WorldWideScience

Sample records for arp5 angptl6 bmi-1

  1. Micro-RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation.

    Science.gov (United States)

    Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J

    2010-07-01

    High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.

  2. Rare Coding Variants in ANGPTL6 Are Associated with Familial Forms of Intracranial Aneurysm.

    Science.gov (United States)

    Bourcier, Romain; Le Scouarnec, Solena; Bonnaud, Stéphanie; Karakachoff, Matilde; Bourcereau, Emmanuelle; Heurtebise-Chrétien, Sandrine; Menguy, Céline; Dina, Christian; Simonet, Floriane; Moles, Alexis; Lenoble, Cédric; Lindenbaum, Pierre; Chatel, Stéphanie; Isidor, Bertrand; Génin, Emmanuelle; Deleuze, Jean-François; Schott, Jean-Jacques; Le Marec, Hervé; Loirand, Gervaise; Desal, Hubert; Redon, Richard

    2018-01-04

    Intracranial aneurysms (IAs) are acquired cerebrovascular abnormalities characterized by localized dilation and wall thinning in intracranial arteries, possibly leading to subarachnoid hemorrhage and severe outcome in case of rupture. Here, we identified one rare nonsense variant (c.1378A>T) in the last exon of ANGPTL6 (Angiopoietin-Like 6)-which encodes a circulating pro-angiogenic factor mainly secreted from the liver-shared by the four tested affected members of a large pedigree with multiple IA-affected case subjects. We showed a 50% reduction of ANGPTL6 serum concentration in individuals heterozygous for the c.1378A>T allele (p.Lys460Ter) compared to relatives homozygous for the normal allele, probably due to the non-secretion of the truncated protein produced by the c.1378A>T transcripts. Sequencing ANGPTL6 in a series of 94 additional index case subjects with familial IA identified three other rare coding variants in five case subjects. Overall, we detected a significant enrichment (p = 0.023) in rare coding variants within this gene among the 95 index case subjects with familial IA, compared to a reference population of 404 individuals with French ancestry. Among the 6 recruited families, 12 out of 13 (92%) individuals carrying IA also carry such variants in ANGPTL6, versus 15 out of 41 (37%) unaffected ones. We observed a higher rate of individuals with a history of high blood pressure among affected versus healthy individuals carrying ANGPTL6 variants, suggesting that ANGPTL6 could trigger cerebrovascular lesions when combined with other risk factors such as hypertension. Altogether, our results indicate that rare coding variants in ANGPTL6 are causally related to familial forms of IA. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  3. The Role of BMI1 in CRPC

    Science.gov (United States)

    2017-10-01

    that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA

  4. Assembly of the Arp5 (Actin-related Protein) Subunit Involved in Distinct INO80 Chromatin Remodeling Activities*

    Science.gov (United States)

    Yao, Wei; Beckwith, Sean L.; Zheng, Tina; Young, Thomas; Dinh, Van T.; Ranjan, Anand; Morrison, Ashby J.

    2015-01-01

    ATP-dependent chromatin remodeling, which repositions and restructures nucleosomes, is essential to all DNA-templated processes. The INO80 chromatin remodeling complex is an evolutionarily conserved complex involved in diverse cellular processes, including transcription, DNA repair, and replication. The functional diversity of the INO80 complex can, in part, be attributed to specialized activities of distinct subunits that compose the complex. Furthermore, structural analyses have identified biochemically discrete subunit modules that assemble along the Ino80 ATPase scaffold. Of particular interest is the Saccharomyces cerevisiae Arp5-Ies6 module located proximal to the Ino80 ATPase and the Rvb1-Rvb2 helicase module needed for INO80-mediated in vitro activity. In this study we demonstrate that the previously uncharacterized Ies2 subunit is required for Arp5-Ies6 association with the catalytic components of the INO80 complex. In addition, Arp5-Ies6 module assembly with the INO80 complex is dependent on distinct conserved domains within Arp5, Ies6, and Ino80, including the spacer region within the Ino80 ATPase domain. Arp5-Ies6 interacts with chromatin via assembly with the INO80 complex, as IES2 and INO80 deletion results in loss of Arp5-Ies6 chromatin association. Interestingly, ectopic addition of the wild-type Arp5-Ies6 module stimulates INO80-mediated ATP hydrolysis and nucleosome sliding in vitro. However, the addition of mutant Arp5 lacking unique insertion domains facilitates ATP hydrolysis in the absence of nucleosome sliding. Collectively, these results define the requirements of Arp5-Ies6 assembly, which are needed to couple ATP hydrolysis to productive nucleosome movement. PMID:26306040

  5. The Role of BMI1 in CRPC

    Science.gov (United States)

    2016-10-01

    we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

  6. Analysis list: BMI1 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

  7. BMI-1, a promising therapeutic target for human cancer

    Science.gov (United States)

    WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN

    2015-01-01

    BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537

  8. Bmi-1: At the crossroads of physiological and pathological biology

    Science.gov (United States)

    Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

    2015-01-01

    Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

  9. BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

    Science.gov (United States)

    Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

    2006-01-01

    Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

  10. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  11. Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

    Science.gov (United States)

    Liu, Jiaguo; Luo, Bin; Zhao, Meng

    2017-01-01

    Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

  12. The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

    Science.gov (United States)

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

    2016-01-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

  13. BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

    Science.gov (United States)

    Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

    2010-02-21

    The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

  14. File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

  15. File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

  16. File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

  17. File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

  18. File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

  19. File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

  20. File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

  1. File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

  2. File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

  3. File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

  4. File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

  5. Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

    NARCIS (Netherlands)

    Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

    2008-01-01

    Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

  6. Expression of Bmi-1 is a prognostic marker in bladder cancer

    Directory of Open Access Journals (Sweden)

    Xu Li-Hua

    2009-02-01

    Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

  7. Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

    Directory of Open Access Journals (Sweden)

    Xiaodong Li

    2016-11-01

    Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

  8. Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

    2010-01-01

    Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

  9. Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

    Directory of Open Access Journals (Sweden)

    Lowell Evan Michael

    2008-12-01

    Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

  10. Expression of Bmi-1 is a prognostic marker in bladder cancer

    International Nuclear Information System (INIS)

    Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

    2009-01-01

    The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

  11. Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

    Science.gov (United States)

    Lu, You-Wei; Li, Jin; Guo, Wei-Jian

    2010-11-08

    The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

  12. BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

    Science.gov (United States)

    Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

    2017-12-01

    Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

  13. GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

    Directory of Open Access Journals (Sweden)

    Bart A Westerman

    Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

  14. Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

  15. Bmi-1 expression modulates non-small cell lung cancer progression

    Science.gov (United States)

    Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

    2015-01-01

    Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

  16. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  17. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Directory of Open Access Journals (Sweden)

    Mehdi Hayat Shahi

    Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  18. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Science.gov (United States)

    Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

    2015-01-01

    BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  19. Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.

    Directory of Open Access Journals (Sweden)

    Shunsuke Nakamura

    Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.

  20. Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma

    Directory of Open Access Journals (Sweden)

    Sara Badodi

    2017-12-01

    Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin

  1. The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

    Science.gov (United States)

    Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

    2018-02-01

    Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

  2. p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

    Science.gov (United States)

    Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

    2015-01-01

    Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

  3. Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

    Directory of Open Access Journals (Sweden)

    Anthony Flamier

    2018-05-01

    Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

  4. Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

    Science.gov (United States)

    Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

    2017-04-01

    We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  5. Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance

    Science.gov (United States)

    Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun

    2014-01-01

    To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841

  6. Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.

    Science.gov (United States)

    Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio

    2015-10-26

    The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in

  7. Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

    Science.gov (United States)

    Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

    2017-09-01

    The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

  8. Reciprocal expression of Bmi1 and Mel-18 is associated with functioning of primitive hematopoietic cells.

    Science.gov (United States)

    Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao

    2009-07-01

    The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.

  9. Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1

    International Nuclear Information System (INIS)

    Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon

    2008-01-01

    Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1

  10. CD133 and BMI1 expressions and its prognostic role in primary ...

    Indian Academy of Sciences (India)

    This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.

  11. EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

    NARCIS (Netherlands)

    Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

    2008-01-01

    Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

  12. Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

    Science.gov (United States)

    Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

    2016-01-01

    Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

  13. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    International Nuclear Information System (INIS)

    Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

    2012-01-01

    The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

  14. miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

    2015-01-02

    Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

  15. Fuel shipment experience, fuel movements from the BMI-1 transport cask

    International Nuclear Information System (INIS)

    Bauer, Thomas L.; Krause, Michael G.

    1986-01-01

    The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask

  16. Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

    Science.gov (United States)

    Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

    2014-01-01

    Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

  17. Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.

    Science.gov (United States)

    López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís

    2015-01-01

    Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.

  18. Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

    Science.gov (United States)

    2011-01-01

    Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

  19. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

    Science.gov (United States)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-22

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

    Directory of Open Access Journals (Sweden)

    Hourinaz Behesti

    2013-01-01

    BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

  1. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

    International Nuclear Information System (INIS)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-01

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

  2. BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

    2018-02-01

    B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

  3. MK3 modulation affects BMI1-dependent and independent cell cycle check-points.

    Directory of Open Access Journals (Sweden)

    Peggy Prickaerts

    Full Text Available Although the MK3 gene was originally found deleted in some cancers, it is highly expressed in others. The relevance of MK3 for oncogenesis is currently not clear. We recently reported that MK3 controls ERK activity via a negative feedback mechanism. This prompted us to investigate a potential role for MK3 in cell proliferation. We here show that overexpression of MK3 induces a proliferative arrest in normal diploid human fibroblasts, characterized by enhanced expression of replication stress- and senescence-associated markers. Surprisingly, MK3 depletion evokes similar senescence characteristics in the fibroblast model. We previously identified MK3 as a binding partner of Polycomb Repressive Complex 1 (PRC1 proteins. In the current study we show that MK3 overexpression results in reduced cellular EZH2 levels and concomitant loss of epigenetic H3K27me3-marking and PRC1/chromatin-occupation at the CDKN2A/INK4A locus. In agreement with this, the PRC1 oncoprotein BMI1, but not the PCR2 protein EZH2, bypasses MK3-induced senescence in fibroblasts and suppresses P16INK4A expression. In contrast, BMI1 does not rescue the MK3 loss-of-function phenotype, suggesting the involvement of multiple different checkpoints in gain and loss of MK3 function. Notably, MK3 ablation enhances proliferation in two different cancer cells. Finally, the fibroblast model was used to evaluate the effect of potential tumorigenic MK3 driver-mutations on cell proliferation and M/SAPK signaling imbalance. Taken together, our findings support a role for MK3 in control of proliferation and replicative life-span, in part through concerted action with BMI1, and suggest that the effect of MK3 modulation or mutation on M/SAPK signaling and, ultimately, proliferation, is cell context-dependent.

  4. Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    Carolina Nör

    2014-02-01

    Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs

  5. Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

    Science.gov (United States)

    Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

    2017-10-06

    We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

  6. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  7. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    Directory of Open Access Journals (Sweden)

    Jiang Lili

    2012-09-01

    Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

  8. BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

    Science.gov (United States)

    Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

    2016-01-01

    Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

  9. Anti-aging Effect of Transplanted Amniotic Membrane Mesenchymal Stem Cells in a Premature Aging Model of Bmi-1 Deficiency

    Science.gov (United States)

    Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun

    2015-01-01

    To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922

  10. Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance

    International Nuclear Information System (INIS)

    Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia

    2012-01-01

    Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the

  11. MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

    Science.gov (United States)

    Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

    2018-03-01

    Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

  12. Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

    Directory of Open Access Journals (Sweden)

    Mohamed Abdouh

    Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

  13. BMI-1 Mediates Estrogen-Deficiency-Induced Bone Loss by Inhibiting Reactive Oxygen Species Accumulation and T Cell Activation.

    Science.gov (United States)

    Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun

    2017-05-01

    Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and

  14. Association of ATM and BMI-1 genetic variation with breast cancer risk in Han Chinese.

    Science.gov (United States)

    Yue, Li-Ling; Wang, Fu-Chao; Zhang, Ming-Long; Liu, Dan; Chen, Ping; Mei, Qing-Bu; Li, Peng-Hui; Pan, Hong-Ming; Zheng, Li-Hong

    2018-04-24

    We tested the hypothesis that genetic variation in ATM and BMI-1 genes can alter the risk of breast cancer through genotyping 6 variants among 524 breast cancer cases and 518 cancer-free controls of Han nationality. This was an observational, hospital-based, case-control association study. Analyses of single variant, linkage, haplotype, interaction and nomogram were performed. Risk was expressed as odds ratio (OR) and 95% confidence interval (CI). All studied variants were in the Hardy-Weinberg equilibrium and were not linked. The mutant allele frequencies of rs1890637, rs3092856 and rs1801516 in ATM gene were significantly higher in cases than in controls (P = .005, ATM gene were significantly associated with 1.98-fold and 6.04-fold increased risk of breast cancer (95% CI: 1.36-2.90 and 1.65-22.08, respectively). Nomogram analysis estimated that the cumulative proportion of 3 significant variants in ATM gene was about 12.5%. Our findings collectively indicated that ATM gene was a candidate gene in susceptibility to breast cancer in Han Chinese. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  15. [Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

    Science.gov (United States)

    Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

    2014-06-01

    To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

  16. Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

    2014-01-01

    Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

  17. MiR-495 Promotes Senescence of Mesenchymal Stem Cells by Targeting Bmi-1

    Directory of Open Access Journals (Sweden)

    Xiujun Li

    2017-06-01

    Full Text Available Background/Aims: Mesenchymal stem cells (MSCs play an important role in regulating angiogenesis and immune balance. Abnormal proliferation and function of MSCs were reported at maternal fetal interface in patients with pre-eclampsia (PE. Micro-RNA-495 was known to be upregulated in the MSCs derived from patients with PE. However, it is not clear whether the up-regulated miR-495 is related to the pathogenesis of PE. Methods: We analyzed the expression of miR-495 in MSCs and umbilical cords derived from healthy pregnancies (NC and PE, then we upregulated or downregulated the expression of miR-495 in MSCs derived from NC and tested the proliferation, apoptosis, migration, invasion, tube formation and senescence. Results: In the current study, we found that the expression of miR-495 was significantly increased in both umbilical cord tissues and MSCs in patients with severe PE. Overexpressing miR-495 arrested cell cycle in S phase and promoted cell apoptosis. The supernatants from miR-495-overexpressed-MSCs inhibited the migration of MSCs and HTR-8/SVneo, invasion of HTR-8/SVneo and tube formation of HUVEC, while si-miR-495 had the opposite effects. Furthermore, we analyzed the senescence related β-galactosidase activity and CD146 and found that miR-495 induced the senescence of MSCs. Molecular mechanism studies confirmed that Bmi-1 mediated these effects of miR-495 on MSCs. Conclusion: Taken together, our data demonstrated that miR-495 induced senescence of MSCs may be involved in the pathogenesis of PE.

  18. [PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

    Science.gov (United States)

    Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

    2016-01-01

    Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

  19. Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

    Science.gov (United States)

    Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

    2010-12-16

    Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

  20. Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

    NARCIS (Netherlands)

    Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

    2005-01-01

    The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

  1. Co-Expression of Bmi-1 and Podoplanin Predicts Overall Survival in Patients With Squamous Cell Carcinoma of the Head and Neck Treated With Radio(chemo)therapy

    International Nuclear Information System (INIS)

    Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.

    2009-01-01

    Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy

  2. [In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

    Science.gov (United States)

    Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

    2018-03-28

    To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

  3. p38 MAPK-Mediated Bmi-1 Down-Regulation and Defective Proliferation in ATM-Deficient Neural Stem Cells Can Be Restored by Akt Activation

    Science.gov (United States)

    Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.

    2011-01-01

    A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053

  4. Dysregulation of the Bmi-1/p16Ink4a pathway provokes an aging-associated decline of submandibular gland function

    Science.gov (United States)

    Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo

    2015-01-01

    Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744

  5. Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

    Directory of Open Access Journals (Sweden)

    Katarzyna Taran

    2016-02-01

    Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

  6. MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells.

    Science.gov (United States)

    Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee

    2017-12-15

    The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.

  7. Recombinant TAT-BMI-1 fusion protein induces ex vivo expansion of human umbilical cord blood-derived hematopoietic stem cells.

    Science.gov (United States)

    Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni

    2017-07-04

    Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.

  8. The oncoprotein and stem cell renewal factor BMI1 associates with poor clinical outcome in oesophageal cancer patients undergoing preoperative chemoradiotherapy

    Directory of Open Access Journals (Sweden)

    Yoshikawa Reigetsu

    2012-10-01

    Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.

  9. c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.

    Science.gov (United States)

    Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B

    2012-04-01

    Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.

  10. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    Energy Technology Data Exchange (ETDEWEB)

    Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

  11. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    International Nuclear Information System (INIS)

    Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

    2012-01-01

    Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

  12. Acute myeloid leukemia stem cell markers in prognosis and targeted therapy: potential impact of BMI-1, TIM-3 and CLL-1.

    Science.gov (United States)

    Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A

    2016-09-06

    Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.

  13. Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

    Directory of Open Access Journals (Sweden)

    Justin W Leung

    2014-03-01

    Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

  14. MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

    Science.gov (United States)

    Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

    2015-01-01

    Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

  15. MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence.

    Directory of Open Access Journals (Sweden)

    Sujatha Venkataraman

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.

  16. Polycomb complex protein BMI-1 promotes invasion and metastasis of pancreatic cancer stem cells by activating PI3K/AKT signaling, an ex vivo, in vitro, and in vivo study

    Science.gov (United States)

    Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li

    2016-01-01

    Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020

  17. MicroRNA-330-3p Expression Indicates Good Prognosis and Suppresses Cell Proliferation by Targeting Bmi-1 in Osteosarcoma

    Directory of Open Access Journals (Sweden)

    Zhenxin Zheng

    2018-03-01

    Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.

  18. Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT.

    Science.gov (United States)

    Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru

    2007-02-01

    Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.

  19. Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

    Science.gov (United States)

    Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

    2018-02-01

    Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

  20. Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

    Science.gov (United States)

    Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

    2017-12-01

    This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

  1. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  2. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  3. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

    2016-08-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  4. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

    2016-01-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  5. Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch

    DEFF Research Database (Denmark)

    López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca

    2015-01-01

    Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. T...

  6. BMI1 and H-RAS Cooperate to Drive Breast Cancer Metastasis | Center for Cancer Research

    Science.gov (United States)

    There have been significant improvements in the diagnosis of breast cancer at early stages of the disease. However, even when patients are identified early, there is a 30 percent chance of recurrence after apparently successful treatment of the initial tumor. The major cause of death for breast cancer patients is metastasis of the tumor to other organs but, unfortunately, the mechanisms of metastatic progression and cancer recurrence are poorly understood.

  7. The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2013-07-01

    J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33

  8. Therapeutic Roles of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

    Science.gov (United States)

    2013-10-01

    ORGANIZATION NAME(S) AND ADDRESS(ES) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER New Jersey, University of Medicine and Dentistry ...classified according to postoperative Gleason score or clinical stage (TNM system ). Histological categories divided tumors with Gleason scores...On the basis of rapid adhesion on collagen, PCa cells were plated on a collagen-I dish for 5 min (5’=rapidly adherent) (3-5% of cells) were

  9. Expression and Clinicopathological Significance of Mel-18 and Bmi-1 in Esophageal Squamous Cell Carcinoma.

    Science.gov (United States)

    Ji, Huaijun; Cao, Ming; Ren, Kunlun; Sun, Ningbo; Wang, Wei; Zhu, Qiang; Zang, Qi; Jiang, Zhongmin

    2017-01-01

    The Polycomb group genes are a general class of regulators that are responsible for maintaining homeotic gene expression throughout cell division. Polycomb group expression plays an important role in oncogenesis of several types of human cancer. Melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 are key Polycomb group proteins. Studies have shown that melanoma nuclear protein 18 is a potential tumor suppression, and B-cell-specific Moloney leukemia virus insert site 1 is overexpressed in several human malignancies. However, the roles of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in esophageal squamous cell carcinoma are still unclear. In this study, we analyzed the expression levels of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in 89 esophageal cancer tissues and paired normal mucosal tissues using immunohistochemistry, Western blotting, and quantitative real-time polymerase chain reaction analyses. We found that the expression of melanoma nuclear protein 18 in the carcinoma tissues was significantly lower than that in the noncancerous mucosal tissues ( P .05). B-cell-specific Moloney leukemia virus insert site 1 expression was strongly correlated with the degree of differentiation, clinical stage, and lymph node metastasis ( P .05). Moreover, there was a negative correlation between melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 expressions in esophageal squamous cell carcinoma ( P < .05). Our study suggests that melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 may play a crucial role in esophageal squamous cell carcinoma. Melanoma nuclear protein 18 or B-cell-specific Moloney leukemia virus insert site 1 may be a potential biomarker for diagnosis and prognosis of esophageal squamous cell carcinoma.

  10. Targeted BMI1 inhibition impairs tumor growth in lung adenocarcinomas with low CEBP alpha expression

    Czech Academy of Sciences Publication Activity Database

    Yong, K.J.; Basseres, D.S.; Welner, R.S.; Zhang, W.C.; Yang, H.; Yan, B.; Alberich-Jorda, Meritxell; Zhang, J.; de Figueiredo-Pontes, L.L.; Battelli, C.; Hetherington, C.J.; Ye, M.; Zhang, H.; Maroni, G.; O'Brien, K.; Magli, M.C.; Borczuk, A.C.; Varticovski, L.; Kocher, O.; Zhang, P.; Moon, Y.C.; Sydorenko, N.; Cao, L.; Davis, T.W.; Thakkar, B.M.; Soo, R.A.; Iwama, A.; Lim, B.; Halmos, B.; Neuberg, D.; Tenen, D.G.; Levantini, E.

    2016-01-01

    Roč. 8, č. 350 (2016), č. článku 350ra104. ISSN 1946-6234 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : ccaat/enhancer-binding-protein * acute myeloid-leukemia * factor-c/ebp-alpha * posttranscriptional control * adjuvant chemotherapy * cell-proliferation * down-regulation * drug discovery * gene signature * self-renewal Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 16.796, year: 2016

  11. The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2011-09-01

    new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007

  12. Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

    Science.gov (United States)

    2013-10-01

    methotrexate were from the Cancer Institute of New Jersey pharmacy . Both collagen I, IV and laminin were purchased from BD Biosciences, and athymicnu/nu mice...forming cells from human prostate [31]. We elected to use a strategy of combin- ing phenotypic and time-of-adherence assays to iso - late TICs from PCa

  13. Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

    Science.gov (United States)

    2015-10-01

    cellularity of the bone marrow of the treated and control mice. The smears demonstrated the presence of heterogeneous cell types including the larger...were supplemented with IL-3, rhTPO (Kirin brewery ), and FLT3-L (Peprotech) cytokines. Cells were suspended at 3 x 103 concentration in one ml of...flushed with a 23G (0.45 × 10 mm) syringe needle to collect single- cell suspensions. Bone marrow sections and blood May-Grünwald-Giemsa–stained

  14. Expression and associations of TRAF1, BMI-1, ALDH1, and Lin28B in oral squamous cell carcinoma.

    Science.gov (United States)

    Wu, Tian-Fu; Li, Yi-Cun; Ma, Si-Rui; Bing-Liu; Zhang, Wen-Feng; Sun, Zhi-Jun

    2017-04-01

    Tumor necrosis factor receptor-associated factor 1, an adaptor protein of tumor necrosis factor 2, is involved in classical nuclear factor (NF)-κB activation and lymphocyte recruitment. However, less is known about the expression and association of tumor necrosis factor receptor-associated factor 1 with cancer stem cell markers in oral squamous cell carcinoma. This study aimed to investigate the expression of tumor necrosis factor receptor-associated factor 1 and stem cell characteristic markers (lin28 homolog B, B cell-specific Moloney murine leukemia virus integration site 1, and aldehyde dehydrogenase 1) in oral squamous cell carcinoma and analyze their relations. Paraffin-embedded tissues of 78 oral squamous cell carcinomas, 39 normal oral mucosa, and 12 oral dysplasia tissues were employed in tissue microarrays, and the expression of tumor necrosis factor receptor-associated factor 1, B cell-specific Moloney murine leukemia virus integration site 1, aldehyde dehydrogenase 1, and lin28 homolog B was measured by immunohistostaining and digital pathological analysis. The expression of tumor necrosis factor receptor-associated factor 1 was higher in the oral squamous cell carcinoma group as compared with the expression in the oral mucosa (p oral dysplasia (p oral squamous cell carcinoma. The patient survival rate was lower in the highly expressed tumor necrosis factor receptor-associated factor 1 group, although the difference was not significant. The clustering analysis showed that tumor necrosis factor receptor-associated factor 1 was most related to aldehyde dehydrogenase 1. These findings suggest that tumor necrosis factor receptor-associated factor 1 has potential direct/indirect regulations with the cancer stem cell markers in oral squamous cell carcinoma, which may help in further analysis of the cancer stem cell characteristics.

  15. Angiopoietin-like protein 6 in patients with obesity, type 2 diabetes mellitus, and anorexia nervosa: The influence of very low-calorie diet, bariatric surgery, and partial realimentation.

    Science.gov (United States)

    Cinkajzlova, Anna; Lacinova, Zdenka; Klouckova, Jana; Kavalkova, Petra; Trachta, Pavel; Kosak, Mikulas; Haluzikova, Denisa; Papezova, Hana; Mraz, Milos; Haluzík, Martin

    2017-02-01

    Angiopoietin-like protein 6 (ANGPTL6) is a circulating protein with a potential role in energy homeostasis. The aim of the study was to explore the changes in ANGPTL6 levels in patients with obesity (Body mass index, BMI > 40 kg/m 2 ) with and without type 2 diabetes mellitus (T2DM) undergoing dietary intervention (very low calorie diet - VLCD) and in a subgroup of T2DM patients after bariatric surgery. Additionally, we examined changes in ANGPTL6 in anorexia nervosa (AN) patients at baseline and after partial realimentation. We also explored the changes in ANGPTL6 mRNA expression in subcutaneous adipose tissue (SAT) of obese subjects. The study included 23 non-diabetic obese patients, 40 obese patients with T2DM (27 underwent VLCD and 13 underwent bariatric surgery), 22 patients with AN, and 37 healthy control subjects. ANGPTL6 levels of AN patients were increased relative to the control group (68.6 ± 9.9 ng/ml) and decreased from 110.2 ± 13.3 to 73.6 ± 7.1 ng/ml (p = 0.004) after partial realimentation. Baseline ANGPTL6 levels in patients with obesity and T2DM did not differ from the control group. VLCD decreased ANGPTL6 levels only in obese patients with T2DM. Bariatric surgery induced a transient elevation of ANGPTL6 levels with a subsequent decrease to baseline levels. ANGPTL6 mRNA expression transiently increased after bariatric surgery and returned to baseline levels after 12 months. Collectively, our data suggest that serum ANGPTL6 levels and ANGPTL6 mRNA expression in SAT are affected by metabolic disorders and their treatment but do not appear to directly reflect nutritional status.

  16. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

    OpenAIRE

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2...

  17. Evaluation of cardiac risk marker levels in obese and non-obese patients with polycystic ovaries.

    Science.gov (United States)

    Elci, Erkan; Kaya, Cihan; Cim, Numan; Yildizhan, Recep; Elci, Gulhan Gunes

    2017-01-01

    To compare cardiac risk markers such as asymmetric dimethyl arginine (ADMA), C-reactive protein (CRP), homocystein (Hcy), plasminogen activator inhibitor-1 (PAI-1), vascular endothelial growth factor (VEGF), angiopoietin-related growth factor 6 (ANGPTL6) in obese and non-obese patients with polycystic ovary syndrome (PCOS). Thirty obese (BMI >30 kg/m 2 ) and 30 non-obese (BMI < 30 kg/m 2 ) patients diagnosed with PCOS and 30 age-matched healthy controls were included in the study. The ages of subjects were varying between 18 and 30 years. Serum ADMA, CRP, Hcy, PAI-1, VEGF and ANGPTL6 levels were analyzed for each subject. Serum ADMA, CRP, Hcy, PAI-1, VEGF and ANGPTL6 levels were significantly elevated in obese and non-obese women with PCOS in comparison to control subjects (p < 0.05). This elevation was more obvious in the obese PCOS group than in the other group. Cardiovascular risk markers such as ADMA, CRP, Hcy, PAI-1, VEGF and ANGPTL6 levels are elevated in women with PCOS.

  18. Transient and Prolonged Response of Chicken Cecum Mucosa to Colonization with Different Gut Microbiota

    Science.gov (United States)

    Volf, Jiri; Polansky, Ondrej; Varmuzova, Karolina; Gerzova, Lenka; Sekelova, Zuzana; Faldynova, Marcela; Babak, Vladimir; Medvecky, Matej; Smith, Adrian L.; Kaspers, Bernd; Velge, Philippe; Rychlik, Ivan

    2016-01-01

    In this study we determined protein and gene expression in the caeca of newly hatched chickens inoculated with cecal contents sourced from hens of different ages. Over 250 proteins exhibited modified expression levels in response to microbiota inoculation. The most significant inductions were observed for ISG12-2, OASL, ES1, LYG2, DMBT1-L, CDD, ANGPTL6, B2M, CUZD1, IgM and Ig lambda chain. Of these, ISG12-2, ES1 and both immunoglobulins were expressed at lower levels in germ-free chickens compared to conventional chickens. In contrast, CELA2A, BRT-2, ALDH1A1, ADH1C, AKR1B1L, HEXB, ALDH2, ALDOB, CALB1 and TTR were expressed at lower levels following inoculation of microbiota. When chicks were given microbiota preparations from different age donors, the recipients mounted differential responses to the inoculation which also differed from the response profile in naturally colonised birds. For example, B2M, CUZD1 and CELA2A responded differently to the inoculation with microbiota of 4- or 40-week-old hens. The increased or decreased gene expression could be recorded 6 weeks after the inoculation of newly hatched chickens. To characterise the proteins that may directly interact with the microbiota we characterised chicken proteins that co-purified with the microbiota and identified a range of host proteins including CDD, ANGPTL6, DMBT1-L, MEP1A and Ig lambda. We propose that induction of ISG12-2 results in reduced apoptosis of host cells exposed to the colonizing commensal microbiota and that CDD, ANGPTL6, DMBT1-L, MEP1A and Ig lambda reduce contact of luminal microbiota with the gut epithelium thereby reducing the inflammatory response. PMID:27685470

  19. Identification of adipokine clusters related to parameters of fat mass, insulin sensitivity and inflammation.

    Directory of Open Access Journals (Sweden)

    Gesine Flehmig

    Full Text Available In obesity, elevated fat mass and ectopic fat accumulation are associated with changes in adipokine secretion, which may link obesity to inflammation and the development of insulin resistance. However, relationships among individual adipokines and between adipokines and parameters of obesity, glucose metabolism or inflammation are largely unknown. Serum concentrations of 20 adipokines were measured in 141 Caucasian obese men (n = 67 and women (n = 74 with a wide range of body weight, glycemia and insulin sensitivity. Unbiased, distance-based hierarchical cluster analyses were performed to recognize patterns among adipokines and their relationship with parameters of obesity, glucose metabolism, insulin sensitivity and inflammation. We identified two major adipokine clusters related to either (1 body fat mass and inflammation (leptin, ANGPTL3, DLL1, chemerin, Nampt, resistin or insulin sensitivity/hyperglycemia, and lipid metabolism (vaspin, clusterin, glypican 4, progranulin, ANGPTL6, GPX3, RBP4, DLK1, SFRP5, BMP7, adiponectin, CTRP3 and 5, omentin. In addition, we found distinct adipokine clusters in subgroups of patients with or without type 2 diabetes (T2D. Logistic regression analyses revealed ANGPTL6, DLK1, Nampt and progranulin as strongest adipokine correlates of T2D in obese individuals. The panel of 20 adipokines predicted T2D compared to a combination of HbA1c, HOMA-IR and fasting plasma glucose with lower sensitivity (78% versus 91% and specificity (76% versus 94%. Therefore, adipokine patterns may currently not be clinically useful for the diagnosis of metabolic diseases. Whether adipokine patterns are relevant for the predictive assessment of intervention outcomes needs to be further investigated.

  20. Experiment list: SRX471838 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available : ChIPseq GS WT Bmi1; Mus musculus; ChIP-Seq source_name=Cultured germline stem cells || genotype/variation=...Wild-type || strain=CD1 x C57BL/6 || cell type=Cultured germline stem cells || chip antibody=Mouse anti-Bmi1

  1. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.

    Science.gov (United States)

    Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald

    2017-09-19

    The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.

  2. A novel genome-information content-based statistic for genome-wide association analysis designed for next-generation sequencing data.

    Science.gov (United States)

    Luo, Li; Zhu, Yun; Xiong, Momiao

    2012-06-01

    The genome-wide association studies (GWAS) designed for next-generation sequencing data involve testing association of genomic variants, including common, low frequency, and rare variants. The current strategies for association studies are well developed for identifying association of common variants with the common diseases, but may be ill-suited when large amounts of allelic heterogeneity are present in sequence data. Recently, group tests that analyze their collective frequency differences between cases and controls shift the current variant-by-variant analysis paradigm for GWAS of common variants to the collective test of multiple variants in the association analysis of rare variants. However, group tests ignore differences in genetic effects among SNPs at different genomic locations. As an alternative to group tests, we developed a novel genome-information content-based statistics for testing association of the entire allele frequency spectrum of genomic variation with the diseases. To evaluate the performance of the proposed statistics, we use large-scale simulations based on whole genome low coverage pilot data in the 1000 Genomes Project to calculate the type 1 error rates and power of seven alternative statistics: a genome-information content-based statistic, the generalized T(2), collapsing method, multivariate and collapsing (CMC) method, individual χ(2) test, weighted-sum statistic, and variable threshold statistic. Finally, we apply the seven statistics to published resequencing dataset from ANGPTL3, ANGPTL4, ANGPTL5, and ANGPTL6 genes in the Dallas Heart Study. We report that the genome-information content-based statistic has significantly improved type 1 error rates and higher power than the other six statistics in both simulated and empirical datasets.

  3. Successful immortalization of mesenchymal progenitor cells derived from human placenta and the differentiation abilities of immortalized cells

    International Nuclear Information System (INIS)

    Zhang Xiaohong; Soda, Yasushi; Takahashi, Kenji; Bai, Yuansong; Mitsuru, Ayako; Igura, Koichi; Satoh, Hitoshi; Yamaguchi, Satoru; Tani, Kenzaburo; Tojo, Arinobu; Takahashi, Tsuneo A.

    2006-01-01

    We reported previously that mesenchymal progenitor cells derived from chorionic villi of the human placenta could differentiate into osteoblasts, adipocytes, and chondrocytes under proper induction conditions and that these cells should be useful for allogeneic regenerative medicine, including cartilage tissue engineering. However, similar to human mesenchymal stem cells (hMSCs), though these placental cells can be isolated easily, they are difficult to study in detail because of their limited life span in vitro. To overcome this problem, we attempted to prolong the life span of human placenta-derived mesenchymal cells (hPDMCs) by modifying hTERT and Bmi-1, and investigated whether these modified hPDMCs retained their differentiation capability and multipotency. Our results indicated that the combination of hTERT and Bmi-1 was highly efficient in prolonging the life span of hPDMCs with differentiation capability to osteogenic, adipogenic, and chondrogenic cells in vitro. Clonal cell lines with directional differentiation ability were established from the immortalized parental hPDMC/hTERT + Bmi-1. Interestingly, hPDMC/Bmi-1 showed extended proliferation after long-term growth arrest and telomerase was activated in the immortal hPDMC/Bmi-1 cells. However, the differentiation potential was lost in these cells. This study reports a method to extend the life span of hPDMCs with hTERT and Bmi-1 that should become a useful tool for the study of mesenchymal stem cells

  4. B lymphoma Moloney murine leukemia virus insertion region 1: An oncogenic mediator in prostate cancer.

    Science.gov (United States)

    Liu, Qipeng; Li, Qiaqia; Zhu, Sen; Yi, Yang; Cao, Qi

    2018-06-01

    B lymphoma Moloney murine leukemia virus insertion region 1 (BMI1), a core member of polycomb repressive complex 1 (PRC1), has been intensely investigated in the field of cancer epigenetics for decades. Widely known as a critical regulator in cellular physiology, BMI1 is essential in self-renewal and differentiation in different lineages of stem cells. BMI1 also plays a significant role in cancer etiology for its involvement in pathological progress such as epithelial-mesenchymal transition (EMT) and cancer stem cell maintenance, propagation, and differentiation. Importantly, overexpression of BMI1 is predictive for drug resistance, tumor recurrence, and eventual therapy failure of various cancer subtypes, which renders the pharmacological targeting at BMI1 as a novel and promising therapeutic approach. The study on prostate cancer, a prevalent hormone-related cancer among men, has promoted enormous research advancements in cancer genetics and epigenetics. This review summarizes the role of BMI1 as an oncogenic and epigenetic regulator in tumor initiation, progression, and relapse of prostate cancer.

  5. A novel zinc finger protein Zfp277 mediates transcriptional repression of the Ink4a/arf locus through polycomb repressive complex 1

    DEFF Research Database (Denmark)

    Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu

    2010-01-01

    . METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....

  6. Andrographolide impedes cancer stemness and enhances radio-sensitivity in oral carcinomas via miR-218 activation.

    Science.gov (United States)

    Yang, Po-Yu; Hsieh, Pei-Ling; Wang, Tong Hong; Yu, Cheng-Chia; Lu, Ming-Yi; Liao, Yi-Wen; Lee, Tzu-Hsin; Peng, Chih-Yu

    2017-01-17

    Current evidence suggests that oral cancer stem cells (OCSCs) possess high tumorigenic and metastatic properties as well as chemo- and radioresistance. In this study, we demonstrated that andrographolide, the main bioactive component in the medicinal plant Andrographis, significantly reduced oncogenicity and restored radio-sensitivity of ALDH1+CD44+ OCSCs. Mechanistic studies showed that andrographolide treatment increased the expression of microRNA-218 (miR-218), leading to the downregulation of Bmi1. We showed that knockdown of miR-218 in ALDH1-CD44- non-OCSCs enhanced cancer stemness, while silencing of Bmi1 significantly counteracted it. Furthermore, we found tumor growth was reduced in mice bearing xenograft tumors after andrographolide treatment via activation of miR-218/Bmi1 axis. Together, these data demonstrated that the inhibition of tumor aggressiveness in OCSCs by andrographolide was mediated through the upregulation of miR-218, thereby reducing Bmi1 expression. These findings suggest that andrographolide may be a valuable natural compound for anti-CSCs treatment of OSCC.

  7. Effects of hypoxia on expression of a panel of stem cell and chemoresistance markers in glioblastoma-derived spheroids

    DEFF Research Database (Denmark)

    Kolenda, Jesper; Jensen, Stine Skov; Aaberg-Jessen, Charlotte

    2011-01-01

    ). Spheroids were formed in 21% and 1% O(2) in serum-free medium. The immunohistochemical panel included hypoxia (HIF-1α, HIF-2α), proliferation (Ki-67), and stem cell markers (CD133, podoplanin, Bmi-1, nestin, Sox-2) as well as markers related to chemoresistance (MGMT, TIMP-1, Lamp-1, MRP1, MDR-1...

  8. Maintenance of sweat glands by stem cells located in the acral epithelium.

    Science.gov (United States)

    Ohe, Shuichi; Tanaka, Toshihiro; Yanai, Hirotsugu; Komai, Yoshihiro; Omachi, Taichi; Kanno, Shohei; Tanaka, Kiyomichi; Ishigaki, Kazuhiko; Saiga, Kazuho; Nakamura, Naohiro; Ohsugi, Haruyuki; Tokuyama, Yoko; Atsumi, Naho; Hisha, Hiroko; Yoshida, Naoko; Kumano, Keiki; Yamazaki, Fumikazu; Okamoto, Hiroyuki; Ueno, Hiroo

    2015-10-23

    The skin is responsible for a variety of physiological functions and is critical for wound healing and repair. Therefore, the regenerative capacity of the skin is important. However, stem cells responsible for maintaining the acral epithelium had not previously been identified. In this study, we identified the specific stem cells in the acral epithelium that participate in the long-term maintenance of sweat glands, ducts, and interadnexal epidermis and that facilitate the regeneration of these structures following injury. Lgr6-positive cells and Bmi1-positive cells were found to function as long-term multipotent stem cells that maintained the entire eccrine unit and the interadnexal epidermis. However, while Lgr6-positive cells were rapidly cycled and constantly supplied differentiated cells, Bmi1-positive cells were slow to cycle and occasionally entered the cell cycle under physiological conditions. Upon irradiation-induced injury, Bmi1-positive cells rapidly proliferated and regenerated injured epithelial tissue. Therefore, Bmi1-positive stem cells served as reservoir stem cells. Lgr5-positive cells were rapidly cycled and maintained only sweat glands; therefore, we concluded that these cells functioned as lineage-restricted progenitors. Taken together, our data demonstrated the identification of stem cells that maintained the entire acral epithelium and supported the different roles of three cellular classes. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  9. 75 FR 35877 - Bentley Motors Inc., Receipt of Petition for Decision of Inconsequential Noncompliance

    Science.gov (United States)

    2010-06-23

    ... replacement equipment. Pursuant to 49 U.S.C. 30118(d) and 30120(h) (see implementing rule at 49 CFR part 556... Bentley Motors Inc. (BMI),\\1\\ has determined that unknown number of replacement seat belts that it... United States for replacement purposes. Paragraphs S4.1(k) and S4.1(l) of FMVSS No. 209 requires: (k...

  10. Favorable clinical outcome and unique characteristics in association with Twist1 overexpression in de novo acute myeloid leukemia

    International Nuclear Information System (INIS)

    Chen, C-C; You, J-Y; Gau, J-P; Huang, C-E; Chen, Y-Y; Tsai, Y-H; Chou, H-J; Lung, J; Yang, M-H

    2015-01-01

    Epithelial–mesenchymal transition (EMT) is a critical process for inducing stem-like properties of epithelial cancer cells. However, the role of EMT inducers in hematological malignancies is unknown. Twist1, an EMT inducer necessary for cell migration, has recently been found to have transcriptionally regulatory activity on the expression of Bmi1, and these two are capable of promoting tumorigenesis in a synergized manner. Knowing that Bmi1 expression is essential for maintenance of leukemic stem cells, we speculate that Twist1 might govern the pathogenesis of acute myeloid leukemia (AML) development as well. We found that upregulated Twist1 increased Bmi1 expression in AML and endued leukemic cells a higher proliferative potential and increased resistance to apoptosis. In primary AML samples, there was strong positive correlation between the expression levels of Twist1 and Bmi1. AML patients whose leukemic blasts harbored overexpressed Twist1 had a more aggressive clinical phenotype, but they were more likely to have a better clinical outcome after standard therapy. In vitro studies confirmed that Twist1-overexpressing leukemic cells were more susceptible to cytarabine, but not daunorubicin, cytotoxicity. Our findings suggest that, in a subset of AML patients, Twist1 has a prominent role in the pathogenesis of the disease that leads to unique clinical phenotypes

  11. CD133(+) niches and single cells in glioblastoma have different phenotypes

    DEFF Research Database (Denmark)

    Christensen, Karina; Schrøder, Henrik Daa; Kristensen, Bjarne Winther

    2011-01-01

    with CD133 and the candidate stem cell markers Sox2, Bmi-1, EGFR, podoplanin and nestin, the proliferation marker Ki67 and the endothelial cell markers CD31, CD34, and VWF. Cell counting showed that the CD133(+) cells in the niches had a significantly higher expression of Sox2, EGFR and nestin compared...

  12. Main: 1V3H [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1V3H 大豆 Soybean Glycine max (L.) Merrill Beta-Amylase Name=Bmy1; Glycine Max Molecule: Beta-Amylase; Chai... 495 AA, Molecular weight: 56011 Da ATSDSNMLLNYVPVYVMLPLGVVNVDNVFEDPDGLKEQLLQLRAAGVDGVMVDVWWGIIELKGPKQYDWRAYRSLFQLVQECGLTLQAI...MSFHQCGGNVGDIVNIPIPQWVLDIGESNHDIFYTNRSGTRNKEYLTVGVDNEPIFHGRTAIEIYSDYMKSFRENMSDFLESGLIIDIEVG...FLTWYSNKLLNHGDQILDEANKAFLGCKVKLAIKVSGIHWWYKVENHAAELTAGYYNLNDRDGYRPIARMLSRHHAILNFTCLEMRDSEQPSDAKSGPQELVQQVLSG...GWREDIRVAGENALPRYDATAYNQIILNAKPQGVNNNGPPKLSMFGVTYLRLSDDLLQKSNFNIFKKFVLKMHADQDYCANPQKYNHAITPLKPSAPKIPIEVLLEATKPTLPFPWLPETDMKVDG soybean_1V3H.jpg ...

  13. Inhibitory effect of puerarin on proliferation of retinoblastoma cells ...

    African Journals Online (AJOL)

    ... 71.4 ± 4.5 % for control and Bmi-1 siRNA-treated groups, respectively. Conclusions: The results show that puerarin exert suppressive effects on human retinoblastoma Y79 cells and therefore may find application in the treatment of intraocular tumor. Keywords: Cancer, Puerarin, Retinoblastoma Y79 cells, mTOR inhibition, ...

  14. Maintenance of sweat glands by stem cells located in the acral epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Ohe, Shuichi [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Dermatology, Kansai Medical University, Osaka 573-1010 (Japan); Tanaka, Toshihiro [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Third Department of Internal Medicine, Kansai Medical University, Osaka 573-1010 (Japan); Yanai, Hirotsugu [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Surgery, Kansai Medical University, Osaka 573-1010 (Japan); Komai, Yoshihiro [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Urology and Andrology, Kansai Medical University, Osaka 573-1010 (Japan); Omachi, Taichi [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Pediatrics, Kansai Medical University, Osaka 573-1010 (Japan); Kanno, Shohei; Tanaka, Kiyomichi; Ishigaki, Kazuhiko; Saiga, Kazuho [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Nakamura, Naohiro [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Third Department of Internal Medicine, Kansai Medical University, Osaka 573-1010 (Japan); Ohsugi, Haruyuki [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Department of Urology and Andrology, Kansai Medical University, Osaka 573-1010 (Japan); Tokuyama, Yoko; Atsumi, Naho; Hisha, Hiroko; Yoshida, Naoko; Kumano, Keiki [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan); Yamazaki, Fumikazu; Okamoto, Hiroyuki [Department of Dermatology, Kansai Medical University, Osaka 573-1010 (Japan); Ueno, Hiroo, E-mail: hueno@hirakata.kmu.ac.jp [Department of Stem Cell Pathology, Kansai Medical University, Osaka 573-1010 (Japan)

    2015-10-23

    The skin is responsible for a variety of physiological functions and is critical for wound healing and repair. Therefore, the regenerative capacity of the skin is important. However, stem cells responsible for maintaining the acral epithelium had not previously been identified. In this study, we identified the specific stem cells in the acral epithelium that participate in the long-term maintenance of sweat glands, ducts, and interadnexal epidermis and that facilitate the regeneration of these structures following injury. Lgr6-positive cells and Bmi1-positive cells were found to function as long-term multipotent stem cells that maintained the entire eccrine unit and the interadnexal epidermis. However, while Lgr6-positive cells were rapidly cycled and constantly supplied differentiated cells, Bmi1-positive cells were slow to cycle and occasionally entered the cell cycle under physiological conditions. Upon irradiation-induced injury, Bmi1-positive cells rapidly proliferated and regenerated injured epithelial tissue. Therefore, Bmi1-positive stem cells served as reservoir stem cells. Lgr5-positive cells were rapidly cycled and maintained only sweat glands; therefore, we concluded that these cells functioned as lineage-restricted progenitors. Taken together, our data demonstrated the identification of stem cells that maintained the entire acral epithelium and supported the different roles of three cellular classes. - Highlights: • The acral epithelium have two types of stem cells. • Lgr6-positive cells are rapid-cycling, short-term stem cells. • Bmi1-positive cells are slow-cycling stem cells that act as reserver stem cells. • Lgr5 may be a useful sweat gland marker in mice.

  15. Maintenance of sweat glands by stem cells located in the acral epithelium

    International Nuclear Information System (INIS)

    Ohe, Shuichi; Tanaka, Toshihiro; Yanai, Hirotsugu; Komai, Yoshihiro; Omachi, Taichi; Kanno, Shohei; Tanaka, Kiyomichi; Ishigaki, Kazuhiko; Saiga, Kazuho; Nakamura, Naohiro; Ohsugi, Haruyuki; Tokuyama, Yoko; Atsumi, Naho; Hisha, Hiroko; Yoshida, Naoko; Kumano, Keiki; Yamazaki, Fumikazu; Okamoto, Hiroyuki; Ueno, Hiroo

    2015-01-01

    The skin is responsible for a variety of physiological functions and is critical for wound healing and repair. Therefore, the regenerative capacity of the skin is important. However, stem cells responsible for maintaining the acral epithelium had not previously been identified. In this study, we identified the specific stem cells in the acral epithelium that participate in the long-term maintenance of sweat glands, ducts, and interadnexal epidermis and that facilitate the regeneration of these structures following injury. Lgr6-positive cells and Bmi1-positive cells were found to function as long-term multipotent stem cells that maintained the entire eccrine unit and the interadnexal epidermis. However, while Lgr6-positive cells were rapidly cycled and constantly supplied differentiated cells, Bmi1-positive cells were slow to cycle and occasionally entered the cell cycle under physiological conditions. Upon irradiation-induced injury, Bmi1-positive cells rapidly proliferated and regenerated injured epithelial tissue. Therefore, Bmi1-positive stem cells served as reservoir stem cells. Lgr5-positive cells were rapidly cycled and maintained only sweat glands; therefore, we concluded that these cells functioned as lineage-restricted progenitors. Taken together, our data demonstrated the identification of stem cells that maintained the entire acral epithelium and supported the different roles of three cellular classes. - Highlights: • The acral epithelium have two types of stem cells. • Lgr6-positive cells are rapid-cycling, short-term stem cells. • Bmi1-positive cells are slow-cycling stem cells that act as reserver stem cells. • Lgr5 may be a useful sweat gland marker in mice.

  16. Hotair mediates hepatocarcinogenesis through suppressing miRNA-218 expression and activating P14 and P16 signaling.

    Science.gov (United States)

    Fu, Wei-Ming; Zhu, Xiao; Wang, Wei-Mao; Lu, Ying-Fei; Hu, Bao-Guang; Wang, Hua; Liang, Wei-Cheng; Wang, Shan-Shan; Ko, Chun-Hay; Waye, Mary Miu-Yee; Kung, Hsiang-Fu; Li, Gang; Zhang, Jin-Fang

    2015-10-01

    Long non-coding RNA Hotair has been considered as a pro-oncogene in multiple cancers. Although there is emerging evidence that reveals its biological function and the association with clinical prognosis, the precise mechanism remains largely elusive. We investigated the function and mechanism of Hotair in hepatocellular carcinoma (HCC) cell models and a xenograft mouse model. The regulatory network between miR-218 and Hotair was elucidated by RNA immunoprecipitation and luciferase reporter assays. Finally, the correlation between Hotair, miR-218 and the target gene Bmi-1 were evaluated in 52 paired HCC specimens. In this study, we reported that Hotair negatively regulated miR-218 expression in HCC, which might be mediated through an EZH2-targeting-miR-218-2 promoter regulatory axis. Further investigation revealed that Hotair knockdown dramatically inhibited cell viability and induced G1-phase arrest in vitro and suppressed tumorigenicity in vivo by promoting miR-218 expression. Oncogene Bmi-1 was shown to be a functional target of miR-218, and the main downstream targets signaling, P16(Ink4a) and P14(ARF), were activated in Hotair-suppressed tumorigenesis. In primary human HCC specimens, Hotair and Bmi-1 were concordantly upregulated whereas miR-218 was downregulated in these tissues. Furthermore, Hotair was inversely associated with miR-218 expression and positively correlated with Bmi-1 expression in these clinical tissues. Hotair silence activates P16(Ink4a) and P14(ARF) signaling by enhancing miR-218 expression and suppressing Bmi-1 expression, resulting in the suppression of tumorigenesis in HCC. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  17. Permanganate Treatment of Savannah River Site Simulant Wastes for Strontium and Actinide Removal

    International Nuclear Information System (INIS)

    Wilmarth, W.R.

    2003-01-01

    This study examined the use of sodium permanganate and strontium nitrate to remove the actinides and radio-strontium from Savannah River Site (SRS) waste supernate. We examined the quantities of chemical feed reagents along with increased mixing and the excess of organic reductant. Additionally, we examined two processing schemes including that applicable to either the Salt Waste Processing Facility or the Alpha Removal Process (ARP) (5.6 M sodium ion concentration) conditions and the conditions for an In-Tank application (7.5 M sodium ion concentration). Our results support the following conclusions: The process met minimum required decontamination factors (DFs) within the tested parameter sets for strontium and plutonium in both the ARP and In-Tank application. The strontium DFs far exceeded the required values within the tested parameter sets. Within the ARP application, the use of peroxide as the reductant for permanganate produced higher plutonium DFs than the use of sodium formate. Reductant concentration and degree of mixing strongly influenced radionuclide decontamination. In the formate application under the ARP process, increasing the reductant concentration and mixing energy resulted in higher Sr and Pu decontamination

  18. Metabolites produced by antagonistic microbes inhibit the principal avocado pathogens in vitro

    Directory of Open Access Journals (Sweden)

    Sara Ramírez R.

    2015-04-01

    Full Text Available The demand for Hass avocado in the global market exceeds the supply by over 50%. Colombia has a remarkable advantage as a producer in the region due to its high yields. However, the productivity of this crop can be seriously affected by diseases such as root rot, caused by Phytophthora cinnamomi, postharvest body rot and stem end rot, caused by Colletotrichum sp. and Phomopsis sp., respectively. The potential of 76 bacterial isolates obtained from avocado rhizosphere to produce inhibitory metabolites against avocado's pathogens was evaluated. The antagonistic effect of the rhizobacteria against P. cinnamomi, Colletotrichum sp. and Phomopsis sp. was tested through dual cultures. Thirty-six percent of the tested isolates presented inhibition halos against P. cinnamomi, 36% against Colletotrichum sp. and 67% against Phomopsis sp. Additionally, three isolates were selected for fermentation tests using different broth cultures. The extracts obtained from fermentations in the minimal medium of isolates ARP5.1 and AED06 showed inhibitory activity against the evaluated pathogens, but this effect was not observed with the AED26 extract. The media supplemented with copper chloride did not enhance activity of the extracts. These results suggest that using microbial metabolic extracts is a viable alternative for controlling avocado pathogens in vitro.

  19. The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells

    DEFF Research Database (Denmark)

    Bracken, Adrian P; Kleine-Kohlbrecher, Daniela; Dietrich, Nikolaj

    2007-01-01

    The p16INK4A and p14ARF proteins, encoded by the INK4A-ARF locus, are key regulators of cellular senescence, yet the mechanisms triggering their up-regulation are not well understood. Here, we show that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association...... and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 (PRC2) complex. Significantly, EZH2 is down-regulated in stressed and senescing populations of cells, coinciding with decreased levels of associated H3K27me3, displacement of BMI1, and activation of transcription...

  20. Stemcell Information: SKIP000724 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available medical Innovation. 独立行政法人医薬基盤研究所JCRB細胞バンク http://cellbank.nibio.go.jp/~cellbank/cgi-bin/search_res_det.cgi?...sing the bmi-1, E6 and hTERT. 骨髄由来間葉系幹細胞, hTERT, HPV E6, bmi-1導入, 不死化細胞株 fibroblast-like -- Retrovirus recom...9. Human bone marrow-derived mesenchymal stem cells which were infected with recombinant retroviruses expres...hen the cultures reached subconfluence, the cells were harvested with 0.25% trypsin and 1mM EDTA and replate...d with one-half of harvested cells. ... 5% ... Umezawa, Akihiro 梅澤 明弘 National Center for Chi

  1. Activation of the canonical Wnt pathway leads to loss of hematopoietic stem cell repopulation and multilineage differentiation block

    DEFF Research Database (Denmark)

    Kirstetter, Peggy; Anderson, Kristina; Porse, Bo T

    2006-01-01

    Wnt signaling increases hematopoietic stem cell self-renewal and is activated in both myeloid and lymphoid malignancies, indicating involvement in both normal and malignant hematopoiesis. We report here activated canonical Wnt signaling in the hematopoietic system through conditional expression...... of hematopoietic stem cell function was associated with decreased expression of Cdkn1a (encoding the cell cycle inhibitor p21(cdk)), Sfpi1, Hoxb4 and Bmi1 (encoding the transcription factors PU.1, HoxB4 and Bmi-1, respectively) and altered integrin expression in Lin(-)Sca-1(+)c-Kit(+) cells, whereas PU.1...... of a stable form of beta-catenin. This enforced expression led to hematopoietic failure associated with loss of myeloid lineage commitment at the granulocyte-macrophage progenitor stage; blocked erythrocyte differentiation; disruption of lymphoid development; and loss of repopulating stem cell activity. Loss...

  2. The Role of Attachment in Body Weight and Weight Loss in Bariatric Patients

    OpenAIRE

    Nancarrow, Abigail; Hollywood, Amelia; Ogden, Jane; Hashemi, Majid

    2017-01-01

    Purpose The aim of this study is to explore the role of attachment styles in obesity. Material and Methods The present study explored differences in insecure attachment styles between an obese sample waiting for bariatric surgery (n = 195) and an age, sex and height matched normal weight control group (n = 195). It then explored the role of attachment styles in predicting change in BMI 1 year post bariatric surgery (n = 143). Results The bariatric group reported significant...

  3. Heterogeneity in the kinetics of nuclear proteins and trajectories of substructures associated with heterochromatin

    Czech Academy of Sciences Publication Activity Database

    Stixová, Lenka; Bártová, Eva; Matula, Pa.; Daněk, O.; Legartová, Soňa; Kozubek, Stanislav

    2011-01-01

    Roč. 4, č. 5 (2011), s. 1-17 ISSN 1756-8935 R&D Projects: GA MŠk(CZ) LC06027; GA MŠk(CZ) LC535; GA MŠk(CZ) ME 919; GA ČR(CZ) GAP302/10/1022 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : HP1 * BMI1 * TRF1 Subject RIV: BO - Biophysics Impact factor: 4.462, year: 2011

  4. Establishment of a Novel Lingual Organoid Culture System: Generation of Organoids Having Mature Keratinized Epithelium from Adult Epithelial Stem Cells

    Science.gov (United States)

    Hisha, Hiroko; Tanaka, Toshihiro; Kanno, Shohei; Tokuyama, Yoko; Komai, Yoshihiro; Ohe, Shuichi; Yanai, Hirotsugu; Omachi, Taichi; Ueno, Hiroo

    2013-11-01

    Despite the strong need for the establishment of a lingual epithelial cell culture system, a simple and convenient culture method has not yet been established. Here, we report the establishment of a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Histological analyses showed that the generated organoids had both a stratified squamous epithelial cell layer and a stratum corneum. Very recently, we showed via a multicolor lineage tracing method that Bmi1-positive stem cells exist at the base of the epithelial basal layer in the interpapillary pit. Using our new culture system, we found that organoids could be generated by single Bmi1-positive stem cells and that in the established organoids, multiple Bmi1-positive stem cells were generated at the outermost layer. Moreover, we observed that organoids harvested at an early point in culture could be engrafted and maturate in the tongue of recipient mice and that the organoids generated from carcinogen-treated mice had an abnormal morphology. Thus, this culture system presents valuable settings for studying not only the regulatory mechanisms of lingual epithelium but also lingual regeneration and carcinogenesis.

  5. PRC1 Prevents Replication Stress during Chondrogenic Transit Amplification

    Directory of Open Access Journals (Sweden)

    Frank Spaapen

    2017-12-01

    Full Text Available Transit amplification (TA, a state of combined, rapid proliferative expansion and differentiation of stem cell-descendants, remains poorly defined at the molecular level. The Polycomb Repressive Complex 1 (PRC1 protein BMI1 has been localized to TA compartments, yet its exact role in TA is unclear. PRC1 proteins control gene expression, cell proliferation and DNA-damage repair. Coordination of such DNA-templated activities during TA is predicted to be crucial to support DNA replication and differentiation-associated transcriptional programming. We here examined whether chondrogenesis provides a relevant biological context for synchronized coordination of these chromatin-based tasks by BMI1. Taking advantage of a prominently featuring TA-phase during chondrogenesis in vitro and in vivo, we here report that TA is completely dependent on intact PRC1 function. BMI1-depleted chondrogenic progenitors rapidly accumulate double strand DNA breaks during DNA replication, present massive non-H3K27me3-directed transcriptional deregulation and fail to undergo chondrogenic TA. Genome-wide accumulation of Topoisomerase 2α and Geminin suggests a model in which PRC1 synchronizes replication and transcription during rapid chondrogenic progenitor expansion. Our combined data reveals for the first time a vital cell-autonomous role for PRC1 during chondrogenesis. We provide evidence that chondrocyte hyper-replication and hypertrophy represent a unique example of programmed senescence in vivo. These findings provide new perspectives on PRC1 function in development and disease.

  6. MUC1-C activates polycomb repressive complexes and downregulates tumor suppressor genes in human cancer cells.

    Science.gov (United States)

    Rajabi, Hasan; Hiraki, Masayuki; Kufe, Donald

    2018-04-01

    The PRC2 and PRC1 complexes are aberrantly expressed in human cancers and have been linked to decreases in patient survival. MUC1-C is an oncoprotein that is also overexpressed in diverse human cancers and is associated with a poor prognosis. Recent studies have supported a previously unreported function for MUC1-C in activating PRC2 and PRC1 in cancer cells. In the regulation of PRC2, MUC1-C (i) drives transcription of the EZH2 gene, (ii) binds directly to EZH2, and (iii) enhances occupancy of EZH2 on target gene promoters with an increase in H3K27 trimethylation. Regarding PRC1, which is recruited to PRC2 sites in the hierarchical model, MUC1-C induces BMI1 transcription, forms a complex with BMI1, and promotes H2A ubiquitylation. MUC1-C thereby contributes to the integration of PRC2 and PRC1-mediated repression of tumor suppressor genes, such as CDH1, CDKN2A, PTEN and BRCA1. Like PRC2 and PRC1, MUC1-C is associated with the epithelial-mesenchymal transition (EMT) program, cancer stem cell (CSC) state, and acquisition of anticancer drug resistance. In concert with these observations, targeting MUC1-C downregulates EZH2 and BMI1, inhibits EMT and the CSC state, and reverses drug resistance. These findings emphasize the significance of MUC1-C as a therapeutic target for inhibiting aberrant PRC function and reprogramming the epigenome in human cancers.

  7. Quantitative generalized ratiometric fluorescence spectroscopy for turbid media based on probe encapsulated by biologically localized embedding

    International Nuclear Information System (INIS)

    Yan, Xiu-Fang; Chen, Zeng-Ping; Cui, Yin-Yin; Hu, Yuan-Liang; Yu, Ru-Qin

    2016-01-01

    determination of [Ca 2+ ] in turbid media (ARPE: 5.9%).

  8. Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.

    Science.gov (United States)

    Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa

    2015-05-01

    Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.

  9. Secreted protein acidic and rich in cysteine (SPARC is associated with nasopharyngeal carcinoma metastasis and poor prognosis

    Directory of Open Access Journals (Sweden)

    Wang Hai-Yun

    2012-02-01

    Full Text Available Abstract Background The aim of the present study was to analyse the expression of Secreted protein acidic and rich in cysteine (SPARC in nasopharyngeal carcinoma (NPC specimens, and to evaluate its correlation with clinicopathologic features, including survival of patients with NPC Methods NPC tissue microarrays (TMAs were constructed from Sun Yat-sen University Cancer Center (SYSUCC, another three centers on mainland China, Singapore and Hong Kong. Using quantitative RT-PCR and Western-blotting techniques, we detected mRNA and protein expression of SPARC in NPC cell lines and immortalized nasopharyngeal epithelial cells (NPECs induced by Bmi-1 (NPEC2 Bmi-1. The difference of SPARC expression in the cell lines was tested using a t-test method. The relationship between the SPARC expression and clinicopathological data was assessed by chi-square. Survival analysis was estimated using the Kaplan-Meier approach with log-rank test. Univariate and multivariate analyses of clinical variables were performed using Cox proportional hazards regression models. Results The expression levels of SPARC mRNA and protein were markedly higher in NPC cell lines than in NPEC2 Bmi-1. Especially, the expression levels of SPARC mRNA and protein were much lower in the 6-10B than in the 5-8 F (P = 0.002, P = 0.001. SPARC immunostaining revealed cytoplasmic localization in NPC cells and no staining in the stroma and epithelium. In addition, high level of SPARC positively correlated with the status of distant metastasis (P = 0.001 and WHO histological classification (P = 0.023. NPC patients with high SPARC expression also had a significantly poorer prognosis than patients with low SPARC expression (log-rank test, P P P Conclusions SPARC expression is common in NPC patients. Our data shows that elevated SPARC expression is a potential unfavorable prognostic factor for patients with NPC.

  10. Epigenetic regulation of multiple tumor-related genes leads to suppression of breast tumorigenesis by dietary genistein.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Li

    Full Text Available Breast cancer is one of the most lethal diseases in women; however, the precise etiological factors are still not clear. Genistein (GE, a natural isoflavone found in soybean products, is believed to be a potent chemopreventive agent for breast cancer. One of the most important mechanisms for GE inhibition of breast cancer may involve its potential in impacting epigenetic processes allowing reversal of aberrant epigenetic events during breast tumorigenesis. To investigate epigenetic regulation for GE impedance of breast tumorigenesis, we monitored epigenetic alterations of several key tumor-related genes in an established breast cancer transformation system. Our results show that GE significantly inhibited cell growth in a dose-dependent manner in precancerous breast cells and breast cancer cells, whereas it exhibited little effect on normal human mammary epithelial cells. Furthermore, GE treatment increased expression of two crucial tumor suppressor genes, p21(WAF1 (p21 and p16(INK4a (p16, although it decreased expression of two tumor promoting genes, BMI1 and c-MYC. GE treatment led to alterations of histone modifications in the promoters of p21 and p16 as well as the binding ability of the c-MYC-BMI1 complex to the p16 promoter contributing to GE-induced epigenetic activation of these tumor suppressor genes. In addition, an orally-fed GE diet prevented breast tumorigenesis and inhibited breast cancer development in breast cancer mice xenografts. Our results suggest that genistein may repress early breast tumorigenesis by epigenetic regulation of p21 and p16 by impacting histone modifications as well as the BMI1-c-MYC complex recruitment to the regulatory region in the promoters of these genes. These studies will facilitate more effective use of soybean product in breast cancer prevention and also help elucidate the mechanisms during the process of early breast tumorigenesis.

  11. Epigenetic regulation of multiple tumor-related genes leads to suppression of breast tumorigenesis by dietary genistein.

    Science.gov (United States)

    Li, Yuanyuan; Chen, Huaping; Hardy, Tabitha M; Tollefsbol, Trygve O

    2013-01-01

    Breast cancer is one of the most lethal diseases in women; however, the precise etiological factors are still not clear. Genistein (GE), a natural isoflavone found in soybean products, is believed to be a potent chemopreventive agent for breast cancer. One of the most important mechanisms for GE inhibition of breast cancer may involve its potential in impacting epigenetic processes allowing reversal of aberrant epigenetic events during breast tumorigenesis. To investigate epigenetic regulation for GE impedance of breast tumorigenesis, we monitored epigenetic alterations of several key tumor-related genes in an established breast cancer transformation system. Our results show that GE significantly inhibited cell growth in a dose-dependent manner in precancerous breast cells and breast cancer cells, whereas it exhibited little effect on normal human mammary epithelial cells. Furthermore, GE treatment increased expression of two crucial tumor suppressor genes, p21(WAF1) (p21) and p16(INK4a) (p16), although it decreased expression of two tumor promoting genes, BMI1 and c-MYC. GE treatment led to alterations of histone modifications in the promoters of p21 and p16 as well as the binding ability of the c-MYC-BMI1 complex to the p16 promoter contributing to GE-induced epigenetic activation of these tumor suppressor genes. In addition, an orally-fed GE diet prevented breast tumorigenesis and inhibited breast cancer development in breast cancer mice xenografts. Our results suggest that genistein may repress early breast tumorigenesis by epigenetic regulation of p21 and p16 by impacting histone modifications as well as the BMI1-c-MYC complex recruitment to the regulatory region in the promoters of these genes. These studies will facilitate more effective use of soybean product in breast cancer prevention and also help elucidate the mechanisms during the process of early breast tumorigenesis.

  12. Modeling initiation of Ewing sarcoma in human neural crest cells.

    Directory of Open Access Journals (Sweden)

    Cornelia von Levetzow

    2011-04-01

    Full Text Available Ewing sarcoma family tumors (ESFT are aggressive bone and soft tissue tumors that express EWS-ETS fusion genes as driver mutations. Although the histogenesis of ESFT is controversial, mesenchymal (MSC and/or neural crest (NCSC stem cells have been implicated as cells of origin. For the current study we evaluated the consequences of EWS-FLI1 expression in human embryonic stem cell-derived NCSC (hNCSC. Ectopic expression of EWS-FLI1 in undifferentiated hNCSC and their neuro-mesenchymal stem cell (hNC-MSC progeny was readily tolerated and led to altered expression of both well established as well as novel EWS-FLI1 target genes. Importantly, whole genome expression profiling studies revealed that the molecular signature of established ESFT is more similar to hNCSC than any other normal tissue, including MSC, indicating that maintenance or reactivation of the NCSC program is a feature of ESFT pathogenesis. Consistent with this hypothesis, EWS-FLI1 induced hNCSC genes as well as the polycomb proteins BMI-1 and EZH2 in hNC-MSC. In addition, up-regulation of BMI-1 was associated with avoidance of cellular senescence and reversible silencing of p16. Together these studies confirm that, unlike terminally differentiated cells but consistent with bone marrow-derived MSC, NCSC tolerate expression of EWS-FLI1 and ectopic expression of the oncogene initiates transition to an ESFT-like state. In addition, to our knowledge this is the first demonstration that EWS-FLI1-mediated induction of BMI-1 and epigenetic silencing of p16 might be critical early initiating events in ESFT tumorigenesis.

  13. Epithelial cells derived from human embryonic stem cells display p16INK4A senescence, hypermotility, and differentiation properties shared by many P63+ somatic cell types

    DEFF Research Database (Denmark)

    Dabelsteen, Sally; Hercule, Paula; Barron, Patricia

    2009-01-01

    hESderK cells and keratinocytes a substantially extended lifespan. When exposed to transforming growth factor beta or to an incompletely processed form of Laminin-332, three lifespan-extended or immortalized hESderK lines that we studied became directionally hypermotile, a wound healing and invasion......(+)/K14(+) urothelial and tracheobronchial epithelial cells. Primary and immortalized lines of these cell types had growth requirements and hypermotility responses similar to keratinocytes and bmi1 expression facilitated their immortalization by engineering to express the catalytic subunit of telomerase...

  14. Células madre limbocorneales: actualidades y aplicaciones terapéuticas

    OpenAIRE

    Villarreal Villarreal, Rogelio; Vela Barrera, Iván Daryl; Villarreal Guerra, Pablo; Moreno Treviño, María Guadalupe; Rivera Silva, Gerardo

    2015-01-01

    Las células madre son aquellas células poco diferenciadas capaces de autorrenovarse y diferenciarse hacia células especializadas en el cuerpo. Se encuentran en todos los tejidos autorrenovables como son los epitelios. En el caso del epitelio corneal se ha encontrado que las células madre están alojadas en la región límbica, y más concentradas en la región superior e inferior. Algunos de los marcadores que se utilizan para identificarlas son: p63, ABCG2, C/EBPd, Bmi1, Notch1, K19, vimentina, e...

  15. Lingual Epithelial Stem Cells and Organoid Culture of Them

    Directory of Open Access Journals (Sweden)

    Hiroko Hisha

    2016-01-01

    Full Text Available As tongue cancer is one of the major malignant cancers in the world, understanding the mechanism of maintenance of lingual epithelial tissue, which is known to be the origin of tongue cancer, is unquestionably important. However, the actual stem cells that are responsible for the long-term maintenance of the lingual epithelium have not been identified. Moreover, a simple and convenient culture method for lingual epithelial stem cells has not yet been established. Recently, we have shown that Bmi1-positive cells, residing at the second or third layer of the epithelial cell layer at the base of the interpapillary pit (IPP, were slow-cycling and could supply keratinized epithelial cells for over one year, indicating that Bmi1-positive cells are long-term lingual epithelial stem cells. In addition, we have developed a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Here, we discuss current progress in the identification of lingual stem cells and future applications of the lingual culture system for studying the regulatory mechanisms of the lingual epithelium and for regenerative medicine.

  16. Cancer Stem-Like Cells Enriched in Panc-1 Spheres Possess Increased Migration Ability and Resistance to Gemcitabine

    Science.gov (United States)

    Yin, Tao; Wei, Hongji; Gou, Shanmiao; Shi, Pengfei; Yang, Zhiyong; Zhao, Gang; Wang, Chunyou

    2011-01-01

    Pancreatic cancer is one of the most lethal malignancies with poor prognosis. Previously, we found that a subpopulation of cancer stem cells (CSCs) in the Panc-1 pancreatic cancer cell line could propagate to form spheres. Here we characterized the malignant phenotypes of the pancreatic cancer stem CD44+/CD24+ cells, which were enriched under sphere forming conditions as analyzed by flow cytometry. These cells demonstrated increased resistance to gemcitabine and increased migration ability. Moreover, these cells exhibited epithelial to mesenchymal transition characterized by a decreased level of the epithelial marker E-cadherin and an increased level of the mesenchymal marker vimentin. Notably, abnormal expression of Bmi-1, ABCG2, Cyclin D1 and p16 were found in Panc-1 CSCs. Our results suggest that targeted inhibition of CSCs represents a novel therapeutic approach to overcome chemoresistance and metastasis of pancreatic cancer. PMID:21673909

  17. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival.

    Science.gov (United States)

    Tinkum, Kelsey L; Stemler, Kristina M; White, Lynn S; Loza, Andrew J; Jeter-Jones, Sabrina; Michalski, Basia M; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S; Piwnica-Worms, David; Piwnica-Worms, Helen

    2015-12-22

    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy.

  18. Clinical Implications of Intestinal Stem Cell Markers in Colorectal Cancer

    DEFF Research Database (Denmark)

    Espersen, Maiken Lise Marcker; Olsen, Jesper; Linnemann, Dorte

    2015-01-01

    Colorectal cancer (CRC) still has one of the highest incidence and mortality rate among cancers. Therefore, improved differential diagnostics and personalized treatment are still needed. Several intestinal stem cell markers have been found to be associated with CRC and might have a prognostic...... and predictive significance in CRC patients. This review provides an overview of the intestinal stem cell markers leucine-rich repeat-containing G-protein-coupled receptor 5 (LGR5), B cell–specific Moloney murine leukemia virus insertion site 1 (BMI1), Musashi1 (MSI1), and sex-determining region y-box 9 (SOX9......) and their implications in human CRC. The exact roles of the intestinal stem cell markers in CRC development and progression remain unclear; however, high expression of these stem cell markers have a potential prognostic significance and might be implicated in chemotherapy resistance...

  19. The Role of Attachment in Body Weight and Weight Loss in Bariatric Patients.

    Science.gov (United States)

    Nancarrow, Abigail; Hollywood, Amelia; Ogden, Jane; Hashemi, Majid

    2018-02-01

    The aim of this study is to explore the role of attachment styles in obesity. The present study explored differences in insecure attachment styles between an obese sample waiting for bariatric surgery (n = 195) and an age, sex and height matched normal weight control group (n = 195). It then explored the role of attachment styles in predicting change in BMI 1 year post bariatric surgery (n = 143). The bariatric group reported significantly higher levels of anxious attachment and lower levels of avoidant attachment than the control non-obese group. Baseline attachment styles did not, however, predict change in BMI post surgery. Attachment style is different in those that are already obese from those who are not. Attachment was not related to weight loss post surgery.

  20. Association of FTO Polymorphisms with Early Age of Obesity in Obese Italian Subjects

    Directory of Open Access Journals (Sweden)

    Federica Sentinelli

    2012-01-01

    Aims of our study are to investigate: (1 the association of FTO gene SNPs rs9939609 and rs9930506 with body mass index (BMI and obesity-related parameters in a large cohort (n=752 of Italian obese subjects; (2 the association between the two FTO SNPs and age of onset of obesity. Our results demonstrate a strong association between FTO SNPs rs9939609 (P<0.043 and rs9930506 (P<0.029 with BMI in the Italian population. FTO rs9930506 was significantly associated with higher BMI in a G allele dose-dependent manner (BMI+1.4 kg/m2 per G allele. We also observed that the association with BMI of the two FTO variants varied with age, with the carriers of the risk alleles developing an increase in body weight earlier in life. In conclusion, our study further demonstrates a role of the genetic variability in FTO on BMI in a large Italian population.

  1. Stemcell Information: SKIP000712 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available uman bone marrow-derived mesenchymal stem cells with transgenic HSVE6, E7 and hTERT. ... 骨髄由来間葉系幹細胞, hTERT, HPV E6, E7導入, 不死化細胞... National Institute of Biomedical Innovation. 独立行政法人医薬基盤研究所JCRB細胞バンク http://cellbank.nibio.go.jp/~cell...Yes -- ... poweredby10. When the cultures reached subconfluence, the cells were harv...ested with 0.25% trypsin and 1mM EDTA and replated with one-half of harvested cells. ... 5% ... ...95.2005 Combination of hTERT and bmi-1, E6, or E7 induces prolongation of the life span of bone marrow stromal cell

  2. SSX2 is a novel DNA-binding protein that antagonizes polycomb group body formation and gene repression

    DEFF Research Database (Denmark)

    Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden

    2014-01-01

    Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body...... formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition...

  3. Sustainability of 8% weight loss, reduction of insulin resistance, and amelioration of atherogenic-metabolic risk factors over 4 years by metformin-diet in women with polycystic ovary syndrome.

    Science.gov (United States)

    Glueck, Charles J; Aregawi, Dawit; Agloria, Mahlia; Winiarska, Magdalena; Sieve, Luann; Wang, Ping

    2006-12-01

    In 74 women with polycystic ovary syndrome, treated for 4 years with metformin (MET) and diet, we prospectively assessed whether, and to what degree, weight loss, reduction of insulin resistance, and amelioration of coronary heart disease risk factors could be sustained. We hypothesized that response to MET-diet would not differ by pretreatment body mass index (BMI) classes or =25 to or =30 to or =40 (extremely obese). [table: see text] Metformin-diet was successful in producing stable approximately 8% weight reduction for all 4 years (trend P weight on MET-diet was significant (P or =40, > or =30 to or =25 to weight category (BMI, .1) in the 4 BMI categories. By stepwise regression, weight loss was a significant (P polycystic ovary syndrome effectively and safely reduces weight and LDL-C while raising HDL-C, and maintains these outcomes stable over 4 years.

  4. Trends in Biometric Health Indices Within an Employer-Sponsored Wellness Program With Outcome-Based Incentives.

    Science.gov (United States)

    Fu, Patricia Lin; Bradley, Kent L; Viswanathan, Sheila; Chan, June M; Stampfer, Meir

    2016-07-01

    To evaluate changes in employees' biometrics over time relative to outcome-based incentive thresholds. Retrospective cohort analysis of biometric screening participants (n = 26 388). Large employer primarily in Western United States. Office, retail, and distribution workforce. A voluntary outcome-based biometric screening program, incentivized with health insurance premium discounts. Body mass index (BMI), cholesterol, blood glucose, blood pressure, and nicotine. Followed were participants from their first year of participation, evaluating changes in measures. On average, participants who did not meet the incentive threshold at baseline decreased their BMI (1%), glucose (8%), blood pressure (systolic 9%, diastolic 8%), and total cholesterol (8%) by year 2 with improvements generally sustained or continued during each additional year of participation. On average, individuals at high health risk who participated in a financially incentivized biometric assessment program improved their health indices over time. Further research is needed to understand key determinants that drive health improvement indicated here. © The Author(s) 2016.

  5. Glioma Cells in the Tumor Periphery Have a Stem Cell Phenotype

    DEFF Research Database (Denmark)

    Munthe, Sune; Petterson, Stine Asferg; Dahlrot, Rikke Hedegaard

    2016-01-01

    and a panel of markers was used. The panel comprised of six stem cell-related markers (CD133, Musashi-1, Bmi-1, Sox-2, Nestin and Glut-3), a proliferation marker (Ki-67) as well as a chemo-resistance marker (MGMT). Computer-based automated classifiers were designed to measure the mIDH1 positive nucleus area......-fraction of the chosen markers. Moreover, orthotopic glioblastoma xenografts from five different patient-derived spheroid cultures were obtained and the tumor cells identified by human specific immunohistochemical markers. The results showed that tumor cells in the periphery of patient gliomas expressed stem cell...... in the periphery of patient gliomas have a stem cell phenotype, although it is less pronounced than in the tumor core. Novel therapies aiming at preventing recurrence should therefore take tumor stemness into account. Migrating cells in orthotopic glioblastoma xenografts preserve expression and stem cell markers...

  6. Recent Advances in Intestinal Stem Cells.

    Science.gov (United States)

    McCabe, Laura R; Parameswaran, Narayanan

    2017-09-01

    The intestine is a dynamic organ with rapid stem cell division generating epithelial cells that mature and apoptose in 3-5 days. Rapid turnover maintains the epithelial barrier and homeostasis. Current insights on intestinal stem cells (ISCs) and their regulation are discussed here. The Lgr5+ ISCs maintain intestinal homeostasis by dividing asymmetrically, but also divide symmetrically to extinguish or replace ISCs. Following radiation or mucosal injury, reserve BMI1+ ISCs as well as other crypt cells can de-differentiate into Lgr5+ ISCs. ISC niche cells, including Paneth, immune and myofibroblast cells secrete factors that regulate ISC proliferation. Finally, several studies indicate that the microbiome metabolites regulate ISC growth. ISC cells can be plastic and integrate a complexity of environmental/niche cues to trigger or suppress proliferation as needed.

  7. Liver tumor formation by a mutant retinoblastoma protein in the transgenic mice is caused by an upregulation of c-Myc target genes

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat; Sharkar, Mohammad Tofael Kabir [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Noritake, Hidenao [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kimura, Wataru; Wu, Yi-Xin [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kobayashi, Yoshimasa [Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Uezato, Tadayoshi [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Miura, Naoyuki, E-mail: nmiura@hama-med.ac.jp [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Fifty percent of the mutant Rb transgenic mice produced liver tumors. Black-Right-Pointing-Pointer In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. Black-Right-Pointing-Pointer No increase in expression of the Myc-target genes was observed in the non-tumorous liver. Black-Right-Pointing-Pointer Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, we generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with {approx}50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.

  8. Easy xeno-free and feeder-free method for isolating and growing limbal stromal and epithelial stem cells of the human cornea.

    Directory of Open Access Journals (Sweden)

    Djida Ghoubay-Benallaoua

    Full Text Available Epithelial and stromal stem cells are required to maintain corneal transparency. The aim of the study was to develop a new method to isolate and grow both corneal stromal (SSC and epithelial limbal (LSC stem cells from small human limbal biopsies under culture conditions in accordance with safety requirements mandatory for clinical use in humans. Superficial limbal explants were retrieved from human donor corneo-scleral rims. Human limbal cells were dissociated by digestion with collagenase A, either after epithelial scraping or with no scraping. Isolated cells were cultured with Essential 8 medium (E8, E8 supplemented with EGF (E8+ or Green's medium with 3T3 feeder-layers. Cells were characterized by immunostaining, RT-qPCR, colony forming efficiency, sphere formation, population doubling, second harmonic generation microscopy and differentiation potentials. LSC were obtained from unscraped explants in E8, E8+ and Green's media and were characterized by colony formation and expression of PAX6, ΔNP63α, Bmi1, ABCG2, SOX9, CK14, CK15 and vimentin, with a few cells positive for CK3. LSC underwent 28 population doublings still forming colonies. SSC were obtained from both scraped and unscraped explants in E8 and E8+ media and were characterized by sphere formation, expression of PAX6, SOX2, BMI1, NESTIN, ABCG2, KERATOCAN, VIMENTIN, SOX9, SOX10 and HNK1, production of collagen fibrils and differentiation into keratocytes, fibroblasts, myofibroblasts, neurons, adipocytes, chondrocytes and osteocytes. SSC underwent 48 population doublings still forming spheres, Thus, this new method allows both SSC and LSC to be isolated from small superficial limbal biopsies and to be primary cultured in feeder-free and xeno-free conditions, which will be useful for clinical purposes.

  9. Urinary incontinence 4 and 12 years after first delivery: risk factors associated with prevalence, incidence, remission, and persistence in a cohort of 236 women.

    Science.gov (United States)

    Pizzoferrato, Anne-Cécile; Fauconnier, Arnaud; Quiboeuf, Emeline; Morel, Karine; Schaal, Jean-Patrick; Fritel, Xavier

    2014-11-01

    Our aim was to study risk factors associated with prevalence, incidence, and remission of UI 4 and 12 years after first delivery. Seven hundred seventy-four nulliparous women who gave birth in 1996 in two French maternity units at term received a questionnaire about their urinary symptoms in 2000 and again in 2008. Two hundred thirty-six women returned a questionnaire about UI 4 and 12 years after first delivery. Four groups of women were built: (A) women continent 4 and 12 years after first delivery; (B) women continent at 4 and incontinent at 12 years; (C) women incontinent at 4 and continent at 12 years; and (D) women incontinent at 4 and 12 years. Multivariate logistic regressions were used to determine risk factors of UI prevalence (groups B + D vs. A + C), incidence (B vs. A), remission (C vs. D), and onset of UI (D vs. Factors associated with UI 12 years after first pregnancy were: BMI (OR = 1.17 [95%CI: 1.04-1.32], by 1 kg/m(2) ) and increasing BMI (1.43 [1.19-1.73]), first child's weight (1.08 [1.001-1.16], by 100 g) and UI during first pregnancy (3.77 [1.83-7.76]). Factors associated with UI incidence were age at first delivery (0.86 [0.75-0.98]) and high BMI (1.24 [1.05-1.45]). Increasing BMI, UI during first pregnancy, and heavy first child reduce the likelihood of UI remission (0.37 [0.20-0.68], 0.11 [0.02-0.63], and 0.73[0.59-0.91], respectively). UI during first pregnancy could be indicative of individual susceptibility to UI. Obesity appears to be a modifiable factor for remission of UI in women. © 2013 Wiley Periodicals, Inc.

  10. Targeting p38 Mitogen-Activated Protein Kinase Signaling Restores Subventricular Zone Neural Stem Cells and Corrects Neuromotor Deficits in Atm Knockout Mouse

    Science.gov (United States)

    Kim, Jeesun

    2012-01-01

    Ataxia-telangiectasia (A-T) is a progressive degenerative disorder that results in major neurological disability. In A-T patients, necropsy has revealed atrophy of cerebellar cortical layers along with Purkinje and granular cell loss. We have previously identified an oxidative stress-mediated increase in phospho-p38 mitogen-activated protein kinase (MAPK) and the resultant downregulation of Bmi-1 and upregulation of p21 as key components of the mechanism causing defective proliferation of neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm−/− mice. However, the in vivo aspect of alteration in SVZ tissue and the functional significance of p38MAPK activation in NSCs for neuropathogenesis of ATM deficiency remain unknown. Here we show that the NSC population was abnormally decreased in the SVZ of 3-month-old Atm−/− mice; this decrease was accompanied by p38MAPK activation. However, after a 2-month treatment with the p38MAPK inhibitor SB203580, starting at 1 month old, Atm−/− mice showed restoration of normal levels of Bmi-1 and p21 with the rescue of NSC population in the SVZ. In addition, treated Atm−/− mice exhibited more Purkinje cells in the cerebellum. Most importantly, motor coordination of Atm−/− mice was significantly improved in the treatment group. Our results show for the first time in vivo evidence of depleted NSCs in the SVZ of Atm−/− mice and also demonstrate that pharmacologic inhibition of p38MAPK signaling has the potential to treat neurological defects of A-T. This study provides a promising approach targeting the oxidative stress-dependent p38 signaling pathway not only for A-T but also for other neurodegenerative disorders. PMID:23197859

  11. Diagnostic accuracy of low-dose versus ultra-low-dose CT for lumbar disc disease and facet joint osteoarthritis in patients with low back pain with MRI correlation

    International Nuclear Information System (INIS)

    Lee, Sun Hwa; Yun, Seong Jong; Jo, Hyeon Hwan; Kim, Dong Hyeon; Song, Jae Gwang; Park, Yong Sung

    2018-01-01

    To compare the image quality, radiation dose, and diagnostic performance between low-dose (LD) and ultra-low-dose (ULD) lumbar-spine (L-spine) CT with iterative reconstruction (IR) for patients with chronic low back pain (LBP). In total, 260 patients with chronic LBP who underwent L-spine CT between November 2015 and September 2016 were prospectively enrolled. Of these, 143 underwent LD-CT with IR and 117 underwent ULD-CT with IR. The patients were divided according to their body mass index (BMI) into BMI1 (<22.9 kg/m 2 ), BMI2 (23.0-24.9 kg/m 2 ), and BMI3 (≥25 kg/m 2 ) groups. Two blinded radiologists independently evaluated the signal-to-noise ratio (SNR), qualitative image quality, and final diagnoses (lumbar disc disease and facet joint osteoarthritis). L-spine MRIs interpreted by consensus were used as the reference standard. All data were statistically analyzed. ULD protocol showed significantly lower SNR for all patients (p < 0.001) except the vertebral bodies and lower qualitative image quality for BMI3 patients (p ≤ 0.033). There was no statistically significant difference between ULD (sensitivity, 95.1-98.1%; specificity, 92.5-98.7%; accuracy, 94.6-98.0%) and LD protocols (sensitivity, 95.6-100%; specificity, 95.5-98.9%; accuracy, 97.4-98.1%), (all p≥0.1) in the BMI1 and BMI2; while dose was 60-68% lower with the ULD protocol. Interobserver agreements were excellent or good with regard to image quality and final diagnoses. For the BM1 and BMI2 groups, ULD-CT provided an acceptable image quality and exhibited a diagnostic accuracy similar to that of LD-CT. These findings suggest that it is a useful diagnostic tool for patients with chronic LBP who exhibit a BMI of <25 kg/m 2 . (orig.)

  12. Nrf2 is required to maintain the self-renewal of glioma stem cells

    International Nuclear Information System (INIS)

    Zhu, Jianhong; Wang, Handong; Sun, Qing; Ji, Xiangjun; Zhu, Lin; Cong, Zixiang; Zhou, Yuan; Liu, Huandong; Zhou, Mengliang

    2013-01-01

    Glioblastomas are deadly cancers that display a functional cellular hierarchy maintained by self-renewing glioma stem cells (GSCs). Self-renewal is a complex biological process necessary for maintaining the glioma stem cells. Nuclear factor rythroid 2-related factor 2(Nrf2) plays a significant role in protecting cells from endogenous and exogenous stresses. Nrf2 is a key nuclear transcription factor that regulates antioxidant response element (ARE)-containing genes. Previous studies have demonstrated the significant role of Nrf2 in the proliferation of glioblastoma, and in their resistance to radioactive therapies. We examined the effect of knocking down Nrf2 in GSCs. Nrf2 expression was down-regulated by shRNA transinfected with lentivirus. Expression levels of Nestin, Nrf2, BMI-1, Sox2 and Cyclin E were assessed by western blotting, quantitative polymerase chain reaction (qPCR) and immunohistochemistry analysis. The capacity for self-renewal in vitro was assessed by genesis of colonies. The capacity for self-renewal in vivo was analyzed by tumor genesis of xenografts in nude mice. Knockdown of Nrf2 inhibited the proliferation of GSCs, and significantly reduced the expression of BMI-1, Sox2 and CyclinE. Knocking down of Nrf2 changed the cell cycle distribution of GSCs by causing an uncharacteristic increase in the proportion of cells in the G2 phase and a decrease in the proportion of cells in the S phase of the cell cycle. Nrf2 is required to maintain the self-renewal of GSCs, and its down-regulation can attenuate the self-renewal of GSCs significantly

  13. Transcriptional response of polycomb group genes to status epilepticus in mice is modified by prior exposure to epileptic preconditioning

    Directory of Open Access Journals (Sweden)

    James eReynolds

    2015-03-01

    Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.

  14. Childhood socioeconomic position, adult socioeconomic position and social mobility in relation to markers of adiposity in early adulthood: evidence of differential effects by gender in the 1978/79 Ribeirao Preto cohort study.

    Science.gov (United States)

    Aitsi-Selmi, A; Batty, G D; Barbieri, M A; Silva, A A M; Cardoso, V C; Goldani, M Z; Marmot, M G; Bettiol, H

    2013-03-01

    Longitudinal studies drawn from high-income countries demonstrate long-term associations of early childhood socioeconomic deprivation with increased adiposity in adulthood. However, there are very few data from resource-poor countries where there are reasons to anticipate different gradients. Accordingly, we sought to characterise the nature of the socioeconomic status (SES)-adiposity association in Brazil. We use data from the Ribeirao Preto Cohort Study in Brazil in which 9067 newborns were recruited via their mothers in 1978/79 and one-in-three followed up in 2002/04 (23-25years). SES, based on family income (salaries, interest on savings, pensions and so on), was assessed at birth and early adulthood, and three different adiposity measures (body mass index (BMI), waist circumference (WC), waist-to-hip ratio (WHR)) ascertained at follow-up. The association between childhood SES, adult SES and social mobility (defined as four permutations of SES in childhood and adulthood: low-low, low-high, high-low, high-high), and the adiposity measures was examined using linear regression. There was evidence that the association between SES and the three markers of adiposity was modified by gender in both adulthood (P<0.02 for all outcomes) and childhood SES (P<0.02 for WC and WHR). Thus, in an unadjusted model, linear regression analyses showed that higher childhood SES was associated with lower adiposity in women (coefficient (95% confidence intervals) BMI: -1.49 (-2.29,-0.69); WC: -3.85 (-5.73,-1.97); WHR: -0.03 (-0.04,-0.02)). However, in men, higher childhood SES was related to higher adiposity (BMI: 1.03 (0.28,-1.78); WC: 3.15 (1.20, 5.09); WHR: 0.009 (-0.001, 0.019)) although statistical significance was not seen in all analyses. There was a suggestion that adult SES (but not adult health behaviours or birthweight) accounted for these relationships in women only. Upward mobility was associated with protection against greater adiposity in women but not men. In the

  15. Causal Associations of Adiposity and Body Fat Distribution With Coronary Heart Disease, Stroke Subtypes, and Type 2 Diabetes Mellitus: A Mendelian Randomization Analysis.

    Science.gov (United States)

    Dale, Caroline E; Fatemifar, Ghazaleh; Palmer, Tom M; White, Jon; Prieto-Merino, David; Zabaneh, Delilah; Engmann, Jorgen E L; Shah, Tina; Wong, Andrew; Warren, Helen R; McLachlan, Stela; Trompet, Stella; Moldovan, Max; Morris, Richard W; Sofat, Reecha; Kumari, Meena; Hyppönen, Elina; Jefferis, Barbara J; Gaunt, Tom R; Ben-Shlomo, Yoav; Zhou, Ang; Gentry-Maharaj, Aleksandra; Ryan, Andy; Mutsert, Renée de; Noordam, Raymond; Caulfield, Mark J; Jukema, J Wouter; Worrall, Bradford B; Munroe, Patricia B; Menon, Usha; Power, Chris; Kuh, Diana; Lawlor, Debbie A; Humphries, Steve E; Mook-Kanamori, Dennis O; Sattar, Naveed; Kivimaki, Mika; Price, Jacqueline F; Davey Smith, George; Dudbridge, Frank; Hingorani, Aroon D; Holmes, Michael V; Casas, Juan P

    2017-06-13

    The implications of different adiposity measures on cardiovascular disease etiology remain unclear. In this article, we quantify and contrast causal associations of central adiposity (waist-to-hip ratio adjusted for body mass index [WHRadjBMI]) and general adiposity (body mass index [BMI]) with cardiometabolic disease. Ninety-seven independent single-nucleotide polymorphisms for BMI and 49 single-nucleotide polymorphisms for WHRadjBMI were used to conduct Mendelian randomization analyses in 14 prospective studies supplemented with coronary heart disease (CHD) data from CARDIoGRAMplusC4D (Coronary Artery Disease Genome-wide Replication and Meta-analysis [CARDIoGRAM] plus The Coronary Artery Disease [C4D] Genetics; combined total 66 842 cases), stroke from METASTROKE (12 389 ischemic stroke cases), type 2 diabetes mellitus from DIAGRAM (Diabetes Genetics Replication and Meta-analysis; 34 840 cases), and lipids from GLGC (Global Lipids Genetic Consortium; 213 500 participants) consortia. Primary outcomes were CHD, type 2 diabetes mellitus, and major stroke subtypes; secondary analyses included 18 cardiometabolic traits. Each one standard deviation (SD) higher WHRadjBMI (1 SD≈0.08 U) associated with a 48% excess risk of CHD (odds ratio [OR] for CHD, 1.48; 95% confidence interval [CI], 1.28-1.71), similar to findings for BMI (1 SD≈4.6 kg/m 2 ; OR for CHD, 1.36; 95% CI, 1.22-1.52). Only WHRadjBMI increased risk of ischemic stroke (OR, 1.32; 95% CI, 1.03-1.70). For type 2 diabetes mellitus, both measures had large effects: OR, 1.82 (95% CI, 1.38-2.42) and OR, 1.98 (95% CI, 1.41-2.78) per 1 SD higher WHRadjBMI and BMI, respectively. Both WHRadjBMI and BMI were associated with higher left ventricular hypertrophy, glycemic traits, interleukin 6, and circulating lipids. WHRadjBMI was also associated with higher carotid intima-media thickness (39%; 95% CI, 9%-77% per 1 SD). Both general and central adiposity have causal effects on CHD and type 2 diabetes mellitus

  16. Diagnostic accuracy of low-dose versus ultra-low-dose CT for lumbar disc disease and facet joint osteoarthritis in patients with low back pain with MRI correlation

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sun Hwa [Inje University College of Medicine, Department of Emergency Medicine, Sanggye Paik Hospital, Nowon-gu (Korea, Republic of); Yun, Seong Jong; Jo, Hyeon Hwan; Kim, Dong Hyeon [Republic of Korea Air Force, Department of Radiology, Aerospace Medical Center, Cheongwon-gun, Chungcheongbuk-do (Korea, Republic of); Song, Jae Gwang [Republic of Korea Air Force, Department of Orthopedic Surgery, Aerospace Medical Center, Cheongwon-gun, Chungcheongbuk-do (Korea, Republic of); Park, Yong Sung [Kyung Hee University Hospital at Gangdong, Kyung Hee University School of Medicine, Department of Radiology, Seoul (Korea, Republic of)

    2018-04-15

    To compare the image quality, radiation dose, and diagnostic performance between low-dose (LD) and ultra-low-dose (ULD) lumbar-spine (L-spine) CT with iterative reconstruction (IR) for patients with chronic low back pain (LBP). In total, 260 patients with chronic LBP who underwent L-spine CT between November 2015 and September 2016 were prospectively enrolled. Of these, 143 underwent LD-CT with IR and 117 underwent ULD-CT with IR. The patients were divided according to their body mass index (BMI) into BMI1 (<22.9 kg/m{sup 2}), BMI2 (23.0-24.9 kg/m{sup 2}), and BMI3 (≥25 kg/m{sup 2}) groups. Two blinded radiologists independently evaluated the signal-to-noise ratio (SNR), qualitative image quality, and final diagnoses (lumbar disc disease and facet joint osteoarthritis). L-spine MRIs interpreted by consensus were used as the reference standard. All data were statistically analyzed. ULD protocol showed significantly lower SNR for all patients (p < 0.001) except the vertebral bodies and lower qualitative image quality for BMI3 patients (p ≤ 0.033). There was no statistically significant difference between ULD (sensitivity, 95.1-98.1%; specificity, 92.5-98.7%; accuracy, 94.6-98.0%) and LD protocols (sensitivity, 95.6-100%; specificity, 95.5-98.9%; accuracy, 97.4-98.1%), (all p≥0.1) in the BMI1 and BMI2; while dose was 60-68% lower with the ULD protocol. Interobserver agreements were excellent or good with regard to image quality and final diagnoses. For the BM1 and BMI2 groups, ULD-CT provided an acceptable image quality and exhibited a diagnostic accuracy similar to that of LD-CT. These findings suggest that it is a useful diagnostic tool for patients with chronic LBP who exhibit a BMI of <25 kg/m{sup 2}. (orig.)

  17. A cross sectional study investigating the association between exposure to food outlets and childhood obesity in Leeds, UK.

    Science.gov (United States)

    Griffiths, Claire; Frearson, Anna; Taylor, Adam; Radley, Duncan; Cooke, Carlton

    2014-12-06

    Current UK policy in relation to the influence of the 'food environment' on childhood obesity appears to be driven largely on assumptions or speculations because empirical evidence is lacking and findings from studies are inconsistent. The aim of this study was to investigate the number of food outlets and the proximity of food outlets in the same sample of children, without solely focusing on fast food. Cross sectional study over 3 years (n = 13,291 data aggregated). Body mass index (BMI) was calculated for each participant, overweight and obesity were defined as having a BMI >85(th) (sBMI 1.04) and 95(th) (sBMI 1.64) percentiles respectively (UK90 growth charts). Home and school neighbourhoods were defined as circular buffers with a 2 km Euclidean radius, centred on these locations. Commuting routes were calculated using the shortest straight line distance, with a 2 km buffer to capture varying routes. Data on food outlet locations was sourced from Leeds City Council covering the study area and mapped against postcode. Food outlets were categorised into three groups, supermarkets, takeaway and retail. Proximity to the nearest food outlet in the home and school environmental domain was also investigated. Age, gender, ethnicity and deprivation (IDACI) were included as covariates in all models. There is no evidence of an association between the number of food outlets and childhood obesity in any of these environments; Home Q4 vs. Q1 OR = 1.11 (95% CI = 0.95-1.30); School Q4 vs. Q1 OR = 1.00 (95% CI 0.87 - 1.16); commute Q4 vs. Q1 OR = 0.1.00 (95% CI 0.83 - 1.20). Similarly there is no evidence of an association between the proximity to the nearest food outlet and childhood obesity in the home (OR = 0.77 [95% CI = 0.61 - 0.98]) or the school (OR = 1.01 [95% CI 0.84 - 1.23]) environment. This study provides little support for the notion that exposure to food outlets in the home, school and commuting neighbourhoods increase the risk of obesity

  18. Células madre: generalidades, eventos biológicos y moleculares Stem cells: general aspects, biological and molecular events

    Directory of Open Access Journals (Sweden)

    Mónica María Cortés Márquez

    2008-09-01

    Full Text Available Las autorrenovación y la diferenciación son características de las células madre que varían entre los diferentes tipos celulares según el tejido en el que se encuentren y el microambiente que las rodee. En ambos procesos intervienen inhibidores del ciclo celular, genes implicados en rearreglos cromosómicos, proteínas del desarrollo esencial y vías de señalización específicas. La autorrenovación está regulada por diversos mecanismos, entre los cuales se destacan las vías Wnt, Notch y Hedgehog, y los factores BMI-1, p16Ink4a, ARF, NANOG, OCT3/4, SOX2, HOXB4 y sus páralogos. Los adelantos en el conocimiento de la biología de las células madre y de los mecanismos moleculares que regulan la autorrenovación y la diferenciación han convertido a estas células en una importante promesa para la investigación básica y aplicada. Self-renewal capacity and differentiation are features of stem cells that vary among the different cellular types according to the tissue in which they reside and the surrounding microenvironment. Cellular cycle inhibitors, genes implied in chromosomal rearrangements, essential development proteins and specific signaling pathways intervene in these processes. Self-renewal is regulated by different mechanisms, the most important of which are the Wnt, Notch and Hedgehog pathways, and the factors BMI-1, p16Ink4a, ARF, NANOG, OCT3/4, SOX2, HOXB4 and their paralogs. Advances in the knowledge of stem cells biology and of the molecular mechanisms that influence their selfrenewal and differentiation have made these cells an important promise for both basic and appliedresearch.

  19. Absence of mutations in the coding sequence of the potential tumor suppressor 3pK in metastatic melanoma

    Directory of Open Access Journals (Sweden)

    Houben Roland

    2005-12-01

    Full Text Available Abstract Background Activation of Ras or Raf contributes to tumorigenesis of melanoma. However, constitutive Raf activation is also a characteristic of the majority of benign melanocytic nevi and high intensity signaling of either Ras or Raf was found to induce growth inhibition and senescence rather than transformation. Since the chromosome 3p kinase (3pK is a target of the Ras/Raf/Mek/Erk signaling pathway which antagonizes the function of the oncogene and anti-differentiation factor Bmi-1, 3pK may function as a tumor suppressor in tumors with constitutive Ras/Raf activation. Consequently, we tested whether inactivating 3pK mutations are present in melanoma. Methods 30 metastatic melanoma samples, which were positive for activating mutations of either BRaf or NRas, were analyzed for possible mutations in the 3pk gene. The 10 coding exons and their flanking intron sequences were amplified by PCR and direct sequencing of the PCR products was performed. Results This analysis revealed that besides the presence of some single nucleotide polymorphisms in the 3pk gene, we could not detect any possible loss of function mutation in any of these 30 metastatic melanoma samples selected for the presence of activating mutations within the Ras/Raf/Mek/Erk signaling pathway. Conclusion Hence, in melanoma with constitutively active Ras/Raf inactivating mutations within the 3pk gene do not contribute to the oncogenic phenotype of this highly malignant tumor.

  20. In vivo transcriptional profile analysis reveals RNA splicing and chromatin remodeling as prominent processes for adult neurogenesis.

    Science.gov (United States)

    Lim, Daniel A; Suárez-Fariñas, Mayte; Naef, Felix; Hacker, Coleen R; Menn, Benedicte; Takebayashi, Hirohide; Magnasco, Marcelo; Patil, Nila; Alvarez-Buylla, Arturo

    2006-01-01

    Neural stem cells and neurogenesis persist in the adult mammalian brain subventricular zone (SVZ). Cells born in the rodent SVZ migrate to the olfactory bulb (Ob) where they differentiate into interneurons. To determine the gene expression and functional profile of SVZ neurogenesis, we performed three complementary sets of transcriptional analysis experiments using Affymetrix GeneChips: (1) comparison of adult mouse SVZ and Ob gene expression profiles with those of the striatum, cerebral cortex, and hippocampus; (2) profiling of SVZ stem cells and ependyma isolated by fluorescent-activated cell sorting (FACS); and (3) analysis of gene expression changes during in vivo SVZ regeneration after anti-mitotic treatment. Gene Ontology (GO) analysis of data from these three separate approaches showed that in adult SVZ neurogenesis, RNA splicing and chromatin remodeling are biological processes as statistically significant as cell proliferation, transcription, and neurogenesis. In non-neurogenic brain regions, RNA splicing and chromatin remodeling were not prominent processes. Fourteen mRNA splicing factors including Sf3b1, Sfrs2, Lsm4, and Khdrbs1/Sam68 were detected along with 9 chromatin remodeling genes including Mll, Bmi1, Smarcad1, Baf53a, and Hat1. We validated the transcriptional profile data with Northern blot analysis and in situ hybridization. The data greatly expand the catalogue of cell cycle components, transcription factors, and migration genes for adult SVZ neurogenesis and reveal RNA splicing and chromatin remodeling as prominent biological processes for these germinal cells.

  1. Adhesion-mediated self-renewal abilities of Ph+ blastoma cells

    International Nuclear Information System (INIS)

    Funayama, Keiji; Saito-Kurimoto, Yumi; Ebihara, Yasuhiro; Shimane, Miyuki; Nomura, Hitoshi; Tsuji, Ko-ichiro; Asano, Shigetaka

    2010-01-01

    The Philadelphia chromosome-positive blastoma, maintained by serial subcutaneous transplantation in nude mice, is a highly proliferating biological mass consisting of homogenous CD34 + CD38 - myeloblastoid cells. These cells newly evolved from pluripotent leukemia stem cells of chronic myeloid leukemia in the chronic phase. Therefore, this mass may provide a unique tool for better understanding cellular and molecular mechanisms of self-renewal of leukemia stem cells. In this paper, we demonstrated that intravenously injected blastoma cells can cause Ph+ blastic leukemia with multiple invasive foci in NOD/SCID mice but not in nude mice. In addition, using an in vitro culture system, we clearly showed that blastoma cell adhesion to OP9 stromal cells accelerates blastoma cell proliferation that is associated with up-regulation of BMI1 gene expression; increased levels of β-catenin and the Notch1 intra-cellular domain; and changed the expression pattern of variant CD44 forms, which are constitutively expressed in these blastoma cells. These findings strongly suggest that adhesion of leukemic stem cells to stromal cells via CD44 might be indispensable for their cellular defense against attack by immune cells and for maintenance of their self-renewal ability.

  2. Foxl1-Expressing Mesenchymal Cells Constitute the Intestinal Stem Cell NicheSummary

    Directory of Open Access Journals (Sweden)

    Reina Aoki

    2016-03-01

    Full Text Available Background & Aims: Intestinal epithelial stem cells that express leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5 and/or B cell specific Moloney murine leukemia virus integration site 1 (Bmi1 continuously replicate and generate differentiated cells throughout life. Previously, Paneth cells were suggested to constitute an epithelium-intrinsic niche that regulates the behavior of these stem cells. However, ablating Paneth cells has no effect on the maintenance of functional stem cells. Here, we show definitively that a small subset of mesenchymal subepithelial cells expressing the winged-helix transcription factor forkhead box l1 (Foxl1 are a critical component of the intestinal stem cell niche. Methods: We genetically ablated Foxl1+ mesenchymal cells in adult mice using 2 separate models by expressing either the human or simian diphtheria toxin receptor under Foxl1 promoter control. Conclusions: Killing Foxl1+ cells by diphtheria toxin administration led to an abrupt cessation of proliferation of both epithelial stem- and transit-amplifying progenitor cell populations that was associated with a loss of active Wnt signaling to the intestinal epithelium. Therefore, Foxl1-expressing mesenchymal cells constitute the fundamental niche for intestinal stem cells. Keywords: Intestinal Stem Cell Niche, Wnt, Mesenchyme

  3. Metformin inhibits TGF-β1-induced epithelial-to-mesenchymal transition-like process and stem-like properties in GBM via AKT/mTOR/ZEB1 pathway.

    Science.gov (United States)

    Song, Yang; Chen, Yong; Li, Yunqian; Lyu, Xiaoyan; Cui, Jiayue; Cheng, Ye; Zhao, Liyan; Zhao, Gang

    2018-01-23

    Glioblastoma (GBM) is the most frequent and aggressive brain tumor in adults. In spite of advances in diagnosis and therapy, the prognosis is still relatively poor. The invasive property of GBM is the major cause of death in patients. Epithelial-to-mesenchymal transition-like process (EMT-like process) is considered to play an important role in the invasive property. Metformin has been reported as a regulator of EMT-like process. In this study, we confirmed that metformin inhibited TGF-β1-induced EMT-like process and EMT-associated migration and invasion in LN18 and U87 GBM cells. Our results also showed that metformin significantly suppressed self-renewal capacity of glioblastoma stem cells (GSCs), and expression of stem cell markers Bmi1, Sox2 and Musashi1, indicating that metformin can inhibit cancer stem-like properties of GBM cells. We further clarified that metformin specifically inhibited TGF-β1 activated AKT, the downstream molecular mTOR and the leading transcription factor ZEB1. Taken together, our data demonstrate that metformin inhibits TGF-β1-induced EMT-like process and cancer stem-like properties in GBM cells via AKT/mTOR/ZEB1 pathway and provide evidence of metformin for further clinical investigation targeted GBM.

  4. Identification and characterisation of side population cells in the canine pituitary gland.

    Science.gov (United States)

    van Rijn, Sarah J; Gremeaux, Lies; Riemers, Frank M; Brinkhof, Bas; Vankelecom, Hugo; Penning, Louis C; Meij, Björn P

    2012-06-01

    To date, stem/progenitor cells have not been identified in the canine pituitary gland. Cells that efficiently exclude the vital dye Hoechst 33342 can be visualised and identified using fluorescence activated cell sorting (FACS) as a 'side population' (SP), distinct from the main population (MP). Such SPs have been identified in several tissues and display stem/progenitor cell characteristics. In this study, a small SP (1.3%, n=6) was detected in the anterior pituitary glands of healthy dogs. Quantitative PCR indicated significantly higher expression of CD34 and Thy1 in this SP, but no differences in the expression of CD133, Bmi-1, Axin2 or Shh. Pro-opiomelanocortin (POMC) and Lhx3 expression were significantly higher in the MP than in the SP, but no differences in the expression of Tpit, GH or PRL were found. The study demonstrated the existence of an SP of cells in the normal canine pituitary gland, encompassing cells with stem cell characteristics and without POMC expression. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Bacterially-Associated Transcriptional Remodelling in a Distinct Genomic Subtype of Colorectal Cancer Provides a Plausible Molecular Basis for Disease Development.

    Directory of Open Access Journals (Sweden)

    Katie S Lennard

    Full Text Available The relevance of specific microbial colonisation to colorectal cancer (CRC disease pathogenesis is increasingly recognised, but our understanding of possible underlying molecular mechanisms that may link colonisation to disease in vivo remains limited. Here, we investigate the relationships between the most commonly studied CRC-associated bacteria (Enterotoxigenic Bacteroides fragilis, pks+ Escherichia coli, Fusobacterium spp., afaC+ E. coli, Enterococcus faecalis & Enteropathogenic E. coli and altered transcriptomic and methylation profiles of CRC patients, in order to gain insight into the potential contribution of these bacteria in the aetiopathogenesis of CRC. We show that colonisation by E. faecalis and high levels of Fusobacterium is associated with a specific transcriptomic subtype of CRC that is characterised by CpG island methylation, microsatellite instability and a significant increase in inflammatory and DNA damage pathways. Analysis of the significant, bacterially-associated changes in host gene expression, both at the level of individual genes as well as pathways, revealed a transcriptional remodeling that provides a plausible mechanistic link between specific bacterial colonisation and colorectal cancer disease development and progression in this subtype; these included upregulation of REG3A, REG1A and REG1P in the case of high-level colonization by Fusobacterium, and CXCL10 and BMI1 in the case of colonisation by E. faecalis. The enrichment of both E. faecalis and Fusobacterium in this CRC subtype suggests that polymicrobial colonisation of the colonic epithelium may well be an important aspect of colonic tumourigenesis.

  6. A genome-wide association meta-analysis identifies new childhood obesity loci

    Science.gov (United States)

    Bradfield, Jonathan P.; Taal, H. Rob; Timpson, Nicholas J.; Scherag, André; Lecoeur, Cecile; Warrington, Nicole M.; Hypponen, Elina; Holst, Claus; Valcarcel, Beatriz; Thiering, Elisabeth; Salem, Rany M.; Schumacher, Fredrick R.; Cousminer, Diana L.; Sleiman, Patrick M.A.; Zhao, Jianhua; Berkowitz, Robert I.; Vimaleswaran, Karani S.; Jarick, Ivonne; Pennell, Craig E.; Evans, David M.; St. Pourcain, Beate; Berry, Diane J.; Mook-Kanamori, Dennis O; Hofman, Albert; Rivadeinera, Fernando; Uitterlinden, André G.; van Duijn, Cornelia M.; van der Valk, Ralf J.P.; de Jongste, Johan C.; Postma, Dirkje S.; Boomsma, Dorret I.; Gauderman, William J.; Hassanein, Mohamed T.; Lindgren, Cecilia M.; Mägi, Reedik; Boreham, Colin A.G.; Neville, Charlotte E.; Moreno, Luis A.; Elliott, Paul; Pouta, Anneli; Hartikainen, Anna-Liisa; Li, Mingyao; Raitakari, Olli; Lehtimäki, Terho; Eriksson, Johan G.; Palotie, Aarno; Dallongeville, Jean; Das, Shikta; Deloukas, Panos; McMahon, George; Ring, Susan M.; Kemp, John P.; Buxton, Jessica L.; Blakemore, Alexandra I.F.; Bustamante, Mariona; Guxens, Mònica; Hirschhorn, Joel N.; Gillman, Matthew W.; Kreiner-Møller, Eskil; Bisgaard, Hans; Gilliland, Frank D.; Heinrich, Joachim; Wheeler, Eleanor; Barroso, Inês; O'Rahilly, Stephen; Meirhaeghe, Aline; Sørensen, Thorkild I.A.; Power, Chris; Palmer, Lyle J.; Hinney, Anke; Widen, Elisabeth; Farooqi, I. Sadaf; McCarthy, Mark I.; Froguel, Philippe; Meyre, David; Hebebrand, Johannes; Jarvelin, Marjo-Riitta; Jaddoe, Vincent W.V.; Smith, George Davey; Hakonarson, Hakon; Grant, Struan F.A.

    2012-01-01

    Multiple genetic variants have been associated with adult obesity and a few with severe obesity in childhood; however, less progress has been made to establish genetic influences on common early-onset obesity. We performed a North American-Australian-European collaborative meta-analysis of fourteen studies consisting of 5,530 cases (≥95th percentile of body mass index (BMI)) and 8,318 controls (<50th percentile of BMI) of European ancestry. Taking forward the eight novel signals yielding association with P < 5×10−6 in to nine independent datasets (n = 2,818 cases and 4,083 controls) we observed two loci that yielded a genome wide significant combined P-value, namely near OLFM4 on 13q14 (rs9568856; P=1.82×10−9; OR=1.22) and within HOXB5 on 17q21 (rs9299; P=3.54×10−9; OR=1.14). Both loci continued to show association when including two extreme childhood obesity cohorts (n = 2,214 cases and 2,674 controls). Finally, these two loci yielded directionally consistent associations in the GIANT meta-analysis of adult BMI1. PMID:22484627

  7. Combined effects of smoking and alcohol on metabolic syndrome: the LifeLines cohort study.

    Directory of Open Access Journals (Sweden)

    Sandra N Slagter

    Full Text Available INTRODUCTION: The development of metabolic syndrome (MetS is influenced by environmental factors such as smoking and alcohol consumption. We determined the combined effects of smoking and alcohol on MetS and its individual components. METHODS: 64,046 participants aged 18-80 years from the LifeLines Cohort study were categorized into three body mass index (BMI classes (BMI1 drink/day and tobacco showed higher triglycerides levels. Up to 2 drinks/day was associated with a smaller waist circumference in overweight and obese individuals. Consumption of >2 drinks/day increased blood pressure, with the strongest associations found for heavy smokers. The overall metabolic profile of wine drinkers was better than that of non-drinkers or drinkers of beer or spirits/mixed drinks. CONCLUSION: Light alcohol consumption may moderate the negative associations of smoking with MetS. Our results suggest that the lifestyle advice that emphasizes smoking cessation and the restriction of alcohol consumption to a maximum of 1 drink/day, is a good approach to reduce the prevalence of MetS.

  8. Dclk1+ small intestinal epithelial tuft cells display the hallmarks of quiescence and self-renewal

    Science.gov (United States)

    Chandrakesan, Parthasarathy; May, Randal; Qu, Dongfeng; Weygant, Nathaniel; Taylor, Vivian E.; Li, James D.; Ali, Naushad; Sureban, Sripathi M.; Qante, Michael; Wang, Timothy C.; Bronze, Michael S.; Houchen, Courtney W.

    2015-01-01

    To date, no discrete genetic signature has been defined for isolated Dclk1+ tuft cells within the small intestine. Furthermore, recent reports on the functional significance of Dclk1+ cells in the small intestine have been inconsistent. These cells have been proposed to be fully differentiated cells, reserve stem cells, and tumor stem cells. In order to elucidate the potential function of Dclk1+ cells, we FACS-sorted Dclk1+ cells from mouse small intestinal epithelium using transgenic mice expressing YFP under the control of the Dclk1 promoter (Dclk1-CreER;Rosa26-YFP). Analysis of sorted YFP+ cells demonstrated marked enrichment (~6000 fold) for Dclk1 mRNA compared with YFP− cells. Dclk1+ population display ~6 fold enrichment for the putative quiescent stem cell marker Bmi1. We observed significantly greater expression of pluripotency genes, pro-survival genes, and quiescence markers in the Dclk1+ population. A significant increase in self-renewal capability (14-fold) was observed in in vitro isolated Dclk1+ cells. The unique genetic report presented in this manuscript suggests that Dclk1+ cells may maintain quiescence, pluripotency, and metabolic activity for survival/longevity. Functionally, these reserve characteristics manifest in vitro, with Dclk1+ cells exhibiting greater ability to self-renew. These findings indicate that quiescent stem-like functionality is a feature of Dclk1-expressing tuft cells. PMID:26362399

  9. Identification of CD24 as a cancer stem cell marker in human nasopharyngeal carcinoma.

    Directory of Open Access Journals (Sweden)

    Chun-Hung Yang

    Full Text Available Cancer stem cells (CSCs represent a unique sub-population of tumor cells with the ability to initiate tumor growth and sustain self-renewal. Although CSC biomarkers have been described for various tumors, only a few markers have been identified for nasopharyngeal carcinoma (NPC. In this study, we show that CD24+ cells isolated from human NPC cell lines express stem cell genes (Sox2, Oct4, Nanog, Bmi-1, and Rex-1, and show activation of the Wnt/β-catenin signaling pathway. CD24+ cells possess typical CSC characteristics that include enhanced cell proliferation, increased colony and sphere formation, maintenance of cell differentiation potential in prolonged culture, and enhanced resistance to chemotherapeutic drugs. Notably, CD24+ cells produce tumors following inoculation of as few as 500 cells in immunodeficient NOD/SCID mice. CD24+ cells further show increased invasion ability in vitro, which correlates with enhanced expression of matrix metalloproteinase 2 and 9. In summary, our results suggest that CD24 represents a novel CSC biomarker in NPC.

  10. Effects of a High-Protein/Low-Carbohydrate Diet versus a Standard Hypocaloric Diet on Weight and Cardiovascular Risk Factors: Role of a Genetic Variation in the rs9939609 FTO Gene Variant.

    Science.gov (United States)

    de Luis, Daniel Antonio; Aller, Rocío; Izaola, Olatz; Primo, David; Urdiales, Silvia; Romero, Enrique

    2015-01-01

    The common polymorphism rs9939609 of the fat mass- and obesity-associated gene (FTO) has been linked to obesity. Our aim was to investigate its role in weight loss after the administration of a high-protein/low-carbohydrate diet compared to a standard hypocaloric diet (1,000 kcal/day). During 9 months, 195 patients were randomly allocated to a high-protein hypocaloric diet (HP diet) and a standard hypocaloric diet (S diet). With the HP diet, BMI (-1.9 ± 1.2 vs. -2.10 ± 1.8; p diet, BMI (-0.9 ± 1.1 vs. -1.8 ± 1.2; p diet and in both genotype groups, glucose, insulin levels, homeostasis model assessment of insulin resistance (HOMA-IR), total cholesterol, triglycerides and low-density lipoprotein (LDL) decreased. With the S diet, total cholesterol and LDL decreased. Weight loss was better in A allele carriers than noncarriers, and metabolic improvement was better with the HP diet. © 2015 S. Karger AG, Basel.

  11. Is the association between ACE genes and blood pressure mediated by postnatal growth during the first 3 years?

    Science.gov (United States)

    Min, JungWon; Kim, Young Ju; Lee, Hwayoung; Park, Eun Ae; Cho, Su Jin; Hong, Young Mi; Oh, Se-Young; Ha, Eunhee; Kang, DukHee; Park, Hyesook

    2012-06-01

    Unlike the defined role of angiotensin-converting enzyme (ACE) gene in adult hypertension, ACE gene did not show direct influence on childhood blood pressure (BP), rather, seemed to be related to childhood growth with age-dependent characteristics. Thus, we examined intermediate effects of postnatal growth between the ACE polymorphisms and BP. We analyzed data from 257 children born in 2001-04 at Ewha Womans University Hospital in Seoul, Korea, and followed them up until 3 years of age. Children with excessive adiposity had higher BP, as rapid growers did to no-change and decelerated growers. The ACE II genotype was associated with greater growth acceleration than the DD genotype (II: 46.8% vs. DD: 23.9%), and with a higher BP. The interactions between ACE genotype and adiposity at age 3 were significant on the BP levels. The highest BP increase with the same degree of adiposity was observed in those with the II genotype [β (SE) for BMI: 1.9 (0.9), p=0.04]; particularly, only rapid grown II carriers demonstrated statistical significance on this linear association. These results suggested that ACE polymorphisms and BP association are mediated by postnatal growth. Further studies are required to determine the age-specific ACE genetic effects and its undefined biological mechanism. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Supermarket purchase contributes to nutrition-related non-communicable diseases in urban Kenya.

    Science.gov (United States)

    Demmler, Kathrin M; Klasen, Stephan; Nzuma, Jonathan M; Qaim, Matin

    2017-01-01

    While undernutrition and related infectious diseases are still pervasive in many developing countries, the prevalence of non-communicable diseases (NCD), typically associated with high body mass index (BMI), is rapidly rising. The fast spread of supermarkets and related shifts in diets were identified as possible factors contributing to overweight and obesity in developing countries. Potential effects of supermarkets on people's health have not been analyzed up till now. This study investigates the effects of purchasing food in supermarkets on people's BMI, as well as on health indicators such as fasting blood glucose (FBG), blood pressure (BP), and the metabolic syndrome. This study uses cross-section observational data from urban Kenya. Demographic, anthropometric, and bio-medical data were collected from 550 randomly selected adults. Purchasing food in supermarkets is defined as a binary variable that takes a value of one if any food was purchased in supermarkets during the last 30 days. In a robustness check, the share of food purchased in supermarkets is defined as a continuous variable. Instrumental variable regressions are applied to control for confounding factors and establish causality. Purchasing food in supermarkets contributes to higher BMI (+ 1.8 kg/m2) (Pobese (Pobesity, supermarkets contribute to nutrition-related NCDs. Effects of supermarkets on nutrition and health can mainly be ascribed to changes in the composition of people's food choices.

  13. Hypothalamic stem cells control ageing speed partly through exosomal miRNAs.

    Science.gov (United States)

    Zhang, Yalin; Kim, Min Soo; Jia, Baosen; Yan, Jingqi; Zuniga-Hertz, Juan Pablo; Han, Cheng; Cai, Dongsheng

    2017-08-03

    It has been proposed that the hypothalamus helps to control ageing, but the mechanisms responsible remain unclear. Here we develop several mouse models in which hypothalamic stem/progenitor cells that co-express Sox2 and Bmi1 are ablated, as we observed that ageing in mice started with a substantial loss of these hypothalamic cells. Each mouse model consistently displayed acceleration of ageing-like physiological changes or a shortened lifespan. Conversely, ageing retardation and lifespan extension were achieved in mid-aged mice that were locally implanted with healthy hypothalamic stem/progenitor cells that had been genetically engineered to survive in the ageing-related hypothalamic inflammatory microenvironment. Mechanistically, hypothalamic stem/progenitor cells contributed greatly to exosomal microRNAs (miRNAs) in the cerebrospinal fluid, and these exosomal miRNAs declined during ageing, whereas central treatment with healthy hypothalamic stem/progenitor cell-secreted exosomes led to the slowing of ageing. In conclusion, ageing speed is substantially controlled by hypothalamic stem cells, partially through the release of exosomal miRNAs.

  14. Body Fat and Breast Cancer Risk in Postmenopausal Women: A Longitudinal Study

    Directory of Open Access Journals (Sweden)

    Thomas E. Rohan

    2013-01-01

    Full Text Available Associations between anthropometric indices of obesity and breast cancer risk may fail to capture the true relationship between excess body fat and risk. We used dual-energy-X-ray-absorptiometry- (DXA- derived measures of body fat obtained in the Women’s Health Initiative to examine the association between body fat and breast cancer risk; we compared these risk estimates with those for conventional anthropometric measurements. The study included 10,960 postmenopausal women aged 50–79 years at recruitment, with baseline DXA measurements and no history of breast cancer. During followup (median: 12.9 years, 503 incident breast cancer cases were diagnosed. Hazard ratios (HR and 95% confidence intervals (CI were estimated using Cox proportional hazards models. All baseline DXA-derived body fat measures showed strong positive associations with breast cancer risk. The multivariable-adjusted HR for the uppermost quintile level (versus lowest ranged from 1.53 (95% CI 1.14–2.07 for fat mass of the right leg to 2.05 (1.50–2.79 for fat mass of the trunk. Anthropometric indices (categorized by quintiles of obesity (BMI (1.97, 1.45–2.68, waist circumference (1.97, 1.46–2.65, and waist : hip ratio (1.91, 1.41–2.58 were all strongly, positively associated with risk and did not differ from DXA-derived measures in prediction of risk.

  15. Body Fat and Breast Cancer Risk in Postmenopausal Women: A Longitudinal Study

    International Nuclear Information System (INIS)

    Rohan, T. E.; Heo, M.; Kamensky, V.; Kabat, G. C.

    2013-01-01

    Associations between anthropometric indices of obesity and breast cancer risk may fail to capture the true relationship between excess body fat and risk. We used dual-energy-X-ray-absorptiometry- (DXA-) derived measures of body fat obtained in the Women’s Health Initiative to examine the association between body fat and breast cancer risk; we compared these risk estimates with those for conventional anthropometric measurements. The study included 10,960 postmenopausal women aged 50-79 years at recruitment, with baseline DXA measurements and no history of breast cancer. During followup (median: 12.9 years), 503 incident breast cancer cases were diagnosed. Hazard ratios (HR) and 95% confidence intervals (CI) were estimated using Cox proportional hazards models. All baseline DXA-derived body fat measures showed strong positive associations with breast cancer risk. The multivariable-adjusted HR for the uppermost quintile level (versus lowest) ranged from 1.53 (95% CI 1.14-2.07) for fat mass of the right leg to 2.05 (1.50-2.79) for fat mass of the trunk. Anthropometric indices (categorized by quintiles) of obesity (BMI (1.97, 1.45-2.68), waist circumference (1.97, 1.46-2.65), and waist-: hip ratio (1.91, 1.41-2.58)) were all strongly, positively associated with risk and did not differ from DXA-derived measures in prediction of risk.

  16. The Supplemental Nutrition Assistance Program, Food Insecurity, Dietary Quality, and Obesity Among U.S. Adults.

    Science.gov (United States)

    Nguyen, Binh T; Shuval, Kerem; Bertmann, Farryl; Yaroch, Amy L

    2015-07-01

    We examined whether Supplemental Nutrition Assistance Program (SNAP) participation changes associations between food insecurity, dietary quality, and weight among US adults. We analyzed adult dietary intake data (n = 8333) from the 2003 to 2010 National Health and Nutrition Examination Survey. Bivariate and multivariable methods assessed associations of SNAP participation and 4 levels of food security with diet and weight. Measures of dietary quality were the Healthy Eating Index 2010, total caloric intake, empty calories, and solid fat; weight measures were body mass index (BMI), overweight, and obesity. SNAP participants with marginal food security had lower BMI (1.83 kg/m2; P < .01) and lower probability of obesity (9 percentage points; P < .05). SNAP participants with marginal (3.46 points; P < .01), low (1.98 points; P < .05), and very low (3.84 points; P < .01) food security had better diets, as illustrated by the Healthy Eating Index. Associations between SNAP participation and improved diet and weight were stronger among Whites than Blacks and Hispanics. Our research highlights the role of SNAP in helping individuals who are at risk for food insecurity to obtain a healthier diet and better weight status.

  17. Concepts of epigenetics in prostate cancer development.

    Science.gov (United States)

    Cooper, C S; Foster, C S

    2009-01-27

    Substantial evidence now supports the view that epigenetic changes have a role in the development of human prostate cancer. Analyses of the patterns of epigenetic alteration are providing important insights into the origin of this disease and have identified specific alterations that may serve as useful diagnostic and prognostic biomarkers. Examination of cancer methylation patterns supports a stem cell origin of prostate cancer. It is well established that methylation of GSTpi is a marker of prostate cancer, and global patterns of histone marking appear to be linked to cancer prognosis with levels of acetylated histones H3K9, H3K18, and H4K12, and of dimethylated H4R3 and H3K4, dividing low-grade prostate cancer (Gleason 6 or less) into two prognostically separate groups. Elevated levels of several components of the polycomb group protein complex, EZH2, BMI1, and RING1, can also act as biomarkers of poor clinical outcome. Many components of the epigenetic machinery, including histone deacetylase (whose expression level is linked to the TMPRSS2:ERG translocation) and the histone methylase EZH2, are potential therapeutic targets. The recent discovery of the role of small RNAs in governing the epigenetic status of individual genes offers exciting new possibilities in therapeutics and chemoprevention.

  18. The immediate early gene product EGR1 and polycomb group proteins interact in epigenetic programming during chondrogenesis.

    Directory of Open Access Journals (Sweden)

    Frank Spaapen

    Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.

  19. Obesity, weight gain, and ovarian cancer risk in African American women.

    Science.gov (United States)

    Bandera, Elisa V; Qin, Bo; Moorman, Patricia G; Alberg, Anthony J; Barnholtz-Sloan, Jill S; Bondy, Melissa; Cote, Michele L; Funkhouser, Ellen; Peters, Edward S; Schwartz, Ann G; Terry, Paul; Schildkraut, Joellen M

    2016-08-01

    Although there is growing evidence that higher adiposity increases ovarian cancer risk, little is known about its impact in African American (AA) women, the racial/ethnic group with the highest prevalence of obesity. We evaluated the impact of body mass index (BMI) 1 year before diagnosis and weight gain since age 18 years on ovarian cancer risk in a population-based case-control study in AA women in 11 geographical areas in the US. Cases (n = 492) and age and site matched controls (n = 696) were identified through rapid case ascertainment and random-digit-dialing, respectively. Information was collected on demographic and lifestyle factors, including self-reported height, weight at age 18 and weight 1 year before diagnosis/interview. Multivariable logistic regression was used to compute odds ratios (OR) and 95% confidence intervals (CI), adjusting for potential covariates. Obese women had elevated ovarian cancer risk, particularly for BMI ≥ 40 kg/m(2) compared to BMI Obesity and excessive adult weight gain may increase ovarian cancer risk in post-menopausal AA women. © 2016 UICC.

  20. Loss of Mel-18 enhances breast cancer stem cell activity and tumorigenicity through activating Notch signaling mediated by the Wnt/TCF pathway.

    Science.gov (United States)

    Won, Hee-Young; Lee, Jeong-Yeon; Shin, Dong-Hui; Park, Ji-Hye; Nam, Jeong-Seok; Kim, Hyoung-Chin; Kong, Gu

    2012-12-01

    Mel-18 has been proposed as a negative regulator of Bmi-1, a cancer stem cell (CSC) marker, but it is still unclear whether Mel-18 is involved in CSC regulation. Here, we examined the effect of Mel-18 on the stemness of human breast CSCs. In Mel-18 small hairpin RNA (shRNA)-transduced MCF-7 cells, side population (SP) cells and breast CSC surface marker (CD44(+)/CD24(-)/ESA(+))-expressing cells, which imply a CSC population, were enriched. Moreover, the self-renewal of CSCs was enhanced by Mel-18 knockdown, as measured by the ability for tumorsphere formation in vitro and tumor-initiating capacity in vivo. Similarly, Mel-18 overexpression inhibited the number and self-renewal activity of breast CSCs in SK-BR-3 cells. Furthermore, our data showed that Mel-18 blockade up-regulated the expression of the Wnt/TCF target Jagged-1, a Notch ligand, and consequently activated the Notch pathway. Pharmacologic inhibition of the Notch and Wnt pathways abrogated Mel-18 knockdown-mediated tumorsphere formation ability. Taken together, our findings suggest that Mel-18 is a novel negative regulator of breast CSCs that inhibits the stem cell population and in vitro and in vivo self-renewal through the inactivation of Wnt-mediated Notch signaling.

  1. Canadian Physicians' Use of Antiobesity Drugs and Their Referral Patterns to Weight Management Programs or Providers: The SOCCER Study

    Directory of Open Access Journals (Sweden)

    R. S. Padwal

    2011-01-01

    Full Text Available Antiobesity pharmacotherapy and programs/providers that possess weight management expertise are not commonly used by physicians. The underlying reasons for this are not known. We performed a cross-sectional study in 33 Canadian medical practices (36 physicians examining 1788 overweight/obese adult patients. The frequency of pharmacotherapy use and referral for further diet, exercise, behavioral management and/or bariatric surgery was documented. If drug treatment or referral was not made, reasons were documented by choosing amongst preselected categories. Logistic regression models were used to identify predictors of antiobesity drug use. No single antiobesity management strategy was recommended by physicians in more than 50% of patients. Referral was most common for exercise (49% of cases followed by dietary advice (46%, and only 5% of eligible patients were referred for bariatric surgery. Significant predictors of initiating/continuing pharmacotherapy were male sex (OR 0.70; 95% CI 0.52–0.94, increasing BMI (1.02; 95% CI 1.01–1.03, and private drug coverage (1.78; 95% CI 1.39–2.29. “Not considered” and “patient refusal” were the main reasons for not initiating further weight management. We conclude that both physician and patient factors act as barriers to the use of weight management strategies and both need to be addressed to increase uptake of these interventions.

  2. FUEL Your Life: A Translation of the Diabetes Prevention Program to Worksites.

    Science.gov (United States)

    Wilson, Mark G; DeJoy, David M; Vandenberg, Robert; Padilla, Heather; Davis, Marsha

    2016-01-01

    To evaluate the effectiveness of FUEL Your Life, a translation of the Diabetes Prevention Program for worksites. A randomized control group design was conducted in five worksites of a large transportation company. Measures were collected pretest, posttest (6 months), and follow-up (12 months). Railroad maintenance facilities of Union Pacific Railroad. Participants consisted of 362 workers (227 treatment, 135 control). FUEL Your Life was translated from the Diabetes Prevention Program to better fit within the context of the worksite. The primary difference was the use of peer health coaches to provide social support and reinforcement and an occupational nurse to provide lesson content (six sessions of 10 minutes) to participants instead of the lifestyle coaches employed by the Diabetes Prevention Program, resulting in a less structured meeting schedule. The primary outcomes were weight and body mass index (BMI), with secondary outcomes including eating behaviors, physical activity, and social support. Latent growth modeling was used to measure changes in the outcomes over time. Participants in the intervention group maintained weight/BMI (-.1 pounds/-.1 BMI), whereas the control participants gained weight/BMI (+2.6 pounds/+.3 BMI), resulting in a statistically significant difference between groups. Fifty-five percent of intervention participants lost some weight, whereas only 35% of the control group lost weight. FUEL Your Life, a low intensity intervention, was not effective for promoting weight loss, but was effective for helping workers maintain weight over a 12-month period.

  3. Evolutionary changes of Hox genes and relevant regulatory factors provide novel insights into mammalian morphological modifications.

    Science.gov (United States)

    Li, Kui; Sun, Xiaohui; Chen, Meixiu; Sun, Yingying; Tian, Ran; Wang, Zhengfei; Xu, Shixia; Yang, Guang

    2018-01-01

    The diversity of body plans of mammals accelerates the innovation of lifestyles and the extensive adaptation to different habitats, including terrestrial, aerial and aquatic habitats. However, the genetic basis of those phenotypic modifications, which have occurred during mammalian evolution, remains poorly explored. In the present study, we synthetically surveyed the evolutionary pattern of Hox clusters that played a powerful role in the morphogenesis along the head-tail axis of animal embryos and the main regulatory factors (Mll, Bmi1 and E2f6) that control the expression of Hox genes. A deflected density of repetitive elements and lineage-specific radical mutations of Mll have been determined in marine mammals with morphological changes, suggesting that evolutionary changes may alter Hox gene expression in these lineages, leading to the morphological modification of these lineages. Although no positive selection was detected at certain ancestor nodes of lineages, the increased ω values of Hox genes implied the relaxation of functional constraints of these genes during the mammalian evolutionary process. More importantly, 49 positively-selected sites were identified in mammalian lineages with phenotypic modifications, indicating adaptive evolution acting on Hox genes and regulatory factors. In addition, 3 parallel amino acid substitutions in some Hox genes were examined in marine mammals, which might be responsible for their streamlined body. © 2017 The Authors. Integrative Zoology published by International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  4. Molecular mechanisms of MYCN-dependent apoptosis and the MDM2–p53 pathway: an Achille’s heel to be exploited for the therapy of MYCN-amplified neuroblastoma

    International Nuclear Information System (INIS)

    Petroni, Marialaura; Veschi, Veronica; Gulino, Alberto; Giannini, Giuseppe

    2012-01-01

    The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14 ARF , significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment. In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2–p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR), it stabilizes p53 and its proapoptotic kinase Homeodomain Interacting Protein Kinase 2 (HIPK2). Through the regulation of the HIPK2-p53 inhibitor High Mobility Group protein A1 (HMGA1) and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and antiapoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2–p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.

  5. Molecular mechanisms of MYCN-dependent apoptosis and the MDM2-p53 pathway: an Achille’s heel to be exploited for the therapy of MYCN amplified neuroblastoma

    Directory of Open Access Journals (Sweden)

    Marialaura ePetroni

    2012-10-01

    Full Text Available The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14ARF, significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment.In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2-p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR, it stabilizes p53 and its proapoptotic kinase HIPK2. Through the regulation of the HIPK2-p53 inhibitor HMGA1 and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and anti-apoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2-p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.

  6. Molecular mechanisms of MYCN-dependent apoptosis and the MDM2–p53 pathway: an Achille’s heel to be exploited for the therapy of MYCN-amplified neuroblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Petroni, Marialaura; Veschi, Veronica; Gulino, Alberto; Giannini, Giuseppe, E-mail: giuseppe.giannini@uniroma1.it [Department of Molecular Medicine, University “La Sapienza”, Rome (Italy)

    2012-10-12

    The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14{sup ARF}, significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment. In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2–p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR), it stabilizes p53 and its proapoptotic kinase Homeodomain Interacting Protein Kinase 2 (HIPK2). Through the regulation of the HIPK2-p53 inhibitor High Mobility Group protein A1 (HMGA1) and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and antiapoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2–p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.

  7. Metabolite Profiling of Barley Grains Subjected to Water Stress: To Explain the Genotypic Difference in Drought-Induced Impacts on Malting Quality

    Directory of Open Access Journals (Sweden)

    Xiaojian Wu

    2017-09-01

    Full Text Available Grain weight and protein content will be reduced and increased, respectively, when barley is subjected to water stress after anthesis, consequently deteriorating the malt quality. However, such adverse impact of water stress differs greatly among barley genotypes. In this study, two Tibetan wild barley accessions and two cultivated varieties differing in water stress tolerance were used to investigate the genotypic difference in metabolic profiles during grain-filling stage under drought condition. Totally, 71 differently accumulated metabolites were identified, including organic acids, amino acids/amines, and sugars/sugar alcohols. Their relative contents were significantly affected by water stress for all genotypes and differed distinctly between the wild and cultivated barleys. The principal component analysis of metabolites indicated that the Tibetan wild barley XZ147 possessed a unique response to water stress. When subjected to water stress, the wild barley XZ147 showed the most increase of β-amylase activity among the four genotypes, as a result of its higher lysine content, less indole-3-acetic acid (IAA biosynthesis, more stable H2O2 homeostasis, and more up-regulation of BMY1 gene. On the other hand, XZ147 had the most reduction of β-glucan content under water stress than the other genotypes, which could be explained by the faster grain filling process and the less expression of β-glucan synthase gene GSL7. All these results indicated a great potential for XZ147 in barley breeding for improving water stress tolerance.

  8. [Assessment of control of cardiovascular risk factors in obese posmenopausal women after monitoring a structured dietary education and exercise program. (SÍSIFO Program)].

    Science.gov (United States)

    García Soto, Z M; Montoro García, S; Leal Hernández, M; Abellán Alemán, J

    2016-01-01

    Evaluate the influence of a specific program of physical exercise on cardiovascular risk, quality of life and eating habits of menopausal women. Prospective, intervention study previous-after without control group for three months. 66 menopausal women were included. The intervention consisted of a structured diet and exercise program. Biochemical, anthropometric, dietary and life quality parameters were determined before and three months after surgery. After the intervention a decrease in weight (4.4±2,3kg) and BMI (1.83±0.84kg/m(2)) (p<.05) occurs. A decrease in SBP (p<.05) was also observed. The fasting glucose went down 13.75±11.11mg/dl and HbA1c fell by 0.19±0,12%, both with p<.05. The lipid profile follows a similar behavior, highlighting a decline of 8± 6.2mg/dl in LDL cholesterol values (p<.05). The score on the measured cardiovascular risk by the Framingham tables decreases by 3% postoperatively (p<.05). Regarding the quality of life, it is significantly improved in all analyzed areas. The application of a structured exercise and diet program improves close monitoring parameters associated with cardiovascular risk of the women studied. It also improves the quality of life and dietary habits. Copyright © 2016 SEH-LELHA. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Risk of obstructive sleep apnea with daytime sleepiness is associated with liver damage in non-morbidly obese patients with nonalcoholic fatty liver disease.

    Directory of Open Access Journals (Sweden)

    Edoardo Alessandro Pulixi

    Full Text Available BACKGROUND: A high prevalence of obstructive sleep apnea syndrome (OSAS has been reported in severely obese patients with nonalcoholic fatty liver disease (NAFLD, but few studies have evaluated OSAS in non-morbidly obese NAFLD patients. AIMS: To determine the prevalence of risk for OSAS with or without daytime sleepiness in non-morbidly obese patients with NAFLD and evaluate the association with the severity of liver damage. METHODS: We considered 159 consecutive patients with histological NAFLD and body mass index (BMI 1; 9/13, 69% vs. 39/146, 27%; p = 0.003. At multivariate logistic regression analysis, OSAS with sleepiness was strongly associated with NASH and fibrosis>1 independently of known clinical risk factors such as age, gender, BMI, diabetes, and ALT levels (OR 7.1, 95% c.i. 1.7-51, p = 0.005 and OR 14.0, 95% c.i. 3.5-70, p = 0.0002, respectively. CONCLUSIONS: A proportion of NAFLD patients without severe obesity is at risk for OSAS with daytime sleepiness, which is associated with the severity of liver damage independently of body mass and other cofactors.

  10. Prevalence and Predictors of Metabolic Syndrome in Young Asymptomatic Gujarati Population

    Directory of Open Access Journals (Sweden)

    Sharad R. Jain

    2015-01-01

    Full Text Available Background. Metabolic syndrome is a cluster of risk factors leading to the development of atherosclerotic cardiovascular diseases. We aimed to evaluate the prevalence of metabolic syndrome (MS and its predictors in young and apparently healthy Gujarati individuals. Methods. This population based cross-sectional study involved a total of 1500 healthy adults of 20–40 years of age. Demographic details and clinical data such as body mass index (BMI, waist circumference (WC, and blood pressure were measured along with the estimations of lipoprotein (a, total cholesterol (TC, triglyceride (TG, total lipid, LDL/HDL ratio, TC/HDL ratio, and fasting blood glucose (FBS. Results. Overall in young Gujarati population (20–40 years prevalence rates of MS were 16.0% (male: 21.5%; female: 10.8% where the metabolic abnormalities increased with advanced age as 9.56% of the young population (20–30 years had MS, in contrast to the 24.57% in the old (31–40 years. Odds ratio analysis had indicated BMI (1.120; 95% CI: 1.077–1.163; P<0.0001 as the strongest risk factor for MS closely followed by advancing age (1.100; 95% CI: 1.061–1.139; P<0.0001 levels. Conclusion. Prevalence of metabolic syndrome in young Gujarati population reinforces the need for early life style intervention and awareness programs in this ethnic group.

  11. Isolation and characterization of multipotent progenitor cells from the Bowman's capsule of adult human kidneys.

    Science.gov (United States)

    Sagrinati, Costanza; Netti, Giuseppe Stefano; Mazzinghi, Benedetta; Lazzeri, Elena; Liotta, Francesco; Frosali, Francesca; Ronconi, Elisa; Meini, Claudia; Gacci, Mauro; Squecco, Roberta; Carini, Marco; Gesualdo, Loreto; Francini, Fabio; Maggi, Enrico; Annunziato, Francesco; Lasagni, Laura; Serio, Mario; Romagnani, Sergio; Romagnani, Paola

    2006-09-01

    Regenerative medicine represents a critical clinical goal for patients with ESRD, but the identification of renal adult multipotent progenitor cells has remained elusive. It is demonstrated that in human adult kidneys, a subset of parietal epithelial cells (PEC) in the Bowman's capsule exhibit coexpression of the stem cell markers CD24 and CD133 and of the stem cell-specific transcription factors Oct-4 and BmI-1, in the absence of lineage-specific markers. This CD24+CD133+ PEC population, which could be purified from cultured capsulated glomeruli, revealed self-renewal potential and a high cloning efficiency. Under appropriate culture conditions, individual clones of CD24+CD133+ PEC could be induced to generate mature, functional, tubular cells with phenotypic features of proximal and/or distal tubules, osteogenic cells, adipocytes, and cells that exhibited phenotypic and functional features of neuronal cells. The injection of CD24+CD133+ PEC but not of CD24-CD133- renal cells into SCID mice that had acute renal failure resulted in the regeneration of tubular structures of different portions of the nephron. More important, treatment of acute renal failure with CD24+CD133+ PEC significantly ameliorated the morphologic and functional kidney damage. This study demonstrates the existence and provides the characterization of a population of resident multipotent progenitor cells in adult human glomeruli, potentially opening new avenues for the development of regenerative medicine in patients who have renal diseases.

  12. GSK126 (EZH2 inhibitor) interferes with ultraviolet A radiation-induced photoaging of human skin fibroblast cells

    Science.gov (United States)

    Qin, Haiyan; Zhang, Guang; Zhang, Lianbo

    2018-01-01

    Polycomb group genes (PcG) encode chromatin modification proteins that are involved in the epigenetic regulation of cell differentiation, proliferation and the aging processes. The key subunit of the PcG complex, enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), has a central role in a variety of mechanisms, such as the formation of chromatin structure, gene expression regulation and DNA damage. In the present study, ultraviolet A (UVA) was used to radiate human dermal fibroblasts in order to construct a photo-aged cell model. Subsequently, the cell viability assay, Hoechst staining, apoptosis detection using flow cytometry, senescence-associated β-galactosidase (SA-β-gal) staining and erythrocyte exclusion experiments were performed. GSK126, a histone methylation enzyme inhibitor of EZH2, was used as an experimental factor. Results suggested that GSK126 downregulated the mRNA expression levels of EZH2 and upregulated the mRNA expression levels of BMI-1. Notably, GSK126 affected the transcription of various photoaging-related genes and thus protected against photoaging induced by UVA radiation. PMID:29545866

  13. Metformin in gestational diabetes mellitus: predictors of poor response.

    Science.gov (United States)

    Gante, Inês; Melo, Luís; Dores, Jorge; Ruas, Luísa; Almeida, Maria do Céu

    2018-01-01

    Metformin can be regarded as a first-line treatment in gestational diabetes mellitus (GDM) due to its safety and effectiveness. However, a proportion of women do not achieve adequate glycemic control with metformin alone. We aim to identify predictors of this poor response to metformin. Retrospective multicentre cohort study of women with GDM who started metformin as first-line treatment. The assessed cohort was divided into a metformin group and metformin plus insulin group. Biometric and demographic characteristics, glycemic control data, obstetric, neonatal and postpartum outcomes were compared between groups and analysed in order to identify predictors of poor response to metformin. Data were analysed using STATA, version 13.1. Of the 388 women enrolled in the study, 135 (34.8%) required additional insulin therapy to achieve the glycemic targets. Higher age (aOR: 1.08 (1.03-1.13), P  = 0.003), higher pre-pregnancy body mass index (BMI) (1.06 (1.02-1.10), P  = 0.003) and earlier introduction of metformin (0.89 (0.85-0.94), P  metformin, insulin supplementation was not associated with poor neonatal outcomes. Higher age, higher pre-pregnancy BMI and earlier introduction of metformin could be used as predictors of poor response to metformin. © 2018 European Society of Endocrinology.

  14. Cyclin D1 affects epithelial–mesenchymal transition in epithelial ovarian cancer stem cell-like cells

    Directory of Open Access Journals (Sweden)

    Jiao J

    2013-06-01

    Full Text Available Jie Jiao,1,4 Lu Huang,1 Feng Ye,1 MinFeng Shi,2 XiaoDong Cheng,3 XinYu Wang,3 DongXiao Hu,3 Xing Xie,3 WeiGuo Lu31Women's Reproductive Health Laboratory of Zhejiang Province, Women's Hospital, School of Medicine, Zhejiang University, Hangzhou, 2Department of Gynaecology and Obstetrics, Changhai Hospital, the Second Military Medical University, Shanghai, 3Women's Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women's Hospital, School of Medicine, Zhejiang University, Hangzhou, 4Department of Gynaecology and Obstetrics, Hangzhou First People's Hospital, Hangzhou, People's Republic of ChinaBackground: The association of cancer stem cells with epithelial–mesenchymal transition (EMT is receiving attention. We found in our previous study that EMT existed from CD24- phenotype cells to their differentiated cells. It was shown that cyclin D1 functioned in sustaining self-renewal independent of CDK4/CDK6 activation, but its effect on the EMT mechanism in ovarian cancer stem cells is unclear.Methods: The anchorage-independent spheroids from ovarian adenocarcinoma cell line 3AO were formed in a serum-free medium. CD24- and CD24+ cells were isolated by fluorescence-activated cell sorting. Cell morphology, viability, apoptosis, and migratory ability were observed. Stem-related molecule Bmi-1, Oct-4 and EMT-related marker E-cadherin, and vimentin expressions were analyzed. Cyclin D1 expression in CD24- phenotype enriched spheroids was knocked down with small interfering RNA, and its effects on cell proliferation, apoptosis, migration ability, and EMT-related phenotype after transfection were observed. Results: In our study, CD24- cells presented stronger proliferative, anti-apoptosis capacity, and migratory ability, than CD24+ cells or parental cells. CD24- cells grew with a scattered spindle-shape within 3 days of culture and transformed into a cobblestone-like shape, identical to CD24+ cells or parental cells at 7

  15. Effect of interleukin-17A on stemness of hepatoma cell lines

    Directory of Open Access Journals (Sweden)

    LI Kexin

    2017-06-01

    Full Text Available ObjectiveTo investigate the effect of interleukin-17A (IL-17A on stemness of human hepatoma cell lines Hep 3B, MHCC97H, and MHCC97L and the association between IL-17A and the progression of liver cancer. MethodsHuman hepatoma cell lines Hep 3B, MHCC97H, and MHCC97L were selected, and in vitro 3D sphere formation assay was used to analyze the effect of IL-17A on sphere formation ability. The control group with common culture solution and the experimental group with 50 ng/ml IL-17A were established. Real-time cellular analysis was used to determine the effect of IL-17A on the proliferation and migration of hepatoma cells with enhanced sphere formation ability; quantitative real-time PCR was used to measure the changes in the mRNA expression of IL-17A receptors IL-17RA and IL-17RC and stemness-related genes SOX2, NANOG, OCT4, and BMI1 in hepatoma cells with enhanced sphere formation ability; Western blot was used to measure the expression of epithelial-mesenchymal transition-related proteins E-cadherin, N-cadherin, and vimentin. The t-test was used for comparison of continuous doota betwwen groups. ResultsWith the presence of 50 ng/ml IL-17A and 500 inoculated cells, Hep 3B cells had a significant increase in the number of spheres formed (113.0±10.3 vs 180.0±7.2, t=5.533, P<0.001, while MHCC97H and MHCC97L cells showed no significant changes (t=1.087 and 0.279, P=0.325 and 0785. The analysis showed that IL-17A promoted the proliferation and migration of Hep 3B cells with an increased number of spheres formed. After the addition of 50 ng/ml IL-17A, there was an increase in the mRNA expression of IL-17A receptors IL-17RA and IL-17RC over the time of treatment; Hep 3B cells showed significant increases in the mRNA expression of stemness-related genes SOX2 (t=4.749, P=0.042, NANOG (t=19.600, P=0.003, OCT4 (t=37.310, P<0.001, and BMI1 (t=16.810, P=0.004. Western blot showed no significant change in the expression of the epithelium

  16. A new dietary strategy for long-term treatment of the metabolic syndrome is compared with the American Heart Association (AHA) guidelines: the MEtabolic Syndrome REduction in NAvarra (RESMENA) project.

    Science.gov (United States)

    de la Iglesia, Rocio; Lopez-Legarrea, Patricia; Abete, Itziar; Bondia-Pons, Isabel; Navas-Carretero, Santiago; Forga, Luis; Martinez, J Alfredo; Zulet, M Angeles

    2014-02-01

    The long-term effects of dietary strategies designed to combat the metabolic syndrome (MetS) remain unknown. The present study evaluated the effectiveness of a new dietary strategy based on macronutrient distribution, antioxidant capacity and meal frequency (MEtabolic Syndrome REduction in NAvarra (RESMENA) diet) for the treatment of the MetS when compared with the American Heart Association guidelines, used as Control. Subjects with the MetS (fifty-two men and forty-one women, age 49 (se 1) years, BMI 36·11 (se 0·5) kg/m²) were randomly assigned to one of two dietary groups. After a 2-month nutritional-learning intervention period, during which a nutritional assessment was made for the participants every 15 d, a 4-month self-control period began. No significant differences were found between the groups concerning anthropometry, but only the RESMENA group exhibited a significant decrease in body weight ( - 1·7%; P= 0·018), BMI ( - 1·7%; P= 0·019), waist circumference ( - 1·8%; P= 0·021), waist:hip ratio ( - 1·4%; P= 0·035) and android fat mass ( - 6·9%; P= 0·008). The RESMENA group exhibited a significant decrease in alanine aminotransferase and aspartate aminotransferase (AST) concentrations ( - 26·8%; P= 0·008 and - 14·0%; P= 0·018, respectively), while the Control group exhibited a significant increase in glucose (7·9%; P= 0·011), AST (11·3%; P= 0·045) and uric acid (9·0%; Ptreatment for the MetS.

  17. Reversible immortalisation enables genetic correction of human muscle progenitors and engineering of next-generation human artificial chromosomes for Duchenne muscular dystrophy.

    Science.gov (United States)

    Benedetti, Sara; Uno, Narumi; Hoshiya, Hidetoshi; Ragazzi, Martina; Ferrari, Giulia; Kazuki, Yasuhiro; Moyle, Louise Anne; Tonlorenzi, Rossana; Lombardo, Angelo; Chaouch, Soraya; Mouly, Vincent; Moore, Marc; Popplewell, Linda; Kazuki, Kanako; Katoh, Motonobu; Naldini, Luigi; Dickson, George; Messina, Graziella; Oshimura, Mitsuo; Cossu, Giulio; Tedesco, Francesco Saverio

    2018-02-01

    Transferring large or multiple genes into primary human stem/progenitor cells is challenged by restrictions in vector capacity, and this hurdle limits the success of gene therapy. A paradigm is Duchenne muscular dystrophy (DMD), an incurable disorder caused by mutations in the largest human gene: dystrophin. The combination of large-capacity vectors, such as human artificial chromosomes (HACs), with stem/progenitor cells may overcome this limitation. We previously reported amelioration of the dystrophic phenotype in mice transplanted with murine muscle progenitors containing a HAC with the entire dystrophin locus (DYS-HAC). However, translation of this strategy to human muscle progenitors requires extension of their proliferative potential to withstand clonal cell expansion after HAC transfer. Here, we show that reversible cell immortalisation mediated by lentivirally delivered excisable hTERT and Bmi1 transgenes extended cell proliferation, enabling transfer of a novel DYS-HAC into DMD satellite cell-derived myoblasts and perivascular cell-derived mesoangioblasts. Genetically corrected cells maintained a stable karyotype, did not undergo tumorigenic transformation and retained their migration ability. Cells remained myogenic in vitro (spontaneously or upon MyoD induction) and engrafted murine skeletal muscle upon transplantation. Finally, we combined the aforementioned functions into a next-generation HAC capable of delivering reversible immortalisation, complete genetic correction, additional dystrophin expression, inducible differentiation and controllable cell death. This work establishes a novel platform for complex gene transfer into clinically relevant human muscle progenitors for DMD gene therapy. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  18. Prevalence of overweight preschool children in public day care centers: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Viviane Gabriela Nascimento

    Full Text Available CONTEXT AND OBJECTIVE: Brazil is undergoing a period of epidemiological transition associated with demographic and nutritional changes. The prevalence of obesity is also increasing in children and is causing numerous health problems that are becoming public health issues. The aim here was to evaluate the prevalence of overweight among children of two and three years of age. DESIGN AND SETTING: Cross-sectional study in municipal day care centers in Taubaté, state of São Paulo, Brazil. METHODS: Weight and height measurements were made on 447 preschool children forming a probabilistic randomized sample. Their body mass index (BMI was calculated. Their nutritional status was classified using the World Health Organization reference cutoff points (2006. Their mean weight, height and BMI were compared according to their age and sex. RESULTS: The mean values for the final sample (n = 447 were as follows: mean age: 38.6 months (± 3.5 and Z scores for: weight/height (W/H: 0.50 (± 1.22; height/age: -0.03 (± 1.07; weight/age (W/A: 0.51 (± 1.23; and BMI: 0.51(± 1.23. The prevalence of overweight children (BMI > 1 z was 28.86%, while the prevalence of underweight children (BMI < -2 z was 0.89%. There were no differences in mean BMI among the two and three-year age groups (P = 0.66. CONCLUSION: A high prevalence of overweight was observed in the sample of two and three-year-old children, with practically no malnutrition, thus showing that a significant nutritional transition may already be occurring, even in medium-sized cities of developing countries.

  19. Stromal Adipocyte Enhancer-binding Protein (AEBP1) Promotes Mammary Epithelial Cell Hyperplasia via Proinflammatory and Hedgehog Signaling*

    Science.gov (United States)

    Holloway, Ryan W.; Bogachev, Oleg; Bharadwaj, Alamelu G.; McCluskey, Greg D.; Majdalawieh, Amin F.; Zhang, Lei; Ro, Hyo-Sung

    2012-01-01

    Disruption of mammary stromal-epithelial communication leads to aberrant mammary gland development and induces mammary tumorigenesis. Macrophages have been implicated in carcinogenesis primarily by creating an inflammatory microenvironment, which promotes growth of the adjacent epithelial cells. Adipocyte enhancer-binding protein 1 (AEBP1), a novel proinflammatory mediator, promotes macrophage inflammatory responsiveness by inducing NF-κB activity, which has been implicated in tumor cell growth and survival by aberrant sonic hedgehog (Shh) expression. Here, we show that stromal macrophage AEBP1 overexpression results in precocious alveologenesis in the virgin AEBP1 transgenic (AEBP1TG) mice, and the onset of ductal hyperplasia was accelerated in AEBP1TG mice fed a high fat diet, which induces endogenous AEBP1 expression. Transplantation of AEBP1TG bone marrow cells into non-transgenic (AEBP1NT) mice resulted in alveolar hyperplasia with up-regulation of NF-κB activity and TNFα expression as displayed in the AEBP1TG mammary macrophages and epithelium. Shh expression was induced in AEBP1TG macrophages and RAW264.7 macrophages overexpressing AEBP1. The Shh target genes Gli1 and Bmi1 expression was induced in the AEBP1TG mammary epithelium and HC11 mammary epithelial cells co-cultured with AEBP1TG peritoneal macrophages. The conditioned AEBP1TG macrophage culture media promoted NF-κB activity and survival signal, Akt activation, in HC11 cells, whereas such effects were abolished by TNFα neutralizing antibody treatment. Furthermore, HC11 cells displayed enhanced proliferation in response to AEBP1TG macrophages and their conditioned media. Our findings highlight the role of AEBP1 in the signaling pathways regulating the cross-talk between mammary epithelium and stroma that could predispose the mammary tissue to tumorigenesis. PMID:22995915

  20. Stromal adipocyte enhancer-binding protein (AEBP1) promotes mammary epithelial cell hyperplasia via proinflammatory and hedgehog signaling.

    Science.gov (United States)

    Holloway, Ryan W; Bogachev, Oleg; Bharadwaj, Alamelu G; McCluskey, Greg D; Majdalawieh, Amin F; Zhang, Lei; Ro, Hyo-Sung

    2012-11-09

    Disruption of mammary stromal-epithelial communication leads to aberrant mammary gland development and induces mammary tumorigenesis. Macrophages have been implicated in carcinogenesis primarily by creating an inflammatory microenvironment, which promotes growth of the adjacent epithelial cells. Adipocyte enhancer-binding protein 1 (AEBP1), a novel proinflammatory mediator, promotes macrophage inflammatory responsiveness by inducing NF-κB activity, which has been implicated in tumor cell growth and survival by aberrant sonic hedgehog (Shh) expression. Here, we show that stromal macrophage AEBP1 overexpression results in precocious alveologenesis in the virgin AEBP1 transgenic (AEBP1(TG)) mice, and the onset of ductal hyperplasia was accelerated in AEBP1(TG) mice fed a high fat diet, which induces endogenous AEBP1 expression. Transplantation of AEBP1(TG) bone marrow cells into non-transgenic (AEBP1(NT)) mice resulted in alveolar hyperplasia with up-regulation of NF-κB activity and TNFα expression as displayed in the AEBP1(TG) mammary macrophages and epithelium. Shh expression was induced in AEBP1(TG) macrophages and RAW264.7 macrophages overexpressing AEBP1. The Shh target genes Gli1 and Bmi1 expression was induced in the AEBP1(TG) mammary epithelium and HC11 mammary epithelial cells co-cultured with AEBP1(TG) peritoneal macrophages. The conditioned AEBP1(TG) macrophage culture media promoted NF-κB activity and survival signal, Akt activation, in HC11 cells, whereas such effects were abolished by TNFα neutralizing antibody treatment. Furthermore, HC11 cells displayed enhanced proliferation in response to AEBP1(TG) macrophages and their conditioned media. Our findings highlight the role of AEBP1 in the signaling pathways regulating the cross-talk between mammary epithelium and stroma that could predispose the mammary tissue to tumorigenesis.

  1. Lower hypoxic ventilatory response in smokers compared to non-smokers during abstinence from cigarettes.

    Science.gov (United States)

    Hildebrandt, Wulf; Sauer, Roland; Koehler, Ulrich; Bärtsch, Peter; Kinscherf, Ralf

    2016-11-24

    Carotid body O 2 -chemosensitivity determines the hypoxic ventilatory response (HVR) as part of crucial regulatory reflex within oxygen homeostasis. Nicotine has been suggested to attenuate HVR in neonates of smoking mothers. However, whether smoking affects HVR in adulthood has remained unclear and probably blurred by acute ventilatory stimulation through cigarette smoke. We hypothesized that HVR is substantially reduced in smokers when studied after an overnight abstinence from cigarettes i.e. after nicotine elimination. We therefore determined the isocapnic HVR of 23 healthy male smokers (age 33.9 ± 2.0 years, BMI 24.2 ± 0.5 kg m -2 , mean ± SEM) with a smoking history of >8 years after 12 h of abstinence and compared it to that of 23 healthy male non-smokers matched for age and BMI. Smokers and non-smokers were comparable with regard to factors known to affect isocapnic HVR such as plasma levels of glucose and thiols as well as intracellular levels of glutathione in blood mononuclear cells. As a new finding, abstinent smokers had a significantly lower isocapnic HVR (0.024 ± 0.002 vs. 0.037 ± 0.003 l min -1 % -1 BMI -1 , P = 0.002) compared to non-smokers. However, upon re-exposure to cigarettes the smokers' HVR increased immediately to the non-smokers' level. This is the first report of a substantial HVR reduction in abstinent adult smokers which appears to be masked by daily smoking routine and may therefore have been previously overlooked. A low HVR may be suggested as a novel link between smoking and aggravated hypoxemia during sleep especially in relevant clinical conditions such as COPD.

  2. Visceral adiposity index is associated with benign prostatic enlargement in non-diabetic patients: a cross-sectional study.

    Science.gov (United States)

    Besiroglu, Huseyin; Ozbek, Emin; Dursun, Murat; Otunctemur, Alper

    2018-03-01

    To evaluate the association between visceral adiposity index (VAI) - a novel indicator for the assessment of visceral adipose tissue and prostate enlargement in non diabetic patients. Four hundred patients who were admitted to the Urology clinic between January and December 2014 with complaints of BPH(benign prostatic hyperplasia )/LUTS(male lower urinary tract symptoms)were enrolled in this cross-sectional study. Patients were divided into two groups according to their prostate volume and international prostate symptom score (IPSS) value. They were compared in terms of age, body mass index (BMI), VAI, prostate volume, PSA, post micturional residual volume (PMRV), uroflowmetry Q max value, triglyceride (TG), high density lipoprotein-cholesterol (HDL-C) and fasting blood sugar (FBS). Although univariate analyses reveal that age, BMI, waist circumference (WC), FBS, TG, HDL-C level and TG/HDL ratio were correlated with prostate volume, only age [1.125 OR (1.088-1.164), p = .00001], BMI [1.119 OR (1.040-1.204), p = .003], TG [1.043 OR (1.016-1.071), p = .002], HDL-C [0.923 OR (0.860-0.990), p = .025] and VAI [1.194 OR (1.110-1.305), p = .011] were statistically significant in multivariate analysis. A positive correlation was found between VAI value and prostate volume in the Spearman correlation test (r = 0.29, p = .00001). The calculated area under the curve (AUC) for prostate volumes of 30, 40 and 50 ml were 0.680 (0.621-0.738), 0.625 (0.570-0.681) and 0.590 (0.528-0.652), respectively. Our study revealed a positive correlation between VAI and prostate volume. Our results are needed to be tested with well-designed randomized prospective cohort studies.

  3. BVES Regulates Intestinal Stem Cell Programs and Intestinal Crypt Viability after Radiation

    Science.gov (United States)

    Reddy, Vishruth K.; Short, Sarah P.; Barrett, Caitlyn W.; Mittal, Mukul K.; Keating, Cody E.; Thompson, Joshua J.; Harris, Elizabeth I.; Revetta, Frank; Bader, David M.; Brand, Thomas; Washington, M. Kay; Williams, Christopher S.

    2016-01-01

    Blood Vessel Epicardial Substance (BVES/Popdc1) is a junctional-associated transmembrane protein that is underexpressed in a number of malignancies and regulates epithelial-to-mesenchymal transition. We previously identified a role for BVES in regulation of the Wnt pathway, a modulator of intestinal stem cell programs, but its role in small intestinal (SI) biology remains unexplored. We hypothesized that BVES influences intestinal stem cell programs and is critical to SI homeostasis after radiation injury. At baseline, Bves−/− mice demonstrated increased crypt height, as well as elevated proliferation and expression of the stem cell marker Lgr5 compared to wildtype (WT) mice. Intercross with Lgr5-EGFP reporter mice confirmed expansion of the stem cell compartment in Bves−/− mice. To examine stem cell function after BVES deletion, we employed ex vivo 3D-enteroid cultures. Bves−/− enteroids demonstrated increased stemness compared to WT, when examining parameters such as plating efficiency, stem spheroid formation, and retention of peripheral cystic structures. Furthermore, we observed increased proliferation, expression of crypt-base columnar “CBC” and “+4” stem cell markers, amplified Wnt signaling, and responsiveness to Wnt activation in the Bves−/− enteroids. Bves expression was downregulated after radiation in WT mice. Moreover, after radiation, Bves−/− mice demonstrated significantly greater small intestinal crypt viability, proliferation, and amplified Wnt signaling in comparison to WT mice. Bves−/− mice also demonstrated elevations in Lgr5 and Ascl2 expression, and putative damage-responsive stem cell populations marked by Bmi1 and TERT. Therefore, BVES is a key regulator of intestinal stem cell programs and mucosal homeostasis. PMID:26891025

  4. Adiponectin Levels and Longitudinal Changes in Metabolic Syndrome: The Healthy Twin Study.

    Science.gov (United States)

    Song, Yun-Mi; Lee, Kayoung; Sung, Joohon

    2015-09-01

    We investigated the association of plasma adiponectin levels with longitudinal changes in metabolic syndrome and the metabolic syndrome-related traits [insulin and homeostasis model assessment of insulin resistance (HOMA-IR)], as well as their genetic and environmental correlations. A total of 1030 Koreans (380 men and 650 women; 44.0 ± 12.7 years old) without diabetes of the Healthy Twin Study visited at baseline (2005-2010) and returned for a follow-up examination 3.7 ± 1.2 years later. Baseline plasma adiponectin, metabolic syndrome components [waist circumference (WC), glucose, blood pressure, high-density lipoprotein cholesterol (HDL-C), and triglycerides (TGs)] and metabolic syndrome-related traits were measured at baseline and follow-up. After adjusting for age, sex, smoking, alcohol consumption, physical activity, caloric intake, education level, body mass index (BMI), family history of diabetes, and changes in BMI, 1 standard deviation increment in baseline adiponectin levels was associated with 38-63% lower odds of incident and persistent metabolic syndrome. After additionally adjusting for the baseline levels of each trait, baseline adiponectin levels were inversely associated with WC, blood pressure, insulin, HOMA-IR, and TGs values at follow-up. After adjusting for age, sex, and baseline values of each trait or sum of metabolic syndrome components, baseline adiponectin levels exhibited significantly inverse genetic and environmental correlations with insulin, HOMA-IR, and HDL-C values and the sum of metabolic syndrome components at follow-up. High adiponectin levels reduce the risk of developing metabolic syndrome and having persistent metabolic syndrome and increase of metabolic syndrome-related traits over time. These associations may be explained by pleiotropic genetic mechanisms.

  5. Upregulation of miR-181a suppresses the formation of glioblastoma stem cells by targeting the Notch2 oncogene and correlates with good prognosis in patients with glioblastoma multiforme

    International Nuclear Information System (INIS)

    Huang, Shi-Xiong; Zhao, Zhong-Yan; Weng, Guo-Hu; He, Xiang-Ying; Wu, Chan-Ji; Fu, Chuan-Yi; Sui, Zhi-Yan; Ma, Yu-Shui; Liu, Tao

    2017-01-01

    Glioblastoma stem-like cells (GSCs) are responsible for the initiation and progression of glioblastoma multiforme (GBM), and microRNAs (miRNAs) play an important role in this disease. However, the mechanisms underlying the role of miRNAs in the stemness of GSCs have not been completely elucidated. We previously showed that miR-181a is downregulated in GBM and may predict prognosis in patients with this disease. Here, we demonstrate that the upregulation of miR-181a suppressed GSC formation and inhibited GBM tumorigenesis by targeting the Notch2 oncogene. We found that miR-181a was downregulated in GSCs derived from human glioblastoma U87MG and U373MG cells. The high expression of miR-181a inhibited the levels of stemness-related markers CD133 and BMI1, attenuated sphere proliferation, promoted cell apoptosis, and reduced the tumorigenicity of GSCs. MiR-181a decreased the expression of Notch2 by targeting the 3’-untranslated region of its mRNA. Notch2 overexpression inhibited the effects of miR-181a downregulation on GSCs, and was negatively correlated with miR-181a expression. Moreover, high Notch2 expression together with low miR-181a expression was correlated with a shorter median overall survival for GBM patients. Together, these data show that miR-181a may play an essential role in GSC formation and GBM progression by targeting Notch2, suggesting that Notch2 and miR-181a have potential prognostic value as tumor biomarkers in GBM patients. - Highlights: • MiR-181a suppressed GSC formation and GBM tumorigenesis by targeting Notch2. • Notch2 and miR-181a expression were correlated with OS for GBM patients. • Notch2 and miR-181a have potential prognostic value in GBM patients.

  6. In vitro and in vivo characterization of highly purified Human Mesothelioma derived cells

    International Nuclear Information System (INIS)

    Melotti, Alice; Daga, Antonio; Marubbi, Daniela; Zunino, Annalisa; Mutti, Luciano; Corte, Giorgio

    2010-01-01

    Malignant pleural mesothelioma is a rare disease known to be resistant to conventional therapies. A better understanding of mesothelioma biology may provide the rationale for new therapeutic strategies. In this regard, tumor cell lines development has been an important tool to study the biological properties of many tumors. However all the cell lines established so far were grown in medium containing at least 10% serum, and it has been shown that primary cell lines cultured under these conditions lose their ability to differentiate, acquire gene expression profiles that differ from that of tissue specific stem cells or the primary tumor they derive from, and in some cases are neither clonogenic nor tumorigenic. Our work was aimed to establish from fresh human pleural mesothelioma samples cell cultures maintaining tumorigenic properties. The primary cell cultures, obtained from four human pleural mesotheliomas, were expanded in vitro in a low serum proliferation-permissive medium and the expression of different markers as well as the tumorigenicity in immunodeficient mice was evaluated. The established mesothelioma cell cultures are able to engraft, after pseudo orthotopic intraperitoneal transplantation, in immunodeficient mouse and maintain this ability to after serial transplantation. Our cell cultures were strongly positive for CD46, CD47, CD56 and CD63 and were also strongly positive for some markers never described before in mesothelioma cell lines, including CD55, CD90 and CD99. By real time PCR we found that our cell lines expressed high mRNA levels of typical mesothelioma markers as mesothelin (MSLN) and calretinin (CALB2), and of BMI-1, a stemness marker, and DKK1, a potent Wingless [WNT] inhibitor. These cell cultures may provide a valuable in vitro and in vivo model to investigate mesothelioma biology. The identification of new mesothelioma markers may be useful for diagnosis and/or prognosis of this neoplasia as well as for isolation of mesothelioma

  7. Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma.

    Science.gov (United States)

    Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

    2018-01-01

    Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.

  8. A Multi-Component Day-Camp Weight-Loss Program Is Effective in Reducing BMI in Children after One Year: A Randomized Controlled Trial.

    Directory of Open Access Journals (Sweden)

    Kristian Traberg Larsen

    Full Text Available The objective of the present study was to evaluate the effectiveness of a one-year multi-component immersive day-camp weight-loss intervention for children with overweight and obesity. The study design was a parallel-group randomized controlled trial. One hundred fifteen 11-13-year-old children with overweight and obesity were randomized into either: A six-week day-camp intervention arm focusing on increased physical activity, and healthy diet followed by a subsequent one-year family-based intervention, or a standard intervention arm consisting of one weekly exercise session for six weeks. Body mass index (BMI was the primary outcome. BMI z-score, clustered cardiovascular risk z-score, and body composition were secondary outcomes. All outcomes were measured at baseline, six week-, and 52 week follow-up. After six weeks, children from the day-camp intervention arm had improved their BMI (-2.2 kg/m2 (95% CI -2.6 to -1.7, P<0.001 and all secondary outcomes when compared to the children from the standard intervention arm. After 52 weeks, the day-camp intervention arm had a lower BMI (-1.2 kg/m2 (95% CI -1.8 to -0.5, P = 0.001, and BMI z-score (-0.20 (95% CI -0.35 to -0.05, P = 0.008, and clustered cardiovascular risk z-score (-0.23 (95% CI -0.37 to -0.08, P = 0.002 compared to the standard intervention arm. No group differences were detected in body composition after 52 weeks. This study shows that the day-camp intervention arm is effective in reducing BMI and improving the metabolic health of children with overweight and obesity. However, the effects seem to be diminishing over time.

  9. Slug controls stem/progenitor cell growth dynamics during mammary gland morphogenesis.

    Directory of Open Access Journals (Sweden)

    Mayssa Nassour

    Full Text Available Morphogenesis results from the coordination of distinct cell signaling pathways controlling migration, differentiation, apoptosis, and proliferation, along stem/progenitor cell dynamics. To decipher this puzzle, we focused on epithelial-mesenchymal transition (EMT "master genes". EMT has emerged as a unifying concept, involving cell-cell adhesion, migration and apoptotic pathways. EMT also appears to mingle with stemness. However, very little is known on the physiological role and relevance of EMT master-genes. We addressed this question during mammary morphogenesis. Recently, a link between Slug/Snai2 and stemness has been described in mammary epithelial cells, but EMT master genes actual localization, role and targets during mammary gland morphogenesis are not known and we focused on this basic question.Using a Slug-lacZ transgenic model and immunolocalization, we located Slug in a distinct subpopulation covering about 10-20% basal cap and duct cells, mostly cycling cells, coexpressed with basal markers P-cadherin, CK5 and CD49f. During puberty, Slug-deficient mammary epithelium exhibited a delayed development after transplantation, contained less cycling cells, and overexpressed CK8/18, ER, GATA3 and BMI1 genes, linked to luminal lineage. Other EMT master genes were overexpressed, suggesting compensation mechanisms. Gain/loss-of-function in vitro experiments confirmed Slug control of mammary epithelial cell luminal differentiation and proliferation. In addition, they showed that Slug enhances specifically clonal mammosphere emergence and growth, cell motility, and represses apoptosis. Strikingly, Slug-deprived mammary epithelial cells lost their potential to generate secondary clonal mammospheres.We conclude that Slug pathway controls the growth dynamics of a subpopulation of cycling progenitor basal cells during mammary morphogenesis. Overall, our data better define a key mechanism coordinating cell lineage dynamics and morphogenesis, and

  10. Early nutrition transition in Haiti: linking food purchasing and availability to overweight status in school-aged children.

    Science.gov (United States)

    Morshed, Alexandra B; Becker, Haley V; Delnatus, Jacques Raymond; Wolff, Patricia B; Iannotti, Lora L

    2016-12-01

    The primary aim was to examine the association of socio-economic factors and diet with overweight (including obesity) among school-aged children in Haiti. The secondary aim was to describe food availability and the physical activity built environment in participating schools. This cross-sectional study examined baseline data from the intervention Mamba study assessing the effectiveness of a fortified peanut butter paste in school-aged children. Logistic regression modelling was used to test hypothesized factors in association with overweight status. Six primary schools in Cap-Haitien, the second largest city in Haiti. Children (n 968) aged 3-13 years, in good health and enrolled in a participating school for the 2012/13 school year. Child age (adjusted OR (AOR); 95 % CI=0·25; 0·12, 0·56), child age squared (1·08; 1·03, 1·13), always purchasing food at school (3·52; 1·12, 11·08), mother's BMI (1·10; 1·04, 1·16) and household ownership of a bicycle (0·28; 0·11, 0·71) were significantly associated with overweight (likelihood ratio=36, Poverweight children in the binary analysis (P=0·033) and improved the fit of the model. Schools had limited time and space for physical activity and foods sold by vendors were predominantly high in sugar or fat. To our knowledge the present study is the first to examine the covariates of childhood overweight or describe school food availability and physical activity built environments in Haiti. Further research is necessary to identify intervention targets and feasible, cost-effective approaches for prevention of obesity in Haiti children.

  11. R-spondin1/Wnt-enhanced Ascl2 autoregulation controls the self-renewal of colorectal cancer progenitor cells.

    Science.gov (United States)

    Ye, Jun; Liu, Shanxi; Shang, Yangyang; Chen, Haoyuan; Wang, Rongquan

    2018-06-25

    The Wnt signaling pathway controls stem cell identity in the intestinal epithelium and cancer stem cells (CSCs). The transcription factor Ascl2 (Wnt target gene) is fate decider of intestinal cryptic stem cells and colon cancer stem cells. It is unclear how Wnt signaling is translated into Ascl2 expression and keeping the self-renewal of CRC progenitor cells. We showed that the exogenous Ascl2 in colorectal cancer (CRC) cells activated the endogenous Ascl2 expression via a direct autoactivatory loop, including Ascl2 binding to its own promoter and further transcriptional activation. Higher Ascl2 expression in human CRC cancerous tissues led to greater enrichment in Ascl2 immunoprecipitated DNA within the Ascl2 promoter in the CRC cancerous sample than the peri-cancerous mucosa. Ascl2 binding to its own promoter and inducing further transcriptional activation of the Ascl2 gene was predominant in the CD133 + CD44 + CRC population. R-spondin1/Wnt activated Ascl2 expression dose-dependently in the CD133 + CD44 + CRC population, but not in the CD133 - CD44 - CRC population, which was caused by differences in Ascl2 autoregulation under R-spondin1/Wnt activation. R-spondin1/Wnt treatment in the CD133 + CD44 + or CRC CD133 - CD44 - populations exerted a different pattern of stemness maintenance, which was defined by alterations of the mRNA levels of stemness-associated genes, the protein expression levels (Bmi1, C-myc, Oct-4 and Nanog) and tumorsphere formation. The results indicated that Ascl2 autoregulation formed a transcriptional switch that was enhanced by Wnt signaling in the CD133 + CD44 + CRC population, thus conferring their self-renewal.

  12. The effect of complex workplace dietary interventions on employees' dietary intakes, nutrition knowledge and health status: a cluster controlled trial.

    Science.gov (United States)

    Geaney, Fiona; Kelly, Clare; Di Marrazzo, Jessica Scotto; Harrington, Janas M; Fitzgerald, Anthony P; Greiner, Birgit A; Perry, Ivan J

    2016-08-01

    Evidence on effective workplace dietary interventions is limited. The comparative effectiveness of a workplace environmental dietary modification and an educational intervention both alone and in combination was assessed versus a control workplace on employees' dietary intakes, nutrition knowledge and health status. In the Food Choice at Work cluster controlled trial, four large, purposively selected manufacturing workplaces in Ireland were allocated to control (N=111), nutrition education (Education) (N=226), environmental dietary modification (Environment) (N=113) and nutrition education and environmental dietary modification (Combined) (N=400) in 2013. Nutrition education included group presentations, individual consultations and detailed nutrition information. Environmental dietary modification included menu modification, fruit price discounts, strategic positioning of healthier alternatives and portion size control. Data on dietary intakes, nutrition knowledge and health status were obtained at baseline and follow-up at 7-9months. Multivariate analysis of covariance compared changes across the four groups with adjustment for age, gender, educational status and other baseline characteristics. Follow-up data at 7-9months were obtained for 541 employees (64% of 850 recruited) aged 18-64years: control: 70 (63%), Education: 113 (50%), 74 (65%) and Combined: 284 (71%). There were significant positive changes in intakes of saturated fat (p=0.013), salt (p=0.010) and nutrition knowledge (p=0.034) between baseline and follow-up in the combined intervention versus the control. Small but significant changes in BMI (-1.2kg/m(2) (95% CI -2.385, -0.018, p=0.047) were observed in the combined intervention. Effects in the education and environment alone workplaces were smaller and generally non-significant. Combining nutrition education and environmental dietary modification may be an effective approach for promoting a healthy diet and weight loss at work. Copyright © 2016

  13. Different Effects of BORIS/CTCFL on Stemness Gene Expression, Sphere Formation and Cell Survival in Epithelial Cancer Stem Cells.

    Directory of Open Access Journals (Sweden)

    Loredana Alberti

    Full Text Available Cancer stem cells are cancer cells characterized by stem cell properties and represent a small population of tumor cells that drives tumor development, progression, metastasis and drug resistance. To date, the molecular mechanisms that generate and regulate cancer stem cells are not well defined. BORIS (Brother of Regulator of Imprinted Sites or CTCFL (CTCF-like is a DNA-binding protein that is expressed in normal tissues only in germ cells and is re-activated in tumors. Recent evidences have highlighted the correlation of BORIS/CTCFL expression with poor overall survival of different cancer patients. We have previously shown an association of BORIS-expressing cells with stemness gene expression in embryonic cancer cells. Here, we studied the role of BORIS in epithelial tumor cells. Using BORIS-molecular beacon that was already validated, we were able to show the presence of BORIS mRNA in cancer stem cell-enriched populations (side population and spheres of cervical, colon and breast tumor cells. BORIS silencing studies showed a decrease of sphere formation capacity in breast and colon tumor cells. Importantly, BORIS-silencing led to down-regulation of hTERT, stem cell (NANOG, OCT4, SOX2 and BMI1 and cancer stem cell markers (ABCG2, CD44 and ALDH1 genes. Conversely, BORIS-induction led to up-regulation of the same genes. These phenotypes were observed in cervical, colon and invasive breast tumor cells. However, a completely different behavior was observed in the non-invasive breast tumor cells (MCF7. Indeed, these cells acquired an epithelial mesenchymal transition phenotype after BORIS silencing. Our results demonstrate that BORIS is associated with cancer stem cell-enriched populations of several epithelial tumor cells and the different phenotypes depend on the origin of tumor cells.

  14. Socioeconomic status indicators, physical activity, and overweight/obesity in Brazilian children

    Directory of Open Access Journals (Sweden)

    Victor Keihan Rodrigues Matsudo

    2016-06-01

    Full Text Available Abstract Objective: To analyze the associations between socioeconomic status (SES indicators and physical activity and overweight/obesity in children. Methods: 485 children wore accelerometers for 7 days. Variables included time in sedentary behavior and moderate-to-vigorous physical activity (MVPA, and steps/day. Children were further categorized as meeting or not meeting guidelines of ≥60min/day MVPA and ≥12,000 steps/day. Body mass index (BMI and body fat percentage (BF% were measured using bioelectrical impedance. Overweight/obesity was defined as BMI >+1 SD and BF% ≥85th percentile. Parents answered questionnaires that questioned total annual household income, parental education level, parental employment status and automobile ownership. Results: Children averaged 59.5min/day in MVPA (44.1% met MVPA guidelines, and 9639 steps/day (18.4% met steps/day guidelines. 45.4% and 33% were overweight/obese classified by BMI and BF% respectively. Higher relative total annual household income level (Odds Ratio 0.31; 95% confidence interval=0.15-0.65, and relatively higher maternal (OR=0.38; 95%CI=0.20-0.72 and paternal (OR=0.36; 95%CI=0.17-0.75 education levels were associated with lower odds of children meeting MVPA guidelines. Household automobile ownership was associated with lower odds of children meeting MVPA (OR=0.48; 95%CI=0.31-0.75 and steps/day guidelines (OR=0.44; 95%CI=0.26-0.74. Conclusions: SES indicators were not associated with overweight/obesity, but higher SES was associated with lower odds of children meeting MVPA guidelines.

  15. Metformin for Clozapine Associated Obesity: A Systematic Review and Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Dan J Siskind

    Full Text Available Although clozapine is the gold-standard for treatment refractory schizophrenia, it has the worst metabolic profile of all antipsychotics. This is partly mediated by clozapine's impact on glucagon-like peptide (GLP-1. There is an absence of robust evidence for effective treatments for clozapine associated weight gain and metabolic syndrome. Metformin, with its role in increasing GLP-1 may aid weight loss among people on clozapine.We conducted a systematic-review and meta-analysis of metformin versus placebo for change in weight and metabolic syndrome for people on clozapine without diabetes mellitus. We searched the Cochrane Schizophrenia Group's trial register, Pubmed and Embase, as well as the following Chinese databases: the Chinese Biomedical Literature Service System and China Knowledge Resource Integrated Database. This was supplemented by hand searches of key papers.Eight studies, of which three were from Chinese databases, with 478 participants were included. We found that metformin was superior to placebo in terms of weight loss (-3.12kg, 95%CI -4.88kg to -1.37kg and BMI (-1.18kg/m2, 95%CI -1.76kg/m2 to -0.61kg/m2. Metformin significantly improved three of the five components of metabolic syndrome; waist circumference, fasting glucose and triglycerides. Sensitivity analysis on study quality and duration did not greatly impact results.Metformin led to clinically meaningful weight loss among people on clozapine, and may reduce the rates of metabolic syndrome. Inclusion of metformin into the treatment protocols of people on clozapine, as tolerated, should be considered.PROSPERO registration number: CRD42015029723.

  16. Identification, expansion and characterization of cancer cells with stem cell properties from head and neck squamous cell carcinomas

    Energy Technology Data Exchange (ETDEWEB)

    Kaseb, Hatem O. [Department of Human Genetics, University of Pittsburgh Graduate School of Public Health, Pittsburgh, PA 15261 (United States); Department of Clinical Pathology, National Cancer Institute (NCI), Cairo University, Cairo (Egypt); Fohrer-Ting, Helene [Department of Pathology, University of Pittsburgh School of Medicine, 200 Lothrop Street, Pittsburgh, PA 15261 (United States); McGowan Institute for Regenerative Medicine, University of Pittsburgh, 450 Technology Drive, Suite 300, Pittsburgh, PA 15219 (United States); Lewis, Dale W. [Department of Human Genetics, University of Pittsburgh Graduate School of Public Health, Pittsburgh, PA 15261 (United States); Lagasse, Eric [Department of Pathology, University of Pittsburgh School of Medicine, 200 Lothrop Street, Pittsburgh, PA 15261 (United States); McGowan Institute for Regenerative Medicine, University of Pittsburgh, 450 Technology Drive, Suite 300, Pittsburgh, PA 15219 (United States); Gollin, Susanne M., E-mail: gollin@pitt.edu [Department of Human Genetics, University of Pittsburgh Graduate School of Public Health, Pittsburgh, PA 15261 (United States); University of Pittsburgh Cancer Institute, Pittsburgh, PA 15232 (United States)

    2016-10-15

    Head and neck squamous cell carcinoma (HNSCC) is a major public health concern. Recent data indicate the presence of cancer stem cells (CSC) in many solid tumors, including HNSCC. Here, we assessed the stem cell (SC) characteristics, including cell surface markers, radioresistance, chromosomal instability, and in vivo tumorigenic capacity of CSC isolated from HNSCC patient specimens. We show that spheroid enrichment of CSC from early and short-term HNSCC cell cultures was associated with increased expression of CD44, CD133, SOX2 and BMI1 compared with normal oral epithelial cells. On immunophenotyping, five of 12 SC/CSC markers were homogenously expressed in all tumor cultures, while one of 12 was negative, four of 12 showed variable expression, and two of the 12 were expressed heterogeneously. We showed that irradiated CSCs survived and retained their self-renewal capacity across different ionizing radiation (IR) regimens. Fluorescence in situ hybridization (FISH) analyses of parental and clonally-derived tumor cells revealed different chromosome copy numbers from cell to cell, suggesting the presence of chromosomal instability in HNSCC CSC. Further, our in vitro and in vivo mouse engraftment studies suggest that CD44+/CD66− is a promising, consistent biomarker combination for HNSCC CSC. Overall, our findings add further evidence to the proposed role of HNSCC CSCs in therapeutic resistance. - Highlights: • Spheroid enrichment selects cancer stem cells (CSC) from head & neck tumors (HNSCC). • Compared to normal epithelial cells, isolated CSC express increased SC/CSC markers. • Isolated CSC display enhanced radioresistance, clonogenicity and tumorigenicity. • HNSCC CSC express chromosomal instability. • CD44+/CD66− is a promising, consistent biomarker for HNSCC CSC.

  17. Modulation of miR-203 and its regulators as a function of time during the development of 7, 12 dimethylbenz [a] anthracene induced mouse skin tumors in presence or absence of the antitumor agents

    International Nuclear Information System (INIS)

    Tiwari, Prakash; Gupta, Krishna P.

    2014-01-01

    We investigated the chemopreventive effects of naturally occurring compounds like butyric acid (BA), nicotinamide (NA) and calcium glucarate (CAG) individually or in combination in 7, 12-dimethylbenz [a] anthracene (DMBA) treated mouse skin at 4 and 16 weeks, the time before and after the tumor development. DMBA application did not show any skin tumors at 4 weeks but well defined tumors appeared at 16 weeks. BA, NA or CAG prevented the tumor development significantly but the protection was highly enhanced when all these compounds were given together. In order to see the molecular changes progressing with tumors, we showed the downregulation of tumor suppressor miR-203 at 16 weeks and upregulation of histone deacetylases (HDAC), DNA methyltransferase, promoter methylation of miR-203 at 4 or 16 weeks. Regulators of micro RNA biogenesis such as DICER1 and Ago2 were also deregulated by DMBA. Proto-oncogene c-myc and BMI1 were upregulated and tumor suppressor gene p16 was downregulated by DMBA as a function of time. Effects of BA, NA or CAG were more pronounced after 16 weeks as compared to 4 weeks in preventing the tumor development and altered gene expression. Concomitant administration of BA, NA and CAG tried to prevent these alterations more effectively than that of individual compound possibly by regulating miR-203 status through epigenetic or biogenetic modulations before and after the tumor development. Study provides a rationale for chemoprevention by combination of different compounds targeting miR-203. - Highlights: • DMBA modulates miR-203 and its regulator before and after the onset of tumors. • Suppression of miR-203 and p16 could be the result of gene promoter methylation. • BA, NA or CAG prevents the effects of DMBA. • Combination of BA, NA or CAG is more effective in preventing the DMBA modulations

  18. Boosters and barriers for direct cardiac reprogramming.

    Science.gov (United States)

    Talkhabi, Mahmood; Zonooz, Elmira Rezaei; Baharvand, Hossein

    2017-06-01

    Heart disease is currently the most significant cause of morbidity and mortality worldwide, which accounts for approximately 33% of all deaths. Recently, a promising and alchemy-like strategy has been developed called direct cardiac reprogramming, which directly converts somatic cells such as fibroblasts to cardiac lineage cells such as cardiomyocytes (CMs), termed induced CMs or iCMs. The first in vitro cardiac reprogramming study, mediated by cardiac transcription factors (TFs)-Gata4, Tbx5 and Mef2C-, was not enough efficient to produce an adequate number of fully reprogrammed, functional iCMs. As a result, numerous combinations of cardiac TFs exist for direct cardiac reprogramming of mouse and human fibroblasts. However, the efficiency of direct cardiac reprogramming remains low. Recently, a number of cellular and molecular mechanisms have been identified to increase the efficiency of direct cardiac reprogramming and the quality of iCMs. For example, microgrooved substrate, cardiogenic growth factors [VEGF, FGF, BMP4 and Activin A], and an appropriate stoichiometry of TFs boost the direct cardiac reprogramming. On the other hand, serum, TGFβ signaling, activators of epithelial to mesenchymal transition, and some epigenetic factors (Bmi1 and Ezh2) are barriers for direct cardiac reprogramming. Manipulating these mechanisms by the application of boosters and removing barriers can increase the efficiency of direct cardiac reprogramming and possibly make iCMs reliable for cell-based therapy or other potential applications. In this review, we summarize the latest trends in cardiac TF- or miRNA-based direct cardiac reprogramming and comprehensively discuses all molecular and cellular boosters and barriers affecting direct cardiac reprogramming. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Weight loss with a modified Mediterranean-type diet using fat modification: a randomized controlled trial.

    Science.gov (United States)

    Austel, A; Ranke, C; Wagner, N; Görge, J; Ellrott, T

    2015-08-01

    There is evidence that Mediterranean diets with a high proportion of olive oil and nuts can be effective for weight management and prevention of cardiovascular disease. It might be difficult for populations with other eating habits to follow such diets. Therefore, a modified Mediterranean-type diet using fat modification through neutral and butter-flavored canola oil, walnuts and walnut oil with two portion-controlled sweet daily snacks was tested in Germany. Randomized waiting-list control study with overweight/grade 1 obese subjects: 12-week self-help modified Mediterranean-type diet, 6 weeks of diet plans and 6 weeks of weight loss maintenance training. Trial duration was 12 months. Intervention group (IG) included 100 participants (average age of 52.4 years, weight 85.1 kg and body mass index (BMI) 30.1 kg/m(2)), waiting-list control group (CG) included 112 participants (52.6 years, 84.1 kg and 30.1 kg/m(2)). Per-protocol weight loss after 12 weeks was 5.2 kg in IG vs 0.4 kg in CG (P ⩽ 0.0001), BMI -1.8 vs -0.1 kg/m(2) (P ⩽ 0.0001), waist circumference -4.7 vs -0.9 cm (P ⩽ 0.0001). Triglycerides, total cholesterol and LDL cholesterol improved significantly in IG but not in CG. One-year dropouts: 44% in IG and 53% in CG. Weight loss after 12 months: 4.2 kg (pooled data). A five-meal modified Mediterranean-type diet with two daily portion-controlled sweet snacks was effective for weight management in a self-help setting for overweight and grade 1 obese subjects. Fat modification through canola oil, walnuts and walnut oil improved blood lipids even at 12 months.

  20. Association of childhood adiposity measures with adulthood knee cartilage defects and bone marrow lesions: a 25-year cohort study.

    Science.gov (United States)

    Meng, Tao; Thayer, Shaun; Venn, Alison; Wu, Feitong; Cicuttini, Flavia; March, Lyn; Dwyer, Terence; Halliday, Andrew; Cross, Marita; Laslett, Laura L; Jones, Graeme; Ding, Changhai; Antony, Benny

    2018-05-15

    To describe the associations between childhood adiposity measures and adulthood knee cartilage defects and bone marrow lesions (BMLs) measured 25 years later. 327 participants from the Australian Schools Health and Fitness Survey of 1985 (aged 7-15 years) were followed up 25 years later (aged 31-41 years). Childhood measures (weight, height and skinfolds) were collected in 1985. Body mass index (BMI), overweight status and fat mass were calculated. Participants underwent 1.5T knee magnetic resonance imaging (MRI) during 2008-2010, and cartilage defects and BMLs were scored from knee MRI scans. Log binomial regressions were used to examine the associations. Among 327 participants (47.1% females), 21 (6.4%) were overweight in childhood. Childhood adiposity measures were associated with the increased risk of adulthood patellar cartilage defects (Weight relative risk (RR) 1.05/kg, 95% confidence interval (CI) 1.01 to 1.09; BMI 1.10/kg/m 2 , 1.01 to 1.19; Overweight 2.22/yes, 1.21 to 4.08; fat mass 1.11/kg, 1.01 to 1.22), but not tibiofemoral cartilage defects. Childhood adiposity measures were not significantly associated with adulthood knee BMLs except for the association between childhood overweight status and adulthood patellar BMLs (RR 2.87/yes, 95% CI 1.10 to 7.53). These significant associations persisted after adjustment for corresponding adulthood adiposity measure. Childhood adiposity measures were associated with the increased risk of adulthood patellar cartilage defects and, to a lesser extent, BMLs, independent of adulthood adiposity measures. These results suggest that adiposity in childhood has long-term effects on patellar structural abnormalities in young adults. Copyright © 2018. Published by Elsevier Ltd.

  1. Salinomycin induces cell death and differentiation in head and neck squamous cell carcinoma stem cells despite activation of epithelial-mesenchymal transition and Akt

    International Nuclear Information System (INIS)

    Kuo, Selena Z; Blair, Katherine J; Rahimy, Elham; Kiang, Alan; Abhold, Eric; Fan, Jian-Bing; Wang-Rodriguez, Jessica; Altuna, Xabier; Ongkeko, Weg M

    2012-01-01

    Cancer stem cells (CSC) are believed to play a crucial role in cancer recurrence due to their resistance to conventional chemotherapy and capacity for self-renewal. Recent studies have reported that salinomycin, a livestock antibiotic, selectively targets breast cancer stem cells 100-fold more effectively than paclitaxel. In our study we sought to determine the effects of salinomycin on head and neck squamous cell carcinoma (HNSCC) stem cells. MTS and TUNEL assays were used to study cell proliferation and apoptosis as a function of salinomycin exposure in JLO-1, a putative HNSCC stem cell culture. MTS and trypan blue dye exclusion assays were performed to investigate potential drug interactions between salinomycin and cisplatin or paclitaxel. Stem cell-like phenotype was measured by mRNA expression of stem cell markers, sphere-forming capacity, and matrigel invasion assays. Immunoblotting was also used to determine expression of epithelial-mesenchymal transition (EMT) markers and Akt phosphorylation. Arrays by Illumina, Inc. were used to profile microRNA expression as a function of salinomycin dose. In putative HNSCC stem cells, salinomycin was found to significantly inhibit cell viability, induce a 71.5% increase in levels of apoptosis, elevate the Bax/Bcl-2 ratio, and work synergistically with cisplatin and paclitaxel in inducing cell death. It was observed that salinomycin significantly inhibited sphere forming-capability and repressed the expression of CD44 and BMI-1 by 3.2-fold and 6.2-fold, respectively. Furthermore, salinomycin reduced invasion of HNSCC stem cells by 2.1 fold. Contrary to expectations, salinomycin induced the expression of EMT markers Snail, vimentin, and Zeb-1, decreased expression of E-cadherin, and also induced phosphorylation of Akt and its downstream targets GSK3-β and mTOR. These results demonstrate that in HNSCC cancer stem cells, salinomycin can cause cell death and decrease stem cell properties despite activation of both EMT and

  2. A Longitudinal Study of Association between Adiposity Markers and Intraocular Pressure: The Kangbuk Samsung Health Study.

    Science.gov (United States)

    Zhao, Di; Kim, Myung Hun; Pastor-Barriuso, Roberto; Chang, Yoosoo; Ryu, Seungho; Zhang, Yiyi; Rampal, Sanjay; Shin, Hocheol; Kim, Joon Mo; Friedman, David S; Guallar, Eliseo; Cho, Juhee

    2016-01-01

    Intraocular pressure (IOP) reduction or stabilization is the only proven method for glaucoma management. Identifying risk factors for IOP is crucial to understand the pathophysiology of glaucoma. To examine the associations of change in body mass index (BMI), waist circumference, and percent fat mass with change in intraocular pressure (IOP) in a large sample of Korean adults. Cohort study of 274,064 young and middle age Korean adults with normal fundoscopic findings who attended annual or biennial health exams from January 1, 2002 to Feb 28, 2010 (577,981 screening visits). BMI, waist circumference, and percent fat mass. At each visit, IOP was measured in both eyes with automated noncontact tonometers. In multivariable-adjusted models, the average increase in IOP (95% confidence intervals) over time per interquartile increase in BMI (1.26 kg/m2), waist circumference (6.20 cm), and percent fat mass (3.40%) were 0.18 mmHg (0.17 to 0.19), 0.27 mmHg (0.26 to 0.29), and 0.10 mmHg (0.09 to 0.11), respectively (all P < 0.001). The association was stronger in men compared to women (P < 0.001) and it was only slightly attenuated after including diabetes and hypertension as potential mediators in the model. Increases in adiposity were significantly associated with an increase in IOP in a large cohort of Korean adults attending health screening visits, an association that was stronger for central obesity. Further research is needed to understand better the underlying mechanisms of this association, and to establish the role of weight gain in increasing IOP and the risk of glaucoma and its complications.

  3. Supermarket purchase contributes to nutrition-related non-communicable diseases in urban Kenya.

    Directory of Open Access Journals (Sweden)

    Kathrin M Demmler

    Full Text Available While undernutrition and related infectious diseases are still pervasive in many developing countries, the prevalence of non-communicable diseases (NCD, typically associated with high body mass index (BMI, is rapidly rising. The fast spread of supermarkets and related shifts in diets were identified as possible factors contributing to overweight and obesity in developing countries. Potential effects of supermarkets on people's health have not been analyzed up till now.This study investigates the effects of purchasing food in supermarkets on people's BMI, as well as on health indicators such as fasting blood glucose (FBG, blood pressure (BP, and the metabolic syndrome.This study uses cross-section observational data from urban Kenya. Demographic, anthropometric, and bio-medical data were collected from 550 randomly selected adults. Purchasing food in supermarkets is defined as a binary variable that takes a value of one if any food was purchased in supermarkets during the last 30 days. In a robustness check, the share of food purchased in supermarkets is defined as a continuous variable. Instrumental variable regressions are applied to control for confounding factors and establish causality.Purchasing food in supermarkets contributes to higher BMI (+ 1.8 kg/m2 (P<0.01 and an increased probability (+ 20 percentage points of being overweight or obese (P<0.01. Purchasing food in supermarkets also contributes to higher levels of FBG (+ 0.3 mmol/L (P<0.01 and a higher likelihood (+ 16 percentage points of suffering from pre-diabetes (P<0.01 and the metabolic syndrome (+ 7 percentage points (P<0.01. Effects on BP could not be observed.Supermarkets and their food sales strategies seem to have direct effects on people's health. In addition to increasing overweight and obesity, supermarkets contribute to nutrition-related NCDs. Effects of supermarkets on nutrition and health can mainly be ascribed to changes in the composition of people's food choices.

  4. Pounds Off Digitally study: a randomized podcasting weight-loss intervention.

    Science.gov (United States)

    Turner-McGrievy, Gabrielle M; Campbell, Marci K; Tate, Deborah F; Truesdale, Kimberly P; Bowling, J Michael; Crosby, Lelia

    2009-10-01

    As obesity rates rise, new weight-loss methods are needed. Little is known about the use of podcasting (audio files for a portable music player or computer) to promote weight loss, despite its growing popularity. A 12-week RCT was conducted. The study sample comprised overweight men and women (BMI=25-40 kg/m(2); n=78) in the Raleigh-Durham NC area. In 2008, participants were randomly assigned to receive 24 episodes of a currently available weight-loss podcast (control podcast) or a weight-loss podcast based on social cognitive theory (SCT) designed by the researchers (enhanced podcast) for 12 weeks. Weight was measured on a digital scale at baseline and follow-up. Both groups also completed questionnaires assessing demographic information, food intake, physical activity, and SCT constructs at the introductory and 12-week meetings. Additional questionnaires at the 12-week meeting assessed perceptions of the intervention. Data collection and analysis occurred in 2008 and intention-to-treat was used. Enhanced group participants (n=41) had a greater decrease in weight (-2.9+/-3.5 kg enhanced group vs -0.3+/-2.1 control group; p<0.001 between groups) and BMI (-1.0+/-1.2 kg/m(2) enhanced group vs -0.1+/-0.7 kg/m(2) control group; p<0.001 between groups) than the control group (n=37) and had greater weight-loss-related knowledge (p<0.05), elaboration (p<0.001), and user control (p<0.001) and less cognitive load (p<0.001). The results of this study suggest that the use of behavioral, theory-based podcasting may be an effective way to promote weight loss. NCT00771095.

  5. Metformin for Clozapine Associated Obesity: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Siskind, Dan J; Leung, Janni; Russell, Anthony W; Wysoczanski, Daniel; Kisely, Steve

    2016-01-01

    Although clozapine is the gold-standard for treatment refractory schizophrenia, it has the worst metabolic profile of all antipsychotics. This is partly mediated by clozapine's impact on glucagon-like peptide (GLP-1). There is an absence of robust evidence for effective treatments for clozapine associated weight gain and metabolic syndrome. Metformin, with its role in increasing GLP-1 may aid weight loss among people on clozapine. We conducted a systematic-review and meta-analysis of metformin versus placebo for change in weight and metabolic syndrome for people on clozapine without diabetes mellitus. We searched the Cochrane Schizophrenia Group's trial register, Pubmed and Embase, as well as the following Chinese databases: the Chinese Biomedical Literature Service System and China Knowledge Resource Integrated Database. This was supplemented by hand searches of key papers. Eight studies, of which three were from Chinese databases, with 478 participants were included. We found that metformin was superior to placebo in terms of weight loss (-3.12kg, 95%CI -4.88kg to -1.37kg) and BMI (-1.18kg/m2, 95%CI -1.76kg/m2 to -0.61kg/m2). Metformin significantly improved three of the five components of metabolic syndrome; waist circumference, fasting glucose and triglycerides. Sensitivity analysis on study quality and duration did not greatly impact results. Metformin led to clinically meaningful weight loss among people on clozapine, and may reduce the rates of metabolic syndrome. Inclusion of metformin into the treatment protocols of people on clozapine, as tolerated, should be considered. PROSPERO registration number: CRD42015029723.

  6. The role of body weight, fat distribution and weight change in ethnic differences in the 9-year incidence of hypertension.

    Science.gov (United States)

    Grootveld, Laura R; Van Valkengoed, Irene G M; Peters, Ron J G; Ujcic-Voortman, Joanne K; Brewster, Lizzy M; Stronks, Karien; Snijder, Marieke B

    2014-05-01

    To investigate the role of body composition (body weight, fat distribution and weight change over time) in ethnic differences in the incidence of hypertension in an ethnic Dutch, South Asian Surinamese and African Surinamese background population living in the Netherlands. We included 361 participants without hypertension at baseline (147 ethnic Dutch, 82 South Asian Surinamese, 132 African Surinamese), aged 35-60 years, in whom anthropometric measurements and blood pressures were measured at baseline and after mean 9 years of follow-up. Data were analysed using logistic regression analyses, with hypertension at follow up as a dependent variable. Body weight, fat distribution and weight gain were positively associated with the risk of developing hypertension; these associations did not statistically significantly differ between ethnic groups [odds ratios (ORs), 95% confidence interval (95% CI) per SD: BMI 1.5 (1.2-2.0); waist circumference 1.5 (1.2-1.9); waist to hip ratio (WHR) 1.4 (1.1-1.9), weight gain of 1-2.9 kg/m 1.8 (0.9-3.8)]. As compared with Dutch, a higher incidence of hypertension was found among South Asian Surinamese [OR 2.6 (1.4-4.8)] and in particular among African Surinamese [OR 3.1 (1.76-5.30)]. Among South Asian Surinamese, adjustment for WHR attenuated the OR the most [OR 1.9 (1.0-3.7)]; among African Surinamese, the strongest effect was observed for adjustment by BMI and WHR simultaneously [OR 2.5 (1.4-4.4)]. The ethnic differences in the incidence of hypertension among a middle-aged group with a Dutch, South Asian Surinamese and African Surinamese background were partly explained by body composition. This suggests that other factors may be involved, including genetic factors or unidentified other determinants.

  7. Prognostic value of tumor suppressors in osteosarcoma before and after neoadjuvant chemotherapy.

    Science.gov (United States)

    Robl, Bernhard; Pauli, Chantal; Botter, Sander Martijn; Bode-Lesniewska, Beata; Fuchs, Bruno

    2015-05-09

    Primary bone cancers are among the deadliest cancer types in adolescents, with osteosarcomas being the most prevalent form. Osteosarcomas are commonly treated with multi-drug neoadjuvant chemotherapy and therapy success as well as patient survival is affected by the presence of tumor suppressors. In order to assess the prognostic value of tumor-suppressive biomarkers, primary osteosarcoma tissues were analyzed prior to and after neoadjuvant chemotherapy. We constructed a tissue microarray from high grade osteosarcoma samples, consisting of 48 chemotherapy naïve biopsies (BXs) and 47 tumor resections (RXs) after neoadjuvant chemotherapy. We performed immunohistochemical stainings of P53, P16, maspin, PTEN, BMI1 and Ki67, characterized the subcellular localization and related staining outcome with chemotherapy response and overall survival. Binary logistic regression analysis was used to analyze chemotherapy response and Kaplan-Meier-analysis as well as the Cox proportional hazards model was applied for analysis of patient survival. No significant associations between biomarker expression in BXs and patient survival or chemotherapy response were detected. In univariate analysis, positive immunohistochemistry of P53 (P = 0.008) and P16 (P16; P = 0.033) in RXs was significantly associated with poor survival prognosis. In addition, presence of P16 in RXs was associated with poor survival in multivariate regression analysis (P = 0.003; HR = 0.067) while absence of P16 was associated with good chemotherapy response (P = 0.004; OR = 74.076). Presence of PTEN on tumor RXs was significantly associated with an improved survival prognosis (P = 0.022). Positive immunohistochemistry (IHC) of P16 and P53 in RXs was indicative for poor overall patient survival whereas positive IHC of PTEN was prognostic for good overall patient survival. In addition, we found that P16 might be a marker of osteosarcoma chemotherapy resistance. Therefore, our study supports the use of tumor RXs to

  8. A Longitudinal Study of Association between Adiposity Markers and Intraocular Pressure: The Kangbuk Samsung Health Study

    Science.gov (United States)

    Zhao, Di; Kim, Myung Hun; Pastor-Barriuso, Roberto; Chang, Yoosoo; Ryu, Seungho; Zhang, Yiyi; Rampal, Sanjay; Shin, Hocheol; Kim, Joon Mo; Friedman, David S.; Guallar, Eliseo; Cho, Juhee

    2016-01-01

    Importance Intraocular pressure (IOP) reduction or stabilization is the only proven method for glaucoma management. Identifying risk factors for IOP is crucial to understand the pathophysiology of glaucoma. Objective To examine the associations of change in body mass index (BMI), waist circumference, and percent fat mass with change in intraocular pressure (IOP) in a large sample of Korean adults. Design, setting and participants Cohort study of 274,064 young and middle age Korean adults with normal fundoscopic findings who attended annual or biennial health exams from January 1, 2002 to Feb 28, 2010 (577,981 screening visits). Exposures BMI, waist circumference, and percent fat mass. Main Outcome Measure(s) At each visit, IOP was measured in both eyes with automated noncontact tonometers. Results In multivariable-adjusted models, the average increase in IOP (95% confidence intervals) over time per interquartile increase in BMI (1.26 kg/m2), waist circumference (6.20 cm), and percent fat mass (3.40%) were 0.18 mmHg (0.17 to 0.19), 0.27 mmHg (0.26 to 0.29), and 0.10 mmHg (0.09 to 0.11), respectively (all P < 0.001). The association was stronger in men compared to women (P < 0.001) and it was only slightly attenuated after including diabetes and hypertension as potential mediators in the model. Conclusions and Relevance Increases in adiposity were significantly associated with an increase in IOP in a large cohort of Korean adults attending health screening visits, an association that was stronger for central obesity. Further research is needed to understand better the underlying mechanisms of this association, and to establish the role of weight gain in increasing IOP and the risk of glaucoma and its complications. PMID:26731527

  9. MEL-18 loss mediates estrogen receptor-α downregulation and hormone independence.

    Science.gov (United States)

    Lee, Jeong-Yeon; Won, Hee-Young; Park, Ji-Hye; Kim, Hye-Yeon; Choi, Hee-Joo; Shin, Dong-Hui; Kang, Ju-Hee; Woo, Jong-Kyu; Oh, Seung-Hyun; Son, Taekwon; Choi, Jin-Woo; Kim, Sehwan; Kim, Hyung-Yong; Yi, Kijong; Jang, Ki-Seok; Oh, Young-Ha; Kong, Gu

    2015-05-01

    The polycomb protein MEL-18 has been proposed as a tumor suppressor in breast cancer; however, its functional relevance to the hormonal regulation of breast cancer remains unknown. Here, we demonstrated that MEL-18 loss contributes to the hormone-independent phenotype of breast cancer by modulating hormone receptor expression. In multiple breast cancer cohorts, MEL-18 was markedly downregulated in triple-negative breast cancer (TNBC). MEL-18 expression positively correlated with the expression of luminal markers, including estrogen receptor-α (ER-α, encoded by ESR1). MEL-18 loss was also associated with poor response to antihormonal therapy in ER-α-positive breast cancer. Furthermore, whereas MEL-18 loss in luminal breast cancer cells resulted in the downregulation of expression and activity of ER-α and the progesterone receptor (PR), MEL-18 overexpression restored ER-α expression in TNBC. Consistently, in vivo xenograft experiments demonstrated that MEL-18 loss induces estrogen-independent growth and tamoxifen resistance in luminal breast cancer, and that MEL-18 overexpression confers tamoxifen sensitivity in TNBC. MEL-18 suppressed SUMOylation of the ESR1 transactivators p53 and SP1, thereby driving ESR1 transcription. MEL-18 facilitated the deSUMOylation process by inhibiting BMI-1/RING1B-mediated ubiquitin-proteasomal degradation of SUMO1/sentrin-specific protease 1 (SENP1). These findings demonstrate that MEL-18 is a SUMO-dependent regulator of hormone receptors and suggest MEL-18 expression as a marker for determining the antihormonal therapy response in patients with breast cancer.

  10. MEL-18 loss mediates estrogen receptor–α downregulation and hormone independence

    Science.gov (United States)

    Lee, Jeong-Yeon; Won, Hee-Young; Park, Ji-Hye; Kim, Hye-Yeon; Choi, Hee-Joo; Shin, Dong-Hui; Kang, Ju-Hee; Woo, Jong-Kyu; Oh, Seung-Hyun; Son, Taekwon; Choi, Jin-Woo; Kim, Sehwan; Kim, Hyung-Yong; Yi, Kijong; Jang, Ki-Seok; Oh, Young-Ha; Kong, Gu

    2015-01-01

    The polycomb protein MEL-18 has been proposed as a tumor suppressor in breast cancer; however, its functional relevance to the hormonal regulation of breast cancer remains unknown. Here, we demonstrated that MEL-18 loss contributes to the hormone-independent phenotype of breast cancer by modulating hormone receptor expression. In multiple breast cancer cohorts, MEL-18 was markedly downregulated in triple-negative breast cancer (TNBC). MEL-18 expression positively correlated with the expression of luminal markers, including estrogen receptor–α (ER-α, encoded by ESR1). MEL-18 loss was also associated with poor response to antihormonal therapy in ER-α–positive breast cancer. Furthermore, whereas MEL-18 loss in luminal breast cancer cells resulted in the downregulation of expression and activity of ER-α and the progesterone receptor (PR), MEL-18 overexpression restored ER-α expression in TNBC. Consistently, in vivo xenograft experiments demonstrated that MEL-18 loss induces estrogen-independent growth and tamoxifen resistance in luminal breast cancer, and that MEL-18 overexpression confers tamoxifen sensitivity in TNBC. MEL-18 suppressed SUMOylation of the ESR1 transactivators p53 and SP1, thereby driving ESR1 transcription. MEL-18 facilitated the deSUMOylation process by inhibiting BMI-1/RING1B-mediated ubiquitin-proteasomal degradation of SUMO1/sentrin-specific protease 1 (SENP1). These findings demonstrate that MEL-18 is a SUMO-dependent regulator of hormone receptors and suggest MEL-18 expression as a marker for determining the antihormonal therapy response in patients with breast cancer. PMID:25822021

  11. Identification, expansion and characterization of cancer cells with stem cell properties from head and neck squamous cell carcinomas

    International Nuclear Information System (INIS)

    Kaseb, Hatem O.; Fohrer-Ting, Helene; Lewis, Dale W.; Lagasse, Eric; Gollin, Susanne M.

    2016-01-01

    Head and neck squamous cell carcinoma (HNSCC) is a major public health concern. Recent data indicate the presence of cancer stem cells (CSC) in many solid tumors, including HNSCC. Here, we assessed the stem cell (SC) characteristics, including cell surface markers, radioresistance, chromosomal instability, and in vivo tumorigenic capacity of CSC isolated from HNSCC patient specimens. We show that spheroid enrichment of CSC from early and short-term HNSCC cell cultures was associated with increased expression of CD44, CD133, SOX2 and BMI1 compared with normal oral epithelial cells. On immunophenotyping, five of 12 SC/CSC markers were homogenously expressed in all tumor cultures, while one of 12 was negative, four of 12 showed variable expression, and two of the 12 were expressed heterogeneously. We showed that irradiated CSCs survived and retained their self-renewal capacity across different ionizing radiation (IR) regimens. Fluorescence in situ hybridization (FISH) analyses of parental and clonally-derived tumor cells revealed different chromosome copy numbers from cell to cell, suggesting the presence of chromosomal instability in HNSCC CSC. Further, our in vitro and in vivo mouse engraftment studies suggest that CD44+/CD66− is a promising, consistent biomarker combination for HNSCC CSC. Overall, our findings add further evidence to the proposed role of HNSCC CSCs in therapeutic resistance. - Highlights: • Spheroid enrichment selects cancer stem cells (CSC) from head & neck tumors (HNSCC). • Compared to normal epithelial cells, isolated CSC express increased SC/CSC markers. • Isolated CSC display enhanced radioresistance, clonogenicity and tumorigenicity. • HNSCC CSC express chromosomal instability. • CD44+/CD66− is a promising, consistent biomarker for HNSCC CSC.

  12. SSX and the synovial-sarcoma-specific chimaeric protein SYT-SSX co-localize with the human Polycomb group complex.

    Science.gov (United States)

    Soulez, M; Saurin, A J; Freemont, P S; Knight, J C

    1999-04-29

    Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.

  13. Genetic modelling of PIM proteins in cancer: proviral tagging, cooperation with oncogenes, tumor suppressor genes and carcinogens.

    Directory of Open Access Journals (Sweden)

    Enara eAguirre

    2014-05-01

    Full Text Available The PIM proteins, which were initially discovered as proviral insertion sites in Moloney murine leukemia virus infection, are a family of highly homologous serine/threonine kinases that have been reported to be overexpressed in hematological malignancies and solid tumors. The PIM proteins have also been associated with metastasis and overall treatment responses and implicated in the regulation of apoptosis, metabolism, the cell cycle, and homing and migration, which makes these proteins interesting targets for anticancer drug discovery. The use of retroviral insertional mutagenesis and refined approaches such as complementation tagging has allowed the identification of myc, pim and a third group of genes (including bmi1 and gfi1 as complementing genes in lymphomagenesis. Moreover, mouse modeling of human cancer has provided an understanding of the molecular pathways that are involved in tumor initiation and progression at the physiological level. In particular, genetically modified mice have allowed researchers to further elucidate the role of each of the Pim isoforms in various tumor types. PIM kinases have been identified as weak oncogenes because experimental overexpression in lymphoid tissue, prostate and liver induces tumors at a relatively low incidence and with a long latency. However, very strong synergistic tumorigenicity between Pim1/2 and c-Myc and other oncogenes has been observed in lymphoid tissues. Mouse models have also been used to study whether the inhibition of specific PIM isoforms is required to prevent carcinogen-induced sarcomas, indicating that the absence of Pim2 and Pim3 greatly reduces sarcoma growth and bone invasion; the extent of this effect is similar to that observed in the absence of all 3 isoforms. This review will summarize some of the animal models that have been used to understand the isoform-specific contribution of PIM kinases to tumorigenesis.

  14. Physical health indicators in major mental illness: data from the Quality and Outcome Framework in the UK.

    Science.gov (United States)

    Martin, Julie Langan; Lowrie, Richard; McConnachie, Alex; McLean, Gary; Mair, Frances; Mercer, Stewart; Smith, Daniel

    2015-02-26

    In the UK, the Quality and Outcome Framework (QOF) has specific targets for general practictioners to record body-mass index (BMI) and blood pressure (BP) in major mental illness, diabetes, and chronic kidney disease. Although incentives are given for aspects of major mental illness (schizophrenia, bipolar disorder, and related psychoses), barriers to care can occur. Our aim was to compare recording of specific targets for BP and BMI in individuals with major mental illness relative to diabetes and chronic kidney disease across the UK. Using 2012 and 2013 QOF data from 9731 general practices across all four countries in the UK, we calculated median payment, population achievement, and exception rates for BP indicators in major mental illness and chronic kidney disease and BMI indicators in major mental illness and diabetes. Differences in unweighted rates between practices in the same UK country were tested with a sign test. Differences in population achievement rate between practices in different countries were compared with those in England by use of a quantile regression analysis. UK payment and population achievement rates for BMI recording in major mental illness were significantly lower than were those in diabetes (payment 92·7% vs 95·5% and population achievement 84·0% vs 92·5%, pmental illness than for chronic kidney disease (94·1% vs 97·8% and 87·0% vs 97·1%, pmental illness were significantly lower in Scotland than in England (for BMI -1·5%, 99% CI -2·7 to -0·3, and for BP -1·8%, -2·7 to -0·9; pmental illness than in diabetes and chronic kidney disease throughout the UK. We also found variation in these rates between countries. This finding is probably multifactorial, reflecting a combination of patient, clinician, and wider organisational factors; however, it might also suggest inequality in access to certain aspects of health care for people with major mental illness. None. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Senescence-Associated Molecular and Epigenetic Alterations in Mesenchymal Stem Cell Cultures from Amniotic Fluid of Normal and Fetus-Affected Pregnancy

    Directory of Open Access Journals (Sweden)

    Jūratė Savickienė

    2016-01-01

    Full Text Available Human amniotic-fluid-derived mesenchymal stem cells (AF-MSCs are interesting for their multilineage differentiation potential and wide range of therapeutic applications due to the ease of culture expansion. However, MSCs undergo replicative senescence. So far, the molecular mechanisms that underlie fetal diseases and cell senescence are still poorly understood. Here, we analyzed senescence-associated morphologic, molecular, and epigenetic characteristics during propagation of MSCs derived from AF of normal and fetus-affected pregnancy. AF-MSCs cultures from both cell sources displayed quite similar morphology and expression of specific cell surface (CD44, CD90, and CD105 and stemness (Oct4, Nanog, Sox2, and Rex1 markers but had interindividual variability in proliferation capability and time to reach senescence. Within passages 4 and 8, senescent cultures exhibited typical morphological features, senescence-associated β-galactosidase activity, increased levels of p16, and decreased levels of miR-17 and miR-21 but showed differential expression of p21, p53, and ATM dependently on the onset of cell senescence. These differences correlated with changes in the level of chromatin modifiers (DNMT1 and HDAC1 and polycomb group proteins (EZH2, SUZ12, and BMI1 paralleling with changes in the expression of repressive histone marks (H3K9me3 and H3K27me3 and stemness markers (Oct4, Nanog, Sox2, and Rex1. Therefore epigenetic factors are important for AF-MSCs senescence process that may be related with individuality of donor or a fetus malignancy status.

  16. Supermarket purchase contributes to nutrition-related non-communicable diseases in urban Kenya

    Science.gov (United States)

    Klasen, Stephan; Nzuma, Jonathan M.; Qaim, Matin

    2017-01-01

    Background While undernutrition and related infectious diseases are still pervasive in many developing countries, the prevalence of non-communicable diseases (NCD), typically associated with high body mass index (BMI), is rapidly rising. The fast spread of supermarkets and related shifts in diets were identified as possible factors contributing to overweight and obesity in developing countries. Potential effects of supermarkets on people’s health have not been analyzed up till now. Objective This study investigates the effects of purchasing food in supermarkets on people’s BMI, as well as on health indicators such as fasting blood glucose (FBG), blood pressure (BP), and the metabolic syndrome. Design This study uses cross-section observational data from urban Kenya. Demographic, anthropometric, and bio-medical data were collected from 550 randomly selected adults. Purchasing food in supermarkets is defined as a binary variable that takes a value of one if any food was purchased in supermarkets during the last 30 days. In a robustness check, the share of food purchased in supermarkets is defined as a continuous variable. Instrumental variable regressions are applied to control for confounding factors and establish causality. Results Purchasing food in supermarkets contributes to higher BMI (+ 1.8 kg/m2) (Psupermarkets also contributes to higher levels of FBG (+ 0.3 mmol/L) (PSupermarkets and their food sales strategies seem to have direct effects on people’s health. In addition to increasing overweight and obesity, supermarkets contribute to nutrition-related NCDs. Effects of supermarkets on nutrition and health can mainly be ascribed to changes in the composition of people’s food choices. PMID:28934333

  17. Parental Obesity and Early Childhood Development.

    Science.gov (United States)

    Yeung, Edwina H; Sundaram, Rajeshwari; Ghassabian, Akhgar; Xie, Yunlong; Buck Louis, Germaine

    2017-02-01

    Previous studies identified associations between maternal obesity and childhood neurodevelopment, but few examined paternal obesity despite potentially distinct genetic/epigenetic effects related to developmental programming. Upstate KIDS (2008-2010) recruited mothers from New York State (excluding New York City) at ∼4 months postpartum. Parents completed the Ages and Stages Questionnaire (ASQ) when their children were 4, 8, 12, 18, 24, 30, and 36 months of age corrected for gestation. The ASQ is validated to screen for delays in 5 developmental domains (ie, fine motor, gross motor, communication, personal-social functioning, and problem-solving ability). Analyses included 3759 singletons and 1062 nonrelated twins with ≥1 ASQs returned. Adjusted odds ratios (aORs) and 95% confidence intervals were estimated by using generalized linear mixed models accounting for maternal covariates (ie, age, race, education, insurance, marital status, parity, and pregnancy smoking). Compared with normal/underweight mothers (BMI obese mothers (26% with BMI ≥30) had increased odds of failing the fine motor domain (aOR 1.67; confidence interval 1.12-2.47). The association remained after additional adjustment for paternal BMI (1.67; 1.11-2.52). Paternal obesity (29%) was associated with increased risk of failing the personal-social domain (1.75; 1.13-2.71), albeit attenuated after adjustment for maternal obesity (aOR 1.71; 1.08-2.70). Children whose parents both had BMI ≥35 were likely to additionally fail the problem-solving domain (2.93; 1.09-7.85). Findings suggest that maternal and paternal obesity are each associated with specific delays in early childhood development, emphasizing the importance of family information when screening child development. Copyright © 2017 by the American Academy of Pediatrics.

  18. A Longitudinal Study of Association between Adiposity Markers and Intraocular Pressure: The Kangbuk Samsung Health Study.

    Directory of Open Access Journals (Sweden)

    Di Zhao

    Full Text Available Intraocular pressure (IOP reduction or stabilization is the only proven method for glaucoma management. Identifying risk factors for IOP is crucial to understand the pathophysiology of glaucoma.To examine the associations of change in body mass index (BMI, waist circumference, and percent fat mass with change in intraocular pressure (IOP in a large sample of Korean adults.Cohort study of 274,064 young and middle age Korean adults with normal fundoscopic findings who attended annual or biennial health exams from January 1, 2002 to Feb 28, 2010 (577,981 screening visits.BMI, waist circumference, and percent fat mass.At each visit, IOP was measured in both eyes with automated noncontact tonometers.In multivariable-adjusted models, the average increase in IOP (95% confidence intervals over time per interquartile increase in BMI (1.26 kg/m2, waist circumference (6.20 cm, and percent fat mass (3.40% were 0.18 mmHg (0.17 to 0.19, 0.27 mmHg (0.26 to 0.29, and 0.10 mmHg (0.09 to 0.11, respectively (all P < 0.001. The association was stronger in men compared to women (P < 0.001 and it was only slightly attenuated after including diabetes and hypertension as potential mediators in the model.Increases in adiposity were significantly associated with an increase in IOP in a large cohort of Korean adults attending health screening visits, an association that was stronger for central obesity. Further research is needed to understand better the underlying mechanisms of this association, and to establish the role of weight gain in increasing IOP and the risk of glaucoma and its complications.

  19. Bariatric surgery for obese children and adolescents: a systematic review and meta-analysis.

    Science.gov (United States)

    Black, J A; White, B; Viner, R M; Simmons, R K

    2013-08-01

    The number of obese young people continues to rise, with a corresponding increase in extreme obesity and paediatric-adolescent bariatric surgery. We aimed to (i) systematically review the literature on bariatric surgery in children and adolescents; (ii) meta-analyse change in body mass index (BMI) 1-year post-surgery and (iii) report complications, co-morbidity resolution and health-related quality of life (HRQoL). A systematic literature search (1955-2013) was performed to examine adjustable gastric band, sleeve gastrectomy, Roux-en-Y gastric bypass or biliopancreatic diversions operations among obese children and adolescents. Change in BMI a year after surgery was meta-analysed using a random effects model. In total, 637 patients from 23 studies were included in the meta-analysis. There were significant decreases in BMI at 1 year (average weighted mean BMI difference: -13.5 kg m(-2) ; 95% confidence interval [CI] -14.1 to -11.9). Complications were inconsistently reported. There was some evidence of co-morbidity resolution and improvements in HRQol post-surgery. Bariatric surgery leads to significant short-term weight loss in obese children and adolescents. However, the risks of complications are not well defined in the literature. Long-term, prospectively designed studies, with clear reporting of complications and co-morbidity resolution, alongside measures of HRQol, are needed to firmly establish the harms and benefits of bariatric surgery in children and adolescents. © 2013 The Authors. obesity reviews © 2013 International Association for the Study of Obesity.

  20. Targeting of alpha-v integrins reduces malignancy of bladder carcinoma.

    Directory of Open Access Journals (Sweden)

    Geertje van der Horst

    Full Text Available Low survival rates of metastatic cancers emphasize the need for a drug that can prevent and/or treat metastatic cancer. αv integrins are involved in essential processes for tumor growth and metastasis and targeting of αv integrins has been shown to decrease angiogenesis, tumor growth and metastasis. In this study, the role of αv integrin and its potential as a drug target in bladder cancer was investigated. Treatment with an αv integrin antagonist as well as knockdown of αv integrin in the bladder carcinoma cell lines, resulted in reduced malignancy in vitro, as illustrated by decreased proliferative, migratory and clonogenic capacity. The CDH1/CDH2 ratio increased, indicating a shift towards a more epithelial phenotype. This shift appeared to be associated with downregulation of EMT-inducing transcription factors including SNAI2. The expression levels of the self-renewal genes NANOG and BMI1 decreased as well as the number of cells with high Aldehyde Dehydrogenase activity. In addition, self-renewal ability decreased as measured with the urosphere assay. In line with these observations, knockdown or treatment of αv integrins resulted in decreased metastatic growth in preclinical in vivo models as assessed by bioluminescence imaging. In conclusion, we show that αv integrins are involved in migration, EMT and maintenance of Aldehyde Dehydrogenase activity in bladder cancer cells. Targeting of αv integrins might be a promising approach for treatment and/or prevention of metastatic bladder cancer.

  1. Cell Adhesion Molecule CD166/ALCAM Functions Within the Crypt to Orchestrate Murine Intestinal Stem Cell HomeostasisSummary

    Directory of Open Access Journals (Sweden)

    Nicholas R. Smith

    2017-05-01

    Full Text Available Background & Aims: Intestinal epithelial homeostasis is maintained by active-cycling and slow-cycling stem cells confined within an instructive crypt-based niche. Exquisite regulating of these stem cell populations along the proliferation-to-differentiation axis maintains a homeostatic balance to prevent hyperproliferation and cancer. Although recent studies focus on how secreted ligands from mesenchymal and epithelial populations regulate intestinal stem cells (ISCs, it remains unclear what role cell adhesion plays in shaping the regulatory niche. Previously we have shown that the cell adhesion molecule and cancer stem cell marker, CD166/ALCAM (activated leukocyte cell adhesion molecule, is highly expressed by both active-cycling Lgr5+ ISCs and adjacent Paneth cells within the crypt base, supporting the hypothesis that CD166 functions to mediate ISC maintenance and signal coordination. Methods: Here we tested this hypothesis by analyzing a CD166–/– mouse combined with immunohistochemical, flow cytometry, gene expression, and enteroid culture. Results: We found that animals lacking CD166 expression harbored fewer active-cycling Lgr5+ ISCs. Homeostasis was maintained by expansion of the transit-amplifying compartment and not by slow-cycling Bmi1+ ISC stimulation. Loss of active-cycling ISCs was coupled with deregulated Paneth cell homeostasis, manifested as increased numbers of immature Paneth progenitors due to decreased terminal differentiation, linked to defective Wnt signaling. CD166–/– Paneth cells expressed reduced Wnt3 ligand expression and depleted nuclear β-catenin. Conclusions: These data support a function for CD166 as an important cell adhesion molecule that shapes the signaling microenvironment by mediating ISC–niche cell interactions. Furthermore, loss of CD166 expression results in decreased ISC and Paneth cell homeostasis and an altered Wnt microenvironment. Keywords: Intestinal Stem Cell, Homeostasis

  2. Overweight and obesity in patients with atrial fibrillation: Sex differences in 1-year outcomes in the EORP-AF General Pilot Registry.

    Science.gov (United States)

    Boriani, Giuseppe; Laroche, Cécile; Diemberger, Igor; Fantecchi, Elisa; Meeder, Joan; Kurpesa, Malgorzata; Baluta, Monica Mariana; Proietti, Marco; Tavazzi, Luigi; Maggioni, Aldo P; Lip, Gregory Y H

    2018-04-01

    The impact of overweight and obesity on outcomes in "real world" patients with atrial fibrillation (AF) is not fully defined. Second, sex differences in AF outcomes may also exist. The aim was to investigate outcomes at 1 year follow-up for AF patients enrolled in the EORP-AF Registry, according to BMI (kg/m 2 ), comparing patients with normal BMI (18.5 to obesity (≥ 30 kg/m 2 ), in relation to sex differences. Among 2,540 EORP AF patients (38.9% female; median age 69) with 1 year follow-up data available, 720 (28.3%) had a normal BMI, 1,084 (42.7%) were overweight, and 736 (29.0%) were obese. Obese patients were younger and with more prevalent diabetes mellitus and hypertension (P different according to BMI among female patients (9.3% normal BMI, 5.3% overweight, and 4.3 % obese, P = 0.023), but not among male patients (P = 0.748). The composite outcome of thromboembolic events and death was also significantly different, being lower in obese females (P = 0.035). Among male patients, bleeding events were significantly more frequent in obese subjects (P = 0.035). On multivariable Cox analysis, BMI was not independently associated with all-cause mortality. Among AF patients, overweight and obesity are common and associated with better outcomes in females (a finding previously reported as "obesity paradox"), while no significant differences in outcomes are detected among male patients. Final multivariable model found that increasing BMI was not associated with increased risk of all-cause death; conversely, age and comorbidities persisted as major determinants. © 2018 Wiley Periodicals, Inc.

  3. Cohort profile: Pacific Islands Families (PIF) growth study, Auckland, New Zealand

    Science.gov (United States)

    Rush, E; Oliver, M; Plank, L D; Taylor, S; Iusitini, L; Jalili-Moghaddam, S; Savila, F; Paterson, J; Tautolo, E

    2016-01-01

    Purpose This article profiles a birth cohort of Pacific children participating in an observational prospective study and describes the study protocol used at ages 14–15 years to investigate how food and activity patterns, metabolic risk and family and built environment are related to rates of physical growth of Pacific children. Participants From 2000 to 2015, the Pacific Islands Families Study has followed, from birth, the growth and development of over 1000 Pacific children born in Auckland, New Zealand. In 2014, 931 (66%) of the original cohort had field measures of body composition, blood pressure and glycated haemoglobin. A nested subsample (n=204) was drawn by randomly selecting 10 males and 10 females from each decile of body weight. These participants had measurement of body composition by dual-energy X-ray absorptiometry, food frequency, 6 min walk test and accelerometer-determined physical activity and sedentary behaviours, and blood biomarkers for metabolic disease such as diabetes. Built environment variables were generated from individual addresses. Findings to date Compared to the Centres for Disease Control and Prevention (CDC) reference population with mean SD scores (SDS) of 0, this cohort of 931 14-year-olds was taller, weighed more and had a higher body mass index (BMI) (mean SDS height >0.6, weight >1.6 and BMI >1.4). 7 of 10 youth were overweight or obese. The nested-sampling frame achieved an even distribution by body weight. Future plans Cross-sectional relationships between body size, fatness and growth rate, food patterns, activity patterns, pubertal development, risks for diabetes and hypertension and the family and wider environment will be examined. In addition, analyses will investigate relationships with data collected earlier in the life course and measures of the cohort in the future. Understanding past and present influences on child growth and health will inform timely interventions to optimise future health and reduce

  4. 3-Deazaneplanocin A suppresses aggressive phenotype-related gene expression in an oral squamous cell carcinoma cell line

    International Nuclear Information System (INIS)

    Hatta, Mitsutoki; Naganuma, Kaori; Kato, Kenichi; Yamazaki, Jun

    2015-01-01

    In tumor tissues, alterations of gene expression caused by aberrant epigenetic modifications confer phenotypic diversity on malignant cells. Although 3-deazaneplanocin A (DZNep) has been shown to reactivate tumor suppressor genes in several cancer cells, it remains unclear whether DZNep attenuates the malignant phenotypes of oral squamous cell carcinoma (OSCC) cells. In this study, we investigated the effect of DZNep on the expression of genes related to aggressive phenotypes, such as epithelial–mesenchymal transition, in OSCC cells. We found that DZNep reduced the cellular levels of polycomb group proteins (EZH2, SUZ12, BMI1, and RING1A) and the associated trimethylation of Lys27 on histone H3 and monoubiquitination of Lys119 on histone H2A in the poorly differentiated OSCC cell line SAS. Immunocytochemical staining demonstrated that DZNep induced the reorganization of filamentous actin and the membrane localization of E-cadherin associated with cell–cell adhesions. We also found an inhibitory effect of DZNep on cell proliferation using a WST assay. Finally, quantitative RT-PCR analysis demonstrated that genes involved in the aggressive phenotypes (TWIST2, EGFR, ACTA2, TGFB1, WNT5B, and APLIN) were down-regulated, whereas epithelial phenotype genes (CDH1, CLDN4, IVL, and TGM1) were up-regulated in SAS cells treated with DZNep. Collectively, our findings suggest that DZNep reverses the aggressive characteristics of OSCC cells through the dynamic regulation of epithelial plasticity via the reprogramming of gene expression patterns. - Highlights: • DZNep reduced PcG proteins and associated histone modifications in OSCC cells. • DZNep enhanced cell–cell adhesion indicative of epithelial phenotype in OSCC cells. • DZNep suppressed the aggressive phenotype-related gene expression in OSCC cells. • DZNep activated the gene expression of epithelial markers in OSCC cells.

  5. 3-Deazaneplanocin A suppresses aggressive phenotype-related gene expression in an oral squamous cell carcinoma cell line

    Energy Technology Data Exchange (ETDEWEB)

    Hatta, Mitsutoki, E-mail: hatta@college.fdcnet.ac.jp [Department of Physiological Science and Molecular Biology, Fukuoka Dental College, Fukuoka (Japan); Naganuma, Kaori [Department of Oral and Maxillofacial Surgery, Fukuoka Dental College, Fukuoka (Japan); Kato, Kenichi; Yamazaki, Jun [Department of Physiological Science and Molecular Biology, Fukuoka Dental College, Fukuoka (Japan)

    2015-12-04

    In tumor tissues, alterations of gene expression caused by aberrant epigenetic modifications confer phenotypic diversity on malignant cells. Although 3-deazaneplanocin A (DZNep) has been shown to reactivate tumor suppressor genes in several cancer cells, it remains unclear whether DZNep attenuates the malignant phenotypes of oral squamous cell carcinoma (OSCC) cells. In this study, we investigated the effect of DZNep on the expression of genes related to aggressive phenotypes, such as epithelial–mesenchymal transition, in OSCC cells. We found that DZNep reduced the cellular levels of polycomb group proteins (EZH2, SUZ12, BMI1, and RING1A) and the associated trimethylation of Lys27 on histone H3 and monoubiquitination of Lys119 on histone H2A in the poorly differentiated OSCC cell line SAS. Immunocytochemical staining demonstrated that DZNep induced the reorganization of filamentous actin and the membrane localization of E-cadherin associated with cell–cell adhesions. We also found an inhibitory effect of DZNep on cell proliferation using a WST assay. Finally, quantitative RT-PCR analysis demonstrated that genes involved in the aggressive phenotypes (TWIST2, EGFR, ACTA2, TGFB1, WNT5B, and APLIN) were down-regulated, whereas epithelial phenotype genes (CDH1, CLDN4, IVL, and TGM1) were up-regulated in SAS cells treated with DZNep. Collectively, our findings suggest that DZNep reverses the aggressive characteristics of OSCC cells through the dynamic regulation of epithelial plasticity via the reprogramming of gene expression patterns. - Highlights: • DZNep reduced PcG proteins and associated histone modifications in OSCC cells. • DZNep enhanced cell–cell adhesion indicative of epithelial phenotype in OSCC cells. • DZNep suppressed the aggressive phenotype-related gene expression in OSCC cells. • DZNep activated the gene expression of epithelial markers in OSCC cells.

  6. Maternal characteristics associated with the obesogenic quality of the home environment in early childhood.

    Science.gov (United States)

    Schrempft, Stephanie; van Jaarsveld, Cornelia H M; Fisher, Abigail; Fildes, Alison; Wardle, Jane

    2016-12-01

    The home environment is likely to influence children's diet and activity patterns and ultimately, their weight trajectories. Identifying family characteristics associated with a more 'obesogenic' home can provide insight into the determinants, and has implications for targeting and tailoring strategies to promote healthier lifestyles. The present study examined maternal characteristics associated with a more obesogenic home environment in 1113 families with preschool children. Primary caregivers (99% mothers) from the Gemini cohort completed the Home Environment Interview (HEI) when their children were 4 years old. Maternal demographics and BMI were assessed in the Gemini baseline questionnaire when the children were on average 8 months old. Maternal eating style was assessed when the children were on average 2 years old, using the Dutch Eating Behaviour Questionnaire (DEBQ). Responses to the HEI were standardised and summed to create a composite score of the obesogenic quality of the home; this was categorised into tertiles. Multivariate ordinal logistic regression showed that mothers who were younger (adjusted OR; 95% CI = 0.96; 0.94-0.98), less educated (1.97; 1.40-2.77), and had lower incomes (1.89; 1.43-2.49) at baseline were more likely to live in an obesogenic home environment at 4 years, as were mothers who scored higher on the DEBQ External Eating scale (1.40; 1.16-1.70) at 2 years, and had a higher baseline BMI (1.05; 1.02-1.08). Using a novel, composite measure of the home environment, this study finds that families who are more socio-economically deprived, and where the mothers are themselves heavier and have a more food responsive eating style, tend to provide a home environment with the hallmarks of a higher risk of weight gain. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. The malignant pleural effusion as a model to investigate intratumoral heterogeneity in lung cancer.

    Directory of Open Access Journals (Sweden)

    Saroj K Basak

    Full Text Available Malignant Pleural Effusions (MPE may be useful as a model to study hierarchical progression of cancer and/or intratumoral heterogeneity. To strengthen the rationale for developing the MPE-model for these purposes, we set out to find evidence for the presence of cancer stem cells (CSC in MPE and demonstrate an ability to sustain intratumoral heterogeneity in MPE-primary cultures. Our studies show that candidate lung CSC-expression signatures (PTEN, OCT4, hTERT, Bmi1, EZH2 and SUZ12 are evident in cell pellets isolated from MPE, and MPE-cytopathology also labels candidate-CSC (CD44, cMET, MDR-1, ALDH subpopulations. Moreover, in primary cultures that use MPE as the source of both tumor cells and the tumor microenvironment (TME, candidate CSC are maintained over time. This allows us to live-sort candidate CSC-fractions from the MPE-tumor mix on the basis of surface markers (CD44, c-MET, uPAR, MDR-1 or differences in xenobiotic metabolism (ALDH. Thus, MPE-primary cultures provide an avenue to extract candidate CSC populations from individual (isogenic MPE-tumors. This will allow us to test whether these cells can be discriminated in functional bioassays. Tumor heterogeneity in MPE-primary cultures is evidenced by variable immunolabeling, differences in colony-morphology, and differences in proliferation rates of cell subpopulations. Collectively, these data justify the ongoing development of the MPE-model for the investigation of intratumoral heterogeneity, tumor-TME interactions, and phenotypic validation of candidate lung CSC, in addition to providing direction for the pre-clinical development of rational therapeutics.

  8. Non-Small Cell Lung Cancer Cells Expressing CD44 Are Enriched for Stem Cell-Like Properties

    Science.gov (United States)

    Leung, Elaine Lai-Han; Fiscus, Ronald R.; Tung, James W.; Tin, Vicky Pui-Chi; Cheng, Lik Cheung; Sihoe, Alan Dart-Loon; Fink, Louis M.; Ma, Yupo; Wong, Maria Pik

    2010-01-01

    Background The cancer stem cell theory hypothesizes that cancers are perpetuated by cancer stem cells (CSC) or tumor initiating cells (TIC) possessing self-renewal and other stem cell-like properties while differentiated non-stem/initiating cells have a finite life span. To investigate whether the hypothesis is applicable to lung cancer, identification of lung CSC and demonstration of these capacities is essential. Methodology/Principal Finding The expression profiles of five stem cell markers (CD34, CD44, CD133, BMI1 and OCT4) were screened by flow cytometry in 10 lung cancer cell lines. CD44 was further investigated by testing for in vitro and in vivo tumorigenecity. Formation of spheroid bodies and in vivo tumor initiation ability were demonstrated in CD44+ cells of 4 cell lines. Serial in vivo tumor transplantability in nude mice was demonstrated using H1299 cell line. The primary xenografts initiated from CD44+ cells consisted of mixed CD44+ and CD44− cells in similar ratio as the parental H1299 cell line, supporting in vivo differentiation. Semi-quantitative Real-Time PCR (RT-PCR) showed that both freshly sorted CD44+ and CD44+ cells derived from CD44+-initiated tumors expressed the pluripotency genes OCT4/POU5F1, NANOG, SOX2. These stemness markers were not expressed by CD44− cells. Furthermore, freshly sorted CD44+ cells were more resistant to cisplatin treatment with lower apoptosis levels than CD44− cells. Immunohistochemical analysis of 141 resected non-small cell lung cancers showed tumor cell expression of CD44 in 50.4% of tumors while no CD34, and CD133 expression was observed in tumor cells. CD44 expression was associated with squamous cell carcinoma but unexpectedly, a longer survival was observed in CD44-expressing adenocarcinomas. Conclusion/Significance Overall, our results demonstrated that stem cell-like properties are enriched in CD44-expressing subpopulations of some lung cancer cell lines. Further investigation is required to clarify

  9. Pengaruh Olahraga Jalan Cepat dan Diet terhadap Tekanan Darah Penderita Prahipertensi Pria

    Directory of Open Access Journals (Sweden)

    Mustafa Kamal

    2013-01-01

    serum of the groups all reduce significantly. The highest reduction of those intervention achieved by DASHI-J and brisk walking exercise group with body weight decreased 4.18 kg, Body Mass Index (BMI 1.50 kg/m2, blood pressure 12.00/8.60 mmHg. This implies that DASHI-J and brisk walking exercise play a significant role in reducing body weight, BMI, and both sistolic and diastolic blood pressure.

  10. Downregulation of Melanoma Cell Adhesion Molecule (MCAM/CD146) Accelerates Cellular Senescence in Human Umbilical Cord Blood-Derived Mesenchymal Stem Cells.

    Science.gov (United States)

    Jin, Hye Jin; Kwon, Ji Hye; Kim, Miyeon; Bae, Yun Kyung; Choi, Soo Jin; Oh, Wonil; Yang, Yoon Sun; Jeon, Hong Bae

    2016-04-01

    Therapeutic applications of mesenchymal stem cells (MSCs) for treating various diseases have increased in recent years. To ensure that treatment is effective, an adequate MSC dosage should be determined before these cells are used for therapeutic purposes. To obtain a sufficient number of cells for therapeutic applications, MSCs must be expanded in long-term cell culture, which inevitably triggers cellular senescence. In this study, we investigated the surface markers of human umbilical cord blood-derived MSCs (hUCB-MSCs) associated with cellular senescence using fluorescence-activated cell sorting analysis and 242 cell surface-marker antibodies. Among these surface proteins, we selected the melanoma cell adhesion molecule (MCAM/CD146) for further study with the aim of validating observed expression differences and investigating the associated implications in hUCB-MSCs during cellular senescence. We observed that CD146 expression markedly decreased in hUCB-MSCs following prolonged in vitro expansion. Using preparative sorting, we found that hUCB-MSCs with high CD146 expression displayed high growth rates, multilineage differentiation, expression of stemness markers, and telomerase activity, as well as significantly lower expression of the senescence markers p16, p21, p53, and senescence-associated β-galactosidase, compared with that observed in hUCB-MSCs with low-level CD146 expression. In contrast, CD146 downregulation with small interfering RNAs enhanced the senescence phenotype. In addition, CD146 suppression in hUCB-MSCs caused downregulation of other cellular senescence regulators, including Bmi-1, Id1, and Twist1. Collectively, our results suggest that CD146 regulates cellular senescence; thus, it could be used as a therapeutic marker to identify senescent hUCB-MSCs. One of the fundamental requirements for mesenchymal stem cell (MSC)-based therapies is the expansion of MSCs during long-term culture because a sufficient number of functional cells is required

  11. Cumulative Effect of Obesogenic Behaviours on Adiposity in Spanish Children and Adolescents

    Directory of Open Access Journals (Sweden)

    Helmut Schröder

    2017-12-01

    Full Text Available Objective: Little is known about the cumulative effect of obesogenic behaviours on childhood obesity risk. We determined the cumulative effect on BMI z-score, waist-to-height ratio (WHtR, overweight and abdominal obesity of four lifestyle behaviours that have been linked to obesity. Methods: In this cross-sectional analysis, data were obtained from the EnKid sudy, a representative sample of Spanish youth. The study included 1,614 boys and girls aged 5-18 years. Weight, height and waist circumference were measured. Physical activity (PA, screen time, breakfast consumption and meal frequency were self-reported on structured questionnaires. Obesogenic behaviours were defined as z-score was computed using age- and sex-specific reference values from the World Health Organization (WHO. Overweight including obesity was defined as a BMI > 1 SD from the mean of the WHO reference population. Abdominal obesity was defined as a WHtR ≥ 0.5. Results: High screen time was the most prominent obesogenic behaviour (49.7%, followed by low physical activity (22.4%, low meal frequency (14.4%, and skipping breakfast (12.5%. Although 33% of participants were free of all 4 obesogenic behaviours, 1, 2, and 3 or 4 behaviours were reported by 44.5%, 19.3%, and 5.0%, respectively. BMI z-score and WHtR were positively associated (p < 0.001 with increasing numbers of concurrent obesogenic behaviours. The odds of presenting with obesogenic behaviours were significantly higher in children who were overweight (OR 2.68; 95% CI 1.50; 4.80 or had abdominal obesity (OR 2.12; 95% CI 1.28; 3.52; they reported more than 2 obesogenic behaviours. High maternal and parental education was inversely associated (p = 0.004 and p < 0.001, respectively with increasing presence of obesogenic behaviours. Surrogate markers of adiposity increased with numbers of concurrent presence of obesogenic behaviours. The opposite was true for high maternal and paternal education.

  12. Mitigation of arsenic-induced acquired cancer phenotype in prostate cancer stem cells by miR-143 restoration

    Energy Technology Data Exchange (ETDEWEB)

    Ngalame, Ntube N.O., E-mail: ngalamenn@niehs.nih.gov; Makia, Ngome L., E-mail: makianl@niehs.nih.gov; Waalkes, Michael P., E-mail: waalkes@niehs.nih.gov; Tokar, Erik J., E-mail: tokare@mail.nih.gov

    2016-12-01

    Inorganic arsenic, an environmental contaminant and a human carcinogen is associated with prostate cancer. Emerging evidence suggests that cancer stem cells (CSCs) are the driving force of carcinogenesis. Chronic arsenic exposure malignantly transforms the human normal prostate stem/progenitor cell (SC) line, WPE-stem to arsenic-cancer SCs (As-CSCs), through unknown mechanisms. MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the posttranscriptional level. In prior work, miR-143 was markedly downregulated in As-CSCs, suggesting a role in arsenic-induced malignant transformation. In the present study, we investigated whether loss of miR-143 expression is important in arsenic-induced transformation of prostate SCs. Restoration of miR-143 in As-CSCs was achieved by lentivirus-mediated miR-143 overexpression. Cells were assessed bi-weekly for up to 30 weeks to examine mitigation of cancer phenotype. Secreted matrix metalloproteinase (MMP) activity was increased by arsenic-induced malignant transformation, but miR-143 restoration decreased secreted MMP-2 and MMP-9 enzyme activities compared with scramble controls. Increased cell proliferation and apoptotic resistance, two hallmarks of cancer, were decreased upon miR-143 restoration. Increased apoptosis was associated with decreased BCL2 and BCL-XL expression. miR-143 restoration dysregulated the expression of SC/CSC self-renewal genes including NOTCH-1, BMI-1, OCT4 and ABCG2. The anticancer effects of miR-143 overexpression appeared to be mediated by targeting and inhibiting LIMK1 protein, and the phosphorylation of cofilin, a LIMK1 substrate. These findings clearly show that miR-143 restoration mitigated multiple cancer characteristics in the As-CSCs, suggesting a potential role in arsenic-induced transformation of prostate SCs. Thus, miR-143 is a potential biomarker and therapeutic target for arsenic-induced prostate cancer. - Highlights: • Chronic arsenic exposure

  13. PKH26 staining defines distinct subsets of normal human colon epithelial cells at different maturation stages.

    Directory of Open Access Journals (Sweden)

    Anna Pastò

    Full Text Available BACKGROUND AND AIM: Colon crypts are characterized by a hierarchy of cells distributed along the crypt axis. Aim of this paper was to develop an in vitro system for separation of epithelial cell subsets in different maturation stages from normal human colon. METHODOLOGY AND MAJOR FINDINGS: Dissociated colonic epithelial cells were stained with PKH26, which allows identification of distinct populations based on their proliferation rate, and cultured in vitro in the absence of serum. The cytofluorimetric expression of CK20, Msi-1 and Lgr5 was studied. The mRNA levels of several stemness-associated genes were also compared in cultured cell populations and in three colon crypt populations isolated by microdissection. A PKH(pos population survived in culture and formed spheroids; this population included subsets with slow (PKH(high and rapid (PKH(low replicative rates. Molecular analysis revealed higher mRNA levels of both Msi-1 and Lgr-5 in PKH(high cells; by cytofluorimetric analysis, Msi-1(+/Lgr5(+ cells were only found within PKH(high cells, whereas Msi-1(+/Lgr5(- cells were also observed in the PKH(low population. As judged by qRT-PCR analysis, the expression of several stemness-associated markers (Bmi-1, EphB2, EpCAM, ALDH1 was highly enriched in Msi-1(+/Lgr5(+ cells. While CK20 expression was mainly found in PKH(low and PKH(neg cells, a small PKH(high subset co-expressed both CK20 and Msi-1, but not Lgr5; cells with these properties also expressed Mucin, and could be identified in vivo in colon crypts. These results mirrored those found in cells isolated from different crypt portions by microdissection, and based on proliferation rates and marker expression they allowed to define several subsets at different maturation stages: PKH(high/Lgr5(+/Msi-1(+/CK20(-, PKH(high/Lgr5(-/Msi-1(+/CK20(+, PKH(low/Lgr5(-/Msi-1(+/Ck20(-, and PKH(low/Lgr5(-/Msi-1(-/CK20(+ cells. CONCLUSIONS: Our data show the possibility of deriving in vitro, without any

  14. Risk factors related to female breast cancer in regions of Northeast China: a 1:3 matched case-control population-based study.

    Science.gov (United States)

    Yu, Zhi-gang; Jia, Cun-xian; Geng, Cui-zhi; Tang, Jin-hai; Zhang, Jin; Liu, Li-yuan

    2012-03-01

    There has been an increase in the incidence of breast cancer in China, but no definite risk and protective factors for breast cancer have been identified in Chinese females. This study was designed to identify the risk factors for female breast cancer in North and East China. A 1:3 matched, case-control study was conducted. All of the subjects in the case and control groups were selected from a previous epidemiological survey of 122 058 females aged 25 to 70 years. Single and multiple Logistic regression analyses were used to study potential factors in the development of breast cancer. Significant differences at the level of α=0.20 between case and control groups were observed for the following factors: economic status, social status, family annual income, bean product consumption, body mass index (BMI), family history of breast cancer in the first or second degree, number of miscarriages, menstrual pattern, benign breast disease history, nipple leakage, inverted nipple, history of diabetes mellitus, history of hypertension, history of ovarian cyst, physical exercise, current and global quality of life satisfaction, healthy behavior and prevention, and scores of breast cancer-related knowledge. After Cox-regression model analysis (α=0.10), six factors were found to be significantly related to breast cancer, of which the ORs and 95%CIs were: BMI, 1.696 (1.169-2.460, P=0.005); benign breast disease history, 2.672 (0.848-8.416, P=0.093); family history of breast cancer, 7.080 (1.758-28.551, P=0.006); number of miscarriages, 1.738 (1.014-2.978, P=0.044); global quality of life satisfaction, 3.044 (1.804-5.136, P=0.000); healthy behavior and prevention, 3.294 (1.692-6.412, P=0.000). A comprehensive range of factors related to breast cancer was identified. Women should be educated about a healthy lifestyle, especially those with a family history of breast cancer or a personal history of benign breast disease.

  15. RS 10767664 gene variant in Brain Derived Neurotrophic Factor (BDNF) affect metabolic changes and insulin resistance after a standard hypocaloric diet.

    Science.gov (United States)

    de Luis, Daniel Antonio; Fernández Ovalle, H; Izaola, O; Primo, D; Aller, Rocío

    2018-02-01

    Role of BDNF variants on change in body weight and cardiovascular risk factors after weight loss remains unclear in obese patients. Our aim was to analyze the effects of rs10767664 BDNF gene polymorphism on body weight, cardiovascular risk factors and serum adipokine levels after a standard hypocaloric diet in obese subjects. A Caucasian population of 80 obese patients was analyzed before and after 3months on a standard hypocaloric diet. Fifty patients (62.5%) had the genotype AA and 30 (37.5%) subjects had the next genotypes; AT (25 patients, 31.3%) or TT (5 study subjects, 6.3%) (second group). In non T allele carriers, the decreases in weight-3.4±2.9kg (T allele group -1.7±2.0kg:p=0.01), BMI -1.5±0.2kg (T allele group -1.2±0.5kg:p=0.02), fat mass-2.3±1.1kg (T allele group -1.7±0.9kg:p=0.009), waist circumference-3.8±2.4cm (T allele group -2.1±3.1cm:p=0.008), triglycerides -13.2±7.5mg/dl (T allele group +2.8±1.2mg/dl:p=0.02), insulin -2.1±1.9mUI/L (T allele group -0.3±1.0mUI/L:p=0.01), HOMA-IR -0.9±0.4 (T allele group -0.1±0.8:p=0.01) and leptin -10.1±9.5ng/dl (T allele group -3.1±0.2ng/dl:p=0.01) were higher than T allele carriers. rs10767664 variant of BDNF gene modify anthropometric and biochemical changes after weight loss with a hypocaloric diet. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Effectiveness and Persistence of Liraglutide Treatment Among Patients with Type 2 Diabetes Treated in Primary Care and Specialist Settings: A Subgroup Analysis from the EVIDENCE Study, a Prospective, 2-Year Follow-up, Observational, Post-Marketing Study.

    Science.gov (United States)

    Martinez, Luc; Penfornis, Alfred; Gautier, Jean-Francois; Eschwège, Eveline; Charpentier, Guillaume; Bouzidi, Amira; Gourdy, Pierre

    2017-03-01

    The objective of this subgroup analysis is to investigate the effectiveness of liraglutide in people with type 2 diabetes (T2D) treated within the primary care physician (PCP) and specialist care settings. EVIDENCE is a prospective, observational study of 3152 adults with T2D recently starting or about to start liraglutide treatment in France. We followed patients in the PCP and specialist settings for 2 years to evaluate the effectiveness of liraglutide in glycemic control and body weight reduction. Furthermore, we evaluated the changes in combined antihyperglycemic treatments, the reasons for prescribing liraglutide, patient satisfaction, and safety of liraglutide in these two treatment settings. After 2 years of follow-up, 477 out of 1209 (39.0%) of PCP and 297 out of 1398 (21.2%) of specialist-treated patients still used liraglutide and maintained the glycated hemoglobin (HbA 1c ) target of <7.0%. Significant reductions from baseline were observed in both PCP- and specialist-treated cohorts in mean HbA 1c (-1.22% and -0.8%, respectively), fasting plasma glucose (FPG) concentration (-39 and -23 mg/dL), body weight (-4.4 and -3.8 kg), and body mass index (BMI) (-1.5 and -1.4 kg/m 2 ), all p < 0.0001. Reductions in HbA 1c and FPG were significantly greater among PCP- compared with specialist-treated patients, p < 0.0001 for both. Patient treatment satisfaction was also significantly increased in both cohorts. Reported gastrointestinal adverse events were less frequent among PCP-treated patients compared with specialist-treated patients (4.5% vs. 16.1%). Despite differences in demography and clinical characteristics of patients treated for T2D in PCP and specialty care, greater reduction in HbA 1c and increased glycemic control durability were observed with liraglutide in primary care, compared with specialist care. These data suggest that liraglutide treatment could benefit patients in primary care by delaying the need for further treatment

  17. Improvement in exercise duration, lung function and well-being in G551D-cystic fibrosis patients: a double-blind, placebo-controlled, randomized, cross-over study with ivacaftor treatment.

    Science.gov (United States)

    Edgeworth, Deirdre; Keating, Dominic; Ellis, Matthew; Button, Brenda; Williams, Elyssa; Clark, Denise; Tierney, Audrey; Heritier, Stephane; Kotsimbos, Tom; Wilson, John

    2017-08-01

    G551D, a mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, results in impaired chloride channel function in cystic fibrosis (CF) with multiple end-organ manifestations. The effect of ivacaftor, a CFTR-potentiator, on exercise capacity in CF is unknown. Twenty G551D-CF patients were recruited to a single-centre, double-blind, placebo-controlled, 28-day crossover study of ivacaftor. Variables measured included percentage change from baseline (%Δ) of V O 2 max (maximal oxygen consumption, primary outcome) during cardiopulmonary exercise testing (CPET), relevant other CPET physiological variables, lung function, body mass index (BMI), sweat chloride and disease-specific health related quality of life (QOL) measures (CFQ-R and Alfred Wellness (AWEscore)). %Δ V O 2 max was unchanged compared with placebo as was %Δminute ventilation. However, %Δexercise time (mean 7.3, CI 0.5-14,1, P =0.0222) significantly increased as did %ΔFEV 1 (11.7%, range 5.3-18.1, P <0·005) and %ΔBMI (1.2%, range 0.1-2.3, P =0·0393) whereas sweat chloride decreased (mean -43.4; range -55.5-18.1 mmol·l -1 , P <0·005). Total and activity based domains in both CFQ-R and AWEscore also increased. A positive treatment effect on spirometry, BMI (increased), SCT (decreased) and total and activity based CF-specific QOL measures was expected. However, the lack of discernible improvement in V O 2 max and VE despite other positive changes including spirometric lung function and exercise time with a 28-day ivacaftor intervention suggests that ventilatory parameters are not the sole driver of change in exercise capacity in this study cohort. Investigation over a more prolonged period may delineate the potential interdependencies of the observed discordances over time. ClinicalTrials.gov-NCT01937325. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  18. Determinants of cortisol during pregnancy - The ABCD cohort.

    Science.gov (United States)

    Bleker, Laura S; Roseboom, Tessa J; Vrijkotte, Tanja G; Reynolds, Rebecca M; de Rooij, Susanne R

    2017-09-01

    Psychosocial stress during pregnancy has been proposed as a major contributor of glucocorticoid-mediated programming of the fetal hypothalamic-pituitary adrenal (HPA) axis, with later adverse health consequences. However, evidence linking maternal stress to maternal cortisol values during pregnancy is inconclusive. A possible explanation for this is that other maternal factors overshadow any potential effects of stress on cortisol levels. We studied a large cohort of pregnant women with extensive data on pregnancy characteristics to determine the respective contributions of biological, environmental and psychosocial stress factors to cortisol levels in pregnancy. We used data from 3039 women from the Amsterdam Born Children and their Development-study cohort. Serum cortisol was measured in blood, collected at the first prenatal visit, at different gestational ages (median=91days, range=40-256days), and at various time points during the day (median=11:45h, range=08:00-18:30h). We assessed associations between maternal serum cortisol in pregnancy and biological factors, lifestyle factors and stress factors, including depression, anxiety, pregnancy-related anxiety, work stress, parenting stress and fatigue. In multivariable analysis, variables that were associated with higher cortisol levels in pregnancy were lower maternal age [1.5nmol/l, 95%CI (0.6-2.4)], being nulliparous [21.5 nmol/l (15.9-27.1)], lower pre-pregnancy body mass index (BMI) [1.3nmol/l (0.3-2.4)], higher C-reactive protein (CRP) [1.0nmol/l (0.4-1.5)], carrying a female fetus [9.2nmol/l (1.8-16.5)], non-smoking [14.2nmol/l (0.6-27.7)], sufficient sleep [8.5nmol/l (0.9-16.1)], and being unemployed [12.7nmol/l (2.2-23.2)]. None of the psychosocial stressors was significantly associated with serum cortisol levels in pregnancy. A total of 32% of all variance in cortisol was explained by gestational age, maternal age, time of day, parity, pre-pregnancy BMI, CRP, fetal sex, smoking behavior, self

  19. Blood pressure and anthropometry in children treated with stimulants: a longitudinal cohort study with an individual approach

    Directory of Open Access Journals (Sweden)

    Landgren M

    2017-02-01

    Full Text Available Magnus Landgren,1,2 Salmir Nasic,3 Mats Johnson,1,2 Trygve Lövoll,1 Daniel Holmgren,4,5 Elisabeth Fernell2 1Department of Pediatrics, Unit of Developmental Disorders, Skaraborg’s Hospital, Mariestad, 2Gillberg Neuropsychiatry Centre, University of Gothenburg, Gothenburg, 3Research and Development Centre, 4Department of Pediatrics, Skaraborg’s Hospital, Skövde, 5University of Gothenburg, Gothenburg, Sweden Background: Knowledge about the long-term effects on blood pressure (BP and body mass index (BMI when treating young patients for attention-deficit/hyperactivity disorder (AD/HD with stimulants is limited. Most of the studies have reported mean and not individual values for anthropometrics and BP in treatment with stimulants. This seems to be the first study of changes based on the analyses of individual data measured over time. Patients and methods: Seventy young patients (aged 8–18 years diagnosed with AD/HD and responding well to treatment with stimulants were followed for a mean period of 3 years and 3 months. BP, heart rate, height, weight, and BMI were transformed to standard deviations or z-scores from before treatment to the last registered visit. Results: The mean dose of methylphenidate was 0.95 mg/kg. The mean increase of systolic and diastolic BP was 0.4 z-score and 0.1 z-score, respectively. The systolic BP was associated with BMI; a higher BMI at baseline increased the risk for an increase in systolic BP. Ten percent of the total group had a weight at follow-up of <-1.5 standard deviation (SD and 12% had a height of <-1.5 SD. Mean height at follow-up was -0.2 SD, but 40% had a reduced height of at least 0.5 SD during the treatment period. BMI on a group level was reduced from +0.8 SD to +0.3 SD. Of the 19 patients with a BMI >+1.5 SD at baseline, 50% had a significantly reduced BMI. Conclusion: Consequences of stimulant treatment must be evaluated individually. Besides significant effects on core AD/HD symptoms, some

  20. NPV-LDE-225 (Erismodegib) inhibits epithelial mesenchymal transition and self-renewal of glioblastoma initiating cells by regulating miR-21, miR-128, and miR-200.

    Science.gov (United States)

    Fu, Junsheng; Rodova, Mariana; Nanta, Rajesh; Meeker, Daniel; Van Veldhuizen, Peter J; Srivastava, Rakesh K; Shankar, Sharmila

    2013-06-01

    Glioblastoma multiforme is the most common form of primary brain tumor, often characterized by poor survival. Glioblastoma initiating cells (GICs) regulate self-renewal, differentiation, and tumor initiation properties and are involved in tumor growth, recurrence, and resistance to conventional treatments. The sonic hedgehog (SHH) signaling pathway is essential for normal development and embryonic morphogenesis. The objectives of this study were to examine the molecular mechanisms by which GIC characteristics are regulated by NPV-LDE-225 (Smoothened inhibitor; (2,2'-[[dihydro-2-(4-pyridinyl)-1,3(2H,4H)-pyrimidinediyl]bis(methylene)]bis[N,N-dimethylbenzenamine). Cell viability and apoptosis were measured by XTT and annexin V-propidium iodide assay, respectively. Gli translocation and transcriptional activities were measured by immunofluorescence and luciferase assay, respectively. Gene and protein expressions were measured by quantitative real-time PCR and Western blot analyses, respectively. NPV-LDE-225 inhibited cell viability, neurosphere formation, and Gli transcriptional activity and induced apoptosis by activation of caspase-3 and cleavage of poly(ADP-ribose) polymerase. NPV-LDE-225 increased the expression of tumor necrosis factor-related apoptosis inducing ligand (TRAIL)-R1/DR4, TRAIL-R2/DR5, and Fas and decreased the expression of platelet derived growth factor receptor-α and Bcl2, and these effects were abrogated by Gli1 plus Gli2 short hairpin RNAs. NPV-LDE-225 enhanced the therapeutic potential of FasL and TRAIL by upregulating Fas and DR4/5, respectively. Interestingly, NPV-LDE-225 induced expression of programmed cell death 4 and apoptosis and inhibited cell viability by suppressing micro RNA (miR)-21. Furthermore, NPV-LDE-225 inhibited pluripotency-maintaining factors Nanog, Oct4, Sox2, and cMyc. The inhibition of Bmi1 by NPV-LDE-225 was regulated by induction of miR-128. Finally, NPV-LDE-225 suppressed epithelial-mesenchymal transition by

  1. Variation in GYS1 interacts with exercise and gender to predict cardiovascular mortality.

    Directory of Open Access Journals (Sweden)

    Jenny Fredriksson

    Full Text Available BACKGROUND: The muscle glycogen synthase gene (GYS1 has been associated with type 2 diabetes (T2D, the metabolic syndrome (MetS, male myocardial infarction and a defective increase in muscle glycogen synthase protein in response to exercise. We addressed the questions whether polymorphism in GYS1 can predict cardiovascular (CV mortality in a high-risk population, if this risk is influenced by gender or physical activity, and if the association is independent of genetic variation in nearby apolipoprotein E gene (APOE. METHODOLOGY/PRINCIPAL FINDINGS: Polymorphisms in GYS1 (XbaIC>T and APOE (-219G>T, epsilon2/epsilon3/epsilon4 were genotyped in 4,654 subjects participating in the Botnia T2D-family study and followed for a median of eight years. Mortality analyses were performed using Cox proportional-hazards regression. During the follow-up period, 749 individuals died, 409 due to CV causes. In males the GYS1 XbaI T-allele (hazard ratio (HR 1.9 [1.2-2.9], T2D (2.5 [1.7-3.8], earlier CV events (1.7 [1.2-2.5], physical inactivity (1.9 [1.2-2.9] and smoking (1.5 [1.0-2.3] predicted CV mortality. The GYS1 XbaI T-allele predicted CV mortality particularly in physically active males (HR 1.7 [1.3-2.0]. Association of GYS1 with CV mortality was independent of APOE (219TT/epsilon4, which by its own exerted an effect on CV mortality risk in females (2.9 [1.9-4.4]. Other independent predictors of CV mortality in females were fasting plasma glucose (1.2 [1.1-1.2], high body mass index (BMI (1.0 [1.0-1.1], hypertension (1.9 [1.2-3.1], earlier CV events (1.9 [1.3-2.8] and physical inactivity (1.9 [1.2-2.8]. CONCLUSIONS/SIGNIFICANCE: Polymorphisms in GYS1 and APOE predict CV mortality in T2D families in a gender-specific fashion and independently of each other. Physical exercise seems to unmask the effect associated with the GYS1 polymorphism, rendering carriers of the variant allele less susceptible to the protective effect of exercise on the risk of CV death

  2. Prognostic value of tumor suppressors in osteosarcoma before and after neoadjuvant chemotherapy

    International Nuclear Information System (INIS)

    Robl, Bernhard; Pauli, Chantal; Botter, Sander Martijn; Bode-Lesniewska, Beata; Fuchs, Bruno

    2015-01-01

    Primary bone cancers are among the deadliest cancer types in adolescents, with osteosarcomas being the most prevalent form. Osteosarcomas are commonly treated with multi-drug neoadjuvant chemotherapy and therapy success as well as patient survival is affected by the presence of tumor suppressors. In order to assess the prognostic value of tumor-suppressive biomarkers, primary osteosarcoma tissues were analyzed prior to and after neoadjuvant chemotherapy. We constructed a tissue microarray from high grade osteosarcoma samples, consisting of 48 chemotherapy naïve biopsies (BXs) and 47 tumor resections (RXs) after neoadjuvant chemotherapy. We performed immunohistochemical stainings of P53, P16, maspin, PTEN, BMI1 and Ki67, characterized the subcellular localization and related staining outcome with chemotherapy response and overall survival. Binary logistic regression analysis was used to analyze chemotherapy response and Kaplan-Meier-analysis as well as the Cox proportional hazards model was applied for analysis of patient survival. No significant associations between biomarker expression in BXs and patient survival or chemotherapy response were detected. In univariate analysis, positive immunohistochemistry of P53 (P = 0.008) and P16 (P16; P = 0.033) in RXs was significantly associated with poor survival prognosis. In addition, presence of P16 in RXs was associated with poor survival in multivariate regression analysis (P = 0.003; HR = 0.067) while absence of P16 was associated with good chemotherapy response (P = 0.004; OR = 74.076). Presence of PTEN on tumor RXs was significantly associated with an improved survival prognosis (P = 0.022). Positive immunohistochemistry (IHC) of P16 and P53 in RXs was indicative for poor overall patient survival whereas positive IHC of PTEN was prognostic for good overall patient survival. In addition, we found that P16 might be a marker of osteosarcoma chemotherapy resistance. Therefore, our study supports the use of tumor RXs to

  3. Mitigation of arsenic-induced acquired cancer phenotype in prostate cancer stem cells by miR-143 restoration

    International Nuclear Information System (INIS)

    Ngalame, Ntube N.O.; Makia, Ngome L.; Waalkes, Michael P.; Tokar, Erik J.

    2016-01-01

    Inorganic arsenic, an environmental contaminant and a human carcinogen is associated with prostate cancer. Emerging evidence suggests that cancer stem cells (CSCs) are the driving force of carcinogenesis. Chronic arsenic exposure malignantly transforms the human normal prostate stem/progenitor cell (SC) line, WPE-stem to arsenic-cancer SCs (As-CSCs), through unknown mechanisms. MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the posttranscriptional level. In prior work, miR-143 was markedly downregulated in As-CSCs, suggesting a role in arsenic-induced malignant transformation. In the present study, we investigated whether loss of miR-143 expression is important in arsenic-induced transformation of prostate SCs. Restoration of miR-143 in As-CSCs was achieved by lentivirus-mediated miR-143 overexpression. Cells were assessed bi-weekly for up to 30 weeks to examine mitigation of cancer phenotype. Secreted matrix metalloproteinase (MMP) activity was increased by arsenic-induced malignant transformation, but miR-143 restoration decreased secreted MMP-2 and MMP-9 enzyme activities compared with scramble controls. Increased cell proliferation and apoptotic resistance, two hallmarks of cancer, were decreased upon miR-143 restoration. Increased apoptosis was associated with decreased BCL2 and BCL-XL expression. miR-143 restoration dysregulated the expression of SC/CSC self-renewal genes including NOTCH-1, BMI-1, OCT4 and ABCG2. The anticancer effects of miR-143 overexpression appeared to be mediated by targeting and inhibiting LIMK1 protein, and the phosphorylation of cofilin, a LIMK1 substrate. These findings clearly show that miR-143 restoration mitigated multiple cancer characteristics in the As-CSCs, suggesting a potential role in arsenic-induced transformation of prostate SCs. Thus, miR-143 is a potential biomarker and therapeutic target for arsenic-induced prostate cancer. - Highlights: • Chronic arsenic exposure

  4. Dynamic NMR studies of polymer electrolyte materials for application to lithium-ion batteries and fuel cells

    Science.gov (United States)

    Khalfan, Amish N.

    This dissertation investigates the structural and dynamical properties of polymer electrolyte materials for applications to lithium-ion batteries and fuel cells. The nuclear magnetic resonance (NMR) technique was used to characterize these materials. NMR aids in understanding the local environments of nuclei and the mobility of a molecular/ionic species. Five research projects were carried out, and they have been outlined in this work. NASA has developed rod-coil block copolymers for use as electrolytes in lithium-ion batteries. The copolymers exhibit a microphase separation within their structure leading to the formation of ionically conducting channels. We studied ion transport properties of the copolymers, and determined the predominant mechanism for transport to occur in the amorphous phase. Seven gel polymer electrolytes, each containing a mixture of LiBETI salt and organic solvents, were studied. Two of them incorporated BMI (1-n-butyl-3-methylimidazolium) ionic liquid. Ionic liquids are room temperature molten salts. BMI had been thought to enhance ion mobility. However, the BMI component was observed to restrict ion mobility. Gel polymer electrolytes containing LiTFSI salt and P13TFSI ionic liquid with or without the inclusion of ethylene carbonate (EC) were studied for application to lithium metal/air batteries, which have high theoretical energy densities. The addition of EC was found to improve lithium ion transport. The gels with EC therefore prove to be favorable for use as electrolytes in lithium metal/air batteries. Highly sulfonated poly(arylenethioethersulfone) (SPTES) membranes were examined for use in direct methanol fuel cells (DMFCs) as an alternative to the Nafion membrane. DMFCs use methanol as a fuel instead of reformed hydrogen as in conventional proton exchange membrane fuel cells. Compared to Nafion, the SPTES membranes were shown to retain water better at high temperatures and yield lower methanol diffusion. SPTES membranes with the

  5. Mel-18 controls the enrichment of tumor-initiating cells in SP fraction in mouse breast cancer.

    Science.gov (United States)

    Janakiraman, Harinarayanan; Nobukiyo, Asako; Inoue, Hiroko; Kanno, Masamoto

    2011-06-01

    Side population (SP) cell analysis has been used to identify and isolate a minor population of cells with stem cell properties in normal tissues and in many cancers including breast cancer cells. However, the molecular mechanisms that operate in tumor-initiating cells (TICs) in SP fraction remain unclear. The Polycomb group genes, including Bmi1 and Mel-18, have been implicated in the maintenance of hematopoietic stem cells (HSCs) and suggested to be oncogenic and tumor suppressive, respectively, in breast cancer. In this study, we determined the critical role of Mel-18 in the enrichment mechanisms of TICs with the SP phenotype in a mouse breast cancer cell line, MMK3, that was established from a breast cancer developed spontaneously in Mel-18+/- mice. The Mel-18 protein expression level significantly correlates to the percentage of SP fraction in the mouse breast cancer cell line MMK3 series. The comparison between MMK3V3 (V3) cells containing one copy of the Mel-18 gene and MMK3S2 (S2) cells having twice the amount of Mel-18 expression clearly demonstrates the above relationship. Similar results obtained with the percentage of ALDH+ cells in V3 and S2 further confirmed the correlation between protein expression level of Mel-18 and the TICs. More importantly, transplantation of SP and non-SP cells of V3 and S2 cells into the NOD/SCID mice clearly showed that the heterozygous level of Mel-18 leads to the disappearance of enrichment of TICs into SP fraction in vivo. Stem cell pathway focused gene expression profiling of V3 and S2 cells revealed that the genes Abcg2, Aldh1a1 and Dhh were highly down-regulated in V3 compared to S2. These results indicate that the precise Mel-18 expression level controls TIC enrichment mechanisms through the regulation of channel molecule of Abcg2 and functional TIC marker of Aldhlal. In conclusion, our findings revealed the significance of fine-tuning mechanisms for Mel-18 protein expression level in the maintenance of TIC into SP

  6. Cohort profile: Pacific Islands Families (PIF) growth study, Auckland, New Zealand.

    Science.gov (United States)

    Rush, E; Oliver, M; Plank, L D; Taylor, S; Iusitini, L; Jalili-Moghaddam, S; Savila, F; Paterson, J; Tautolo, E

    2016-11-02

    This article profiles a birth cohort of Pacific children participating in an observational prospective study and describes the study protocol used at ages 14-15 years to investigate how food and activity patterns, metabolic risk and family and built environment are related to rates of physical growth of Pacific children. From 2000 to 2015, the Pacific Islands Families Study has followed, from birth, the growth and development of over 1000 Pacific children born in Auckland, New Zealand. In 2014, 931 (66%) of the original cohort had field measures of body composition, blood pressure and glycated haemoglobin. A nested subsample (n=204) was drawn by randomly selecting 10 males and 10 females from each decile of body weight. These participants had measurement of body composition by dual-energy X-ray absorptiometry, food frequency, 6 min walk test and accelerometer-determined physical activity and sedentary behaviours, and blood biomarkers for metabolic disease such as diabetes. Built environment variables were generated from individual addresses. Compared to the Centres for Disease Control and Prevention (CDC) reference population with mean SD scores (SDS) of 0, this cohort of 931 14-year-olds was taller, weighed more and had a higher body mass index (BMI) (mean SDS height >0.6, weight >1.6 and BMI >1.4). 7 of 10 youth were overweight or obese. The nested-sampling frame achieved an even distribution by body weight. Cross-sectional relationships between body size, fatness and growth rate, food patterns, activity patterns, pubertal development, risks for diabetes and hypertension and the family and wider environment will be examined. In addition, analyses will investigate relationships with data collected earlier in the life course and measures of the cohort in the future. Understanding past and present influences on child growth and health will inform timely interventions to optimise future health and reduce inequalities for Pacific people. Published by the BMJ

  7. Obesity genes and risk of major depressive disorder in a multiethnic population: a cross-sectional study.

    Science.gov (United States)

    Samaan, Zainab; Lee, Yvonne K; Gerstein, Hertzel C; Engert, James C; Bosch, Jackie; Mohan, Viswanathan; Diaz, Rafael; Yusuf, Salim; Anand, Sonia S; Meyre, David

    2015-12-01

    Observational studies have shown a positive association between obesity (body mass index [BMI] ≥ 30 kg/m2) and depression. Around 120 obesity-associated loci have been identified, but genetic variants associated with depression remain elusive. Recently, our team reported that the fat mass and obesity-associated (FTO) gene rs9939609 obesity-risk variant is paradoxically inversely associated with the risk of depression. This finding raises the question as to whether other obesity-associated genetic variants are also associated with depression. Twenty-one obesity gene variants other than FTO were selected from a custom ∼50,000 single-nucleotide polymorphisms (SNPs) genotyping array (ITMAT-Broad-CARe array). Associations of these 21 SNPs and an unweighted genotype score with BMI and major depressive disorder (determined using the DSM-IV diagnostic criteria) were tested in 3,209 cases and 14,195 noncases, using baseline data collected from July 2001 to August 2003 from the multiethnic EpiDREAM study. Body mass index was positively associated with depression status (odds ratio [OR] = 1.02; 95% CI, 1.02-1.03 per BMI unit; P = 2.9 × 10(-12), adjusted for age, sex, and ethnicity). Six of 21 genetic variants (rs1514176 [TNN13K], rs2206734 [CDKAL1], rs11671664 [GIPR], rs2984618 [TAL1], rs3824755 [NT5C2], and rs7903146 [TCF7L2]) and the genotype score were significantly associated with BMI (1.47 × 10(-14) ≤ P ≤ .04). Of the 21 SNPs, TAL1 rs2984618 obesity-risk allele was associated with a higher risk of major depressive disorder (P = 1.79 × 10(-4), adjusted for age, sex, BMI, and ethnicity), and BDNF rs1401635 demonstrated significant ethnic-dependent association with major depressive disorder (OR = 0.88; 95% CI, 0.80-0.97; P = .01 in non-Europeans and OR = 1.11; 95% CI, 1.02-1.20; P = .02 in Europeans; Pinteraction = 2.73 × 10(-4)). The genotype score, calculated with or without FTO rs9939609, and adjusted for the same covariates, was not associated with

  8. Beneficial effects of a Paleolithic diet on cardiovascular risk factors in type 2 diabetes: a randomized cross-over pilot study

    Directory of Open Access Journals (Sweden)

    Hansson Anita

    2009-07-01

    Full Text Available Abstract Background Our aim was to compare the effects of a Paleolithic ('Old Stone Age' diet and a diabetes diet as generally recommended on risk factors for cardiovascular disease in patients with type 2 diabetes not treated with insulin. Methods In a randomized cross-over study, 13 patients with type 2 diabetes, 3 women and 10 men, were instructed to eat a Paleolithic diet based on lean meat, fish, fruits, vegetables, root vegetables, eggs and nuts; and a Diabetes diet designed in accordance with dietary guidelines during two consecutive 3-month periods. Outcome variables included changes in weight, waist circumference, serum lipids, C-reactive protein, blood pressure, glycated haemoglobin (HbA1c, and areas under the curve for plasma glucose and plasma insulin in the 75 g oral glucose tolerance test. Dietary intake was evaluated by use of 4-day weighed food records. Results Study participants had on average a diabetes duration of 9 years, a mean HbA1c of 6,6% units by Mono-S standard and were usually treated with metformin alone (3 subjects or metformin in combination with a sulfonylurea (3 subjects or a thiazolidinedione (3 subjects. Mean average dose of metformin was 1031 mg per day. Compared to the diabetes diet, the Paleolithic diet resulted in lower mean values of HbA1c (-0.4% units, p = 0.01, triacylglycerol (-0.4 mmol/L, p = 0.003, diastolic blood pressure (-4 mmHg, p = 0.03, weight (-3 kg, p = 0.01, BMI (-1 kg/m2, p = 0.04 and waist circumference (-4 cm, p = 0.02, and higher mean values of high density lipoprotein cholesterol (+0.08 mmol/L, p = 0.03. The Paleolithic diet was mainly lower in cereals and dairy products, and higher in fruits, vegetables, meat and eggs, as compared with the Diabetes diet. Further, the Paleolithic diet was lower in total energy, energy density, carbohydrate, dietary glycemic load, saturated fatty acids and calcium, and higher in unsaturated fatty acids, dietary cholesterol and several vitamins. Dietary GI

  9. Going to sleep in the supine position is a modifiable risk factor for late pregnancy stillbirth; Findings from the New Zealand multicentre stillbirth case-control study.

    Directory of Open Access Journals (Sweden)

    Lesley M E McCowan

    Full Text Available Our objective was to test the primary hypothesis that maternal non-left, in particular supine going-to-sleep position, would be a risk factor for late stillbirth (≥28 weeks of gestation.A multicentre case-control study was conducted in seven New Zealand health regions, between February 2012 and December 2015. Cases (n = 164 were women with singleton pregnancies and late stillbirth, without congenital abnormality. Controls (n = 569 were women with on-going singleton pregnancies, randomly selected and frequency matched for health region and gestation. The primary outcome was adjusted odds of late stillbirth associated with self-reported going-to-sleep position, on the last night. The last night was the night before the late stillbirth was thought to have occurred or the night before interview for controls. Going-to-sleep position on the last night was categorised as: supine, left-side, right-side, propped or restless. Multivariable logistic regression adjusted for known confounders.Supine going-to-sleep position on the last night was associated with increased late stillbirth risk (adjusted odds ratios (aOR 3.67, 95% confidence interval (CI 1.74 to 7.78 with a population attributable risk of 9.4%. Other independent risk factors for late stillbirth (aOR, 95% CI were: BMI (1.04, 1.01 to 1.08 per unit, maternal age ≥40 (2.88, 1.31 to 6.32, birthweight <10th customised centile (2.76, 1.59 to 4.80, and <6 hours sleep on the last night (1.81, 1.14 to 2.88. The risk associated with supine-going-to-sleep position was greater for term (aOR 10.26, 3.00 to 35.04 than preterm stillbirths (aOR 3.12, 0.97 to 10.05.Supine going-to-sleep position is associated with a 3.7 fold increase in overall late stillbirth risk, independent of other common risk factors. A public health campaign encouraging women not to go-to-sleep supine in the third trimester has potential to reduce late stillbirth by approximately 9%.

  10. Gender-Dependent Association of FTO Polymorphisms with Body Mass Index in Mexicans.

    Directory of Open Access Journals (Sweden)

    Yolanda Saldaña-Alvarez

    Full Text Available To evaluate the associations between six single-nucleotide polymorphisms (SNPs in intron 1 of FTO and body mass index (BMI, a case-control association study of 2314 unrelated Mexican-Mestizo adult subjects was performed. The association between each SNP and BMI was tested using logistic and linear regression adjusted for age, gender, and ancestry and assuming additive, recessive, and dominant effects of the minor allele. Association analysis after BMI stratification showed that all five FTO SNPs (rs1121980, rs17817449, rs3751812, rs9930506, and rs17817449, were significantly associated with obesity class II/III under an additive model (P<0.05. Interestingly, we also documented a genetic model-dependent influence of gender on the effect of FTO variants on increased BMI. Two SNPs were specifically associated in males under a dominant model, while the remainder were associated with females under additive and recessive models (P<0.05. The SNP rs9930506 showed the highest increased in obesity risk in females (odds ratio = 4.4. Linear regression using BMI as a continuous trait also revealed differential FTO SNP contributions. Homozygous individuals for the risk alleles of rs17817449, rs3751812, and rs9930506 were on average 2.18 kg/m(2 heavier than homozygous for the wild-type alleles; rs1121980 and rs8044769 showed significant but less-strong effects on BMI (1.54 kg/m(2 and 0.9 kg/m(2, respectively. Remarkably, rs9930506 also exhibited positive interactions with age and BMI in a gender-dependent manner. Women carrying the minor allele of this variant have a significant increase in BMI by year (0.42 kg/m(2, P = 1.17 x 10(-10. Linear regression haplotype analysis under an additive model, confirmed that the TGTGC haplotype harboring all five minor alleles, increased the BMI of carriers by 2.36 kg/m(2 (P = 1.15 x 10(-5. Our data suggest that FTO SNPs make differential contributions to obesity risk and support the hypothesis that gender differences in the

  11. Self-renewal and chemotherapy resistance of p75NTR positive cells in esophageal squamous cell carcinomas

    International Nuclear Information System (INIS)

    Huang, Sheng-Dong; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Bai, Chen-Guang; Wang, Feng; Luo, Jun-Hui; Xu, Zhi-Yun

    2009-01-01

    p75 NTR has been used to isolate esophageal and corneal epithelial stem cells. In the present study, we investigated the expression of p75 NTR in esophageal squamous cell carcinoma (ESCC) and explored the biological properties of p75 NTR+ cells. p75 NTR expression in ESCC was assessed by immunohistochemistry. p75 NTR+ and p75 NTR- cells of 4 ESCC cell lines were separated by fluorescence-activated cell sorting. Differentially expressed genes between p75 NTR+ and p75 NTR- cells were determined by real-time quantitative reverse transcription-PCR. Sphere formation assay, DDP sensitivity assay, 64 copper accumulation assay and tumorigenicity analysis were performed to determine the capacity of self-renewal, chemotherapy resistance and tumorigenicity of p75 NTR+ cells. In ESCC specimens, p75 NTR was found mainly confined to immature cells and absent in cells undergoing terminal differentiation. The percentage of p75 NTR+ cells was 1.6%–3.7% in Eca109 and 3 newly established ESCC cell lines. The expression of Bmi-1, which is associated with self-renewal of stem cells, was significantly higher in p75 NTR+ cells. p63, a marker identified in keratinocyte stem cells, was confined mainly to p75 NTR+ cells. The expression of CTR1, which is associated with cisplatin (DDP)-resistance, was significantly decreased in p75 NTR+ cells. Expression levels of differentiation markers, such as involucrin, cytokeratin 13, β1-integrin and β4-integrin, were lower in p75 NTR+ cells. In addition, p75 NTR+ cells generated both p75 NTR+ and p75 NTR- cells, and formed nonadherent spherical clusters in serum-free medium supplemented with growth factors. Furthermore, p75 NTR+ cells were found to be more resistant to DDP and exhibited lower 64 copper accumulation than p75 NTR- cells. Our results demonstrated that p75 NTR+ cells possess some characteristics of CSCs, namely, self-renewal and chemotherapy resistance. Chemotherapy resistance of p75 NTR+ cells may probably be attributable to

  12. Células madre limbocorneales: actualidades y aplicaciones terapéuticas

    Directory of Open Access Journals (Sweden)

    Rogelio Villarreal Villarreal

    2015-04-01

    Full Text Available Las células madre son aquellas células poco diferenciadas capaces de autorrenovarse y diferenciarse hacia células especializadas en el cuerpo. Se encuentran en todos los tejidos autorrenovables como son los epitelios. En el caso del epitelio corneal se ha encontrado que las células madre están alojadas en la región límbica, y más concentradas en la región superior e inferior. Algunos de los marcadores que se utilizan para identificarlas son: p63, ABCG2, C/EBPd, Bmi1, Notch1, K19, vimentina, entro otros. Actualmente se ha estudiado la utilización de células madre límbicas en padecimientos que involucran deficiencia de las mismas: como daño químico o térmico a la superficie ocular, síndrome de Stevens-Johnson y aniridia. Para cultivar las células madre es necesario tomar una biopsia de limbo esclerocorneal de 1-2 mm2 la cual puede sembrarse directamente o ser tratada previamente con tripsina y dispasa para crear una suspensión de células. Se han utilizado capas alimentadoras de soporte como: fibroblastos 3T3, membrana amniótica, matrices extracelulares matrigel, colágeno, polímeros de gelificación termosensible y cápsula anterior de cristalino. Los medios de cultivo utilizados también varían, siendo los más utilizados el medio de Eagle modificado por Dulbecco, Ham F12, MCDB151, medio EpiLife, PCT, entre otros. Para transportar las células madre a la superficie ocular han sido estudiados diversos sustratos o medios de soporte. El que más se utiliza actualmente es la membrana amniótica, pero otros como lentes de contacto, geles de fibrina y biopolímeros termosensibles están también reportados.

  13. Modification and Validation of the Triglyceride-to-HDL Cholesterol Ratio as a Surrogate of Insulin Sensitivity in White Juveniles and Adults without Diabetes Mellitus: The Single Point Insulin Sensitivity Estimator (SPISE).

    Science.gov (United States)

    Paulmichl, Katharina; Hatunic, Mensud; Højlund, Kurt; Jotic, Aleksandra; Krebs, Michael; Mitrakou, Asimina; Porcellati, Francesca; Tura, Andrea; Bergsten, Peter; Forslund, Anders; Manell, Hannes; Widhalm, Kurt; Weghuber, Daniel; Anderwald, Christian-Heinz

    2016-09-01

    The triglyceride-to-HDL cholesterol (TG/HDL-C) ratio was introduced as a tool to estimate insulin resistance, because circulating lipid measurements are available in routine settings. Insulin, C-peptide, and free fatty acids are components of other insulin-sensitivity indices but their measurement is expensive. Easier and more affordable tools are of interest for both pediatric and adult patients. Study participants from the Relationship Between Insulin Sensitivity and Cardiovascular Disease [43.9 (8.3) years, n = 1260] as well as the Beta-Cell Function in Juvenile Diabetes and Obesity study cohorts [15 (1.9) years, n = 29] underwent oral-glucose-tolerance tests and euglycemic clamp tests for estimation of whole-body insulin sensitivity and calculation of insulin sensitivity indices. To refine the TG/HDL ratio, mathematical modeling was applied including body mass index (BMI), fasting TG, and HDL cholesterol and compared to the clamp-derived M-value as an estimate of insulin sensitivity. Each modeling result was scored by identifying insulin resistance and correlation coefficient. The Single Point Insulin Sensitivity Estimator (SPISE) was compared to traditional insulin sensitivity indices using area under the ROC curve (aROC) analysis and χ(2) test. The novel formula for SPISE was computed as follows: SPISE = 600 × HDL-C(0.185)/(TG(0.2) × BMI(1.338)), with fasting HDL-C (mg/dL), fasting TG concentrations (mg/dL), and BMI (kg/m(2)). A cutoff value of 6.61 corresponds to an M-value smaller than 4.7 mg · kg(-1) · min(-1) (aROC, M:0.797). SPISE showed a significantly better aROC than the TG/HDL-C ratio. SPISE aROC was comparable to the Matsuda ISI (insulin sensitivity index) and equal to the QUICKI (quantitative insulin sensitivity check index) and HOMA-IR (homeostasis model assessment-insulin resistance) when calculated with M-values. The SPISE seems well suited to surrogate whole-body insulin sensitivity from inexpensive fasting single-point blood draw and BMI

  14. The effects of dietary approaches to stop hypertension diet on weight loss, anti-Müllerian hormone and metabolic profiles in women with polycystic ovary syndrome: A randomized clinical trial.

    Science.gov (United States)

    Foroozanfard, Fatemeh; Rafiei, Hamideh; Samimi, Mansooreh; Gilasi, Hamid Reza; Gorjizadeh, Roohangiz; Heidar, Zahra; Asemi, Zatollah

    2017-07-01

    This study was designed to evaluate the effects of the dietary approaches to stop hypertension (DASH diet) on weight loss, anti-Müllerian hormone (AMH) and metabolic profiles in women with polycystic ovary syndrome (PCOS). A randomized controlled clinical trial was conducted among 60 overweight or obese patients with PCOS. Patients were randomly assigned to receive either low-calorie DASH (N=30) or control diet (N=30) for 12 weeks. The DASH and control diets were consisted of 52%-55% carbohydrates, 16%-18% proteins and 30% total fats; however, the DASH diet was designed to be rich in fruits, vegetables, whole grains, low-fat dairy products, cholesterol and refined grains. Both diets were equicaloric. Adherence to the DASH diet, compared to the control diet, resulted in a significant decrease in BMI (-1.6±0.5 vs -1.2±0.7 kg/m 2 , P=.02). Significant decreases in AMH (-1.1±3.1 vs +0.3±0.7 ng/mL, P=.01), insulin (-25.2±51.0 vs -1.2±28.8 pmol/L, P=.02), homoeostasis model of assessment-estimated insulin resistance (-0.9±2.0 vs -0.1±1.0, P=.02), free androgen index (FAI; -0.03±0.09 vs +0.06±0.21, P=.02) and malondialdehyde (MDA) levels (-0.5±0.4 vs +0.2±0.3 μmol/L, P<.001), and significant increases in quantitative insulin sensitivity check index (+0.01±0.03 vs -0.004±0.01, P=.02), sex hormone-binding globulin (SHBG; +3.7±8.5 vs -1.5±7.2 nmol/L, P=.01) and nitric oxide (NO; +9.0±4.9 vs +0.6±2.3 μmol/L, P<.001) were also seen in the DASH group compared with the control group. Adherence to the DASH diet for 12 weeks among PCOS women had beneficial effects on BMI, AMH, insulin metabolism, SHBG, FAI, NO and MDA levels. © 2017 John Wiley & Sons Ltd.

  15. Gender-Dependent Association of FTO Polymorphisms with Body Mass Index in Mexicans

    Science.gov (United States)

    Saldaña-Alvarez, Yolanda; Salas-Martínez, María Guadalupe; García-Ortiz, Humberto; Luckie-Duque, Angélica; García-Cárdenas, Gustavo; Vicenteño-Ayala, Hermenegildo; Cordova, Emilio J.; Esparza-Aguilar, Marcelino; Contreras-Cubas, Cecilia; Carnevale, Alessandra; Chávez-Saldaña, Margarita; Orozco, Lorena

    2016-01-01

    To evaluate the associations between six single-nucleotide polymorphisms (SNPs) in intron 1 of FTO and body mass index (BMI), a case-control association study of 2314 unrelated Mexican-Mestizo adult subjects was performed. The association between each SNP and BMI was tested using logistic and linear regression adjusted for age, gender, and ancestry and assuming additive, recessive, and dominant effects of the minor allele. Association analysis after BMI stratification showed that all five FTO SNPs (rs1121980, rs17817449, rs3751812, rs9930506, and rs17817449), were significantly associated with obesity class II/III under an additive model (P<0.05). Interestingly, we also documented a genetic model-dependent influence of gender on the effect of FTO variants on increased BMI. Two SNPs were specifically associated in males under a dominant model, while the remainder were associated with females under additive and recessive models (P<0.05). The SNP rs9930506 showed the highest increased in obesity risk in females (odds ratio = 4.4). Linear regression using BMI as a continuous trait also revealed differential FTO SNP contributions. Homozygous individuals for the risk alleles of rs17817449, rs3751812, and rs9930506 were on average 2.18 kg/m2 heavier than homozygous for the wild-type alleles; rs1121980 and rs8044769 showed significant but less-strong effects on BMI (1.54 kg/m2 and 0.9 kg/m2, respectively). Remarkably, rs9930506 also exhibited positive interactions with age and BMI in a gender-dependent manner. Women carrying the minor allele of this variant have a significant increase in BMI by year (0.42 kg/m2, P = 1.17 x 10−10). Linear regression haplotype analysis under an additive model, confirmed that the TGTGC haplotype harboring all five minor alleles, increased the BMI of carriers by 2.36 kg/m2 (P = 1.15 x 10−5). Our data suggest that FTO SNPs make differential contributions to obesity risk and support the hypothesis that gender differences in the mechanisms

  16. The p27 Pathway Modulates the Regulation of Skeletal Growth and Osteoblastic Bone Formation by Parathyroid Hormone-Related Peptide.

    Science.gov (United States)

    Zhu, Min; Zhang, Jing; Dong, Zhan; Zhang, Ying; Wang, Rong; Karaplis, Andrew; Goltzman, David; Miao, Dengshun

    2015-11-01

    Parathyroid hormone-related peptide (PTHrP) 1-84 knock-in mice (Pthrp KI) develop skeletal growth retardation and defective osteoblastic bone formation. To further examine the mechanisms underlying this phenotype, microarray analyses of differential gene expression profiles were performed in long bone extracts from Pthrp KI mice and their wild-type (WT) littermates. We found that the expression levels of p27, p16, and p53 were significantly upregulated in Pthrp KI mice relative to WT littermates. To determine whether p27 was involved in the regulation by PTHrP of skeletal growth and development in vivo, we generated compound mutant mice, which were homozygous for both p27 deletion and the Pthrp KI mutation (p27(-/-) Pthrp KI). We then compared p27(-/-) Pthrp KI mice with p27(-/-), Pthrp KI, and WT littermates. Deletion of p27 in Pthrp KI mice resulted in a longer lifespan, increased body weight, and improvement in skeletal growth. At 2 weeks of age, skeletal parameters, including length of long bones, size of epiphyses, numbers of proliferating cell nuclear antigen (PCNA)-positive chondrocytes, bone mineral density, trabecular bone volume, osteoblast numbers, and alkaline phosphatase (ALP)-, type I collagen-, and osteocalcin-positive bone areas were increased in p27(-/-) mice and reduced in both Pthrp KI and p27(-/-) Pthrp KI mice compared with WT mice; however, these parameters were increased in p27(-/-) Pthrp KI mice compared with Pthrp KI mice. As well, protein expression levels of PTHR, IGF-1, and Bmi-1, and the numbers of total colony-forming unit fibroblastic (CFU-f) and ALP-positive CFU-f were similarly increased in p27(-/-) Pthrp KI mice compared with Pthrp KI mice. Our results demonstrate that deletion of p27 in Pthrp KI mice can partially rescue defects in skeletal growth and osteoblastic bone formation by enhancing endochondral bone formation and osteogenesis. These studies, therefore, indicate that the p27 pathway may function downstream in the action

  17. Velocidade de ganho de peso nos primeiros anos de vida e excesso de peso entre 5-11 anos de idade, Salvador, Bahia, Brasil Weight gain rate in early childhood and overweight in children 5-11 years old in Salvador, Bahia State, Brazil

    Directory of Open Access Journals (Sweden)

    Sheila Maria Alvim de Matos

    2011-04-01

    Full Text Available Crianças com sobrepeso estão mais propensas a se tornarem adultos com sobrepeso ou obesos, sendo a prevenção mais eficaz a intervenção em fases precoces da vida. Analisou-se a associação entre ganho de peso nos primeiros anos de vida e sobrepeso/obesidade em 1.056 crianças menores de 11 anos de idade. Foram coletadas informações relacionadas ao estilo de vida, saneamento, condições socioeconômicas, peso ao nascer e aleitamento materno. O ganho de peso do nascimento até diferentes intervalos (até 12 meses, > 12 a 18, > 18 a 24, e > 24 a 60 meses foi considerado de forma contínua em escores-z. Foi considerado excesso de peso o índice de massa corporal (IMC maior ou igual a +1 escore-z, usando referências da Organização Mundial da Saúde (OMS de 2006 e 2007. Adotou-se a regressão linear e Poisson multivariada. A velocidade do ganho ponderal mostrou-se associada ao IMC, observando-se duas vezes mais sobrepeso/obesidade a cada incremento de uma unidade no desvio-padrão da velocidade do ganho ponderal para o intervalo de 24 e 60 meses (RR = 2,08; IC95%: 1,87-2,32. Encontrou-se associação entre o rápido ganho de peso em todos os intervalos de idade e a ocorrência de sobrepeso/obesidade anos mais tarde.Overweight children are more prone to become overweight or obese adults. The most effective prevention is intervention in early childhood. We analyzed the association between early weight gain and overweight/obesity in 1,056 children under 11 years of age. Data were collected on lifestyle, sanitation, socioeconomic status, birth weight, and breastfeeding. Weight gain from birth until different age brackets ( 12 to 18, > 18 to 24, and > 24 to 60 months was considered a continuous variable in z-scores. Overweight was defined as body mass index (BMI > +1 z-score, based on 2006 and 2007 World Health Organization (WHO guidelines. Poisson regression and linear regression were used in the multivariate statistical analysis. Weight gain

  18. Early evaluation of patient risk for substantial weight gain during olanzapine treatment for schizophrenia, schizophreniform, or schizoaffective disorder

    Directory of Open Access Journals (Sweden)

    Hardy Thomas A

    2008-09-01

    Full Text Available Abstract Background To make well informed treatment decisions for their patients, clinicians need credible information about potential risk for substantial weight gain. We therefore conducted a post-hoc analysis of clinical trial data, examining early weight gain as a predictor of later substantial weight gain. Methods Data from 669 (Study 1 and 102 (Study 2 olanzapine-treated patients diagnosed with schizophrenia, schizophreniform, or schizoaffective disorder were analyzed to identify and validate weight gain cut-offs at Weeks 1–4 that were predictive of substantial weight gain (defined as an increase of ≥ 5, 7, 10 kg or 7% of baseline weight after approximately 30 weeks of treatment. Baseline characteristics alone, baseline characteristics plus weight change from baseline to Weeks 1, 2, 3 or 4, and weight change from baseline to Weeks 1, 2, 3, or 4 alone were evaluated as predictors of substantial weight gain. Similar analyses were performed to determine BMI increase cut-offs at Weeks 1–4 of treatment that were predictive of substantial increase in BMI (1, 2 or 3 kg/m2 increase from baseline. Results At Weeks 1 and 2, predictions based on early weight gain plus baseline characteristics were more robust than those based on early weight gain alone. However, by Weeks 3 and 4, there was little difference between the operating characteristics associated with these two sets of predictors. The positive predictive values ranged from 30.1% to 73.5%, while the negative predictive values ranged from 58.1% to 89.0%. Predictions based on early BMI increase plus baseline characteristics were not uniformly more robust at any time compared to those based on early BMI increase alone. The positive predictive values ranged from 38.3% to 83.5%, while negative predictive values ranged from 42.1% to 84.7%. For analyses of both early weight gain and early BMI increase, results for the validation dataset were similar to those observed in the primary dataset

  19. S100A16 promotes differentiation and contributes to a less aggressive tumor phenotype in oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Sapkota, Dipak; Bruland, Ove; Parajuli, Himalaya; Osman, Tarig A.; Teh, Muy-Teck; Johannessen, Anne C.; Costea, Daniela Elena

    2015-01-01

    -expression. These functional effects were associated with concomitant down-regulation of self-renewal (Bmi-1 and Oct 4A) and invasion related (MMP1 and MMP9) molecules. S100A16 over-expression also suppressed tumorigenesis of H357 cells in a mouse xenograft model and the resulting tumor xenografts displayed features/expression of increased differentiation and reduced proliferation/self-renewal. These results indicate that S100A16 is a differentiation promoting protein and might function as a tumor suppressor in OSCC. The online version of this article (doi:10.1186/s12885-015-1622-1) contains supplementary material, which is available to authorized users

  20. Prediction of a new body shape index and body adiposity estimator for development of type 2 diabetes mellitus: The Rural Chinese Cohort Study.

    Science.gov (United States)

    Han, Chengyi; Liu, Yu; Sun, Xizhuo; Luo, Xinping; Zhang, Lu; Wang, Bingyuan; Ren, Yongcheng; Zhou, Junmei; Zhao, Yang; Zhang, Dongdong; Liu, Xuejiao; Zhang, Ming; Hu, Dongsheng

    2017-11-01

    To compare the ability of a body shape index (ABSI) and body adiposity estimator (BAE) to BMI, waist circumference (WC) and waist:height ratio (WHtR) for predicting development of type 2 diabetes mellitus (T2DM) in rural adult Chinese. The prospective cohort study included 11 687 eligible participants who were free of T2DM at baseline. The risk of new-onset T2DM for ABSI, BAE, BMI, WC and WHtR quintiles was estimated by Cox proportional-hazards regression at follow-up. We also compared the power of ABSI and BAE to BMI, WC and WHtR for predicting the development of T2DM. With increasing ABSI, BAE, BMI, WC and WHtR, T2DM incidence was substantially increased (P trend<0·0001). After adjustment for multi-covariates, risk of T2DM was increased from the second to fifth quintile as compared with first quintile for ABSI (1·27; 95 % CI 0·95, 1·69; 1·35; 95 % CI 1·00, 1·82; 1·75; 95 % CI 1·33, 2·32 and 1·87; 95 % CI 1·40, 2·49; P trend<0·0001); BAE (1·82; 95 % CI 1·38, 2·41; 1·93; 95 % CI 1·38, 2·68; 2·73; 95 % CI 1·94, 3·84 and 4·18; 95 % CI 2·98, 5·87; P trend<0·0001); BMI (1·42; 95 % CI 1·03, 1·97; 1·62; 95 % CI 1·18, 2·23; 2·59; 95 % CI 1·92, 3·50 and 3·90; 95 % CI 2·90, 5·26; P trend<0·0001); WC (1·53; 95 % CI 1·08, 2·17; 1·66; 95 % CI 1·18, 2·33; 2·72; 1·97, 3·76 and 4·09; 95 % CI 2·97, 5·62; P trend<0·0001); and WHtR (1·40; 95 % CI 0·98, 1·99; 2·06; 95 % CI 1·47, 2·88; 2·90; 95 % CI 2·10, 4·01 and 4·22; 95 % CI 3·05, 5·85; P trend<0·0001). ABSI, BAE, BMI, WC and WHR were effective and comparable in discriminating cases from non-cases of T2DM. Risk of T2DM was increased with elevated ABSI and BAE, but the predictive ability for T2DM did not differ than that of BMI, WC and WHtR in a rural Chinese population.

  1. Bardoxolone methyl induces apoptosis and autophagy and inhibits epithelial-to-mesenchymal transition and stemness in esophageal squamous cancer cells

    Directory of Open Access Journals (Sweden)

    Wang YY

    2015-02-01

    , cleaved caspase-9, and cleaved poly ADP ribose polymerase (PARP levels but increased the expression level of Bcl-2-associated X (Bax. Furthermore, CDDO-Me induced autophagy in both Ec109 and KYSE70 cells via suppression of the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/Akt/mTOR signaling pathway. There were interactions between the autophagic and apoptotic pathways in Ec109 and KYSE70 cells subject to CDDO-Me treatment. CDDO-Me also scavenged reactive oxygen species through activation of the nuclear factor (erythroid-derived 2-related factor 2 (Nrf2 pathway in Ec109 and KYSE70 cells. CDDO-Me inhibited cell invasion, epithelial–mesenchymal transition, and stemness in Ec109 and KYSE70 cells. CDDO-Me significantly downregulated E-cadherin but upregulated Snail, Slug, and zinc finger E-box-binding homeobox 1 (TCF-8/ZEB1 in Ec109 and KYSE70 cells. CDDO-Me significantly decreased the expression of octamer-4, sex determining region Y-box 2 (Sox-2, Nanog, and B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1, all markers of cancer cell stemness, in Ec109 and KYSE70 cells. Taken together, these results indicate that CDDO-Me is a promising anticancer agent against ESCC. Further studies are warranted to explore the molecular targets, efficacy and safety of CDDO-Me in the treatment of ESCC.Keywords: CDDO-Me, esophageal squamous cell carcinoma, cell cycle, apoptosis, autophagy, EMT, stemness, Akt, mTOR