; Yun, Eun-Young; Lee, Jinhyuk; Kim, Ji-Young; Hwang, Jae-Sam; Jeong, Woo-Sik; Jun, Mira

    2014-02-01

    In our ongoing research to find therapeutic compounds for Alzheimer's disease (AD) from natural resources, the inhibitory activity of the BACE1 enzyme by Tenebrio molitor larvae and its major compounds were evaluated. The T. molitor larvae extract and its fractions exhibited strong BACE1 suppression. The major components of hexane fraction possessing both high yield and strong BACE1 inhibition were determined by thin layer chromatography, gas chromatography, and nuclear magnetic resonance analysis. A remarkable composition of unsaturated long chain fatty acids, including oleic acid and linoleic acid, were identified. Oleic acid, in particular, noncompetitively attenuated BACE1 activity with a half-maximal inhibitory concentration (IC₅₀) value of 61.31 μM and Ki value of 34.3 μM. Furthermore, the fatty acids were stably interacted with BACE1 at different allosteric sites of the enzyme bound with the OH of CYS319 and the NH₃ of TYR320 for oleic acid and with the C=O group of GLN304 for linoleic acid. Here, we first revealed novel pharmacophore features of oleic acids and linoleic acid to BACE1 by in silico docking studies. The present findings would clearly suggest potential guidelines for designing novel BACE1 selective inhibitors.

  8. Increasing the calcium content of mealworms (Tenebrio molitor) to improve their nutritional value for bone mineralization of growing chicks.

    Science.gov (United States)

    Klasing, K C; Thacker, P; Lopez, M A; Calvert, C C

    2000-12-01

    The purpose of these studies was to determine the husbandry variables that optimize the Ca content of mealworms (Tenebrio molitor) and to determine the bioavailability of this Ca for bone mineralization in chicks that consume the mealworms. To determine the optimal level of Ca in the substrates used in short-term (mealworms and to determine the length of time that mealworms should be exposed to high-Ca substrates, mealworms were placed in either a wheat bran or a chicken starter substrate supplemented with 0, 4, 8, or 12% Ca from CaCO3. The mealworms were harvested after 0.5, 1, 2, 3, 4, 7, or 14 days. The Ca content of the mealworms was greatest with the use of chicken starter and increased linearly with the Ca content of the substrate. In general, the Ca content of the mealworms increased during the first 24 hr and decreased after > or = 1 wk, especially at the higher levels of Ca supplementation. The chicken starter also resulted in higher levels of vitamin D in mealworms. Mealworms held in wheat bran with 8% Ca were fed to growing chicks. Ca bioavailability was calculated from the chicks' bone ash. The Ca in these mealworms was 76% as bioavailable as the Ca in oyster shell.

  9. Characterization of PHB1 and its role in mitochondrial maturation and yolk platelet degradation during development of Artemia embryos.

    Directory of Open Access Journals (Sweden)

    Xiang Ye

    Full Text Available BACKGROUND: To cope with harsh environments, crustaceans such as Artemia produce diapause gastrula embryos (cysts with suppressed metabolism. Metabolism and development resume during post-diapause development, but the mechanism behind these cellular events remains largely unknown. PRINCIPAL FINDING: Our study investigated the role of prohibitin 1 (PHB1 in metabolic reinitiation during post-diapause development. We found that PHB1 was developmentally regulated via changes in phosphorylation status and localization. Results from RNA interference experiments demonstrated PHB1 to be critical for mitochondrial maturation and yolk degradation during development. In addition, PHB1 was present in yolk platelets, and it underwent ubiquitin-mediated degradation during the proteolysis of yolk protein. CONCLUSIONS/SIGNIFICANCE: PHB1 has an indispensable role in coordinating mitochondrial maturation and yolk platelet degradation during development in Artemia. This novel function of PHB1 provides new clues to comprehend the roles of PHB1 in metabolism and development.

  10. Ultrastructure of cyst shell and underlying membranes of three strains of the brine shrimp Artemia (Branchiopoda: Anostraca) from South India.

    Science.gov (United States)

    Sugumar, V; Munuswamy, N

    2006-12-01

    The cyst of Artemia has shell and membranous coverings over the embryo. The membranous coverings have special adaptive features to allow the physical changes accompanying repeated hydration and dehydration cycles that might occur and adversely influence postembryonic development. Whole and slices of cryptobiotic cysts were processed for electron microscopy to study the internal details and to compare the morphological architecture of three Artemia strains of South India. Surface topography of scanning electron microscopic (SEM) studies revealed distinct button shaped structures on the cyst of Puthalam strain. Transmission electron microscopic (TEM) studies of the cysts displayed the conventional pattern of anostracan crustaceans with outer cortex and alveolar layer, cuticular membranes, and the cytoplasmic inclusions namely nucleus, yolk droplets, lipoid bodies, and mitochondria. The prominent wavy outer cortex layer of Puthalam cysts corroborates the results of SEM studies.

  11. 温度对中国卤虫(Artemia sinica)种群的影响%EFFECTS OF TEMPERATURE ON THE POPULATION OF ARTEMIA SINICA

    Institute of Scientific and Technical Information of China (English)

    贾沁贤; 庄玲; 周望舒; 杨孟科

    1995-01-01

    本文采用生命表和数值模型分析等方法,对中国卤虫(Artemia sinica)的温度特性做了研究.1.孵化发育起始温度9.07℃,幼虫发育起始温度9.07℃.有效积温(℃·d)前者为0.921±o.979,后者为205.26士24.1,平均世代有效积温458.4士39.6.2.各项生命表参数均与温度呈显著的函数关系,其适温范围基本介于18-34℃,最适点介于26.5-28.5℃,种群增长倍数>2的温度范围在18-34℃. 3.在山西盐池水域,该卤虫的年世代数为6.2±0.62个世代,第2-5个世代是种群生产力高峰期.在此期间种群的加倍时间<15d,内禀增长率>0.04d-1,因此资源开发价值最大.

  12. Mesozoic fossils (>145 Mya suggest the antiquity of the subgenera of Daphnia and their coevolution with chaoborid predators

    Directory of Open Access Journals (Sweden)

    Taylor Derek J

    2011-05-01

    Full Text Available Abstract Background The timescale of the origins of Daphnia O. F. Mueller (Crustacea: Cladocera remains controversial. The origin of the two main subgenera has been associated with the breakup of the supercontinent Pangaea. This vicariance hypothesis is supported by reciprocal monophyly, present day associations with the former Gondwanaland and Laurasia regions, and mitochondrial DNA divergence estimates. However, previous multilocus nuclear DNA sequence divergence estimates at Daphnia. Results We describe new fossils of ephippia from the Khotont site in Mongolia associated with the Jurassic-Cretaceous boundary (about 145 MYA that are morphologically similar to several modern genera of the family Daphniidae, including the two major subgenera of Daphnia, i.e., Daphnia s. str. and Ctenodaphnia. The daphniid fossils co-occurred with fossils of the predaceous phantom midge (Chaoboridae. Conclusions Our findings indicate that the main subgenera of Daphnia are likely much older than previously known from fossils (at least 100 MY older or from nuclear DNA estimates of divergence. The results showing co-occurrence of the main subgenera far from the presumed Laurasia/Gondwanaland dispersal barrier shortly after formation suggests that vicariance from the breakup of Pangaea is an unlikely explanation for the origin of the main subgenera. The fossil impressions also reveal that the coevolution of a dipteran predator (Chaoboridae with the subgenus Daphnia is much older than previously known -- since the Mesozoic.

  13. Study of model systems to test the potential function of Artemia group 1 late embryogenesis abundant (LEA) proteins.

    Science.gov (United States)

    Warner, Alden H; Guo, Zhi-hao; Moshi, Sandra; Hudson, John W; Kozarova, Anna

    2016-01-01

    Embryos of the brine shrimp, Artemia franciscana, are genetically programmed to develop either ovoviparously or oviparously depending on environmental conditions. Shortly upon their release from the female, oviparous embryos enter diapause during which time they undergo major metabolic rate depression while simultaneously synthesize proteins that permit them to tolerate a wide range of stressful environmental events including prolonged periods of desiccation, freezing, and anoxia. Among the known stress-related proteins that accumulate in embryos entering diapause are the late embryogenesis abundant (LEA) proteins. This large group of intrinsically disordered proteins has been proposed to act as molecular shields or chaperones of macromolecules which are otherwise intolerant to harsh conditions associated with diapause. In this research, we used two model systems to study the potential function of the group 1 LEA proteins from Artemia. Expression of the Artemia group 1 gene (AfrLEA-1) in Escherichia coli inhibited growth in proportion to the number of 20-mer amino acid motifs expressed. As well, clones of E. coli, transformed with the AfrLEA-1 gene, expressed multiple bands of LEA proteins, either intrinsically or upon induction with isopropyl-β-thiogalactoside (IPTG), in a vector-specific manner. Expression of AfrLEA-1 in E. coli did not overcome the inhibitory effects of high concentrations of NaCl and KCl but modulated growth inhibition resulting from high concentrations of sorbitol in the growth medium. In contrast, expression of the AfrLEA-1 gene in Saccharomyces cerevisiae did not alter the growth kinetics or permit yeast to tolerate high concentrations of NaCl, KCl, or sorbitol. However, expression of AfrLEA-1 in yeast improved its tolerance to drying (desiccation) and freezing. Under our experimental conditions, both E. coli and S. cerevisiae appear to be potentially suitable hosts to study the function of Artemia group 1 LEA proteins under environmentally

  14. Effects of Surface-Engineered Nanoparticle-Based Dispersants for Marine Oil Spills on the Model Organism Artemia franciscana

    OpenAIRE

    Rodd, April L.; Creighton, Megan A.; Vaslet, Charles A.; Rangel-Mendez, J. Rene; Hurt, Robert H.; Kane, Agnes B.

    2014-01-01

    Fine particles are under active consideration as alternatives to chemical dispersants for large-scale petroleum spills. Fine carbon particles with engineered surface chemistry have been shown to stabilize oil-in-water emulsions, but the environmental impacts of large-scale particle introduction to the marine environment are unknown. Here we study the impact of surface-engineered carbon-black materials on brine shrimp (Artemia franciscana) as a model marine microcrustacean. Mortality was chara...

  15. Daphnia growth on microcystin-producing and microcystin-free Microcystis aeruginosa in different mixtures with the green alga Scenedesmus obliquus

    OpenAIRE

    Lürling, M.F.L.L.W.

    2003-01-01

    The hypothesis that negative effects of Microcystis on Daphnia growth and reproduction can be explained from the presence of microcystin in the Microcystis cells was tested by comparing the effects on Daphnia life history characteristics of a microcystin-free mutant strain and microcystin-containing strain of the cyanobacterium Microcystis aeruginosa PCC7806. To avoid nutritional deficiency, Microcystis was offered to Daphnia alone and in various mixtures with the high-quality green alga Scen...

  16. 卤虫属分类研究进展%Progress on Researches of Taxonomy on Genus Artemia

    Institute of Scientific and Technical Information of China (English)

    张伟峰; 郝浩永; 陈莉

    2008-01-01

    卤虫(Anemia)属于节肢动物门(Phylum Arthropoda),甲壳纲(Class Crustacea),鳃足亚纲(SubclassBranchiopoda),无甲目(Order Anostraca),卤虫科(Family Artemidae).世界卤虫根据生殖方式可分为两性生殖卤虫和孤雌生殖卤虫两大类.利用生殖隔离实验将世界两性卤虫分为8个种:Anemiafranciscana Kellogg、Artemia persimilis Piccinelli et Prosdoeimi、Anemia rnonica Verrill、Anemia salina Linnaeus、Artemia urmianaGünther、Anemia tunisiana Bowen et Sterling、Anemia sinica Cai和Anemia tibetiana Abatzopouios,Zhang et Sorge-loos.其中,我国发现有A.sinica和A.tibetiana两种两性卤虫.孤雌生殖卤虫统称为Artemia parthenogenetica,并在其后加上产地的地名以示区别.

  17. Multiple {gamma}-glutamylation: A novel type of post-translational modification in a diapausing Artemia cyst protein

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Mai [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Ikeda, Yuka [Institute of High Polymer Research, Faculty of Textile Science and Technology, Shinshu University, 3-15-1, Tokida, Ueda 386-8567 (Japan); Kanzawa, Hideaki [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Sakamoto, Mika [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Goto, Mina [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Tsunasawa, Susumu [Analytical and Measuring Instruments Division, Shimadzu Corporation, Nishinokyo Kuwabaracho 1, Nakagyo-Ku, Kyoto 604-8511 (Japan); Uchiumi, Toshio, E-mail: uchiumi@bio.sc.niigata-u.ac.jp [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Odani, Shoji [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan)

    2010-03-26

    A highly hydrophilic, glutamate-rich protein was identified in the aqueous phenol extract from the cytosolic fraction of brine shrimp (Artemia franciscana) diapausing cysts and termed Artemia phenol soluble protein (PSP). Mass spectrometric analysis revealed the presence of many protein peaks around m/z 11,000, separated by 129 atomic mass units; this value corresponds to that of glutamate, which is strongly suggestive of heterogeneous polyglutamylation. Polyglutamylation has long been known as the functionally important post-translational modification of tubulins, which carry poly(L-glutamic acid) chains of heterogeneous length branching off from the main chain at the {gamma}-carboxy groups of a few specific glutamate residues. In Artemia PSP, however, Edman degradation of enzymatic peptides revealed that at least 13, and presumably 16, glutamate residues were modified by the attachment of a single L-glutamate, representing a hitherto undescribed type of post-translational modification: namely, multiple {gamma}-glutamylation or the addition of a large number of glutamate residues along the polypeptide chain. Although biological significance of PSP and its modification is yet to be established, suppression of in vitro thermal aggregation of lactate dehydrogenase by glutamylated PSP was observed.

  18. Shell-bound iron dependant nitric oxide synthesis in encysted Artemia parthenogenetica embryos during hydrogen peroxide exposure.

    Science.gov (United States)

    Veeramani, Sivaram; Baskaralingam, Vaseeharan

    2011-12-01

    Artemia is a tiny marine crustacean, serves as an excellent tool in both basic and applied aspects of stress biology research. In the current manuscript, we report that Artemia parthenogenetica embryos (cysts), in diapause stage, undergo iron transition changes when exposed to chemical diapause deactivation stimulus (hydrogen peroxide). X-ray surface analysis of A. parthenogenetica embryos exposed to H(2)O(2) showed significant transitional changes in iron, as seen in cyst cross-sections. Electron paramagnetic resonance study revealed that upon H(2)O(2) exposure, increased nitric oxide (NO) production was observed in non-decapsulated cysts (ND), but not in decapsulated cysts (DC) (shell-removed cysts). Spin trapping studies also showed an increase in hydroxyl radical formation in NDs exposed to H(2)O(2) through Fenton-like reaction. On the contrary, exposure of DCs to H(2)O(2) did not induce hydroxyl radical formation. Taken together, results from the present study indicate a key role of cyst shell-bound iron and reactive oxygen species on successful diapause termination in eukaryotic extremophile animal model, such as Artemia.

  19. Salt sensitivity of the morphometry of Artemia franciscana during development: a demonstration of 3D critical windows.

    Science.gov (United States)

    Mueller, Casey A; Willis, Eric; Burggren, Warren W

    2016-02-01

    A 3D conceptual framework of 'critical windows' was used to examine whether the morphometry of Artemia franciscana is altered by salinity exposure during certain key periods of development. Artemia franciscana were hatched at 20 ppt (designated control salinity) and were then exposed to 10, 30, 40 or 50 ppt either chronically (days 1-15) or only on days 1-6, 7-9, 10-12 or 13-15. On day 15, maturity was assessed and morphometric characteristics, including mass, total body length, tail length and width, length of the third swimming appendage and eye diameter, were measured. Maturation and morphometry on day 15 were influenced by the exposure window and salinity dose. Artemia franciscana were generally larger following exposure to 10 and 40 ppt during days 1-6 and 7-9 when compared with days 10-12 and 13-15, in part due to a higher percentage of mature individuals. Exposure to different salinities on days 1-6 produced the greatest differences in morphometry, and thus this appears to be a period in development when A. franciscana is particularly sensitive to salinity. Viewing the developmental window as three-dimensional allowed more effective visualization of the complex interactions between exposure window, stressor dose and the magnitude of morphometric changes in A. franciscana.

  20. The use of a brine shrimp (Artemia salina) bioassay to assess the toxicity of diatom extracts and short chain aldehydes.

    Science.gov (United States)

    Caldwell, Gary S; Bentley, Matthew G; Olive, Peter J W

    2003-09-01

    Water soluble algal extracts, the aldehydes 2E,4E-decadienal, decanal, undecanal and the fatty acid eicosapentaenoic acid (EPA) were assayed for toxicity to hatching success and larval mortality of the brine shrimp Artemia salina. Both crude cellular extracts of the diatoms Skeletonema costatum and Nitzschia commutata and the diatom-derived short chain aldehyde decadienal were found to inhibit hatching success of A. salina cysts in a dose-dependent manner. Decadienal also significantly affected larval mortality rates in 24 and 72 h exposure incubations. The Artemia hatching success assay was the least sensitive of the three (EC50=3.94 microg ml(-1)). A greater sensitivity was observed for the 72 h compared with the 24 h exposure trials (EC50 for 24h=2.14, 72 h=0.023 microg ml(-1)). Decanal did not significantly affect survival or hatching success at the concentrations tested. Undecanal and EPA showed a limited toxic effect in naupliar mortality trials. We suggest that 72 h Artemia exposure trials represent an acceptable bioassay for diatom toxicity where alternative bioassays are unavailable.

  1. Protective effect induced by atropine, carbamates, and 2-pyridine aldoxime methoiodide Artemia salina larvae exposed to fonofos and phosphamidon.

    Science.gov (United States)

    Victoria Barahona, M; Sánchez-Fortún, Sebastián

    2007-01-01

    The acute toxicity of fonofos and phosphamidon on three age classes of Artemia salina was evaluated. An increase in toxicity of these organophosphorous (OP) insecticides was found following longer development of A. salina. The effects of pretreatment with the nonselective muscarinic antagonist atropine, the two reversible acetylcholinesterease inhibitors physostigmine and pyridostigmine, and the cholinesterase-reactivating oxime 2-pyridine aldoxime methoiodide (2-PAM), as individual and combined pretreatments, on OP-induced lethality in 24 h Artemia were also investigated. The lethal action of both OP insecticides was prevented by pretreatment of 24 h Artemia with atropine and 2-PAM, while physostigmine proved ineffective against intoxication with both OP insecticides and pyridostigmine exhibited a low synergic effect. In both cases, the inhibitory effects of combinations of atropine (10(-5)M) plus 2-PAM were greater than those elicited by either drug alone, with the maximum protection afforded being 100%. Combined pretreatment of atropine (10(-5)M) plus physostigmine practically abolished the lethal effects induced by both insecticides. Pretreatment with 2-PAM (10(-6)M) plus physostigmine afforded maximal protection of 100% and 76% on the lethality induced by fonofos and phosphamidon, respectively. The data obtained suggest that the combination of atropine plus 2-PAM or physostigmine and the combined pretreatment of 2-PAM plus physostigmine are effective in the prevention of the lethal effects induced by fonofos and phosphamidon in A. salina larvae.

  2. Is polyploidy a persevering accident or an adaptive evolutionary pattern? The case of the brine shrimp Artemia.

    Science.gov (United States)

    Maniatsi, Stefania; Baxevanis, Athanasios D; Kappas, Ilias; Deligiannidis, Panagiotis; Triantafyllidis, Alexander; Papakostas, Spiros; Bougiouklis, Dimitrios; Abatzopoulos, Theodore J

    2011-02-01

    Asexual organisms are confronted with substantial drawbacks, both immediate and delayed, threatening their evolutionary persistence. Yet, genetic associations with asexuality may refresh the gene pool promoting adaptation of clonal lineages; polyploidy is one of them. Parthenogenesis itself and/or polyploidy are responsible for the maintenance and spread of clones in Artemia, a sexual-asexual genus of halophilic anostracans. We applied flow cytometry, microsatellite genotyping, and mtDNA sequencing to 23 asexual populations. Artemia parthenogens have evolved multiple times either through hybridization or spontaneously. Nine out of 23 populations contained clones of mixed ploidy (2n, 3n, 4n). Most clones were diploid (20/31) while two and nine clones were triploid and tetraploid, respectively. Apomictic triploids and tetraploids formed two distinct groups of low genetic diversity compared with the more divergent automictic diploids. Polyploidy is also polyphyletic in Artemia, with triploids and tetraploids having independent origins from different sexual ancestors. We discern a pattern of geographical parthenogenesis with all clonal groups being more widespread than their closest sexuals. In favour of a specialist model, asexual diploids are restricted to single locations and are strikingly segregated from generalist triploids and tetraploids occupying a variety of sites. This is a rare pattern of mixed life-history strategies within an asexual complex.

  3. 黄粉虫桃酥的工艺配方%Researcll on Technology and Formula of Tenebrio molitor Linneeus Walnut Cookie

    Institute of Scientific and Technical Information of China (English)

    李汉臣; 赵希艳; 陈姣

    2012-01-01

    以传统桃酥配方为基础加入黄粉虫脱脂粉,通过对不同原料配比的研究,使桃酥形态、色泽、组织状态、滋味各指标最佳,以丰富桃酥品种。试验时以感官评分为评价指标,主要考虑黄粉虫添加量、水的添加量、糖的添加量、烤箱温度对桃酥品质的影响,在单因素试验的基础上采用正交分析的方法,确定最佳工艺配方:面粉量为900 g,黄粉虫脱脂粉添加量100 g,水的添加量110 g,白糖400 g,植物油450 g,膨松剂20 g(碳酸氢钠8 g,碳酸氢铵12 g),烤箱温度180/150℃(面火/底火)。%In order to enrich the types of walnut cake,fatless Tenebrio molitor Linneeus powder was mixed into traditional formula and varied ratios of materials were researched. The content of fatless Tenebrio molitor Lin- neeus powder,water and sugar and baking temperature were researched through sensory score in single factor experiment and orthogonal test. The optimum formulation determined is :flour 90 g,fatless Tenebrio molitor Lin- neeus powder 10 g,water 11 g,sugar 40 g,oil 45 g,raising agent 2 g,baking temperature 180/150C (the a- bove/the below).

  4. Coadaptation: lessons from the brine shrimp Artemia, "the aquatic Drosophila" (Crustacea; Anostraca Coadaptación: lecciones desde el camarón de salmuera Artemia, "la Drosophila acuática" (Crustacea; Anostraca

    Directory of Open Access Journals (Sweden)

    GONZALO GAJARDO

    2001-03-01

    Full Text Available During the fifties Brncic and the Dobzhansky's school, using the fruit fly Drosophila as a test organism, introduced the term integration of the genotype, or genetic coadaptation, which has had great impact on thinking in today's evolutionary biology. In this work we use the brine shrimp Artemia - in many respects a sort of aquatic Drosophila- as a model organism to evaluate the relationship between population structure, potential for divergence and the degree of morphological and/or genetic change. These aspects, tightly linked with the organization of the genotype, are important to understanding how recombination and adaptive release of genetic and phenotypic variation affect the speciation process in Artemia. Analysis of genetic (allozyme, diploid and chromocentre numbers, morphological (Mahalanobis distances and reproductive data (cross-fertility tests available for populations of the bisexual, endemic species of the Americas, Artemia franciscana and A. persimilis, indicate that: (i A. franciscana and A. persimilis are morphologically distinct in correspondence with observed genetic differences (D Nei > 1; 2n = 42 and 44; 12.5 and 1.5 mean chromocentre numbers, respectively; (ii populations from Chile and other South American localities (mainly A. franciscana display high levels of genetic variability and a trend to develop large genetic distances between populations; (iii the plasticity of Artemia gene pool is associated, at least in part, with ecological heterogeneity. Hence an adaptive divergence mode is thought to best define the speciation process in Artemia; (iv the succesful production of laboratory hybrids in the allopatric Artemia populations studied in the Americas, a feature seen in other anostracods, could be explained by the fact that formerly allopatric populations have not achieved later sympatry, as required by the allopatric speciation paradigmEn los años cincuenta Brncic y la escuela de Dobzhansky introdujeron el t

  5. Acute toxicity of several organophosphorous insecticides and protection by cholinergic antagonists and 2-PAM on Artemia salina larvae.

    Science.gov (United States)

    Sánchez-Fortún, S; Sanz, F; Barahona, M V

    1996-10-01

    The acute toxicity of chlorpyrifos, methylchlorpyrifos, parathion and methylparathion to three age classes of Artemia salina was determined. In general, A. salina 24-h old was less sensitive to these organophosphorous insecticides (OPI) than A. salina 48-h old and A. salina 48-h old was significantly more tolerant than A. salina 72-h old, in contrast, chlorpyrifos was equally toxic to A. salina 48- and 72-h old. There were some differences among the three age classes of A. salina in the relative order of toxicity of OPI tested. The rank order of toxicity to A. salina 48-h old was methylparathion salina 24- and 72-h old it was methylparathion = parathion Artemia salina 24-h old was investigated. The lethal action of OPI tested was completely prevented by pretreatment of Artemia salina 24-h old with 2-PAM (10(-5) M) and atropine (10(-4 )M). However no concentration of hexamethonium, pirenzepine or AF-DX 116 protected 100% of the animals poisoned by LC84 of the OPI selected, maximum protection obtained was 71 to 88%. In contrast, the maximum inhibition of mortality obtained with AF-DX 116 pretreatment was about 55% because this compound was used at concentrations which were non toxic to control Artemia salina. Atropine, hexamethonium, pirenzepine, AF-DX 116 and 2-PAM afforded 50 % protection (IC50) of Artemia salina against mortality by LC84 of the OPI selected at concentrations in the range of 6.62x10(-7)-1.6x10(-6) M, 2. 38x10(-4)-2.05x10(-3)M, 8.91x10(-7)-1.24x10(-6) M, 9.66x10(-8)-1. 34x10(-7 )M, and 1.95x10(-8)-2.73x10(-8 )M, respectively. Pretreatment of atropine plus 2-PAM to determine whether this combination afforded greater inhibition of the lethality induced by four OPI tested than pretreatment with either atropine or 2-PAM alone was investigated. Atropine (10(-5) M) in combination with 2-PAM (10(-7 )M) inhibited completely the acute toxicity of all OPI tested, while the pretreatment with atropine (10(-6) M) plus 2-PAM at the same concentration gave a

  6. Daphnia as a refuge for an antibiotic resistance gene in an experimental freshwater community.

    Science.gov (United States)

    Eckert, Ester M; Di Cesare, Andrea; Stenzel, Birgit; Fontaneto, Diego; Corno, Gianluca

    2016-11-15

    Mechanisms that enable the maintenance of antibiotic resistance genes in the environment are still greatly unknown. Here we show that the tetracycline resistance gene tet(A) is largely removed from the pelagic aquatic bacterial community through filter feeding by Daphnia obtusa while it becomes detectable within the microbiome of the daphniids themselves, where it was not present prior to the experiment. We moreover show that a multitude of Daphnia-associated bacterial taxa are potential carriers of tet(A) and postulated that the biofilm-like structures, where bacteria grow in, may enable horizontal transfer of such genes. This experiment highlights the need to take ecological interactions and a broad range of niches into consideration when studying and discussing the fate of antibiotic resistance genes in nature.

  7. Uptake and depuration of three differently functionalized zinc oxide nanoparticles to Daphnia magna

    DEFF Research Database (Denmark)

    Skjolding, Lars Michael; Winther-Nielsen, Margrete; Baun, Anders

    or decrease the bioaccumulation compared to ZnO NP. The experiments were based on ISO 6341 Daphnia immobilization test and bioaccumulation studies with Daphnia magna including a 24h uptake and 24h depuration phase. The tested ZnO NP was of same primary size (35 nm) but with different functionalizations (Zn......O, ZnO-OH, ZnO-C8H17). Characterization included ICP-MS, DLS, BET and TEM. Preliminary results show a fast uptake of ZnO NP (k1=0.11 h-1) and fast depuration (k2=-0.23). In contrast, ZnO-OH did not show significant uptake compared to control. The poster will focus on trends in uptake and depuration...

  8. Toxicity of Nanoscale CuO and ZnO to Daphnia magna

    Institute of Scientific and Technical Information of China (English)

    ZHAO Hai-zhou; LU Guang-hua; XIA Jun; JIN Shao-ge

    2012-01-01

    The potential effects of nanoscale CuO(nCuO),nanoscale ZnO(nZnO)and their mixtures on Daphnia magna were investigated,including 48-h acute toxicity and 21-d chronic toxicity tests as well as a feeding experiment.The results of acute toxicity show that nCuO/nZnO mixture was the most toxic followed by nCuO and nZnO.The nanoparticles(NPs)inhibited both the growth and reproduction of Daphnia magna during the testing period.Concentration dependence was apparent in all the cases and the intrinsic rate of natural increase was confirmed to be a very sensitive parameter to NPs exposure.Binary mixture appeared to be more toxic than the corresponding individual exposures at most cases except for the feeding behavior.

  9. Toxicity of aqueous C70-gallic acid suspension in Daphnia magna.

    Science.gov (United States)

    Seda, Brandon C; Ke, Pu-Chun; Mount, Andrew S; Klaine, Stephen J

    2012-01-01

    The present study assessed the toxic effects of stable aqueous colloidal suspensions of gallic-acid-stabilized C(70) fullerene on Daphnia magna. The suspensions were stabilized through noncovalent surface modification with gallic acid. In addition to whole-organism responses, changes in antioxidative processes in D. magna were quantified. Acute toxicity was observed with 96LC50 for C(70) -gallic acid of 0.4 ± 0.1 mg/L C(70) . Daphnia magna fecundity was significantly reduced in 21-d bioassays at C(70) -gallic aqcid concentrations below quantifiable limits. Antioxidant enzyme activities of glutathione peroxidase and superoxide dismutase as well as lipid peroxidation suggested that exposed organisms experienced oxidative stress. Microscopic techniques used to determine cellular toxicity via apoptosis proved unsuccessful.

  10. Accumulation of dieldrin in an alga (Scenedesmus obliquus), Daphnia magna, and the guppy (Poecilia reticulata)

    Science.gov (United States)

    Reinert, Robert E.

    1972-01-01

    Scenedesmus obliquus, Daphnia magna, and Poecilia reticulata accumulated dieldrin directly from water; average concentration factors (concentration in organism, dry weight, divided by concentration in water) were 1282 for the alga, 13,954 for D. magna, and 49,307 (estimated) for the guppy. The amount accumulated by each species at equilibrium (after about 1.5, 3-4, and 18 days, respectively) was directly proportional to the concentration of dieldrin in the water. Daphnia magna and guppies accumulated more dieldrin from water than from food that had been exposed to similar concentrations in water. When guppies were fed equal daily rations of D. magna containing different concentrations of insecticide, the amounts of dieldrin accumulated by the fish were directly proportional to the concentration in D. magna; when two lots of guppies were fed different quantities of D. magna (10 and 20 organisms per day) containing identical concentrations of dieldrin, however, the amounts accumulated did not differ substantially.

  11. Hormetic response of cholinesterase from Daphnia magna in chronic exposure to triazophos and chlorpyrifos

    Institute of Scientific and Technical Information of China (English)

    Shaonan Li; Yajun Tan

    2011-01-01

    In vivo activity of cholinesterase (ChE) in Daphnia magna was measured at different time points during 21-day exposure to triazophos and chlorpyrifos ranging from 0.05 to 2.50 μg/L and 0.01 to 2.00 μg/L, respectively.For exposure to triazophos, ChE was induced up to 176.5% at 1.5 μg/L and day 10 when measured by acetylthiocholine (ATCh), whereas it was induced up to 174.2% at 0.5 μg/L and day 10 when measured by butyrylthiocholine (BTCh).For exposure to chlorpyrifos, ChE was induced up to 134.0% and 160.5% when measured by ATCh and BTCh, respectivly, with both maximal inductions detected at 0.l μg/L and day 8.Obvious induction in terms of ChE activity was also detected in daphnia removed from exposures 24 hr after their birth and kept in a recovery culture for 21 days.Results indicated that the enzyme displayed symptoms of hormesis, a characteristic featured by conversion from low-dose stimulation to high-dose inhibition.In spite of that, no promotion in terms of reproduction rate and body size was detected at any tested concentrations regardless of whether the daphnia were collected at end of the 21-day exposure or at end of a 21-day recovery culture.This suggested that induction of ChE caused by anticholinesterases had nothing to do with the prosperity of the daphnia population.

  12. High mutational rates of large-scale duplication and deletion in Daphnia pulex

    OpenAIRE

    Keith, Nathan; Tucker, Abraham E.; Jackson, Craig E.; Sung, Way; Lucas Lledó, José Ignacio; Schrider, Daniel R.; Schaack, Sarah; DUDYCHA, JEFFRY L.; Ackerman, Matthew; Andrew J. Younge; Shaw, Joseph R.; Lynch, Michael

    2016-01-01

    Knowledge of the genome-wide rate and spectrum of mutations is necessary to understand the origin of disease and the genetic variation driving all evolutionary processes. Here, we provide a genome-wide analysis of the rate and spectrum of mutations obtained in two Daphnia pulex genotypes via separate mutation-accumulation (MA) experiments. Unlike most MA studies that utilize haploid, homozygous, or self-fertilizing lines, D. pulex can be propagated ameiotically while maintaining a naturally h...

  13. Trophic transfer of differently functionalized zinc oxide nanoparticles from crustaceans (Daphnia magna) to zebrafish (Danio rerio)

    DEFF Research Database (Denmark)

    Skjolding, Lars Michael; Winther-Nielsen, M.; Baun, Anders

    2014-01-01

    O-octyl NP in D. magna was studied. Bulk ZnO particles (≤5 μm) and ZnCl2 were used as references for uptake of particles and dissolved species of Zn, respectively. Furthermore, the trophic transfer of ZnO NP and ZnO-octyl NP from daphnids (Daphnia magna) to zebra fish (Danio rerio) was studied. For ZnO NP...

  14. Bioaccumulation of perfluoroalkyl substances by Daphnia magna in water with different types and concentrations of protein.

    Science.gov (United States)

    Xia, Xinghui; Rabearisoa, Andry H; Jiang, Xiaoman; Dai, Zhineng

    2013-10-01

    Perfluoroalkyl substances (PFASs) are sometimes regarded as proteinophilic compounds, however, there is no research report about the effect of environmental protein on the bioaccumulation of PFASs in waters. In the present study we investigated influences of protein on the bioaccumulation of six kinds of PFASs by Daphnia magna in water; it included perfluorooctane sulfonate, perfluorooctanoic acid, perfluorononanoic acid, perfluorodecanoic acid, perfluoroundecanoic acid, and perfluorododecanoic acid. Two types of protein including bovine albumin from animal and soy peptone from plant were compared and the effects of protein concentration were investigated. Both types of protein at high concentrations (10 and 20 mg L(-1)) suppressed the bioaccumulation of PFASs. When protein concentration increased from 0 to 20 mg L(-1), the decreasing ratios of the PFAS body burden (35.3-52.9%) in Daphnia magna induced by bovine albumin were significantly higher than those (22.0-36.6%) by soy peptone. The dialysis bag experiment results showed that the binding of PFASs to protein followed the Freundlich isotherm, suggesting it is not a linear partitioning process but an adsorption-like process. The partition coefficients of PFASs between bovine albumin and water were higher compared to soy peptone; this resulted in higher reducing rates of freely dissolved concentrations of PFASs with increasing bovine albumin concentration, leading to a stronger suppression of PFAS bioaccumulation. However, the presence of both types of protein with a low concentration (1 mg L(-1)) enhanced the bioaccumulation of PFASs. Furthermore, the water-based bioaccumulation factor based on the freely dissolved concentrations of PFASs even increased with and the depuration rate constants of PFASs from Daphnia magna decreased with protein concentration, suggesting that protein would not only reduce the bioavailable concentrations and uptake rates of PFASs but also lower the elimination rates of PFASs in

  15. Acute toxicity of copper oxide nanoparticles to Daphnia magna under different test conditions

    DEFF Research Database (Denmark)

    Thit, Amalie; Huggins, Krista; Selck, Henriette;

    2016-01-01

    The acute toxicity of monodispersed 6 nm and <100 nm poly-dispersed copper oxide nanoparticles toward Daphnia magna was assessed using 48 h immobilization tests. CuSO4 was used as a reference. Four different exposure conditions were tested, to study whether the toxicity of the nanoparticle suspen...... model MINTEQ. These findings show that the acute toxicity of copper oxide nanoparticles is governed by test water composition and the chemical species Cu2+....

  16. Variation in copper effects on kairomone-mediated responses in Daphnia pulicaria.

    Science.gov (United States)

    DeMille, C M; Arnott, S E; Pyle, G G

    2016-04-01

    Chemical signals play an integral role in many predator-prey relationships but their effectiveness can be altered by environmental conditions. Prey species can detect predator kairomones, which induce anti-predator defenses. An example of this predator-prey relationship exists between Daphnia spp. and Chaoborus spp.; however, when living in water contaminated with low concentrations of copper (Cu) Daphnia can fail to respond to Chaoborus kairomone and, in turn, become more susceptible to predation. This has implications for Daphnia living in regions with Cu contamination, such as areas where mining activity has resulted in increased levels of metals in the surrounding lakes. We examined kairomone-mediated responses of multiple Daphnia pulicaria clones obtained from 8 lakes in Ontario, Canada, in the absence and presence of environmentally-relevant Cu concentrations. Life history traits and morphological anti-predator defenses were assessed using neonates collected from mothers that were exposed to kairomone and Cu treatments. We found that kairomone-mediated responses and Cu-tolerance varied among D. pulicaria clones. Clones exposed to kairomone, in the absence of Cu additions, had diverse responses, including larger neonates, delayed reproduction, or altered brood size relative to no-kairomone controls. These kairomone-induced responses act as antipredator defense strategies against Chaoborus by preventing predation or stabilizing population growth. When exposed to Cu, two clones were able to respond to kairomone, while four clones no longer induced a response to kairomone. This variation in non-lethal effects of Cu on aquatic organisms suggests that toxicity tests should incorporate multiple genotypes and include predator-prey interactions.

  17. Climate Effects on High Latitude Daphnia via Food Quality and Thresholds

    Science.gov (United States)

    Przytulska, Anna; Bartosiewicz, Maciej; Rautio, Milla; Dufresne, France; Vincent, Warwick F.

    2015-01-01

    Climate change is proceeding rapidly at high northern latitudes and may have a variety of direct and indirect effects on aquatic food webs. One predicted effect is the potential shift in phytoplankton community structure towards increased cyanobacterial abundance. Given that cyanobacteria are known to be a nutritionally poor food source, we hypothesized that such a shift would reduce the efficiency of feeding and growth of northern zooplankton. To test this hypothesis, we first isolated a clone of Daphnia pulex from a permafrost thaw pond in subarctic Québec, and confirmed that it was triploid but otherwise genetically similar to a diploid, reference clone of the same species isolated from a freshwater pond in southern Québec. We used a controlled flow-through system to investigate the direct effect of temperature and indirect effect of subarctic picocyanobacteria (Synechococcus) on threshold food concentrations and growth rate of the high latitude clone. We also compared the direct effect of temperature on both Daphnia clones feeding on eukaryotic picoplankton (Nannochloropsis). The high latitude clone had a significantly lower food threshold for growth than the temperate clone at both 18 and 26°C, implying adaptation to lower food availability even under warmer conditions. Polyunsaturated fatty acids were present in the picoeukaryote but not the cyanobacterium, confirming the large difference in food quality. The food threshold for growth of the high latitude Daphnia was 3.7 (18°C) to 4.2 (26°C) times higher when fed Synechococcus versus Nannochloropsis, and there was also a significant negative effect of increased temperature and cyanobacterial food on zooplankton fatty acid content and composition. The combined effect of temperature and food quality on the performance of the high latitude Daphnia was greater than their effects added separately, further indicating the potentially strong indirect effects of climate warming on aquatic food web processes. PMID

  18. Unusual duplication of the insulin-like receptor in the crustacean Daphnia pulex

    Directory of Open Access Journals (Sweden)

    Dufresne France

    2010-10-01

    Full Text Available Abstract Background The insulin signaling pathway (ISP has a key role in major physiological events like carbohydrate metabolism and growth regulation. The ISP has been well described in vertebrates and in a few invertebrate model organisms but remains largely unexplored in non-model invertebrates. This study is the first detailed genomic study of this pathway in a crustacean species, Daphnia pulex. Results The Daphnia pulex draft genome sequence assembly was scanned for major components of the ISP with a special attention to the insulin-like receptor. Twenty three putative genes are reported. The pathway appears to be generally well conserved as genes found in other invertebrates are present. Major findings include a lower number of insulin-like peptides in Daphnia as compared to other invertebrates and the presence of multiple insulin-like receptors (InR, with four genes as opposed to a single one in other invertebrates. Genes encoding for the Dappu_InR are likely the result of three duplication events and bear some unusual features. Dappu_InR-4 has undergone extensive evolutionary divergence and lacks the conserved site of the catalytic domain of the receptor tyrosine kinase. Dappu_InR-1 has a large insert and lacks the transmembranal domain in the β-subunit. This domain is also absent in Dappu_InR-3. Dappu_InR-2 is characterized by the absence of the cystein-rich region. Real-time q-PCR confirmed the expression of all four receptors. EST analyses of cDNA libraries revealed that the four receptors were differently expressed under various conditions. Conclusions Duplications of the insulin receptor genes might represent an important evolutionary innovation in Daphnia as they are known to exhibit extensive phenotypic plasticity in body size and in the size of defensive structures in response to predation.

  19. Response of Daphnia's antioxidant system to spatial heterogeneity in Cyanobacteria concentrations in a lowland reservoir.

    Directory of Open Access Journals (Sweden)

    Adrianna Wojtal-Frankiewicz

    Full Text Available Many species and clones of Daphnia inhabit ecosystems with permanent algal blooms, and they can develop tolerance to cyanobacterial toxins. In the current study, we examined the spatial differences in the response of Daphnia longispina to the toxic Microcystis aeruginosa in a lowland eutrophic dam reservoir between June (before blooms and September (during blooms. The reservoir showed a distinct spatial pattern in cyanobacteria abundance resulting from the wind direction: the station closest to the dam was characterised by persistently high Microcystis biomass, whereas the upstream stations had a significantly lower biomass of Microcystis. Microcystin concentrations were closely correlated with the cyanobacteria abundance (r = 0.93. The density of daphniids did not differ among the stations. The main objective of this study was to investigate how the distribution of toxic Microcystis blooms affects the antioxidant system of Daphnia. We examined catalase (CAT activity, the level of the low molecular weight antioxidant glutathione (GSH, glutathione S-transferase (GST activity and oxidative stress parameters, such as lipid peroxidation (LPO. We found that the higher the abundance (and toxicity of the cyanobacteria, the lower the values of the antioxidant parameters. The CAT activity and LPO level were always significantly lower at the station with the highest M. aeruginosa biomass, which indicated the low oxidative stress of D. longispina at the site with the potentially high toxic thread. However, the low concentration of GSH and the highest activity of GST indicated the occurrence of detoxification processes at this site. These results demonstrate that daphniids that have coexisted with a high biomass of toxic cyanobacteria have effective mechanisms that protect them against the toxic effects of microcystins. We also conclude that Daphnia's resistance capacity to Microcystis toxins may differ within an ecosystem, depending on the bloom

  20. Competitive outcome of Daphnia-Simocephalus experimental microcosms: salinity versus priority effects.

    Directory of Open Access Journals (Sweden)

    Cláudia Loureiro

    Full Text Available Competition is a major driving force in freshwaters, especially given the cyclic nature and dynamics of pelagic food webs. Competition is especially important in the initial species assortment during colonization and re-colonization events, which depends strongly on the environmental context. Subtle changes, such as saline intrusion, may disrupt competitive relationships and, thus, influence community composition. Bearing this in mind, our objective was to assess whether low salinity levels (using NaCl as a proxy alter the competitive outcome (measured as the rate of population biomass increase of Daphnia-Simocephalus experimental microcosms, taking into account interactions with priority effects (sequential species arrival order. With this approach, we aimed to experimentally demonstrate a putative mechanism of differential species sorting in brackish environments or in freshwaters facing secondary salinization. Experiments considered three salinity levels, regarding NaCl added (0.00, 0.75 and 1.50 g L(-1, crossed with three competition scenarios (no priority, priority of Daphnia over Simocephalus, and vice-versa. At lower NaCl concentrations (0.00 and 0.75 g L(-1, Daphnia was a significantly superior competitor, irrespective of the species inoculation order, suggesting negligible priority effects. However, the strong decrease in Daphnia population growth at 1.50 g L(-1 alleviated the competitive pressure on Simocephalus, causing an inversion of the competitive outcome in favour of Simocephalus. The intensity of this inversion depended on the competition scenario. This salinity-mediated disruption of the competitive outcome demonstrates that subtle environmental changes produce indirect effects in key ecological mechanisms, thus altering community composition, which may lead to serious implications in terms of ecosystem functioning (e.g. lake regime shifts due to reduced grazing and biodiversity.

  1. Effects of crepuscular photoenvironment on light-induced behavior of Daphnia.

    Science.gov (United States)

    Grover, P B; Miller, R J

    1984-11-01

    Phototactic response rates in the aquatic crustacean Daphnia magna were found to increase greatly when cultured under a lighting regime that included simulation of sunset and sunrise. The changes in intensity and color of the crepuscular periods are known to be the primary stimulus for vertical migrations of many planktonic forms, and may have importance to many other animals as well. The value of this type of lighting to investigators of animal behavior and physiology is discussed.

  2. Effects of algal food quality on sexual reproduction of Daphnia magna

    OpenAIRE

    Choi, Jong‐Yun; Kim, Seong‐Ki; La, Geung‐Hwan; Chang, Kwang‐Hyeon; Kim, Dong‐Kyun; Jeong, Keon‐Young; Min S. Park; Jo, Hyunbin; Kim, Hyun‐Woo; Jeong, Kwang‐Seuk

    2016-01-01

    Abstract The objective of our study was to investigate sexual reproduction of Daphnia magna associated with mating behaviors and hatching rates, according to different algal food sources. Since a diatom is known to contain more abundant long‐chain poly unsaturated fatty acids (PUFAs), we hypothesized that the diatom‐consuming D. magna would exhibit more successful reproduction rates. Upon the hypothesis, we designed three experiments using two algal species, a green alga (Chlorella vulgaris) ...

  3. A Novel Porous Carrier Found in Nature for Nanocomposite Materials Preparation: A Case Study of Artemia Egg Shell-Supported TiO2 for Formaldehyde Removal

    Directory of Open Access Journals (Sweden)

    Sufeng Wang

    2015-01-01

    Full Text Available Artemia egg shells have an asymptotic sized pore structure (pore diameter: 500 nm–2500 nm, which could be used as a porous carrier for the preparation of nanocomposite materials. The objective of the present study was to prepare shell-supported TiO2 using a naturally porous carrier, Artemia egg shell, and to exhibit a case study of shell-supported TiO2 for formaldehyde removal. Characterization of shell-TiO2 using SEM-EDS, TEM, and XRD proved that Artemia shell with asymptotic reduction pores (pore diameter: 500 nm–2500 nm can be used as the carrier for nanocomposite materials. Artemia egg shell-supported TiO2 in polycrystalline-like nanostructures can be used for the high efficiency removal (adsorption and degradation of formaldehyde under visible light. Our results suggest that iron, one of the shell’s components, should broaden the absorption of visible light and enhance the photocatalytic efficiency of nanotitanium dioxide under visible light. Due to their interesting absorption and formaldehyde removal qualities, Artemia egg shell, as a novel naturally porous carrier for nanocomposite materials preparation, especially in the preparation of nanocatalysts, is worthy of further study.

  4. Optimum level of fish liver oil as enrichment for Artemia fed to the tiger tail seahorse Hippocampus comes for reproduction and juvenile survival

    Directory of Open Access Journals (Sweden)

    Mac Nhu Binh

    2012-09-01

    Full Text Available Reproductive performance of broodstocks and juvenile stress resistance of seahorseHippocampus comes afed Artemia enriched with varying fish liver oil (FLO were evaluated. Artemia wasenriched in seven media with 0%, 1%, 2%, 3%, 4%, 5% and 10% FLO supplemented with egg yolk,baker’s yeast and vitamins 12 h before feeding to seahorse broodstocks. In general, responseparameters increased at lower concentration of FLO, peaked at 5% and decreased at 10%; thus, forparabolic relationships, the quadratic regression was appropriate to estimate quantitative optimum level.Artemia enrichment with FLO increased considerably its saturated FA content in the form of myristic acidand the total HUFA content, particularly DHA and arachidonic acid. Feeding seahorse broodstock with FLOenriched Artemia resulted in: (1 significant increase in brood size both during the first and secondbrooding, (2 significant shortening of interbrooding period, and (3 significant extension of the time tototal mortality during the salinity shock test of juveniles. Quantitative estimates of mean optimum FLOlevel for the enrichment of Artemia fed to H. comes awas 6.3% (range 5.9–7.0% using each responseparameter fitted in a quadratic model.

  5. Daphnia magna fitness during low food supply under different water temperature and brownification scenarios

    Directory of Open Access Journals (Sweden)

    Andrea Gall

    2016-11-01

    Full Text Available Much of our current knowledge about non-limiting dietary carbon supply for herbivorous zooplankton is based on experimental evidence and typically conducted at ~1 mg C L-1 and ~20°C. Here we ask how low supply of dietary carbon affects somatic growth, reproduction, and survival of Daphnia magna and test effects of higher water temperature (+3 °C relative to ambient and brownification (3X higher than natural water color; both predicted effects of climate change during fall cooling. We predicted that even at very low carbon supply (~5µg C L-1, higher water temperature and brownification will allow D. magna to increase its fitness. Neonates (<24 h old were incubated with lake seston for 4 weeks (October-November 2013 in experimental bottles submerged in outdoor mesocosms to explore effects of warmer and darker water. Higher temperature and brownification did not significantly affect food quality, as assessed by its fatty acid composition. Daphnia exposed to both increased temperature and brownification had highest somatic growth and were the only that reproduced, and higher temperature caused the highest Daphnia survival success. These results suggest that even under low temperature and thus lower physiological activity, low food quantity is more important than its quality for D. magna fitness.

  6. Toxicological Monitoring of a Water Supply Reservoir by Acute Assays with Daphnia Pulex

    Directory of Open Access Journals (Sweden)

    Carlos Daniel Ramos Contreras

    2015-05-01

    Full Text Available Daphnia pulex assays (48 hours were performed to determine acute toxicity of water samples from La Fe reservoir, Antioquia, Colombia. Eight sampling campaigns were done between March 2010 and June 2012, a period that included rainfall episodes. Samples were taken from the water column at three depths and from lotic areas. Physicochemical properties such as pH, electrical conductivity, temperature and dissolved oxygen were measured both in field and laboratory, and concentrations of dissolved iron (Fe, manganese (Mn, aluminium (Al, lead (Pb, cadmium (Cd and chromium (Cr were assessed. The overall results for the physicochemical properties remained at expected levels for natural waters with slightly higher conductivities in samples collected from bottom and some tributaries. The results of the toxicity tests showed significant mortalities in only 28% of assays. A higher mortality of Daphnia pulex was detected for tests performed during periods of higher precipitation (August 2010, February and July 2011 mainly for samples taken near the confluence of natural tributaries. No significant relationships between physicochemical variables and mortality of Daphnia pulex were found.DOI: http://dx.doi.org/10.5755/j01.erem.71.1.9788

  7. Daphnicle dynamics based on kinetic theory: an analogue-modelling of swarming and behaviour of daphnia.

    Science.gov (United States)

    Øien, Alf H

    2004-01-01

    Attempts are presented of an analogue modelling of Daphnia responses to various influences and stimuli, as distribution of food and of predators. An aim of the study is to examine to what extent a statistical-mechanical approach may be useful as a tool in modelling of Daphnia swarms behaviour. In the modelling we follow a line close to test particle studies in physical sciences. A generalized kinetic equation of what we shall call daphnicles is derived. The modelling incorporates individual characteristics of daphnicles, as position, velocity, degree of food saturation and responses daphnicles have to outside influences. Each daphnicle we assume responds to some stimuli in ordered ways and to others in stochastic ways, and the degree or strength of reactions depends on the density of all daphnicles, the density of food available, the saturation level of daphnicles and the threat level in the environment, or background, the daphnicles are living on. Some fluid equations of daphnicle swarms are subsequently derived from the basic equation, and solutions are given of the model-equations, including a food distribution equation, in some particular cases that show peculiarities in reactions of daphnicles to food, degree of saturation and to threat, when these are acting alone, and in combination. The modelling results may be compared to results of laboratory experiments of Daphnia behaviour that soon will be performed.

  8. Mimicking Daphnia magna bioassay performance by an electronic tongue for urban water quality control

    Energy Technology Data Exchange (ETDEWEB)

    Kirsanov, Dmitry, E-mail: d.kirsanov@gmail.com [Laboratory of Chemical Sensors, St. Petersburg State University, St. Petersburg (Russian Federation); Laboratory of Artificial Sensor Systems, ITMO University, St. Petersburg (Russian Federation); Legin, Evgeny [Laboratory of Artificial Sensor Systems, ITMO University, St. Petersburg (Russian Federation); Sensor Systems LLC, St. Petersburg (Russian Federation); Zagrebin, Anatoly; Ignatieva, Natalia; Rybakin, Vladimir [Institute of Limnology, Russian Academy of Sciences, St. Petersburg (Russian Federation); Legin, Andrey [Laboratory of Chemical Sensors, St. Petersburg State University, St. Petersburg (Russian Federation); Laboratory of Artificial Sensor Systems, ITMO University, St. Petersburg (Russian Federation)

    2014-05-01

    Highlights: • -Daphnia magna bioassay can be simulated with multisensor system. • Urban water toxicity can be predicted from potentiometric ET data. • Independent test set validation confirms statistical significance of the results. - Abstract: Toxicity is one of the key parameters of water quality in environmental monitoring. However, being evaluated as a response of living beings (as their mobility, fertility, death rate, etc.) to water quality, toxicity can only be assessed with the help of these living beings. This imposes certain restrictions on toxicity bioassay as an analytical method: biotest organisms must be properly bred, fed and kept under strictly regulated conditions and duration of tests can be quite long (up to several days), thus making the whole procedure the prerogative of the limited number of highly specialized laboratories. This report describes an original application of potentiometric multisensor system (electronic tongue) when the set of electrochemical sensors was calibrated against Daphnia magna death rate in order to perform toxicity assessment of urban waters without immediate involvement of living creatures. PRM (partial robust M) and PLS (projections on latent structures) regression models based on the data from this multisensor system allowed for prediction of toxicity of unknown water samples in terms of biotests but in the fast and simple instrumental way. Typical errors of water toxicity predictions were below 20% in terms of Daphnia death rate which can be considered as a good result taking into account the complexity of the task.

  9. The complete mitochondrial genome of the Chinese Daphnia pulex (Cladocera, Daphniidae

    Directory of Open Access Journals (Sweden)

    Xuexia Geng

    2016-09-01

    Full Text Available Daphnia pulex has played an important role in fresh-water ecosystems. In this study, the complete mitochondrial genome of Daphnia pulex from Chaohu, China was sequenced for the first time. It was accomplished using long-PCR methods and a primer-walking sequencing strategy with genus-specific primers. The mitogenome was found to be 15,306 bp in length. It contained 13 protein-coding genes, two rRNA genes, 22 tRNA genes and a typical control region. This research revealed an overall A+T content of 64.50%. All of the 22 typical animal tRNA genes had a classical clover-leaf structure except for trnS1, in which its DHU arm simply formed a loop. The lengths of small and large rRNA were 744 bp and 1,313 bp, respectively. The A+T-rich region was 723 bp in length, which is longer than that from the North American species (689 bp. In terms of structure and composition, many similarities were found between the Chinese and North American Daphnia pulex.

  10. Mating behavior of Daphnia: impacts of predation risk, food quantity, and reproductive phase of females.

    Directory of Open Access Journals (Sweden)

    Geung-Hwan La

    Full Text Available High predation risk and food depletion lead to sexual reproduction in cyclically parthenogenetic Daphnia. Mating, the core of sexual reproduction, also occurs under these conditions. Assessment of the environmental conditions and alteration of mating efforts may aid in determining the success of sexual reproduction. Here, we evaluated the impacts of predation risk, food quantity, and reproductive phase of females on the mating behavior of Daphnia obtusa males including contact frequency and duration using video analysis. Mating-related behavior involved male-female contact (mating as well as male-male contact (fighting. Mating frequency increased while unnecessary fighting decreased in the presence of predation risk. In addition, low food concentration reduced fighting between males. Males attempted to attach to sexual females more than asexual females, and fighting occurred more frequently in the presence of sexual females. Duration of mating was relatively long; however, males separated shortly after contact in terms of fighting behavior. Thus, assessment of environmental factors and primary sexing of mates were performed before actual contact, possibly mechanically, and precise sex discrimination was conducted after contact. These results suggest that mating in Daphnia is not a random process but rather a balance between predation risk and energetic cost that results in changes in mating and fighting strategies.

  11. Potential impact of low-concentration silver nanoparticles on predator-prey interactions between predatory dragonfly nymphs and Daphnia magna as a prey.

    Science.gov (United States)

    Pokhrel, Lok R; Dubey, Brajesh

    2012-07-17

    This study investigated the potential impacts of low-concentration citrate-coated silver nanoparticles (citrate-nAg; 2 μg L(-1) as total Ag) on the interactions of Daphnia magna Straus (as a prey) with the predatory dragonfly ( Anax junius : Odonata) nymph using the behavioral, survival, and reproductive end points. Four different toxicity bioassays were evaluated: (i) horizontal migration; (ii) vertical migration; (iii) 48 h survival; and (iv) 21 day reproduction; using four different treatment combinations: (i) Daphnia + citrate-nAg; (ii) Daphnia + predator; (iii) Daphnia + citrate-nAg + predator; and (iv) Daphnia only (control). Daphnia avoided the predators using the horizontal and vertical movements, indicating that Daphnia might have perceived a significant risk of predation. However, with citrate-nAg + predator treatment, Daphnia response did not differ from control in the vertical migration test, suggesting that Daphnia were unable to detect the presence of predator with citrate-nAg treatment and this may have potential implication on daphnids population structure owing to predation risk. The 48 h survival test showed a significant mortality of Daphnia individuals in the presence of predators, with or without citrate-nAg, in the test environment. Average reproduction of daphnids increased by 185% with low-concentration citrate-nAg treatment alone but was severely compromised in the presence of predators (decreased by 91.3%). Daphnia reproduction was slightly enhanced by approximately 128% with citrate-nAg + predator treatment. Potential mechanisms of these differential effects of low-concentration citrate-nAg, with or without predators, are discussed. Because silver dissolution was minimal, the observed toxicity could not be explained by dissolved Ag alone. These findings offer novel insights into how exposure to low-concentration silver nanoparticles could influence predator-prey interactions in the fresh water systems.

  12. Insect growth regulatory effects of some extracts and sterols from Myrtillocactus geometrizans (Cactaceae) against Spodoptera frugiperda and Tenebrio molitor.

    Science.gov (United States)

    Céspedes, Carlos L; Salazar, J Rodrigo; Martínez, Mariano; Aranda, Eduardo

    2005-10-01

    A methanol extract from the roots and aerial parts of Myrtillocactus geometrizans (Cactaceae) yielded peniocerol 1, macdougallin 2, and chichipegenin 3. The natural products 1, 2 their mixtures, MeOH and CH(2)Cl(2) extracts showed insecticidal and insect growth regulatory activity against fall armyworm [Spodoptera frugiperda J. E. Smith (Lepidoptera: Noctuidae)], an important insect pest of corn, and [Tenebrio molitor (Coleoptera)], a pest of stored grains in Mexico. The most active compounds were 1, 2, and a mixture (M(2)) of 1 and 2 (6:4). All these extracts, compounds and the mixture had insect growth regulating (IGR) activity between 5.0 and 50.0 ppm and insecticidal effects between 50 and 300 ppm in diets. The extracts were insecticidal to larvae, with lethal doses between 100 and 200 ppm. These compounds appear to have selective effects on the pre-emergence metabolism of Coleoptera, because in all treatments of the larvae of T. molitor, pupation were shortened and this process show precociousness in relation to controls. In contrast to S. frugiperda larvae, onset of pupation was noticeably delayed. Emergence in both cases was drastically diminished. In both pupae and in the few adults that were able to emerge, many deformations were observed. The results of these assays indicated that the compounds were more active than other known natural insect growth inhibitors such as gedunin and methanol extracts of Cedrela salvadorensis and Yucca periculosa. Peniocerol, macdougallin and chichipegenin, as well as mixtures of these substances, may be useful as natural insecticidal agents.

  13. Melanization and pathogenicity in the insect, Tenebrio molitor, and the crustacean, Pacifastacus leniusculus, by Aeromonas hydrophila AH-3.

    Directory of Open Access Journals (Sweden)

    Chadanat Noonin

    Full Text Available Aeromonas hydrophila is the most common Aeromonas species causing infections in human and other animals such as amphibians, reptiles, fish and crustaceans. Pathogenesis of Aeromonas species have been reported to be associated with virulence factors such as lipopolysaccharides (LPS, bacterial toxins, bacterial secretion systems, flagella, and other surface molecules. Several mutant strains of A. hydrophila AH-3 were initially used to study their virulence in two animal species, Pacifastacus leniusculus (crayfish and Tenebrio molitor larvae (mealworm. The AH-3 strains used in this study have mutations in genes involving the synthesis of flagella, LPS structures, secretion systems, and some other factors, which have been reported to be involved in A. hydrophila pathogenicity. Our study shows that the LPS (O-antigen and external core is the most determinant A. hydrophila AH-3 virulence factor in both animals. Furthermore, we studied the immune responses of these hosts to infection of virulent or non-virulent strains of A. hydrophila AH-3. The AH-3 wild type (WT containing the complete LPS core is highly virulent and this bacterium strongly stimulated the prophenoloxidase activating system resulting in melanization in both crayfish and mealworm. In contrast, the ΔwaaE mutant which has LPS without O-antigen and external core was non-virulent and lost ability to stimulate this system and melanization in these two animals. The high phenoloxidase activity found in WT infected crayfish appears to result from a low expression of pacifastin, a prophenoloxidase activating enzyme inhibitor, and this gene expression was not changed in the ΔwaaE mutant infected animal and consequently phenoloxidase activity was not altered as compared to non-infected animals. Therefore we show that the virulence factors of A. hydrophila are the same regardless whether an insect or a crustacean is infected and the O-antigen and external core is essential for activation of the

  14. Nutritional Value of Pupae Versus Larvae of Tenebrio molitor (Coleoptera: Tenebrionidae) as Food for Rearing Podisus maculiventris (Heteroptera: Pentatomidae).

    Science.gov (United States)

    Morales-Ramos, Juan A; Rojas, M Guadalupe; Shelby, Kent S; Coudron, Thomas A

    2016-04-01

    Life-table analysis yielded demographic parameter values that indicate that Tenebrio molitor (L.) pupae are potentially more suitable factitious prey to mass-produce the predator Podisus maculiventris (Say) and are more suitable prey than the larvae. P. maculiventris developed faster (23.2 vs. 25.5 d), weighed more (females 80.9 vs. 66.6 mg and males 64.7 vs. 53.7 mg), and had a higher survival rate (0.88 vs. 0.7), fecundity, and reproductive output (87.1 vs. 22.8 eggs/female) when reared on pupae compared with larvae of T. molitor. The total protein content and soluble protein content were significantly higher in pupae (60.2 and 23%, respectively) than larvae (53.1 and 14.4%, respectively). Lipid content was significantly lower in pupae (32.1%) than larvae (35.9%), and larvae had more polyunsaturated fatty acids (83.6 vs. 56.6 mg/g) and less oleic (0.1 mg/g) and steric (6.1 mg/g) acids than pupae (37.3 and 12.3 mg/g, respectively). The total sugar content was not significantly different between pupae and larvae. However, larvae had significantly more fructose than pupae, but pupae had more galactose, glucosamine, glucose, mannose, and trehalose than larvae. Differences in nutritional composition and its impact on predator demographic parameters are potential factors that make the pupal stage a better food source.

  15. Self-selection of two diet components by Tenebrio molitor (Coleoptera: Tenebrionidae) larvae and its impact on fitness.

    Science.gov (United States)

    Morales-Ramos, J A; Rojas, M G; Shapiro-Ilan, D I; Tedders, W L

    2011-10-01

    We studied the ability of Tenebrio molitor L. (Coleoptera: Tenebrionidae) to self-select optimal ratios of two dietary components to approach nutritional balance and maximum fitness. Relative consumption of wheat bran and dry potato flakes was determined among larvae feeding on four different ratios of these components (10, 20, 30, and 40% potato). Groups of early instars were provided with a measured amount of food and the consumption of each diet component was measured at the end of 4 wk and again 3 wk later. Consumption of diet components by T. molitor larvae deviated significantly from expected ratios indicating nonrandom self-selection. Mean percentages of dry potato consumed were 11.98, 19.16, 19.02, and 19.27% and 11.89, 20.48, 24.67, and 25.97% during the first and second experimental periods for diets with 10, 20, 30, and 40% potato, respectively. Life table analysis was used to determine the fitness of T. molitor developing in the four diet mixtures in a no-choice experiment. The diets were compared among each other and a control diet of wheat bran only. Doubling time was significantly shorter in groups consuming 10 and 20% potato than the control and longer in groups feeding on 30 and 40% potato. The self-selected ratios of the two diet components approached 20% potato, which was the best ratio for development and second best for population growth. Our findings show dietary self-selection behavior in T. molitor larvae, and these findings may lead to new methods for optimizing dietary supplements for T. molitor.

  16. Melanization and pathogenicity in the insect, Tenebrio molitor, and the crustacean, Pacifastacus leniusculus, by Aeromonas hydrophila AH-3.

    Science.gov (United States)

    Noonin, Chadanat; Jiravanichpaisal, Pikul; Söderhäll, Irene; Merino, Susana; Tomás, Juan M; Söderhäll, Kenneth

    2010-12-29

    Aeromonas hydrophila is the most common Aeromonas species causing infections in human and other animals such as amphibians, reptiles, fish and crustaceans. Pathogenesis of Aeromonas species have been reported to be associated with virulence factors such as lipopolysaccharides (LPS), bacterial toxins, bacterial secretion systems, flagella, and other surface molecules. Several mutant strains of A. hydrophila AH-3 were initially used to study their virulence in two animal species, Pacifastacus leniusculus (crayfish) and Tenebrio molitor larvae (mealworm). The AH-3 strains used in this study have mutations in genes involving the synthesis of flagella, LPS structures, secretion systems, and some other factors, which have been reported to be involved in A. hydrophila pathogenicity. Our study shows that the LPS (O-antigen and external core) is the most determinant A. hydrophila AH-3 virulence factor in both animals. Furthermore, we studied the immune responses of these hosts to infection of virulent or non-virulent strains of A. hydrophila AH-3. The AH-3 wild type (WT) containing the complete LPS core is highly virulent and this bacterium strongly stimulated the prophenoloxidase activating system resulting in melanization in both crayfish and mealworm. In contrast, the ΔwaaE mutant which has LPS without O-antigen and external core was non-virulent and lost ability to stimulate this system and melanization in these two animals. The high phenoloxidase activity found in WT infected crayfish appears to result from a low expression of pacifastin, a prophenoloxidase activating enzyme inhibitor, and this gene expression was not changed in the ΔwaaE mutant infected animal and consequently phenoloxidase activity was not altered as compared to non-infected animals. Therefore we show that the virulence factors of A. hydrophila are the same regardless whether an insect or a crustacean is infected and the O-antigen and external core is essential for activation of the proPO system

  17. Effect of entomocidal proteins from Bacillus thuringiensis on ion permeability of apical membranes of Tenebrio molitor larvae gut epithelium.

    Science.gov (United States)

    Andreev, I M; Bulushova, N V; Zalunin, I A; Chestukhina, G G

    2009-10-01

    Effects of entomocidal Cry-type proteins, delta-endotoxins Cry3A and Cry11A produced by Bacillus thuringiensis, on ion permeability of the apical membranes of intestinal epithelium from Tenebrio molitor larvae midgut were studied. Using potential-sensitive dyes safranine O and oxonol VI and DeltapH indicator acridine orange, it was shown that placing brush border membrane vesicles (BBMV) (loaded with Mg2+ during their preparation) into a salt-free buffer medium resulted in spontaneous generation of transmembrane electric potential on the vesicular membrane (negative inside the vesicles) accompanied by acidification of the aqueous phase inside the vesicles. The generation of transmembrane ion gradients on the vesicular membrane was a result of an electrogenic efflux of Mg2+ from the vesicles as shown by abolishing of the membrane potential by such agents as MgSO4 or CaCl2 in centimolar concentrations, a highly lipophilic cation tetraphenylphosphonium, and some blockers of cell membrane Ca2+-channels in submillimolar concentrations. A passive generation of membrane potential on the vesicular membrane (but positive inside the vesicles) was also observed upon addition of centimolar concentrations of K2SO4. Addition of delta-endotoxins Cry3A and Cry11A to the vesicle suspension in a salt-free buffer medium or in the same medium supplemented with centimolar concentrations of K2SO4 exerted a pronounced hyperpolarization of the vesicular membrane. This hyperpolarization was sensitive to the same agents, which abolished the membrane potential generation in the absence of delta-endotoxin. It is concluded that Cry proteins induced in BBMV from T. molitor opening pores or ion channels, which were considerably more permeable for alkaline- and alkaline-earth metal cations than for the accompanying anions.

  18. The 3D structure and function of digestive cathepsin L-like proteinases of Tenebrio molitor larval midgut.

    Science.gov (United States)

    Beton, Daniela; Guzzo, Cristiane R; Ribeiro, Alberto F; Farah, Chuck S; Terra, Walter R

    2012-09-01

    Cathepsin L-like proteinases (CAL) are major digestive proteinases in the beetle Tenebrio molitor. Procathepsin Ls 2 (pCAL2) and 3 (pCAL3) were expressed as recombinant proteins in Escherichia coli, purified and activated under acidic conditions. Immunoblot analyses of different T. molitor larval tissues demonstrated that a polyclonal antibody to pCAL3 recognized pCAL3 and cathepsin L 3 (CAL3) only in the anterior two-thirds of midgut tissue and midgut luminal contents of T. molitor larvae. Furthermore, immunocytolocalization data indicated that pCAL3 occurs in secretory vesicles and microvilli in anterior midgut. Therefore CAL3, like cathepsin L 2 (CAL2), is a digestive enzyme secreted by T. molitor anterior midgut. CAL3 hydrolyses Z-FR-MCA and Z-RR-MCA (typical cathepsin substrates), whereas CAL2 hydrolyses only Z-FR-MCA. Active site mutants (pCAL2C25S and pCAL3C26S) were constructed by replacing the catalytic cysteine with serine to prevent autocatalytic processing. Recombinant pCAL2 and pCAL3 mutants (pCAL2C25S and pCAL3C26S) were prepared, crystallized and their 3D structures determined at 1.85 and 2.1 Å, respectively. While the overall structure of these enzymes is similar to other members of the papain superfamily, structural differences in the S2 subsite explain their substrate specificities. The data also supported models for CAL trafficking to lysosomes and to secretory vesicles to be discharged into midgut contents.

  19. [Expression optimization and characterization of Tenebrio molitor antimicrobiol peptides TmAMP1m in Escherichia coli].

    Science.gov (United States)

    Alimu, Reyihanguli; Mao, Xinfang; Liu, Zhongyuan

    2013-06-01

    To improve the expression level of tmAMP1m gene from Tenebrio molitor in Escherichia coli, we studied the effects of expression level and activity of the fusion protein HIS-TmAMP1m by conditions, such as culture temperature, inducing time and the final concentration of inductor Isopropyl beta-D-thiogalactopyranoside (IPTG). We analyzed the optimum expression conditions by Tricine-SDS-PAGE electrophoresis, meanwhile, detected its antibacterial activity by using agarose cavity diffusion method. The results suggest that when inducing the recombinant plasmid with a final IPTG concentration of 0.1 mmol/L at 37 degrees C for 4 h, there was the highest expression level of fusion protein HIS-TmAMP1m in Escherichia coli. Under these conditions, the expression of fusion protein accounted for 40% of the total cell lysate with the best antibacterial activity. We purified the fusion protein HIS-TmAMPlm with nickel-nitrilotriacetic acid (Ni-NTA) metal-affinity chromatography matrices. Western blotting analysis indicates that the His monoclonal antibody could be specifically bound to fusion protein HIS-TmAMPlm. After expression by inducing, the fusion protein could inhibit the growth of host cell transformed by pET30a-tmAMP1m. The fusion protein HIS-TmAMP1m had better stability and remained higher antibacterial activities when incubated at 100 degrees C for 10 h, repeated freeze thawing at -20 degrees C, dissolved in strong acid and alkali, or treated by organic solvents and protease. Moreover, the minimum inhibitory concentration results demonstrated that the fusion protein HIS-TmAMP1m has a good antibacterial activity against Staphylococcus aureus, Staphylococcus sp., Corynebacterium glutamicum, Bacillus thuringiensis, Corynebacterium sp. This study laid the foundation to promote the application of insect antimicrobial peptides and further research.

  20. Study on Tenebrio molitor Shell Decalcified Extraction Process by Ultrasonic Method%超声波法对黄粉虫虫壳脱钙工艺研究

    Institute of Scientific and Technical Information of China (English)

    何梦丹; 潘登奎

    2016-01-01

    Based on deproteinization, removed lipid Tenebrio molitor shell, under the condition of ultrasonic method, HCl as decalcified reagent, the paper explored Tenebrio molitor shell decalcified process conditions from HCl concentration, ultrasonic time, ultrasonic temperature. The results showed that HCl could significantly improve decalcification rate under the condition of ultrasonic method, the best decalcified conditions was HCl concentration 1.0 mol/L, ultrasonic temperature 20℃, and ultrasonic time 30 min, the decalcification rate was 91.52%.%以脱蛋白、脱油脂后的黄粉虫为原料,在超声波辅助下,以盐酸为脱钙剂,从盐酸浓度、超声时间、超声温度3个方面探究黄粉虫虫壳脱钙的工艺条件。结果表明,在超声波辅助下,HCl能显著提高脱钙速率,最佳脱钙条件为:盐酸浓度1.0 mol/L,超声温度20℃,超声时间30 min,脱钙率91.52%。

  1. Reproduction and longevity of Supputius cincticeps (Het.: Pentatomidae fed with larvae of Zophobas confusa, Tenebrio molitor (Col.: Tenebrionidae or Musca domestica (Dip.: Muscidae

    Directory of Open Access Journals (Sweden)

    José Cola Zanuncio

    2005-09-01

    Full Text Available Reproduction and longevity of Supputius cincticeps (Stål (Heteroptera: Pentatomidae fed on Zophobas confusa Gebien, Tenebrio molitor L. (Coleoptera: Tenebrionidae or Musca domestica (L. (Diptera: Muscidae larvae were studied during two generations at 24.7 ± 1.1ºC, 70 ± 10% R.H. and 12 h of photophase. Body weight of newly-emerged adults, oviposition period, number of egg masses, total number of eggs and longevity of S. cincticeps were higher when fed on Z. confusa or T. molitor larvae than on M. domestica larvae. Regardless of diet, S. cincticeps showed better reproduction and longevity in the second generation in laboratory conditions.Foram avaliadas, em duas gerações, a reprodução e a longevidade de Supputius cincticeps (Stål (Heteroptera: Pentatomidae alimentado com larvas de Zophobas confusa Gebien, Tenebrio molitor L. (Coleoptera: Tenebrionidae ou Musca domestica (L. (Diptera: Muscidae a 24,7 ± 1,1ºC, 70 ± 10% de U.R. e fotofase de 12 h. O peso de adultos recém emergidos, o período de oviposição, o número de posturas, de ovos totais e a longevidade de fêmeas de S. cincticeps foram maiores com larvas de Z. confusa ou T. molitor que com M. domestica. Independentemente do tipo de presa, S. cincticeps mostrou melhor performance reprodutiva e longevidade na segunda geração.

  2. N-terminal GNBP homology domain of Gram-negative binding protein 3 functions as a beta-1,3-glucan binding motif in Tenebrio molitor.

    Science.gov (United States)

    Lee, Hanna; Kwon, Hyun-Mi; Park, Ji-Won; Kurokawa, Kenji; Lee, Bok Luel

    2009-08-31

    The Toll signalling pathway in invertebrates is responsible for defense against Gram-positive bacteria and fungi, leading to the expression of antimicrobial peptides via NF-kappaB-like transcription factors. Gram-negative binding protein 3 (GNBP3) detects beta-1,3-glucan, a fungal cell wall component, and activates a three step serine protease cascade for activation of the Toll signalling pathway. Here, we showed that the recombinant N-terminal domain of Tenebrio molitor GNBP3 bound to beta-1,3-glucan, but did not activate down-stream serine protease cascade in vitro. Reversely, the N-terminal domain blocked GNBP3-mediated serine protease cascade activation in vitro and also inhibited beta-1,3-glucan-mediated antimicrobial peptide induction in Tenebrio molitor larvae. These results suggest that the N-terminal GNBP homology domain of GNBP3 functions as a beta-1,3-glucan binding domain and the C-terminal domain of GNBP3 may be required for the recruitment of immediate down-stream serine protease zymogen during Toll signalling pathway activation.

  3. Environmental heat stress induces epigenetic transgenerational inheritance of robustness in parthenogenetic Artemia model.

    Science.gov (United States)

    Norouzitallab, Parisa; Baruah, Kartik; Vandegehuchte, Michiel; Van Stappen, Gilbert; Catania, Francesco; Vanden Bussche, Julie; Vanhaecke, Lynn; Sorgeloos, Patrick; Bossier, Peter

    2014-08-01

    The notion that phenotypic traits emerging from environmental experiences are heritable remains under debate. However, the recent report of nonmendelian transgenerational epigenetic inheritance, i.e., the inheritance of traits not determined by the DNA sequence, might make such a phenomenon plausible. In our study, by carrying out common garden experiments, we could provide clear evidences that, on exposure to nonlethal heat shocks, a parental population of parthenogenetic (all female) Artemia (originating from one single female) experiences an increase in levels of Hsp70 production, tolerance toward lethal heat stress, and resistance against pathogenic Vibrio campbellii. Interestingly, these acquired phenotypic traits were transmitted to three successive generations, none of which were exposed to the parental stressor. This transgenerational inheritance of the acquired traits was associated with altered levels of global DNA methylation and acetylated histones H3 and H4 in the heat-shocked group compared to the control group, where both the parental and successive generations were reared at standard temperature. These results indicated that epigenetic mechanisms, such as global DNA methylation and histones H3 and H4 acetylation, have particular dynamics that are crucial in the heritability of the acquired adaptive phenotypic traits across generations.

  4. Vibrio hispanicus sp. nov., isolated from Artemia sp. and sea water in Spain.

    Science.gov (United States)

    Gomez-Gil, B; Thompson, F L; Thompson, C C; Garcia-Gasca, A; Roque, A; Swings, J

    2004-01-01

    Three Gram-negative, small, motile, rod-shaped bacteria were isolated from Artemia sp. and sea water in Barcelona, Spain, during 1990 and 1991. They were fermentative, oxidase-positive, sensitive to vibriostatic agent O/129, arginine dihydrolase-positive, lysine and ornithine decarboxylase-negative and grew in the absence of NaCl. They differed from phenotypically related species by their ability to grow at 4 degrees C and utilize L-rhamnose. Cloning of the 16S rRNA gene of the type strain produced two different 16S rRNA gene sequences, which differed by 15 bases (0.99%); comparison of these sequences with those deposited in GenBank showed close relationships with Vibrio proteolyticus (97.6% similarity), Vibrio diazotrophicus (97.9%), Vibrio campbellii (96.8%) and Vibrio alginolyticus (96.8%), among others. DNA-DNA hybridization levels with the closest phylogenetically related Vibrio species were Vibrio, for which the name Vibrio hispanicus sp. nov. is proposed, with the type strain LMG 13240T (=CAIM 525T=VIB 213T).

  5. Male-female coevolution in the wild: evidence from a time series in artemia franciscana.

    Science.gov (United States)

    Rode, Nicolas O; Charmantier, Anne; Lenormand, Thomas

    2011-10-01

    Sexual conflicts are ubiquitous in nature and are expected to lead to an antagonistic coevolution between the sexes. This coevolutionary process is driven by selection on sexually antagonistic traits that can either be directional or fluctuating. In this study, we used dormant cysts of Artemia franciscana, collected in the same population in three different years over a 23-year period (corresponding to ∼160 generations in this system), to investigate male-female coevolution in natural conditions over time. We performed a cross experiment study where reproduction of females mated to males from the past, present, or future was monitored until death. In agreement with a model of "fluctuating selection," we found that females survived better and had longer interbrood intervals when mated with their contemporary males compared to when mated with males from the future or the past. However, female weekly and lifetime reproductive successes displayed no differences between contemporary and noncontemporary matings. Finally, the coevolutionary patterns ("arms race dynamics" or "fluctuating selection dynamics") possibly acting on female relative fitness could not be discriminated. This study is the first direct demonstration that the process of male-female coevolution, previously revealed by experimental evolution in laboratory artificial conditions, can occur in nature on a short evolutionary time scale.

  6. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    Directory of Open Access Journals (Sweden)

    Sahgal Geethaa

    2013-01-01

    Full Text Available Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT] to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC 50 for the solvents were 8.5% (DMSO, 6.4% (methanol, 3.4% (ethanol and 2.5% (Tween 20. The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  7. 运城盐湖卤虫Artemia sinica饵料分析

    Institute of Scientific and Technical Information of China (English)

    刘承松; 王宏毅

    1995-01-01

    Artemia Sinica为山西运城盐湖特有种.我们于1991年5月在运城盐化局一工段涝取成虫,立即用4%的福尔马林溶液浸制.将成虫50条取其消化遭,挤出内容物,客于100毫升蒸馏水并搅匀,取其中的水溶液做成50目装片,全部在显微镜下镜检.镜检结果如下:1.50目装片中所包括的种类:原生动物3种,藻类4种和有机质碎屑.2.50目装片中有机质碎屑最多,其次为绿色杜氏藻和盐生杜氏藻.隐杆藻属和原生动物则较少.在实验室人工饲养以盐生杜氏藻作为饵料效果最佳.

  8. Evaluation of the photodynamic activity of Xanthene Dyes on Artemia salina described by chemometric approaches

    Directory of Open Access Journals (Sweden)

    Diogo S. Pellosi

    2013-10-01

    Full Text Available The development of drugs for photodynamic therapy (PDT is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i photosensitizers concentration, (ii the LED irradiation time and (iii the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 23 full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  9. Analyzing the movement of the Nauplius 'Artemia salina' by optical tracking of plasmonic nanoparticles.

    Science.gov (United States)

    Kirchner, Silke R; Fedoruk, Michael; Lohmüller, Theobald; Feldmann, Jochen

    2014-07-15

    We demonstrate how optical tweezers may provide a sensitive tool to analyze the fluidic vibrations generated by the movement of small aquatic organisms. A single gold nanoparticle held by an optical tweezer is used as a sensor to quantify the rhythmic motion of a Nauplius larva (Artemia salina) in a water sample. This is achieved by monitoring the time dependent displacement of the trapped nanoparticle as a consequence of the Nauplius activity. A Fourier analysis of the nanoparticle's position then yields a frequency spectrum that is characteristic to the motion of the observed species. This experiment demonstrates the capability of this method to measure and characterize the activity of small aquatic larvae without the requirement to observe them directly and to gain information about the position of the larvae with respect to the trapped particle. Overall, this approach could give an insight on the vitality of certain species found in an aquatic ecosystem and could expand the range of conventional methods for analyzing water samples.

  10. Comparative evaluation of short-term toxicity of inorganic arsenic compounds on Artemia salina.

    Science.gov (United States)

    GuŢu, Claudia Maria; Olaru, Octavian Tudorel; Purdel, Nicoleta Carmen; Ilie, Mihaela; NeamŢu, Marius Cristian; Dănciulescu Miulescu, Rucsandra; Avramescu, Elena Taina; Margină, Denisa Marilena

    2015-01-01

    The study aimed to assess the short-term effects exerted by two inorganic arsenic species (arsenite and arsenate) on Artemia salina after 24, 48 and 72 h. The dose-lethality curves obtained indicate that the lethality induced by arsenite was higher than by arsenate. The lowest observed effect concentration for arsenite (0.5 μg/mL) is similar with the no observed effect concentration for arsenate, thus indicating that the toxicity of arsenite is higher compared with arsenate. Also, the lethal concentration 50 values confirm that arsenite induced about 1.24-fold higher toxicity than arsenate at 24 h and about three-fold higher toxicity at 48 h and 72 h of exposure. Both LC50 (lethal concentration 50) values are indicating negligible effects exhibited by arsenic at this trophic level after short-term exposure. The predicted no effect concentration in the surface aquatic compartment corresponds to 10.38 μg/L, similar to the limit imposed by Directive 98/83/EC.

  11. Toxicity of some glucose/mannose-binding lectins to Biomphalaria glabrata and Artemia salina.

    Science.gov (United States)

    dos Santos, Aldenir Feitosa; Cavada, Benildo Sousa; da Rocha, Bruno Anderson Matias; do Nascimento, Kyria Santiago; Sant'Ana, Antônio Euzébio Goulart

    2010-01-01

    Schistosomiasis or bilharzia, which affects millions of people living in Africa, Asia and Latin America, is closely associated with certain species of aquatic snails. One way of attacking the disease is to eradicate the host snails. Molluscicidal activities of natural compounds are especially important in the widespread control of this tropical disease. As part of our search for natural compounds with molluscicidal properties for the vector control of schistosomiasis, we are now evaluating for the first time the toxicity of the plant lectins from Canavalia brasiliensis (ConBr), Cratylia floribunda (CFL), Dioclea guianensis (Dgui), Dioclea grandiflora (DGL) and Dioclea virgata (Dvir) to Biomphalaria glabrata Say and Artemia salina Leach. Results indicate that all the samples were toxic to A. salina Leach, some of them with values of lethal concentration that kills 90% of the population (LC(90))<10 microg mL(-1). They are also active against B. glabrata Say, killing 100% of adult snails, at a concentration of 50 microg mL(-1). The lectins CFL and Dgui possess properties lethal to mollusks, with values of LC(90)=50.3 microg mL(-1) and LC(90)=41.0 microg mL(-1), respectively.

  12. Chronic toxicity bioassay with populations of the crustacean Artemia salina exposed to the organophosphate diazinon.

    Science.gov (United States)

    Bustos-Obregon, Eduardo; Vargas, Alvaro

    2010-01-01

    A chronic toxicity bioassay was conducted with the microcrustacean Artemia salina as the testing organism for the toxic organophosphate diazinon in order to determine if the species is an appropriate indicator of pollution in aquatic environments. Tests of animal exposure to different concentrations of the toxicant were performed for 24, 48 and 72 hours after larvae hatching. Registered mortality data was used to obtain the lethal dose 50 (LD50) of the organophosphate for each exposure time, considering the immobilization of A. salina larvae as the mortality parameter. The lethal concentration (LD50) in the same exposure times was calculated by evaluating morphological changes on the three initial stages of larval development. Both doses were determined by using probit statistical analysis. Results indicate greater dose-response exactitude after 24 hours of exposure to the toxicant. High sensitivity of the organism to the toxicant was determined, thus indicating that A. salina is an appropriate ecotoxicological bioindicator of aquatic environments polluted with pesticides, with the special consideration that this species is a natural resident of saline water bodies, and thus could be used to control pollution in these environments as a result of the unrestrained usage of such toxic substances.

  13. Evaluation of the photodynamic activity of xanthene dyes on Artemia salina described by chemometric approaches.

    Science.gov (United States)

    Pellosi, Diogo S; Batistela, Vagner R; Souza, Vagner R de; Scarminio, Ieda S; Caetano, Wilker; Hioka, Noboru

    2013-01-01

    The development of drugs for photodynamic therapy (PDT) is an important area of research due to their growing use in medical applications. Therefore, it is important to develop new bioassay methods for PDT photosensitizers that are inexpensive, easy to handle and highly sensitive to environmental conditions. Xanthene dyes (fluorescein, rose bengal B, erythrosine B and eosin Y) with LED light sources were investigated using Artemia salina as a bioindicator of photodynamic activity. In this study, three factors were investigated: (i) photosensitizers concentration, (ii) the LED irradiation time and (iii) the waiting time between the addition of the photosensitizers and the beginning of the irradiation. To analyze the photo-killing of A. salina, it was employed a 2³ full factorial design. The death of A. salina was related to dye structure and the interaction between the irradiation time and the photosensitizers concentration. About 60% of crustaceans death was obtained using rose bengal B, which presentes the highest quantum yield of singlet oxygen due to the number of iodide substituents in the xanthenes ring. The proposed bioassay using A. salina, xanthene dyes and LED irradiation was found suitable for quantitative PDT drug evaluation.

  14. Toxicity assessment of fumonisins using the brine shrimp (Artemia salina) bioassay.

    Science.gov (United States)

    Hartl, M; Humpf, H U

    2000-12-01

    The Fusarium mycotoxins fumonisin B(1) (FB(1)) (1) and B(2) (FB(2)) (2), their hydrolysed analogues HFB(1) (3) and HFB(2) (4) and the recently discovered fumonisin derivatives N-palmitoyl-HFB(1) (5) and N-carboxymethyl-FB(1) (6) were compared for their toxicity in a short term bioassay using brine shrimp (Artemia salina). The brine shrimp were hatched in artificial sea water and exposed to the fumonisins in microwell plates with a mortality endpoint after 48 hours. LC(50) values were calculated after Probit transformation of the resulting data. Of the substances tested, fumonisin B(1) emerged to be the most toxic whereas its N-carboxymethyl analogue was 100-fold less effective. The hydrolysed fumonisins showed a four- to sixfold reduced toxicity compared to FB(1). N-Palmitoyl-HFB(1) had a higher LC(50) value than its precursor HFB(1). The brine shrimp assay proved to be a convenient and rapid system for toxicity assessment of this group of mycotoxins.

  15. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test.

    Science.gov (United States)

    Geethaa, Sahgal; Thavamany, Priscilla Jayanthi; Chiew, Siah Poh; Thong, Ong Ming

    2013-10-01

    Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO) are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT]) to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v) for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC50 for the solvents were 8.5% (DMSO), 6.4% (methanol), 3.4% (ethanol) and 2.5% (Tween 20). The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  16. Artemia salina acute immobilization test: a possible tool for aquatic ecotoxicity assessment.

    Science.gov (United States)

    Kalčíková, Gabriela; Zagorc-Končan, Jana; Zgajnar Gotvajn, Andreja

    2012-01-01

    Despite the fact that the marine crustacean Artemia salina is extensively used in ecotoxicology, there is still a lack of information about its sensitivity to commonly used chemicals. In the presented study, acute toxicity of 18 commonly used chemicals - including organic solvents, industrial chemicals, metals and inorganic compounds - to A. salina was evaluated. A. salina showed a range of sensitivities to tested chemicals. Regarding all of the investigated organics, phenolic compounds expressed the highest toxicity to A. salina. Nitrite and mercury were the most toxic inorganic substances applied in the study. On the other hand, dimethyl sulfoxide, nitrate and ammonium were the least toxic. The possibility to use A. salina for interspecies correlation was assessed by comparison of sensitivities of different organisms (bacteria, fish, crustacean) to organic compounds. Correlation between various species was observed, especially between A. salina and fish. Due to the strong relation between toxicity and the logarithm of the octanol/water partition coefficient logP(OW,) lipophilicity was found to be the main factor influencing toxicity of the chosen organic compounds. No significant correlation between toxicity to A. salina and physico-chemical parameters of metals was observed.

  17. Toxicity of organophosphates on morphology and locomotor behavior in brine shrimp, Artemia salina.

    Science.gov (United States)

    Venkateswara Rao, J; Kavitha, P; Jakka, N M; Sridhar, V; Usman, P K

    2007-08-01

    The acute toxicity and hatching success of four organophosphorus insecticides--acephate (ACEP), chlorpyrifos (CPP), monocrotophos (MCP), and profenofos (PF)--was studied in a short-term bioassay using brine shrimp, Artemia salina. Fifty percent hatchability inhibition concentration and median lethal concentration (LC(50)) values were calculated after probit transformation of the resulting data. Among the insecticides tested, CPP is found to be the most toxic and also to inhibit hatching success of A. salina cysts in a concentration-dependent manner. In addition, the effect of these pesticides on locomotor behavior (swimming speed) and morphologic differences were studied in LC(50)-exposed nauplii after 24 hours. The in vivo effect of these insecticides on acetylcholinesterase (Enzyme commission number (EC 3.1.1.7) activity was also determined in LC(50)-exposed nauplii after 24 hours. Maximum percent decrease in their swimming speed and significant morphologic alterations were noticed in CPP-exposed brine shrimps. The order of toxicity was CPP > PF > MCP > ACEP in all the parameters studied.

  18. Toxicity of four antifouling biocides and their mixtures on the brine shrimp Artemia salina.

    Science.gov (United States)

    Koutsaftis, A; Aoyama, I

    2007-11-15

    Zinc pyrithione (ZPT), Copper pyrihione (CPT), Chlorothalonil and Diuron are four of the most widely used as alternative to tributlytin (TBT) antifouling biocides in boat paints. As most previous laboratory bioassays for these biocides have been conducted solely based on acute tests with a single compound, information on the possible combined toxicity of these common biocides to marine organisms are limited. In this study, the toxicity of binary (in several proportions), ternary and quaternary mixtures were evaluated using the brine shrimp Artemia salina as test organism. Mixture toxicities were studied using the concentration addition model (isobolograms and toxic unit summation), and the mixture toxicity index (MTI). The ZPT-CPT combination had a strictly synergistic effect which requires attention because the coexistence of ZPT and CPT in the marine environment, due to transchelation of ZPT, may occur. The binary mixtures of Diuron with the metal pyrithiones exhibited various interactive effects (synergistic, antagonistic or additive) depending on concentration ratios, whereas all binary mixtures that contained Chlorothalonil exhibited antagonistic effects. The different types of combined effects subsequent to proportion variation of binary mixtures underline the importance of the combined toxicity characterization for various ratios of concentrations. The four ternary mixtures tested, also exhibited various interactive effects, and the quaternary mixture exhibited synergism. The models applied were in agreement in most cases. The observed synergistic interactions underline the requirement to review water quality guidelines, which are likely underestimating the adverse combined effects of these chemicals.

  19. Impacts of harvesting on brine shrimp (Artemia franciscana) in Great Salt Lake, Utah, USA.

    Science.gov (United States)

    Sura, Shayna A; Belovsky, Gary E

    2016-03-01

    Selective harvesting can cause evolutionary responses in populations via shifts in phenotypic characteristics, especially those affecting life history. Brine shrimp (Artemia franciscana) cysts in Great Salt Lake (GSL), Utah, USA are commercially harvested with techniques that select against floating cysts. This selective pressure could cause evolutionary changes over time. Our objectives are to (1) determine if there is a genetic basis to cyst buoyancy, (2) determine if cyst buoyancy and nauplii mortality have changed over time, and (3) to examine GSL environmental conditions over time to distinguish whether selective harvesting pressure or a trend in environmental conditions caused changes in cyst buoyancy and nauplii mortality. Mating crosses between floating and sinking parental phenotypes with two food concentrations (low and high) indicated there is a genetic basis to cyst buoyancy. Using cysts harvested from 1991-2011, we found cyst buoyancy decreased and nauplii mortality increased over time. Data on water temperature, salinity, and chlorophyll a concentration in GSL from 1994 to 2011 indicated that although water temperature has increased over time and chlorophyll a concentration has decreased over time, the selective harvesting pressure against floating cysts is a better predictor of changes in cyst buoyancy and nauplii mortality over time than trends in environmental conditions. Harvesting of GSL A. franciscana cysts is causing evolutionary changes, which has implications for the sustainable management and harvesting of these cysts. Monitoring phenotypic characteristics and life-history traits of the population should be implemented and appropriate responses taken to reduce the impacts of the selective harvesting.

  20. Tolerance to cadmium and cadmium-binding ligands in Great Salt Lake brine shrimp (Artemia salina)

    Energy Technology Data Exchange (ETDEWEB)

    Jayasekara, S.; Drown, D.B.; Sharma, R.P.

    1986-02-01

    Information on the accumulation of cadmium in cytosolic proteins of Great Lake brine shrimp (Artemia salina) was obtained from animals collected directly from the lake and also from animal hatched and maintained in three sublethal concentrations of cadmium (0.5, 2.0, 5.0 ppm) in saltwater aquaria. Brine shrimp growth under these conditions was monitored by measuring body lengths during a 7-day exposure period. Heat-stable, cadmium-binding ligands were isolated and identified by Sephadex G-75 chromatography and atomic absorption spectrophotometry. Cadmium was found to be equally distributed between high and low molecular weight proteins in animals collected from the lake and the 0.5 ppm cadmium group. There was also a slight growth stimulation noted in the 0.5-pm group. Higher cadmium incorporation was noted in low molecular weight fractions with increasing cadmium concentration in the exposure media. Low molecular weight fractions were also found to have high uv absorption characteristics at 250 nm and low absorption at 280 nm. Molecular weight of the cadmium-binding ligands was found to be 11,000 as estimated by the gel filtration method. De novo synthesis of this protein was increased as a function of cadmium concentration in the media. However, slow accumulation of cadmium in other protein fractions was also noticed in higher cadmium exposure groups, suggesting the existence of possible tolerance mechanisms in brine shrimp exposed to suspected acute cadmium concentrations.