WorldWideScience

Sample records for archaeal phylogenetic diversity

  1. Bacterial and archaeal phylogenetic diversity associated with swine sludge from an anaerobic treatment lagoon.

    Science.gov (United States)

    Cardinali-Rezende, Juliana; Pereira, Zelina L; Sanz, José L; Chartone-Souza, Edmar; Nascimento, Andréa M A

    2012-11-01

    Over the last decades, the demand for pork products has increased significantly, along with concern about suitable waste management. Anaerobic-lagoon fermentation for swine-sludge stabilization is a good strategy, although little is known about the microbial communities in the lagoons. Here, we employed a cloning- and sequencing-based analysis of the 16S rRNA gene to characterize and quantify the prokaryotic community composition in a swine-waste-sludge anaerobic lagoon (SAL). DNA sequence analysis revealed that the SAL library harbored 15 bacterial phyla: Bacteroidetes, Cloroflexi, Proteobacteria, Firmicutes, Deinococcus-Thermus, Synergystetes, Gemmatimonadetes, Chlorobi, Fibrobacteres, Verrucomicrobia and candidates division OP5, OP8, WWE1, KSB1, WS6. The SAL library was generally dominated by carbohydrate-oxidizing bacteria. The archaeal sequences were related to the Crenarchaeota and Euryarchaeota phyla. Crenarchaeota predominated in the library, demonstrating that it is not restricted to high-temperature environments, being also responsible for ammonium oxidation in the anaerobic lagoon. Euryarchaeota sequences were associated with the hydrogenotrophic methanogens (Methanomicrobiales and Methanobacteriales). Quantitative PCR analysis revealed that the number of bacterial cells was at least three orders of magnitude higher than the number of archaeal cells in the SAL. The identified prokaryotic diversity was ecologically significant, particularly the archaeal community of hydrogenotrophic methanogens, which was responsible for methane production in the anaerobic lagoon. This study provided insight into the archaeal involvement in the overall oxidation of organic matter and the production of methane. Therefore, the treatment of swine waste in the sludge anaerobic lagoon could represent a potential inoculum for the start-up of municipal solid-waste digesters. PMID:22828793

  2. Phylogenetic Diversity of Archaea and the Archaeal Ammonia Monooxygenase Gene in Uranium Mining-Impacted Locations in Bulgaria

    Directory of Open Access Journals (Sweden)

    Galina Radeva

    2014-01-01

    Full Text Available Uranium mining and milling activities adversely affect the microbial populations of impacted sites. The negative effects of uranium on soil bacteria and fungi are well studied, but little is known about the effects of radionuclides and heavy metals on archaea. The composition and diversity of archaeal communities inhabiting the waste pile of the Sliven uranium mine and the soil of the Buhovo uranium mine were investigated using 16S rRNA gene retrieval. A total of 355 archaeal clones were selected, and their 16S rDNA inserts were analysed by restriction fragment length polymorphism (RFLP discriminating 14 different RFLP types. All evaluated archaeal 16S rRNA gene sequences belong to the 1.1b/Nitrososphaera cluster of Crenarchaeota. The composition of the archaeal community is distinct for each site of interest and dependent on environmental characteristics, including pollution levels. Since the members of 1.1b/Nitrososphaera cluster have been implicated in the nitrogen cycle, the archaeal communities from these sites were probed for the presence of the ammonia monooxygenase gene (amoA. Our data indicate that amoA gene sequences are distributed in a similar manner as in Crenarchaeota, suggesting that archaeal nitrification processes in uranium mining-impacted locations are under the control of the same key factors controlling archaeal diversity.

  3. Bacterial and Archaeal Diversity From the Eastern Lau Spreading Center

    Science.gov (United States)

    Reysenbach, A.; Banta, A.; Kelly, S.; Kirshstein, J.; Voytek, M.

    2005-12-01

    Due to the diversity of venting styles, geological settings and variations in fluid geochemistry, the Valu Fa Ridge and Eastern Lau Spreading Center (ELSC) provide a unique opportunity to explore the effects geological and geochemical variables on patterns of microbial phylogenetic and metabolic diversity. High temperature sulfides, diffuse flow fluids and microbial mats were collected from six active vent fields on the Valu Fa Ridge and Eastern Lau Spreading Center during the R/V Melville cruise TUIM05MV. All samples were subsampled for molecular and microbial culturing purposes. The archaeal and bacterial 16S rRNA genes were amplified by PCR from a selection of samples. Additionally, the presence of Aquificales and an unidentified lineage, the DHVE archaeal group, was explored using PCR primers specific for these groups. A selection of DNAs were also screened for functional genes that are diagnostic for certain pathways, viz, aclB (reductive TCA cycle), mcrA (methanogenesis), nirS and nirK (nitrite reduction), amoA (ammonia oxidation). Culturing of thermophiles, both acidophiles and neutrophiles, was initiated. Over 20 hydrogen oxidizing (hydrogen and oxygen) or nitrate reducing (hydrogen and nitrate) chemolithoautotrophs were isolated as colonies and grow at 70 degrees C. All are related to Persephonella hydrogenophila, with the exception of 2 cultures that perhaps represent new species of Hydrogenivirga and Aquifex. Preliminary analysis of patterns of Aquificales diversity using both culturing and molecular approaches suggest that the distributions of this group alone are very different from that observed at other hydrothermal sites such as along the East Pacific Rise or Central Indian Ridge. As yet, the most commonly isolated Aquificales, P. marina, has not been detected in enrichment cultures from ELSC, and the diversity of Aquificales-related sequences is much greater than detected from sites along the EPR. It is therefore also likely, that patterns of

  4. 印度尼西亚Padang Cermin热泉古菌多样性分析%Phylogenetic Diversity of Archaeal Community in the Hot Spring in Padang Cermin, Sumatra, Indonesia

    Institute of Scientific and Technical Information of China (English)

    沈继红; 宋维志; 林学政; 王帅; Dewi Seswita Zilda

    2012-01-01

    通过印度尼西亚苏门答腊岛Padang Cermin热泉环境基因组DNA构建古菌16S rRNA基因文库,并利用PCR-RFLP技术对其古菌多样性和系统发育分析进行了研究.根据限制性内切酶AluⅠ和MspⅠ的特征性酶切图谱,将62个阳性克隆归类为14个分类操作单位(operational taxonomic unit,OTU),文库的覆盖度达90.32%.克隆文库的优势类群为OTU2和OTU1,分别占克隆文库的27.42%和20.96%.从每个OUT中选取一个代表性克隆进行16S rRNA基因的序列测定与系统发育分析,结果表明,测定的Padang Cermin热泉中的古菌均属于泉古菌门,包括热变形菌目(Thermoproteales)、硫还原球菌目(Desulfurococcales)、杂色泉古菌(miscellaneous crenarchaeotic group,MCG)和未培养泉古菌(uncultured Crenarchaeota,UC),该热泉代表性克隆与GenBank数据库已有16S rRNA序列的相似性为91.9%~97.8%,而且与其相似性最高的序列均来自未培养的古菌克隆,由结果可见,Padang Cermin热泉古菌群落与已报道的其他热泉古菌群落的相似性较低,表明该热泉可能具有某些独特的特征,存在着特殊的古菌生态类群.%Diversity and phylogenetic analysis of archaea in the hot spring in Padang Cermin, Sumatra, Indonesia are investigated by constructing the 16S rRNA gene library of metagenomic DNA and using PCR-RFLP technique. Total 62 positive clones are classified into 14 operational taxonomic units (OTUs) according to their distinct restriction patterns of two kinds of restriction enzymes Alu Ⅰ and MspⅠ . A representative clone from each OTU is sequenced. The phylogenetic analysis shows that all archaea in the hot spring in Padang Cermin belong to Crenarchaeota, including Thermoproteales, Desulfurococcales, miscellaneous crenarchaeotic group (MCG) and some unidentified families. The similarities between the representative clone sequences from the hot spring in Padang Cermin and their closest sequences deposited in Gen

  5. Archaeal and bacterial diversity in hot springs on the Tibetan Plateau, China.

    Science.gov (United States)

    Huang, Qiuyuan; Dong, Christina Z; Dong, Raymond M; Jiang, Hongchen; Wang, Shang; Wang, Genhou; Fang, Bin; Ding, Xiaoxue; Niu, Lu; Li, Xin; Zhang, Chuanlun; Dong, Hailiang

    2011-09-01

    The diversity of archaea and bacteria was investigated in ten hot springs (elevation >4600 m above sea level) in Central and Central-Eastern Tibet using 16S rRNA gene phylogenetic analysis. The temperature and pH of these hot springs were 26-81°C and close to neutral, respectively. A total of 959 (415 and 544 for bacteria and archaea, respectively) clone sequences were obtained. Phylogenetic analysis showed that bacteria were more diverse than archaea and that these clone sequences were classified into 82 bacterial and 41 archaeal operational taxonomic units (OTUs), respectively. The retrieved bacterial clones were mainly affiliated with four known groups (i.e., Firmicutes, Proteobacteria, Cyanobacteria, Chloroflexi), which were similar to those in other neutral-pH hot springs at low elevations. In contrast, most of the archaeal clones from the Tibetan hot springs were affiliated with Thaumarchaeota, a newly proposed archaeal phylum. The dominance of Thaumarchaeota in the archaeal community of the Tibetan hot springs appears to be unique, although the exact reasons are not yet known. Statistical analysis showed that diversity indices of both archaea and bacteria were not statistically correlated with temperature, which is consistent with previous studies.

  6. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  7. Bacterial and archaeal diversities in Yunnan and Tibetan hot springs, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Feng-Ping; Zhi, Xiao-Yang; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Tang, Shu-Kun; Jiang, Hong-Chen; Zhang, Chuanlun L; Dong, Hailiang; Li, Wen-Jun

    2013-04-01

    Thousands of hot springs are located in the north-eastern part of the Yunnan-Tibet geothermal zone, which is one of the most active geothermal areas in the world. However, a comprehensive and detailed understanding of microbial diversity in these hot springs is still lacking. In this study, bacterial and archaeal diversities were investigated in 16 hot springs (pH 3.2-8.6; temperature 47-96°C) in Yunnan Province and Tibet, China by using a barcoded 16S rRNA gene-pyrosequencing approach. Aquificae, Proteobacteria, Firmicutes, Deinococcus-Thermus and Bacteroidetes comprised the large portion of the bacterial communities in acidic hot springs. Non-acidic hot springs harboured more and variable bacterial phyla than acidic springs. Desulfurococcales and unclassified Crenarchaeota were the dominated groups in archaeal populations from most of the non-acidic hot springs; whereas, the archaeal community structure in acidic hot springs was simpler and characterized by Sulfolobales and Thermoplasmata. The phylogenetic analyses showed that Aquificae and Crenarchaeota were predominant in the investigated springs and possessed many phylogenetic lineages that have never been detected in other hot springs in the world. Thus findings from this study significantly improve our understanding of microbial diversity in terrestrial hot springs.

  8. Archaeal and bacterial diversity in acidic to circumneutral hot springs in the Philippines.

    Science.gov (United States)

    Huang, Qiuyuan; Jiang, Hongchen; Briggs, Brandon R; Wang, Shang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng; Solis, Ramonito; Arcilla, Carlo A; Abrajano, Teofilo; Dong, Hailiang

    2013-09-01

    The microbial diversity was investigated in sediments of six acidic to circumneutral hot springs (Temperature: 60-92 °C, pH 3.72-6.58) in the Philippines using an integrated approach that included geochemistry and 16S rRNA gene pyrosequencing. Both bacterial and archaeal abundances were lower in high-temperature springs than in moderate-temperature ones. Overall, the archaeal community consisted of sequence reads that exhibited a high similarity (nucleotide identity > 92%) to phyla Crenarchaeota, Euryarchaeota, and unclassified Archaea. The bacterial community was composed of sequence reads moderately related (nucleotide identity > 90%) to 17 phyla, with Aquificae and Firmicutes being dominant. These phylogenetic groups were correlated with environmental conditions such as temperature, dissolved sulfate and calcium concentrations in spring water, and sediment properties including total nitrogen, pyrite, and elemental sulfur. Based on the phylogenetic inference, sulfur metabolisms appear to be key physiological functions in these hot springs. Sulfobacillus (within phylum Firmicutes) along with members within Sulfolobales were abundant in two high-temperature springs (> 76 °C), and they were hypothesized to play an important role in regulating the sulfur cycling under high-temperature conditions. The results of this study improve our understanding of microbial diversity and community composition in acidic to circumneutral terrestrial hot springs and their relationships with geochemical conditions.

  9. Land-use systems affect Archaeal community structure and functional diversity in western Amazon soils

    Directory of Open Access Journals (Sweden)

    Acácio Aparecido Navarrete

    2011-10-01

    Full Text Available The study of the ecology of soil microbial communities at relevant spatial scales is primordial in the wide Amazon region due to the current land use changes. In this study, the diversity of the Archaea domain (community structure and ammonia-oxidizing Archaea (richness and community composition were investigated using molecular biology-based techniques in different land-use systems in western Amazonia, Brazil. Soil samples were collected in two periods with high precipitation (March 2008 and January 2009 from Inceptisols under primary tropical rainforest, secondary forest (5-20 year old, agricultural systems of indigenous people and cattle pasture. Denaturing gradient gel electrophoresis of polymerase chain reaction-amplified DNA (PCR-DGGE using the 16S rRNA gene as a biomarker showed that archaeal community structures in crops and pasture soils are different from those in primary forest soil, which is more similar to the community structure in secondary forest soil. Sequence analysis of excised DGGE bands indicated the presence of crenarchaeal and euryarchaeal organisms. Based on clone library analysis of the gene coding the subunit of the enzyme ammonia monooxygenase (amoA of Archaea (306 sequences, the Shannon-Wiener function and Simpson's index showed a greater ammonia-oxidizing archaeal diversity in primary forest soils (H' = 2.1486; D = 0.1366, followed by a lower diversity in soils under pasture (H' = 1.9629; D = 0.1715, crops (H' = 1.4613; D = 0.3309 and secondary forest (H' = 0.8633; D = 0.5405. All cloned inserts were similar to the Crenarchaeota amoA gene clones (identity > 95 % previously found in soils and sediments and distributed primarily in three major phylogenetic clusters. The findings indicate that agricultural systems of indigenous people and cattle pasture affect the archaeal community structure and diversity of ammonia-oxidizing Archaea in western Amazon soils.

  10. Detection and analysis of elusive members of a novel and diverse archaeal community within a thermal spring streamer consortium.

    Science.gov (United States)

    Colman, Daniel R; Thomas, Raquela; Maas, Kendra R; Takacs-Vesbach, Cristina D

    2015-03-01

    Recent metagenomic analyses of Yellowstone National Park (YNP) thermal spring communities suggested the presence of minor archaeal populations that simultaneous PCR-based assays using traditional 'universal' 16S rRNA gene primers failed to detect. Here we use metagenomics to identify PCR primers effective at detecting elusive members of the Archaea, assess their efficacy, and describe the diverse and novel archaeal community from a circum-neutral thermal spring from the Bechler region of YNP. We determined that a less commonly used PCR primer, Arch349F, captured more diversity in this spring than the widely used A21F primer. A search of the PCR primers against the RDP 16S rRNA gene database indicated that Arch349F also captured the largest percentage of Archaea, including 41 % more than A21F. Pyrosequencing using the Arch349F primer recovered all of the phylotypes present in the clone-based portion of the study and the metagenome of this spring in addition to several other populations of Archaea, some of which are phylogenetically novel. In contrast to the lack of amplification with traditional 16S rRNA gene primers, our comprehensive analyses suggested a diverse archaeal community in the Bechler spring, with implications for recently discovered groups such as the Geoarchaeota and other undescribed archaeal groups.

  11. Distribution and Diversity of Archaeal Ammonia Monooxygenase Genes Associated with Corals▿ †

    OpenAIRE

    Beman, J. Michael; Roberts, Kathryn J.; Wegley, Linda; Rohwer, Forest; Francis, Christopher A.

    2007-01-01

    Corals are known to harbor diverse microbial communities of Bacteria and Archaea, yet the ecological role of these microorganisms remains largely unknown. Here we report putative ammonia monooxygenase subunit A (amoA) genes of archaeal origin associated with corals. Multiple DNA samples drawn from nine coral species and four different reef locations were PCR screened for archaeal and bacterial amoA genes, and archaeal amoA gene sequences were obtained from five different species of coral coll...

  12. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  13. Phylogenetic diversity of Amazonian tree communities

    OpenAIRE

    Honorio Coronado, Eurídice N.; Dexter, Kyle G.; Pennington, R. Toby; Chave, Jérôme; Lewis, Simon L.; Alexiades, Miguel N.; Alvarez, Esteban; Alves de Oliveira, Atila; Amaral, Iêda L.; Araujo-Murakami, Alejandro; Arets, Eric J. M. M.; Aymard, Gerardo A.; Baraloto, Christopher; Bonal, Damien; Brienen, Roel

    2015-01-01

    Aim: To examine variation in the phylogenetic diversity (PD) of tree communities across geographical and environmental gradients in Amazonia. Location: Two hundred and eighty-three c. 1 ha forest inventory plots from across Amazonia. Methods: We evaluated PD as the total phylogenetic branch length across species in each plot (PDss), the mean pairwise phylogenetic distance between species (MPD), the mean nearest taxon distance (MNTD) and their equivalents standardized for species richness (ses...

  14. Archaeal phylogeny: reexamination of the phylogenetic position of Archaeoglobus fulgidus in light of certain composition-induced artifacts

    Science.gov (United States)

    Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.

    1991-01-01

    A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.

  15. RNA-Based Assessment of Diversity and Composition of Active Archaeal Communities in the German Bight

    Directory of Open Access Journals (Sweden)

    Bernd Wemheuer

    2012-01-01

    Full Text Available Archaea play an important role in various biogeochemical cycles. They are known extremophiles inhabiting environments such as thermal springs or hydrothermal vents. Recent studies have revealed a significant abundance of Archaea in moderate environments, for example, temperate sea water. Nevertheless, the composition and ecosystem function of these marine archaeal communities is largely unknown. To assess diversity and composition of active archaeal communities in the German Bight, seven marine water samples were taken and studied by RNA-based analysis of ribosomal 16S rRNA. For this purpose, total RNA was extracted from the samples and converted to cDNA. Archaeal community structures were investigated by pyrosequencing-based analysis of 16S rRNA amplicons generated from cDNA. To our knowledge, this is the first study combining next-generation sequencing and metatranscriptomics to study archaeal communities in marine habitats. The pyrosequencing-derived dataset comprised 62,045 archaeal 16S rRNA sequences. We identified Halobacteria as the predominant archaeal group across all samples with increased abundance in algal blooms. Thermoplasmatales (Euryarchaeota and the Marine Group I (Thaumarchaeota were identified in minor abundances. It is indicated that archaeal community patterns were influenced by environmental conditions.

  16. Diversity and Habitat Niche Modeling of Candidate Archaeal Phylum Aigarchaeota

    Science.gov (United States)

    Alba, T. W.; Goertz, G.; Williams, A. J.; Cole, J. K.; Murugapiran, S. K.; Dodsworth, J. A.; Hedlund, B. P.

    2013-12-01

    ';Aigarchaeota' (formerly known as pSL4 and Hot Water Crenarchaeotic Group I (HWCGI)) is a candidate phylum of Archaea known only by 16S rRNA gene fragments from cultivation-independent microbial surveys and a single composite genome from Candidatus ';Caldiarchaeum subterraneum', an inhabitant of a subterranean gold mine in Japan. Sequences reported in various publications are found exclusively in geothermal settings, but a comprehensive assessment has not yet been performed. We mined public databases for 16S rRNA gene sequences related to known ';Aigarchaeota' and used a combination of approaches to rigorously define the phylogenetic boundaries of the phylum. The analyses supported the proposed relationship between ';Aigarchaeota', Thaumarchaeota, Crenarchaeota, and Korarchaeota in the so-called 'TACK superphylum' and identified ~200 16S rRNA genes and gene fragments belonging to ';Aigarchaeota', including those recovered from terrestrial geothermal systems on several continents (North America, Asia, Africa, Europe, and Oceania) and marine geothermal and subsurface samples in both the Atlantic and Pacific. ';Aigarchaeota' belonged to at least three family- to order-level groups and at least seven genus-level groups. All genus-level groups were recovered from geographically distant locations, suggesting a global distribution within amenable habitats. ';Aigarchaeota'-specific primers for the polymerase chain reaction (PCR) amplification of 16S rRNA genes were designed using SP-Designer and reviewed using the Ribosomal Database Project Probe Match tool. The primers will be used to determine the presence and abundance of ';Aigarchaeota' in a wide variety of samples from terrestrial geothermal systems in the western U.S. and Asia. These phylogenetic data, along with a large geochemical database, will be analyzed using multivariate statistics to develop biogeographic and habitat niche models for ';Aigarchaeota'. This study offers the first coherent view of the

  17. Biosynthesis of ribose-5-phosphate and erythrose-4-phosphate in archaea: a phylogenetic analysis of archaeal genomes

    Directory of Open Access Journals (Sweden)

    Tim Soderberg

    2005-01-01

    Full Text Available A phylogenetic analysis of the genes encoding enzymes in the pentose phosphate pathway (PPP, the ribulose monophosphate (RuMP pathway, and the chorismate pathway of aromatic amino acid biosynthesis, employing data from 13 complete archaeal genomes, provides a potential explanation for the enigmatic phylogenetic patterns of the PPP genes in archaea. Genomic and biochemical evidence suggests that three archaeal species (Methanocaldococcus jannaschii, Thermoplasma acidophilum and Thermoplasma volcanium produce ribose-5-phosphate via the nonoxidative PPP (NOPPP, whereas nine species apparently lack an NOPPP but may employ a reverse RuMP pathway for pentose synthesis. One species (Halobacterium sp. NRC-1 lacks both the NOPPP and the RuMP pathway but may possess a modified oxidative PPP (OPPP, the details of which are not yet known. The presence of transketolase in several archaeal species that are missing the other two NOPPP genes can be explained by the existence of differing requirements for erythrose-4-phosphate (E4P among archaea: six species use transketolase to make E4P as a precursor to aromatic amino acids, six species apparently have an alternate biosynthetic pathway and may not require the ability to make E4P, and one species (Pyrococcus horikoshii probably does not synthesize aromatic amino acids at all.

  18. pH dominates variation in tropical soil archaeal diversity and community structure.

    Science.gov (United States)

    Tripathi, Binu M; Kim, Mincheol; Lai-Hoe, Ang; Shukor, Nor A A; Rahim, Raha A; Go, Rusea; Adams, Jonathan M

    2013-11-01

    Little is known of the factors influencing soil archaeal community diversity and composition in the tropics. We sampled soils across a range of forest and nonforest environments in the equatorial tropics of Malaysia, covering a wide range of pH values. DNA was PCR-amplified for the V1-V3 region of the 16S rRNA gene, and 454-pyrosequenced. Soil pH was the best predictor of diversity and community composition of Archaea, being a stronger predictor than land use. Archaeal OTU richness was highest in the most acidic soils. Overall archaeal abundance in tropical soils (determined by qPCR) also decreased at higher pH. This contrasts with the opposite trend previously found in temperate soils. Thaumarcheota group 1.1b was more abundant in alkaline soils, whereas group 1.1c was only detected in acidic soils. These results parallel those found in previous studies in cooler climates, emphasizing niche conservatism among broad archaeal groups. Among the most abundant operational taxonomic units (OTUs), there was clear evidence of niche partitioning by pH. No individual OTU occurred across the entire range of pH values. Overall, the results of this study show that pH plays a major role in structuring tropical soil archaeal communities.

  19. Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

    Science.gov (United States)

    Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

    2015-12-01

    Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)].

  20. Metagenomic evaluation of bacterial and archaeal diversity in the geothermal hot springs of manikaran, India.

    Science.gov (United States)

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Green, Stefan J; Joshi, Amit; Chauhan, Ashvini

    2015-02-19

    Bacterial and archaeal diversity in geothermal spring water were investigated using 16S rRNA gene amplicon metagenomic sequencing. This revealed the dominance of Firmicutes, Aquificae, and the Deinococcus-Thermus group in this thermophilic environment. A number of sequences remained taxonomically unresolved, indicating the presence of potentially novel microbes in this unique habitat.

  1. Phylogenetic diversity of Mesorhizobium in chickpea

    Indian Academy of Sciences (India)

    Dong Hyun Kim; Mayank Kaashyap; Abhishek Rathore; Roma R Das; Swathi Parupalli; Hari D Upadhyaya; S Gopalakrishnan; Pooran M Gaur; Sarvjeet Singh; Jagmeet Kaur; Mohammad Yasin; Rajeev K Varshney

    2014-06-01

    Crop domestication, in general, has reduced genetic diversity in cultivated gene pool of chickpea (Cicer arietinum) as compared with wild species (C. reticulatum, C. bijugum). To explore impact of domestication on symbiosis, 10 accessions of chickpeas, including 4 accessions of C. arietinum, and 3 accessions of each of C. reticulatum and C. bijugum species, were selected and DNAs were extracted from their nodules. To distinguish chickpea symbiont, preliminary sequences analysis was attempted with 9 genes (16S rRNA, atpD, dnaJ, glnA, gyrB, nifH, nifK, nodD and recA) of which 3 genes (gyrB, nifK and nodD) were selected based on sufficient sequence diversity for further phylogenetic analysis. Phylogenetic analysis and sequence diversity for 3 genes demonstrated that sequences from C. reticulatum were more diverse. Nodule occupancy by dominant symbiont also indicated that C. reticulatum (60%) could have more various symbionts than cultivated chickpea (80%). The study demonstrated that wild chickpeas (C. reticulatum) could be used for selecting more diverse symbionts in the field conditions and it implies that chickpea domestication affected symbiosis negatively in addition to reducing genetic diversity.

  2. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    Science.gov (United States)

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

  3. Archaeal viruses of the sulfolobales

    DEFF Research Database (Denmark)

    Erdmann, Susanne; Garrett, Roger Antony

    2015-01-01

    Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2 with an environm......Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2...... in CRISPR loci of Sulfolobus species from a second coinfecting conjugative plasmid or virus (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012; Erdmann et al. Mol Microbiol 91:900-917, 2014). Here we describe, firstly, the isolation of archaeal virus mixtures from terrestrial hot springs...

  4. Phylogenetic and functional analysis of metagenome sequence from high-temperature archaeal habitats demonstrate linkages between metabolic potential and geochemistry

    Directory of Open Access Journals (Sweden)

    William P. Inskeep

    2013-05-01

    Full Text Available Geothermal habitats in Yellowstone National Park (YNP provide an unparalled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze and synthesize metagenomic and geochemical data collected from seven high-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (~40-45 Mbase Sanger sequencing per site was obtained from environmental DNA extracted from high-temperature sediments and/or microbial mats and subjected to numerous phylogenetic and functional analyses. Analysis of individual sequences (e.g., MEGAN and G+C content and assemblies from each habitat type revealed the presence of dominant archaeal populations in all environments, 10 of whose genomes were largely reconstructed from the sequence data. Analysis of protein family occurrence, particularly of those involved in energy conservation, electron transport and autotrophic metabolism, revealed significant differences in metabolic strategies across sites consistent with differences in major geochemical attributes (e.g., sulfide, oxygen, pH. These observations provide an ecological basis for understanding the distribution of indigenous archaeal lineages across high temperature systems of YNP.

  5. Phylogenetic and Functional Analysis of Metagenome Sequence from High-Temperature Archaeal Habitats Demonstrate Linkages between Metabolic Potential and Geochemistry.

    Science.gov (United States)

    Inskeep, William P; Jay, Zackary J; Herrgard, Markus J; Kozubal, Mark A; Rusch, Douglas B; Tringe, Susannah G; Macur, Richard E; Jennings, Ryan deM; Boyd, Eric S; Spear, John R; Roberto, Francisco F

    2013-01-01

    Geothermal habitats in Yellowstone National Park (YNP) provide an unparalleled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze, and synthesize metagenomic and geochemical data collected from seven high-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (∼40-45 Mb Sanger sequencing per site) was obtained from environmental DNA extracted from high-temperature sediments and/or microbial mats and subjected to numerous phylogenetic and functional analyses. Analysis of individual sequences (e.g., MEGAN and G + C content) and assemblies from each habitat type revealed the presence of dominant archaeal populations in all environments, 10 of whose genomes were largely reconstructed from the sequence data. Analysis of protein family occurrence, particularly of those involved in energy conservation, electron transport, and autotrophic metabolism, revealed significant differences in metabolic strategies across sites consistent with differences in major geochemical attributes (e.g., sulfide, oxygen, pH). These observations provide an ecological basis for understanding the distribution of indigenous archaeal lineages across high-temperature systems of YNP.

  6. Quantitative and phylogenetic study of the Deep Sea Archaeal Group in sediments of the arctic mid-ocean spreading ridge

    Directory of Open Access Journals (Sweden)

    Steffen Leth eJørgensen

    2013-10-01

    Full Text Available In marine sediments archaea often constitute a considerable part of the microbial community, of which the Deep Sea Archaeal Group (DSAG is one of the most predominant. Despite their high abundance no members from this archaeal group have so far been characterized and thus their metabolism is unknown. Here we show that the relative abundance of DSAG marker genes can be correlated with geochemical parameters, allowing prediction of both the potential electron donors and acceptors of these organisms. We estimated the abundance of 16S rRNA genes from Archaea, Bacteria and DSAG in 52 sediment horizons from two cores collected at the slow-spreading Arctic Mid-Ocean Ridge, using qPCR. The results indicate that members of the DSAG make up the entire archaeal population in certain horizons and constitute up to ~ 50% of the total microbial community. The quantitative data were correlated to 30 different geophysical and geochemical parameters obtained from the same sediment horizons. We observed a significant correlation between the relative abundance of DSAG 16S rRNA genes and the content of organic carbon (p < 0.0001. Further, significant co-variation with iron oxide, and dissolved iron and manganese (all p < 0.0000, indicated a direct or indirect link to iron and manganese cycling. Neither of these parameters correlated with the relative abundance of archaeal or bacterial 16S rRNA genes, nor did any other major electron donor or acceptor measured. Phylogenetic analysis of DSAG 16S rRNA gene sequences reveals three monophyletic lineages with no apparent habitat-specific distribution. In this study we support the hypothesis that members of the DSAG are tightly linked to the content of organic carbon and directly or indirectly involved in the cycling of iron and/or manganese compounds. Further, we provide a molecular tool to assess their abundance in environmental samples and enrichment cultures.

  7. Phylogenetic analysis of the archaeal community in an alkaline-saline soil of the former lake Texcoco (Mexico).

    Science.gov (United States)

    Valenzuela-Encinas, César; Neria-González, Isabel; Alcántara-Hernández, Rocio J; Enríquez-Aragón, J Arturo; Estrada-Alvarado, Isabel; Hernández-Rodríguez, César; Dendooven, Luc; Marsch, Rodolfo

    2008-03-01

    The soil of the former lake Texcoco is an extreme environment localized in the valley of Mexico City, Mexico. It is highly saline and alkaline, where Na+, Cl(-), HCO3(-) and CO3(2-) are the predominant ions, with a pH ranging from 9.8 to 11.7 and electrolytic conductivities in saturation extracts from 22 to 150 dS m(-1). Metagenomic DNA from the archaeal community was extracted directly from soil and used as template to amplify 16S ribosomal gene by PCR. PCR products were used to construct gene libraries. The ribosomal library showed that the archaeal diversity included Natronococcus sp., Natronolimnobius sp., Natronobacterium sp., Natrinema sp., Natronomonas sp., Halovivax sp., "Halalkalicoccus jeotgali" and novel clades within the family of Halobacteriaceae. Four clones could not be classified. It was found that the archaeal diversity in an alkaline-saline soil of the former lake Texcoco, Mexico, was low, but showed yet uncharacterized and unclassified species.

  8. Phylogenetic diversity of Archaea in the intestinal tract of termites from different lineages.

    Science.gov (United States)

    Shi, Yu; Huang, Zhou; Han, Shuai; Fan, Shuo; Yang, Hong

    2015-08-01

    Termites are among the few arthropods that emit methane to the atmosphere, which is a significant source of global greenhouse gas due to their huge biomass on earth. In this study, phylogenetic diversity of Archaea of five termite species from different lineages were analyzed based on 16S rRNA genes. Archaea associated with wood-feeding lower termite, R. chinensis were exclusively Methanobrevibacter in the order Methanobacteriales. This type of methanogens was also found in Nasutitermes sp. and Microcerotermes sp. but not in the fungus-cultivating termites, Odontotermes formosanus and Macrotermes barneyi, which harbor Archaea of the order Methanoplasmatales and Methanosarcinales in their guts. Archaeal diversity of wood-feeding higher termites was higher than wood-feeding lower termites. The highest archaeal diversity was found in Nasutitermes sp. In addition to methanogens affiliated with the orders Methanobacteriales, Methanomicrobiales, and Methanoplasmatales, 37% of archaeal clones were affiliated with non-methanogenic Thaumarchaeota. The results of this study will be significant for further understanding of symbiotic relationship between intestinal microbiota and termites.

  9. Birth of Archaeal Cells: Molecular Phylogenetic Analyses of G1P Dehydrogenase, G3P Dehydrogenases, and Glycerol Kinase Suggest Derived Features of Archaeal Membranes Having G1P Polar Lipids

    Science.gov (United States)

    2016-01-01

    Bacteria and Eukarya have cell membranes with sn-glycerol-3-phosphate (G3P), whereas archaeal membranes contain sn-glycerol-1-phosphate (G1P). Determining the time at which cells with either G3P-lipid membranes or G1P-lipid membranes appeared is important for understanding the early evolution of terrestrial life. To clarify this issue, we reconstructed molecular phylogenetic trees of G1PDH (G1P dehydrogenase; EgsA/AraM) which is responsible for G1P synthesis and G3PDHs (G3P dehydrogenase; GpsA and GlpA/GlpD) and glycerol kinase (GlpK) which is responsible for G3P synthesis. Together with the distribution of these protein-encoding genes among archaeal and bacterial groups, our phylogenetic analyses suggested that GlpA/GlpD in the Commonote (the last universal common ancestor of all extant life with a cellular form, Commonote commonote) acquired EgsA (G1PDH) from the archaeal common ancestor (Commonote archaea) and acquired GpsA and GlpK from a bacterial common ancestor (Commonote bacteria). In our scenario based on this study, the Commonote probably possessed a G3P-lipid membrane synthesized enzymatically, after which the archaeal lineage acquired G1PDH followed by the replacement of a G3P-lipid membrane with a G1P-lipid membrane.

  10. Diversity of putative archaeal RNA viruses in metagenomic datasets of a yellowstone acidic hot spring.

    OpenAIRE

    Hongming WANG; Yu, Yongxin; Liu, Taigang; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-01-01

    Two genomic fragments (5,662 and 1,269 nt in size, GenBank accession no. JQ756122 and JQ756123, respectively) of novel, positive-strand RNA viruses that infect archaea were first discovered in an acidic hot spring in Yellowstone National Park (Bolduc et al., 2012). To investigate the diversity of these newly identified putative archaeal RNA viruses, global metagenomic datasets were searched for sequences that were significantly similar to those of the viruses. A total of 3,757 associated read...

  11. Diversity and Abundance of Ammonia-Oxidizing Archaeal Nitrite Reductase (nirK) Genes in Estuarine Sediments of San Francisco Bay

    Science.gov (United States)

    Reji, L.; Lee, J. A.; Damashek, J.; Francis, C. A.

    2013-12-01

    Nitrification, the microbially-mediated aerobic oxidation of ammonia to nitrate via nitrite, is an integral component of the global biogeochemical nitrogen cycle. The first and rate-limiting step of nitrification, ammonia oxidation, is carried out by two distinct microbial groups: ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA). Molecular ecological studies targeting the amoA gene have revealed the abundance and ubiquity of AOA in terrestrial as well as aquatic environments. In addition to the ammonia oxidation machinery that includes the amoA gene, AOA also encode a gene for copper-containing nitrite reductase (nirK). The distribution patterns and functional role of nirK in AOA remain mostly unknown; proposed functions include the indirect involvement in ammonia oxidation through the production of nitric oxide during nitrite reduction, and (2) nitrite detoxification. In the present study, the diversity and abundance of archaeal nirK genes in estuarine sediments were investigated using quantitative polymerase chain reaction, cloning and sequencing approaches. In sediment samples collected from the San Francisco Bay estuary, two archaeal nirK variants (AnirKa and AnirKb) were amplified using specific primer sets. Overall, AnirKa was observed to be significantly more abundant than AnirKb in the sediment samples, with variation in relative abundance spanning two to three orders of magnitude between sampling sites. Phylogenetic analysis revealed a number of unique archaeal nirK sequence types, as well as many that clustered with sequences from previous estuarine studies and cultured AOA isolates, such as Nitrosopumilus maritimus. This study yielded new insights into the diversity and abundance of archaeal nirK genes in estuarine sediments, and highlights the importance of further investigating the physiological role of this gene in AOA, as well as its suitability as a marker gene for studying AOA in the environment.

  12. Functionally and phylogenetically diverse plant communities key to soil biota.

    Science.gov (United States)

    Milcu, Alexandru; Allan, Eric; Roscher, Christiane; Jenkins, Tania; Meyer, Sebastian T; Flynn, Dan; Bessler, Holger; Buscot, François; Engels, Christof; Gubsch, Marlén; König, Stephan; Lipowsky, Annett; Loranger, Jessy; Renker, Carsten; Scherber, Christoph; Schmid, Bernhard; Thébault, Elisa; Wubet, Tesfaye; Weisser, Wolfgang W; Scheu, Stefan; Eisenhauer, Nico

    2013-08-01

    Recent studies assessing the role of biological diversity for ecosystem functioning indicate that the diversity of functional traits and the evolutionary history of species in a community, not the number of taxonomic units, ultimately drives the biodiversity--ecosystem-function relationship. Here, we simultaneously assessed the importance of plant functional trait and phylogenetic diversity as predictors of major trophic groups of soil biota (abundance and diversity), six years from the onset of a grassland biodiversity experiment. Plant functional and phylogenetic diversity were generally better predictors of soil biota than the traditionally used species or functional group richness. Functional diversity was a reliable predictor for most biota, with the exception of soil microorganisms, which were better predicted by phylogenetic diversity. These results provide empirical support for the idea that the diversity of plant functional traits and the diversity of evolutionary lineages in a community are important for maintaining higher abundances and diversity of soil communities.

  13. Denaturing gradient gel electrophoresis and barcoded pyrosequencing reveal unprecedented archaeal diversity in mangrove sediment and rhizosphere samples.

    Science.gov (United States)

    Pires, Ana C C; Cleary, Daniel F R; Almeida, Adelaide; Cunha, Angela; Dealtry, Simone; Mendonça-Hagler, Leda C S; Smalla, Kornelia; Gomes, Newton C M

    2012-08-01

    Mangroves are complex ecosystems that regulate nutrient and sediment fluxes to the open sea. The importance of bacteria and fungi in regulating nutrient cycles has led to an interest in their diversity and composition in mangroves. However, very few studies have assessed Archaea in mangroves, and virtually nothing is known about whether mangrove rhizospheres affect archaeal diversity and composition. Here, we studied the diversity and composition of Archaea in mangrove bulk sediment and the rhizospheres of two mangrove trees, Rhizophora mangle and Laguncularia racemosa, using denaturing gradient gel electrophoresis (DGGE) and pyrosequencing of archaeal 16S rRNA genes with a nested-amplification approach. DGGE profiles revealed significant structural differences between bulk sediment and rhizosphere samples, suggesting that roots of both mangrove species influence the sediment archaeal community. Nearly all of the detected sequences obtained with pyrosequencing were identified as Archaea, but most were unclassified at the level of phylum or below. Archaeal richness was, furthermore, the highest in the L. racemosa rhizosphere, intermediate in bulk sediment, and the lowest in the R. mangle rhizosphere. This study shows that rhizosphere microhabitats of R. mangle and L. racemosa, common plants in subtropical mangroves located in Rio de Janeiro, Brazil, hosted distinct archaeal assemblages. PMID:22660713

  14. Bacterial and Archaeal Diversity in the Gastrointestinal Tract of the North American Beaver (Castor canadensis)

    Science.gov (United States)

    Gruninger, Robert J.; McAllister, Tim A.; Forster, Robert J.

    2016-01-01

    The North American Beaver (Castor canadensis) is the second largest living rodent and an iconic symbol of Canada. The beaver is a semi-aquatic browser whose diet consists of lignocellulose from a variety of plants. The beaver is a hindgut fermenter and has an enlarged ceacum that houses a complex microbiome. There have been few studies examining the microbial diversity in gastrointestinal tract of hindgut fermenting herbivores. To examine the bacterial and archaeal communities inhabiting the gastrointestinal tract of the beaver, the microbiome of the ceacum and feaces was examined using culture-independent methods. DNA from the microbial community of the ceacum and feaces of 4 adult beavers was extracted, and the16S rRNA gene was sequenced using either bacterial or archaeal specific primers. A total of 1447 and 1435 unique bacterial OTUs were sequenced from the ceacum and feaces, respectively. On average, the majority of OTUs within the ceacum were classified as Bacteroidetes (49.2%) and Firmicutes (47.6%). The feaces was also dominated by OTUs from Bacteroidetes (36.8%) and Firmicutes (58.9%). The composition of bacterial community was not significantly different among animals. The composition of the ceacal and feacal microbiome differed, but this difference is due to changes in the abundance of closely related OTUs, not because of major differences in the taxonomic composition of the communities. Within these communities, known degraders of lignocellulose were identified. In contrast, to the bacterial microbiome, the archaeal community was dominated by a single species of methanogen, Methanosphaera stadtmanae. The data presented here provide the first insight into the microbial community within the hindgut of the beaver. PMID:27227334

  15. Phylogenetic analysis of bacterial and archaeal arsC gene sequences suggests an ancient, common origin for arsenate reductase

    Directory of Open Access Journals (Sweden)

    Dugas Sandra L

    2003-07-01

    Full Text Available Abstract Background The ars gene system provides arsenic resistance for a variety of microorganisms and can be chromosomal or plasmid-borne. The arsC gene, which codes for an arsenate reductase is essential for arsenate resistance and transforms arsenate into arsenite, which is extruded from the cell. A survey of GenBank shows that arsC appears to be phylogenetically widespread both in organisms with known arsenic resistance and those organisms that have been sequenced as part of whole genome projects. Results Phylogenetic analysis of aligned arsC sequences shows broad similarities to the established 16S rRNA phylogeny, with separation of bacterial, archaeal, and subsequently eukaryotic arsC genes. However, inconsistencies between arsC and 16S rRNA are apparent for some taxa. Cyanobacteria and some of the γ-Proteobacteria appear to possess arsC genes that are similar to those of Low GC Gram-positive Bacteria, and other isolated taxa possess arsC genes that would not be expected based on known evolutionary relationships. There is no clear separation of plasmid-borne and chromosomal arsC genes, although a number of the Enterobacteriales (γ-Proteobacteria possess similar plasmid-encoded arsC sequences. Conclusion The overall phylogeny of the arsenate reductases suggests a single, early origin of the arsC gene and subsequent sequence divergence to give the distinct arsC classes that exist today. Discrepancies between 16S rRNA and arsC phylogenies support the role of horizontal gene transfer (HGT in the evolution of arsenate reductases, with a number of instances of HGT early in bacterial arsC evolution. Plasmid-borne arsC genes are not monophyletic suggesting multiple cases of chromosomal-plasmid exchange and subsequent HGT. Overall, arsC phylogeny is complex and is likely the result of a number of evolutionary mechanisms.

  16. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean

    NARCIS (Netherlands)

    Sintes, Eva; Bergauer, Kristin; De Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.

    2013-01-01

    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotype

  17. Functionally and phylogenetically diverse plant communities key to soil biota

    OpenAIRE

    Milcu, Alexandru; Allan, Eric; Roscher, Christiane; Jenkins, Tania; Meyer, Sebastian T.; Flynn, Dan; Bessler, Holger; Buscot, François; Engels, Christof; Gubsch, Marlén; König, Stephan; Lipowsky, Annett; Loranger, Jessy; Renker, Carsten; Scherber, Christoph

    2013-01-01

    Recent studies assessing the role of biological diversity for ecosystem functioning indicate that the diversity of functional traits and the evolutionary history of species in a community, not the number of taxonomic units, ultimately drives the biodiversity–ecosystem-function relationship. Here, we simultaneously assessed the importance of plant functional trait and phylogenetic diversity as predictors of major trophic groups of soil biota (abundance and diversity), six years from the onset ...

  18. Spatial Patterns of Palm Diversity from a Phylogenetic Perspective

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Svenning, J.-C.; Kissling, W. Daniel;

    . Robust and well-resolved phylogenetic trees, in combination with comprehensive distributional and trait data, can provide important insights into the long-term causes of spatial biodiversity patterns. Palms lend themselves to such research not least due to an exceptionally good data basis, and several...... studies using a variety of approaches have recently shown that the distribution of palm diversity is strongly influenced by the phylogenetic history of the family. Here, we provide an overview of evidence for evolutionary imprints on palm diversity patterns (sensu lato), including our own studies where we...... applied ecoinformatics to study phylogenetic diversity and assemblage structure. It appears that evolutionary processes are important for palm diversity patterns across spatial scales ranging from local communities to biogeographic realms, with the influence of individual processes being scale dependent...

  19. Archaeal community in a human-disturbed watershed in southeast China: diversity, distribution, and responses to environmental changes.

    Science.gov (United States)

    Hu, Anyi; Wang, Hongjie; Li, Jiangwei; Liu, Jing; Chen, Nengwang; Yu, Chang-Ping

    2016-05-01

    The response of freshwater bacterial community to anthropogenic disturbance has been well documented, yet the studies of freshwater archaeal community are rare, especially in lotic environments. Here, we investigated planktonic and benthic archaeal communities in a human-perturbed watershed (Jiulong River Watershed, JRW) of southeast China by using Illumina 16S ribosomal RNA gene amplicon sequencing. The results of taxonomic assignments indicated that SAGMGC-1, Methanobacteriaceae, Methanospirillaceae, and Methanoregulaceae were the four most abundant families in surface waters, accounting for 12.65, 23.21, 18.58 and 10.97 % of planktonic communities, whereas Nitrososphaeraceae and Miscellaneous Crenarchaeotic Group occupied more than 49 % of benthic communities. The compositions of archaeal communities and populations in waters and sediments were significantly different from each other. Remarkably, the detection frequencies of families Methanobacteriaceae and Methanospirillaceae, and genera Methanobrevibacter and Methanosphaera in planktonic communities correlated strongly with bacterial fecal indicator, suggesting some parts of methanogenic Archaea may come from fecal contamination. Because soluble reactive phosphorus (SRP) and the ratio of dissolved inorganic nitrogen to SRP instead of nitrogen nutrients showed significant correlation with several planktonic Nitrosopumilus- and Nitrosotalea-like OTUs, Thaumarchaeota may play an unexplored role in biogeochemical cycling of river phosphorus. Multivariate statistical analyses revealed that the variation of α-diversity of planktonic archaeal community was best explained by water temperature, whereas nutrient concentrations and stoichiometry were the significant drivers of β-diversity of planktonic and benthic communities. Taken together, these results demonstrate that the structure of archaeal communities in the JRW is sensitive to anthropogenic disturbances caused by riparian human activities. PMID:26810199

  20. Archaeal diversity and abundance within different layers of summer sea-ice and seawater from Prydz Bay, Antarctica

    Institute of Scientific and Technical Information of China (English)

    MA Jifei; DU Zongjun; LUO Wei; YU Yong; ZENG Yixin; CHEN Bo; LI Huirong

    2014-01-01

    Fluorescence in-situ hybridization (FISH) and 16S rRNA gene clone library analyses were used to determine the abundance and diversity of archaea in Prydz Bay, Antarctica. Correlation analysis was also performed to assess links between physicochemical parameters and archaeal abundance and diversity within the sea-ice. Samples of sea-ice and seawater were collected during the 26th Chinese National Antarctic Research Expedition. The results of FISH showed that archaea were relatively abundant within the top layer of the sea-ice, and correlation analysis suggested that the concentration of 4NH+ might be one of the main factors underlying this distribution pattern. However, using 16S rRNA gene libraries, archaea were not detected in the top and middle layers of the sea-ice. All archaeal clones obtained from the bottom layer of the sea-ice were grouped into the Marine Group I Crenarchaeota while the archaeal clones from seawater were assigned to Marine Group I Crenarchaeota, Marine Group II Euryarchaeota, and Marine Group III Euryarchaeota. Overall, the ifndings of this study showed that the diversity of archaea in the sea-ice in Prydz Bay was low.

  1. Microbial population, activity, and phylogenetic diversity in the subseafloor core sediment from the Sea of Okhotsk

    Science.gov (United States)

    Inagaki, F.; Suzuki, M.; Takai, K.; Nealson, K. H.; Horikoshi, K.

    2002-12-01

    Subseafloor environments has already been recognized as the largest biosphere on the planet Earth, however, the microbial diversity and activity has been still poorly understood, even in their impacts on biogeochemical processes, tectonic settings, and paleoenvironmental events. We demonstrate here the evaluation of microbial community structure and active habitats in deeply buried cold marine sediments collected from the Sea of Okhotsk by a combined use of molecular ecological surveys and culturing assays. The piston core sediment (MD01-2412) was collected by IMAGES (International Marine Global Change Study) Project from the southeastern Okhotsk Sea, June 2001. The total recovered length was about 58m. The lithology of the core sediment was mainly constructed from pelagic clay (PC) and volcanic ash layers (Ash). We collected aseptically the most inside core parts from 16 sections at different depths for microbiological study. The direct count of DAPI-stained cells revealed that the cells in Ash samples were present 1.2 to 2.2 times higher than in PC samples. The quantitative-PCR of 16S rDNA between bacterial and archaeal rDNA suggested that the increased population density in Ash layers was caused by the bacterial components. We studied approximately 650 and 550 sequences from bacterial and archaeal rDNA clone libraries, respectively. The similarity and phylogenetic analyses revealed that the microbial community structures were apparently different between in Ash layers and PC samples. From bacterial rDNA clone libraries, the members within gamma-Proteobacteria such as genera Halomonas, Shewanella, Psychromonas and Methylosinus were predominantly detected in Ash layers whereas the Dehalococcoides group and delta-Proteobacteria were major bacterial components in PC samples. From archaeal libraries, the sequences from Ash and PC samples were affiliated into the clusters represented by the environmental sequences obtained from terrestrial and deep-sea environments

  2. Land-Sparing Agriculture Best Protects Avian Phylogenetic Diversity.

    Science.gov (United States)

    Edwards, David P; Gilroy, James J; Thomas, Gavin H; Uribe, Claudia A Medina; Haugaasen, Torbjørn

    2015-09-21

    The conversion of natural habitats to farmland is a major driver of the global extinction crisis. Two strategies are promoted to mitigate the impacts of agricultural expansion on biodiversity: land sharing integrates wildlife-friendly habitats within farmland landscapes, and land sparing intensifies farming to allow the offset of natural reserves. A key question is which strategy would protect the most phylogenetic diversity--the total evolutionary history shared across all species within a community. Conserving phylogenetic diversity decreases the chance of losing unique phenotypic and ecological traits and provides benefits for ecosystem function and stability. Focusing on birds in the threatened Chocó-Andes hotspot of endemism, we tested the relative benefits of each strategy for retaining phylogenetic diversity in tropical cloud forest landscapes threatened by cattle pastures. Using landscape simulations, we find that land sharing would protect lower community-level phylogenetic diversity than land sparing and that with increasing distance from forest (from 500 to >1,500 m), land sharing is increasingly inferior to land sparing. Isolation from forest also leads to the loss of more evolutionarily distinct species from communities within land-sharing landscapes, which can be avoided with effective land sparing. Land-sharing policies that promote the integration of small-scale wildlife-friendly habitats might be of limited benefit without the simultaneous protection of larger blocks of natural habitat, which is most likely to be achieved via land-sparing measures. PMID:26344093

  3. Lipase production by diverse phylogenetic clades of Aureobasidium pullulans

    Science.gov (United States)

    Thirty-nine strains representing 12 diverse phylogenetic clades of Aureobasidium pullulans were surveyed for lipase production using a quantitative assay. Strains in clades 4 and 10 produced 0.2-0.3 U lipase/ml, while color variant strain NRRL Y-2311-1 in clade 8 produced 0.54 U lipase/ml. Strains i...

  4. Host specialization and phylogenetic diversity of Corynespora cassiicola.

    Science.gov (United States)

    Dixon, L J; Schlub, R L; Pernezny, K; Datnoff, L E

    2009-09-01

    The fungus Corynespora cassiicola is primarily found in the tropics and subtropics, and is widely diverse in substrate utilization and host association. Isolate characterization within C. cassiicola was undertaken to investigate how genetic diversity correlates with host specificity, growth rate, and geographic distribution. C. cassiicola isolates were collected from 68 different plant species in American Samoa, Brazil, Malaysia, and Micronesia, and Florida, Mississippi, and Tennessee within the United States. Phylogenetic analyses using four loci were performed with 143 Corynespora spp. isolates, including outgroup taxa obtained from culture collections: C. citricola, C. melongenae, C. olivacea, C. proliferata, C. sesamum, and C. smithii. Phylogenetic trees were congruent from the ribosomal DNA internal transcribed spacer region, two random hypervariable loci (caa5 and ga4), and the actin-encoding locus act1, indicating a lack of recombination within the species and asexual propagation. Fifty isolates were tested for pathogenicity on eight known C. cassiicola crop hosts: basil, bean, cowpea, cucumber, papaya, soybean, sweet potato, and tomato. Pathogenicity profiles ranged from one to four hosts, with cucumber appearing in 14 of the 16 profiles. Bootstrap analyses and Bayesian posterior probability values identified six statistically significant phylogenetic lineages. The six phylogenetic lineages correlated with host of origin, pathogenicity, and growth rate but not with geographic location. Common fungal genotypes were widely distributed geographically, indicating long-distance and global dispersal of clonal lineages. This research reveals an abundance of previously unrecognized genetic diversity within the species and provides evidence for host specialization on papaya. PMID:19671003

  5. [Effects of long-term fertilization on bacterial and archaeal diversity and community structure within subtropical red paddy soils].

    Science.gov (United States)

    Yuan, Hong-zhao; Wu, Hao; Ge, Ti-da; Li, Ke-lin; Wu, Jin-shui; Wang, Jiu-rong

    2015-06-01

    Paddy soils not only function as an important sink for "missing carbon" but also play an important role in the production of greenhouse gases such as N2O and CH4. Dynamic changes in greenhouse gases in the atmosphere are closely related to microbially mediated carbon and nitrogen transformation processes occurring in soil. Using soil samples collected from a long-term fertilization experimental site in Taojiang County, subtropical China (established in 1986), we determined the effects of long-term (>25 years) non-fertilization (CK), chemical fertilization (NPK), and NPK combined with rice straw residues (NPKS) on soil bacterial and archaeal community structures. The 16S rRNA genotypes from the three differently treated soils were divided into 9 bacterial phylotypes, mainly including Proteobacteria, Acidobacteria, Chloroflexi, and archaea of Crenarchaeota and Euryarchaeota. The relative abundance of Proteobacteria, Acidobacteria and Crenarchaeota increased in the soils under NPK and NPKS treatments, with the increase being greater in the latter treatment. LUBSHUFF statistical analyses also demonstrated that there was significant difference among the microbial community compositions in CK-, NPK- and NPKS-treated soils. The abundance of bacterial and archaeal 16S rRNA genes ranged from 0.58 x 10(10) to 1.06 x 10(10) copies · g(-1) dry soil and from 1.16 x 10(6) to 1.72 x 10(6) copies · g(-1) dry soil, respectively. Application of fertilizers increased the bacterial and archaeal abundance and diversity in the treated soils, with NPKS > NPK. Long-term chemical and organic applications significantly affected the abundance, diversity and composition of bacterial and archaeal communities in paddy ecosystems. PMID:26572036

  6. Pyrosequencing-derived bacterial, archaeal, and fungal diversity of spacecraft hardware destined for Mars.

    Science.gov (United States)

    La Duc, Myron T; Vaishampayan, Parag; Nilsson, Henrik R; Torok, Tamas; Venkateswaran, Kasthuri

    2012-08-01

    Spacecraft hardware and assembly cleanroom surfaces (233 m(2) in total) were sampled, total genomic DNA was extracted, hypervariable regions of the 16S rRNA gene (bacteria and archaea) and ribosomal internal transcribed spacer (ITS) region (fungi) were subjected to 454 tag-encoded pyrosequencing PCR amplification, and 203,852 resulting high-quality sequences were analyzed. Bioinformatic analyses revealed correlations between operational taxonomic unit (OTU) abundance and certain sample characteristics, such as source (cleanroom floor, ground support equipment [GSE], or spacecraft hardware), cleaning regimen applied, and location about the facility or spacecraft. National Aeronautics and Space Administration (NASA) cleanroom floor and GSE surfaces gave rise to a larger number of diverse bacterial communities (619 OTU; 20 m(2)) than colocated spacecraft hardware (187 OTU; 162 m(2)). In contrast to the results of bacterial pyrosequencing, where at least some sequences were generated from each of the 31 sample sets examined, only 13 and 18 of these sample sets gave rise to archaeal and fungal sequences, respectively. As was the case for bacteria, the abundance of fungal OTU in the GSE surface samples dramatically diminished (9× less) once cleaning protocols had been applied. The presence of OTU representative of actinobacteria, deinococci, acidobacteria, firmicutes, and proteobacteria on spacecraft surfaces suggests that certain bacterial lineages persist even following rigorous quality control and cleaning practices. The majority of bacterial OTU observed as being recurrent belonged to actinobacteria and alphaproteobacteria, supporting the hypothesis that the measures of cleanliness exerted in spacecraft assembly cleanrooms (SAC) inadvertently select for the organisms which are the most fit to survive long journeys in space.

  7. Altitudinal Patterns of Species Diversity and Phylogenetic Diversity across Temperate Mountain Forests of Northern China

    Science.gov (United States)

    Zhang, Wenxin; Huang, Dizhou; Wang, Renqing; Liu, Jian; Du, Ning

    2016-01-01

    The spatial patterns of biodiversity and their underlying mechanisms have been an active area of research for a long time. In this study, a total of 63 samples (20m × 30m) were systematically established along elevation gradients on Mount Tai and Mount Lao, China. We explored altitudinal patterns of plant diversity in the two mountain systems. In order to understand the mechanisms driving current diversity patterns, we used phylogenetic approaches to detect the spatial patterns of phylogenetic diversity and phylogenetic structure along two elevation gradients. We found that total species richness had a monotonically decreasing pattern and tree richness had a unimodal pattern along the elevation gradients in the two study areas. However, altitudinal patterns in shrub richness and herbs richness were not consistent on the two mountains. At low elevation, anthropogenic disturbances contributed to the increase of plant diversity, especially for shrubs and herbs in understory layers, which are more sensitive to changes in microenvironment. The phylogenetic structure of plant communities exhibited an inverted hump-shaped pattern along the elevation gradient on Mount Tai, which demonstrates that environmental filtering is the main driver of plant community assembly at high and low elevations and inter-specific competition may be the main driver of plant community assembly in the middle elevations. However, the phylogenetic structure of plant communities did not display a clear pattern on Mount Lao where the climate is milder. Phylogenetic beta diversity and species beta diversity consistently increased with increasing altitudinal divergence in the two study areas. However, the altitudinal patterns of species richness did not completely mirror phylogenetic diversity patterns. Conservation areas should be selected taking into consideration the preservation of high species richness, while maximizing phylogenetic diversity to improve the potential for diversification in the

  8. Altitudinal Patterns of Species Diversity and Phylogenetic Diversity across Temperate Mountain Forests of Northern China.

    Science.gov (United States)

    Zhang, Wenxin; Huang, Dizhou; Wang, Renqing; Liu, Jian; Du, Ning

    2016-01-01

    The spatial patterns of biodiversity and their underlying mechanisms have been an active area of research for a long time. In this study, a total of 63 samples (20m × 30m) were systematically established along elevation gradients on Mount Tai and Mount Lao, China. We explored altitudinal patterns of plant diversity in the two mountain systems. In order to understand the mechanisms driving current diversity patterns, we used phylogenetic approaches to detect the spatial patterns of phylogenetic diversity and phylogenetic structure along two elevation gradients. We found that total species richness had a monotonically decreasing pattern and tree richness had a unimodal pattern along the elevation gradients in the two study areas. However, altitudinal patterns in shrub richness and herbs richness were not consistent on the two mountains. At low elevation, anthropogenic disturbances contributed to the increase of plant diversity, especially for shrubs and herbs in understory layers, which are more sensitive to changes in microenvironment. The phylogenetic structure of plant communities exhibited an inverted hump-shaped pattern along the elevation gradient on Mount Tai, which demonstrates that environmental filtering is the main driver of plant community assembly at high and low elevations and inter-specific competition may be the main driver of plant community assembly in the middle elevations. However, the phylogenetic structure of plant communities did not display a clear pattern on Mount Lao where the climate is milder. Phylogenetic beta diversity and species beta diversity consistently increased with increasing altitudinal divergence in the two study areas. However, the altitudinal patterns of species richness did not completely mirror phylogenetic diversity patterns. Conservation areas should be selected taking into consideration the preservation of high species richness, while maximizing phylogenetic diversity to improve the potential for diversification in the

  9. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean

    OpenAIRE

    Sintes, Eva; Bergauer, Kristin; de Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.

    2013-01-01

    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotypes of marine Crenarchaeota Group I (MCGI) were detected in the waters of the tropical Atlantic and the coastal Arctic. The HAC-AOA ecotype (high ammonia concentration AOA) was ≍ 8000 times and 15 ti...

  10. Understanding global patterns of mammalian functional and phylogenetic diversity

    Science.gov (United States)

    Safi, Kamran; Cianciaruso, Marcus V.; Loyola, Rafael D.; Brito, Daniel; Armour-Marshall, Katrina; Diniz-Filho, José Alexandre F.

    2011-01-01

    Documenting and exploring the patterns of diversity of life on Earth has always been a central theme in biology. Species richness despite being the most commonly used measure of diversity in macroecological studies suffers from not considering the evolutionary and ecological differences among species. Phylogenetic diversity (PD) and functional diversity (FD) have been proposed as alternative measures to overcome this limitation. Although species richness, PD and FD are closely related, their relationships have never been investigated on a global scale. Comparing PD and FD with species richness corroborated the general assumptions of surrogacy of the different diversity measures. However, the analysis of the residual variance suggested that the mismatches between the diversity measures are influenced by environmental conditions. PD increased relative to species richness with increasing mean annual temperature, whereas FD decreased with decreasing seasonality relative to PD. We also show that the tropical areas are characterized by a FD deficit, a phenomenon, that suggests that in tropical areas more species can be packed into the ecological space. We discuss potential mechanisms that could have resulted in the gradient of spatial mismatch observed in the different biodiversity measures and draw parallels to local scale studies. We conclude that the use of multiple diversity measures on a global scale can help to elucidate the relative importance of historical and ecological processes shaping the present gradients in mammalian diversity. PMID:21807734

  11. Panorama phylogenetic diversity and distribution of Type A influenza virus.

    Directory of Open Access Journals (Sweden)

    Shuo Liu

    Full Text Available BACKGROUND: Type A influenza virus is one of important pathogens of various animals, including humans, pigs, horses, marine mammals and birds. Currently, the viral type has been classified into 16 hemagglutinin and 9 neuraminidase subtypes, but the phylogenetic diversity and distribution within the viral type largely remain unclear from the whole view. METHODOLOGY/PRINCIPAL FINDINGS: The panorama phylogenetic trees of influenza A viruses were calculated with representative sequences selected from approximately 23,000 candidates available in GenBank using web servers in NCBI and the software MEGA 4.0. Lineages and sublineages were classified according to genetic distances, topology of the phylogenetic trees and distributions of the viruses in hosts, regions and time. CONCLUSIONS/SIGNIFICANCE: Here, two panorama phylogenetic trees of type A influenza virus covering all the 16 hemagglutinin subtypes and 9 neuraminidase subtypes, respectively, were generated. The trees provided us whole views and some novel information to recognize influenza A viruses including that some subtypes of avian influenza viruses are more complicated than Eurasian and North American lineages as we thought in the past. They also provide us a framework to generalize the history and explore the future of the viral circulation and evolution in different kinds of hosts. In addition, a simple and comprehensive nomenclature system for the dozens of lineages and sublineages identified within the viral type was proposed, which if universally accepted, will facilitate communications on the viral evolution, ecology and epidemiology.

  12. The climatic niche diversity of malagasy primates: a phylogenetic perspective.

    Directory of Open Access Journals (Sweden)

    Jason M Kamilar

    Full Text Available BACKGROUND: Numerous researchers have posited that there should be a strong negative relationship between the evolutionary distance among species and their ecological similarity. Alternative evidence suggests that members of adaptive radiations should display no relationship between divergence time and ecological similarity because rapid evolution results in near-simultaneous speciation early in the clade's history. In this paper, we performed the first investigation of ecological diversity in a phylogenetic context using a mammalian adaptive radiation, the Malagasy primates. METHODOLOGY/PRINCIPAL FINDINGS: We collected data for 43 extant species including: 1 1064 species by locality samples, 2 GIS climate data for each sampling locality, and 3 the phylogenetic relationships of the species. We calculated the niche space of each species by summarizing the climatic variation at localities of known occurrence. Climate data from all species occurrences at all sites were entered into a principal components analysis. We calculated the mean value of the first two PCA axes, representing rainfall and temperature diversity, for each species. We calculated the K statistic using the Physig program for Matlab to examine how well the climatic niche space of species was correlated with phylogeny. CONCLUSIONS/SIGNIFICANCE: We found that there was little relationship between the phylogenetic distance of Malagasy primates and their rainfall and temperature niche space, i.e., closely related species tend to occupy different climatic niches. Furthermore, several species from different genera converged on a similar climatic niche. These results have important implications for the evolution of ecological diversity, and the long-term survival of these endangered species.

  13. Phylogenetic and Functional Analysis of Metagenome Sequence from High-Temperature Archaeal Habitats Demonstrate Linkages between Metabolic Potential and Geochemistry

    DEFF Research Database (Denmark)

    Inskeep, William P; Jay, Zackary J; Herrgard, Markus;

    2013-01-01

    Geothermal habitats in Yellowstone National Park (YNP) provide an unparalleled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze, and synthesize metagenomic and geochemical data collected from seven high......-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.......4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (∼40-45 Mb Sanger sequencing per site) was obtained from environmental DNA extracted from high-temperature sediments and...

  14. Marine Bacterial and Archaeal Ion-Pumping Rhodopsins: Genetic Diversity, Physiology, and Ecology.

    Science.gov (United States)

    Pinhassi, Jarone; DeLong, Edward F; Béjà, Oded; González, José M; Pedrós-Alió, Carlos

    2016-12-01

    The recognition of a new family of rhodopsins in marine planktonic bacteria, proton-pumping proteorhodopsin, expanded the known phylogenetic range, environmental distribution, and sequence diversity of retinylidene photoproteins. At the time of this discovery, microbial ion-pumping rhodopsins were known solely in haloarchaea inhabiting extreme hypersaline environments. Shortly thereafter, proteorhodopsins and other light-activated energy-generating rhodopsins were recognized to be widespread among marine bacteria. The ubiquity of marine rhodopsin photosystems now challenges prior understanding of the nature and contributions of "heterotrophic" bacteria to biogeochemical carbon cycling and energy fluxes. Subsequent investigations have focused on the biophysics and biochemistry of these novel microbial rhodopsins, their distribution across the tree of life, evolutionary trajectories, and functional expression in nature. Later discoveries included the identification of proteorhodopsin genes in all three domains of life, the spectral tuning of rhodopsin variants to wavelengths prevailing in the sea, variable light-activated ion-pumping specificities among bacterial rhodopsin variants, and the widespread lateral gene transfer of biosynthetic genes for bacterial rhodopsins and their associated photopigments. Heterologous expression experiments with marine rhodopsin genes (and associated retinal chromophore genes) provided early evidence that light energy harvested by rhodopsins could be harnessed to provide biochemical energy. Importantly, some studies with native marine bacteria show that rhodopsin-containing bacteria use light to enhance growth or promote survival during starvation. We infer from the distribution of rhodopsin genes in diverse genomic contexts that different marine bacteria probably use rhodopsins to support light-dependent fitness strategies somewhere between these two extremes.

  15. Marine Bacterial and Archaeal Ion-Pumping Rhodopsins: Genetic Diversity, Physiology, and Ecology.

    Science.gov (United States)

    Pinhassi, Jarone; DeLong, Edward F; Béjà, Oded; González, José M; Pedrós-Alió, Carlos

    2016-12-01

    The recognition of a new family of rhodopsins in marine planktonic bacteria, proton-pumping proteorhodopsin, expanded the known phylogenetic range, environmental distribution, and sequence diversity of retinylidene photoproteins. At the time of this discovery, microbial ion-pumping rhodopsins were known solely in haloarchaea inhabiting extreme hypersaline environments. Shortly thereafter, proteorhodopsins and other light-activated energy-generating rhodopsins were recognized to be widespread among marine bacteria. The ubiquity of marine rhodopsin photosystems now challenges prior understanding of the nature and contributions of "heterotrophic" bacteria to biogeochemical carbon cycling and energy fluxes. Subsequent investigations have focused on the biophysics and biochemistry of these novel microbial rhodopsins, their distribution across the tree of life, evolutionary trajectories, and functional expression in nature. Later discoveries included the identification of proteorhodopsin genes in all three domains of life, the spectral tuning of rhodopsin variants to wavelengths prevailing in the sea, variable light-activated ion-pumping specificities among bacterial rhodopsin variants, and the widespread lateral gene transfer of biosynthetic genes for bacterial rhodopsins and their associated photopigments. Heterologous expression experiments with marine rhodopsin genes (and associated retinal chromophore genes) provided early evidence that light energy harvested by rhodopsins could be harnessed to provide biochemical energy. Importantly, some studies with native marine bacteria show that rhodopsin-containing bacteria use light to enhance growth or promote survival during starvation. We infer from the distribution of rhodopsin genes in diverse genomic contexts that different marine bacteria probably use rhodopsins to support light-dependent fitness strategies somewhere between these two extremes. PMID:27630250

  16. A molecular phylogenetic analysis of strombid gastropod morphological diversity.

    Science.gov (United States)

    Latiolais, Jared M; Taylor, Michael S; Roy, Kaustuv; Hellberg, Michael E

    2006-11-01

    The shells of strombid gastropods show a wide variety of forms, ranging from small and fusiform to large and elaborately ornamented with a strongly flared outer lip. Here, we present the first species-level molecular phylogeny for strombids and use the resulting phylogenetic framework to explore relationships between species richness and morphological diversity. We use portions of one nuclear (325 bp of histone H3) and one mitochondrial (640 bp of cytochrome oxidase I, COI) gene to infer relationships within the two most species-rich genera in the Strombidae: Strombus and Lambis. We include 32 species of Strombus, representing 10 of 11 extant subgenera, and 3 of the 9 species of Lambis, representing 2 of 3 extant subgenera. Maximum likelihood and Bayesian analyses of COI and of H3 and COI combined suggest Lambis is nested within a paraphyletic Strombus. Eastern Pacific and western Atlantic species of Strombus form a relatively recent monophyletic radiation within an older, paraphyletic Indo-West Pacific grade. Morphological diversity of subclades scales positively with species richness but does not show evidence of strong phylogenetic constraints. PMID:16839783

  17. Phylogenetic Diversity and Spatial Distribution of the Microbial Community Associated with the Caribbean Deep-water Sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA Gene Analysis

    OpenAIRE

    Meyer, Birte; Kuever, Jan

    2008-01-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species...

  18. Functional and phylogenetic diversity of woody plants drive herbivory in a highly diverse forest

    OpenAIRE

    Schuldt, Andreas; Assmann, Thorsten; Bruelheide, Helge; Durka, Walter; Eichenberg, David; Härdtle, Werner; Kröber, Wenzel; Michalski, Stefan G.; Purschke, Oliver

    2014-01-01

    Biodiversity loss may alter ecosystem processes, such as herbivory, a key driver of ecological functions in species-rich (sub)tropical forests. However, the mechanisms underlying such biodiversity effects remain poorly explored, as mostly effects of species richness – a very basic biodiversity measure – have been studied. Here, we analyze to what extent the functional and phylogenetic diversity of woody plant communities affect herbivory along a diversity gradient in a subtropical forest. We ...

  19. Threat diversity will erode mammalian phylogenetic diversity in the near future.

    Directory of Open Access Journals (Sweden)

    Clémentine M A Jono

    Full Text Available To reduce the accelerating rate of phylogenetic diversity loss, many studies have searched for mechanisms that could explain why certain species are at risk, whereas others are not. In particular, it has been demonstrated that species might be affected by both extrinsic threat factors as well as intrinsic biological traits that could render a species more sensitive to extinction; here, we focus on extrinsic factors. Recently, the International Union for Conservation of Nature developed a new classification of threat types, including climate change, urbanization, pollution, agriculture and aquaculture, and harvesting/hunting. We have used this new classification to analyze two main factors that could explain the expected future loss of mammalian phylogenetic diversity: 1. differences in the type of threats that affect mammals and 2. differences in the number of major threats that accumulate for a single species. Our results showed that Cetartiodactyla, Diprotodontia, Monotremata, Perissodactyla, Primates, and Proboscidea could lose a high proportion of their current phylogenetic diversity in the coming decades. In contrast, Chiroptera, Didelphimorphia, and Rodentia could lose less phylogenetic diversity than expected if extinctions were random. Some mammalian clades, including Marsupiala, Chiroptera, and a subclade of Primates, are affected by particular threat types, most likely due solely to their geographic locations and associations with particular habitats. However, regardless of the geography, habitat, and taxon considered, it is not the threat type, but the threat diversity that determines the extinction risk for species and clades. Thus, some mammals might be randomly located in areas subjected to a large diversity of threats; they might also accumulate detrimental traits that render them sensitive to different threats, which is a characteristic that could be associated with large body size. Any action reducing threat diversity is

  20. A database of phylogenetically atypical genes in archaeal and bacterial genomes, identified using the DarkHorse algorithm

    Directory of Open Access Journals (Sweden)

    Allen Eric E

    2008-10-01

    Full Text Available Abstract Background The process of horizontal gene transfer (HGT is believed to be widespread in Bacteria and Archaea, but little comparative data is available addressing its occurrence in complete microbial genomes. Collection of high-quality, automated HGT prediction data based on phylogenetic evidence has previously been impractical for large numbers of genomes at once, due to prohibitive computational demands. DarkHorse, a recently described statistical method for discovering phylogenetically atypical genes on a genome-wide basis, provides a means to solve this problem through lineage probability index (LPI ranking scores. LPI scores inversely reflect phylogenetic distance between a test amino acid sequence and its closest available database matches. Proteins with low LPI scores are good horizontal gene transfer candidates; those with high scores are not. Description The DarkHorse algorithm has been applied to 955 microbial genome sequences, and the results organized into a web-searchable relational database, called the DarkHorse HGT Candidate Resource http://darkhorse.ucsd.edu. Users can select individual genomes or groups of genomes to screen by LPI score, search for protein functions by descriptive annotation or amino acid sequence similarity, or select proteins with unusual G+C composition in their underlying coding sequences. The search engine reports LPI scores for match partners as well as query sequences, providing the opportunity to explore whether potential HGT donor sequences are phylogenetically typical or atypical within their own genomes. This information can be used to predict whether or not sufficient information is available to build a well-supported phylogenetic tree using the potential donor sequence. Conclusion The DarkHorse HGT Candidate database provides a powerful, flexible set of tools for identifying phylogenetically atypical proteins, allowing researchers to explore both individual HGT events in single genomes, and

  1. Tree phylogenetic diversity promotes host-parasitoid interactions.

    Science.gov (United States)

    Staab, Michael; Bruelheide, Helge; Durka, Walter; Michalski, Stefan; Purschke, Oliver; Zhu, Chao-Dong; Klein, Alexandra-Maria

    2016-07-13

    Evidence from grassland experiments suggests that a plant community's phylogenetic diversity (PD) is a strong predictor of ecosystem processes, even stronger than species richness per se This has, however, never been extended to species-rich forests and host-parasitoid interactions. We used cavity-nesting Hymenoptera and their parasitoids collected in a subtropical forest as a model system to test whether hosts, parasitoids, and their interactions are influenced by tree PD and a comprehensive set of environmental variables, including tree species richness. Parasitism rate and parasitoid abundance were positively correlated with tree PD. All variables describing parasitoids decreased with elevation, and were, except parasitism rate, dependent on host abundance. Quantitative descriptors of host-parasitoid networks were independent of the environment. Our study indicates that host-parasitoid interactions in species-rich forests are related to the PD of the tree community, which influences parasitism rates through parasitoid abundance. We show that effects of tree community PD are much stronger than effects of tree species richness, can cascade to high trophic levels, and promote trophic interactions. As during habitat modification phylogenetic information is usually lost non-randomly, even species-rich habitats may not be able to continuously provide the ecosystem process parasitism if the evolutionarily most distinct plant lineages vanish. PMID:27383815

  2. Phylogenetic and functional alpha and beta diversity in temperate and tropical tree communities

    OpenAIRE

    Nathan G Swenson; Erikson, David L.; Mi, Xiangcheng; Norman A. Bourg; Forero-Montaña, Jimena; Ge, Xuejun; Howe, Robert; Lake, Jeffrey K.; Liu, Xiaojuan; Ma, Keping; Pei, Nancai; Thompson, Jill; Uriarte, Maria; Wolf, Amy; Wright, S. Joseph

    2012-01-01

    The study of biodiversity has tended to focus primarily on relatively information poor measures of species diversity. Recently, many studies of local diversity (alpha diversity) have begun to use measures of functional and phylogenetic alpha diversity. Investigations into the phylogenetic and functional dissimilarity (beta diversity) of communities have been far less numerous, but these dissimilarity measures have the potential to infer the mechanisms underlying community assembly and dynamic...

  3. Archaeal diversity and the extent of iron and manganese pyritization in sediments from a tropical mangrove creek (Cardoso Island, Brazil)

    Science.gov (United States)

    Otero, X. L.; Lucheta, A. R.; Ferreira, T. O.; Huerta-Díaz, M. A.; Lambais, M. R.

    2014-06-01

    Even though several studies on the geochemical processes occurring in mangrove soils and sediments have been performed, information on the diversity of Archaea and their functional roles in these ecosystems, especially in subsurface environments, is scarce. In this study, we have analyzed the depth distribution of Archaea and their possible relationships with the geochemical transformations of Fe and Mn in a sediment core from a tropical mangrove creek, using 16S rRNA gene profiling and sequential extraction of different forms of Fe and Mn. A significant shift in the archaeal community structure was observed in the lower layers (90-100 cm), coinciding with a clear decrease in total organic carbon (TOC) content and an increase in the percentage of sand. The comparison of the archaeal communities showed a dominance of methanogenic Euryarchaeota in the upper layers (0-20 cm), whereas Crenarchaeota was the most abundant taxon in the lower layers. The dominance of methanogenic Euryarchaeota in the upper layer of the sediment suggests the occurrence of methanogenesis in anoxic microenvironments. The concentrations of Fe-oxyhydroxides in the profile were very low, and showed positive correlation with the concentrations of pyrite and degrees of Fe and Mn pyritization. Additionally, a partial decoupling of pyrite formation from organic matter concentration was observed, suggesting excessive Fe pyritization. This overpyritization of Fe can be explained either by the anoxic oxidation of methane by sulfate and/or by detrital pyrite tidal transportation from the surrounding mangrove soils. The higher pyritization levels observed in deeper layers of the creek sediment were also in agreement with its Pleistocenic origin.

  4. Matrix metalloproteinases in neural development:a phylogenetically diverse perspective

    Institute of Scientific and Technical Information of China (English)

    Christopher D. Small; Bryan D. Crawford

    2016-01-01

    The matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases originally charac-terized as secreted proteases responsible for degrading extracellular matrix proteins. Their canonical role in matrix remodelling is of signiifcant importance in neural development and regeneration, but emerging roles for MMPs, especially in signal transduction pathways, are also of obvious importance in a neural con-text. Misregulation of MMP activity is a hallmark of many neuropathologies, and members of every branch of the MMP family have been implicated in aspects of neural development and disease. However, while extraordinary research efforts have been made to elucidate the molecular mechanisms involving MMPs, methodological constraints and complexities of the research models have impeded progress. Here we discuss the current state of our understanding of the roles of MMPs in neural development using recent ex-amples and advocate a phylogenetically diverse approach to MMP research as a means to both circumvent the challenges associated with speciifc model organisms, and to provide a broader evolutionary context from which to synthesize an understanding of the underlying biology.

  5. Phylogenetic diversity and position of the genus Campylobacter

    Science.gov (United States)

    Lau, P. P.; DeBrunner-Vossbrinck, B.; Dunn, B.; Miotto, K.; MacDonnell, M. T.; Rollins, D. M.; Pillidge, C. J.; Hespell, R. B.; Colwell, R. R.; Sogin, M. L.; Fox, G. E.

    1987-01-01

    RNA sequence analysis has been used to examine the phylogenetic position and structure of the genus Campylobacter. A complete 5S rRNA sequence was determined for two strains of Campylobacter jejuni and extensive partial sequences of the 16S rRNA were obtained for several strains of C. jejuni and Wolinella succinogenes. In addition limited partial sequence data were obtained from the 16S rRNAs of isolates of C. coli, C. laridis, C. fetus, C. fecalis, and C. pyloridis. It was found that W. succinogenes is specifically related to, but not included, in the genus Campylobacter as presently constituted. Within the genus significant diversity was noted. C. jejuni, C. coli and C. laridis are very closely related but the other species are distinctly different from one another. C. pyloridis is without question the most divergent of the Campylobacter isolates examined here and is sufficiently distinct to warrant inclusion in a separate genus. In terms of overall position in bacterial phylogeny, the Campylobacter/Wolinella cluster represents a deep branching most probably located within an expanded version of the Division containing the purple photosynthetic bacteria and their relatives. The Campylobacter/Wolinella cluster is not specifically includable in either the alpha, beta or gamma subdivisions of the purple bacteria.

  6. Archaeal and bacterial diversity in an arsenic-rich shallow-sea hydrothermal system undergoing phase separation

    Directory of Open Access Journals (Sweden)

    Roy Edward Price

    2013-07-01

    Full Text Available Phase separation is a ubiquitous process in seafloor hydrothermal vents, creating a large range of salinities. Toxic elements (e.g., arsenic partition into the vapor phase, and thus can be enriched in both high and low salinity fluids. However, investigations of microbial diversity at sites associated with phase separation are rare. We evaluated prokaryotic diversity in arsenic-rich shallow-sea vents off Milos Island (Greece by comparative analysis of 16S rRNA clone sequences from two vent sites with similar pH and temperature but marked differences in salinity. Clone sequences were also obtained for aioA-like functional genes (AFGs. Bacteria in the surface sediments (0 to 1.5 cm at the high salinity site consisted of mainly Epsilonproteobacteria (Arcobacter sp., which transitioned to almost exclusively Firmicutes (Bacillus sp. at ~10 cm depth. However, the low salinity site consisted of Bacteroidetes (Flavobacteria in the surface and Epsilonproteobacteria (Arcobacter sp. at ~10 cm depth. Archaea in the high salinity surface sediments were dominated by the orders Archaeoglobales and Thermococcales, transitioning to Thermoproteales and Desulfurococcales (Staphylothermus sp. in the deeper sediments. In contrast, the low salinity site was dominated by Thermoplasmatales in the surface and Thermoproteales at depth. Similarities in gas and redox chemistry suggest that salinity and/or arsenic concentrations may select for microbial communities that can tolerate these parameters. Many of the archaeal 16S rRNA sequences contained inserts, possibly introns, including members of the Euryarchaeota. Clones containing AFGs affiliated with either Alpha- or Betaproteobacteria, although most were only distantly related to published representatives. Most clones (89% originated from the deeper layer of the low salinity, highest arsenic site. This is the only sample with overlap in 16S rRNA data, suggesting arsenotrophy as an important metabolism in similar

  7. Phylogenetic and biological species diversity within the Neurospora tetrasperma complex

    NARCIS (Netherlands)

    Menkis, A.; Bastiaans, E.; Jacobson, D.J.; Johannesson, H.

    2009-01-01

    The objective of this study was to explore the evolutionary history of the morphologically recognized filamentous ascomycete Neurospora tetrasperma, and to reveal the genetic and reproductive relationships among its individuals and populations. We applied both phylogenetic and biological species rec

  8. Land-use systems affect Archaeal community structure and functional diversity in western Amazon soils

    OpenAIRE

    Acácio Aparecido Navarrete; Rodrigo Gouvêa Taketani; Lucas William Mendes; Fabiana de Souza Cannavan; Fatima Maria de Souza Moreira; Siu Mui Tsai

    2011-01-01

    The study of the ecology of soil microbial communities at relevant spatial scales is primordial in the wide Amazon region due to the current land use changes. In this study, the diversity of the Archaea domain (community structure) and ammonia-oxidizing Archaea (richness and community composition) were investigated using molecular biology-based techniques in different land-use systems in western Amazonia, Brazil. Soil samples were collected in two periods with high precipitation (March 2008 a...

  9. Distribution and Diversity of Archaeal and Bacterial Ammonia Oxidizers in Salt Marsh Sediments▿

    OpenAIRE

    Moin, Nicole S.; Nelson, Katelyn A.; Bush, Alexander; Bernhard, Anne E.

    2009-01-01

    Diversity and abundance of ammonia-oxidizing Betaproteobacteria (β-AOB) and archaea (AOA) were investigated in a New England salt marsh at sites dominated by short or tall Spartina alterniflora (SAS and SAT sites, respectively) or Spartina patens (SP site). AOA amoA gene richness was higher than β-AOB amoA richness at SAT and SP, but AOA and β-AOB richness were similar at SAS. β-AOB amoA clone libraries were composed exclusively of Nitrosospira-like amoA genes. AOA amoA genes at SAT and SP we...

  10. Edge-related loss of tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

    Directory of Open Access Journals (Sweden)

    Bráulio A Santos

    Full Text Available Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (<80 ha forest fragments. This was attributed to a reduction of 11% in the average phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.

  11. Phylogenetic beta diversity in tropical forests: Implications for the roles of geographical and environmental distance

    Institute of Scientific and Technical Information of China (English)

    Jin-Long ZHANG; Nathan G.SWENSON; Sheng-Bin CHEN; Xiao-Juan LIU; Zong-Shan LI; Ji-Hong HUANG; Xiang-Cheng MI

    2013-01-01

    Various mechanistic theories of community assembly have been proposed ranging from niche-based theory to neutral theory.Analyses of beta diversity in a phylogenetic context could provide an excellent opportunity for testing many of these hypotheses.We analyzed the patterns of phylogenetic beta diversity in tropical tree communities in Panama to test several community assembly hypotheses.In particular,the degree to which the phylogenetic dissimilarity between communities can be explained by geographical or environmental distance can yield support for stochastic or deterministic assembly processes,respectively.Therefore,we examined:(i) the existence of distance decay of phylogenetic similarity among communities and its degree of departure from that expected under a null model; and (ii) the relative importance of geographical versus environmental distance in predicting the phylogenetic dissimilarity of communities.We found evidence that the similarity in the phylogenetic composition of communities decayed with geographical distance and environmental gradients.Null model evidence showed that beta diversity in the study system was phylogenetically non-random.Our results highlighted not only the role of local ecological mechanisms,including environmental filtering and competitive exclusion,but also biogeographical processes such as speciation,dispersal limitation,and niche evolution in structuring phylogenetic turnover.These results also highlight the importance of niche conservatism in structuring species diversity patterns.

  12. Using phylogenetic, functional and trait diversity to understand patterns of plant community productivity.

    Directory of Open Access Journals (Sweden)

    Marc W Cadotte

    Full Text Available BACKGROUND: Two decades of research showing that increasing plant diversity results in greater community productivity has been predicated on greater functional diversity allowing access to more of the total available resources. Thus, understanding phenotypic attributes that allow species to partition resources is fundamentally important to explaining diversity-productivity relationships. METHODOLOGY/PRINCIPAL FINDINGS: Here we use data from a long-term experiment (Cedar Creek, MN and compare the extent to which productivity is explained by seven types of community metrics of functional variation: 1 species richness, 2 variation in 10 individual traits, 3 functional group richness, 4 a distance-based measure of functional diversity, 5 a hierarchical multivariate clustering method, 6 a nonmetric multidimensional scaling approach, and 7 a phylogenetic diversity measure, summing phylogenetic branch lengths connecting community members together and may be a surrogate for ecological differences. Although most of these diversity measures provided significant explanations of variation in productivity, the presence of a nitrogen fixer and phylogenetic diversity were the two best explanatory variables. Further, a statistical model that included the presence of a nitrogen fixer, seed weight and phylogenetic diversity was a better explanation of community productivity than other models. CONCLUSIONS: Evolutionary relationships among species appear to explain patterns of grassland productivity. Further, these results reveal that functional differences among species involve a complex suite of traits and that perhaps phylogenetic relationships provide a better measure of the diversity among species that contributes to productivity than individual or small groups of traits.

  13. Phylogenetic and Metabolic Diversity of Planctomycetes from Anaerobic, Sulfide- and Sulfur-Rich Zodletone Spring, Oklahoma▿

    OpenAIRE

    Elshahed, Mostafa S.; Youssef, Noha H.; Luo, Qingwei; Najar, Fares Z; Roe, Bruce A; Sisk, Tracy M.; Bühring, Solveig I.; Hinrichs, Kai-Uwe; Krumholz, Lee R

    2007-01-01

    We investigated the phylogenetic diversity and metabolic capabilities of members of the phylum Planctomycetes in the anaerobic, sulfide-saturated sediments of a mesophilic spring (Zodletone Spring) in southwestern Oklahoma. Culture-independent analyses of 16S rRNA gene sequences generated using Planctomycetes-biased primer pairs suggested that an extremely diverse community of Planctomycetes is present at the spring. Although sequences that are phylogenetically affiliated with cultured hetero...

  14. Abundance and Diversity of Bacterial, Archaeal, and Fungal Communities Along an Altitudinal Gradient in Alpine Forest Soils: What Are the Driving Factors?

    Science.gov (United States)

    Siles, José A; Margesin, Rosa

    2016-07-01

    Shifts in soil microbial communities over altitudinal gradients and the driving factors are poorly studied. Their elucidation is indispensable to gain a comprehensive understanding of the response of ecosystems to global climate change. Here, we investigated soil archaeal, bacterial, and fungal communities at four Alpine forest sites representing a climosequence, over an altitudinal gradient from 545 to 2000 m above sea level (asl), regarding abundance and diversity by using qPCR and Illumina sequencing, respectively. Archaeal community was dominated by Thaumarchaeota, and no significant shifts were detected in abundance or community composition with altitude. The relative bacterial abundance increased at higher altitudes, which was related to increasing levels of soil organic matter and nutrients with altitude. Shifts in bacterial richness and diversity as well as community structure (comprised basically of Proteobacteria, Acidobacteria, Actinobacteria, and Bacteroidetes) significantly correlated with several environmental and soil chemical factors, especially soil pH. The site at the lowest altitude harbored the highest bacterial richness and diversity, although richness/diversity community properties did not show a monotonic decrease along the gradient. The relative size of fungal community also increased with altitude and its composition comprised Ascomycota, Basidiomycota, and Zygomycota. Changes in fungal richness/diversity and community structure were mainly governed by pH and C/N, respectively. The variation of the predominant bacterial and fungal classes over the altitudinal gradient was the result of the environmental and soil chemical factors prevailing at each site. PMID:26961712

  15. Nitrogen addition, not initial phylogenetic diversity, increases litter decomposition by fungal communities

    Directory of Open Access Journals (Sweden)

    Anthony Stuart Amend

    2015-02-01

    Full Text Available Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity. This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between phylogenetic diversity and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial phylogenetic diversity, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of sixty-six days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial phylogenetic diversity failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which phylogenetic diversity predicts ecosystem function will depend on environmental context.

  16. The cladistic basis for the phylogenetic diversity (PD) measure links evolutionary features to environmental gradients and supports broad applications of microbial ecology's "phylogenetic beta diversity" framework.

    Science.gov (United States)

    Faith, Daniel P; Lozupone, Catherine A; Nipperess, David; Knight, Rob

    2009-11-01

    The PD measure of phylogenetic diversity interprets branch lengths cladistically to make inferences about feature diversity. PD calculations extend conventional species-level ecological indices to the features level. The "phylogenetic beta diversity" framework developed by microbial ecologists calculates PD-dissimilarities between community localities. Interpretation of these PD-dissimilarities at the feature level explains the framework's success in producing ordinations revealing environmental gradients. An example gradients space using PD-dissimilarities illustrates how evolutionary features form unimodal response patterns to gradients. This features model supports new application of existing species-level methods that are robust to unimodal responses, plus novel applications relating to climate change, commercial products discovery, and community assembly.

  17. Phylogenetic Diversity in the Macromolecular Composition of Microalgae

    Science.gov (United States)

    Finkel, Zoe V.; Follows, Mick J.; Liefer, Justin D.; Brown, Chris M.; Benner, Ina; Irwin, Andrew J.

    2016-01-01

    The elemental stoichiometry of microalgae reflects their underlying macromolecular composition and influences competitive interactions among species and their role in the food web and biogeochemistry. Here we provide a new estimate of the macromolecular composition of microalgae using a hierarchical Bayesian analysis of data compiled from the literature. The median macromolecular composition of nutrient-sufficient exponentially growing microalgae is 32.2% protein, 17.3% lipid, 15.0% carbohydrate, 17.3% ash, 5.7% RNA, 1.1% chlorophyll-a and 1.0% DNA as percent dry weight. Our analysis identifies significant phylogenetic differences in macromolecular composition undetected by previous studies due to small sample sizes and the large inherent variability in macromolecular pools. The phylogenetic differences in macromolecular composition lead to variations in carbon-to-nitrogen ratios that are consistent with independent observations. These phylogenetic differences in macromolecular and elemental composition reflect adaptations in cellular architecture and biochemistry; specifically in the cell wall, the light harvesting apparatus, and storage pools. PMID:27228080

  18. Archaeal Communities in a Heterogeneous Hypersaline-Alkaline Soil

    Directory of Open Access Journals (Sweden)

    Yendi E. Navarro-Noya

    2015-01-01

    Full Text Available In this study the archaeal communities in extreme saline-alkaline soils of the former lake Texcoco, Mexico, with electrolytic conductivities (EC ranging from 0.7 to 157.2 dS/m and pH from 8.5 to 10.5 were explored. Archaeal communities in the 0.7 dS/m pH 8.5 soil had the lowest alpha diversity values and were dominated by a limited number of phylotypes belonging to the mesophilic Candidatus Nitrososphaera. Diversity and species richness were higher in the soils with EC between 9.0 and 157.2 dS/m. The majority of OTUs detected in the hypersaline soil were members of the Halobacteriaceae family. Novel phylogenetic branches in the Halobacteriales class were detected in the soil, and more abundantly in soil with the higher pH (10.5, indicating that unknown and uncharacterized Archaea can be found in this soil. Thirteen different genera of the Halobacteriaceae family were identified and were distributed differently between the soils. Halobiforma, Halostagnicola, Haloterrigena, and Natronomonas were found in all soil samples. Methanogenic archaea were found only in soil with pH between 10.0 and 10.3. Retrieved methanogenic archaea belonged to the Methanosarcinales and Methanomicrobiales orders. The comparison of the archaeal community structures considering phylogenetic information (UniFrac distances clearly clustered the communities by pH.

  19. Archaeal Communities in a Heterogeneous Hypersaline-Alkaline Soil.

    Science.gov (United States)

    Navarro-Noya, Yendi E; Valenzuela-Encinas, César; Sandoval-Yuriar, Alonso; Jiménez-Bueno, Norma G; Marsch, Rodolfo; Dendooven, Luc

    2015-01-01

    In this study the archaeal communities in extreme saline-alkaline soils of the former lake Texcoco, Mexico, with electrolytic conductivities (EC) ranging from 0.7 to 157.2 dS/m and pH from 8.5 to 10.5 were explored. Archaeal communities in the 0.7 dS/m pH 8.5 soil had the lowest alpha diversity values and were dominated by a limited number of phylotypes belonging to the mesophilic Candidatus Nitrososphaera. Diversity and species richness were higher in the soils with EC between 9.0 and 157.2 dS/m. The majority of OTUs detected in the hypersaline soil were members of the Halobacteriaceae family. Novel phylogenetic branches in the Halobacteriales class were detected in the soil, and more abundantly in soil with the higher pH (10.5), indicating that unknown and uncharacterized Archaea can be found in this soil. Thirteen different genera of the Halobacteriaceae family were identified and were distributed differently between the soils. Halobiforma, Halostagnicola, Haloterrigena, and Natronomonas were found in all soil samples. Methanogenic archaea were found only in soil with pH between 10.0 and 10.3. Retrieved methanogenic archaea belonged to the Methanosarcinales and Methanomicrobiales orders. The comparison of the archaeal community structures considering phylogenetic information (UniFrac distances) clearly clustered the communities by pH.

  20. Metagenomic-Based Study of the Phylogenetic and Functional Gene Diversity in Galápagos Land and Marine Iguanas

    KAUST Repository

    Hong, Pei-Ying

    2014-12-19

    In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.

  1. Human-mediated loss of phylogenetic and functional diversity in coral reef fishes

    OpenAIRE

    D'Agata, S.; Mouillot, D.; Kulbicki, Michel; Andréfouët, Serge; Bellwood, D. R.; Cinner, J. E.; Cowman, P. F.; Kronen, M.; Pinca, S.; Vigliola, Laurent

    2014-01-01

    Beyond the loss of species richness [1-3], human activities may also deplete the breadth of evolutionary history (phylogenetic diversity) and the diversity of roles (functional diversity) carried out by species within communities, two overlooked components of biodiversity. Both are, however, essential to sustain ecosystem functioning and the associated provision of ecosystem services, particularly under fluctuating environmental conditions [1-7]. We quantified the effect of human activities o...

  2. Plant-Pollinator Coextinctions and the Loss of Plant Functional and Phylogenetic Diversity

    OpenAIRE

    Marcos Costa Vieira; Marcus Vinicius Cianciaruso; Mário Almeida-Neto

    2013-01-01

    Plant-pollinator coextinctions are likely to become more frequent as habitat alteration and climate change continue to threaten pollinators. The consequences of the resulting collapse of plant communities will depend partly on how quickly plant functional and phylogenetic diversity decline following pollinator extinctions. We investigated the functional and phylogenetic consequences of pollinator extinctions by simulating coextinctions in seven plant-pollinator networks coupled with independe...

  3. The Genetic Diversity and Phylogenetic Status of Luxi Cattle

    Institute of Scientific and Technical Information of China (English)

    MAO Yong-jiang; CHANG Hong; YANG Zhang-ping; XU Ming; ZHANG Liu; CHANG Guo-bin; SONG Wei-tao; WANG Dong-lei

    2006-01-01

    A total of 87 individuals of Luxi cattle from Juanchen and Liangshan counties, Shangdong Province, China, were sampled by simple random sampling in typical colony. Twenty-one blood proteins and enzymes loci were detected by polyacrylamide gel electrophoresis (PAGE) and starch gel electrophoresis (SGE). In the meantime, the data of 7 loci of 13 cattle populations in China and other countries were collected and phylogeny relationships were studied. The results indicated that 9 out of 21 loci showed polymorphism (42.86%); the level of genetic variation in Luxi cattle population was relatively high, the mean heterozygosity was 0.1416. The Luxi cattle have a close phylogenetic relationship with the cattle populations of east and south of Asia, and this further confirmed the fact that Luxi cattle were the cross-breed between the Bos taurus and Bos indicus in China, but it is impossible that yellow cattle contained the blood of of Bali.

  4. MOLECULAR DIVERSITY OF DRINKING WATER MICROBIAL COMMUNITIES: A PHYLOGENETIC APPROACH

    Science.gov (United States)

    The microbiological quality of drinking water is assessed using culture-based methods that are highly selective and that tend to underestimate the densities and diversity of microbial populations inhabiting distribution systems. In order to better understand the effect of differe...

  5. Archaeal and Bacterial Diversity and Enzymatic Activities Associated With Particulate Matter in the Laptev Sea, a River-Impacted Arctic Shelf Environment

    Science.gov (United States)

    Evans, C. T.; Deming, J. W.

    2006-12-01

    Arctic Ocean shelves are influenced by riverine input of terrestrial, relatively refractory particulate organic matter (POM) as well as fresh material from marine phytoplankton blooms. The fate of organic particles and aggregates depends in large part on their associated microbes and the effectiveness of hydrolytic enzymes. The Laptev Sea provides an ideal setting to test for connections between Archaeal and Bacterial communities, the quality of the POM they colonize, and the activities of extracellular enzymes. Aboard the Russian icebreaker Kapitan Dranitsyn during the NABOS 2005 cruise to the Laptev Sea, we sampled various size fractions of particulate matter, from 0.2 to 70 μm. Patterns of Archaeal and Bacterial diversity were analyzed using terminal restriction fragment length polymorphism (T-RFLP). Extracellular enzymatic activities were evaluated using fluorescent substrate analogs. Thus far, we have observed a statistically significant difference between particle-associated and free-living Bacteria, many of which appear (by clone library) to be gamma-proteobacteria or CFB. Bacterial community richness associated with the largest particle fractions, where protease and glucosidase activities were the highest, was best explained by indicators of primary productivity (chlorophyll a and phaeopigments), while richness associated with smaller size fractions was best explained by general particle indicators (and depth and salinity). In contrast, particle-associated Archaea were not significantly different from their free-living counterparts. Archaeal clone library results indicate a predominance of Marine Group 1 Crenarchaea, the group containing a recently isolated nitrifying Archaeon. Given all these results, we hypothesize that in the Laptev Sea cold-active Bacteria are the primary agents in the enzymatic degradation of POM, whether terrestrial or marine, while Archaea play other roles in the elemental cycles of Arctic waters, perhaps especially in the nitrogen

  6. Evolution and Phylogenetic Diversity of Yam Species (Dioscorea spp.: Implication for Conservation and Agricultural Practices.

    Directory of Open Access Journals (Sweden)

    Marie Florence Sandrine Ngo Ngwe

    Full Text Available Yams (Dioscorea spp. consist of approximately 600 species. Presently, these species are threatened by genetic erosion due to many factors such as pest attacks and farming practices. In parallel, complex taxonomic boundaries in this genus makes it more challenging to properly address the genetic diversity of yam and manage its germplasm. As a first step toward evaluating and preserving the genetic diversity yam species, we use a phylogenetic diversity (PD approach that has the advantage to investigate phylogenetic relationships and test hypotheses of species monophyly while alleviating to the problem of ploidy variation within and among species. The Bayesian phylogenetic analysis of 62 accessions from 7 species from three regions of Cameroon showed that most Dioscorea sections were monophyletic, but species within sections were generally non-monophyletic. The wild species D. praehensilis and cultivated D. cayenensis were the species with the highest PD. At the opposite, D. esculenta has a low PD and future studies should focus on this species to properly address its conservation status. We also show that wild species show a stronger genetic structure than cultivated species, which potentially reflects the management of the yam germplasm by farmers. These findings show that phylogenetic diversity is a promising approach for an initial investigation of genetic diversity in a crop consisting of closely related species.

  7. Mapping genetic and phylogenetic diversity of a temperate forest using remote sensing based upscaling methods

    Science.gov (United States)

    Escriba, C. G.; Yamasaki, E.; Leiterer, R.; Tedder, A.; Shimizu, K.; Morsdorf, F.; Schaepman, M. E.

    2015-12-01

    Functioning and resilience of forest ecosystems under environmental pressures increases when biodiversity at genetic, species, canopy and ecosystem level is higher. Therefore mapping and monitoring diversity becomes a necessity to assess changes in ecosystems and understanding their consequences. Diversity can be assessed by using different metrics, such as diversity of functional traits or genetic diversity amongst others. In-situ approaches have provided useful, but usually spatially constrained information, often dependent on expert knowledge. We propose using remote sensing in combination with in-situ sampling at different spatial scales. We map phylogenetic and genetic diversity using airborne imaging spectroscopy in combination with terrestrial and airborne laser scanning, as well as exhaustive in-situ sampling schemes. To this end, we propose to link leaf optical properties using a taxonomic approach (spectranomics) to genetic and phylogenetic diversity. The test site is a managed mixed temperate forest on the south-facing slope of Laegern Mountain, Switzerland (47°28'42.0" N, 8°21'51.8" E, 682 m.a.s.l.). The intensive sampling area is roughly 300m x 300m and dominant species are European beech (Fagus sylvatica) and Ash (Fraxinus excelsior). We perform phylogenetic and intraspecific genetic variation analyses for the five most dominant tree species at the test site. For these species, information on functional biochemical and architectural plant traits diversity is retrieved from imaging spectroscopy and laser scanning data and validated with laboratory and in-situ measurements. To assess regional-scale genetic diversity, the phylogenetic and genetic signals are quantified using the remote sensing data, resulting in spatially distributed intra-specific genetic variation. We discuss the usefulness of combined remote sensing and in-situ sampling, to bridge diversity scales from genetic to canopy level.

  8. The Primary Results of Analyses on The Archaeal and Bacterial Diversity of Active Cave Environments Settled in Limestones at Southern Turkey

    Science.gov (United States)

    Tok, Ezgi; Kurt, Halil; Tunga Akarsubasi, A.

    2016-04-01

    The microbial diversity of cave sediments which are obtained from three different caves named Insuyu, Balatini and Altınbeşik located at Southern Turkey has been investigated using molecular methods for biomineralization . The total number of 22 samples were taken in duplicates from the critical zones of the caves at where the water activity is observed all year round. Microbial communities were monitored by 16S rRNA gene based PCR-DGGE (Polymerase Chain Reaction - Denaturating Gradient Gel Electrophoresis) methodology. DNA were extracted from the samples by The PowerSoil® DNA Isolation Kit (MO BIO Laboratories inc., CA) with the modifications on the producer's protocol. The synthetic DNA molecule poly-dIdC was used to increase the yield of PCR amplification via blocking the reaction between CaCO3 and DNA molecules. Thereafter samples were amplified by using both Archaeal and Bacterial universal primers (ref). Subsequently, archaeal and bacterial diversities in cave sediments, were investigated to be able to compare with respect to their similarities by using DGGE. DGGE patterns were analysed with BioNumerics software 5.1. Similarity matrix and dendograms of the DGGE profiles were generated based on the Dice correlation coefficient (band-based) and unweighted pair-group method with arithmetic mean (UPGMA). The structural diversity of the microbial community was examined by the Shannon index of general diversity (H). Similtaneously, geochemical analyses of the sediment samples were performed within the scope of this study. Total organic carbon (TOC), x-ray diffraction spectroscopy (XRD) and x-ray fluorescence spectroscopy (XRF) analysis of sediments were also implemented. The extensive results will be obtained at the next stages of the study currently carried on.

  9. Characterization of Bacterial, Archaeal and Eukaryote Symbionts from Antarctic Sponges Reveals a High Diversity at a Three-Domain Level and a Particular Signature for This Ecosystem

    Science.gov (United States)

    Rodríguez-Marconi, Susana; De la Iglesia, Rodrigo; Díez, Beatriz; Fonseca, Cássio A.; Hajdu, Eduardo; Trefault, Nicole

    2015-01-01

    Sponge-associated microbial communities include members from the three domains of life. In the case of bacteria, they are diverse, host specific and different from the surrounding seawater. However, little is known about the diversity and specificity of Eukarya and Archaea living in association with marine sponges. This knowledge gap is even greater regarding sponges from regions other than temperate and tropical environments. In Antarctica, marine sponges are abundant and important members of the benthos, structuring the Antarctic marine ecosystem. In this study, we used high throughput ribosomal gene sequencing to investigate the three-domain diversity and community composition from eight different Antarctic sponges. Taxonomic identification reveals that they belong to families Acarnidae, Chalinidae, Hymedesmiidae, Hymeniacidonidae, Leucettidae, Microcionidae, and Myxillidae. Our study indicates that there are different diversity and similarity patterns between bacterial/archaeal and eukaryote microbial symbionts from these Antarctic marine sponges, indicating inherent differences in how organisms from different domains establish symbiotic relationships. In general, when considering diversity indices and number of phyla detected, sponge-associated communities are more diverse than the planktonic communities. We conclude that three-domain microbial communities from Antarctic sponges are different from surrounding planktonic communities, expanding previous observations for Bacteria and including the Antarctic environment. Furthermore, we reveal differences in the composition of the sponge associated bacterial assemblages between Antarctic and tropical-temperate environments and the presence of a highly complex microbial eukaryote community, suggesting a particular signature for Antarctic sponges, different to that reported from other ecosystems. PMID:26421612

  10. [Phylogenetic diversity of bacteria in soda lake stratified sediments].

    Science.gov (United States)

    Tourova, T P; Grechnikova, M A; Kuznetsov, V V; Sorokin, D Yu

    2014-01-01

    Various previously developed techniques for DNA extraction from the samples with complex physicochemical structure (soils, silts, and sediments) and modifications of these techniques developed in the present work were tested. Their usability for DNA extraction from the sediments of the Kulunda Steppe hypersaline soda lakes was assessed, and the most efficient procedure for indirect (two-stage) DNA extraction was proposed. Almost complete separation of the cell fraction was shown, as well as the inefficiency of nested PCR for analysis of the clone libraries obtained from washed sediments by amplification of the 16S rRNA gene fragments. Analysis of the clone library obtained from the cell fractions of stratified sediments (upper, medium, and lower layers) revealed that in the sediments of Lake Gorchina-3 most eubacterial phylotypes belonged to the class Clostridia, phylum Firmicutes. They were probably specific for this habitatand formed a new, presently unknown high-rank taxon. The data obtained revealed no pronounced stratification of the spe- cies diversity of the eubacterial component of the microbial community inhabiting the sediments (0-20 cm) in the inshore zone of Lake Gorchina-3.

  11. Phylogenetic diversity of stress signalling pathways in fungi

    Directory of Open Access Journals (Sweden)

    Stansfield Ian

    2009-02-01

    Full Text Available Abstract Background Microbes must sense environmental stresses, transduce these signals and mount protective responses to survive in hostile environments. In this study we have tested the hypothesis that fungal stress signalling pathways have evolved rapidly in a niche-specific fashion that is independent of phylogeny. To test this hypothesis we have compared the conservation of stress signalling molecules in diverse fungal species with their stress resistance. These fungi, which include ascomycetes, basidiomycetes and microsporidia, occupy highly divergent niches from saline environments to plant or mammalian hosts. Results The fungi displayed significant variation in their resistance to osmotic (NaCl and sorbitol, oxidative (H2O2 and menadione and cell wall stresses (Calcofluor White and Congo Red. There was no strict correlation between fungal phylogeny and stress resistance. Rather, the human pathogens tended to be more resistant to all three types of stress, an exception being the sensitivity of Candida albicans to the cell wall stress, Calcofluor White. In contrast, the plant pathogens were relatively sensitive to oxidative stress. The degree of conservation of osmotic, oxidative and cell wall stress signalling pathways amongst the eighteen fungal species was examined. Putative orthologues of functionally defined signalling components in Saccharomyces cerevisiae were identified by performing reciprocal BLASTP searches, and the percent amino acid identities of these orthologues recorded. This revealed that in general, central components of the osmotic, oxidative and cell wall stress signalling pathways are relatively well conserved, whereas the sensors lying upstream and transcriptional regulators lying downstream of these modules have diverged significantly. There was no obvious correlation between the degree of conservation of stress signalling pathways and the resistance of a particular fungus to the corresponding stress. Conclusion Our

  12. Seed plant phylogenetic diversity and species richness in conservation planning within a global biodiversity hotspot in eastern Asia.

    Science.gov (United States)

    Li, Rong; Kraft, Nathan J B; Yu, Haiying; Li, Heng

    2015-12-01

    One of the main goals of conservation biology is to understand the factors shaping variation in biodiversity across the planet. This understanding is critical for conservation planners to be able to develop effective conservation strategies. Although many studies have focused on species richness and the protection of rare and endemic species, less attention has been paid to the protection of the phylogenetic dimension of biodiversity. We explored how phylogenetic diversity, species richness, and phylogenetic community structure vary in seed plant communities along an elevational gradient in a relatively understudied high mountain region, the Dulong Valley, in southeastern Tibet, China. As expected, phylogenetic diversity was well correlated with species richness among the elevational bands and among communities. At the community level, evergreen broad-leaved forests had the highest levels of species richness and phylogenetic diversity. Using null model analyses, we found evidence of nonrandom phylogenetic structure across the region. Evergreen broad-leaved forests were phylogenetically overdispersed, whereas other vegetation types tended to be phylogenetically clustered. We suggest that communities with high species richness or overdispersed phylogenetic structure should be a focus for biodiversity conservation within the Dulong Valley because these areas may help maximize the potential of this flora to respond to future global change. In biodiversity hotspots worldwide, we suggest that the phylogenetic structure of a community may serve as a useful measure of phylogenetic diversity in the context of conservation planning.

  13. Ecological Diversity in South American Mammals: Their Geographical Distribution Shows Variable Associations with Phylogenetic Diversity and Does Not Follow the Latitudinal Richness Gradient

    OpenAIRE

    Paula Nilda Fergnani; Adriana Ruggiero

    2015-01-01

    The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR) is informative in terms of ecological diversity (ED, an approximation to functional diversity) and phylogenetic diversity (AvPD) using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans), mid-Cenozoic immigrants (hystrico...

  14. Phylogenetic diversity and biogeography of the Mamiellophyceae lineage of eukaryotic phytoplankton across the oceans.

    Science.gov (United States)

    Monier, Adam; Worden, Alexandra Z; Richards, Thomas A

    2016-08-01

    High-throughput diversity amplicon sequencing of marine microbial samples has revealed that members of the Mamiellophyceae lineage are successful phytoplankton in many oceanic habitats. Indeed, these eukaryotic green algae can dominate the picoplanktonic biomass, however, given the broad expanses of the oceans, their geographical distributions and the phylogenetic diversity of some groups remain poorly characterized. As these algae play a foundational role in marine food webs, it is crucial to assess their global distribution in order to better predict potential changes in abundance and community structure. To this end, we analyzed the V9-18S small subunit rDNA sequences deposited from the Tara Oceans expedition to evaluate the diversity and biogeography of these phytoplankton. Our results show that the phylogenetic composition of Mamiellophyceae communities is in part determined by geographical provenance, and do not appear to be influenced - in the samples recovered - by water depth, at least at the resolution possible with the V9-18S. Phylogenetic classification of Mamiellophyceae sequences revealed that the Dolichomastigales order encompasses more sequence diversity than other orders in this lineage. These results indicate that a large fraction of the Mamiellophyceae diversity has been hitherto overlooked, likely because of a combination of size fraction, sequencing and geographical limitations. PMID:26929141

  15. Trends over time in tree and seedling phylogenetic diversity indicate regional differences in forest biodiversity change.

    Science.gov (United States)

    Potter, Kevin M; Woodall, Christopher W

    2012-03-01

    Changing climate conditions may impact the short-term ability of forest tree species to regenerate in many locations. In the longer term, tree species may be unable to persist in some locations while they become established in new places. Over both time frames, forest tree biodiversity may change in unexpected ways. Using repeated inventory measurements five years apart from more than 7000 forested plots in the eastern United States, we tested three hypotheses: phylogenetic diversity is substantially different from species richness as a measure of biodiversity; forest communities have undergone recent changes in phylogenetic diversity that differ by size class, region, and seed dispersal strategy; and these patterns are consistent with expected early effects of climate change. Specifically, the magnitude of diversity change across broad regions should be greater among seedlings than in trees, should be associated with latitude and elevation, and should be greater among species with high dispersal capacity. Our analyses demonstrated that phylogenetic diversity and species richness are decoupled at small and medium scales and are imperfectly associated at large scales. This suggests that it is appropriate to apply indicators of biodiversity change based on phylogenetic diversity, which account for evolutionary relationships among species and may better represent community functional diversity. Our results also detected broadscale patterns of forest biodiversity change that are consistent with expected early effects of climate change. First, the statistically significant increase over time in seedling diversity in the South suggests that conditions there have become more favorable for the reproduction and dispersal of a wider variety of species, whereas the significant decrease in northern seedling diversity indicates that northern conditions have become less favorable. Second, we found weak correlations between seedling diversity change and latitude in both zones

  16. Phylogenetic Diversity of Nitrogen Fixation Genes in the Symbiotic Microbial Community in the Gut of Diverse Termites

    OpenAIRE

    Ohkuma, Moriya; Noda, Satoko; Kudo, Toshiaki

    1999-01-01

    Nitrogen fixation by the microorganisms in the gut of termites is one of the crucial aspects of symbiosis, since termites usually thrive on a nitrogen-poor diet. The phylogenetic diversity of the nitrogen-fixing organisms within the symbiotic community in the guts of various termite species was investigated without culturing the resident microorganisms. A portion of the dinitrogenase reductase gene (nifH) was directly amplified from DNA extracted from the mixed population in the termite gut. ...

  17. Defining conservation priorities for freshwater fishes according to taxonomic, functional, and phylogenetic diversity

    Science.gov (United States)

    Strecker, A.L.; Olden, J.D.; Whittier, Joanna B.; Paukert, C.P.

    2011-01-01

    To date, the predominant use of systematic conservation planning has been to evaluate and conserve areas of high terrestrial biodiversity. Although studies in freshwater ecosystems have received recent attention, research has rarely considered the potential tradeoffs between protecting different dimensions of biodiversity and the ecological processes that maintain diversity. We provide the first systematic prioritization for freshwaters (focusing on the highly threatened and globally distinct fish fauna of the Lower Colorado River Basin, USA) simultaneously considering scenarios of: taxonomic, functional, and phylogenetic diversity;contemporary threats to biodiversity (including interactions with nonnative species);and future climate change and human population growth. There was 75% congruence between areas of highest conservation priority for different aspects of biodiversity, suggesting that conservation efforts can concurrently achieve strong complementarity among all types of diversity. However, sizable fractions of the landscape were incongruent across conservation priorities for different diversity scenarios, underscoring the importance of considering multiple dimensions of biodiversity and highlighting catchments that contribute disproportionately to taxonomic, functional, and phylogenetic diversity in the region. Regions of projected human population growth were not concordant with conservation priorities;however, higher human population abundance will likely have indirect effects on native biodiversity by increasing demand for water. This will come in direct conflict with projected reductions in precipitation and warmer temperatures, which have substantial overlap with regions of high contemporary diversity. Native and endemic fishes in arid ecosystems are critically endangered by both current and future threats, but our results highlight the use of systematic conservation planning for the optimal allocation of limited resources that incorporates multiple

  18. Solid and Aqueous Geochemical Controls on Phylogenetic Diversity and Abundance of Microbial Biofilms

    Science.gov (United States)

    Jones, A. A.; Bennett, P. C.

    2015-12-01

    In the subsurface, the vast majority of microorganisms are found in biofilms attached to mineral surfaces. The fickle nature of these environments (chemically and physically) likely causes dynamic ecological shifts in these microbial communities. We used laboratory biofilm reactors (inoculated with a diverse subsurface community) to explore the role of mineralogy as part of a microbe-mineral-water ecosystem under variable pressures (mineralogy, pH, carbon, phosphate). Following multivariate analyses, pH was identified as the key physicochemical property associated with variation in both phylogenetic and taxonomic diversity as well as overall community structure (Pbiofilm accumulation (Pbiofilm accumulation (Pbiofilm accumulation (Pbiofilms. All reactors harbored structurally, taxonomically, and phylogenetically distinct microbial communities.

  19. Divergence Times and Phylogenetic Patterns of Sebacinales, a Highly Diverse and Widespread Fungal Lineage

    OpenAIRE

    Garnica, Sigisfredo; Riess, Kai; Max E Schön; Oberwinkler, Franz; Sabrina D Setaro

    2016-01-01

    Patterns of geographic distribution and composition of fungal communities are still poorly understood. Widespread occurrence in terrestrial ecosystems and the unique richness of interactions of Sebacinales with plants make them a target group to study evolutionary events in the light of nutritional lifestyle. We inferred diversity patterns, phylogenetic structures and divergence times of Sebacinales with respect to their nutritional lifestyles by integrating data from fossil-calibrated phylog...

  20. Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity

    OpenAIRE

    Thompson, Patrick L.; Jonathan Davies, T; Andrew Gonzalez

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phyt...

  1. Molecular Phylogenetic Diversity and Spatial Distribution of Bacterial Communities in Cooling Stage during Swine Manure Composting

    OpenAIRE

    Guo, Yan; Zhang, Jinliang; Yan, Yongfeng; Wu, Jian; Zhu, Nengwu; Deng, Changyan

    2015-01-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and subsequent sub-cloning and sequencing were used in this study to analyze the molecular phylogenetic diversity and spatial distribution of bacterial communities in different spatial locations during the cooling stage of composted swine manure. Total microbial DNA was extracted, and bacterial near full-length 16S rRNA genes were subsequently amplified, cloned, RFLP-screened, and sequenced. A total of 420 positive ...

  2. Update of phylogenetic and genetic diversity of Sporothrix schenckii sensu lato.

    Science.gov (United States)

    Rangel-Gamboa, Lucía; Martínez-Hernandez, Fernando; Maravilla, Pablo; Arenas-Guzmán, Roberto; Flisser, Ana

    2016-03-01

    Sporothrix schenckii sensu lato causes subcutaneous mycosis. In this article we analysed its phylogeny and genetic diversity using calmodulin DNA sequences deposited in GenBank database. Population genetics indices were calculated, plus phylogenetic and haplotype network trees were built. Five clades with high values of posterior probability, 47 haplotypes and high diversity in the complex were found. Analysis of partial calmodulin sequences alignment revealed conserved and polymorphic regions that could be used as reference for taxonomic identification. The use of population genetics analysis allowed understanding the phylogenetic proximity of S. schenckii s. str. and S. brasiliensis; scarce genetic flow among them with low migration index and high ancestry coefficient was found. Similarly, S. globosa, S. mexicana and S. pallida sequences showed highly differentiated species with no genetic exchange. The phylogenetic tree suggests that S. mexicana shared a common ancestor with S. pallida; while S. globosa and S. brasiliensis are more related to S. schenckii s. str. and showed less haplotype diversity and restrictions in geographic distribution. In the haplotype network tree S. schenckii s. str. species displayed worldwide distribution without dispersion centres; while S. brasiliensis and S. globosa, exhibited Brazil and Euro-Asia as dispersion centres, respectively. Our data suggest that S. schenckii complex has been submitted to a divergent evolution process, probably due to the pressure of the environment and of the host. In contrast, S. brasiliensis could have been submitted to purifying selection or expansion process.

  3. Opposing Patterns of Seasonal Change in Functional and Phylogenetic Diversity of Tadpole Assemblages

    Science.gov (United States)

    Strauß, Axel; Guilhaumon, François; Randrianiaina, Roger Daniel; Wollenberg Valero, Katharina C.; Vences, Miguel; Glos, Julian

    2016-01-01

    Assemblages that are exposed to recurring temporal environmental changes can show changes in their ecological properties. These can be expressed by differences in diversity and assembly rules. Both can be identified using two measures of diversity: functional (FD) and phylogenetic diversity (PD). Frog communities are understudied in this regard, especially during the tadpole life stage. We utilised tadpole assemblages from Madagascan rainforest streams to test predictions of seasonal changes on diversity and assemblage composition and on diversity measures. From the warm-wet to the cool-dry season, species richness (SR) of tadpole assemblages decreased. Also FD and PD decreased, but FD less and PD more than expected by chance. During the dry season, tadpole assemblages were characterised by functional redundancy (among assemblages—with increasing SR), high FD (compared to a null model), and low PD (phylogenetic clustering; compared to a null model). Although mutually contradictory at first glance, these results indicate competition as tadpole community assembly driving force. This is true during the limiting cool-dry season but not during the more suitable warm-wet season. We thereby show that assembly rules can strongly depend on season, that comparing FD and PD can reveal such forces, that FD and PD are not interchangeable, and that conclusions on assembly rules based on FD alone are critical. PMID:27014867

  4. Phylogenetic diversity does not capture body size variation at risk in the world's mammals

    DEFF Research Database (Denmark)

    Fritz, Susanne A; Purvis, Andy

    2010-01-01

    Mammals contribute to important ecosystem processes and services, but many mammalian species are threatened with extinction. We compare how global patterns in three measures of mammalian diversity--species richness, phylogenetic diversity (PD) and body mass variance (BMV)--would change if all...... currently threatened species were lost. Given that many facets of species' ecology and life history scale predictably with body mass, the BMV in a region roughly reflects the diversity of species' roles within ecosystems and so is a simple proxy for functional diversity (FD). PD is also often considered...... more BMV than under random extinction, while only 11 per cent would lose significantly more PD. Ecosystem consequences of these selective losses may be profound, especially throughout the tropics, but are not captured by PD. This low surrogacy stresses a need for conservation prioritization based...

  5. Revisiting phylogenetic diversity and cryptic species of Cenococcum geophilum sensu lato.

    Science.gov (United States)

    Obase, Keisuke; Douhan, Greg W; Matsuda, Yosuke; Smith, Matthew E

    2016-08-01

    The fungus Cenococcum geophilum Fr. (Dothideomycetes, Ascomycota) is one of the most common ectomycorrhizal fungi in boreal to temperate regions. A series of molecular studies has demonstrated that C. geophilum is monophyletic but a heterogeneous species or a species complex. Here, we revisit the phylogenetic diversity of C. geophilum sensu lato from a regional to intercontinental scale by using new data from Florida (USA) along with existing data in GenBank from Japan, Europe, and North America. The combination of internal transcribed spacer (ITS) ribosomal DNA and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene resolved six well-supported lineages (87-100 % bootstrap values) that are closely related to each other and a seventh lineage that is phylogenetically distinct. A multi-locus analysis (small subunit (SSU), large subunit (LSU), translational elongation factor (TEF), and the largest and second-largest subunits of RNA polymerase II (RPB1 and RPB2)) revealed that the divergent lineage is the sister group to all other known Cenococcum isolates. Isolates of the divergent lineage grow fast on nutrient media and do not form ectomycorrhizas on seedlings of several pine and oak species. Our results indicate that C. geophilum sensu lato includes more phylogenetically distinct cryptic species than have previously been reported. Furthermore, the divergent lineage appears to be a non-mycorrhizal sister group. We discuss the phylogenetic diversity of C. geophilum sensu lato and argue in favor of species recognition based on phylogenetic and ecological information in addition to morphological characteristics. A new genus and species (Pseudocenococcum floridanum gen. et sp. nov.) is proposed to accommodate a divergent and putatively non-mycorrhizal lineage. PMID:26968743

  6. Archaeal Diversity in Biofilm Technologies Applied to Treat Urban and Industrial Wastewater: Recent Advances and Future Prospects

    Directory of Open Access Journals (Sweden)

    Jesús González-López

    2013-09-01

    Full Text Available Biological wastewater treatment (WWT frequently relies on biofilms for the removal of anthropogenic contaminants. The use of inert carrier materials to support biofilm development is often required, although under certain operating conditions microorganisms yield structures called granules, dense aggregates of self-immobilized cells with the characteristics of biofilms maintained in suspension. Molecular techniques have been successfully applied in recent years to identify the prokaryotic communities inhabiting biofilms in WWT plants. Although methanogenic Archaea are widely acknowledged as key players for the degradation of organic matter in anaerobic bioreactors, other biotechnological functions fulfilled by Archaea are less explored, and research on their significance and potential for WWT is largely needed. In addition, the occurrence of biofilms in WWT plants can sometimes be a source of operational problems. This is the case for membrane bioreactors (MBR, an advanced technology that combines conventional biological treatment with membrane filtration, which is strongly limited by biofouling, defined as the undesirable accumulation of microbial biofilms and other materials on membrane surfaces. The prevalence and spatial distribution of archaeal communities in biofilm-based WWT as well as their role in biofouling are reviewed here, in order to illustrate the significance of this prokaryotic cellular lineage in engineered environments devoted to WWT.

  7. A database of phylogenetically atypical genes in archaeal and bacterial genomes, identified using the DarkHorse algorithm

    OpenAIRE

    Allen Eric E; Gaasterland Terry; Podell Sheila

    2008-01-01

    Abstract Background The process of horizontal gene transfer (HGT) is believed to be widespread in Bacteria and Archaea, but little comparative data is available addressing its occurrence in complete microbial genomes. Collection of high-quality, automated HGT prediction data based on phylogenetic evidence has previously been impractical for large numbers of genomes at once, due to prohibitive computational demands. DarkHorse, a recently described statistical method for discovering phylogeneti...

  8. Relative roles of local disturbance, current climate and palaeoclimate in determining phylogenetic and functional diversity in Chinese forests

    Directory of Open Access Journals (Sweden)

    G. Feng

    2013-09-01

    Full Text Available The main processes underlying the generation and maintenance of biodiversity include both local factors such as competition and abiotic filtering and regional forces such as palaeoclimate, speciation and dispersal. While the effects of regional and local drivers on species diversity are increasingly studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese forest plots to data on current and Last Glacial Maximum (LGM climate as well as local disturbance regimes to study their relative roles in determining woody plant phylogenetic and functional diversity in this important hotspot for woody plant diversity. Local disturbance was the best predictor of functional diversity as represented by maximum canopy height (Hmax, probably reflecting the dominant role of competition for light in determining the forest Hmax structure. In contrast, the LGM-present anomaly in temperature was the factor with the strongest explanatory power for phylogenetic diversity, with modern climate also important. Hence, local contemporary and regional historical factors have highly contrasting importance for the geographic patterns of the functional and phylogenetic aspects of Chinese forest woody plant diversity. Importantly, contemporary factors are of overriding importance for functional diversity, while palaeoclimate has left a strong signature in the phylogenetic diversity patterns.

  9. Novel viral genomes identified from six metagenomes reveal wide distribution of archaeal viruses and high viral diversity in terrestrial hot springs.

    Science.gov (United States)

    Gudbergsdóttir, Sóley Ruth; Menzel, Peter; Krogh, Anders; Young, Mark; Peng, Xu

    2016-03-01

    Limited by culture-dependent methods the number of viruses identified from thermophilic Archaea and Bacteria is still very small. In this study we retrieved viral sequences from six hot spring metagenomes isolated worldwide, revealing a wide distribution of four archaeal viral families, Ampullaviridae, Bicaudaviridae, Lipothrixviridae and Rudiviridae. Importantly, we identified 10 complete or near complete viral genomes allowing, for the first time, an assessment of genome conservation and evolution of the Ampullaviridae family as well as Sulfolobus Monocaudavirus 1 (SMV1)-related viruses. Among the novel genomes, one belongs to a putative thermophilic virus infecting the bacterium Hydrogenobaculum, for which no virus has been reported in the literature. Moreover, a high viral diversity was observed in the metagenomes, especially among the Lipothrixviridae, as indicated by the large number of unique contigs and the lack of a completely assembled genome for this family. This is further supported by the large number of novel genes in the complete and partial genomes showing no sequence similarities to public databases. CRISPR analysis revealed hundreds of novel CRISPR loci and thousands of novel CRISPR spacers from each metagenome, reinforcing the notion of high viral diversity in the thermal environment.

  10. New high through put approach to study ancient microbial phylogenetic diversity in permafrost

    Science.gov (United States)

    Spirina, E.; Cole, J.; Chai, B.; Gilichinksy, D.; Tiedje, J.

    2003-04-01

    The study of microbial diversity in the deep ancient permafrost can help to answer many questions: (1) what kind of mechanisms keeps microbial cells alive, (2) how many of phylogenetic groups exist in situ and never had been cultivated, (3) what is the difference between modern and ancient microorganisms? From this point, distinct environments were examined: Arctic and Antarctic modern soil and permafrost. 16S rDNA genes were amplified from genomic DNA extracted from both original frozen samples and the same samples incubated at 10oC for 8 weeks under both aerobic and anaerobic conditions to determine those capable to grow. High throughput DNA sequencing was performed on the cloned PCR products to obtain partial 16S rDNA gene sequences. The unique script was written to automatically compare over 2,000 partial sequences with those rrn sequences in the Ribosomal Database Project (RDP) release 8.1 using the SEQUENCE MATCH. Sequences were grouped into categories from the RDPs phylogenetic hierarchy based on the closest database matches. Investigation revealed significant microbial diversity; two phylogenetic groups were predominant in all samples: Proteobacteria and Gram Positive Bacteria. Microbial community composition within those groups is different from sample to sample. However, similar genera, such as Arthrobacter, Bacillus, Citrobacter, Caulobacter, Comamonas, Flavobacterium, Nocardioides, Pseudomonas, Rhodocyclus, Rhodococcus, Sphingobacterium, Sphingomonas, Streptococcus, Terrabacter appeared in both polar regions. The greatest microbial diversity was detected in Arctic surface samples. According to RDPs phylogenetic hierarchy those organisms are related to Proteobacteria_SD, Gram Positive Bacteria_SD, Leptospirillum-Nitrospira, Nitrospina_SD, Flexibacter-Cytophaga-Bacteroides, Planctomyces and Relatives. Both the aerobic and anaerobic low temperatures soil incubation yielded some microbes not detected in the original samples. It should be possible, using

  11. Variation in sulfide tolerance of photosystem II in phylogenetically diverse cyanobacteria from sulfidic habitats

    Science.gov (United States)

    Miller, Scott R.; Bebout, Brad M.

    2004-01-01

    Physiological and molecular phylogenetic approaches were used to investigate variation among 12 cyanobacterial strains in their tolerance of sulfide, an inhibitor of oxygenic photosynthesis. Cyanobacteria from sulfidic habitats were found to be phylogenetically diverse and exhibited an approximately 50-fold variation in photosystem II performance in the presence of sulfide. Whereas the degree of tolerance was positively correlated with sulfide levels in the environment, a strain's phenotype could not be predicted from the tolerance of its closest relatives. These observations suggest that sulfide tolerance is a dynamic trait primarily shaped by environmental variation. Despite differences in absolute tolerance, similarities among strains in the effects of sulfide on chlorophyll fluorescence induction indicated a common mode of toxicity. Based on similarities with treatments known to disrupt the oxygen-evolving complex, it was concluded that sulfide toxicity resulted from inhibition of the donor side of photosystem II.

  12. Phylogenetic and functional diversity of nitrogen cycling microbes in coastal sediments

    Directory of Open Access Journals (Sweden)

    Xiaoli Zhang

    2013-07-01

    Full Text Available The coastal zone contains diverse habitats which are usually characterized by strong environmental gradients (e.g. salinity, nutrients and pollutants. This makes the coastal zone an ideal experimental laboratory for describing microbial diversity and testing hypotheses on community structure, function and control. Coastal sediment is of significance in nutrient regeneration and transformation involving different assemblages of microbes in the nitrogen cycle. This review focuses on 16S rRNA gene-based phylogenetic diversity and the key enzyme encoding gene-based (e.g. nifH, amoA, narG, nirS, nirK, nosZ, nrfA, hzo and hzs functional diversity of nitrogen fixing, ammonia oxidizing and anaerobic ammonia oxidation (Anammox bacteria as well as bacteria and fungi involved in denitrification and dissimilatory nitrate reduction to ammonium (DNRA. Characteristics of community composition and diversity of nitrogen cycling microbes in different habitats (e.g. estuarine, intertidal flats, seagrass or seaweed beds, mangroves, salt marsh, coral reefs, and shallow seas, and their spatiotemporal patterns under benthic pollution or bioturbation are reviewed. Future directions for a better understanding diversity of nitrogen cycling microbes are suggested, such as culture methods and technologies, and single-cell sequencing, etc.

  13. Phylogenetically Diverse Aerobic Anoxygenic Phototrophic Bacteria Isolated from Epilithic Biofilms in Tama River, Japan

    Science.gov (United States)

    Hirose, Setsuko; Matsuura, Katsumi; Haruta, Shin

    2016-01-01

    The diversity of aerobic anoxygenic phototrophic (AAP) bacteria in freshwater environments, particularly in rivers, has not been examined in as much detail as in ocean environments. In the present study, we investigated the phylogenetic and physiological diversities of AAP bacteria in biofilms that developed on submerged stones in a freshwater river using culture methods. The biofilms collected were homogenized and inoculated on solid media and incubated aerobically in the dark. Sixty-eight red-, pink-, yellow-, orange-, or brown-colored colonies were isolated, and, of these, 28 isolates contained the photosynthetic pigment, bacteriochlorophyll (BChl) a. Phylogenetic analyses based on 16S rRNA gene sequences showed that the isolates were classified into 14 groups in 8 operational taxonomic units (OTUs) and distributed in the orders Rhodospirillales, Rhodobacterales, and Sphingomonadales of Alphaproteobacteria and in Betaproteobacteria. Physiological analyses confirmed that none of the representative isolates from any of the groups grew under anaerobic phototrophic conditions. Seven isolates in 4 OTUs showed a 16S rRNA gene sequence identity of 98.0% or less with any established species, suggesting the presence of previously undescribed species of AAP bacteria. Six isolates in 2 other OTUs had the closest relatives, which have not been reported to be AAP bacteria. Physiological comparisons among the isolates revealed differences in preferences for nutrient concentrations, BChl contents, and light-harvesting proteins. These results suggest that diverse and previously unknown AAP bacteria inhabit river biofilms. PMID:27453124

  14. Reappraisal of phylogenetic status and genetic diversity analysis of Asian population of Lentinula edodes

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Phylogenetic relationship within the Lentinula genus is constructed based on the sequenced ITS fragments of the 60Chinese wild L. edodes isolates and the sequence data of 48 isolates of different species from other districts downloaded from the GenBank. The 108 isolates of Lentinula genus are divided into two branches and seven groups, one branch and two groups in the New World, and the other branch and five groups in the Old World, and the isolates clustering of different groups corresponds obviously with the classification of the morphological species. Asian isolates are partitioned in group Ⅰ and Ⅴ, two of the five groups of the Old World,by which the germplasm resources status represented is of great importance shown by the phylogenetic analysis. Group V which fills up the blank of geographic distribution has become one of the mainstream groups with an increased isolate number, while group Ⅰ has a tendency to dissimilate into two subgroups (Ia and Ib) with a huge isolate quantity and a coverage of most tested districts, suggesting that China (or Asia) is an important genetic diversity center of the natural population of Lentinula genus. Genetic analysis of Asian isolates based on groups Ia, Ib and group V indicates that the diversity of the east coastal-land, northwestern highland and southwestern China and Himalayas districts is the most plentiful, which is the three priorities in diversity protection of Asian Lentinula population.

  15. Structure and phylogenetic diversity of post-fire ectomycorrhizal communities of maritime pine.

    Science.gov (United States)

    Rincón, A; Santamaría, B P; Ocaña, L; Verdú, M

    2014-02-01

    Environmental disturbances define the diversity and assemblage of species, affecting the functioning of ecosystems. Fire is a major disturbance of Mediterranean pine forests. Pines are highly dependent on the ectomycorrhizal (EM) fungal symbiosis, which is critical for tree recruitment under primary succession. To determine the effects of time since fire on the structure and recovery of EM fungal communities, we surveyed the young Pinus pinaster regenerate in three sites differing in the elapsed time after the last fire event. Pine roots were collected, and EM fungi characterized by sequencing the internal transcribed spacer (ITS) and the large subunit (LSU) regions of the nuclear ribosomal (nr)-DNA. The effects of the elapsed time after fire on the EM community structure (richness, presence/absence of fungi, phylogenetic diversity) and on soil properties were analysed.Fungal richness decreased with the elapsed time since the fire; although, the phylogenetic diversity of the EM community increased. Soil properties were different depending on the elapsed time after fire and particularly, the organic matter, carbon-to-nitrogen (C/N) ratio, nitrogen and iron significantly correlated with the assemblage of fungal species. Ascomycetes, particularly Tuberaceae and Pezizales, were significantly over-represented on saplings in the burned site. On seedlings, a significant over-representation of Rhizopogonaceae and Atheliaceae was observed in the most recently burned site, while other fungi (i.e. Cortinariaceae) were significantly under-represented. Our results are consistent with the hypothesis that fire can act as a selective agent by printing a phylogenetic signal on the EM fungal communities associated with naturally regenerated pines, pointing out to some groups as potential fire-adapted fungi. PMID:23955264

  16. The UCSC Archaeal Genome Browser: 2012 update.

    Science.gov (United States)

    Chan, Patricia P; Holmes, Andrew D; Smith, Andrew M; Tran, Danny; Lowe, Todd M

    2012-01-01

    The UCSC Archaeal Genome Browser (http://archaea.ucsc.edu) offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of the vertebrate UCSC Genome Browser, but also integrates archaeal and bacterial-specific tracks with a few graphic display enhancements. The browser currently contains 115 archaeal genomes, plus 31 genomes of viruses known to infect archaea. Some of the recently developed or enhanced tracks visualize data from published high-throughput RNA-sequencing studies, the NCBI Conserved Domain Database, sequences from pre-genome sequencing studies, predicted gene boundaries from three different protein gene prediction algorithms, tRNAscan-SE gene predictions with RNA secondary structures and CRISPR locus predictions. We have also developed a companion resource, the Archaeal COG Browser, to provide better search and display of arCOG gene function classifications, including their phylogenetic distribution among available archaeal genomes.

  17. Diversity dynamics in Nymphalidae butterflies: effect of phylogenetic uncertainty on diversification rate shift estimates.

    Science.gov (United States)

    Peña, Carlos; Espeland, Marianne

    2015-01-01

    The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC) is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE) and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution.

  18. Diversity dynamics in Nymphalidae butterflies: effect of phylogenetic uncertainty on diversification rate shift estimates.

    Directory of Open Access Journals (Sweden)

    Carlos Peña

    Full Text Available The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution.

  19. Divergence Times and Phylogenetic Patterns of Sebacinales, a Highly Diverse and Widespread Fungal Lineage.

    Directory of Open Access Journals (Sweden)

    Sigisfredo Garnica

    Full Text Available Patterns of geographic distribution and composition of fungal communities are still poorly understood. Widespread occurrence in terrestrial ecosystems and the unique richness of interactions of Sebacinales with plants make them a target group to study evolutionary events in the light of nutritional lifestyle. We inferred diversity patterns, phylogenetic structures and divergence times of Sebacinales with respect to their nutritional lifestyles by integrating data from fossil-calibrated phylogenetic analyses. Relaxed molecular clock analyses indicated that Sebacinales originated late Permian within Basidiomycota, and their split into Sebacinaceae and Serendipitaceae nom. prov. likely occurred during the late Jurassic and the early Cretaceous, coinciding with major diversifications of land plants. In Sebacinaceae, diversification of species with ectomycorrhizal lifestyle presumably started during the Paleocene. Lineage radiations of the core group of ericoid and cavendishioid mycorrhizal Sebacinales started probably in the Eocene, coinciding with diversification events of their hosts. The diversification of Sebacinales with jungermannioid interactions started during the Oligocene, and occurred much later than the diversification of their hosts. Sebacinales communities associated either with ectomycorrhizal plants, achlorophyllous orchids, ericoid and cavendishioid Ericaceae or liverworts were phylogenetically clustered and globally distributed. Major Sebacinales lineage diversifications started after the continents had drifted apart. We also briefly discuss dispersal patterns of extant Sebacinales.

  20. Divergence Times and Phylogenetic Patterns of Sebacinales, a Highly Diverse and Widespread Fungal Lineage.

    Science.gov (United States)

    Garnica, Sigisfredo; Riess, Kai; Schön, Max E; Oberwinkler, Franz; Setaro, Sabrina D

    2016-01-01

    Patterns of geographic distribution and composition of fungal communities are still poorly understood. Widespread occurrence in terrestrial ecosystems and the unique richness of interactions of Sebacinales with plants make them a target group to study evolutionary events in the light of nutritional lifestyle. We inferred diversity patterns, phylogenetic structures and divergence times of Sebacinales with respect to their nutritional lifestyles by integrating data from fossil-calibrated phylogenetic analyses. Relaxed molecular clock analyses indicated that Sebacinales originated late Permian within Basidiomycota, and their split into Sebacinaceae and Serendipitaceae nom. prov. likely occurred during the late Jurassic and the early Cretaceous, coinciding with major diversifications of land plants. In Sebacinaceae, diversification of species with ectomycorrhizal lifestyle presumably started during the Paleocene. Lineage radiations of the core group of ericoid and cavendishioid mycorrhizal Sebacinales started probably in the Eocene, coinciding with diversification events of their hosts. The diversification of Sebacinales with jungermannioid interactions started during the Oligocene, and occurred much later than the diversification of their hosts. Sebacinales communities associated either with ectomycorrhizal plants, achlorophyllous orchids, ericoid and cavendishioid Ericaceae or liverworts were phylogenetically clustered and globally distributed. Major Sebacinales lineage diversifications started after the continents had drifted apart. We also briefly discuss dispersal patterns of extant Sebacinales. PMID:26938104

  1. The Role of the Phylogenetic Diversity Measure, PD, in Bio-informatics: Getting the Definition Right

    Directory of Open Access Journals (Sweden)

    Daniel P. Faith

    2006-01-01

    Full Text Available A recent paper in this journal (Faith and Baker, 2006 described bio-informatics challenges in the application of the PD (phylogenetic diversity measure of Faith (1992a, and highlighted the use of the root of the phylogenetic tree, as implied by the original definition of PD. A response paper (Crozier et al. 2006 stated that 1 the (Faith, 1992a PD definition did not include the use of the root of the tree, and 2 Moritz and Faith (1998 changed the PD definition to include the root. Both characterizations are here refuted. Examples from Faith (1992a,b document the link from the definition to the use of the root of the overall tree, and a survey of papers over the past 15 years by Faith and colleagues demonstrate that the stated PD definition has remained the same as that in the original 1992 study. PD’s estimation of biodiversity at the level of “feature diversity” is seen to have provided the original rationale for the measure’s consideration of the root of the phylogenetic tree.

  2. Microbial communities in salt lakes: Phylogenetic diversity, metabolic diversity, and in situ activities

    OpenAIRE

    Oren, Aharon; Baxter, Bonnie K; Bart C Weimer

    2009-01-01

    A roundtable discussion was held on Monday, 12 May 2008, following the sessions on 'Microorganisms in Hypersaline Environments' at the 10th Conference on Salt Lake Research & 2008 FRIENDS of Great Salt Lake Issues Forum, University of Utah, Salt Lake City. Among the aspects discussed were: 1. The gap between our knowledge of the microorganisms isolated in culture and the true microbial diversity as apparent when using culture-independent techniques, in most cases based on the characterization...

  3. Dengue in China: Comprehensive Phylogenetic Evaluation Reveals Evidence of Endemicity and Complex Genetic Diversity.

    Science.gov (United States)

    Chen, Rubing; Han, Guan-Zhu

    2016-01-01

    Despite the increasing threat of dengue outbreaks in China, it is still considered as an imported disease and its introduction and/or circulation patterns remain obscure. On the basis of the most extensive phylogenetic analysis to date, we showed highly complex genetic diversity of dengue viruses (DENVs) in south China with up to 20 different clades/lineages from multiple serotypes co-circulating in the same year. Despite that most of these clades/lineages were resulted from imported cases, evidence of local persistence of DENV serotype 1 (DENV-1) was observed, indicating its potential endemicity in Guangdong province. This study, therefore, provided an overview of DENV genetic diversity and evolutionary dynamics in China, which will be useful for developing policies to prevent and control future dengue outbreaks in China. PMID:26458780

  4. Phylogenetic niche conservatism explains an inverse latitudinal diversity gradient in freshwater arthropods

    Science.gov (United States)

    Morinière, Jérôme; van Dam, Matthew H.; Hawlitschek, Oliver; Bergsten, Johannes; Michat, Mariano C.; Hendrich, Lars; Ribera, Ignacio; Toussaint, Emmanuel F. A.; Balke, Michael

    2016-05-01

    The underlying mechanisms responsible for the general increase in species richness from temperate regions to the tropics remain equivocal. Many hypotheses have been proposed to explain this astonishing pattern but additional empirical studies are needed to shed light on the drivers at work. Here we reconstruct the evolutionary history of the cosmopolitan diving beetle subfamily Colymbetinae, the majority of which are found in the Northern hemisphere, hence exhibiting an inversed latitudinal diversity gradient. We reconstructed a dated phylogeny using 12 genes, to investigate the biogeographical history and diversification dynamics in the Colymbetinae. We aimed to identify the role that phylogenetic niche conservatism plays in the inversed diversification pattern seen in this group. Our results suggest that Colymbetinae originated in temperate climates, which supports the hypothesis that their distribution is the result of an ancestral adaptation to temperate environmental conditions rather than tropical origins, and that temperate niche conservatism can generate and/or maintain inverse latitudinal diversity gradients.

  5. An integrated study reveals diverse methanogens, Thaumarchaeota, and yet-uncultivated archaeal lineages in Armenian hot springs.

    Science.gov (United States)

    Hedlund, Brian P; Dodsworth, Jeremy A; Cole, Jessica K; Panosyan, Hovik H

    2013-07-01

    Culture-independent and enrichment techniques, with an emphasis on members of the Archaea, were used to determine the composition and structure of microbial communities inhabiting microbial mats in the source pools of two geothermal springs near the towns of Arzakan and Jermuk in Armenia. Amplification of small-subunit rRNA genes using "universal" primers followed by pyrosequencing (pyrotags) revealed highly diverse microbial communities in both springs, with >99 % of pyrosequences corresponding to members of the domain Bacteria. The spring in Arzakan was colonized by a photosynthetic mat dominated by Cyanobacteria, in addition to Proteobacteria, Bacteroidetes, Chloroflexi, Spirochaeta and a diversity of other Bacteria. The spring in Jermuk was colonized by phylotypes related to sulfur, iron, and hydrogen chemolithotrophs in the Betaproteobacteria and Epsilonproteobacteria, along with a diversity of other Bacteria. Analysis of near full-length small subunit rRNA genes amplified using Archaea-specific primers showed that both springs are inhabited by a diversity of methanogens, including Methanomicrobiales and Methanosarcinales and relatives of Methanomassiliicoccus luminyensis, close relatives of the ammonia-oxidizing archaeon (AOA) "Candidatus Nitrososphaera gargensis", and the yet-uncultivated Miscellaneous Crenarchaeotal Group and Deep Hydrothermal Vent Crenarchaeota group 1. Methanogenic enrichments confirmed the predicted physiological diversity, revealing methylotrophic, acetoclastic, and hydrogenotrophic methanogenesis at 45 and 55 °C, but not 65 °C. This is one of only a few studies combining cultivation-independent and -dependent approaches to study archaea in moderate-temperature (37-73 °C) terrestrial geothermal environments and suggests important roles for methanogenic archaea and AOA in the carbon and nitrogen biogeochemical cycles in these environments. PMID:23632917

  6. An integrated study reveals diverse methanogens, Thaumarchaeota, and yet-uncultivated archaeal lineages in Armenian hot springs.

    Science.gov (United States)

    Hedlund, Brian P; Dodsworth, Jeremy A; Cole, Jessica K; Panosyan, Hovik H

    2013-07-01

    Culture-independent and enrichment techniques, with an emphasis on members of the Archaea, were used to determine the composition and structure of microbial communities inhabiting microbial mats in the source pools of two geothermal springs near the towns of Arzakan and Jermuk in Armenia. Amplification of small-subunit rRNA genes using "universal" primers followed by pyrosequencing (pyrotags) revealed highly diverse microbial communities in both springs, with >99 % of pyrosequences corresponding to members of the domain Bacteria. The spring in Arzakan was colonized by a photosynthetic mat dominated by Cyanobacteria, in addition to Proteobacteria, Bacteroidetes, Chloroflexi, Spirochaeta and a diversity of other Bacteria. The spring in Jermuk was colonized by phylotypes related to sulfur, iron, and hydrogen chemolithotrophs in the Betaproteobacteria and Epsilonproteobacteria, along with a diversity of other Bacteria. Analysis of near full-length small subunit rRNA genes amplified using Archaea-specific primers showed that both springs are inhabited by a diversity of methanogens, including Methanomicrobiales and Methanosarcinales and relatives of Methanomassiliicoccus luminyensis, close relatives of the ammonia-oxidizing archaeon (AOA) "Candidatus Nitrososphaera gargensis", and the yet-uncultivated Miscellaneous Crenarchaeotal Group and Deep Hydrothermal Vent Crenarchaeota group 1. Methanogenic enrichments confirmed the predicted physiological diversity, revealing methylotrophic, acetoclastic, and hydrogenotrophic methanogenesis at 45 and 55 °C, but not 65 °C. This is one of only a few studies combining cultivation-independent and -dependent approaches to study archaea in moderate-temperature (37-73 °C) terrestrial geothermal environments and suggests important roles for methanogenic archaea and AOA in the carbon and nitrogen biogeochemical cycles in these environments.

  7. Pyrosequencing of mcrA and archaeal 16S rRNA genes reveals diversity and substrate preferences of methanogen communities in anaerobic digesters.

    Science.gov (United States)

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng; Lee, Patrick K H

    2015-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield.

  8. Virulence Genes, Genetic Diversity, Antimicrobial Susceptibility and Phylogenetic Background of Escherichia coli Isolates

    Directory of Open Access Journals (Sweden)

    Abdi

    2015-08-01

    Full Text Available Background The epidemiology of Uropathogenic Escherichia coli (UPEC in urban and rural communities in Iran was never investigated prior to this study. Objectives The aims of this study were to detect the frequency of virulence genes and determine the antimicrobial susceptibility and phylogenetic background of Escherichia coli isolates collected from urban and rural communities. Materials and Methods A total of 100 E. coli isolates were collected from urine samples of patients with urinary tract infections (UTIs residing in two different locations, and confirmed by current biochemical tests. The phylogenetic groups were determined by the triplex-polymerase chain reaction (PCR method, and multiplex PCRs were used to detect eight Vf genes (fimH, iucD, irp2, hlyA, ompT, iha, iroN, and cnf1. The susceptibility profile of E. coli isolates was determined by the disk diffusion method. Results Ninety-five percent of UPEC showed at least one of the virulence genes, the most prevalent being fimH (95%, followed by irp2 (89%, iucD (69%, ompT (67%, iroN (29%, and iha (29%. The various combinations of detected genes were designated as virulence patterns. Phylogenetic groups, B2 (55% and D (22%, comprised the majority of isolated strains. Phenotypic tests showed that 92%, 74% and 71% of the isolates were resistant to ampicillin, ceftizoxime and cefixime, respectively. Conclusions These findings indicate that the UPEC isolates had eight virulence factors with high frequencies. Moreover, these results suggest a direct connection between virulence factors, gene diversity, phylogenetic background, and antimicrobial resistance in UPEC isolates.

  9. Morphological, phylogenetic and physiological diversity of cyanobacteria in the hot springs of Zerka Ma

    Directory of Open Access Journals (Sweden)

    Aharon Oren

    2009-12-01

    Full Text Available The freshwater thermal springs of Zerka Ma'in, located in Jordan in the mountains of Moab east of the Dead Sea, are densely inhabited by cyanobacteria up to the highest temperature of 63°C. We have investigated the cyanobacterial diversity of these springs and their outflow channels by microscopic examination, culture-dependent and culture-independent phylogenetic analysis, and by physiological studies of selected isolates of special interest. Both unicellular and filamentous types of cyanobacteria are present, and we identified morphological types such as Thermosynechococcus, Chroogloeocystis, Fischerella (Mastigocladus, Scytonema (occurring as large masses at lower temperatures, and others. Although morphologically similar cyanobacteria have been identified in hot springs world-wide, the Zerka Ma’in strains were phylogenetically distinct based on 16S rRNA gene sequence analysis. Considerable diversity was detected also in the gene sequences of nifH (nitrogenase reductase, encoding one of the key enzymes involved in nitrogen fixation. Nitrogen fixation in a Mastigocladus isolate obtained from the springs was investigated in further depth. The heterocystous strain could fix nitrogen (as assayed by acetylene reduction at tem peratures up to 53°C.

  10. Increasing land use drives changes in plant phylogenetic diversity and prevalence of specialists

    Science.gov (United States)

    Vamosi, Jana C.

    2016-01-01

    Increased human land use has resulted in the increased homogenization of biodiversity between sites, yet we lack sufficient indicators to predict which species decline and the consequence of their potential loss on ecosystem services. We used comparative phylogenetic analysis to (1) characterize how increasing conversion of forest and grasslands to grazing pasturelands changes plant diversity and composition; (2) examine how changes in land use relate to declines in functional trait diversity; and (3) specifically investigate how these changes in plant composition affect the prevalence of zygomorphy and the possible consequences that these changes may have on pollinator functional groups. As predicted, we found that the conversion to grazing pasturelands negatively impacted species richness and phylogenetic composition. Clades with significantly more represented taxa in grasslands (GL) were genera with a high representation of agricultural weeds, while the composition was biased towards clades of subalpine herbaceous wildflowers in Mixed Forest (MF). Changes in community composition and structure had strong effects on the prevalence of zygomorphic species likely driven by nitrogen-fixing abilities of certain clades with zygomorphic flowers (e.g., Fabaceae). Land conversion can thus have unexpected impacts on trait distributions relevant for the functioning of the community in other capacities (e.g., cascading effects to other trophic levels (i.e., pollinators). Finally, the combination of traits represented by the current composition of species in GL and MF might enhance the diagnostic value of productivity and ecosystem processes in the most eroded ecosystems. PMID:26966669

  11. Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

    Science.gov (United States)

    Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

    2004-01-01

    We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

  12. Relative roles of local disturbance, current climate and palaeoclimate in determining phylogenetic and functional diversity in Chinese forests

    OpenAIRE

    Feng, G.; Mi, X. C.; P. K. Bøcher; Mao, L. F.; Sandel, B.; Cao, M.; Ye, W. H.; Z. Q. Hao; H. D. Gong; Zhang, Y.T.; Zhao, X. H.; Jin, G. Z.; Ma, K. P.; J.-C. Svenning

    2013-01-01

    The main processes underlying the generation and maintenance of biodiversity include both local factors such as competition and abiotic filtering and regional forces such as palaeoclimate, speciation and dispersal. While the effects of regional and local drivers on species diversity are increasingly studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese forest plots to dat...

  13. Relative roles of local disturbance, current climate and paleoclimate in determining phylogenetic and functional diversity in Chinese forests

    OpenAIRE

    Feng, G.; Mi, X. C.; P. K. Bøcher; Mao, L. F.; Sandel, B.; Cao, M.; Ye, W. H.; Z. Q. Hao; H. D. Gong; Zhang, Y.T.; Zhao, X. H.; Jin, G. Z.; Ma, K. P.; J.-C. Svenning

    2014-01-01

    The main processes underlying the generation and maintenance of biodiversity include both local factors such as competition and abiotic filtering and regional forces such as paleoclimate, speciation and dispersal. While the effects of regional and local drivers on species diversity are increasingly studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese fo...

  14. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Directory of Open Access Journals (Sweden)

    Marion G Howard

    Full Text Available Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ, Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD measures as well as species richness (SR for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD. Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness

  15. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia

    Science.gov (United States)

    Howard, Marion G.; McDonald, William J. F.; Forster, Paul I.; Kress, W. John; Erickson, David; Faith, Daniel P.; Shapcott, Alison

    2016-01-01

    Australia’s Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ), Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD) measures as well as species richness (SR) for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD). Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness and higher than

  16. Patterns of Phylogenetic Diversity of Subtropical Rainforest of the Great Sandy Region, Australia Indicate Long Term Climatic Refugia.

    Science.gov (United States)

    Howard, Marion G; McDonald, William J F; Forster, Paul I; Kress, W John; Erickson, David; Faith, Daniel P; Shapcott, Alison

    2016-01-01

    Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ), Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD) measures as well as species richness (SR) for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD). Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness and higher than

  17. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm.

    Science.gov (United States)

    Tupinambá, Daiva Domenech; Cantão, Maurício Egídio; Costa, Ohana Yonara Assis; Bergmann, Jessica Carvalho; Kruger, Ricardo Henrique; Kyaw, Cynthia Maria; Barreto, Cristine Chaves; Quirino, Betania Ferraz

    2016-01-01

    This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7%) were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers) were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest) and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area). More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied.

  18. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm

    Science.gov (United States)

    Tupinambá, Daiva Domenech; Cantão, Maurício Egídio; Costa, Ohana Yonara Assis; Bergmann, Jessica Carvalho; Kruger, Ricardo Henrique; Kyaw, Cynthia Maria; Barreto, Cristine Chaves; Quirino, Betania Ferraz

    2016-01-01

    This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7%) were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers) were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest) and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area). More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied. PMID:27006640

  19. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm

    Directory of Open Access Journals (Sweden)

    Daiva Domenech Tupinambá

    2016-01-01

    Full Text Available This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7% were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area. More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied.

  20. Survival and transfer ability of phylogenetically diverse bacterial endosymbionts in environmental Acanthamoeba isolates.

    Science.gov (United States)

    Matsuo, Junji; Kawaguchi, Kouhei; Nakamura, Shinji; Hayashi, Yasuhiro; Yoshida, Mitsutaka; Takahashi, Kaori; Mizutani, Yoshihiko; Yao, Takashi; Yamaguchi, Hiroyuki

    2010-08-01

    Obligate intracellular bacteria are commonly found as endosymbionts of acanthamoebae; however, their survival in and ability to transfer to amoebae are currently uncharacterized. In this study, six bacterial endosymbionts, found in five environmental Acanthamoeba isolates (S13, R18, S23, S31, S40) from different locations of Sapporo city, Japan, were characterized. Phylogenetic analysis revealed that three bacterial endosymbionts (eS23, eS31, eS40a) belonged to α- and β-Proteobacteria phyla and the remaining endosymbionts (eS13, eR18, eS40b) belonged to the order Chlamydiales. The Acanthamoeba isolate (S40) contained two phylogenetically different bacterial endosymbionts (eS40a, eS40b). Fluorescent in situ hybridization analysis showed that all bacterial endosymbionts were diffusely localized within amoebae. Transmission electron microscopy also showed that the endosymbionts were rod-shaped (eS23, eS31, eS40a) or sphere- or crescent-shaped (eS13, eR18, eS40b). No successful culture of these bacteria was achieved using conventional culture methods, but the viability of endosymbionts was confirmed by live/dead staining and RT-PCR methods. However, endosymbionts (except eR18) derived from original host cells lost the ability to be transferred to another Acanthamoebae strains [ATCC strain (C3), environmental strains (S14, R23, S24)]. Thus, our data demonstrate that phylogenetically diverse bacterial endosymbionts found in amoebae maintain a stable interaction with amoebae, but the transferability is limited.

  1. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008

    Directory of Open Access Journals (Sweden)

    Seon Young Choi

    2016-03-01

    Full Text Available An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997. Nontoxigenic (CTX− V. cholerae El Tor dominated toxigenic (CTX+ strains (2001 to 2003, but V. cholerae CTX+ variant El Tor was isolated during 2004 to 2008, outcompeting CTX−V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX+ El Tor, two were CTX− El Tor, and the remaining strain was a CTX+ classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX− isolate is ancestral to the 6th and 7th pandemic CTX+V. cholerae isolates. The other CTX− isolate joined with CTX− non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX+ isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX+ El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX+ El Tor isolate contained West African-South American (WASA recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity.

  2. Molecular phylogenetics, species diversity, and biogeography of the Andean lizards of the genus Proctoporus (Squamata: Gymnophthalmidae).

    Science.gov (United States)

    Goicoechea, Noemí; Padial, José M; Chaparro, Juan C; Castroviejo-Fisher, Santiago; De la Riva, Ignacio

    2012-12-01

    The family Gymnophthalmidae comprises ca. 220 described species of Neotropical lizards distributed from southern Mexico to Argentina. It includes 36 genera, among them Proctoporus, which contains six currently recognized species occurring across the yungas forests and wet montane grasslands of the Amazonian versant of the Andes from central Peru to central Bolivia. Here, we investigate the phylogenetic relationships and species limits of Proctoporus and closely related taxa by analyzing 2121 base pairs of mitochondrial (12S, 16S, and ND4) and nuclear (c-mos) genes. Our taxon sampling of 92 terminals includes all currently recognized species of Proctoporus and 15 additional species representing the most closely related groups to the genus. Maximum parsimony, maximum likelihood and Bayesian phylogenetic analyses recovered a congruent, fully resolved, and strongly supported hypothesis of relationships that challenges previous phylogenetic hypotheses and classifications, and biogeographic scenarios. Our main results are: (i) discovery of a strongly supported clade that includes all species of Proctoporus and within which are nested the monotypic Opipeuter xestus (a genus that we consider a junior synonym of Proctoporus), and two species of Euspondylus, that are therefore transferred to Proctoporus; (ii) the paraphyly of Proctoporus bolivianus with respect to P. subsolanus, which is proposed as a junior synonym of P. bolivianus; (iii) the detection of seven divergent and reciprocally monophyletic lineages (five of them previously assigned to P. bolivianus) that are considered confirmed candidate species, which implies that more candidate species are awaiting formal description and naming than currently recognized species in the genus; (iv) rejection of the hypothesis that Proctoporus diversified following a south to north pattern parallel to the elevation of the Andes; (v) species diversity in Proctoporus is the result of in situ diversification through vicariance in

  3. Exploring the determinants of phylogenetic diversity and assemblage structure in conifers across temporal, spatial, and taxonomic scales

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Borchsenius, Finn; Sandel, Brody Steven;

    Composition, diversity, structure and function of modern plant communities are strongly related to the current environment, but they may also depend on past eco-evolutionary dynamics. For example, climate change can exert a strong influence on lineage diversification and niche evolution, and thus...... have long-lasting effects on species pools and local assemblages. Integrating such long-term dynamics with short-term ecological processes in a common analytical framework is a major challenge of integrative biodiversity science. Phylogenetically informed diversity measures and palaeo...... and economic importance. They are better studied than most other globally distributed groups of forest trees, allowing integrative studies with high phylogenetic and spatial resolution. We analyse phylogenetic diversity, assemblage structure, and diversification rates for regional conifer assemblages...

  4. Common biosynthetic origins for polycyclic tetramate macrolactams from phylogenetically diverse bacteria.

    Science.gov (United States)

    Blodgett, Joshua A V; Oh, Dong-Chan; Cao, Shugeng; Currie, Cameron R; Kolter, Roberto; Clardy, Jon

    2010-06-29

    A combination of small molecule chemistry, biosynthetic analysis, and genome mining has revealed the unexpected conservation of polycyclic tetramate macrolactam biosynthetic loci in diverse bacteria. Initially our chemical analysis of a Streptomyces strain associated with the southern pine beetle led to the discovery of frontalamides A and B, two previously undescribed members of this antibiotic family. Genome analyses and genetic manipulation of the producing organism led to the identification of the frontalamide biosynthetic gene cluster and several biosynthetic intermediates. The biosynthetic locus for the frontalamides' mixed polyketide/amino acid structure encodes a hybrid polyketide synthase nonribosomal peptide synthetase (PKS-NRPS), which resembles iterative enzymes known in fungi. No such mixed iterative PKS-NRPS enzymes have been characterized in bacteria. Genome-mining efforts revealed strikingly conserved frontalamide-like biosynthetic clusters in the genomes of phylogenetically diverse bacteria ranging from proteobacteria to actinomycetes. Screens for environmental actinomycete isolates carrying frontalamide-like biosynthetic loci led to the isolation of a number of positive strains, the majority of which produced candidate frontalamide-like compounds under suitable growth conditions. These results establish the prevalence of frontalamide-like gene clusters in diverse bacterial types, with medicinally important Streptomyces species being particularly enriched. PMID:20547882

  5. Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia.

    Science.gov (United States)

    Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D

    2011-12-01

    Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.

  6. A Large and Phylogenetically Diverse Class of Type 1 Opsins Lacking a Canonical Retinal Binding Site.

    Science.gov (United States)

    Becker, Erin A; Yao, Andrew I; Seitzer, Phillip M; Kind, Tobias; Wang, Ting; Eigenheer, Rich; Shao, Katie S Y; Yarov-Yarovoy, Vladimir; Facciotti, Marc T

    2016-01-01

    Opsins are photosensitive proteins catalyzing light-dependent processes across the tree of life. For both microbial (type 1) and metazoan (type 2) opsins, photosensing depends upon covalent interaction between a retinal chromophore and a conserved lysine residue. Despite recent discoveries of potential opsin homologs lacking this residue, phylogenetic dispersal and functional significance of these abnormal sequences have not yet been investigated. We report discovery of a large group of putatively non-retinal binding opsins, present in a number of fungal and microbial genomes and comprising nearly 30% of opsins in the Halobacteriacea, a model clade for opsin photobiology. We report phylogenetic analyses, structural modeling, genomic context analysis and biochemistry, to describe the evolutionary relationship of these recently described proteins with other opsins, show that they are expressed and do not bind retinal in a canonical manner. Given these data, we propose a hypothesis that these abnormal opsin homologs may represent a novel family of sensory opsins which may be involved in taxis response to one or more non-light stimuli. If true, this finding would challenge our current understanding of microbial opsins as a light-specific sensory family, and provides a potential analogy with the highly diverse signaling capabilities of the eukaryotic G-protein coupled receptors (GPCRs), of which metazoan type 2 opsins are a light-specific sub-clade. PMID:27327432

  7. A Large and Phylogenetically Diverse Class of Type 1 Opsins Lacking a Canonical Retinal Binding Site.

    Directory of Open Access Journals (Sweden)

    Erin A Becker

    Full Text Available Opsins are photosensitive proteins catalyzing light-dependent processes across the tree of life. For both microbial (type 1 and metazoan (type 2 opsins, photosensing depends upon covalent interaction between a retinal chromophore and a conserved lysine residue. Despite recent discoveries of potential opsin homologs lacking this residue, phylogenetic dispersal and functional significance of these abnormal sequences have not yet been investigated. We report discovery of a large group of putatively non-retinal binding opsins, present in a number of fungal and microbial genomes and comprising nearly 30% of opsins in the Halobacteriacea, a model clade for opsin photobiology. We report phylogenetic analyses, structural modeling, genomic context analysis and biochemistry, to describe the evolutionary relationship of these recently described proteins with other opsins, show that they are expressed and do not bind retinal in a canonical manner. Given these data, we propose a hypothesis that these abnormal opsin homologs may represent a novel family of sensory opsins which may be involved in taxis response to one or more non-light stimuli. If true, this finding would challenge our current understanding of microbial opsins as a light-specific sensory family, and provides a potential analogy with the highly diverse signaling capabilities of the eukaryotic G-protein coupled receptors (GPCRs, of which metazoan type 2 opsins are a light-specific sub-clade.

  8. Phylogenetic diversity of nitrogen-utilizing genes in hydrothermal chimneys from 3 middle ocean ridges.

    Science.gov (United States)

    Cao, Huiluo; Shao, Zongze; Li, Jiangtao; Zhang, Weipeng; Qian, Pei-Yuan

    2015-11-01

    Nitrogen-metabolizing genes, including nitrogenase (nifH), periplasmic nitrate reductase (napA), and cytochrome cd 1-type nitrite reductase (nirS), were collected from hydrothermal chimney sulfides on 3 middle ocean ridges and compared for the first time. There was a clear phylogenetic distinction of these nifH genes between different hydrothermal ecosystems, which supported the colonization and potential adaptation by different nitrogen fixing microbes in those sulfides. In particular, in sulfides from low-temperature hydrothermal vents of the Southwest Indian Ocean Ridge, the prevalence of nifH genes appears to be attributed to sulfate-reducing bacteria, suggesting their ecological significance. Phylogenetic analysis of nitrate/nitrite reductase genes indicated that nitrate was a critical electron acceptor for sulfur- or metal-oxidizing bacteria in these hydrothermal ecosystems. Our results provided information about the compositions and diversity of the 3 important genes involved in nitrogen fixation and nitrate/nitrite reduction processes in hydrothermal ecosystems and is the first comprehensive genetic repertoire of genes related to potential nitrogen fixation and denitrification processes in various hydrothermal environments.

  9. Relative roles of local disturbance, current climate and palaeoclimate in determining phylogenetic and functional diversity in Chinese forests

    DEFF Research Database (Denmark)

    Feng, Gang; Mi, Xiangcheng; Bøcher, Peder Klith;

    2014-01-01

    importance for the geographic patterns of the functional (as represented by variation in maximum canopy height) and phylogenetic aspects of Chinese forest's woody plant diversity. Importantly, contemporary factors are of overriding importance for functional diversity, while paleoclimate has left a strong......The main processes underlying the generation and maintenance of biodiversity include both local factors such as competition and abiotic filtering and regional forces such as paleoclimate, speciation and dispersal. While the effects of regional and local drivers on species diversity are increasingly...... studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese forest plots to data on current and Last Glacial Maximum (LGM) climate as well as local disturbance regimes to study...

  10. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali;

    2015-01-01

    viruses and plasmids. In particular, it has been suggested that ECE-host interactions have shaped the coevolution of ECEs and their archaeal hosts. Furthermore, archaeal hosts have developed defense systems, including the innate restriction-modification (R-M) system and the adaptive CRISPR (clustered...

  11. Panorama phylogenetic diversity and distribution of type A influenza viruses based on their six internal gene sequences

    Directory of Open Access Journals (Sweden)

    Shen Chao-Jian

    2009-09-01

    Full Text Available Abstract Background Type A influenza viruses are important pathogens of humans, birds, pigs, horses and some marine mammals. The viruses have evolved into multiple complicated subtypes, lineages and sublineages. Recently, the phylogenetic diversity of type A influenza viruses from a whole view has been described based on the viral external HA and NA gene sequences, but remains unclear in terms of their six internal genes (PB2, PB1, PA, NP, MP and NS. Methods In this report, 2798 representative sequences of the six viral internal genes were selected from GenBank using the web servers in NCBI Influenza Virus Resource. Then, the phylogenetic relationships among the representative sequences were calculated using the software tools MEGA 4.1 and RAxML 7.0.4. Lineages and sublineages were classified mainly according to topology of the phylogenetic trees and distribution of the viruses in hosts, regions and time. Results The panorama phylogenetic trees of the six internal genes of type A influenza viruses were constructed. Lineages and sublineages within the type based on the six internal genes were classified and designated by a tentative universal numerical nomenclature system. The diversity of influenza viruses circulating in different regions, periods, and hosts based on the panorama trees was analyzed. Conclusion This study presents the first whole views to the phylogenetic diversity and distribution of type A influenza viruses based on their six internal genes. It also proposes a tentative universal nomenclature system for the viral lineages and sublineages. These can be a candidate framework to generalize the history and explore the future of the viruses, and will facilitate future scientific communications on the phylogenetic diversity and evolution of the viruses. In addition, it provides a novel phylogenetic view (i.e. the whole view to recognize the viruses including the origin of the pandemic A(H1N1 influenza viruses.

  12. Phylogenetic and functional diversity of microbial communities associated with subsurface sediments of the Sonora Margin, Guaymas Basin.

    Science.gov (United States)

    Vigneron, Adrien; Cruaud, Perrine; Roussel, Erwan G; Pignet, Patricia; Caprais, Jean-Claude; Callac, Nolwenn; Ciobanu, Maria-Cristina; Godfroy, Anne; Cragg, Barry A; Parkes, John R; Van Nostrand, Joy D; He, Zhili; Zhou, Jizhong; Toffin, Laurent

    2014-01-01

    Subsurface sediments of the Sonora Margin (Guaymas Basin), located in proximity of active cold seep sites were explored. The taxonomic and functional diversity of bacterial and archaeal communities were investigated from 1 to 10 meters below the seafloor. Microbial community structure and abundance and distribution of dominant populations were assessed using complementary molecular approaches (Ribosomal Intergenic Spacer Analysis, 16S rRNA libraries and quantitative PCR with an extensive primers set) and correlated to comprehensive geochemical data. Moreover the metabolic potentials and functional traits of the microbial community were also identified using the GeoChip functional gene microarray and metabolic rates. The active microbial community structure in the Sonora Margin sediments was related to deep subsurface ecosystems (Marine Benthic Groups B and D, Miscellaneous Crenarchaeotal Group, Chloroflexi and Candidate divisions) and remained relatively similar throughout the sediment section, despite defined biogeochemical gradients. However, relative abundances of bacterial and archaeal dominant lineages were significantly correlated with organic carbon quantity and origin. Consistently, metabolic pathways for the degradation and assimilation of this organic carbon as well as genetic potentials for the transformation of detrital organic matters, hydrocarbons and recalcitrant substrates were detected, suggesting that chemoorganotrophic microorganisms may dominate the microbial community of the Sonora Margin subsurface sediments.

  13. Phylogenetic and Functional Diversity of Microbial Communities Associated with Subsurface Sediments of the Sonora Margin, Guaymas Basin

    Science.gov (United States)

    Vigneron, Adrien; Cruaud, Perrine; Roussel, Erwan G.; Pignet, Patricia; Caprais, Jean-Claude; Callac, Nolwenn; Ciobanu, Maria-Cristina; Godfroy, Anne; Cragg, Barry A.; Parkes, John R.; Van Nostrand, Joy D.; He, Zhili; Zhou, Jizhong; Toffin, Laurent

    2014-01-01

    Subsurface sediments of the Sonora Margin (Guaymas Basin), located in proximity of active cold seep sites were explored. The taxonomic and functional diversity of bacterial and archaeal communities were investigated from 1 to 10 meters below the seafloor. Microbial community structure and abundance and distribution of dominant populations were assessed using complementary molecular approaches (Ribosomal Intergenic Spacer Analysis, 16S rRNA libraries and quantitative PCR with an extensive primers set) and correlated to comprehensive geochemical data. Moreover the metabolic potentials and functional traits of the microbial community were also identified using the GeoChip functional gene microarray and metabolic rates. The active microbial community structure in the Sonora Margin sediments was related to deep subsurface ecosystems (Marine Benthic Groups B and D, Miscellaneous Crenarchaeotal Group, Chloroflexi and Candidate divisions) and remained relatively similar throughout the sediment section, despite defined biogeochemical gradients. However, relative abundances of bacterial and archaeal dominant lineages were significantly correlated with organic carbon quantity and origin. Consistently, metabolic pathways for the degradation and assimilation of this organic carbon as well as genetic potentials for the transformation of detrital organic matters, hydrocarbons and recalcitrant substrates were detected, suggesting that chemoorganotrophic microorganisms may dominate the microbial community of the Sonora Margin subsurface sediments. PMID:25099369

  14. Analysis of genetic diversity and phylogenetic relationships among red jungle fowls and Chinese domestic fowls

    Institute of Scientific and Technical Information of China (English)

    BAO WenBin; CHEN GuoHong; LI BiChun; WU XinSheng; SHU JingTing; WU ShengLong; XU Qi; Steffen WEIGEND

    2008-01-01

    Genetic diversity and phylogenetic relationships among 568 individuals of two red jungle fowl subspe-cies (Gallus gallus spadiceus in China and Gallus gallus gallus in Thailand) and 14 Chinese domestic chicken breeds were evaluated with 29 microstaellite loci, the genetic variability within population and genetic differentiation among population were estimated, and then genetic diversity and phylogenetic relationships were analyzed among red jungle fowls and Chinese domestic fowls. A total of 286 alleles were detected in 16 population with 29 microsatellite markers and the average number of the alleles observed in 29 microsatellite loci was 9.86±6.36. The overall expected heterozygosity of all population was 0.6708±0.0251, and the number of population deviated from Hardy-Weinberg equilibrium per locus ranged from 0 to 7. In the whole population, the average of genetic differentiation among population, measured as FST value, was 16.7% (P<0.001), and all loci contributed significantly (P<0.001) to this differentiation. It can also be seen that the deficit of heterozygotes was very high (0.015) (P<0.01). Reynolds' distance values varied between 0.036 (Xiaoshan chicken-Luyuan chicken pair) and 0.330 (G gallus gallus-Gushi chicken pair). The Nm value ranged from 0.533 (between G gallus gallus and Gushi chicken) to 5.833 (between Xiaoshan chicken and Luyuan chicken). An unrooted consensus tree was constructed using the neighbour-joining method and the Reynolds' genetic distance. The heavy-body sized chicken breeds, Luyuan chicken, Xiaoshan chicken, Beijing Fatty chicken, Henan Game chicken, Huainan Partridge and Langshan chicken formed one branch, and it had a close genetic relationship between Xiaoshan chicken-Luyuan chicken pair and Chahua chicken-Tibetan chicken pair. Chahua chicken and Tibetan chicken had closer genetic relationship with these two subspecies of red jungle fowl than other domestic chicken breeds. G gallus spadiceus showed closer phylogenetic

  15. Analysis of genetic diversity and phylogenetic relationships among red jungle fowls and Chinese domestic fowls

    Institute of Scientific and Technical Information of China (English)

    Steffen; WEIGEND

    2008-01-01

    Genetic diversity and phylogenetic relationships among 568 individuals of two red jungle fowl subspe- cies (Gallus gallus spadiceus in China and Gallus gallus gallus in Thailand) and 14 Chinese domestic chicken breeds were evaluated with 29 microstaellite loci, the genetic variability within population and genetic differentiation among population were estimated, and then genetic diversity and phylogenetic relationships were analyzed among red jungle fowls and Chinese domestic fowls. A total of 286 alleles were detected in 16 population with 29 microsatellite markers and the average number of the alleles observed in 29 microsatellite loci was 9.86±6.36. The overall expected heterozygosity of all population was 0.6708±0.0251, and the number of population deviated from Hardy-Weinberg equilibrium per locus ranged from 0 to 7. In the whole population, the average of genetic differentiation among population, measured as FST value, was 16.7% (P<0.001), and all loci contributed significantly (P<0.001) to this differentiation. It can also be seen that the deficit of heterozygotes was very high (0.015) (P<0.01). Reynolds’ distance values varied between 0.036 (Xiaoshan chicken-Luyuan chicken pair) and 0.330 (G. gallus gallus-Gushi chicken pair). The Nm value ranged from 0.533 (between G. gallus gallus and Gushi chicken) to 5.833 (between Xiaoshan chicken and Luyuan chicken). An unrooted consensus tree was constructed using the neighbour-joining method and the Reynolds’ genetic distance. The heavy-body sized chicken breeds, Luyuan chicken, Xiaoshan chicken, Beijing Fatty chicken, Henan Game chicken, Huainan Partridge and Langshan chicken formed one branch, and it had a close genetic relationship between Xiaoshan chicken-Luyuan chicken pair and Chahua chicken-Tibetan chicken pair. Chahua chicken and Tibetan chicken had closer genetic relationship with these two subspecies of red jungle fowl than other domestic chicken breeds. G. gallus spadiceus showed closer phylogenetic

  16. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  17. Towards a better understanding of Apis mellifera and Varroa destructor microbiomes: introducing 'phyloh' as a novel phylogenetic diversity analysis tool.

    Science.gov (United States)

    Sandionigi, A; Vicario, S; Prosdocimi, E M; Galimberti, A; Ferri, E; Bruno, A; Balech, B; Mezzasalma, V; Casiraghi, M

    2015-07-01

    The study of diversity in biological communities is an intriguing field. Huge amount of data are nowadays available (provided by the innovative DNA sequencing techniques), and management, analysis and display of results are not trivial. Here, we propose for the first time the use of phylogenetic entropy as a measure of bacterial diversity in studies of microbial community structure. We then compared our new method (i.e. the web tool phyloh) for partitioning phylogenetic diversity with the traditional approach in diversity analyses of bacteria communities. We tested phyloh to characterize microbiome in the honeybee (Apis mellifera, Insecta: Hymenoptera) and its parasitic mite varroa (Varroa destructor, Arachnida: Parasitiformes). The rationale is that the comparative analysis of honeybee and varroa microbiomes could open new perspectives concerning the role of the parasites on honeybee colonies health. Our results showed a dramatic change of the honeybee microbiome when varroa occurs, suggesting that this parasite is able to influence host microbiome. Among the different approaches used, only the entropy method, in conjunction with phylogenetic constraint as implemented in phyloh, was able to discriminate varroa microbiome from that of parasitized honeybees. In conclusion, we foresee that the use of phylogenetic entropy could become a new standard in the analyses of community structure, in particular to prove the contribution of each biological entity to the overall diversity.

  18. Towards a better understanding of Apis mellifera and Varroa destructor microbiomes: introducing 'phyloh' as a novel phylogenetic diversity analysis tool.

    Science.gov (United States)

    Sandionigi, A; Vicario, S; Prosdocimi, E M; Galimberti, A; Ferri, E; Bruno, A; Balech, B; Mezzasalma, V; Casiraghi, M

    2015-07-01

    The study of diversity in biological communities is an intriguing field. Huge amount of data are nowadays available (provided by the innovative DNA sequencing techniques), and management, analysis and display of results are not trivial. Here, we propose for the first time the use of phylogenetic entropy as a measure of bacterial diversity in studies of microbial community structure. We then compared our new method (i.e. the web tool phyloh) for partitioning phylogenetic diversity with the traditional approach in diversity analyses of bacteria communities. We tested phyloh to characterize microbiome in the honeybee (Apis mellifera, Insecta: Hymenoptera) and its parasitic mite varroa (Varroa destructor, Arachnida: Parasitiformes). The rationale is that the comparative analysis of honeybee and varroa microbiomes could open new perspectives concerning the role of the parasites on honeybee colonies health. Our results showed a dramatic change of the honeybee microbiome when varroa occurs, suggesting that this parasite is able to influence host microbiome. Among the different approaches used, only the entropy method, in conjunction with phylogenetic constraint as implemented in phyloh, was able to discriminate varroa microbiome from that of parasitized honeybees. In conclusion, we foresee that the use of phylogenetic entropy could become a new standard in the analyses of community structure, in particular to prove the contribution of each biological entity to the overall diversity. PMID:25367306

  19. Effect of bromochloromethane and fumarate on phylogenetic diversity of the formyltetrahydrofolate synthetase gene in bovine rumen.

    Science.gov (United States)

    Mitsumori, Makoto; Matsui, Hiroki; Tajima, Kiyoshi; Shinkai, Takumi; Takenaka, Akio; Denman, Stuart E; McSweeney, Christopher S

    2014-01-01

    Effect of the methane inhibitor, bromochloromethane (BCM) and dietary substrate, fumarate, on microbial community structure of acetogen bacteria in the bovine rumen was investigated through analysis of the formyltetrahydrofolate synthetase gene (fhs). The fhs sequences obtained from BCM-untreated, BCM-treated, fumarate-untreated and fumarate-treated bovine rumen were categorized into homoacetogens and nonhomoacetogenic bacteria by homoacetogen similarity scores. Phylogenetic tree analysis indicated that most of the fhs sequences categorized into homoacetogens were divided into nine clusters, which were in close agreement with a result shown in a self-organizing map. The diversity of the fhs sequences from the BCM-treated rumen was significantly different from those from BCM-non-treated rumen. Principal component analysis also showed that addition of BCM to the rumen altered the population structure of acetogenic bacteria significantly but the effect of fumarate was comparatively minor. These results indicate that BCM affects diversity of actogens in the bovine rumen, and changes in acetogenic community structure in response to methane inhibitors may be caused by different mechanisms.

  20. Antifungal drug susceptibility and phylogenetic diversity among Cryptococcus isolates from dogs and cats in North America.

    Science.gov (United States)

    Singer, Lisa M; Meyer, Wieland; Firacative, Carolina; Thompson, George R; Samitz, Eileen; Sykes, Jane E

    2014-06-01

    Molecular types of the Cryptococcus neoformans/Cryptococcus gattii species complex that infect dogs and cats differ regionally and with host species. Antifungal drug susceptibility can vary with molecular type, but the susceptibility of Cryptococcus isolates from dogs and cats is largely unknown. Cryptococcus isolates from 15 dogs and 27 cats were typed using URA5 restriction fragment length polymorphism analysis (RFLP), PCR fingerprinting, and multilocus sequence typing (MLST). Susceptibility was determined using a microdilution assay (Sensititre YeastOne; Trek Diagnostic Systems). MICs were compared among groups. The 42 isolates studied comprised molecular types VGI (7%), VGIIa (7%), VGIIb (5%), VGIIc (5%), VGIII (38%), VGIV (2%), VNI (33%), and VNII (2%), as determined by URA5 RFLP. The VGIV isolate was more closely related to VGIII according to MLST. All VGIII isolates were from cats. All sequence types identified from veterinary isolates clustered with isolates from humans. VGIII isolates showed considerable genetic diversity compared with other Cryptococcus molecular types and could be divided into two major subgroups. Compared with C. neoformans MICs, C. gattii MICs were lower for flucytosine, and VGIII MICs were lower for flucytosine and itraconazole. For all drugs except itraconazole, C. gattii isolates exhibited a wider range of MICs than C. neoformans. MICs varied with Cryptococcus species and molecular type in dogs and cats, and MICs of VGIII isolates were most variable and may reflect phylogenetic diversity in this group. Because sequence types of dogs and cats reflect those infecting humans, these observations may also have implications for treatment of human cryptococcosis.

  1. Phylogenetic relationships and morphological diversity in Darwin's finches and their relatives.

    Science.gov (United States)

    Burns, Kevin J; Hackett, Shannon J; Klein, Nedra K

    2002-06-01

    Despite the importance of Darwin's finches to the development of evolutionary theory, the origin of the group has only recently been examined using a rigorous, phylogenetic methodology that includes many potential outgroups. Knowing the evolutionary relationships of Darwin's finches to other birds is important for understanding the context from which this adaptive radiation arose. Here we show that analysis of mitochondrial DNA sequence data from the cytochrome b gene confirm that Darwin's finches are monophyletic. In addition, many taxa previously proposed as the sister taxon to Darwin's finches can be excluded as their closest living relative. Darwin's finches are part of a well-supported monophyletic group of species, all of which build a domed nest. All but two of the non-Darwin's finches included in this clade occur on Caribbean islands and most are Caribbean endemics. These close relatives of Darwin's finches show a diversity of bill types and feeding behaviors similar to that observed among Darwin's finches themselves. Recent studies have shown that adaptive evolution in Darwin's finches occurred relatively quickly. Our data show that among the relatives of Darwin's finches, the evolution of bill diversity was also rapid and extensive.

  2. Temporal Dynamics of Active Prokaryotic Nitrifiers and Archaeal Communities from River to Sea.

    Science.gov (United States)

    Hugoni, Mylène; Agogué, Hélène; Taib, Najwa; Domaizon, Isabelle; Moné, Anne; Galand, Pierre E; Bronner, Gisèle; Debroas, Didier; Mary, Isabelle

    2015-08-01

    To test if different niches for potential nitrifiers exist in estuarine systems, we assessed by pyrosequencing the diversity of archaeal gene transcript markers for taxonomy (16S ribosomal RNA (rRNA)) during an entire year along a salinity gradient in surface waters of the Charente estuary (Atlantic coast, France). We further investigated the potential for estuarine prokaryotes to oxidize ammonia and hydrolyze urea by quantifying thaumarchaeal amoA and ureC and bacterial amoA transcripts. Our results showed a succession of different nitrifiers from river to sea with bacterial amoA transcripts dominating in the freshwater station while archaeal transcripts were predominant in the marine station. The 16S rRNA sequence analysis revealed that Thaumarchaeota marine group I (MGI) were the most abundant overall but other archaeal groups like Methanosaeta were also potentially active in winter (December-March) and Euryarchaeota marine group II (MGII) were dominant in seawater in summer (April-August). Each station also contained different Thaumarchaeota MGI phylogenetic clusters, and the clusters' microdiversity was associated to specific environmental conditions suggesting the presence of ecotypes adapted to distinct ecological niches. The amoA and ureC transcript dynamics further indicated that some of the Thaumarchaeota MGI subclusters were involved in ammonia oxidation through the hydrolysis of urea. Our findings show that ammonia-oxidizing Archaea and Bacteria were adapted to contrasted conditions and that the Thaumarchaeota MGI diversity probably corresponds to distinct metabolisms or life strategies. PMID:25851445

  3. Phylogenetic diversity of dissimilatory ferric iron reducers in paddy soil of Hunan, South China

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xin-Jun [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Graduate Univ., Chinese Academy of Sciences, BJ (China); Yang Jing; Chen Xue-Ping; Sun Guo-Xin [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Zhu Yong-Guan [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Key Lab. of Urban Environment and Health, Inst. of Urban Environment, Chinese Academy of Sciences, Xiamen (China)

    2009-12-15

    Purpose: Dissimilatory iron-reducing bacteria have been described by both culture-dependent and -independent methods in various environments, including freshwater, marine sediments, natural wetlands, and contaminated aquifers. However, little is known about iron-reducing microbial communities in paddy soils. The goal of this study was to characterize iron-reducing microbial communities in paddy soil. Moreover, the effect of dissolved and solid-phase iron (III) species on the iron-reducing microbial communities was also investigated by enrichment cultures. Methods: Ferric citrate and ferrihydrite were used respectively to set up enrichment cultures of dissimilatory ironreducing microorganisms using 1% inoculum of soil samples, and the iron reduction was measured. Moreover, bacterial DNA was extracted and 16S rRNA genes were PCR-amplified, and subsequently analyzed by the clone library and terminal restriction fragment length polymorphism (T-RFLP). Results: Phylogenetic analysis of 16S rRNA gene sequences extracted from the enrichment cultures revealed that Bradyrhizobium, Bacteroides, Clostridium and Ralstonia species were the dominant bacteria in the ferric citrate enrichment. However, members of the genera Clostridium, Bacteroides, and Geobacter were the dominant micro-organisms in the ferrihydrite enrichment. Analysis of enrichment cultures by T-RFLP strongly supported the cloning and sequencing results. Conclusions: The present study demonstrated that dissimilatory iron-reducing consortia in As-contaminated paddy soil are phylogenetically diverse. Moreover, iron (III) sources as a key factor have a strong effect on the iron (III)-reducing microbial community structure and relative abundance in the enrichments. In addition, Geobacter species are selectively enriched by ferrihydrite enrichment cultures. (orig.)

  4. Evaluating methods for isolating total RNA and predicting the success of sequencing phylogenetically diverse plant transcriptomes.

    Science.gov (United States)

    Johnson, Marc T J; Carpenter, Eric J; Tian, Zhijian; Bruskiewich, Richard; Burris, Jason N; Carrigan, Charlotte T; Chase, Mark W; Clarke, Neil D; Covshoff, Sarah; Depamphilis, Claude W; Edger, Patrick P; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M; Jordon-Thaden, Ingrid; Kutchan, Toni M; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C Neal; Surek, Barbara; Thomsen, Christina J M; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥ 1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers.

  5. Evaluating methods for isolating total RNA and predicting the success of sequencing phylogenetically diverse plant transcriptomes.

    Directory of Open Access Journals (Sweden)

    Marc T J Johnson

    Full Text Available Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds expressed within samples. Tissue types (e.g., leaf vs. flower varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥ 1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score, RNA purity (OD 260/230, sequencing platform (GAIIx vs HiSeq and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers.

  6. Phylogenetic Diversity of Young Ocean Crust at the East Pacific Rise 9° N

    Science.gov (United States)

    Santelli, C. M.; Bach, W.; Rogers, D. R.; Edwards, K. J.

    2004-12-01

    Numerous studies show increasing evidence for a significant biosphere in oceanic lithosphere. Geochemical modeling suggests that most biological activity at or below the seafloor occurs in young crust (microbial activity, molecular microbiological data is required to corroborate these morphological and chemical observations. The application of molecular techniques to old ocean crust, however, can be difficult because of issues such as low cell density, contamination, and sluggish activity. Hence, studies on young ocean crust may provide insight and constraints on processes that could also apply to older crust. In this study, we have investigated the initial colonization of very young mid-ocean ridge basalt by endolithic microorganisms, and the changes in microbial diversity as a result of increasing rock alteration. Seafloor basalt samples were collected during RV Atlantis cruise AT11-7 in February 2004, from the East Pacific Rise (EPR) between 9° 28'N and 9° 50'N. Samples representing various flow morphologies, glass contents, and ages (up to ˜20 kyrs) were collected by DSV Alvin and brought to the surface in bioboxes. All basalts contain glass that ranges from very fresh to slightly altered with Fe-oxidation rims and/or Mn-oxide crusts. Total community DNA was successfully extracted from glass samples representative of a variety of alteration states. Clone libraries were constructed from PCR products of 16S rRNA genes using bacterial primers. Approximately 90 randomly selected clones from each library were sequenced. Phylogenetic analyses will indicate the overall diversity of young ocean crust and will help determine the succession of microorganisms colonizing the rock with increasing alteration. These results may also give us a better indication of the physiology of these microorganisms. Ultimately, this information will provide more accurate estimates of the impact of microbial activity in important geochemical processes such as the evolution of crustal

  7. Phylogenetically diverse AM fungi from Ecuador strongly improve seedling growth of native potential crop trees.

    Science.gov (United States)

    Schüßler, Arthur; Krüger, Claudia; Urgiles, Narcisa

    2016-04-01

    In many deforested regions of the tropics, afforestation with native tree species could valorize a growing reservoir of degraded, previously overused and abandoned land. The inoculation of tropical tree seedlings with arbuscular mycorrhizal fungi (AM fungi) can improve tree growth and viability, but efficiency may depend on plant and AM fungal genotype. To study such effects, seven phylogenetically diverse AM fungi, native to Ecuador, from seven genera and a non-native AM fungus (Rhizophagus irregularis DAOM197198) were used to inoculate the tropical potential crop tree (PCT) species Handroanthus chrysanthus (synonym Tabebuia chrysantha), Cedrela montana, and Heliocarpus americanus. Twenty-four plant-fungus combinations were studied in five different fertilization and AMF inoculation treatments. Numerous plant growth parameters and mycorrhizal root colonization were assessed. The inoculation with any of the tested AM fungi improved seedling growth significantly and in most cases reduced plant mortality. Plants produced up to threefold higher biomass, when compared to the standard nursery practice. AM fungal inoculation alone or in combination with low fertilization both outperformed full fertilization in terms of plant growth promotion. Interestingly, root colonization levels for individual fungi strongly depended on the host tree species, but surprisingly the colonization strength did not correlate with plant growth promotion. The combination of AM fungal inoculation with a low dosage of slow release fertilizer improved PCT seedling performance strongest, but also AM fungal treatments without any fertilization were highly efficient. The AM fungi tested are promising candidates to improve management practices in tropical tree seedling production. PMID:26260945

  8. Phylogenetic diversity of endophytic leaf fungus isolates from the medicinal tree Trichilia elegans (Meliaceae).

    Science.gov (United States)

    Rhoden, S A; Garcia, A; Rubin Filho, C J; Azevedo, J L; Pamphile, J A

    2012-01-01

    Various types of organisms, mainly fungi and bacteria, live within vegetal organs and tissues, without causing damage to the plant. These microorganisms, which are called endophytes, can be useful for biological control and plant growth promotion; bioactive compounds from these organisms may have medical and pharmaceutical applications. Trichilia elegans (Meliaceae) is a native tree that grows abundantly in several regions of Brazil. Preparations using the leaves, seeds, bark, and roots of many species of the Meliaceae family have been widely used in traditional medicine, and some members of the Trichilia genus are used in Brazilian popular medicine. We assessed the diversity of endophytic fungi from two wild specimens of T. elegans, collected from a forest remnant, by sequencing ITS1-5.8S-ITS2 of rDNA of the isolates. The fungi were isolated and purified; 97 endophytic fungi were found; they were separated into 17 morpho-groups. Of the 97 endophytic fungi, four genera (Phomopsis, Diaporthe, Dothideomycete, and Cordyceps) with 11 morpho-groups were identified. Phomopsis was the most frequent genus among the identified endophytes. Phylogenetic analysis showed two major clades: Sordariomycetes, which includes three genera, Phomopsis, Diaporthe, and Cordyceps, and the clade Dothideomycetes, which was represented by the order Pleosporales. PMID:22782630

  9. Tasting soil fungal diversity with earth tongues: phylogenetic test of SATe alignments for environmental ITS data.

    Directory of Open Access Journals (Sweden)

    Zheng Wang

    Full Text Available An abundance of novel fungal lineages have been indicated by DNA sequencing of the nuclear ribosomal ITS region from environmental samples such as soil and wood. Although phylogenetic analysis of these novel lineages is a key component of unveiling the structure and diversity of complex communities, such analyses are rare for environmental ITS data due to the difficulties of aligning this locus across significantly divergent taxa. One potential approach to this issue is simultaneous alignment and tree estimation. We targeted divergent ITS sequences of the earth tongue fungi (Geoglossomycetes, a basal class in the Ascomycota, to assess the performance of SATé, recent software that combines progressive alignment and tree building. We found that SATé performed well in generating high-quality alignments and in accurately estimating the phylogeny of earth tongue fungi. Drawing from a data set of 300 sequences of earth tongues and progressively more distant fungal lineages, 30 insufficiently identified ITS sequences from the public sequence databases were assigned to the Geoglossomycetes. The association between earth tongues and plants has been hypothesized for a long time, but hard evidence is yet to be collected. The ITS phylogeny showed that four ectomycorrhizal isolates shared a clade with Geoglossum but not with Trichoglossum earth tongues, pointing to the significant potential inherent to ecological data mining of environmental samples. Environmental sampling holds the key to many focal questions in mycology, and simultaneous alignment and tree estimation, as performed by SATé, can be a highly efficient companion in that pursuit.

  10. Elucidating further phylogenetic diversity among the Defluviicoccus-related glycogen-accumulating organisms in activated sludge.

    Science.gov (United States)

    McIlroy, Simon; Seviour, Robert J

    2009-12-01

    Glycogen-accumulating organisms (GAO) are thought to out-compete the polyphosphate-accumulating organisms (PAO) in activated sludge communities removing phosphate (P). Two GAO groups are currently recognized, the gammaproteobacterial Candidatus'Competibacter phosphatis', and the alphaproteobacterial Defluviicoccus vanus-related tetrad forming organisms (TFOs). Both are phylogenetically diverse based on their 16S rRNA sequences, with the latter currently considered to contain members falling into three distinct clusters. This paper identifies members of an additional fourth Defluviicoccus cluster from 16S rRNA gene clone library data obtained from a laboratory-scale activated sludge plant community removing P, and details FISH probes designed against them. Probe DF181A was designed to target a single sequence and DF181B designed against the remaining sequences in the cluster. Cells hybridizing with these probes in the biomass samples tested always appeared as either TFOs or in large clusters of small cocci. Members of the Defluviicoccus-related organisms were commonly found in full-scale wastewater treatments plants, sometimes as a dominant population. PMID:23765935

  11. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan

    2014-05-12

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  12. Actinomycetes from Red Sea Sponges: Sources for Chemical and Phylogenetic Diversity

    Directory of Open Access Journals (Sweden)

    Usama Ramadan Abdelmohsen

    2014-05-01

    Full Text Available The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II as well as nonribosomal peptide synthetases (NRPS showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery.

  13. Phylogenetically Diverse Burkholderia Associated with Midgut Crypts of Spurge Bugs, Dicranocephalus spp. (Heteroptera: Stenocephalidae).

    Science.gov (United States)

    Kuechler, Stefan Martin; Matsuura, Yu; Dettner, Konrad; Kikuchi, Yoshitomo

    2016-06-25

    Diverse phytophagous heteropteran insects, commonly known as stinkbugs, are associated with specific gut symbiotic bacteria, which have been found in midgut cryptic spaces. Recent studies have revealed that members of the stinkbug families Coreidae and Alydidae of the superfamily Coreoidea are consistently associated with a specific group of the betaproteobacterial genus Burkholderia, called the "stinkbug-associated beneficial and environmental (SBE)" group, and horizontally acquire specific symbionts from the environment every generation. However, the symbiotic system of another coreoid family, Stenocephalidae remains undetermined. We herein investigated four species of the stenocephalid genus Dicranocephalus. Examinations via fluorescence in situ hybridization (FISH) and transmission electron microscopy (TEM) revealed the typical arrangement and ultrastructures of midgut crypts and gut symbionts. Cloning and molecular phylogenetic analyses of bacterial genes showed that the midgut crypts of all species are colonized by Burkholderia strains, which were further assigned to different subgroups of the genus Burkholderia. In addition to the SBE-group Burkholderia, a number of stenocephalid symbionts belonged to a novel clade containing B. sordidicola and B. udeis, suggesting a specific symbiont clade for the Stenocephalidae. The symbiotic systems of stenocephalid bugs may provide a unique opportunity to study the ongoing evolution of symbiont associations in the stinkbug-Burkholderia interaction. PMID:27265344

  14. Diversity of cytosolic HSP70 Heat Shock Protein from decapods and their phylogenetic placement within Arthropoda.

    Science.gov (United States)

    Baringou, Stephane; Rouault, Jacques-Deric; Koken, Marcel; Hardivillier, Yann; Hurtado, Luis; Leignel, Vincent

    2016-10-10

    The 70kDa heat shock proteins (HSP70) are considered the most conserved members of the HSP family. These proteins are primordial to the cell, because of their implications in many cellular pathways (e. g., development, immunity) and also because they minimize the effects of multiple stresses (e. g., temperature, pollutants, salinity, radiations). In the cytosol, two ubiquitous HSP70s with either a constitutive (HSC70) or an inducible (HSP70) expression pattern are found in all metazoan species, encoded by 5 or 6 genes (Drosophila melanogaster or yeast and human respectively). The cytosolic HSP70 protein family is considered a major actor in environmental adaptation, and widely used in ecology as an important biomarker of environmental stress. Nevertheless, the diversity of cytosolic HSP70 remains unclear amongst the Athropoda phylum, especially within decapods. Using 122 new and 311 available sequences, we carried out analyses of the overall cytosolic HSP70 diversity in arthropods (with a focus on decapods) and inferred molecular phylogenies. Overall structural and phylogenetic analyses showed a surprisingly high diversity in cytosolic HSP70 and revealed the existence of several unrecognised groups. All crustacean HSP70 sequences present signature motifs and molecular weights characteristic of non-organellar HSP70, with multiple specific substitutions in the protein sequence. The cytosolic HSP70 family in arthropods appears to be constituted of at least three distinct groups (annotated as A, B and C), which comprise several subdivisions, including both constitutive and inducible forms. Group A is constituted by several classes of Arthropods, while group B and C seem to be specific to Malacostraca and Hexapoda/Chelicerata, respectively. The HSP70 organization appeared much more complex than previously suggested, and far beyond a simple differentiation according to their expression pattern (HSC70 versus HSP70). This study proposes a new classification of cytosolic

  15. 高浓度酒精废水厌氧处理工程系统中古菌多样性及其代谢特征%Archaeal diversity and metabolic function in anaerobic digest process treating high concentration ethanol wastewater

    Institute of Scientific and Technical Information of China (English)

    高瑞芳; 袁旭峰; 王小芬; 朱万斌; 程序; 崔宗均

    2011-01-01

    Fast conformation, good shock resistance and good suspensibility of anaerobic granular sludge are the important characteristics of a new anaerobic treatment plant dealing with high concentration organic wastewater. In order to investigate the diversity and functional characteristics of archaea,most important component of granular sludge, total archaeal genomic DNA was extracted from sample.The community structure was studied by polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) and cloning-sequencing based 16S rDNA. The results showed that archaeal community clones were classified into Methanosaeta, Methanosarcina, Methanobacterium and Methanomethylovorans all four clusters, accounting for 58.2%, 23.6%, 12.7% and 3.6% of the clone library capacity separately, one clone with 1.8% proportion could not be found the most sinilar strain. The sequences blast results and phylogenetic analysis of archaea showed that clones C10, C11, C13 and C19 had high similarity with the known strains FJ61882 l, AB479397, AJ244290 and AB447878 separately and their relative taxonomy groups also be found. Methanosaeta and Methanosarcina were the main clusters in archaeal community, so methane production approach was acetic acid-based. Intermediate metabolites VFAs analysis was combined with different metabolic functions comparison, which confirmed the corresponding relationship between archaeal community diversity and its metabolism function.%颗粒污泥形成快、抗冲击能力强、悬浮性好是新型高浓度有机废水厌氧处理系统的重要特征.为了研究颗粒污泥中古茵组成多样性及其功能特征,采集活性污泥样品,提取总基因组DNA,应用PCR-DGGE和16S rDNA克隆测序技术对系统内古菌群落进行研究.结果表明:古菌克隆文库中克隆子的近缘种归属于Methanosaeta、Methanosarcina、Methanobacterium和Methanomethylovorans 4个类群,所占文库容量比例依次为58.2%、23.6%、12.7%和3

  16. Contrasting taxonomic and phylogenetic diversity responses to forest modifications: comparisons of taxa and successive plant life stages in South African scarp forest.

    Science.gov (United States)

    Grass, Ingo; Brandl, Roland; Botzat, Alexandra; Neuschulz, Eike Lena; Farwig, Nina

    2015-01-01

    The degradation of natural forests to modified forests threatens subtropical and tropical biodiversity worldwide. Yet, species responses to forest modification vary considerably. Furthermore, effects of forest modification can differ, whether with respect to diversity components (taxonomic or phylogenetic) or to local (α-diversity) and regional (β-diversity) spatial scales. This real-world complexity has so far hampered our understanding of subtropical and tropical biodiversity patterns in human-modified forest landscapes. In a subtropical South African forest landscape, we studied the responses of three successive plant life stages (adult trees, saplings, seedlings) and of birds to five different types of forest modification distinguished by the degree of within-forest disturbance and forest loss. Responses of the two taxa differed markedly. Thus, the taxonomic α-diversity of birds was negatively correlated with the diversity of all plant life stages and, contrary to plant diversity, increased with forest disturbance. Conversely, forest disturbance reduced the phylogenetic α-diversity of all plant life stages but not that of birds. Forest loss neither affected taxonomic nor phylogenetic diversity of any taxon. On the regional scale, taxonomic but not phylogenetic β-diversity of both taxa was well predicted by variation in forest disturbance and forest loss. In contrast to adult trees, the phylogenetic diversity of saplings and seedlings showed signs of contemporary environmental filtering. In conclusion, forest modification in this subtropical landscape strongly shaped both local and regional biodiversity but with contrasting outcomes. Phylogenetic diversity of plants may be more threatened than that of mobile species such as birds. The reduced phylogenetic diversity of saplings and seedlings suggests losses in biodiversity that are not visible in adult trees, potentially indicating time-lags and contemporary shifts in forest regeneration. The different

  17. Contrasting taxonomic and phylogenetic diversity responses to forest modifications: comparisons of taxa and successive plant life stages in South African scarp forest.

    Directory of Open Access Journals (Sweden)

    Ingo Grass

    Full Text Available The degradation of natural forests to modified forests threatens subtropical and tropical biodiversity worldwide. Yet, species responses to forest modification vary considerably. Furthermore, effects of forest modification can differ, whether with respect to diversity components (taxonomic or phylogenetic or to local (α-diversity and regional (β-diversity spatial scales. This real-world complexity has so far hampered our understanding of subtropical and tropical biodiversity patterns in human-modified forest landscapes. In a subtropical South African forest landscape, we studied the responses of three successive plant life stages (adult trees, saplings, seedlings and of birds to five different types of forest modification distinguished by the degree of within-forest disturbance and forest loss. Responses of the two taxa differed markedly. Thus, the taxonomic α-diversity of birds was negatively correlated with the diversity of all plant life stages and, contrary to plant diversity, increased with forest disturbance. Conversely, forest disturbance reduced the phylogenetic α-diversity of all plant life stages but not that of birds. Forest loss neither affected taxonomic nor phylogenetic diversity of any taxon. On the regional scale, taxonomic but not phylogenetic β-diversity of both taxa was well predicted by variation in forest disturbance and forest loss. In contrast to adult trees, the phylogenetic diversity of saplings and seedlings showed signs of contemporary environmental filtering. In conclusion, forest modification in this subtropical landscape strongly shaped both local and regional biodiversity but with contrasting outcomes. Phylogenetic diversity of plants may be more threatened than that of mobile species such as birds. The reduced phylogenetic diversity of saplings and seedlings suggests losses in biodiversity that are not visible in adult trees, potentially indicating time-lags and contemporary shifts in forest regeneration. The

  18. Nitrification of archaeal ammonia oxidizers in a high- temperature hot spring

    Science.gov (United States)

    Chen, Shun; Peng, Xiaotong; Xu, Hengchao; Ta, Kaiwen

    2016-04-01

    The oxidation of ammonia by microbes has been shown to occur in diverse natural environments. However, the link of in situ nitrification activity to taxonomic identities of ammonia oxidizers in high-temperature environments remains poorly understood. Here, we studied in situ ammonia oxidation rates and the diversity of ammonia-oxidizing Archaea (AOA) in surface and bottom sediments at 77 °C in the Gongxiaoshe hot spring, Tengchong, Yunnan, China. The in situ ammonia oxidation rates measured by the 15N-NO3- pool dilution technique in the surface and bottom sediments were 4.80 and 5.30 nmol N g-1 h-1, respectively. Real-time quantitative polymerase chain reaction (qPCR) indicated that the archaeal 16S rRNA genes and amoA genes were present in the range of 0.128 to 1.96 × 108 and 2.75 to 9.80 × 105 gene copies g-1 sediment, respectively, while bacterial amoA was not detected. Phylogenetic analysis of 16S rRNA genes showed high sequence similarity to thermophilic Candidatus Nitrosocaldus yellowstonii, which represented the most abundant operational taxonomic units (OTU) in both surface and bottom sediments. The archaeal predominance was further supported by fluorescence in situ hybridization (FISH) visualization. The cell-specific rate of ammonia oxidation was estimated to range from 0.410 to 0.790 fmol N archaeal cell-1 h-1, higher than those in the two US Great Basin hot springs. These results suggest the importance of archaeal rather than bacterial ammonia oxidation in driving the nitrogen cycle in terrestrial geothermal environments.

  19. Environmental shaping of sponge associated archaeal communities.

    Directory of Open Access Journals (Sweden)

    Aline S Turque

    Full Text Available BACKGROUND: Archaea are ubiquitous symbionts of marine sponges but their ecological roles and the influence of environmental factors on these associations are still poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We compared the diversity and composition of archaea associated with seawater and with the sponges Hymeniacidon heliophila, Paraleucilla magna and Petromica citrina in two distinct environments: Guanabara Bay, a highly impacted estuary in Rio de Janeiro, Brazil, and the nearby Cagarras Archipelago. For this we used metagenomic analyses of 16S rRNA and ammonia monooxygenase (amoA gene libraries. Hymeniacidon heliophila was more abundant inside the bay, while P. magna was more abundant outside and P. citrina was only recorded at the Cagarras Archipelago. Principal Component Analysis plots (PCA generated using pairwise unweighted UniFrac distances showed that the archaeal community structure of inner bay seawater and sponges was different from that of coastal Cagarras Archipelago. Rarefaction analyses showed that inner bay archaeaoplankton were more diverse than those from the Cagarras Archipelago. Only members of Crenarchaeota were found in sponge libraries, while in seawater both Crenarchaeota and Euryarchaeota were observed. Although most amoA archaeal genes detected in this study seem to be novel, some clones were affiliated to known ammonia oxidizers such as Nitrosopumilus maritimus and Cenarchaeum symbiosum. CONCLUSION/SIGNIFICANCE: The composition and diversity of archaeal communities associated with pollution-tolerant sponge species can change in a range of few kilometers, probably influenced by eutrophication. The presence of archaeal amoA genes in Porifera suggests that Archaea are involved in the nitrogen cycle within the sponge holobiont, possibly increasing its resistance to anthropogenic impacts. The higher diversity of Crenarchaeota in the polluted area suggests that some marine sponges are able to change the composition

  20. Integrating Taxonomic, Functional and Phylogenetic Beta Diversities: Interactive Effects with the Biome and Land Use across Taxa

    Science.gov (United States)

    Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel

    2015-01-01

    The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation. PMID:25978319

  1. Archaeal DNA replication.

    Science.gov (United States)

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

  2. Why and how might genetic and phylogenetic diversity be reflected in the identification of key biodiversity areas?

    Science.gov (United States)

    Brooks, T M; Cuttelod, A; Faith, D P; Garcia-Moreno, J; Langhammer, P; Pérez-Espona, S

    2015-02-19

    'Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326-337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for 'threatened species' to consider 'threatened taxa' and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites.

  3. Phylogenetic Diversity, Distribution, and Cophylogeny of Giant Bacteria (Epulopiscium) with their Surgeonfish Hosts in the Red Sea

    KAUST Repository

    Miyake, Sou

    2016-03-14

    Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments

  4. Diversity of Archaea and detection of crenarchaeotal amoA genes in the rivers Rhine and Têt

    NARCIS (Netherlands)

    Herfort, L.; Kim, J.H.; Coolen, M.J.L.; Abbas, B.; Schouten, S.; Herndl, G.J.; Sinninghe Damste, J.S.

    2009-01-01

    Pelagic archaeal phylogenetic diversity and the potential for crenarchaeotal nitrification of Group 1.1a were determined in the rivers Rhine and Têt by 16S rRNA sequencing, catalyzed reported deposition-fluorescence in situ hybridization (CARD–FISH) and quantification of 16S rRNA and functional gene

  5. Phylogenetic diversity of dominant bacterial communities during bioremediation of crude oil-polluted soil

    Directory of Open Access Journals (Sweden)

    Eugene Thomas Cloete

    2011-08-01

    Full Text Available Bioremediation of hydrocarbon pollutants is advantageous owing to the cost-effectiveness of the technology and the ubiquity of hydrocarbon degrading microorganisms in the soil. Soil microbial diversity is affected by hydrocarbon perturbation thus selective enrichment of hydrocarbon utilizers occurs. Hydrocarbons interact with the soil matrix and soil microorganisms determining the fate of the contaminants relative to their chemical nature and microbial degradative capabilities respectively. Bacterial dynamics in crude oil-polluted soil microcosms undergoing bioremediation were investigated over a 42-day period. Four out of the five microcosms containing 4kg of pristine soil each were contaminated with 4% Arabian light crude oil. Three microcosms were amended with either 25g of NPK fertilizer, calcium ammonium nitrate or poultry droppings respectively while the fourth designated oil-contaminated control was unamended. The fifth microcosm had only pristine soil and was set up to ascertain indigenous bacterial community structure pre-contamination. Biostimulated soils were periodically tilled and watered. Hydrocarbon degradation was measured throughout the experimental period by gas chromatography. Gas chromatographic tracing of residual hydrocarbons in biostimulated soils showed marked attenuation of contaminants starting from the second (day 14 till the sixth (day 42 week after contamination whereas no significant reduction in hydrocarbon peaks was seen in the oil contaminated control soil throughout the 6-week experimental period. Molecular fingerprints of bacterial communities involved in aerobic biodegradation of crude oil hydrocarbons in biostimulated soils and controls were generated with DGGE using PCR-amplification of 16S rRNA gene obtained from extracted total soil community DNA. DGGE fingerprints demonstrated that NPK, calcium ammonium nitrate and poultry droppings selected different bacterial populations during the active phase of oil

  6. Archaeal diversity in deep-sea hydrothermal sediments from the East Pacific Rise%东太平洋海隆深海热液区沉积物古菌多样性分析

    Institute of Scientific and Technical Information of China (English)

    刘青; 谢运标; 陈逍遥; 周梅先

    2014-01-01

    Archaeal diversity of deep-sea hydrothermal sediments from 3 sites on the East Pacific Rise was investiga-ted and analyzed with polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).Phyloge-netic analyses revealed that a total of 296 random 16S rRNA gene clones were assigned to Thaumarchaeota (47.64%),Euryarchaeota (44.93%),Crenarchaeota (6.77%)and unclassified Archaea (0.68%).Among them,the genus Nitrosopumilus belonging to the phylum Thaumarchaeota and the class Thermoplasmata belonging to the phylum Euryarchaeota were the dominant groups,representing 35.47% and 27.03% of archaeal clones,re-spectively.In addition,some archaeal 16S rRNA gene sequences were affiliated with deep-sea hydrothermal vent Euryarchaeota 3,5 and 6 (DHVE3,DHVE5 and DHVE6),and Marine Benthic Group B and G (MBGB and MB-GE ).Archaeal communities in sediments from 3 sites on East Pacific Rise were clearly distinct from each other.97 archaeal clones from S5-TVG1 site were divided to Thaumarchaeota (49.48%),Euryarchaeota (49.48%)and Crenarchaeota (1.03%).103 archaeal clones from S14-TVG10 site belonged to Thaumarchaeota(84.47%)and Euryarchaeota (15.53%).96 archaeal clones from S16-TVG12 site were assigned to Euryarchaeota(71.88%), Crenarchaeota (19.79%),Thaumarchaeota (6.25%)and unclassified Archaea (2.08%).Our results indicate that Archaea is abundant and there are a lot of novel archaeal groups in deep-sea hydrothermal sediments from 3 sites on the East Pacific Rise,and the distinct community structure and diversity of Archaea in deep-sea hydrother-mal sediments suggested that the sampling area was influenced by hydrothermalism.%采用PCR-RFLP方法对东太平洋海隆深海热液区3个站位沉积物中的古菌多样性进行了初步研究.结果显示,从古菌16S rRNA基因文库中随机挑取的296个阳性克隆分属奇古菌门(Thaumar-chaeota,47.64%)、广古菌门(Euryarchaeota,44.93%)、泉古菌门(Crenarchaeota,6.77

  7. [Phylogenetic diversity of culturable bacteria in the ancient salt deposits of the Yipinglang Salt Mine, P. R. China].

    Science.gov (United States)

    Chen, Yi-guang; Li, Hui-ming; Li, Qin-yuan; Chen, Wei; Cui, Xiao-long

    2007-08-01

    The microbial diversity of cultivable bacteria, isolated from the ancient salt deposits from the Yipinglang Salt Mine (YPL) in the Yunnan Province, P. R. China,was investigated by using conventional culture-dependent method and phylogenetic analyses based on 16S rRNA gene sequence comparisons. 38 bacteria strains were isolated from the brine, halite and saline soil samples on MBA (marine broth agar 2216, Difco) and ISP 2 (International Streotomyces Project medium 2) media supplemented with 0.5-3.5 mol/L NaCl. The genomic DNAs of the isolates were extracted and their 16S rRNA genes were amplified by PCR using bacterial universal primers. The resulting 16S rRNA gene sequences were compared with sequences obtained from public databases to find the most closely related species. Phylogenetic analyses were performed using the software packages MEGA after multiple alignment of sequence data by CLUSTAL X. The evolutional instances (corrected by Kimura's 2-parameter model) were calculated and clustering was performed with the neighbor-joining method. The results showed that the isolates are members of twenty-four genera (Acinetobacter, Agromyces, Arthrobacter, Bacillus, Brevundimonas, Chromohalobacter, Dietzia, Erythrobacter, Exiguobacterium, Halomonas, Idiomarina, Kocuria, Marinobacter, Micrococcus, Paracoccus, Planomicrbium, Porphyrobacter, Pseudomonas, Psychrobacter, Roseivivax, Saccharospirillum, Salegentibactor, Salinicoccus, Streptomyces) of seventeen families (Alteromonadaceae, Bacillaceae, Caulobacteraceae, Flavobacteriaceae, Halomonadaceae, Idiomarinaceae, Microbacteriaceae, Micrococcaceae, Moraxellaceae, Planococcaceae, Pseudomonadaceae, Rhodobacteraceae, Dietziaceae, Saccharospirillaceae, Sphingomonadaceae, Staphylococcaceae, Streptomycetaceae) in four major phylogenetic groups (Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria). The most abundant and diverse isolates were within the phyla of Proteobacteria (47.3%; Gamma-Proteobacteria, 31.5%; Alpha

  8. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences

    Science.gov (United States)

    Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

    2016-01-01

    The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species’ genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

  9. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.

    Directory of Open Access Journals (Sweden)

    Jianbin Liu

    Full Text Available The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau.

  10. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.

    Science.gov (United States)

    Liu, Jianbin; Ding, Xuezhi; Zeng, Yufeng; Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

    2016-01-01

    The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

  11. Influences of plant type on bacterial and archaeal communities in constructed wetland treating polluted river water.

    Science.gov (United States)

    Long, Yan; Yi, Hao; Chen, Sili; Zhang, Zhengke; Cui, Kai; Bing, Yongxin; Zhuo, Qiongfang; Li, Bingxin; Xie, Shuguang; Guo, Qingwei

    2016-10-01

    Both bacteria and archaeal communities can play important roles in biogeochemical processes in constructed wetland (CW) system. However, the influence of plant type on microbial community in surface water CW remains unclear. The present study investigated bacterial and archaeal communities in five surface water CW systems with different plant species. The abundance, richness, and diversity of both bacterial and archaeal communities considerably differed in these five CW systems. Compared with the other three CW systems, the CW systems planted with Vetiveria zizanioides or Juncus effusus L. showed much higher bacterial abundance but lower archaeal abundance. Bacteria outnumbered archaea in each CW system. Moreover, the CW systems planted with V. zizanioides or J. effusus L. had relatively lower archaeal but higher bacterial richness and diversity. In each CW system, bacterial community displayed much higher richness and diversity than archaeal community. In addition, a remarkable difference of both bacterial and archaeal community structures was observed in the five studied CW systems. Proteobacteria was the most abundant bacterial group (accounting for 33-60 %). Thaumarchaeota organisms (57 %) predominated in archaeal communities in CW systems planted with V. zizanioides or J. effusus L., while Woesearchaeota (23 or 24 %) and Euryarchaeota (23 or 15 %) were the major archaeal groups in CW systems planted with Cyperus papyrus or Canna indica L. Archaeal community in CW planted with Typha orientalis Presl was mainly composed of unclassified archaea. Therefore, plant type exerted a considerable influence on microbial community in surface water CW system. PMID:27392623

  12. Bacterial and archaeal community structures in the Arctic deep-sea sediment

    Institute of Scientific and Technical Information of China (English)

    LI Yan; LIU Qun; LI Chaolun; DONG Yi; ZHANG Wenyan; ZHANG Wuchang; XIAO Tian

    2015-01-01

    Microbial community structures in the Arctic deep-sea sedimentary ecosystem are determined by organic matter input, energy availability, and other environmental factors. However, global warming and earlier ice-cover melting are affecting the microbial diversity. To characterize the Arctic deep-sea sediment microbial diversity and its rela-tionship with environmental factors, we applied Roche 454 sequencing of 16S rDNA amplicons from Arctic deep-sea sediment sample. Both bacterial and archaeal communities’ richness, compositions and structures as well as tax-onomic and phylogenetic affiliations of identified clades were characterized. Phylotypes relating to sulfur reduction and chemoorganotrophic lifestyle are major groups in the bacterial groups;while the archaeal community is domi-nated by phylotypes most closely related to the ammonia-oxidizing Thaumarchaeota (96.66%) and methanogenic Euryarchaeota (3.21%). This study describes the microbial diversity in the Arctic deep marine sediment (>3 500 m) near the North Pole and would lay foundation for future functional analysis on microbial metabolic processes and pathways predictions in similar environments.

  13. Phylogenetic analysis of a spontaneous cocoa bean fermentation metagenome reveals new insights into its bacterial and fungal community diversity.

    Directory of Open Access Journals (Sweden)

    Koen Illeghems

    Full Text Available This is the first report on the phylogenetic analysis of the community diversity of a single spontaneous cocoa bean box fermentation sample through a metagenomic approach involving 454 pyrosequencing. Several sequence-based and composition-based taxonomic profiling tools were used and evaluated to avoid software-dependent results and their outcome was validated by comparison with previously obtained culture-dependent and culture-independent data. Overall, this approach revealed a wider bacterial (mainly γ-Proteobacteria and fungal diversity than previously found. Further, the use of a combination of different classification methods, in a software-independent way, helped to understand the actual composition of the microbial ecosystem under study. In addition, bacteriophage-related sequences were found. The bacterial diversity depended partially on the methods used, as composition-based methods predicted a wider diversity than sequence-based methods, and as classification methods based solely on phylogenetic marker genes predicted a more restricted diversity compared with methods that took all reads into account. The metagenomic sequencing analysis identified Hanseniaspora uvarum, Hanseniaspora opuntiae, Saccharomyces cerevisiae, Lactobacillus fermentum, and Acetobacter pasteurianus as the prevailing species. Also, the presence of occasional members of the cocoa bean fermentation process was revealed (such as Erwinia tasmaniensis, Lactobacillus brevis, Lactobacillus casei, Lactobacillus rhamnosus, Lactococcus lactis, Leuconostoc mesenteroides, and Oenococcus oeni. Furthermore, the sequence reads associated with viral communities were of a restricted diversity, dominated by Myoviridae and Siphoviridae, and reflecting Lactobacillus as the dominant host. To conclude, an accurate overview of all members of a cocoa bean fermentation process sample was revealed, indicating the superiority of metagenomic sequencing over previously used techniques.

  14. Physiological and phylogenetic study of microbes from geochemically and hydrogeologically diverse subsurface environments

    Energy Technology Data Exchange (ETDEWEB)

    Balkwill, D.L.; Reeves, R.H.

    1991-01-01

    The present document is an interim technical report in which we describe the research which has been completed during the seven-month period since the start of the grant. Progress is summarized in two main areas. The first is microbiological characterization of subsurface materials from the Hanford reservation and the Idaho National Engineering Laboratory, and the second is phylogenetic characterization of these microorganisms. The major tools used for phylogenetic characterization are RFLP analysis of PCR derived material and 16S rRNA sequencing. A description of manuscripts ready for publication is also provided. 4 refs. (MHB)

  15. Niche specialization of terrestrial archaeal ammonia oxidizers

    OpenAIRE

    Gubry-Rangin, Cécile; Hai, Brigitte; Quince, Christopher; Engel, Marion; Thomson, Bruce C.; James, Phillip; Schloter, Michael; Robert I. Griffiths; Prosser, James I.; Nicol, Graeme W.

    2011-01-01

    Soil pH is a major determinant of microbial ecosystem processes and potentially a major driver of evolution, adaptation, and diversity of ammonia oxidizers, which control soil nitrification. Archaea are major components of soil microbial communities and contribute significantly to ammonia oxidation in some soils. To determine whether pH drives evolutionary adaptation and community structure of soil archaeal ammonia oxidizers, sequences of amoA, a key functional gene of ammonia oxidation, were...

  16. Phylogenetic diversity of archaeal 16S rRNA and ammonia monooxygenase genes from tropical estuarine sediments on the central west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, S.K.; Verma, P.; Ramaiah, N.; Anil, A.C.; Shouche, Y.S.

    extraction Two replicates of ~0.5 to 1 g sub-samples of all six samples were subjected to DNA extraction. The MOBIO soil DNA extraction kit (MO BIO, USA) was used for extraction as per the protocol provided by the manufacturer. DNA extracts from each sub... manufacturer’s instructions. PCR primers Arch-amoAF: 5’-STAATGGTCTGGCTTAGACG and Arch-amoAR: 5’- GCGGCCATCCATCTGTATGT were used for amplifying AamoA-gene fragments following Francis et al. (2005). The PCR products were pooled and purified as done for 16S r...

  17. Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

    Directory of Open Access Journals (Sweden)

    Patrick M Erwin

    Full Text Available BACKGROUND: Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP, might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6% of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil. CONCLUSIONS/SIGNIFICANCE: The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities

  18. A Large and Phylogenetically Diverse Class of Type 1 Opsins Lacking a Canonical Retinal Binding Site

    OpenAIRE

    Becker, EA; Yao, AI; Seitzer, PM; Kind, T; Wang, T.; Eigenheer, R; Shao, KSY; Yarov-Yarovoy, V; Facciotti, MT

    2016-01-01

    Opsins are photosensitive proteins catalyzing light-dependent processes across the tree of life. For both microbial (type 1) and metazoan (type 2) opsins, photosensing depends upon covalent interaction between a retinal chromophore and a conserved lysine residue. Despite recent discoveries of potential opsin homologs lacking this residue, phylogenetic dispersal and functional significance of these abnormal sequences have not yet been investigated. We report discovery of a large group of putat...

  19. Patterns of species diversity and phylogenetic structure of vascular plants on the Qinghai-Tibetan Plateau

    OpenAIRE

    Yan, Yujing; Yang, Xian; Tang, Zhiyao

    2013-01-01

    Large-scale patterns of species richness and the underlying mechanisms regulating these patterns have long been the central issues in biogeography and macroecology. Phylogenetic community structure is a result of combined effects of contemporary ecological interactions, environmental filtering, and evolutionary history, and it links community ecology with biogeography and trait evolution. The Qinghai-Tibetan Plateau provides a good opportunity to test the influence of contemporary climate on ...

  20. A proteomic approach to discover and compare interacting partners of papillomavirus E2 proteins from diverse phylogenetic groups.

    Science.gov (United States)

    Jang, Moon Kyoo; Anderson, D Eric; van Doorslaer, Koenraad; McBride, Alison A

    2015-06-01

    Papillomaviruses are a very successful group of viruses that replicate persistently in localized regions of the stratified epithelium of their specific host. Infection results in pathologies ranging from asymptomatic infection, benign warts, to malignant carcinomas. Despite this diversity, papillomavirus genomes are small (7-8 kbp) and contain at most eight genes. To sustain the complex papillomaviral life cycle, each viral protein has multiple functions and interacts with and manipulates a plethora of cellular proteins. In this study, we use tandem affinity purification and MS to identify host factors that interact with 11 different papillomavirus E2 proteins from diverse phylogenetic groups. The E2 proteins function in viral transcription and replication and correspondingly interact with host proteins involved in transcription, chromatin remodeling and modification, replication, and RNA processing. PMID:25758368

  1. Phylogenetic diversity and community structure of sponge-associated bacteria from mangroves of the Caribbean Sea

    KAUST Repository

    Yang, Jiangke

    2011-02-08

    To gain insight into the species richness and phylogeny of the microbial communities associated with sponges in mangroves, we performed an extensive phylogenetic analysis, based on terminal restriction fragment length polymorphism profiling and 16S ribosomal RNA gene sequences, of the 4 sponge species Aplysina fulva, Haliclona hogarthi, Tedania ignis and Ircinia strobilina as well as of ambient seawater. The sponge-associated bacterial communities contained 13 phyla, including Poribacteria and an unclassified group not found in the ambient seawater community, 98% of which comprised Proteobacteria, Cyanobacteria and Bacteroidetes. Although the sponges themselves were phylogenetically distant and bacterial community variation within the host species was observed, microbial phyla such as Proteobacteria, Acidobacteria, Chloroflexi and the unclassified group were consistently observed as the dominant populations within the communities. The sponge-associated bacterial communities resident in the Caribbean Sea mangroves are phylogenetically similar but significantly distinct from communities found in other biogeographical sites such as the deep-water environments of the Caribbean Sea, the South China Sea and Australia. The interspecific variation within the host species and the distinct biogeographical characteristics that the sponge-associated bacteria exhibited indicate that the acquisition, establishment and formation of functional sponge-associated bacterial communities may initially be the product of both vertical and horizontal transmission, and is then shaped by the internal environment created by the sponge species and certain external environmental factors. © Inter-Research 2011.

  2. Patterns of taxonomic, phylogenetic diversity during a long-term succession of forest on the Loess Plateau, China: insights into assembly process.

    Science.gov (United States)

    Chai, Yongfu; Yue, Ming; Liu, Xiao; Guo, Yaoxin; Wang, Mao; Xu, Jinshi; Zhang, Chenguang; Chen, Yu; Zhang, Lixia; Zhang, Ruichang

    2016-01-01

    Quantifying the drivers underlying the distribution of biodiversity during succession is a critical issue in ecology and conservation, and also can provide insights into the mechanisms of community assembly. Ninety plots were established in the Loess Plateau region of northern Shaanxi in China. The taxonomic and phylogenetic (alpha and beta) diversity were quantified within six succession stages. Null models were used to test whether phylogenetic distance observed differed from random expectations. Taxonomic beta diversity did not show a regular pattern, while phylogenetic beta diversity decreased throughout succession. The shrub stage occurred as a transition from phylogenetic overdispersion to clustering either for NRI (Net Relatedness Index) or betaNRI. The betaNTI (Nearest Taxon Index) values for early stages were on average phylogenetically random, but for the betaNRI analyses, these stages were phylogenetically overdispersed. Assembly of woody plants differed from that of herbaceous plants during late community succession. We suggest that deterministic and stochastic processes respectively play a role in different aspects of community phylogenetic structure for early succession stage, and that community composition of late succession stage is governed by a deterministic process. In conclusion, the long-lasting evolutionary imprints on the present-day composition of communities arrayed along the succession gradient. PMID:27272407

  3. Bacterial and archaeal dynamics in phylogeny and function in the North Atlantic deep waters

    Science.gov (United States)

    Herndl, G. J.; Brink, M.; Agogue, H.

    2009-04-01

    The diversity and specific functional aspects linked to the N cycle of the bacterio- and archaeoplankton were investigated in the major deep water masses of the North Atlantic following the main driver of the thermohaline circulation, the North Atlantic Deep Water, from 65°N to 5°S. The phylogenetic composition of Bacteria and Archaea is not only depth-dependent but, specific water masses harbor specific prokaryotic communities. The specific composition of these communities in a particular water mass is maintained even over large distances. The distribution of archaeal and bacterial amoA genes were also determined. Archaeal amoA copy numbers decreased drastically with depth especially in the eastern subtropical Atlantic. This coincides with the lower nutrient concentration of the deep waters in the southern parts of the North Atlantic and the older age of the deep-water masses there. These data demonstrate that the diversity and potential nitrification activity are closely linked to the hydrology and chemical characteristics of the major water masses in the North Atlantic.

  4. Ecological Diversity in South American Mammals: Their Geographical Distribution Shows Variable Associations with Phylogenetic Diversity and Does Not Follow the Latitudinal Richness Gradient.

    Science.gov (United States)

    Fergnani, Paula Nilda; Ruggiero, Adriana

    2015-01-01

    The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR) is informative in terms of ecological diversity (ED, an approximation to functional diversity) and phylogenetic diversity (AvPD) using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans), mid-Cenozoic immigrants (hystricognaths, primates) and newcomers (carnivorans, artiodactyls). If closely related species are ecologically more similar than distantly related species, AvPD will be a strong predictor of ED; however, lower ED than predicted from AvPD may be due to species retaining most of their ancestral characters, suggesting niche conservatism. This pattern could occur in tropical rainforests for taxa of tropical affinity (old autochthonous and mid-Cenozoic immigrants) and in open and arid habitats for newcomers. In contrast, higher ED than expected from AvPD could occur, possibly in association with niche evolution, in arid and open habitats for taxa of tropical affinity and in forested habitats for newcomers. We found that TR was a poor predictor of ED and AvPD. After controlling for TR, there was considerable variability in the extent to which AvPD accounted for ED. Taxa of tropical affinity did not support the prediction of ED deficit within tropical rainforests, rather, they showed a mosaic of regions with an excess of ED interspersed with zones of ED deficit within the tropics; newcomers showed ED deficit in arid and open regions. Some taxa of tropical affinity showed excess of ED in tropical desert areas (hystricognaths) or temperate semideserts (xenarthrans); newcomers showed excess of ED at cold-temperate latitudes in the Northern Hemisphere. This result suggests that extreme climatic conditions at both temperate and tropical latitudes may have promoted niche evolution in mammals.

  5. Ecological Diversity in South American Mammals: Their Geographical Distribution Shows Variable Associations with Phylogenetic Diversity and Does Not Follow the Latitudinal Richness Gradient.

    Science.gov (United States)

    Fergnani, Paula Nilda; Ruggiero, Adriana

    2015-01-01

    The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR) is informative in terms of ecological diversity (ED, an approximation to functional diversity) and phylogenetic diversity (AvPD) using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans), mid-Cenozoic immigrants (hystricognaths, primates) and newcomers (carnivorans, artiodactyls). If closely related species are ecologically more similar than distantly related species, AvPD will be a strong predictor of ED; however, lower ED than predicted from AvPD may be due to species retaining most of their ancestral characters, suggesting niche conservatism. This pattern could occur in tropical rainforests for taxa of tropical affinity (old autochthonous and mid-Cenozoic immigrants) and in open and arid habitats for newcomers. In contrast, higher ED than expected from AvPD could occur, possibly in association with niche evolution, in arid and open habitats for taxa of tropical affinity and in forested habitats for newcomers. We found that TR was a poor predictor of ED and AvPD. After controlling for TR, there was considerable variability in the extent to which AvPD accounted for ED. Taxa of tropical affinity did not support the prediction of ED deficit within tropical rainforests, rather, they showed a mosaic of regions with an excess of ED interspersed with zones of ED deficit within the tropics; newcomers showed ED deficit in arid and open regions. Some taxa of tropical affinity showed excess of ED in tropical desert areas (hystricognaths) or temperate semideserts (xenarthrans); newcomers showed excess of ED at cold-temperate latitudes in the Northern Hemisphere. This result suggests that extreme climatic conditions at both temperate and tropical latitudes may have promoted niche evolution in mammals

  6. Ecological Diversity in South American Mammals: Their Geographical Distribution Shows Variable Associations with Phylogenetic Diversity and Does Not Follow the Latitudinal Richness Gradient.

    Directory of Open Access Journals (Sweden)

    Paula Nilda Fergnani

    Full Text Available The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR is informative in terms of ecological diversity (ED, an approximation to functional diversity and phylogenetic diversity (AvPD using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans, mid-Cenozoic immigrants (hystricognaths, primates and newcomers (carnivorans, artiodactyls. If closely related species are ecologically more similar than distantly related species, AvPD will be a strong predictor of ED; however, lower ED than predicted from AvPD may be due to species retaining most of their ancestral characters, suggesting niche conservatism. This pattern could occur in tropical rainforests for taxa of tropical affinity (old autochthonous and mid-Cenozoic immigrants and in open and arid habitats for newcomers. In contrast, higher ED than expected from AvPD could occur, possibly in association with niche evolution, in arid and open habitats for taxa of tropical affinity and in forested habitats for newcomers. We found that TR was a poor predictor of ED and AvPD. After controlling for TR, there was considerable variability in the extent to which AvPD accounted for ED. Taxa of tropical affinity did not support the prediction of ED deficit within tropical rainforests, rather, they showed a mosaic of regions with an excess of ED interspersed with zones of ED deficit within the tropics; newcomers showed ED deficit in arid and open regions. Some taxa of tropical affinity showed excess of ED in tropical desert areas (hystricognaths or temperate semideserts (xenarthrans; newcomers showed excess of ED at cold-temperate latitudes in the Northern Hemisphere. This result suggests that extreme climatic conditions at both temperate and tropical latitudes may have promoted niche evolution in

  7. Phylogenetic diversity of plants alters the effect of species richness on invertebrate herbivory

    OpenAIRE

    Russell Dinnage

    2013-01-01

    Long-standing ecological theory proposes that diverse communities of plants should experience a decrease in herbivory. Yet previous empirical examinations of this hypothesis have revealed that plant species richness increases herbivory in just as many systems as it decreases it. In this study, I ask whether more insight into the role of plant diversity in promoting or suppressing herbivory can be gained by incorporating information about the evolutionary history of species in a community. In ...

  8. Genetic diversity and phylogenetic relationship of Chinese cashmere goats based on microsatellite DNA markers

    OpenAIRE

    Ran Di; Xiaohong He; Jianlin Han; Weijun Guan; Yabin Pu; Qianjun Zhao; Baoling Fu; Yuehui Ma

    2007-01-01

    Genetic diversity of nine indigenous Chinese cashmere goat populations and one West African breed were investigated using 19 microsatellite DNA markers and fluorescence PCR. The aim was to investigate the status of the genetic resources of Chinese cashmere goats. Fourteen of the microsatellite loci were highly polymorphic and effective markers for analysis of genetic diversity and relationship among goat populations. Analysis of polymorphic information content and genetic heterozygosity showe...

  9. Phylogenetic diversity and genotypical complexity of H9N2 influenza A viruses revealed by genomic sequence analysis.

    Directory of Open Access Journals (Sweden)

    Guoying Dong

    Full Text Available H9N2 influenza A viruses have become established worldwide in terrestrial poultry and wild birds, and are occasionally transmitted to mammals including humans and pigs. To comprehensively elucidate the genetic and evolutionary characteristics of H9N2 influenza viruses, we performed a large-scale sequence analysis of 571 viral genomes from the NCBI Influenza Virus Resource Database, representing the spectrum of H9N2 influenza viruses isolated from 1966 to 2009. Our study provides a panoramic framework for better understanding the genesis and evolution of H9N2 influenza viruses, and for describing the history of H9N2 viruses circulating in diverse hosts. Panorama phylogenetic analysis of the eight viral gene segments revealed the complexity and diversity of H9N2 influenza viruses. The 571 H9N2 viral genomes were classified into 74 separate lineages, which had marked host and geographical differences in phylogeny. Panorama genotypical analysis also revealed that H9N2 viruses include at least 98 genotypes, which were further divided according to their HA lineages into seven series (A-G. Phylogenetic analysis of the internal genes showed that H9N2 viruses are closely related to H3, H4, H5, H7, H10, and H14 subtype influenza viruses. Our results indicate that H9N2 viruses have undergone extensive reassortments to generate multiple reassortants and genotypes, suggesting that the continued circulation of multiple genotypical H9N2 viruses throughout the world in diverse hosts has the potential to cause future influenza outbreaks in poultry and epidemics in humans. We propose a nomenclature system for identifying and unifying all lineages and genotypes of H9N2 influenza viruses in order to facilitate international communication on the evolution, ecology and epidemiology of H9N2 influenza viruses.

  10. The Effect of Dietary Replacement of Ordinary Rice with Red Yeast Rice on Nutrient Utilization, Enteric Methane Emission and Rumen Archaeal Diversity in Goats

    Science.gov (United States)

    Wang, L. Z.; Zhou, M. L.; Wang, J. W.; Wu, D.; Yan, T.

    2016-01-01

    Twenty castrated Boer crossbred goats were used in the present study with two treatments to examine the effect of dietary replacement of ordinary rice with red yeast rice on nutrient utilization, enteric methane emission and ruminal archaea structure and composition. Two treatment diets contained (DM basis) 70.0% of forage, 21.8% of concentrates and 8.2% of either ordinary rice (control) or red yeast rice (RYR). Nutrient utilization was measured and enteric methane emissions were determined in respiration chambers. Results showed that RYR had significantly lower digestibility of N and organic matter compared to control group. However, feeding red yeast rice did not affect N retention as g/d or a proportion of N intake, and reduced heat production as MJ/d or as a proportion of metabolizable energy intake, thus leading to a higher proportion of metabolizable energy intake to be retained in body tissue. RYR also had significantly lower methane emissions either as g/d, or as a proportion of feed intake. Although feeding red yeast rice had no negative effect on any rumen fermentation variables, it decreased serum contents of total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol. In the present study, 75616 archaeal sequences were generated and clustered into 2364 Operational Taxonomic Units. At the genus level, the predominant archaea in the rumen of goats was Methanobrevibacter, which was significantly inhibited with the supplementation of red yeast rice. In conclusion, red yeast rice is a potential feed ingredient for mitigation of enteric methane emissions of goats. However, caution should be taken when it is used because it may inhibit the digestibility of some nutrients. Further studies are required to evaluate its potential with different diets and animal species, as well as its effects on animal health and food safety. PMID:27467559

  11. The Effect of Dietary Replacement of Ordinary Rice with Red Yeast Rice on Nutrient Utilization, Enteric Methane Emission and Rumen Archaeal Diversity in Goats.

    Science.gov (United States)

    Wang, L Z; Zhou, M L; Wang, J W; Wu, D; Yan, T

    2016-01-01

    Twenty castrated Boer crossbred goats were used in the present study with two treatments to examine the effect of dietary replacement of ordinary rice with red yeast rice on nutrient utilization, enteric methane emission and ruminal archaea structure and composition. Two treatment diets contained (DM basis) 70.0% of forage, 21.8% of concentrates and 8.2% of either ordinary rice (control) or red yeast rice (RYR). Nutrient utilization was measured and enteric methane emissions were determined in respiration chambers. Results showed that RYR had significantly lower digestibility of N and organic matter compared to control group. However, feeding red yeast rice did not affect N retention as g/d or a proportion of N intake, and reduced heat production as MJ/d or as a proportion of metabolizable energy intake, thus leading to a higher proportion of metabolizable energy intake to be retained in body tissue. RYR also had significantly lower methane emissions either as g/d, or as a proportion of feed intake. Although feeding red yeast rice had no negative effect on any rumen fermentation variables, it decreased serum contents of total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol. In the present study, 75616 archaeal sequences were generated and clustered into 2364 Operational Taxonomic Units. At the genus level, the predominant archaea in the rumen of goats was Methanobrevibacter, which was significantly inhibited with the supplementation of red yeast rice. In conclusion, red yeast rice is a potential feed ingredient for mitigation of enteric methane emissions of goats. However, caution should be taken when it is used because it may inhibit the digestibility of some nutrients. Further studies are required to evaluate its potential with different diets and animal species, as well as its effects on animal health and food safety. PMID:27467559

  12. Patterns of taxonomic, phylogenetic diversity during a long-term succession of forest on the Loess Plateau, China: insights into assembly process

    OpenAIRE

    Yongfu Chai; Ming Yue; Xiao Liu; Yaoxin Guo; Mao Wang; Jinshi Xu; Chenguang Zhang; Yu Chen; Lixia Zhang; Ruichang Zhang

    2016-01-01

    Quantifying the drivers underlying the distribution of biodiversity during succession is a critical issue in ecology and conservation, and also can provide insights into the mechanisms of community assembly. Ninety plots were established in the Loess Plateau region of northern Shaanxi in China. The taxonomic and phylogenetic (alpha and beta) diversity were quantified within six succession stages. Null models were used to test whether phylogenetic distance observed differed from random expecta...

  13. Phylogenetic analysis of VP1 gene sequences of waterfowl parvoviruses from the Mainland of China revealed genetic diversity and recombination.

    Science.gov (United States)

    Wang, Shao; Cheng, Xiao-Xia; Chen, Shao-Ying; Lin, Feng-Qiang; Chen, Shi-Long; Zhu, Xiao-Li; Wang, Jin-Xiang; Huang, Mei-Qing; Zheng, Min

    2016-03-01

    To determine the origin and evolution of goose parvovirus (GPV) and Muscovy duck parvovirus (MDPV) in the Mainland of China, phylogenetic and recombination analyses in the present study were performed on 32 complete VP1 gene sequences from China and other countries. Based on the phylogenetic analysis of the VP1 gene, GPV strains studied here from Mainland China (PRC) could be divided into three genotypes, namely PRC-I, PRC-II and PRC-III. Genotype PRC-I is indigenous to Mainland China. Only one GPV strain from Northeast China was of Genotype PRC-II and was thought to be imported from Europe. Genotype PRC-III, which was the most isolated genotype during 1999-2012, is related to GPVs in Taiwan and has been the predominant pathogen responsible for recent Derzy's disease outbreaks in Mainland China. Current vaccine strains used in Mainland China belong to Genotype PRC-I that is evolutionary distant from Genotypes PRC-II and PRC-III. In comparison, MDPV strains herein from Mainland China are clustered in a single group which is closely related to Taiwanese MDPV strains, and the full-length sequences of the VP1 gene of China MDPVs are phylogenetic closely related to the VP1 sequence of a Hungarian MDPV strain. Moreover, We also found that homologous recombination within VP1 gene plays a role in generating genetic diversity in GPV evolution. The GPV GDFSh from Guangdong Province appears to be the evolutionary product of a recombination event between parental GPV strains GD and B, while the major parent B proved to be a reference strain for virulent European GPVs. Our findings provide valuable information on waterfowl parvoviral evolution in Mainland China.

  14. Environmental constraints underpin the distribution and phylogenetic diversity of nifH in the Yellowstone geothermal complex.

    Science.gov (United States)

    Hamilton, Trinity L; Boyd, Eric S; Peters, John W

    2011-05-01

    Biological nitrogen fixation is a keystone process in many ecosystems, providing bioavailable forms of fixed nitrogen for members of the community. In the present study, degenerate primers targeting the nitrogenase iron protein-encoding gene (nifH) were designed and employed to investigate the physical and chemical parameters that underpin the distribution and diversity of nifH as a proxy for nitrogen-fixing organisms in the geothermal springs of Yellowstone National Park (YNP), Wyoming. nifH was detected in 57 of the 64 YNP springs examined, which varied in pH from 1.90 to 9.78 and temperature from 16°C to 89°C. This suggested that the distribution of nifH in YNP is widespread and is not constrained by pH and temperature alone. Phylogenetic and statistical analysis of nifH recovered from 13 different geothermal spring environments indicated that the phylogeny exhibits evidence for both geographical and ecological structure. Model selection indicated that the phylogenetic relatedness of nifH assemblages could be best explained by the geographic distance between sampling sites. This suggests that nifH assemblages are dispersal limited with respect to the fragmented nature of the YNP geothermal spring environment. The second highest ranking explanatory variable for predicting the phylogenetic relatedness of nifH assemblages was spring water conductivity (a proxy for salinity), suggesting that salinity may constrain the distribution of nifH lineages in geographically isolated YNP spring ecosystems. In summary, these results indicate a widespread distribution of nifH in YNP springs, and suggest a role for geographical and ecological factors in constraining the distribution of nifH lineages in the YNP geothermal complex.

  15. Phylogenetic Diversity of Ammopiptanthus Rhizobia and Distribution of Rhizobia Associated with Ammopiptanthus mongolicus in Diverse Regions of Northwest China.

    Science.gov (United States)

    Zhao, Liang; Wang, Xinye; Huo, Haibo; Yuan, Guiji; Sun, Yali; Zhang, Dehui; Cao, Ying; Xu, Lin; Wei, Gehong

    2016-07-01

    Aiming to investigate the diversity and distribution of rhizobia associated with Ammopiptanthus, an endangered evergreen legume widely distributed in deserts, we characterized a total of 219 nodule isolates from nine sampling sites in Northwest China with different soil characteristics based upon restriction fragment length polymorphism (RFLP) analysis of 16S ribosomal RNA (rRNA) and symbiotic genes (nodC and nifH). Ten isolates representing different 16S rRNA-RFLP types were selected for further sequence analyses of 16S rRNA and four housekeeping genes. As results, nine genospecies belonging to the genera Ensifer, Neorhizobium, Agrobacterium, Pararhizobium, and Rhizobium could be defined among the isolates. The nodC and nifH phylogenies of 14 isolates representing different symbiotic-RFLP types revealed five lineages linked to Ensifer fredii, Ensifer meliloti, Rhizobium leguminosarum, Mesorhizobium amorphae, and Rhizobium gallicum, which demonstrated the various origins and lateral transfers of symbiotic genes between different genera and species. The rhizobial diversities of Ammopiptanthus mongolicus varied among regions, and the community compositions of rhizobia associated with A. mongolicus were significantly different in wild and cultured fields. Constrained correspondence analysis showed that the distribution of A. mongolicus rhizobia could be explained by available potassium content and that the assembly of symbiotic types was mainly affected by available phosphorus content and carbon-nitrogen ratio. PMID:27079453

  16. Phylogenetic Diversity of Diazotrophs along an Experimental Nutrient Gradient in Mangrove Sediments

    Directory of Open Access Journals (Sweden)

    Isabel C. Romero

    2015-07-01

    Full Text Available The diversity of diazotrophs was studied in the sediment of mangrove forests (Twin Cays, Belize subjected to a long-term fertilization with nitrogen and phosphorus. Terminal Restriction Fragment Length Polymorphism (TRFLP and cloning of PCR-amplified nifH genes were combined via in silico analysis to assign clones to TRFLP-nifH phylotypes, as well as to characterize the occurrence of phylotypes in response to environmental conditions. Results indicated that mangrove sediments from Belize harbor a unique diazotrophic community with a low metabolic diversity dominated by sulfate reducers. The variability of potential nitrogen-fixing sulfate reducers was explained by several environmental parameters, primarily by the abundance of dead roots in the sediments, and the concentration of H2S in the pore-waters. This study describes the complexity of microbial communities within the mangrove sediments with specific functional groups varying along environmental gradients.

  17. Common biosynthetic origins for polycyclic tetramate macrolactams from phylogenetically diverse bacteria

    OpenAIRE

    Blodgett, Joshua A. V.; Oh, Dong-Chan; Cao, Shugeng; Currie, Cameron R.; Kolter, Roberto; Clardy, Jon

    2010-01-01

    A combination of small molecule chemistry, biosynthetic analysis, and genome mining has revealed the unexpected conservation of polycyclic tetramate macrolactam biosynthetic loci in diverse bacteria. Initially our chemical analysis of a Streptomyces strain associated with the southern pine beetle led to the discovery of frontalamides A and B, two previously undescribed members of this antibiotic family. Genome analyses and genetic manipulation of the producing organism led to the identificati...

  18. Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs.

    Science.gov (United States)

    Amarouche-Yala, Samia; Benouadah, Ali; El Ouahab Bentabet, Abd; López-García, Purificación

    2014-11-01

    Geothermal springs in Algeria have been known since the Roman Empire. They mainly locate in Eastern Algeria and are inhabited by thermophilic organisms, which include cyanobacteria forming mats and concretions. In this work, we have investigated the cyanobacterial diversity of these springs. Cyanobacteria were collected from water, concretions and mats in nine hot springs with water temperatures ranging from 39 to 93 °C. Samples were collected for isolation in culture, microscopic morphological examination, and molecular diversity analysis based on 16S rRNA gene sequences. Nineteen different cyanobacterial morphotypes were identified, the most abundant of which were three species of Leptolyngbya, accompanied by members of the genera Gloeocapsa, Gloeocapsopsis, Stigonema, Fischerella, Synechocystis, Microcoleus, Cyanobacterium, Chroococcus and Geitlerinema. Molecular diversity analyses were in good general agreement with classical identification and allowed the detection of additional species in three springs with temperatures higher than 50 °C. They corresponded to a Synechococcus clade and to relatives of the intracellularly calcifying Candidatus Gloeomargarita lithophora. The hottest springs were dominated by members of Leptolyngbya, Synechococcus-like cyanobacteria and Gloeomargarita, whereas Oscillatoriales other than Leptolyngbya, Chroococcales and Stigonematales dominated lower temperature springs. The isolation of some of these strains sets the ground for future studies on the biology of thermophilic cyanobacteria.

  19. Anatomical diversity and regressive evolution in trichomanoid filmy ferns (Hymenophyllaceae): a phylogenetic approach.

    Science.gov (United States)

    Dubuisson, Jean-Yves; Hennequin, Sabine; Bary, Sophie; Ebihara, Atsushi; Boucheron-Dubuisson, Elodie

    2011-12-01

    To infer the anatomical evolution of the Hymenophyllaceae (filmy ferns) and to test previously suggested scenarios of regressive evolution, we performed an exhaustive investigation of stem anatomy in the most variable lineage of the family, the trichomanoids, using a representative sampling of 50 species. The evolution of qualitative and quantitative anatomical characters and possibly related growth-forms was analyzed using a maximum likelihood approach. Potential correlations between selected characters were then statistically tested using a phylogenetic comparative method. Our investigations support the anatomical homogeneity of this family at the generic and sub-generic levels. Reduced and sub-collateral/collateral steles likely derived from an ancestral massive protostele, and sub-collateral/collateral types appear to be related to stem thickness reduction and root apparatus regression. These results corroborate the hypothesis of regressive evolution in the lineage, in terms of morphology as well as anatomy. In addition, a heterogeneous cortex, which is derived in the lineage, appears to be related to a colonial strategy and likely to a climbing phenotype. The evolutionary hypotheses proposed in this study lay the ground for further evolutionary analyses that take into account trichomanoid habitats and accurate ecological preferences.

  20. Identification and genomic analysis of transcription factors in archaeal genomes exemplifies their functional architecture and evolutionary origin.

    Science.gov (United States)

    Pérez-Rueda, Ernesto; Janga, Sarath Chandra

    2010-06-01

    Archaea, which represent a large fraction of the phylogenetic diversity of organisms, are prokaryotes with eukaryote-like basal transcriptional machinery. This organization makes the study of their DNA-binding transcription factors (TFs) and their transcriptional regulatory networks particularly interesting. In addition, there are limited experimental data regarding their TFs. In this work, 3,918 TFs were identified and exhaustively analyzed in 52 archaeal genomes. TFs represented less than 5% of the gene products in all the studied species comparable with the number of TFs identified in parasites or intracellular pathogenic bacteria, suggesting a deficit in this class of proteins. A total of 75 families were identified, of which HTH_3, AsnC, TrmB, and ArsR families were universally and abundantly identified in all the archaeal genomes. We found that archaeal TFs are significantly small compared with other protein-coding genes in archaea as well as bacterial TFs, suggesting that a large fraction of these small-sized TFs could supply the probable deficit of TFs in archaea, by possibly forming different combinations of monomers similar to that observed in eukaryotic transcriptional machinery. Our results show that although the DNA-binding domains of archaeal TFs are similar to bacteria, there is an underrepresentation of ligand-binding domains in smaller TFs, which suggests that protein-protein interactions may act as mediators of regulatory feedback, indicating a chimera of bacterial and eukaryotic TFs' functionality. The analysis presented here contributes to the understanding of the details of transcriptional apparatus in archaea and provides a framework for the analysis of regulatory networks in these organisms.

  1. Diversity and phylogenetic analyses of bacteria from a shallow-waterhydrothermal vent in Milos island (Greece

    Directory of Open Access Journals (Sweden)

    Donato eGiovannelli

    2013-07-01

    Full Text Available Studies of shallow-water hydrothermal vents have been lagging behind their deep-sea counterparts. Hence, the importance of these systems and their contribution to the local and regional diversity and biogeochemistry is unclear. This study analyzes the bacterial community along a transect at the shallow-water hydrothermal vent system of Milos island, Greece. The abundance and biomass of the prokaryotic community is comparable to areas not affected by hydrothermal activity and was, on average, 1.34×108 cells g-1. The abundance, biomass and diversity of the prokaryotic community increased with the distance from the center of the vent and appeared to be controlled by the temperature gradient rather than the trophic conditions. The retrieved 16S rRNA gene fragments matched sequences from a variety of geothermal environments, although the average similarity was low (94 %, revealing previously undiscovered taxa. Epsilonproteobacteria constituted the majority of the population along the transect, with an average contribution to the total diversity of 60%. The larger cluster of 16S rRNA gene sequences was related to chemolithoautotrophic Sulfurovum spp., an Epsilonproteobacterium so far detected only at deep-sea hydrothermal vents. The presence of previously unknown lineages of Epsilonproteobacteria could be related to the abundance of organic matter in these systems, which may support alternative metabolic strategies to chemolithoautotrophy. The relative contribution of Gammaproteobacteria to the Milos microbial community increased along the transect as the distance from the center of the vent increased. Further attempts to isolate key species from these ecosystems will be critical to shed light on their evolution and ecology.

  2. Phylogenetic Diversity and Biological Activity of Actinobacteria Isolated from the Chukchi Shelf Marine Sediments in the Arctic Ocean

    Directory of Open Access Journals (Sweden)

    Meng Yuan

    2014-03-01

    Full Text Available Marine environments are a rich source of Actinobacteria and have the potential to produce a wide variety of biologically active secondary metabolites. In this study, we used four selective isolation media to culture Actinobacteria from the sediments collected from the Chukchi Shelf in the Arctic Ocean. A total of 73 actinobacterial strains were isolated. Based on repetitive DNA fingerprinting analysis, we selected 30 representatives for partial characterization according to their phylogenetic diversity, antimicrobial activities and secondary-metabolite biosynthesis genes. Results from the 16S rRNA gene sequence analysis indicated that the 30 strains could be sorted into 18 phylotypes belonging to 14 different genera: Agrococcus, Arsenicicoccus, Arthrobacter, Brevibacterium, Citricoccus, Janibacter, Kocuria, Microbacterium, Microlunatus, Nocardioides, Nocardiopsis, Saccharopolyspora, Salinibacterium and Streptomyces. To our knowledge, this paper is the first report on the isolation of Microlunatus genus members from marine habitats. Of the 30 isolates, 11 strains exhibited antibacterial and/or antifungal activity, seven of which have activities against Bacillus subtilis and Candida albicans. All 30 strains have at least two biosynthetic genes, one-third of which possess more than four biosynthetic genes. This study demonstrates the significant diversity of Actinobacteria in the Chukchi Shelf sediment and their potential for producing biologically active compounds and novel material for genetic manipulation or combinatorial biosynthesis.

  3. Phylogenetic diversity and biological activity of actinobacteria isolated from the Chukchi Shelf marine sediments in the Arctic Ocean.

    Science.gov (United States)

    Yuan, Meng; Yu, Yong; Li, Hui-Rong; Dong, Ning; Zhang, Xiao-Hua

    2014-03-01

    Marine environments are a rich source of Actinobacteria and have the potential to produce a wide variety of biologically active secondary metabolites. In this study, we used four selective isolation media to culture Actinobacteria from the sediments collected from the Chukchi Shelf in the Arctic Ocean. A total of 73 actinobacterial strains were isolated. Based on repetitive DNA fingerprinting analysis, we selected 30 representatives for partial characterization according to their phylogenetic diversity, antimicrobial activities and secondary-metabolite biosynthesis genes. Results from the 16S rRNA gene sequence analysis indicated that the 30 strains could be sorted into 18 phylotypes belonging to 14 different genera: Agrococcus, Arsenicicoccus, Arthrobacter, Brevibacterium, Citricoccus, Janibacter, Kocuria, Microbacterium, Microlunatus, Nocardioides, Nocardiopsis, Saccharopolyspora, Salinibacterium and Streptomyces. To our knowledge, this paper is the first report on the isolation of Microlunatus genus members from marine habitats. Of the 30 isolates, 11 strains exhibited antibacterial and/or antifungal activity, seven of which have activities against Bacillus subtilis and Candida albicans. All 30 strains have at least two biosynthetic genes, one-third of which possess more than four biosynthetic genes. This study demonstrates the significant diversity of Actinobacteria in the Chukchi Shelf sediment and their potential for producing biologically active compounds and novel material for genetic manipulation or combinatorial biosynthesis. PMID:24663116

  4. Phylogenetic diversity of fungal communities in areas accessible and not accessible to tourists in Naracoorte Caves.

    Science.gov (United States)

    Adetutu, Eric M; Thorpe, Krystal; Bourne, Steven; Cao, Xiangsheng; Shahsavari, Esmaeil; Kirby, Greg; Ball, Andrew S

    2011-01-01

    The fungal diversity in areas accessible and not accessible to tourists at UNESCO World Heritage-listed Naracoorte Caves was investigated with culture-dependent and culture-independent techniques for assistance in cave management protocol development. The caves were selected based on tourist numbers and configurations: Stick Tomato (open, high numbers), Alexandra (lockable openings, high numbers) and Strawhaven (control; no access). Culture-based survey revealed Ascomycota dominance irrespective of sampling area with Microascales (Trichurus sp.) being most frequently isolated. Some Hypocreales-like sequences belonging to Fusarium sp., Trichoderma sp. and Neonectria sp. (Stick Tomato) were cultured only from areas not accessible to tourists. These orders also were detected by DGGE assay irrespective of sampling area. The predominance of Ascomycota (especially Microascales) suggested their important ecological roles in these caves. Culture-independent analysis showed higher Shannon fungal diversity values (from ITS-based DGGE profiles) in tourist-accessible areas of these caves than in inaccessible areas with the fungal community banding patterns being substantially different in Stick Tomato Cave. Further investigations are needed to determine the cause of the differences in the fungal communities of Stick Tomato Cave, although cave-related factors such as use, configuration and sediment heterogeneity might have contributed to these differences. PMID:21642344

  5. Archaeal CRISPR-based immune systems

    DEFF Research Database (Denmark)

    Garrett, Roger A; Vestergaard, Gisle Alberg; Shah, Shiraz Ali

    2011-01-01

    CRISPR (clustered regularly interspaced short palindromic repeats)-based immune systems are essentially modular with three primary functions: the excision and integration of new spacers, the processing of CRISPR transcripts to yield mature CRISPR RNAs (crRNAs), and the targeting and cleavage...... of foreign nucleic acid. The primary target appears to be the DNA of foreign genetic elements, but the CRISPR/Cmr system that is widespread amongst archaea also specifically targets and cleaves RNA in vitro. The archaeal CRISPR systems tend to be both diverse and complex. Here we examine evidence...... of CRISPR loci and the evidence for intergenomic exchange of CRISPR systems....

  6. The Cladistic Basis for the Phylogenetic Diversity (PD) Measure Links Evolutionary Features to Environmental Gradients and Supports Broad Applications of Microbial Ecology’s “Phylogenetic Beta Diversity” Framework

    Science.gov (United States)

    Faith, Daniel P.; Lozupone, Catherine A.; Nipperess, David; Knight, Rob

    2009-01-01

    The PD measure of phylogenetic diversity interprets branch lengths cladistically to make inferences about feature diversity. PD calculations extend conventional species-level ecological indices to the features level. The “phylogenetic beta diversity” framework developed by microbial ecologists calculates PD-dissimilarities between community localities. Interpretation of these PD-dissimilarities at the feature level explains the framework’s success in producing ordinations revealing environmental gradients. An example gradients space using PD-dissimilarities illustrates how evolutionary features form unimodal response patterns to gradients. This features model supports new application of existing species-level methods that are robust to unimodal responses, plus novel applications relating to climate change, commercial products discovery, and community assembly. PMID:20087461

  7. The Cladistic Basis for the Phylogenetic Diversity (PD Measure Links Evolutionary Features to Environmental Gradients and Supports Broad Applications of Microbial Ecology’s “Phylogenetic Beta Diversity” Framework

    Directory of Open Access Journals (Sweden)

    Rob Knight

    2009-11-01

    Full Text Available The PD measure of phylogenetic diversity interprets branch lengths cladistically to make inferences about feature diversity. PD calculations extend conventional specieslevel ecological indices to the features level. The “phylogenetic beta diversity” framework developed by microbial ecologists calculates PD-dissimilarities between community localities. Interpretation of these PD-dissimilarities at the feature level explains the framework’s success in producing ordinations revealing environmental gradients. An example gradients space using PD-dissimilarities illustrates how evolutionary features form unimodal response patterns to gradients. This features model supports new application of existing species-level methods that are robust to unimodal responses, plus novel applications relating to climate change, commercial products discovery, and community assembly.

  8. Novel viral genomes identified from six metagenomes reveal wide distribution of archaeal viruses and high viral diversity in terrestrial hot springs

    DEFF Research Database (Denmark)

    Islin, Sóley Ruth; Menzel, Peter; Krogh, Anders;

    2016-01-01

    number of unique contigs and the lack of a completely assembled genome for this family. This is further supported by the large number of novel genes in the complete and partial genomes showing no sequence similarities to public databases. CRISPR analysis revealed hundreds of novel CRISPR loci...... and thousands of novel CRISPR spacers from each metagenome, reinforcing the notion of high viral diversity in the thermal environment....

  9. Diversity of bacteria carried by pinewood nematode in USA and phylogenetic comparison with isolates from other countries.

    Directory of Open Access Journals (Sweden)

    Diogo Neves Proença

    Full Text Available Pine wilt disease (PWD is native to North America and has spread to Asia and Europe. Lately, mutualistic relationship has been suggested between the pinewood nematode (PWN, Bursaphelenchus xylophilus the causal nematode agent of PWD, and bacteria. In countries where PWN occurs, nematodes from diseased trees were reported to carry bacteria from several genera. However no data exists for the United States. The objective of this study was to evaluate the diversity of the bacterial community carried by B. xylophilus, isolated from different Pinus spp. with PWD in Nebraska, United States. The bacteria carried by PWN belonged to Gammaproteobacteria (79.9%, Betaproteobacteria (11.7%, Bacilli (5.0%, Alphaproteobacteria (1.7% and Flavobacteriia (1.7%. Strains from the genera Chryseobacterium and Pigmentiphaga were found associated with the nematode for the first time. These results were compared to results from similar studies conducted from other countries of three continents in order to assess the diversity of bacteria with associated with PWN. The isolates from the United States, Portugal and China belonged to 25 different genera and only strains from the genus Pseudomonas were found in nematodes from all countries. The strains from China were closely related to P. fluorescens and the strains isolated from Portugal and USA were phylogenetically related to P. mohnii and P. lutea. Nematodes from the different countries are associated with bacteria of different species, not supporting a relationship between PWN with a particular bacterial species. Moreover, the diversity of the bacteria carried by the pinewood nematode seems to be related to the geographic area and the Pinus species. The roles these bacteria play within the pine trees or when associated with the nematodes, might be independent of the presence of the nematode in the tree and only related on the bacteria's relationship with the tree.

  10. Phylogenetic diversity and evolutionary relatedness of alkenone-producing haptophyte algae in lakes: Implications for continental paleotemperature reconstructions

    Science.gov (United States)

    Theroux, Susanna; D'Andrea, William J.; Toney, Jaime; Amaral-Zettler, Linda; Huang, Yongsong

    2010-12-01

    Alkenones have been found in an increasing number of lakes around the world, making them a promising new tool for continental paleoclimate reconstruction. However, individual lakes may harbor different species of haptophyte algae with different sensitivities to temperature variations, thus presenting a significant challenge to the use of lacustrine alkenones for paleotemperature reconstructions. To explore the extent of lacustrine haptophyte diversity, we conducted the first comprehensive phylogenetic and geochemical survey of lacustrine alkenone producers. We sampled 15 alkenone-containing lake surface sediments from a variety of geographic locales and inferred identities of environmental sequences using 18S ribosomal RNA (rRNA) gene-based phylogenies. For two lakes, BrayaSø in southwest Greenland and Tso Ur on the Tibetan Plateau, we also analyzed both surface and downcore sediments to characterize haptophyte populations through time. In parallel with phylogenetic analyses, we determined the alkenone distributions (including C 37/C 38 ratios, and the presence/absence of C 38 methyl ketones and C 40 compounds) in all the samples. The resulting alkenone profiles from this study do not all align with traditional "marine" versus "coastal/lacustrine" alkenone profiles. Additionally, our genetic data indicate the presence of multiple haptophyte species from a single lake sediment sample; these distinct haptophyte populations could not be discerned from the alkenone profiles alone. These results show that alkenone profiles are not a reliable way to assess the haptophyte algae in lakes and that DNA fingerprinting is a preferred approach for species identification. Although closely related haptophyte species or subspecies may not warrant different temperature calibrations, our results emphasize the importance of genetic data for inferring haptophyte identities and eventually selecting alkenone-temperature calibrations for paleoclimate reconstructions.

  11. Phosphate Solubilizing Ability and Phylogenetic Diversity of Bacteria from P-Rich Soils Around Dianchi Lake Drainage Area of China

    Institute of Scientific and Technical Information of China (English)

    YANG Pei-Xiang; YANG Fa-Xiang; MA Li; CHEN Ming-Hui; XI Jia-Qin; HE Feng; DUAN Chang-Qun; MO Ming-He; FANG Dun-Huang; DUAN Yan-Qing

    2012-01-01

    The phylogenetic diversity of phosphate solubilizing bacteria (PSB) distributed in P-rich soils in the Dianchi Lake drainage area of China was characterized,and the tricalcium phosphate (TCP) solubilizing activities of isolated PSB were determined.Among 1328 bacteria isolated from 100 P-rich soil samples,377 isolates (28.39% of the total) that exhibited TCP solubilization activity were taken as PSB.These PSB showed different abilities to solubilize TCP,with the concentrations of solubilized P in bacterial cultures varying from 33.48 to 69.63 mg L -1.A total of 123 PSB isolates,with relatively high TCP solubilization activity (> 54.00mg L-1),were submitted for restriction fragment length polymorphism (RFLP) analysis,which revealed 32 unique RFLP patterns.Based on these patterns,62 representative isolates,one to three from each RFLP pattern,were selected for 16S rRNA sequencing Phylogenetic analysis placed the 123 PSB into three bacterial phyla,namely proteobacteria,Actinobacteria and Firrnicutes.Members of proteobacteria were the dominant PSB,where 107 isolates represented by 26 RFLP patterns were associated with the genera of Burkholdema,Pseudomonas,Acinetobacter,Enterobacter,Pantoea,Serratia,Klebsiella,Leclercia,Raoultella and Cedecea.Firmicutes were the subdominant group,in which 13 isolates were affiliated with the genera of Bacillus and Brevibacterium.The remaining 3 isolates were identified as three species of the genus Arthrobacter.This research extends the knowledge on PSB in P-rich soils and broadens the spectrum of PSB for the development of environmentally friendly biophosphate fertilizers.

  12. Phylogenetic diversity and genotypic complexity of H1N1 subtype swine influenza viruses isolated in Mainland China

    Directory of Open Access Journals (Sweden)

    Liu Yizhi

    2012-11-01

    Full Text Available Abstract Background After the occurrence of 2009 pandemic H1N1, close attention has been paid to the H1N1 subtype swine influenza viruses (H1N1 SIV by scientific communities in many countries. A large-scale sequence analysis of the NCBI Influenza Virus Resource Database on H1N1 SIVs submitted primarily by scientists in China during 1992 to 2011 was performed. The aims of this study were to elucidate the genetic and evolutionary characteristics of H1N1 SIVs, to identify and unify the lineages and genetic characteristics of the H1N1 SIVs isolated in mainland China. Results Most of the strains were isolated during the period of 2008 to 2010 from Guangdong and Shandong provinces, China. Based on the phylogenetic and genotypic analyses, all of the H1N1 SIV strains can be classified into 8 lineages and 10 genotypes. All strains were of the characteristics of low pathogenic influenza viruses. The viruses of different lineage are characterized with different amino acid residues at the receptor-binding sites. Viruses containing PB2 genes of the classical swine, early seasonal human and recent seasonal human lineage might be more infectious to human. Some genotypes were directly related with human influenza viruses, which include strains that harbored genes derived from human influenza viruses. Conclusions Phylogenetic diversity and complexity existed in H1N1 SIVs isolated in mainland China. These H1N1 SIV strains were closely related to other subtype influenza viruses, especially to human influenza viruses. Moreover, it was shown that, novel lineages and genotypes of H1N1 SIVs emerged recently in mainland China. These findings provided new and essential information for further understanding of the genetic and evolutionary characteristics and monitoring the H1N1 SIVs in mainland China.

  13. Relevance of free-living amoebae as hosts for phylogenetically diverse microorganisms.

    Science.gov (United States)

    Scheid, Patrick

    2014-07-01

    In addition to their role as parasites, free-living amoebae (FLA) can act as hosts of and vehicles for phylogentically diverse microorganisms while some of them replicate intracellularly. These microorganisms are adapted to the intracellular conditions in the amoeba, find suitable conditions and protection from negative environmental influences and take advantage of the dispersal in the environment by their amoebic host. It is expedient to call these organisms "endocytobionts", at least during the initial steps of any studies. By doing so, it is not necessary to go into potential characteristics of these relationships such as parasitism, phoresy, zoochory, or mutualism at an early stage of study. Among those organisms resisting the lysis within their amoebic host, there are obligate and facultative pathogenic microorganisms affecting the health of humans or animals. FLA-endocytobiont relationships are not only important for the tenacity of the involved microorganisms. Especially if FLA are present in biofilms and there are close ties with many other microorganisms, the odds are for some of these microorganisms to develop human pathogenic properties. Here, the amoebic passage seems to be a prerequisite for the development of virulence factors and it may have an impact on evolutionary processes.

  14. Comparison of Archaeal and Bacterial Diversity in Methane Seep Carbonate Nodules and Host Sediments, Eel River Basin and Hydrate Ridge, USA.

    Science.gov (United States)

    Mason, Olivia U; Case, David H; Naehr, Thomas H; Lee, Raymond W; Thomas, Randal B; Bailey, Jake V; Orphan, Victoria J

    2015-10-01

    Anaerobic oxidation of methane (AOM) impacts carbon cycling by acting as a methane sink and by sequestering inorganic carbon via AOM-induced carbonate precipitation. These precipitates commonly take the form of carbonate nodules that form within methane seep sediments. The timing and sequence of nodule formation within methane seep sediments are not well understood. Further, the microbial diversity associated with sediment-hosted nodules has not been well characterized and the degree to which nodules reflect the microbial assemblage in surrounding sediments is unknown. Here, we conducted a comparative study of microbial assemblages in methane-derived authigenic carbonate nodules and their host sediments using molecular, mineralogical, and geochemical methods. Analysis of 16S rRNA gene diversity from paired carbonate nodules and sediments revealed that both sample types contained methanotrophic archaea (ANME-1 and ANME-2) and syntrophic sulfate-reducing bacteria (Desulfobacteraceae and Desulfobulbaceae), as well as other microbial community members. The combination of geochemical and molecular data from Eel River Basin and Hydrate Ridge suggested that some nodules formed in situ and captured the local sediment-hosted microbial community, while other nodules may have been translocated or may represent a record of conditions prior to the contemporary environment. Taken together, this comparative analysis offers clues to the formation regimes and mechanisms of sediment-hosted carbonate nodules. PMID:25947096

  15. Comparison of Archaeal and Bacterial Diversity in Methane Seep Carbonate Nodules and Host Sediments, Eel River Basin and Hydrate Ridge, USA.

    Science.gov (United States)

    Mason, Olivia U; Case, David H; Naehr, Thomas H; Lee, Raymond W; Thomas, Randal B; Bailey, Jake V; Orphan, Victoria J

    2015-10-01

    Anaerobic oxidation of methane (AOM) impacts carbon cycling by acting as a methane sink and by sequestering inorganic carbon via AOM-induced carbonate precipitation. These precipitates commonly take the form of carbonate nodules that form within methane seep sediments. The timing and sequence of nodule formation within methane seep sediments are not well understood. Further, the microbial diversity associated with sediment-hosted nodules has not been well characterized and the degree to which nodules reflect the microbial assemblage in surrounding sediments is unknown. Here, we conducted a comparative study of microbial assemblages in methane-derived authigenic carbonate nodules and their host sediments using molecular, mineralogical, and geochemical methods. Analysis of 16S rRNA gene diversity from paired carbonate nodules and sediments revealed that both sample types contained methanotrophic archaea (ANME-1 and ANME-2) and syntrophic sulfate-reducing bacteria (Desulfobacteraceae and Desulfobulbaceae), as well as other microbial community members. The combination of geochemical and molecular data from Eel River Basin and Hydrate Ridge suggested that some nodules formed in situ and captured the local sediment-hosted microbial community, while other nodules may have been translocated or may represent a record of conditions prior to the contemporary environment. Taken together, this comparative analysis offers clues to the formation regimes and mechanisms of sediment-hosted carbonate nodules.

  16. Bacterial phylogenetic diversity in a constructed wetland system treating acid coal mine drainage

    Energy Technology Data Exchange (ETDEWEB)

    Nicorarat, D.; Dick, W.A.; Dopson, M.; Tuovinen, O.H. [Ohio State University, Columbus, OH (USA)

    2008-02-15

    Microorganisms in acid mine drainage are typically acidophiles that mediate the oxidation of reduced compounds of iron and sulfur. However, microbial populations in wetland systems constructed to treat acid mine drainage are not well characterized. This study was to analyze bacterial diversity, using cultivation-independent molecular ecological techniques, in a constructed wetland that received acid drainage from an abandoned underground coal mine. DNA was purified from Fe(III)-precipitates from the oxidized surface zone of wetland sediments and 16S rRNA gene sequences were amplified and cloned. A total of 200 clones were analyzed by restriction fragment length polymorphism (RFLP) and 77 unique RFLP patterns were obtained with four restriction enzymes. Of these patterns, 30 most dominant unique clones were selected for sequencing of their 16S rRNA genes. Half of these 30 clones could be matched with autotrophic iron- and sulfur-oxidizing bacteria (Acidithiohacillus ferrooxidans and Acidithiobacillus thiooxidans). Several clones also formed a clade with heterotrophic iron-oxidizing bacteria (TRA2-10, TRA3-20, and TRA5-3) and heterotrophic bacteria (Stenotrophomas maltophilia, Bordetella spp., Alcalgenes sp., Alcaligenesfaecalis, and Alcaligenes xylosoxidans). Approximately 40% and 35% of the analyzed RFLP restriction patterns were consistent with A. ferrooxidans and A. thiooxidans, respectively. The relatively high frequency of acidithiobacilli is consistent with the chemical and physical characteristics of this site i.e., continuous, abundant supply of reduced iron and sulfur compounds, pH 3-4, ambient temperature, and limited organics originating from the coal seam and from vegetation or soil surrounding the inlet channel to the wetland.

  17. Phylogenetic diversity of alkaline protease-producing psychrotrophic bacteria from glacier and cold environments of Lahaul and Spiti, India.

    Science.gov (United States)

    Salwan, Richa; Gulati, Arvind; Kasana, Ramesh Chand

    2010-04-01

    The diversity of proteolytic bacteria associated with a glacier and cold environment soils from three different locations in Lahaul and Spiti, India was investigated. Two hundred seventeen bacterial strains were isolated in pure culture. Subsequently these strains were screened for protease-production and one hundred nine showed protease production. From these protease producing psychrotrophic bacteria twenty showing high enzyme production at low temperature and alkaline pH were characterized and identified. The 16S rRNA phylogenetic analysis revealed that none of the strains showed 100% identity with the validly published species of various genera. Isolates belonged to three classes i.e. Actinobacteria, Gammaproteobacteria and Alphaproteobacteria, and were affiliated with the genera Acinetobacter, Arthrobacter, Mycoplana, Pseudomonas, Pseudoxanthomonas, Serratia and Stenotrophomonas. The optimal growth temperature ranged from 10 to 28 degrees C and interestingly, high levels of enzyme productions were measured at growth temperatures between 15 and 25 degrees C, for most of the isolates in plate assay. Most of the isolates were found to produce at least two other hydrolytic enzymes along with protease. The crude protease from one strain was active over broad range of temperature and pH with optima at 30 degrees C and 7.5, respectively. The protease activity was enhanced by Ca(2+), dithiothreitol and beta-mercaptoethanol. While Na(+), Hg(2+), Zn(2+), Mn(2+), phenylmethanesulfonyl fluoride and ethylenediaminetetraacetic acid did not showed much effect on protease activity. The results enrich our knowledge on the psychrotrophic bacterial diversity and biogeographic distribution of enzyme producing bacteria in western Himalaya. PMID:20082368

  18. Structural diversity of eukaryotic 18S rRNA and its impact on alignment and phylogenetic reconstruction.

    Science.gov (United States)

    Xie, Qiang; Lin, Jinzhong; Qin, Yan; Zhou, Jianfu; Bu, Wenjun

    2011-02-01

    Ribosomal RNAs are important because they catalyze the synthesis of peptides and proteins. Comparative studies of the secondary structure of 18S rRNA have revealed the basic locations of its many length-conserved and length-variable regions. In recent years, many more sequences of 18S rDNA with unusual lengths have been documented in GenBank. These data make it possible to recognize the diversity of the secondary and tertiary structures of 18S rRNAs and to identify the length-conserved parts of 18S rDNAs. The longest 18S rDNA sequences of almost every known eukaryotic phylum were included in this study. We illustrated the bioinformatics-based structure to show that, the regions that are more length-variable, regions that are less length-variable, the splicing sites for introns, and the sites of A-minor interactions are mostly distributed in different parts of the 18S rRNA. Additionally, this study revealed that some length-variable regions or insertion positions could be quite close to the functional part of the 18S rRNA of Foraminifera organisms. The tertiary structure as well as the secondary structure of 18S rRNA can be more diverse than what was previously supposed. Besides revealing how this interesting gene evolves, it can help to remove ambiguity from the alignment of eukaryotic 18S rDNAs and to improve the performance of 18S rDNA in phylogenetic reconstruction. Six nucleotides shared by Archaea and Eukaryota but rarely by Bacteria are also reported here for the first time, which might further support the supposed origin of eukaryote from archaeans.

  19. Phylogenetic and functional diversity within toluene-degrading, sulphate-reducing consortia enriched from a contaminated aquifer.

    Science.gov (United States)

    Kuppardt, Anke; Kleinsteuber, Sabine; Vogt, Carsten; Lüders, Tillmann; Harms, Hauke; Chatzinotas, Antonis

    2014-08-01

    Three toluene-degrading microbial consortia were enriched under sulphate-reducing conditions from different zones of a benzene, toluene, ethylbenzene and xylenes (BTEX) plume of two connected contaminated aquifers. Two cultures were obtained from a weakly contaminated zone of the lower aquifer, while one culture originated from the highly contaminated upper aquifer. We hypothesised that the different habitat characteristics are reflected by distinct degrader populations. Degradation of toluene with concomitant production of sulphide was demonstrated in laboratory microcosms and the enrichment cultures were phylogenetically characterised. The benzylsuccinate synthase alpha-subunit (bssA) marker gene, encoding the enzyme initiating anaerobic toluene degradation, was targeted to characterise the catabolic diversity within the enrichment cultures. It was shown that the hydrogeochemical parameters in the different zones of the plume determined the microbial composition of the enrichment cultures. Both enrichment cultures from the weakly contaminated zone were of a very similar composition, dominated by Deltaproteobacteria with the Desulfobulbaceae (a Desulfopila-related phylotype) as key players. Two different bssA sequence types were found, which were both affiliated to genes from sulphate-reducing Deltaproteobacteria. In contrast, the enrichment culture from the highly contaminated zone was dominated by Clostridia with a Desulfosporosinus-related phylotype as presumed key player. A distinct bssA sequence type with high similarity to other recently detected sequences from clostridial toluene degraders was dominant in this culture. This work contributes to our understanding of the niche partitioning between degrader populations in distinct compartments of BTEX-contaminated aquifers.

  20. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Directory of Open Access Journals (Sweden)

    Pasupuleti Sreenivasa Rao

    2013-08-01

    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  1. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.

    Directory of Open Access Journals (Sweden)

    Jin-Kyung Hong

    Full Text Available Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7% belonged to the MG-I and SCG, which together contained most (93.9% of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and 95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and ecological niche of Thaumarchaeota.

  2. Phylogenetic congruence and ecological coherence in terrestrial Thaumarchaeota.

    Science.gov (United States)

    Oton, Eduard Vico; Quince, Christopher; Nicol, Graeme W; Prosser, James I; Gubry-Rangin, Cécile

    2016-01-01

    Thaumarchaeota form a ubiquitously distributed archaeal phylum, comprising both the ammonia-oxidising archaea (AOA) and other archaeal groups in which ammonia oxidation has not been demonstrated (including Group 1.1c and Group 1.3). The ecology of AOA in terrestrial environments has been extensively studied using either a functional gene, encoding ammonia monooxygenase subunit A (amoA) or 16S ribosomal RNA (rRNA) genes, which show phylogenetic coherence with respect to soil pH. To test phylogenetic congruence between these two markers and to determine ecological coherence in all Thaumarchaeota, we performed high-throughput sequencing of 16S rRNA and amoA genes in 46 UK soils presenting 29 available contextual soil characteristics. Adaptation to pH and organic matter content reflected strong ecological coherence at various levels of taxonomic resolution for Thaumarchaeota (AOA and non-AOA), whereas nitrogen, total mineralisable nitrogen and zinc concentration were also important factors associated with AOA thaumarchaeotal community distribution. Other significant associations with environmental factors were also detected for amoA and 16S rRNA genes, reflecting different diversity characteristics between these two markers. Nonetheless, there was significant statistical congruence between the markers at fine phylogenetic resolution, supporting the hypothesis of low horizontal gene transfer between Thaumarchaeota. Group 1.1c Thaumarchaeota were also widely distributed, with two clusters predominating, particularly in environments with higher moisture content and organic matter, whereas a similar ecological pattern was observed for Group 1.3 Thaumarchaeota. The ecological and phylogenetic congruence identified is fundamental to understand better the life strategies, evolutionary history and ecosystem function of the Thaumarchaeota. PMID:26140533

  3. Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource

    Directory of Open Access Journals (Sweden)

    Sharpton Thomas J

    2012-10-01

    Full Text Available Abstract Background New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. Results We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as “Sifting Families,” or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology–based analyses. Conclusions We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/.

  4. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    Science.gov (United States)

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  5. Diversity of Archaea and detection of crenarchaeotal amoA genes in the rivers Rhine and Têt

    OpenAIRE

    Herfort, L.; Kim, J.H.; M J L Coolen; Abbas, B.; Schouten, S; Herndl, G. J.; Sinninghe Damste, J.S.

    2009-01-01

    Pelagic archaeal phylogenetic diversity and the potential for crenarchaeotal nitrification of Group 1.1a were determined in the rivers Rhine and Têt by 16S rRNA sequencing, catalyzed reported deposition-fluorescence in situ hybridization (CARD–FISH) and quantification of 16S rRNA and functional genes. Euryarchaeota were, for the first time, detected in temperate river water even though a net predominance of crenarchaeotal phylotypes was found. Differences in phylogenic distribution were obser...

  6. Archaeal diversity in Icelandic hot springs

    DEFF Research Database (Denmark)

    Kvist, Thomas; Ahring, Birgitte Kiær; Westermann, Peter

    2007-01-01

    enzymes AluI and BsuRI. The sequenced clones from this solfatara belonged to Sulfolobales, Thermoproteales or were most closest related to sequences from uncultured Archaea. Sequences related to group I.1b were not found in the neutral hot spring or the hyperthermophilic solfatara (90 degrees C)....

  7. Shaping the Archaeal Cell Envelope

    NARCIS (Netherlands)

    Ellen, Albert F.; Zolghadr, Behnam; Driessen, Arnold M. J.; Albers, Sonja-Verena

    2010-01-01

    Although archaea have a similar cellular organization as other prokaryotes, the lipid composition of their membranes and their cell surface is unique. Here we discuss recent developments in our understanding of the archaeal protein secretion mechanisms, the assembly of macromolecular cell surface st

  8. Archaeal virus-host interactions

    NARCIS (Netherlands)

    Quax, T.E.F.

    2013-01-01

      The work presented in this thesis provides novel insights in several aspects of the molecular biology of archaea, bacteria and their viruses. Three fundamentally different groups of viruses are associated with the three domains of life. Archaeal viruses are characterized by a particularly

  9. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest

    OpenAIRE

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2010-01-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees wer...

  10. Phylogenetic diversity of culturable fungi from the deep-sea sediments of the central Indian Basin and their growth characteristics

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    of sporulating cultures mostly matched either with 18S or ITS sequences but seldom with both the sequences. Phylogenetic analysis of ascomycetes using 18S sequence data grouped them into 7 clusters belonging to Aspergillus sp., Sagenomella sp., Exophiala sp...

  11. Global analysis of viral infection in an archaeal model system

    Directory of Open Access Journals (Sweden)

    Walid S. Maaty

    2012-12-01

    Full Text Available The origin and evolutionary relationship of viruses is poorly understood. This makes archaeal virus-host of particular interest because the hosts generally root near the base of phylogenetic trees, while some of the viruses have clear structural similarities to those that infect prokaryotic and eukaryotic cells. Despite the advantageous position for use in evolutionary studies, little is known about archaeal viruses or how they interact with their hosts, compared to viruses of bacteria and eukaryotes. In addition, many archaeal viruses have been isolated from extreme environments and present a unique opportunity for elucidating factors that are important for existence at the extremes.. In this article we focus on virus-host interactions using a proteomics approach to study Sulfolobus Turreted Icosahedral Virus (STIV infection of Sulfolobus solfataricus P2. Using cultures grown from the ATCC cell stock, a single cycle of STIV infection was sampled 6 times over a 72 hr period. More than 700 proteins were identified throughout the course of the experiments. Seventy one host proteins were found to change by nearly two-fold (p<0.05 with 40 becoming more abundant and 31 less abundant. The modulated proteins represent 30 different cell pathways and 14 COG groups. 2D gel analysis showed that changes in post translational modifications were a common feature of the affected proteins. The results from these studies showed that the prokaryotic antiviral adaptive immune system CRISPR associated proteins (CAS proteins were regulated in response to the virus infection. It was found that regulated proteins come from mRNAs with a shorter than average half-life. In addition, activity-based protein profiling (ABPP profiling on 2D gels showed caspase, hydrolase and tyrosine phosphatase enzyme activity labeling at the protein isoform level. Together, this data provides a more detailed global view of archaeal cellular responses to viral infection, demonstrates the

  12. Thrombin-like enzymes from venom gland of Deinagkistrodon acutus:cDNA cloning, mechanism of diversity and phylogenetic tree construction

    Institute of Scientific and Technical Information of China (English)

    Xiang-dong ZHA; He-sheng HUANG; Li-zhi ZHOU; Jing LIU; Kang-sen XU

    2006-01-01

    Aim: To clone cDNAs of thrombin-like enzymes (TLEs) from venom gland of Deinagkistrodon acutus and analyze the mechanisms by which their structural diversity arose. Methods: Reverse transcription-polymerase chain reaction and gene cloning techniques were used, and the cloned sequences were analyzed by using bioinformatics tools. Results: Novel cDNAs of snake venom TLEs were cloned. The possibilities of post-transcriptional recombination and horizontal gene transfer are discussed. A phylogenetic tree was constructed. Conclusion:The cDNAs of snake venom TLEs exhibit great diversification. There are several types of structural variations. These variations may be attributable to certain mechanisms including recombination.

  13. A phylogenetic perspective on diversity of Galatheoidea (Munida, Munidopsis) from cold-water coral and cold seep communities in the western North Atlantic Ocean

    Science.gov (United States)

    Coykendall, Dolly K.; Nizinski, Martha S.; Morrison, Cheryl

    2016-01-01

    Squat lobsters (Galatheoidea and Chirostyloidea), a diverse group of decapod crustaceans, are ubiquitous members of the deep-sea fauna. Within Galatheoidea, the genera Munida and Munidopsis are the most diverse, but accurate estimates of biodiversity are difficult due to morphological complexity and cryptic diversity. Four species of Munida and nine species of Munidopsis from cold-water coral (CWC) and cold seep communities in the northwestern Atlantic Ocean (NWA) and the Gulf of Mexico (GOM) were collected over eleven years and fifteen research cruises in order to assess faunal associations and estimate squat lobster biodiversity. Identification of the majority of specimens was determined morphologically. Mitochondrial COI sequence data, obtained from material collected during these research cruises, was supplemented with published sequences of congeners from other regions. The phylogenetic analysis of Munida supports three of the four NWA and GOM species (M. microphthalma, M. sanctipauli, and M. valida) as closely related taxa. The fourth species, Munida iris, is basal to most other species of Munida, and is closely related to M. rutllanti, a species found in the northeastern Atlantic Ocean (NEA). The majority of the nine species of Munidopsis included in our analyses were collected from chemosynthetic cold seep sites from the GOM. While seep taxa were scattered throughout the phylogenetic tree, four of these species (Munidopsis livida, M. similis, M. bermudezi, and M. species A) from the NWA and the GOM were part of a large eighteen-species clade that included species collected from Pacific Ocean chemosynthetic habitats, such as hydrothermal vents and whale falls. Shinkaia crosnieri was the sister taxon to the chemosynthetic clade, and M. livida was the most basal member of this clade. Munidopsis sp. B, an undescribed species with representative individuals collected from two GOM chemosynthetic sites, exhibited the largest genetic distance from other northern

  14. Specific bacterial, archaeal, and eukaryotic communities in tidal-flat sediments along a vertical profile of several meters.

    Science.gov (United States)

    Wilms, Reinhard; Sass, Henrik; Köpke, Beate; Köster, Jürgen; Cypionka, Heribert; Engelen, Bert

    2006-04-01

    The subsurface of a tidal-flat sediment was analyzed down to 360 cm in depth by molecular and geochemical methods. A community structure analysis of all three domains of life was performed using domain-specific PCR followed by denaturing gradient gel electrophoresis analysis and sequencing of characteristic bands. The sediment column comprised horizons easily distinguishable by lithology that were deposited in intertidal and salt marsh environments. The pore water profile was characterized by a subsurface sulfate peak at a depth of about 250 cm. Methane and sulfate profiles were opposed, showing increased methane concentrations in the sulfate-free layers. The availability of organic carbon appeared to have the most pronounced effect on the bacterial community composition in deeper sediment layers. In general, the bacterial community was dominated by fermenters and syntrophic bacteria. The depth distribution of methanogenic archaea correlated with the sulfate profile and could be explained by electron donor competition with sulfate-reducing bacteria. Sequences affiliated with the typically hydrogenotrophic Methanomicrobiales were present in sulfate-free layers. Archaea belonging to the Methanosarcinales that utilize noncompetitive substrates were found along the entire anoxic-sediment column. Primers targeting the eukaryotic 18S rRNA gene revealed the presence of a subset of archaeal sequences in the deeper part of the sediment cores. The phylogenetic distance to other archaeal sequences indicates that these organisms represent a new phylogenetic group, proposed as "tidal-flat cluster 1." Eukarya were still detectable at 360 cm, even though their diversity decreased with depth. Most of the eukaryotic sequences were distantly related to those of grazers and deposit feeders.

  15. Phylogenetic relationships between the six superoxide dismutase proteins (FeSOD of Trichomonas vaginalis and FeSOD6 genetic diversity

    Directory of Open Access Journals (Sweden)

    Hwang U.W

    2002-03-01

    Full Text Available The parasitic protozoan Trichomonas vaginalis is known to contain several types of Fe-containing superoxide dismutase proteins (FeSOD. Using three different methods of phylogenetic analysis, maximum parsimony (MP, neighbor joining (NJ, and maximum likelihood (ML methods, we examined the phylogenetic relationships among the six FeSOD (FeSOD1-FeSOD6 based on their amino acid sequences. All the analyses consistently suggested that the six proteins formed a monophyletic group implying that they probably be originated from an ancestral protein form through repeated duplication events. Although MP tree was totally unresolved, the NJ and ML trees revealed that FeSOD6 placed the most basal position and thus emerged earlier than the other five gene types during the evolution of T. vaginalis. Phylogenetic relationships among the five remaining proteins were (FeSOD2, FeSOD3, (FeSOD4, (FeSODl, FeSOD5 although weakly supported in terms of bootstrapping values. In addition to this, we newly designed two PCR primer specifically amplifying full-length FeSOD6 gene and examined its genetic diversity among 1 2 T. vaginalis isolates from five countries and three continents. They had the same nucleotide sequences except those of three Korean isolates which showed one to three different nucleotides

  16. Multilocus phylogenetic analyses reveal unexpected abundant diversity and significant disjunct distribution pattern of the Hedgehog Mushrooms (Hydnum L.).

    Science.gov (United States)

    Feng, Bang; Wang, Xiang-Hua; Ratkowsky, David; Gates, Genevieve; Lee, Su See; Grebenc, Tine; Yang, Zhu L

    2016-01-01

    Hydnum is a fungal genus proposed by Linnaeus in the early time of modern taxonomy. It contains several ectomycorrhizal species which are commonly consumed worldwide. However, Hydnum is one of the most understudied fungal genera, especially from a molecular phylogenetic view. In this study, we extensively gathered specimens of Hydnum from Asia, Europe, America and Australasia, and analyzed them by using sequences of four gene fragments (ITS, nrLSU, tef1α and rpb1). Our phylogenetic analyses recognized at least 31 phylogenetic species within Hydnum, 15 of which were reported for the first time. Most Australasian species were recognized as strongly divergent old relics, but recent migration between Australasia and the Northern Hemisphere was also detected. Within the Northern Hemisphere, frequent historical biota exchanges between the Old World and the New World via both the North Atlantic Land Bridge and the Bering Land Bridge could be elucidated. Our study also revealed that most Hydnum species found in subalpine areas of the Hengduan Mountains in southwestern China occur in northeastern/northern China and Europe, indicating that the composition of the mycobiota in the Hengduan Mountains reigion is more complicated than what we have known before. PMID:27151256

  17. Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

    DEFF Research Database (Denmark)

    Nielsen, L; Arctander, P; Jensen, T H;

    2009-01-01

    To investigate the possible origin and spread of the dramatic re-emergent 2002 distemper epizootic observed among seals in Danish Waters, we have sequenced wild-type genes of the attachment (H) glycoproteins of viruses from both the 2002 and 1988 epizootics. Phylogenetic analysis of the H genes o...... epizootic in Danish Waters was investigated and determined to be caused by canine distemper virus, the closest relative of PDV, revealing no direct epidemiological link to the seal epizootics. (C) 2009 Elsevier B.V. All rights reserved....

  18. Composition of bacterial and archaeal communities during landfill refuse decomposition processes.

    Science.gov (United States)

    Song, Liyan; Wang, Yangqing; Zhao, Heping; Long, David T

    2015-12-01

    Little is known about the archaeal and the bacterial diversities in a landfill during different phases of decomposition. In this study, the archaeal and the bacterial diversities of Laogang landfill (Shanghai, China) at two different decomposition phases (i.e., initial methanogenic phase (IMP) and stable methanogenic phase (SMP)), were culture-independently examined using PCR-based 454 pyrosequencing. A total of 47,753 sequences of 16S rRNA genes were retrieved from 69,954 reads and analyzed to evaluate the diversities of the archaeal and bacterial communities. The most predominant types of archaea were hydrogenotrophic Methanomicrobiales, and of bacteria were Proteobacteria, Firmicutes, and Bacteroidetes. As might be expected, their abundances varied at decomposition phases. Archaea Methanomicrobiales accounts for 97.6% of total archaeal population abundance in IMP and about 57.6% in SMP. The abundance of archaeal genus Halobacteriale was 0.1% in IMP and was 20.3% in the SMP. The abundance of Firmicutes was 21.3% in IMP and was 4.3% in SMP. The abundance of Bacteroidetes represented 11.5% of total bacterial in IMP and was dominant (49.4%) in SMP. Both the IMP and SMP had unique cellulolytic bacteria compositions. IMP consisted of members of Bacillus, Fibrobacter, and Eubacterium, while SMP harbored groups of Microbacterium. Both phases had Clostridium with different abundance, 4-5 folds higher in SMP.

  19. Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains.

    Science.gov (United States)

    Whitman, William B; Woyke, Tanja; Klenk, Hans-Peter; Zhou, Yuguang; Lilburn, Timothy G; Beck, Brian J; De Vos, Paul; Vandamme, Peter; Eisen, Jonathan A; Garrity, George; Hugenholtz, Philip; Kyrpides, Nikos C

    2015-01-01

    The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Herein, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while they are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity.

  20. Modelling the evolution of the archaeal tryptophan synthase

    Directory of Open Access Journals (Sweden)

    Merkl Rainer

    2007-04-01

    Full Text Available Abstract Background Microorganisms and plants are able to produce tryptophan. Enzymes catalysing the last seven steps of tryptophan biosynthesis are encoded in the canonical trp operon. Among the trp genes are most frequently trpA and trpB, which code for the alpha and beta subunit of tryptophan synthase. In several prokaryotic genomes, two variants of trpB (named trpB1 or trpB2 occur in different combinations. The evolutionary history of these trpB genes is under debate. Results In order to study the evolution of trp genes, completely sequenced archaeal and bacterial genomes containing trpB were analysed. Phylogenetic trees indicated that TrpB sequences constitute four distinct groups; their composition is in agreement with the location of respective genes. The first group consisted exclusively of trpB1 genes most of which belonged to trp operons. Groups two to four contained trpB2 genes. The largest group (trpB2_o contained trpB2 genes all located outside of operons. Most of these genes originated from species possessing an operon-based trpB1 in addition. Groups three and four pertain to trpB2 genes of those genomes containing exclusively one or two trpB2 genes, but no trpB1. One group (trpB2_i consisted of trpB2 genes located inside, the other (trpB2_a of trpB2 genes located outside the trp operon. TrpA and TrpB form a heterodimer and cooperate biochemically. In order to characterise trpB variants and stages of TrpA/TrpB cooperation in silico, several approaches were combined. Phylogenetic trees were constructed for all trp genes; their structure was assessed via bootstrapping. Alternative models of trpB evolution were evaluated with parsimony arguments. The four groups of trpB variants were correlated with archaeal speciation. Several stages of TrpA/TrpB cooperation were identified and trpB variants were characterised. Most plausibly, trpB2 represents the predecessor of the modern trpB gene, and trpB1 evolved in an ancestral bacterium

  1. The effects of micro-aeration on the phylogenetic diversity of microorganisms in a thermophilic anaerobic municipal solid-waste digester.

    Science.gov (United States)

    Tang, Yueqin; Shigematsu, Toru; Ikbal; Morimura, Shigeru; Kida, Kenji

    2004-05-01

    We demonstrated previously that micro-aeration allows construction of an effective thermophilic methane-fermentation system for treatment of municipal solid waste (MSW) without production of H(2)S. In the present study, we compared the microbial communities in a thermophilic MSW digester without aeration and with micro-aeration by fluorescence in situ hybridization (FISH), denaturing gradient gel electrophoresis (DGGE), phylogenetic analysis of libraries of 16S rRNA gene clones and quantitative real-time PCR. Moreover, we studied the activity of sulfate-reducing bacteria (SRB) by analysis of the transcription of the gene for dissimilatory sulfite reductase (dsr). Experiments using FISH revealed that microorganisms belonging to the domain Bacteria dominated in the digester both without aeration and with micro-aeration. Phylogenetic analysis based on 16S rRNA gene and analysis of bacteria by DGGE did not reveal any obvious difference within the microbial communities under the two aeration conditions, and bacteria affiliated with the phylum Firmicutes were dominant. In Archaea, the population of Methanosarcina decreased while the population of Methanoculleus increased as a result of micro-aerations as revealed by the analysis of 16S rRNA gene clones and quantitative real-time PCR. Reverse transcription and PCR (RT-PCR) demonstrated the transcription of dsrA not only in the absence of aeration but also in the presence of micro-aeration, even under conditions where no H(2)S was detected in the biogas. In conclusion, micro-aeration has no obvious effects on the phylogenetic diversity of microorganisms. Furthermore, the activity of SRBs in the digester was not repressed even though the concentration of H(2)S in the biogas was very low under the micro-aeration conditions. PMID:15159157

  2. Archaeal ammonia oxidation in volcanic grassland soils of Iceland. Effects of elevated temperature and N availability on processes and organisms

    NARCIS (Netherlands)

    Daebeler, A.

    2014-01-01

    Thaumarchaea are recognized today as the most abundant and ubiquitously dis­tributed archaeal organisms, especially in the oceans and soil. Their phylogenetic placement as a phylum, the capability of all cultivated Thaumarchaea to oxidize ammonia for energy conservation as well as many further aspec

  3. Phylogenetic diversity of bacteria associated with Paleolithic paintings and surrounding rock walls in two Spanish caves (Llonín and La Garma).

    Science.gov (United States)

    Schabereiter-Gurtner, Claudia; Saiz-Jimenez, Cesareo; Piñar, Guadalupe; Lubitz, Werner; Rölleke, Sabine

    2004-02-01

    Bacterial diversity in caves is still rarely investigated using culture-independent techniques. In the present study, bacterial communities on Paleolithic paintings and surrounding rock walls in two Spanish caves (Llonín and La Garma) were analyzed, using 16S rDNA-based denaturing gradient gel electrophoresis community fingerprinting and phylogenetic analyses without prior cultivation. Results revealed complex bacterial communities consisting of a high number of novel 16S rDNA sequence types and indicated a high biodiversity of lithotrophic and heterotrophic bacteria. Identified bacteria were related to already cultured bacteria (39 clones) and to environmental 16S rDNA clones (46 clones). The nearest phylogenetic relatives were members of the Proteobacteria (41.1%), of the Acidobacterium division (16.5%), Actinobacteria (20%), Firmicutes (10.6%), of the Cytophaga/Flexibacter/Bacteroides division (5.9%), Nitrospira group (3.5%), green non-sulfur bacteria (1.2%), and candidate WS3 division (1.2%). Thirteen of these clones were most closely related to those obtained from the previous studies on Tito Bustillo Cave. The comparison of the present data with the data obtained previously from Altamira and Tito Bustillo Caves revealed similarities in the bacterial community components, especially in the high abundance of the Acidobacteria and Rhizobiaceae, and in the presence of bacteria related to ammonia and sulfur oxidizers. PMID:19712338

  4. Elevational gradients in phylogenetic structure of ant communities reveal the interplay of biotic and abiotic constraints on diversity

    DEFF Research Database (Denmark)

    Machac, Antonin; Janda, Milan; Dunn, Robert R.;

    2011-01-01

    A central focus of ecology and biogeography is to determine the factors that govern spatial variation in biodiversity. Here, we examined patterns of ant diversity along climatic gradients in three temperate montane systems: Great Smoky Mountains National Park (USA), Chiricahua Mountains (USA), an...

  5. Microscopic examination of distribution and phenotypic properties of phylogenetically diverse Chloroflexaceae-related bacteria in hot spring microbial mats

    DEFF Research Database (Denmark)

    Nübel, Ulrich; Bateson, Mary M; Vandieken, Verona;

    2002-01-01

    We investigated the diversity, distribution, and phenotypes of uncultivated Chloroflexaceae-related bacteria in photosynthetic microbial mats of an alkaline hot spring (Mushroom Spring, Yellowstone National Park). By applying a directed PCR approach, molecular cloning, and sequence analysis of 16S......-scale distribution. FISH was combined with oxygen microelectrode measurements, microscope spectrometry, and microautoradiography to examine their microenvironment, pigmentation, and carbon source usage. Abundant type C-related, filamentous bacteria were found to flourish within the cyanobacterium-dominated, highly...

  6. Microscopic Examination of Distribution and Phenotypic Properties of Phylogenetically Diverse Chloroflexaceae-Related Bacteria in Hot Spring Microbial Mats

    DEFF Research Database (Denmark)

    Nübel, U.; Bateson, Mary M.; Vandieken, V.;

    2002-01-01

    We investigated the diversity, distribution, and phenotypes of uncultivated Chloroflexaceae-related bacteria in photosynthetic microbial mats of an alkaline hot spring (Mushroom Spring, Yellowstone National Park). By applying a directed PCR approach, molecular cloning, and sequence analysis of 16S......-scale distribution. FISH was combined with oxygen microelectrode measurements, microscope spectrometry, and microautoradiography to examine their microenvironment, pigmentation, and carbon source usage. Abundant type C-related, filamentous bacteria were found to flourish within the cyanobacterium-dominated, highly...

  7. Comparative molecular analysis of the prokaryotic diversity of two salt mine soils in southwest China.

    Science.gov (United States)

    Xiao, Wei; Wang, Zhi-Gang; Wang, Yong-Xia; Schneegurt, Mark A; Li, Zhi-Ying; Lai, Yong-Hong; Zhang, Shi-Ying; Wen, Meng-Liang; Cui, Xiao-Long

    2013-11-01

    While much is known about the microbial diversity in some hypersaline environments, little is known about those of salt mine tunnel soils. The objective of this study was to conduct a comprehensive phylogenetic comparison of the archaeal and bacterial communities present in Yipinglang salt mine (YPL) and Qiaohou salt mine (QH) tunnels differing in salinity and salt composition using 16S rRNA gene clone libraries. Two hundred twenty-eight sequences for QH and 182 sequences for YPL were analyzed by amplified ribosomal DNA-restriction analysis. Libraries revealed 44 bacterial and 57 archaeal different operational taxonomic units belonging to at least 8 bacterial and 3 archaeal divisions, but not all divisions were observed in both salt mines. The bacterial community affiliated with the Bacteroidetes was the most abundant (60% of clones) in QH, while the community in YPL was dominated by δ-Proteobacteria (45% of clones). All archaeal clones from QH were affiliated with Halobacteriaceae. In contrast, in the YPL library, 49% of clones belonged to Halobacteriaceae, 31% of clones related to unclassified archaea, and 21% of clones belonged to Crenarchaeota. Bioinformatic analysis and comparisons showed that the clone libraries were significantly different between two salt mines. PMID:23457089

  8. Genetic diversity and phylogenetic relationships between and within wild Pistacia species populations and implications for its conservation

    Institute of Scientific and Technical Information of China (English)

    Parvaneh Iranjo; Daryuoosh NabatiAhmadi; Karim Sorkheh; Hamid Rajabi Memeari; Sezai Ercisli

    2016-01-01

    Although cultivation and utilization of Pistacia are fully exploited, the evolutionary history of the Pistacia genus and the relationships among the species and acces-sions is still not well understood. The aim of this study was to analyze random amplified polymorphic DNA (RAPD) in a total of 50 accessions of wild pistachio species, which included five populations Pistacia vera, Pistacia khinjuk, Pistacia atlantica, Pistacia mutica, and Pistacia eurycarpa. High levels of genetic diversity were detected within wild pistachio accessions, as revealed by using the unweighted pair-group method with arithmetic averaging and supported via analysis of molecular variance. The objectives of this investigation were to estimate marker indices, polymorphic information contents (PICs), and genetic similarities (GS) for RAPD markers;assess the genetic diversity of Pistacia species, using GS estimated from RAPD fingerprints and molecular characterization;and facilitate the use of markers in inter-specific introgression and cultivar improvement. Out of the 149 polymerase chain reaction fragments that were scored, 146 (97.98%) were polymorphic. Genetic similarities ranged from 0.3 to 0.86%, marker indices ranged from 2.98 to 17.74%, and PICs ranged from 0.80 to 0.99%. Our results provided great molecular identification of all assayed genotypes, which have shown that there is large quantity of genetic diversity among the pistachio accessions. This finding might render striking information in breeding management strategies for genetic conservation and cultivar development.

  9. Identification and characterization of T-cell antigen receptor-related genes in phylogenetically diverse vertebrate species.

    Science.gov (United States)

    Rast, J P; Haire, R N; Litman, R T; Pross, S; Litman, G W

    1995-01-01

    Characterization of the structure, multiplicity, organization, and cell lineage-specific expression of T-cell receptor (TCR) genes of nonmammalian vertebrate species is central to the understanding of the evolutionary origins of rearranging genes of the vertebrate immune system. We recently described a polymerase chain reaction (PCR) strategy that relies on short sequence similarities shared by nearly all vertebrate TCR and immunoglobulin (Ig) variable (V) regions and have used this approach to isolate a TCR beta (TCRB) homolog from a cartilaginous fish. Using these short PCR products as probes in spleen cDNA and genomic libraries, we were able to isolate a variety of unique TCR and TCR-like genes. Here we report the identification and characterization of a chicken TCR gamma (TCRG) homolog, apparent Xenopus and pufferfish TCR alpha (TCRA) homologs, and two horned shark TCR delta (TCRD)-like genes. In addition, we have identified what could be a novel representative of the Ig gene superfamily in the pufferfish. This method of using short, minimally degenerate PCR primers should speed progress in the phylogenetic investigations of the TCR and related genes and lend important insights into both the origins and functions of these unique gene systems. PMID:7642232

  10. Phylogenetic analysis reveals positive correlations between adaptations to diverse hosts in a group of pathogen-like herbivores.

    Science.gov (United States)

    Peterson, Daniel A; Hardy, Nate B; Morse, Geoffrey E; Stocks, Ian C; Okusu, Akiko; Normark, Benjamin B

    2015-10-01

    A jack of all trades can be master of none-this intuitive idea underlies most theoretical models of host-use evolution in plant-feeding insects, yet empirical support for trade-offs in performance on distinct host plants is weak. Trade-offs may influence the long-term evolution of host use while being difficult to detect in extant populations, but host-use evolution may also be driven by adaptations for generalism. Here we used host-use data from insect collection records to parameterize a phylogenetic model of host-use evolution in armored scale insects, a large family of plant-feeding insects with a simple, pathogen-like life history. We found that a model incorporating positive correlations between evolutionary changes in host performance best fit the observed patterns of diaspidid presence and absence on nearly all focal host taxa, suggesting that adaptations to particular hosts also enhance performance on other hosts. In contrast to the widely invoked trade-off model, we advocate a "toolbox" model of host-use evolution in which armored scale insects accumulate a set of independent genetic tools, each of which is under selection for a single function but may be useful on multiple hosts. PMID:26374400

  11. Phylogenetic analysis of porcine rotavirus in Argentina: increasing diversity of G4 strains and evidence of interspecies transmission.

    Science.gov (United States)

    Parra, Gabriel I; Vidales, Graciela; Gomez, Jorge A; Fernandez, Fernando M; Parreño, Viviana; Bok, Karin

    2008-01-01

    Group A rotaviruses are one of the most frequently detected viral agents associated with neonatal diarrhea in piglets. In order to characterize rotavirus (RV) strains circulating in Argentinean swine, four porcine production farms located in Buenos Aires were studied. RV strains genotyped as P[6]G4, P[6]G8 and P[1]G6 were found in piglets under 30 days of age, without diarrhea. Phylogenetic and sequence analysis of the VP7 gene from G4 strains available in databases, reveals five porcine new lineages (III-VII) and three sublineages (VIIa-VIIc). The G4 porcine Argentinean strains were grouped with a porcine RV strain isolated in Brazil and another RV strain isolated from a child with diarrhea in Mexico, constituting an American lineage (VII). On the other hand, porcine G6 and G8 were closely related to RV's circulating in Argentinean cattle and South-American camelids, respectively. The fact that G4 porcine lineages were epidemiologically related to human strains, and G6 and G8 Argentinean porcine strains were found related to bovine and South-American camelids, respectively, suggests that pigs might play a crucial role as reservoir and generator of newly adapted emerging RV strains for human and other species.

  12. Molecular epidemiology and phylogenetic analysis of diverse bovine astroviruses associated with diarrhea in cattle and water buffalo calves in China.

    Science.gov (United States)

    Alfred, Niyokwishimira; Liu, Huan; Li, Mu Lan; Hong, Shao Feng; Tang, Hai Bo; Wei, Zu Zhang; Chen, Ying; Li, Fa Kai; Zhong, Yi Zhi; Huang, Wei Jian

    2015-06-01

    Astroviruses are the principal causative agents of gastroenteritis in humans and have been associated with diarrhea in other mammals as well as birds. However, astroviral infection of animals had been poorly studied. In the present study, 211 rectal swabs collected from cattle and water buffalo calves with mild to severe diarrhea were tested for bovine astrovirus (BAstV) by RT-PCR. Results: 92/211 (43.6%) samples were positive for BAstV, at a rate of 46.10% (71/154) in cattle and 36.84% (21/57) in water buffalo. Phylogenetic analysis based on the partial and full-length of 25 ORF2 amino acid sequences obtained in this study classified the Guangxi BAstVs isolates into five subgroups under the genus of Mamastrovirus, genotype MAstV33, which suggested that the water buffalo was a new host of this genogroup that previously included only cattle and roe deer. Despite the origin of the host, the Guangxi BAstV isolates were closely related to the BAstV Hong Kong isolates (B18/HK and B76-2/HK), but highly divergent from the BAstV NeuroS1 isolate previously associated with neurologic disease in cattle in the U.S.A. Nucleotide sequence-based characterization of the ORF1b/ORF2 junction and corresponding overlapping regions showed distinctive properties, which may be common to BAstVs. Our results suggested that cattle and water buffalo are prone to infection of closely related astroviruses, which probably evolved from the same ancestor. The current study described astroviruses in water buffalo for the first time and is thus far among the largest epidemiological investigations of BAstV infection in cattle conducted in China.

  13. The Genetic Diversity and Phylogenetic Characteritics of Rotavirus VP4(P Genotypes in Children With Acute Diarrhea

    Directory of Open Access Journals (Sweden)

    Haghshenas Z

    2011-11-01

    Full Text Available Background: Acute gastroenteritis is a major cause of morbidity and mortality among children in developing countries. Rotaviruses are recognized as the most common etiologic factors of gastroenteritis. In this study, we determined the epidemiologic features, clinical symptoms and molecular structure of rotavirus VP4(P genotypes in children with acute diarrhea in Bahrami Hospital in Tehran Iran, during 2009 for justifying the routine use of rotavirus vaccines in children. Methods: One hundred fifty fecal samples from 150 children with acute diarrhea in Bahrami Pediatric Hospital in Tehran, Iran were collected from January to December 2009. The patients’ mean age was 20.90+18.19 years (ranging from 1 month to 14 years. Fecal samples were transported on ice to the laboratory of virology department of Pasture Institute of Iran. The demographic and clinical data for each case were entered in an author-devised questionnaire. Group A rotavirus was detected by dsRNA-PAGE. Subsequently, rotavirus genotyping (VP4 was performed by semi-nested multiple RT-PCR and the phylogenetic tree of the Rotavirus nucleotides was constructed. The data were analyzed by statistical tests including Wilcoxon signed and Mann-Whitney U. Results: Rotavirus was isolated in 19.3% of the samples, more than 90% of which had long RNA patterns. The predominant genotype (VP4 was P[8] (86% and other genotypes respectively were P[6] (6.9% and P[4] (6.9%. Conclusion: A high prevalence of the P[8] genotype was found to be the cause of acute diarrhea. The analysis of P[8] genotype sequence showed a high level of similarity of the virus in this study with those of other Asian countries.

  14. Archaeal Enzymes and Applications in Industrial Biocatalysts.

    Science.gov (United States)

    Littlechild, Jennifer A

    2015-01-01

    Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in "extreme" conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  15. Archaeal Enzymes and Applications in Industrial Biocatalysts

    Directory of Open Access Journals (Sweden)

    Jennifer A. Littlechild

    2015-01-01

    Full Text Available Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in “extreme” conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  16. Phylogenetic Profiling and Diversity of Bacterial Communities in the Death Valley, an Extreme Habitat in the Atacama Desert.

    Science.gov (United States)

    Piubeli, Francine; de Lourdes Moreno, María; Kishi, Luciano Takeshi; Henrique-Silva, Flavio; García, María Teresa; Mellado, Encarnación

    2015-12-01

    The Atacama Desert, one of the driest deserts in the world, represents a unique extreme environmental ecosystem to explore the bacterial diversity as it is considered to be at the dry limit for life. A 16S rRNA gene (spanning the hyper variable V3 region) library was constructed from an alkaline sample of unvegetated soil at the hyperarid margin in the Atacama Desert. A total of 244 clone sequences were used for MOTHUR analysis, which revealed 20 unique phylotypes or operational taxonomic units (OTUs). V3 region amplicons of the 16S rRNA were suitable for distinguishing the bacterial community to the genus and specie level. We found that all OTUs were affiliated with taxa representative of the Firmicutes phylum. The extremely high abundance of Firmicutes indicated that most bacteria in the soil were spore-forming survivors. In this study we detected a narrower diversity as compared to other ecological studies performed in other areas of the Atacama Desert. The reported genera were Oceanobacillus (representing the 69.5 % of the clones sequenced), Bacillus, Thalassobacillus and Virgibacillus. The present work shows physical and chemical parameters have a prominent impact on the microbial community structure. It constitutes an example of the communities adapted to live in extreme conditions caused by dryness and metal concentrations . PMID:26543264

  17. The UCSC Archaeal Genome Browser: 2012 update

    OpenAIRE

    Chan, Patricia P.; Holmes, Andrew D.; Smith, Andrew M.; Tran, Danny; Lowe, Todd M.

    2011-01-01

    The UCSC Archaeal Genome Browser (http://archaea.ucsc.edu) offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of ...

  18. Spatial distribution of archaeal and bacterial ammonia oxidizers in the littoral buffer zone of a nitrogen-rich lake

    Institute of Scientific and Technical Information of China (English)

    Yu Wang; Guibing Zhu; Lei Ye; Xiaojuan Feng; Huub J. M. Op den Camp; Chengqing Yin

    2012-01-01

    The spatial distribution and diversity of archaeal and bacterial ammonia oxidizers (AOA and AOB) were evaluated targeting amoA genes in the gradient of a littoral buffer zone which has been identified as a hot spot for N cycling.Here we found high spatial heterogeneity in the nitrification rate and abundance of ammonia oxidizers in the five sampling sites.The bacterial amoA gene was numerically dominant in most of the surface soil but decreased dramatically in deep layers.Higher nitrification potentials were detected in two sites near the land/water interface at 4.4-6.1 μg NO2--N/(g dry weight soil.hr),while only 1.0-1.7 μg NO2- -N/(gdry weight soil·hr) was measured at other sites.The potential nitrification rates were proportional to the amoA gene abundance for AOB,hut with no significant correlation with AOA.The NH4+ concentration was the most determinative parameter for the abundance of AOB and potential nitrification rates in this study.Higher richness in the surface layer was found in the analysis of biodiversity.Phylogenetic analysis revealed that most of the bacterial amoA sequences in surface soil were affiliated with the genus of Nitrosopira while the archaeal sequences were almost equally affiliated with Candidatus ‘Nitrososphaera gargensis' and Candidatus ‘Nitrosoealdus yellowstonii'.The spatial distribution of AOA and AOB indicated that bacteria may play a more important role in nitrification in the littoral buffer zone of a N-rich lake.

  19. Diversity of Archaea in Icelandic hot springs based on 16S rRNA and chaperonin genes.

    Science.gov (United States)

    Mirete, Salvador; de Figueras, Carolina G; González-Pastor, Jose E

    2011-07-01

    The diversity of archaeal communities growing in four hot springs (65-90 °C, pH 6.5) was assessed with 16S rRNA gene primers specific for the domain Archaea. Overall, mainly uncultured members of the Desulfurococcales, the Thermoproteales and the Korarchaeota, were identified. Based on this diversity, a set of chaperonin heat-shock protein (Hsp60) gene sequences from different archaeal species were aligned to design two degenerate primer sets for the amplification of the chaperonin gene: Ths and Kor (which can also detect the korarchaeotal chaperonin gene from one of the samples). A phylogenetic tree was constructed using the chaperonin sequences retrieved and other sequences from cultured representatives. The Alpha and Beta paralogs of the chaperonin gene were observed within the main clades and orthologs among them. Cultivated representatives from these clades were assigned to either paralog in the chaperonin tree. Uncultured representatives observed in the 16S rRNA gene analysis were found to be related to the Desulfurococcales. The topologies of the 16S rRNA gene and chaperonin phylogenetic trees were compared, and similar phylogenetic relationships were observed. Our results suggest that the chaperonin Hsp60 gene may be used as a phylogenetic marker for the clades found in this extreme environment.

  20. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring

    Directory of Open Access Journals (Sweden)

    Sonu Bhatia

    2015-09-01

    Full Text Available The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche.

  1. Phylogenetic analysis of methanogens from the bovine rumen

    Directory of Open Access Journals (Sweden)

    Forster Robert J

    2001-05-01

    Full Text Available Abstract Background Interest in methanogens from ruminants has resulted from the role of methane in global warming and from the fact that cattle typically lose 6 % of ingested energy as methane. Several species of methanogens have been isolated from ruminants. However they are difficult to culture, few have been consistently found in high numbers, and it is likely that major species of rumen methanogens are yet to be identified. Results Total DNA from clarified bovine rumen fluid was amplified using primers specific for Archaeal 16S rRNA gene sequences (rDNA. Phylogenetic analysis of 41 rDNA sequences identified three clusters of methanogens. The largest cluster contained two distinct subclusters with rDNA sequences similar to Methanobrevibacter ruminantium 16S rDNA. A second cluster contained sequences related to 16S rDNA from Methanosphaera stadtmanae, an organism not previously described in the rumen. The third cluster contained rDNA sequences that may form a novel group of rumen methanogens. Conclusions The current set of 16S rRNA hybridization probes targeting methanogenic Archaea does not cover the phylogenetic diversity present in the rumen and possibly other gastro-intestinal tract environments. New probes and quantitative PCR assays are needed to determine the distribution of the newly identified methanogen clusters in rumen microbial communities.

  2. Human settlement as driver of bacterial, but not of archaeal, ammonia oxidizers abundance and community structure in tropical stream sediments

    Directory of Open Access Journals (Sweden)

    Mariana De Paula Reis

    2015-08-01

    Full Text Available Ammonia-oxidizing archaea (AOA and bacteria (AOB are a diverse and functionally important group in the nitrogen cycle. Nevertheless, AOA and AOB communities driving this process remain uncharacterized in tropical freshwater sediment. Here, the effect of human settlement on the AOA and AOB diversity and abundance have been assessed by phylogenetic and quantitative PCR analyses, using archaeal and bacterial amoA and 16S rRNA genes. Overall, each environment contained specific clades of amoA and 16S rRNA genes sequences, suggesting that selective pressures lead to AOA and AOB inhabiting distinct ecological niches. Human settlement activities, as derived from increased metal and mineral nitrogen contents, appear to cause a response among the AOB community, with Nitrosomonas taking advantage over Nitrosospira in impacted environments. We also observed a dominance of AOB over AOA in mining-impacted sediments, suggesting that AOB might be the primary drivers of ammonia oxidation in these sediments. In addition, ammonia concentrations demonstrated to be the driver for the abundance of AOA, with an inversely proportional correlation between them. Our findings also revealed the presence of novel ecotypes of Thaumarchaeota, such as those related to the obligate acidophilic Nitrosotalea devanaterra at ammonia-rich places of circumneutral pH. These data add significant new information regarding AOA and AOB from tropical freshwater sediments, albeit future studies would be required to provide additional insights into the niche differentiation among these microorganisms.

  3. Phylogeny of bacterial and archaeal genomes using conserved genes: supertrees and supermatrices.

    Directory of Open Access Journals (Sweden)

    Jenna Morgan Lang

    Full Text Available Over 3000 microbial (bacterial and archaeal genomes have been made publically available to date, providing an unprecedented opportunity to examine evolutionary genomic trends and offering valuable reference data for a variety of other studies such as metagenomics. The utility of these genome sequences is greatly enhanced when we have an understanding of how they are phylogenetically related to each other. Therefore, we here describe our efforts to reconstruct the phylogeny of all available bacterial and archaeal genomes. We identified 24, single-copy, ubiquitous genes suitable for this phylogenetic analysis. We used two approaches to combine the data for the 24 genes. First, we concatenated alignments of all genes into a single alignment from which a Maximum Likelihood (ML tree was inferred using RAxML. Second, we used a relatively new approach to combining gene data, Bayesian Concordance Analysis (BCA, as implemented in the BUCKy software, in which the results of 24 single-gene phylogenetic analyses are used to generate a "primary concordance" tree. A comparison of the concatenated ML tree and the primary concordance (BUCKy tree reveals that the two approaches give similar results, relative to a phylogenetic tree inferred from the 16S rRNA gene. After comparing the results and the methods used, we conclude that the current best approach for generating a single phylogenetic tree, suitable for use as a reference phylogeny for comparative analyses, is to perform a maximum likelihood analysis of a concatenated alignment of conserved, single-copy genes.

  4. Genetic diversity of Trypanosoma cruzi in bats, and multilocus phylogenetic and phylogeographical analyses supporting Tcbat as an independent DTU (discrete typing unit).

    Science.gov (United States)

    Lima, Luciana; Espinosa-Álvarez, Oneida; Ortiz, Paola A; Trejo-Varón, Javier A; Carranza, Julio C; Pinto, C Miguel; Serrano, Myrna G; Buck, Gregory A; Camargo, Erney P; Teixeira, Marta M G

    2015-11-01

    Trypanosoma cruzi is a complex of phenotypically and genetically diverse isolates distributed in six discrete typing units (DTUs) designated as TcI-TcVI. Five years ago, T. cruzi isolates from Brazilian bats showing unique patterns of traditional ribosomal and spliced leader PCRs not clustering into any of the six DTUs were designated as the Tcbat genotype. In the present study, phylogenies inferred using SSU rRNA (small subunit of ribosomal rRNA), gGAPDH (glycosomal glyceraldehyde 3-phosphate dehydrogenase) and Cytb (cytochrome b) genes strongly supported Tcbat as a monophyletic lineage prevalent in Brazil, Panama and Colombia. Providing strong support for Tcbat, sequences from 37 of 47 nuclear and 12 mitochondrial genes (retrieved from a draft genome of Tcbat) and reference strains of all DTUs available in databanks corroborated Tcbat as an independent DTU. Consistent with previous studies, multilocus analysis of most nuclear genes corroborated the evolution of T. cruzi from bat trypanosomes its divergence into two main phylogenetic lineages: the basal TcII; and the lineage clustering TcIV, the clade comprising TcIII and the sister groups TcI-Tcbat. Most likely, the common ancestor of Tcbat and TcI was a bat trypanosome. However, the results of the present analysis did not support Tcbat as the ancestor of all DTUs. Despite the insights provided by reports of TcIII, TcIV and TcII in bats, including Amazonian bats harbouring TcII, further studies are necessary to understand the roles played by bats in the diversification of all DTUs. We also demonstrated that in addition to value as molecular markers for DTU assignment, Cytb, ITS rDNA and the spliced leader (SL) polymorphic sequences suggest spatially structured populations of Tcbat. Phylogenetic and phylogeographical analyses, multiple molecular markers specific to Tcbat, and the degrees of sequence divergence between Tcbat and the accepted DTUs strongly support the definitive classification of Tcbat as a new DTU.

  5. Genetic diversity of Trypanosoma cruzi in bats, and multilocus phylogenetic and phylogeographical analyses supporting Tcbat as an independent DTU (discrete typing unit).

    Science.gov (United States)

    Lima, Luciana; Espinosa-Álvarez, Oneida; Ortiz, Paola A; Trejo-Varón, Javier A; Carranza, Julio C; Pinto, C Miguel; Serrano, Myrna G; Buck, Gregory A; Camargo, Erney P; Teixeira, Marta M G

    2015-11-01

    Trypanosoma cruzi is a complex of phenotypically and genetically diverse isolates distributed in six discrete typing units (DTUs) designated as TcI-TcVI. Five years ago, T. cruzi isolates from Brazilian bats showing unique patterns of traditional ribosomal and spliced leader PCRs not clustering into any of the six DTUs were designated as the Tcbat genotype. In the present study, phylogenies inferred using SSU rRNA (small subunit of ribosomal rRNA), gGAPDH (glycosomal glyceraldehyde 3-phosphate dehydrogenase) and Cytb (cytochrome b) genes strongly supported Tcbat as a monophyletic lineage prevalent in Brazil, Panama and Colombia. Providing strong support for Tcbat, sequences from 37 of 47 nuclear and 12 mitochondrial genes (retrieved from a draft genome of Tcbat) and reference strains of all DTUs available in databanks corroborated Tcbat as an independent DTU. Consistent with previous studies, multilocus analysis of most nuclear genes corroborated the evolution of T. cruzi from bat trypanosomes its divergence into two main phylogenetic lineages: the basal TcII; and the lineage clustering TcIV, the clade comprising TcIII and the sister groups TcI-Tcbat. Most likely, the common ancestor of Tcbat and TcI was a bat trypanosome. However, the results of the present analysis did not support Tcbat as the ancestor of all DTUs. Despite the insights provided by reports of TcIII, TcIV and TcII in bats, including Amazonian bats harbouring TcII, further studies are necessary to understand the roles played by bats in the diversification of all DTUs. We also demonstrated that in addition to value as molecular markers for DTU assignment, Cytb, ITS rDNA and the spliced leader (SL) polymorphic sequences suggest spatially structured populations of Tcbat. Phylogenetic and phylogeographical analyses, multiple molecular markers specific to Tcbat, and the degrees of sequence divergence between Tcbat and the accepted DTUs strongly support the definitive classification of Tcbat as a new DTU

  6. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways.

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-06-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP-DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP-DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP-promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP-DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  7. Genetic diversity and phylogenetic relationship among Tunisian cactus species (Opuntia) as revealed by random amplified microsatellite polymorphism markers.

    Science.gov (United States)

    Bendhifi Zarroug, M; Baraket, G; Zourgui, L; Souid, S; Salhi Hannachi, A

    2015-01-01

    Opuntia ficus indica is one of the most economically important species in the Cactaceae family. Increased interest in this crop stems from its potential contribution to agricultural diversification, application in the exploitation of marginal lands, and utility as additional income sources for farmers. In Tunisia, O. ficus indica has been affected by drastic genetic erosion resulting from biotic and abiotic stresses. Thus, it is imperative to identify and preserve this germplasm. In this study, we focused on the use of random amplified microsatellite polymorphisms to assess genetic diversity among 25 representatives of Tunisian Opuntia species maintained in the collection of the National Institute of Agronomic Research of Tunisia. Seventy-two DNA markers were screened to discriminate accessions using 16 successful primer combinations. The high percentage of polymorphic band (100%), the resolving power value (5.68), the polymorphic information content (0.94), and the marker index (7.2) demonstrated the efficiency of the primers tested. Therefore, appropriate cluster analysis used in this study illustrated a divergence among the cultivars studied and exhibited continuous variation that occurred independently of geographic origin. O. ficus indica accessions did not cluster separately from the other cactus pear species, indicating that their current taxonomical classifications are not well aligned with their genetic variability or locality of origin. PMID:25730081

  8. Protein Adaptations in Archaeal Extremophiles

    Directory of Open Access Journals (Sweden)

    Christopher J. Reed

    2013-01-01

    Full Text Available Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity.

  9. Seasonal Effects in a Lake Sediment Archaeal Community of the Brazilian Savanna

    Directory of Open Access Journals (Sweden)

    Thiago Rodrigues

    2014-01-01

    Full Text Available The Cerrado is a biome that corresponds to 24% of Brazil’s territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked differences between the archaeal communities found in the two seasons. I.1a and I.1c Thaumarchaeota were found in greater numbers in the transition period, while MCG Archaea was dominant on the dry season. Methanogens were only found in the dry season. Analysis of 16S rRNA sequences revealed lower diversity on the transition period. We detected archaeal amoA sequences in both seasons, but there were more OTUs during the dry season. These sequences were within the same cluster as Nitrosotalea devanaterra’s amoA gene. The principal coordinate analysis (PCoA test revealed significant differences between samples from different seasons. These results provide information on archaeal diversity in freshwater lake sediments of the Cerrado and indicates that rain is likely a factor that impacts these communities.

  10. Archaeal communities associated with roots of the common reed (Phragmites australis) in Beijing Cuihu Wetland.

    Science.gov (United States)

    Liu, Yin; Li, Hong; Liu, Qun Fang; Li, Yan Hong

    2015-05-01

    The richness, phylogeny and composition of archaeal community associated with the roots of common reed (Phragmites australis) growing in the Beijing Cuihu Wetland, China was investigated using a 16S rDNA library. In total, 235 individual sequences were collected, and a phylogenetic analysis revealed that 69.4 and 11.5 % of clones were affiliated with the Euryarchaeota and the Crenarchaeota, respectively. In Euryarchaeota, the archaeal community was dominated by species in following genera: Methanobacterium in the order Methanobacteriales (60.7 %); Methanoregula and Methanospirillum in the order Methanomicrobiales (20.2 %), and Methanomethylovorans, Methanosarcina and Methanosaeta in the order Methanosarcinales (17.2 %). Of 27 sequences assigned to uncultured Crenarchaeota, 22 were grouped into Group 1.3, and five grouped into Group 1.1b. Hence, the archaeal communities associated with reed roots are largely involved in methane production, and, to a lesser extent, in ammonia oxidization. Quantification of the archaeal amoA gene indicated that ammonia oxidizing archaea were more numerous in the rhizosphere soil than in the root tissue or surrounding water. A total of 19.1 % of the sequences were unclassified, suggesting that many unidentified archaea are probably involved in the reed wetland ecosystem. PMID:25739566

  11. Archaeal Nitrification in Hot Springs

    Science.gov (United States)

    Richter, A.; Daims, H.; Reigstad, L.; Wanek, W.; Wagner, M.; Schleper, C.

    2006-12-01

    Biological nitrification, i.e. the aerobic conversion of ammonia to nitrate via nitrite, is a major component of the global nitrogen cycle. Until recently, it was thought that the ability to aerobically oxidize ammonia was confined to bacteria of the phylum Proteobacteria. However, it has recently been shown that Archaea of the phylum Crenarchaeota are also capable of ammonia oxidation. As many Crenarchaeota are thermophilic or hyperthermophilic, and at least some of them are capable of ammonia oxidation we speculated on the existence of (hyper)thermophilic ammonia-oxidizing archaea (AOA). Using PCR primers specifically targeting the archaeal ammonia monooxygenase (amoA) gene, we were indeed able to confirm the presence of such organisms in several hot springs in Reykjadalur, Iceland. These hot springs exhibited temperatures well above 80 °C and pH values ranging from 2.0 to 4.5. To proof that nitrification actually took place under these extreme conditions, we measured gross nitrification rates by the isotope pool dilution method; we added 15N-labelled nitrate to the mud and followed the dilution of the label by nitrate production from ammonium either in situ (incubation in the hot spring) or under controlled conditions in the laboratory (at 80 °C). The nitrification rates in the hot springs ranged from 0.79 to 2.22 mg nitrate-N per L of mud and day. Controls, in which microorganisms were killed before the incubations, demonstrated that the nitrification was of biological origin. Addition of ammonium increased the gross nitrification rate approximately 3-fold, indicating that the nitrification was ammonium limited under the conditions used. Collectively, our study provides evidence that (1) AOA are present in hot springs and (2) that they are actively nitrifying. These findings have major implications for our understanding of nitrogen cycling of hot environments.

  12. Phylogenetic congruence and ecological coherence in terrestrial Thaumarchaeota

    OpenAIRE

    Oton, Eduard Vico; Quince, Christopher; Nicol, Graeme W.; Prosser, James I.; Gubry-Rangin, Cécile

    2015-01-01

    Thaumarchaeota form a ubiquitously distributed archaeal phylum, comprising both the ammonia-oxidising archaea (AOA) and other archaeal groups in which ammonia oxidation has not been demonstrated (including Group 1.1c and Group 1.3). The ecology of AOA in terrestrial environments has been extensively studied using either a functional gene, encoding ammonia monooxygenase subunit A (amoA) or 16S ribosomal RNA (rRNA) genes, which show phylogenetic coherence with respect to soil pH. To test phylog...

  13. Characterization of microbial diversity and community in water flooding oil reservoirs in China.

    Science.gov (United States)

    Zhao, Lingxia; Ma, Ting; Gao, Mengli; Gao, Peike; Cao, Meina; Zhu, Xudong; Li, Guoqiang

    2012-10-01

    The diversity and distribution of bacterial and archaeal communities in four different water flooding oil reservoirs with different geological properties were investigated using 16S rDNA clone library construction method. Canonical correspondence analysis was used to analyze microbial community clustering and the correlation with environmental factors. The results indicated that the diversity and abundance in the bacterial communities were significantly higher than the archaeal communities, while both of them had high similarity within the communities respectively. Phylogenetic analysis showed that of compositions of bacterial communities were distinctly different both at phylum and genus level. Proteobacteria dominated in each bacterial community, ranging from 61.35 to 75.83 %, in which α-proteobacteria and γ-proteobacteria were the main groups. In comparison to bacterial communities, the compositions of archaeal communities were similar at phylum level, while varied at genus level, and the dominant population was Methanomicrobia, ranging from 65.91 to 92.74 % in the single oil reservoir. The factor that most significantly influenced the microbial communities in these reservoirs was found to be temperature. Other environmental factors also influenced the microbial communities but not significantly. It is therefore assumed that microbial communities are formed by an accumulated effect of several factors. These results are essential for understanding ecological environment of the water flooding oil reservoirs and providing scientific guidance to the performance of MEOR technology. PMID:22806743

  14. Characterization of microbial diversity and community in water flooding oil reservoirs in China.

    Science.gov (United States)

    Zhao, Lingxia; Ma, Ting; Gao, Mengli; Gao, Peike; Cao, Meina; Zhu, Xudong; Li, Guoqiang

    2012-10-01

    The diversity and distribution of bacterial and archaeal communities in four different water flooding oil reservoirs with different geological properties were investigated using 16S rDNA clone library construction method. Canonical correspondence analysis was used to analyze microbial community clustering and the correlation with environmental factors. The results indicated that the diversity and abundance in the bacterial communities were significantly higher than the archaeal communities, while both of them had high similarity within the communities respectively. Phylogenetic analysis showed that of compositions of bacterial communities were distinctly different both at phylum and genus level. Proteobacteria dominated in each bacterial community, ranging from 61.35 to 75.83 %, in which α-proteobacteria and γ-proteobacteria were the main groups. In comparison to bacterial communities, the compositions of archaeal communities were similar at phylum level, while varied at genus level, and the dominant population was Methanomicrobia, ranging from 65.91 to 92.74 % in the single oil reservoir. The factor that most significantly influenced the microbial communities in these reservoirs was found to be temperature. Other environmental factors also influenced the microbial communities but not significantly. It is therefore assumed that microbial communities are formed by an accumulated effect of several factors. These results are essential for understanding ecological environment of the water flooding oil reservoirs and providing scientific guidance to the performance of MEOR technology.

  15. Hyperthermophilic Archaeal Viruses as Novel Nanoplatforms

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch

    ; attachment, alignment, and fusion. Upon infection, the intracellular replication cycle lasts 8 h at which point the virus particles are released as spindle-shaped tailless particles. Chapter II builds on the replication and purification methods in Chapter I to study the interaction between the two...... nanoplatforms than mammalian viruses because they cannot proliferate in humans and hence are less likely to trigger adverse effects. Another group of viruses that fits this criterion is archaeal viruses yet their potential remains untapped. As a group, archaeal viruses offer distinct advantages such as unique...

  16. Methanopyrus kandleri: an archaeal methanogen unrelated to all other known methanogens

    Science.gov (United States)

    Burggraf, S.; Stetter, K. O.; Rouviere, P.; Woese, C. R.

    1991-01-01

    Analysis of its 16S rRNA sequence shows that the newly discovered hyperthermophilic methanogen, Methanopryus kandleri, is phylogenetically unrelated to any other known methanogen. The organism represents a separate lineage originating near the root of the archaeal tree. Although the 16S rRNA sequence of Mp. kandleri resembles euryarchaeal 16S rRNAs more than it does crenarchaeal, it shows more crenarchaeal signature features than any known euryarchaeal rRNA. Attempts to place it in relation to the root of the archaeal tree show that the Mp. kandleri lineage likely arises from the euryarchaeal branch of the tree. While the existence of so deeply branching a methanogenic lineage brings into question the thesis that methanogenesis evolved from an earlier metabolism similar to that seen in Thermococcus, it at the same time reinforces the notion that the aboriginal [correction of aborginal] archaeon was a thermophile.

  17. A study of archaeal enzymes involved in polar lipid synthesis linking amino acid sequence information, genomic contexts and lipid composition

    Directory of Open Access Journals (Sweden)

    Hiromi Daiyasu

    2005-01-01

    Full Text Available Cellular membrane lipids, of which phospholipids are the major constituents, form one of the characteristic features that distinguish Archaea from other organisms. In this study, we focused on the steps in archaeal phospholipid synthetic pathways that generate polar lipids such as archaetidylserine, archaetidylglycerol, and archaetidylinositol. Only archaetidylserine synthase (ASS, from Methanothermobacter thermautotrophicus, has been experimentally identified. Other enzymes have not been fully examined. Through database searching, we detected many archaeal hypothetical proteins that show sequence similarity to members of the CDP alcohol phosphatidyltransferase family, such as phosphatidylserine synthase (PSS, phosphatidylglycerol synthase (PGS and phosphatidylinositol synthase (PIS derived from Bacteria and Eukarya. The archaeal hypothetical proteins were classified into two groups, based on the sequence similarity. Members of the first group, including ASS from M. thermautotrophicus, were closely related to PSS. The rough agreement between PSS homologue distribution within Archaea and the experimentally identified distribution of archaetidylserine suggested that the hypothetical proteins are ASSs. We found that an open reading frame (ORF tends to be adjacent to that of ASS in the genome, and that the order of the two ORFs is conserved. The sequence similarity of phosphatidylserine decarboxylase to the product of the ORF next to the ASS gene, together with the genomic context conservation, suggests that the ORF encodes archaetidylserine decarboxylase, which may transform archaetidylserine to archaetidylethanolamine. The second group of archaeal hypothetical proteins was related to PGS and PIS. The members of this group were subjected to molecular phylogenetic analysis, together with PGSs and PISs and it was found that they formed two distinct clusters in the molecular phylogenetic tree. The distribution of members of each cluster within Archaea

  18. Methanobacterium Dominates Biocathodic Archaeal Communities in Methanogenic Microbial Electrolysis Cells

    KAUST Repository

    Siegert, Michael

    2015-07-06

    © 2015 American Chemical Society. Methane is the primary end product from cathodic current in microbial electrolysis cells (MECs) in the absence of methanogenic inhibitors, but little is known about the archaeal communities that develop in these systems. MECs containing cathodes made from different materials (carbon brushes, or plain graphite blocks or blocks coated with carbon black and platinum, stainless steel, nickel, ferrihydrite, magnetite, iron sulfide, or molybdenum disulfide) were inoculated with anaerobic digester sludge and acclimated at a set potential of -600 mV (versus a standard hydrogen electrode). The archaeal communities on all cathodes, except those coated with platinum, were predominated by Methanobacterium (median 97% of archaea). Cathodes with platinum contained mainly archaea most similar to Methanobrevibacter. Neither of these methanogens were abundant (<0.1% of archaea) in the inoculum, and therefore their high abundance on the cathode resulted from selective enrichment. In contrast, bacterial communities on the cathode were more diverse, containing primarily δ-Proteobacteria (41% of bacteria). The lack of a consistent bacterial genus on the cathodes indicated that there was no similarly selective enrichment of bacteria on the cathode. These results suggest that the genus Methanobacterium was primarily responsible for methane production in MECs when cathodes lack efficient catalysts for hydrogen gas evolution. (Figure Presented).

  19. 利用小亚基核糖体RNA技术分析温室黄瓜近根土壤古菌和真菌多样性%Diversity analysis of archaeal and fungal communities in adjacent cucumber root soil samples in greenhouse by small-subunit rRNA gene cloning

    Institute of Scientific and Technical Information of China (English)

    赵志祥; 芦晓飞; 陈国华; 茆振川; 杨宇红; 刘二明; 谢丙炎

    2011-01-01

    constructed. The sequences of archaea and fungi were defined into operational taxonomic units (OTUs) when 97% similarity threshold for OTU assignment was performed by using the software DOTUR. Phylogenenetic analysis showed that crenarchaeota and unidentified-archaea were the two major sub-groups and only a few of euryarchaeota existed in the archaeal clone library, total 45 OTUs. All the crenarchaeota belonged to thermoprotei;except for Basidiomycotina, the other four sub-group fimgi were discovered in the fungal library, total 24 OTUs. The diversities of archaea were very abundant and a few euryarchaeota (methanebacteria) existed in the archaeal clone library, it might be directly related to the long-term high temperature, high humidity, and high content of organic matter. The limitation of oxygen was the other reason for causing this phenomenon; Ascomycotina (over 80%) was the dominant sub-groups in fungal library. It was because most of the plant fungai diseases belonged to soil-borne diseases which gone through the winter by the ways of scierotium or perithecium and became the sources of primary infection.

  20. Phylogenetic diversity of freshwater picocyanobacteria

    OpenAIRE

    Callieri, Cristiana; Coci, Manuela

    2012-01-01

    Picocyanobacteria are photosynthetic prokaryotes, coccoid or rod-shaped, with a cell diameter < 2 ?m. They are common in lakes and oceans, and abundant across a wide spectrum of trophic conditions (Callieri et al 2012). The dominant genus of freshwater picocyanobacteria is Synechococcus. Analysis of 16S rRNA gene of freshwater Synechococcus showed its polyphyletic origin, requiring better insights in the present classification of the genus and possibly a revision. We isolated more than 40 pic...

  1. Phylogenetically resolving epidemiologic linkage

    Science.gov (United States)

    Romero-Severson, Ethan O.; Bulla, Ingo; Leitner, Thomas

    2016-01-01

    Although the use of phylogenetic trees in epidemiological investigations has become commonplace, their epidemiological interpretation has not been systematically evaluated. Here, we use an HIV-1 within-host coalescent model to probabilistically evaluate transmission histories of two epidemiologically linked hosts. Previous critique of phylogenetic reconstruction has claimed that direction of transmission is difficult to infer, and that the existence of unsampled intermediary links or common sources can never be excluded. The phylogenetic relationship between the HIV populations of epidemiologically linked hosts can be classified into six types of trees, based on cladistic relationships and whether the reconstruction is consistent with the true transmission history or not. We show that the direction of transmission and whether unsampled intermediary links or common sources existed make very different predictions about expected phylogenetic relationships: (i) Direction of transmission can often be established when paraphyly exists, (ii) intermediary links can be excluded when multiple lineages were transmitted, and (iii) when the sampled individuals’ HIV populations both are monophyletic a common source was likely the origin. Inconsistent results, suggesting the wrong transmission direction, were generally rare. In addition, the expected tree topology also depends on the number of transmitted lineages, the sample size, the time of the sample relative to transmission, and how fast the diversity increases after infection. Typically, 20 or more sequences per subject give robust results. We confirm our theoretical evaluations with analyses of real transmission histories and discuss how our findings should aid in interpreting phylogenetic results. PMID:26903617

  2. Planktonic Euryarchaeota are a significant source of archaeal tetraether lipids in the ocean

    Science.gov (United States)

    Lincoln, Sara A.; Wai, Brenner; Eppley, John M.; Church, Matthew J.; Summons, Roger E.; DeLong, Edward F.

    2014-01-01

    Archaea are ubiquitous in marine plankton, and fossil forms of archaeal tetraether membrane lipids in sedimentary rocks document their participation in marine biogeochemical cycles for >100 million years. Ribosomal RNA surveys have identified four major clades of planktonic archaea but, to date, tetraether lipids have been characterized in only one, the Marine Group I Thaumarchaeota. The membrane lipid composition of the other planktonic archaeal groups—all uncultured Euryarchaeota—is currently unknown. Using integrated nucleic acid and lipid analyses, we found that Marine Group II Euryarchaeota (MG-II) contributed significantly to the tetraether lipid pool in the North Pacific Subtropical Gyre at shallow to intermediate depths. Our data strongly suggested that MG-II also synthesize crenarchaeol, a tetraether lipid previously considered to be a unique biomarker for Thaumarchaeota. Metagenomic datasets spanning 5 y indicated that depth stratification of planktonic archaeal groups was a stable feature in the North Pacific Subtropical Gyre. The consistent prevalence of MG-II at depths where the bulk of exported organic matter originates, together with their ubiquitous distribution over diverse oceanic provinces, suggests that this clade is a significant source of tetraether lipids to marine sediments. Our results are relevant to archaeal lipid biomarker applications in the modern oceans and the interpretation of these compounds in the geologic record. PMID:24946804

  3. CrAgDb--a database of annotated chaperone repertoire in archaeal genomes.

    Science.gov (United States)

    Rani, Shikha; Srivastava, Abhishikha; Kumar, Manish; Goel, Manisha

    2016-03-01

    Chaperones are a diverse class of ubiquitous proteins that assist other cellular proteins in folding correctly and maintaining their native structure. Many different chaperones cooperate to constitute the 'proteostasis' machinery in the cells. It has been proposed earlier that archaeal organisms could be ideal model systems for deciphering the basic functioning of the 'protein folding machinery' in higher eukaryotes. Several chaperone families have been characterized in archaea over the years but mostly one protein at a time, making it difficult to decipher the composition and mechanistics of the protein folding system as a whole. In order to deal with these lacunae, we have developed a database of all archaeal chaperone proteins, CrAgDb (Chaperone repertoire in Archaeal genomes). The data have been presented in a systematic way with intuitive browse and search facilities for easy retrieval of information. Access to these curated datasets should expedite large-scale analysis of archaeal chaperone networks and significantly advance our understanding of operation and regulation of the protein folding machinery in archaea. Researchers could then translate this knowledge to comprehend the more complex protein folding pathways in eukaryotic systems. The database is freely available at http://14.139.227.92/mkumar/cragdb/. PMID:26862144

  4. Diversity of Ammonia-Oxidizing Archaea and Bacteria Across Physical-Chemical Gradients in San Francisco Bay Estuary Sediments

    Science.gov (United States)

    Mosier, A. C.; Francis, C. A.

    2006-12-01

    A combination of recent metagenomic analyses and the cultivation of a novel, ammonia-oxidizing, marine crenarchaeota revealed the first evidence for nitrification within the Archaeal domain. Further genetic and metagenomic studies demonstrated the presence of ammonia-oxidizing crenarchaea in diverse marine and terrestrial environments. These discoveries challenge the currently accepted view of the global nitrogen cycle and validate the need for further research on microbial diversity and function. In particular, it is imperative to reexamine the microbial communities involved in ammonia oxidation in marine and estuarine sediments, where this process plays a pivotal role in the cycling and removal of nitrogen. Using phylogenetic analyses of ammonia monooxygenase subunit A (amoA) gene sequences, we examined the distribution and diversity of ammonia-oxidizing archaea (AOA) and bacteria (AOB) in San Francisco Bay, the largest estuary on the West coast of the United States. The highly impacted bay, encompassing nearly 178,000 km2, effectively connects two estuaries with varying physical-chemical characteristics to the Pacific Ocean. We recovered archaeal and bacterial amoA genes from 11 sites distributed throughout the bay, spanning the northern and southern estuaries and the central region where they connect to the ocean. Richness estimates varied considerably across all sites examined, with archaeal amoA estimates being generally higher than bacterial amoA. Several of the bacterial amoA libraries were represented by fewer than 3 genotypes. Archaeal amoA sequences were phylogenetically diverse and grouped within previously described sediment and soil/sediment clusters. Several sequences were closely related to the only cultivated AOA, Nitrosopumilus maritimus. Both the archaeal and bacterial amoA sequences showed significant regional specificity. Distinct populations exist in the northern and southern estuaries and sequences from the northernmost and southernmost sites

  5. Temporal Dynamics of Active Prokaryotic Nitrifiers and Archaeal Communities from River to Sea

    OpenAIRE

    Hugoni, Mylène; Agogué, Hélène; Taib, Najwa; Domaizon, Isabelle; Moné, Anne; Pierre E Galand; Bronner, Gisèle; Debroas, Didier; Mary, Isabelle

    2015-01-01

    International audience To test if different niches for potential nitrifiers exist in estuarine systems, we assessed by pyrosequencing the diversity of archaeal gene transcript markers for taxonomy (16S ribosomal RNA (rRNA)) during an entire year along a salinity gradient in surface waters of the Charente estuary (Atlantic coast, France). We further investigated the potential for estuarine prokaryotes to oxidize ammonia and hydrolyze urea by quantifying thaumarchaeal amoA and ureC and bacte...

  6. Abundance and Composition of Epiphytic Bacterial and Archaeal Ammonia Oxidizers of Marine Red and Brown Macroalgae

    OpenAIRE

    Trias, R. (Rosalía); García-Lledó A. (Arantzazu); Sánchez, N.; López-Jurado, J. L.; Hallin, S. (Sara); Bañeras, Ll. (Lluís)

    2012-01-01

    Ammonia-oxidizing bacteria (AOB) and archaea (AOA) are important for nitrogen cycling in marine ecosystems. Little is known about the diversity and abundance of these organisms on the surface of marine macroalgae, despite the algae’s potential importance to create surfaces and local oxygen-rich environments supporting ammonia oxidation at depths with low dissolved oxygen levels. We determined the abundance and composition of the epiphytic bacterial and archaeal ammonia-oxidizing communities o...

  7. Previously undocumented diversity and abundance of cryptic species: a phylogenetic analysis of Indo-Pacific Arminidae Rafinesque, 1814 (Mollusca: Nudibranchia) with descriptions of 20 new species of Dermatobranchus

    Science.gov (United States)

    Gosliner, Terrence M; Fahey, Shireen J

    2011-01-01

    The phylogenetic relationships amongst the Arminidae were analysed based upon morphological characters of 58 presently described species or nudibranchs, including 35 previously described Arminidae and 20 new species of Dermatobranchus. From the literature review and anatomical examinations, 43 characters were considered for 78 taxa. These characters were polarized using Berthella canariensis as the outgroup taxon and the type species of several other genera identified from recent publications. The resulting phylogeny supports the monophyly of Arminidae, Dermatobranchus, Doridina, and Proctonotidae. The paraphyly of the Arminina is further demonstrated in this study. Two previously described, but poorly known, species of Indo-Pacific Armina are redescribed, Armina magna Baba, 1955 and Armina paucifoliata Baba, 1955. The anatomy and taxonomic status of nine previously described species of Dermatobranchus were examined in this study. The anatomy of Dermatobranchus pustulosus (van Hasselt, 1824) has been overlooked since Bergh (1888) illustrated the radula of van Hasselt's specimen. It is redescribed and its range is extended to several new localities in the western Pacific. Dermatobranchus pulcherrimus Miller & Willan, 1986 is considered here as a new synonym of Dermatobranchus rubidus (Gould, 1852). The following 20 species of Dermatobranchus are new and are described in the present paper: Dermatobranchus albineus sp. nov., Dermatobranchus arminus sp. nov., Dermatobranchus caesitius sp. nov., Dermatobranchus caeruleomaculatus sp. nov., Dermatobranchus cymatilis sp. nov., Dermatobranchus dendonephthyphagus sp. nov., Dermatobranchus diagonalis sp. nov., Dermatobranchus earlei sp. nov., Dermatobranchus fasciatus sp. nov., Dermatobranchus funiculus sp. nov., Dermatobranchus kalyptos sp. nov., Dermatobranchus kokonas sp. nov., Dermatobranchus leoni sp. nov., Dermatobranchus microphallus sp. nov., Dermatobranchus oculus sp. nov., Dermatobranchus phyllodes sp. nov

  8. Archaeal community structures in the solfataric acidic hot springs with different temperatures and elemental compositions.

    Science.gov (United States)

    Satoh, Tomoko; Watanabe, Keiko; Yamamoto, Hideo; Yamamoto, Shuichi; Kurosawa, Norio

    2013-01-01

    Archaeal 16S rRNA gene compositions and environmental factors of four distinct solfataric acidic hot springs in Kirishima, Japan were compared. The four ponds were selected by differences of temperature and total dissolved elemental concentration as follows: (1) Pond-A: 93°C and 1679 mg L(-1), (2) Pond-B: 66°C and 2248 mg L(-1), (3) Pond-C: 88°C and 198 mg L(-1), and (4) Pond-D: 67°C and 340 mg L(-1). In total, 431 clones of 16S rRNA gene were classified into 26 phylotypes. In Pond-B, the archaeal diversity was the highest among the four, and the members of the order Sulfolobales were dominant. The Pond-D also showed relatively high diversity, and the most frequent group was uncultured thermoacidic spring clone group. In contrast to Pond-B and Pond-D, much less diverse archaeal clones were detected in Pond-A and Pond-C showing higher temperatures. However, dominant groups in these ponds were also different from each other. The members of the order Sulfolobales shared 89% of total clones in Pond-A, and the uncultured crenarchaeal groups shared 99% of total Pond-C clones. Therefore, species compositions and biodiversity were clearly different among the ponds showing different temperatures and dissolved elemental concentrations.

  9. Structure of the rare archaeal biosphere and seasonal dynamics of active ecotypes in surface coastal waters.

    Science.gov (United States)

    Hugoni, Mylène; Taib, Najwa; Debroas, Didier; Domaizon, Isabelle; Jouan Dufournel, Isabelle; Bronner, Gisèle; Salter, Ian; Agogué, Hélène; Mary, Isabelle; Galand, Pierre E

    2013-04-01

    Marine Archaea are important players among microbial plankton and significantly contribute to biogeochemical cycles, but details regarding their community structure and long-term seasonal activity and dynamics remain largely unexplored. In this study, we monitored the interannual archaeal community composition of abundant and rare biospheres in northwestern Mediterranean Sea surface waters by pyrosequencing 16S rDNA and rRNA. A detailed analysis of the rare biosphere structure showed that the rare archaeal community was composed of three distinct fractions. One contained the rare Archaea that became abundant at different times within the same ecosystem; these cells were typically not dormant, and we hypothesize that they represent a local seed bank that is specific and essential for ecosystem functioning through cycling seasonal environmental conditions. The second fraction contained cells that were uncommon in public databases and not active, consisting of aliens to the studied ecosystem and representing a nonlocal seed bank of potential colonizers. The third fraction contained Archaea that were always rare but actively growing; their affiliation and seasonal dynamics were similar to the abundant microbes and could not be considered a seed bank. We also showed that the major archaeal groups, Thaumarchaeota marine group I and Euryarchaeota group II.B in winter and Euryarchaeota group II.A in summer, contained different ecotypes with varying activities. Our findings suggest that archaeal diversity could be associated with distinct metabolisms or life strategies, and that the rare archaeal biosphere is composed of a complex assortment of organisms with distinct histories that affect their potential for growth.

  10. Stratified active archaeal communities in the sediments of Jiulong River Estuary, China

    Directory of Open Access Journals (Sweden)

    Qianqian eLi

    2012-08-01

    Full Text Available Here the composition of total and active archaeal communities in a sediment core of Jiulong River estuary at Fujian Province, Southern China was reported. Profiles of CH4 and SO42- concentrations from the sediment core indicated the existence of a sulfate-methane transition zone (SMTZ in which sulfate reduction-coupled anaerobic oxidation of methane occurs. Accordingly, three sediment layers (16-18.5 cm, 71-73.5 cm, 161-163.5 cm from the 1.2 m sediment core were sectioned and named top, middle and bottom, respectively. Total DNA and RNA of each layer were extracted and used for clone libraries and sequence analysis of 16S rRNA genes, the reverse transcription (RT-PCR products of 16S rRNA and methyl CoM reductase alpha subunit (mcrA genes. Phylogenetic analysis indicated that archaeal communities of the three layers were dominated by the Miscellaneous Crenarchaeotal Group (MCG whose ecological functions were still unknown. The MCG could be further divided into seven subgroups, named MCG-A, B, C, D, E, F and G. MCG-A and MCG-G were the most active groups in the estuarine sediments. Known anaerobic methanotrophic archaea (ANMEs were only found as minor components in these estuarine archaeal communities. This study, together with the studies of deep subsurface sediments, would be a very good start point to target and compare the specific active archaeal groups and their roles in the dark, deep subsurface sediment environments.

  11. TBP Domain Symmetry in Basal and Activated Archaeal Transcription

    OpenAIRE

    Ouhammouch, Mohamed; Hausner, Winfried; Geiduschek, E Peter

    2008-01-01

    The TATA-box binding protein (TBP) is the platform for assembly of archaeal and eukaryotic transcription preinitiation complexes. Ancestral gene duplication and fusion events have produced the saddle-shaped TBP molecule, with its two direct-repeat subdomains and pseudo-two-fold symmetry. Collectively, eukaryotic TBPs have diverged from their present-day archaeal counterparts, which remain highly symmetrical. The similarity of the N- and C-halves of archaeal TBPs is especially pronounced in th...

  12. Changes in archaeal abundance and community structure along a salinity gradient in the lower Pearl River and its estuary

    Science.gov (United States)

    Zhang, C.; Wang, J.; Xie, W.; Wang, P.; Wei, Y.; Chen, S.; Zhou, X.

    2013-12-01

    Archaea occur in a wide range of habitats and across broad environmental gradients. At the global scale, salinity is known to be a major driving force for archaeal species diversity. The goal of this study was to examine changes in abundance and diversity of archaeal community DNA and membrane lipids in the water column along a salinity gradient in the lower Pearl River and estuary in the context of water/gas chemistry (pH, nitrate/nitrite, ammonia, methane, carbon dioxide). The pH increased and nitrate/nitrite and ammonia decreased from the lower Pearl River to the estuary. Methane and carbon dioxide fluxes were high in the lower Pearl River and decreased sharply in the estuary and toward the open ocean. The archaeal lipid profile exhibited abrupt changes from dominance of GDGT-0 (a glycerol diakly glycerol tetraether with zero cyclopentyl ring, which is commonly present in methanogens) to dominance of crenarchaeol (a specific biomarker for Thaumarchaeota) with increasing salinity from zero in the lower Pearl River to >0.5% in the estuary. Quantification of the 16S rRNA gene abundance using qPCR revealed a switch from bacteria-dominance to archaea-dominance and the ratio of archaeal nirK/bacterial-amoA genes had a peak value in the estuary, suggesting enhanced activity of ammonia oxidation by archaea. Pyrosequencing of archaeal 16S rRNA, amoA and nirK genes exhibited systematic variation defined by habitat types. Our current studies employ rate measurements of carbon fixation, ammonia oxidation, and nitrate reduction using isotope labeling approaches, which will allow us to link changes in archaeal community structure and ecological function.

  13. Geochemical Approach to Archaeal Ecology: δ13C of GDGTs

    Science.gov (United States)

    Lichtin, S.; Warren, C.; Pearson, A.; Pagani, M.

    2015-12-01

    Over the last decade and a half, glycerol dialkyl glycerol tetraethers (GDGTs) have increasingly been used to reconstruct environmental temperatures; proxies like TEX86 that correlate the relative abundance of these archaeal cell membrane lipids to sea surface temperature are omnipresent in paleoclimatology literature. While it has become common to make claims about past temperatures using GDGTs, our present understanding of the organisms that synthesize the compounds is still quite limited. The generally accepted theory states that microorganisms like the Thaumarchaeota modify the structure of membrane lipids to increase intermolecular interactions, strengthening the membrane at higher temperatures. Yet to date, culture experiments have been largely restricted to a single species, Nitrosopumilus maritimes, and recent studies on oceanic archaeal rRNA have revealed that these biomarkers are produced in diverse, heterogeneous, and site-specific communities. This brings up questions as to whether different subclasses of GDGTs, and all subsequent proxies, represent adaptation within a single organismal group or a shift in community composition. To investigate whether GDGTs with different chain structures, from the simple isoprenoidal GDGT-0 to Crenarchaeol with its many cyclopentane groups, are sourced from archaea with similar or disparate metabolic pathways—and if that information is inherited in GDGTs trapped in marine sediments—this study examines the stable carbon isotope values (δ13C) of GDGTs extracted from the uppermost meters of sediment in the Orca Basin, Gulf of Mexico, using spooling-wire microcombustion isotope-ratio mass spectrometer (SWiM-IRMS), tackling a fundamental assumption of the TEX86 proxy that influences the way we perceive the veracity of existing temperature records.

  14. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten;

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic co...... into the potential underlying mechanisms that have shaped community composition and phylogenetic diversity in one of the most species-rich, complex regions of the world....

  15. Bacterial/archaeal/organellar polyadenylation.

    Science.gov (United States)

    Mohanty, Bijoy K; Kushner, Sidney R

    2011-01-01

    Although the first poly(A) polymerase (PAP) was discovered in Escherichia coli in 1962, the study of polyadenylation in bacteria was largely ignored for the next 30 years. However, with the identification of the structural gene for E. coli PAP I in 1992, it became possible to analyze polyadenylation using both biochemical and genetic approaches. Subsequently, it has been shown that polyadenylation plays a multifunctional role in prokaryotic RNA metabolism. Although the bulk of our current understanding of prokaryotic polyadenylation comes from studies on E. coli, recent limited experiments with Cyanobacteria, organelles, and Archaea have widened our view on the diversity, complexity, and universality of the polyadenylation process. For example, the identification of polynucleotide phosphorylase (PNPase), a reversible phosphorolytic enzyme that is highly conserved in bacteria, as an additional PAP in E. coli caught everyone by surprise. In fact, PNPase has now been shown to be the source of post-transcriptional RNA modifications in a wide range of cells of prokaryotic origin including those that lack a eubacterial PAP homolog. Accordingly, the past few years have witnessed increased interest in the mechanism and role of post-transcriptional modifications in all species of prokaryotic origin. However, the fact that many of the poly(A) tails are very short and unstable as well as the presence of polynucleotide tails has posed significant technical challenges to the scientific community trying to unravel the mystery of polyadenylation in prokaryotes. This review discusses the current state of knowledge regarding polyadenylation and its functions in bacteria, organelles, and Archaea.

  16. Similarities and Contrasts in the Archaeal Community of Two Japanese Mountains: Mt. Norikura Compared to Mt. Fuji.

    Science.gov (United States)

    Singh, Dharmesh; Takahashi, Koichi; Park, Jungok; Adams, Jonathan M

    2016-02-01

    The community ecology, abundance, and diversity patterns of soil archaea are poorly understood-despite the fact that they are a major branch of life that is ubiquitous and important in nitrogen cycling in terrestrial ecosystems. We set out to investigate the elevational patterns of archaeal ecology, and how these compare with other groups of organisms. Many studies of different groups of organisms (plants, birds, etc.) have shown a series of distinct communities with elevation, and often a diversity maximum in mid-elevations. We investigated the soil archaeal communities on Mt. Norikura, Japan, using 454 pyrosequencing of the 16S ribosomal RNA (rRNA) gene. There was a strong mid-elevation maximum in diversity, and a mid-elevation maximum in abundance of soil archaea 16S rRNA and amoA genes. These diversity and abundance maximums could not be correlated with any identifiable soil parameter, nor plant diversity. Discrete, predictable communities of archaea occurred at each elevational level, also not explicable in terms of pH or major nutrients. When we compared the archaeal community and diversity patterns with those found in an earlier study of Mt Fuji, both mountains showed mid-elevation maximums in diversity and abundance of archaea, possibly a result of some common environmental factor such as soil disturbance frequency. However, they showed distinct sets of archaeal communities at similar elevational sampling points. Presumably, the difference reflects their distinct geology (Norikura being andesitic, while Fuji is basaltic) and the resulting combinations of soil chemistry and environmental conditions, although no explanatory variable was found. Clearly, many soil archaea have strongly defined niches and will only occur in a narrow subset of the range of possible climate and soil conditions. The findings of a mid-elevation diversity maximum on Norikura provides a further instance of how widespread this unexplained pattern is in nature, in a wide variety of

  17. DETECTING EFFECT OF PHYLOGENETIC DIVERSITY ON SEEDLING MORTALITY IN AN EVERGREEN BROAD-LEAVED FOREST IN CHINA%常绿阔叶林谱系多样性对幼苗存活率的影响

    Institute of Scientific and Technical Information of China (English)

    陈英

    2009-01-01

    密度制约机制对于维护生物多样性有非常重要的作用.随着对密度制约机制的深入研究,人们逐渐认识到:不仅在种内存在密度制约效应,亲缘关系相近的物种之间也可能表现出密度制约效应.webb在2000年提山的NRI(净种间亲缘关系指数)、NTI(净最近种间亲缘关系指数)考虑了比较全面的谱系信息,获得了广泛的应用.该文采用NRI、NTI来代表种间关系,并用Logistic回归模犁来分析了谱系因子对浙江省开化县古田山自然保护区24hm~2永久监测样地中501个幼苗样方死亡率的影响.通过对6次幼苗调查数据的分析表明:不仅相同物种密度对于幼苗的死亡率有显著影响,当密度达到一定水平时,谱系因子同样也对幼苗的死亡率有显著影响苗区中个体间的亲缘关系越近,幼苗个体的死亡率越高.%Aims Negative density dependence plays an important role in maintaining forest biodiversity. Ecologists found this mechanism operates not only between conspecifics but also between closely related heterospecifics. Our objective was to determine whether phylogenetic diversity affects seedling mortality at different scales.Methods We used net relatedness index (NRI) and nearest taxon index (NTI) to represent phylogenetic diversity and employed logistic regression modeling. We analyzed the relationship between seedling mortality and phylogenetic diversity using the seedling dynamic data from six seedling censuses of 507 seedling plots at Gutianshan Nature Reserve during May 2006 and November 2007. Important findings We found that higher density of conspecifics resulted in higher seedling mortality, and phylogenetic diversity was responsible for seedling mortality when seedling density was high (>3.46 individuals·m~(-2)).

  18. Methane metabolism in the archaeal phylum Bathyarchaeota revealed by genome-centric metagenomics.

    Science.gov (United States)

    Evans, Paul N; Parks, Donovan H; Chadwick, Grayson L; Robbins, Steven J; Orphan, Victoria J; Golding, Suzanne D; Tyson, Gene W

    2015-10-23

    Methanogenic and methanotrophic archaea play important roles in the global flux of methane. Culture-independent approaches are providing deeper insight into the diversity and evolution of methane-metabolizing microorganisms, but, until now, no compelling evidence has existed for methane metabolism in archaea outside the phylum Euryarchaeota. We performed metagenomic sequencing of a deep aquifer, recovering two near-complete genomes belonging to the archaeal phylum Bathyarchaeota (formerly known as the Miscellaneous Crenarchaeotal Group). These genomes contain divergent homologs of the genes necessary for methane metabolism, including those that encode the methyl-coenzyme M reductase (MCR) complex. Additional non-euryarchaeotal MCR-encoding genes identified in a range of environments suggest that unrecognized archaeal lineages may also contribute to global methane cycling. These findings indicate that methane metabolism arose before the last common ancestor of the Euryarchaeota and Bathyarchaeota. PMID:26494757

  19. Methane metabolism in the archaeal phylum Bathyarchaeota revealed by genome-centric metagenomics.

    Science.gov (United States)

    Evans, Paul N; Parks, Donovan H; Chadwick, Grayson L; Robbins, Steven J; Orphan, Victoria J; Golding, Suzanne D; Tyson, Gene W

    2015-10-23

    Methanogenic and methanotrophic archaea play important roles in the global flux of methane. Culture-independent approaches are providing deeper insight into the diversity and evolution of methane-metabolizing microorganisms, but, until now, no compelling evidence has existed for methane metabolism in archaea outside the phylum Euryarchaeota. We performed metagenomic sequencing of a deep aquifer, recovering two near-complete genomes belonging to the archaeal phylum Bathyarchaeota (formerly known as the Miscellaneous Crenarchaeotal Group). These genomes contain divergent homologs of the genes necessary for methane metabolism, including those that encode the methyl-coenzyme M reductase (MCR) complex. Additional non-euryarchaeotal MCR-encoding genes identified in a range of environments suggest that unrecognized archaeal lineages may also contribute to global methane cycling. These findings indicate that methane metabolism arose before the last common ancestor of the Euryarchaeota and Bathyarchaeota.

  20. Spatial isolation and environmental factors drive distinct bacterial and archaeal communities in different types of petroleum reservoirs in China

    Science.gov (United States)

    Gao, Peike; Tian, Huimei; Wang, Yansen; Li, Yanshu; Li, Yan; Xie, Jinxia; Zeng, Bing; Zhou, Jiefang; Li, Guoqiang; Ma, Ting

    2016-02-01

    To investigate the spatial distribution of microbial communities and their drivers in petroleum reservoir environments, we performed pyrosequencing of microbial partial 16S rRNA, derived from 20 geographically separated water-flooding reservoirs, and two reservoirs that had not been flooded, in China. The results indicated that distinct underground microbial communities inhabited the different reservoirs. Compared with the bacteria, archaeal alpha-diversity was not strongly correlated with the environmental variables. The variation of the bacterial and archaeal community compositions was affected synthetically, by the mining patterns, spatial isolation, reservoir temperature, salinity and pH of the formation brine. The environmental factors explained 64.22% and 78.26% of the total variance for the bacterial and archaeal communities, respectively. Despite the diverse community compositions, shared populations (48 bacterial and 18 archaeal genera) were found and were dominant in most of the oilfields. Potential indigenous microorganisms, including Carboxydibrachium, Thermosinus, and Neptunomonas, were only detected in a reservoir that had not been flooded with water. This study indicates that: 1) the environmental variation drives distinct microbial communities in different reservoirs; 2) compared with the archaea, the bacterial communities were highly heterogeneous within and among the reservoirs; and 3) despite the community variation, some microorganisms are dominant in multiple petroleum reservoirs.

  1. Exploring microbial dark matter to resolve the deep archaeal ancestry of eukaryotes.

    Science.gov (United States)

    Saw, Jimmy H; Spang, Anja; Zaremba-Niedzwiedzka, Katarzyna; Juzokaite, Lina; Dodsworth, Jeremy A; Murugapiran, Senthil K; Colman, Dan R; Takacs-Vesbach, Cristina; Hedlund, Brian P; Guy, Lionel; Ettema, Thijs J G

    2015-09-26

    The origin of eukaryotes represents an enigmatic puzzle, which is still lacking a number of essential pieces. Whereas it is currently accepted that the process of eukaryogenesis involved an interplay between a host cell and an alphaproteobacterial endosymbiont, we currently lack detailed information regarding the identity and nature of these players. A number of studies have provided increasing support for the emergence of the eukaryotic host cell from within the archaeal domain of life, displaying a specific affiliation with the archaeal TACK superphylum. Recent studies have shown that genomic exploration of yet-uncultivated archaea, the so-called archaeal 'dark matter', is able to provide unprecedented insights into the process of eukaryogenesis. Here, we provide an overview of state-of-the-art cultivation-independent approaches, and demonstrate how these methods were used to obtain draft genome sequences of several novel members of the TACK superphylum, including Lokiarchaeum, two representatives of the Miscellaneous Crenarchaeotal Group (Bathyarchaeota), and a Korarchaeum-related lineage. The maturation of cultivation-independent genomics approaches, as well as future developments in next-generation sequencing technologies, will revolutionize our current view of microbial evolution and diversity, and provide profound new insights into the early evolution of life, including the enigmatic origin of the eukaryotic cell. PMID:26323759

  2. Assessment of bacterial and archaeal community structure in Swine wastewater treatment processes.

    Science.gov (United States)

    Da Silva, Marcio Luis Busi; Cantão, Mauricio Egídio; Mezzari, Melissa Paola; Ma, Jie; Nossa, Carlos Wolfgang

    2015-07-01

    Microbial communities from two field-scale swine wastewater treatment plants (WWTPs) were assessed by pyrosequencing analyses of bacterial and archaeal 16S ribosomal DNA (rDNA) fragments. Effluent samples from secondary (anaerobic covered lagoons and upflow anaerobic sludge blanket [UASB]) and tertiary treatment systems (open-pond natural attenuation lagoon and air-sparged nitrification-denitrification tank followed by alkaline phosphorus precipitation process) were analyzed. A total of 56,807 and 48,859 high-quality reads were obtained from bacterial and archaeal libraries, respectively. Dominant bacterial communities were associated with the phylum Firmicutes, Bacteroidetes, Proteobacteria, or Actinobacteria. Bacteria and archaea diversity were highest in UASB effluent sample. Escherichia, Lactobacillus, Bacteroides, and/or Prevotella were used as indicators of putative pathogen reduction throughout the WWTPs. Satisfactory pathogen reduction was observed after the open-pond natural attenuation lagoon but not after the air-sparged nitrification/denitrification followed by alkaline phosphorus precipitation treatment processes. Among the archaeal communities, 80% of the reads was related to hydrogeno-trophic methanogens Methanospirillum. Enrichment of hydrogenotrophic methanogens detected in effluent samples from the anaerobic covered lagoons and UASB suggested that CO2 reduction with H2 was the dominant methanogenic pathway in these systems. Overall, the results served to improve our current understanding of major microbial communities' changes downgradient from the pen and throughout swine WWTP as a result of different treatment processes. PMID:25432577

  3. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  4. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest.

    Science.gov (United States)

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2011-03-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees were monitored at bimonthly intervals through 16S rRNA gene-based terminal restriction fragment length polymorphism profiling and quantitative PCR analysis. Effects on nitrifying and denitrifying groups were assessed by measuring the abundances of nirS and nosZ genes as well as bacterial and archaeal amoA genes. Seasonal dynamics displayed by key phylogenetic and nitrogen (N) cycling functional groups were found to be tightly coupled with seasonal alterations in labile C and N pools as well as with variation in soil temperature and soil moisture. In particular, archaea and acidobacteria were highly responsive to soil nutritional and soil climatic changes associated with seasonality, indicating their high metabolic versatility and capability to adapt to environmental changes. For these phyla, significant interrelations with soil chemical and microbial process data were found suggesting their potential, but poorly described contribution to nitrification or denitrification in temperate forest soils. In conclusion, our extensive approach allowed us to get novel insights into effects of seasonality and resource availability on the microbial community, in particular on hitherto poorly studied bacterial phyla and functional groups.

  5. Biogas production and methanogenic archaeal community in mesophilic and thermophilic anaerobic co-digestion processes.

    Science.gov (United States)

    Yu, D; Kurola, J M; Lähde, K; Kymäläinen, M; Sinkkonen, A; Romantschuk, M

    2014-10-01

    Over 258 Mt of solid waste are generated annually in Europe, a large fraction of which is biowaste. Sewage sludge is another major waste fraction. In this study, biowaste and sewage sludge were co-digested in an anaerobic digestion reactor (30% and 70% of total wet weight, respectively). The purpose was to investigate the biogas production and methanogenic archaeal community composition in the anaerobic digestion reactor under meso- (35-37 °C) and thermophilic (55-57 °C) processes and an increasing organic loading rate (OLR, 1-10 kg VS m(-3) d(-1)), and also to find a feasible compromise between waste treatment capacity and biogas production without causing process instability. In summary, more biogas was produced with all OLRs by the thermophilic process. Both processes showed a limited diversity of the methanogenic archaeal community which was dominated by Methanobacteriales and Methanosarcinales (e.g. Methanosarcina) in both meso- and thermophilic processes. Methanothermobacter was detected as an additional dominant genus in the thermophilic process. In addition to operating temperatures, the OLRs, the acetate concentration, and the presence of key substrates like propionate also affected the methanogenic archaeal community composition. A bacterial cell count 6.25 times higher than archaeal cell count was observed throughout the thermophilic process, while the cell count ratio varied between 0.2 and 8.5 in the mesophilic process. This suggests that the thermophilic process is more stable, but also that the relative abundance between bacteria and archaea can vary without seriously affecting biogas production.

  6. Functional analysis of archaeal MBF1 by complementation studies in yeast

    Directory of Open Access Journals (Sweden)

    Siebers Bettina

    2011-03-01

    Full Text Available Abstract Background Multiprotein-bridging factor 1 (MBF1 is a transcriptional co-activator that bridges a sequence-specific activator (basic-leucine zipper (bZIP like proteins (e.g. Gcn4 in yeast or steroid/nuclear-hormone receptor family (e.g. FTZ-F1 in insect and the TATA-box binding protein (TBP in Eukaryotes. MBF1 is absent in Bacteria, but is well- conserved in Eukaryotes and Archaea and harbors a C-terminal Cro-like Helix Turn Helix (HTH domain, which is the only highly conserved, classical HTH domain that is vertically inherited in all Eukaryotes and Archaea. The main structural difference between archaeal MBF1 (aMBF1 and eukaryotic MBF1 is the presence of a Zn ribbon motif in aMBF1. In addition MBF1 interacting activators are absent in the archaeal domain. To study the function and therefore the evolutionary conservation of MBF1 and its single domains complementation studies in yeast (mbf1Δ as well as domain swap experiments between aMBF1 and yMbf1 were performed. Results In contrast to previous reports for eukaryotic MBF1 (i.e. Arabidopsis thaliana, insect and human the two archaeal MBF1 orthologs, TMBF1 from the hyperthermophile Thermoproteus tenax and MMBF1 from the mesophile Methanosarcina mazei were not functional for complementation of an Saccharomyces cerevisiae mutant lacking Mbf1 (mbf1Δ. Of twelve chimeric proteins representing different combinations of the N-terminal, core domain, and the C-terminal extension from yeast and aMBF1, only the chimeric MBF1 comprising the yeast N-terminal and core domain fused to the archaeal C-terminal part was able to restore full wild-type activity of MBF1. However, as reported previously for Bombyx mori, the C-terminal part of yeast Mbf1 was shown to be not essential for function. In addition phylogenetic analyses revealed a common distribution of MBF1 in all Archaea with available genome sequence, except of two of the three Thaumarchaeota; Cenarchaeum symbiosum A and Nitrosopumilus maritimus

  7. Seasonal Effects in a Lake Sediment Archaeal Community of the Brazilian Savanna

    OpenAIRE

    Thiago Rodrigues; Elisa Catão; Mercedes M. C. Bustamante; Quirino, Betania F.; Kruger, Ricardo H; Kyaw, Cynthia M

    2014-01-01

    The Cerrado is a biome that corresponds to 24% of Brazil’s territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked ...

  8. Characterisation of the microbial diversity in a pig manure storage pit using small subunit rDNA sequence analysis.

    Science.gov (United States)

    Snell-Castro, Raúl; Godon, Jean-Jacques; Delgenès, Jean-Philippe; Dabert, Patrick

    2005-04-01

    The microbial community structure of pig manure slurry (PMS) was determined with comparative analysis of 202 bacterial, 44 archaeal and 33 eukaryotic small subunit (SSU) rDNA partial sequences. Based on a criterion of 97% of sequence similarity, the phylogenetic analyses revealed a total of 108, eight and five phylotypes for the Bacteria, Archaea and Eukarya lineages, respectively. Only 36% of the bacterial phylotypes were closely related (>or=97% similarity) to any previously known sequence in databases. The bacterial groups most often represented in terms of phylotype and clone abundance were the Eubacterium (22% of total sequences), the Clostridium (15% of sequences), the Bacillus-Lactobacillus-Streptococcus subdivision (20% of sequences), theMycoplasma and relatives (10% of sequences) and the Flexibacter-Cytophaga-Bacteroides (20% of sequences). The global microbial community structure and phylotype diversity show a close relationship to the pig gastrointestinal tract ecosystem whereas phylotypes from the Acholeplasma-Anaeroplasma and the Clostridium purinolyticum groups appear to be better represented in manure. Archaeal diversity was dominated by three phylotypes clustering with a group of uncultured microorganisms of unknown activity and only distantly related to the Thermoplasmales and relatives. Other Archaea were methanogenic H2/CO2 utilisers. No known acetoclastic Archaea methanogen was found. Eukaryotic diversity was represented by a pluricellular nematode, two Alveolata, a Blastocystis and an Entamoebidae. Manure slurry physico-chemical characteristics were analysed. Possible inhibitory effects of acetate, sulphide and ammonia concentrations on the microbial anaerobic ecosystem are discussed. PMID:16329909

  9. First insights into the diversity of gill monogeneans of 'Gnathochromis' and Limnochromis (Teleostei, Cichlidae) in Burundi: do the parasites mirror host ecology and phylogenetic history?

    Science.gov (United States)

    Kmentová, Nikol; Gelnar, Milan; Koblmüller, Stephan; Vanhove, Maarten P M

    2016-01-01

    Monogenea is one of the most species-rich groups of parasitic flatworms worldwide, with many species described only recently, which is particularly true for African monogeneans. For example, Cichlidogyrus, a genus mostly occurring on African cichlids, comprises more than 100 nominal species. Twenty-two of these have been described from Lake Tanganyika, a famous biodiversity hotspot in which many vertebrate and invertebrate taxa, including monogeneans, underwent unique and spectacular radiations. Given their often high degrees of host specificity, parasitic monogeneans were also used as a potential tool to uncover host species relationships. This study presents the first investigation of the monogenean fauna occurring on the gills of endemic 'Gnathochromis' species along the Burundese coastline of Lake Tanganyika. We test whether their monogenean fauna reflects the different phylogenetic position and ecological niche of 'Gnathochromis' pfefferi and Gnathochromis permaxillaris. Worms collected from specimens of Limnochromis auritus, a cichlid belonging to the same cichlid tribe as G. permaxillaris, were used for comparison. Morphological as well as genetic characterisation was used for parasite identification. In total, all 73 Cichlidogyrus individuals collected from 'G.' pfefferi were identified as C. irenae. This is the only representative of Cichlidogyrus previously described from 'G.' pfefferi, its type host. Gnathochromis permaxillaris is infected by a species of Cichlidogyrus morphologically very similar to C. gillardinae. The monogenean species collected from L. auritus is considered as new for science, but sample size was insufficient for a formal description. Our results confirm previous suggestions that 'G.' pfefferi as a good disperser is infected by a single monogenean species across the entire Lake Tanganyika. Although G. permaxillaris and L. auritus are placed in the same tribe, Cichlidogyrus sp. occurring on G. permaxillaris is morphologically more

  10. A Method for Identification of Selenoprotein Genes in Archaeal Genomes

    Institute of Scientific and Technical Information of China (English)

    Mingfeng Li; Yanzhao Huang; Yi Xiao

    2009-01-01

    The genetic codon UGA has a dual function: serving as a terminator and encoding selenocysteine. However, most popular gene annotation programs only take it as a stop signal, resulting in misannotation or completely missing selenoprotein genes. We developed a computational method named Asec-Prediction that is specific for the prediction of archaeal selenoprotein genes. To evaluate its effectiveness, we first applied it to 14 archaeal genomes with previously known selenoprotein genes, and Asec-Prediction identified all reported selenoprotein genes without redundant results. When we applied it to 12 archaeal genomes that had not been researched for selenoprotein genes, Asec-Prediction detected a novel selenoprotein gene in Methanosarcina acetivorans. Further evidence was also collected to support that the predicted gene should be a real selenoprotein gene. The result shows that Asec-Prediction is effective for the prediction of archaeal selenoprotein genes.

  11. Micro-evolutionary diversification among Indian Ocean parrots: temporal and spatial changes in phylogenetic diversity as a consequence of extinction and invasion

    OpenAIRE

    Jackson, H.; Jones, C G; Agapow, P-M; Tatayah, V; Groombridge, Jim J

    2015-01-01

    Almost 90% of global bird extinctions have occurred on islands. The loss of endemic spe- cies from island systems can dramatically alter evolutionary trajectories of insular species biodiversity, resulting in a loss of evolutionary diversity important for species adaptation to changing environments. The Western Indian Ocean islands have been the scene of evolution for a large number of endemic parrots. Since their discovery in the 16th cen- tury, many of these parrots have become extinct or h...

  12. Divergent responses of methanogenic archaeal communities in two rice cultivars to elevated ground-level O3.

    Science.gov (United States)

    Zhang, Jianwei; Tang, Haoye; Zhu, Jianguo; Lin, Xiangui; Feng, Youzhi

    2016-06-01

    Inhibitive effect of elevated ground-level ozone (O3) on paddy methane (CH4) emission varies with rice cultivars. However, little information is available on its microbial mechanism. For this purpose, the responses of methane-metabolizing microorganisms, methanogenic archaea and methanotrophic bacteria to O3 pollution were investigated in the O3-tolerant (YD6) and the O3-sensitive (IIY084) cultivars at two rice growth stages in Free Air Concentration Elevation of O3 (O3-FACE) system of China. It was found that O3 pollution didn't change the abundances of Type I and Type II methanotrophic bacteria at two rice stages. For methanogenic archaea, their abundances in both cultivars were decreased by O3 pollution at the tillering stage. Furthermore, a greater negative influence on methanogenic archaeal community was observed on IIY084 than on YD6: at tillering stage, the alpha diversity indices of methanogenic archaeal community in IIY084 was decreased to a greater extent than in YD6; IIY084 shifted methanogenic archaeal community composition and decreased the abundances and the diversities of Methanosarcinaceae and Methanosaetaceae as well as the abundance of Methanomicrobiales, while the diversity of Methanocellaceae were increased in YD6. These findings indicate that the variations in the responses of paddy CH4 emission to O3 pollution between cultivars could result from the divergent responses of their methanogenic archaea. PMID:26895536

  13. Structure and Cell Biology of Archaeal Virus STIV

    OpenAIRE

    Fu, Chi-yu; Johnson, John E.

    2012-01-01

    Recent investigations of archaeal viruses have revealed novel features of their structures and life cycles when compared to eukaryotic and bacterial viruses, yet there are structure-based unifying themes suggesting common ancestral relationships among dsDNA viruses in the three kingdoms of life. Sulfolobus solfataricus and the infecting virus Sulfolobus turreted icosahedral virus (STIV) is one of the well-established model systems to study archaeal virus replication and viral-host interaction...

  14. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs.

    Directory of Open Access Journals (Sweden)

    Pedro R Frade

    Full Text Available Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP and clone library sequencing of the 16S rRNA gene to compare the diversity and community structure of dominant archaeal and bacterial communities associating with the mucus of three common reef-building coral species (Porites astreoides, Siderastrea siderea and Orbicella annularis over different spatial scales on a Caribbean fringing reef. Sampling locations included three reef sites, three reef patches within each site and two depths. Reference sediment samples and ambient water were also taken for each of the 18 sampling locations resulting in a total of 239 samples. While only 41% of the bacterial operational taxonomic units (OTUs characterized by T-RFLP were shared between mucus and the ambient water or sediment, for archaeal OTUs this percentage was 2-fold higher (78%. About half of the mucus-associated OTUs (44% and 58% of bacterial and archaeal OTUs, respectively were shared between the three coral species. Our multivariate statistical analysis (ANOSIM, PERMANOVA and CCA showed that while the bacterial community composition was determined by habitat (mucus, sediment or seawater, host coral species, location and spatial distance, the archaeal community composition was solely determined by the habitat. This study highlights that mucus-associated archaeal and bacterial communities differ in their degree of community turnover over reefs and in their host-specificity.

  15. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs.

    Science.gov (United States)

    Frade, Pedro R; Roll, Katharina; Bergauer, Kristin; Herndl, Gerhard J

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP) and clone library sequencing of the 16S rRNA gene to compare the diversity and community structure of dominant archaeal and bacterial communities associating with the mucus of three common reef-building coral species (Porites astreoides, Siderastrea siderea and Orbicella annularis) over different spatial scales on a Caribbean fringing reef. Sampling locations included three reef sites, three reef patches within each site and two depths. Reference sediment samples and ambient water were also taken for each of the 18 sampling locations resulting in a total of 239 samples. While only 41% of the bacterial operational taxonomic units (OTUs) characterized by T-RFLP were shared between mucus and the ambient water or sediment, for archaeal OTUs this percentage was 2-fold higher (78%). About half of the mucus-associated OTUs (44% and 58% of bacterial and archaeal OTUs, respectively) were shared between the three coral species. Our multivariate statistical analysis (ANOSIM, PERMANOVA and CCA) showed that while the bacterial community composition was determined by habitat (mucus, sediment or seawater), host coral species, location and spatial distance, the archaeal community composition was solely determined by the habitat. This study highlights that mucus-associated archaeal and bacterial communities differ in their degree of community turnover over reefs and in their host-specificity. PMID:26788724

  16. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  17. Forest strata drive spatial structure of bacterial and archaeal communities and microbial methane cycling in neotropical bromeliad wetlands

    Science.gov (United States)

    Martinson, Guntars; Brandt, Franziska; Conrad, Ralf

    2016-04-01

    Several thousands of tank bromeliads per hectare of neotropical forest create a unique wetland ecosystem that harbors diverse communities of archaea and bacteria and emit substantial amounts of methane. We studied spatial distribution of archaeal and bacterial communities, microbial methane cycling and their environmental drivers in tank bromeliad wetlands. We selected tank bromeliads of different species and functional types (terrestrial and canopy bromeliads) in a neotropical montane forest of Southern Ecuador and sampled the organic tank slurry. Archaeal and bacterial communities were characterized using terminal-restriction fragment length polymorphism (T-RFLP) and Illumina MiSeq sequencing, respectively, and linked with physico-chemical tank-slurry properties. Additionally, we performed tank-slurry incubations to measure methane production potential, stable carbon isotope fractionation and pathway of methane formation. Archaeal and bacterial community composition in bromeliad wetlands was dominated by methanogens and by Alphaproteobacteria, respectively, and did not differ between species but between functional types. Hydrogenotrophic Methanomicrobiales were the dominant methanogens among all bromeliads but the relative abundance of aceticlastic Methanosaetaceae increased in terrestrial bromeliads. Complementary, hydrogenotrophic methanogenesis was the dominant pathway of methane formation but the relative contribution of aceticlastic methanogenesis increased in terrestrial bromeliads and led to a concomitant increase in total methane production. Rhodospirillales were characteristic for canopy bromeliads, Planctomycetales and Actinomycetalis for terrestrial bromeliads. While nitrogen concentration and pH explained 32% of the archaeal community variability, 29% of the bacterial community variability was explained by nitrogen, acetate and propionate concentrations. Our study demonstrates that bromeliad functional types, associated with different forest strata

  18. A new species of Andean frog of the genus Bryophryne from southern Peru Anura: Craugastoridae) and its phylogenetic position, with notes on the diversity of the genus.

    Science.gov (United States)

    Chaparro, Juan C; Padial, José M; Gutiérrez, Roberto C; De La Riva, Ignacio

    2015-01-01

    We describe a new species of terrestrial frog of the genus Bryophryne (Anura: Craugastoridae) from the wet puna and elfin forests of the Amazonian versant of the Andes. The new species seems to be restricted to high altitude environments at elevations between 3506-3651 m in the area now protected by Megantoni National Sanctuary and Manu National Park (Distrito de Echarate, Provincia La Convención, Departamento Cusco, Peru). The new species is characterized by lacking vomerine processes of vomers, by having tympanic annulus and tympanic membrane not evident through the skin, smooth dorsal skin with scattered warts, conspicuous dorsolateral, middorsal, and occipital folds, warty flanks, areolate skin on ventral surfaces of the body, and by lacking finger and toe fringes and basal web on feet. In life, specimens have bright and highly variable dorsal coloration that ranges from olive-green to red with variable combinations of red or orange marks (red or orange in the green form and olive-green in the red form). Molecular phylogenetic analyses of mitochondrial and nuclear DNA place the new species within the genus Bryophryne and as sister group of B. cophites. Bryophryne bustamantei, also sequenced for this study, is found as the sister group of the clade formed by B. cophites and the new species. Bryophryne is found as sister group of Psychrophrynella in maximum likelihood analyses and as the sister group of a large clade of holoadenines in parsimony analyses. The genus Bryophryne now contains nine species, all of them distributed along the Cordillera Oriental of the Peruvian Andes, southeast of the Apurimac River valley. PMID:26250261

  19. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus "Ferrovum".

    Directory of Open Access Journals (Sweden)

    Sophie R Ullrich

    Full Text Available Members of the genus "Ferrovum" are ubiquitously distributed in acid mine drainage (AMD waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain "Ferrovum myxofaciens" P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus "Ferrovum" is extremely scarce.In order to access the wider genetic pool of the genus "Ferrovum" we sequenced the genome of a "Ferrovum"-containing mixed culture and successfully assembled the almost complete genome sequence of the novel "Ferrovum" strain JA12.The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct "Ferrovum" species. "Ferrovum" strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that "Ferrovum" strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively.The potential utilisation of urea by "Ferrovum" strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs "Ferrovum" strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin and Acidithiobacillus ferrivorans (iron oxidase indicates the existence of a modified pathway in "Ferrovum" strain JA12

  20. Phylogenetic and Physiological Diversity of Subseafloor Microbial Communities at Axial Seamount, Juan de Fuca Ridge: Summary of Results From the New Millenium Observatory (NeMO), 1998-2004

    Science.gov (United States)

    Baross, J. A.; Huber, J. A.; Mehta, M. P.; Opatkiewicz, A.; Bolton, S. A.; Butterfield, D. A.; Sogin, M. L.; Embley, R. W.

    2005-12-01

    Axial Seamount (45 ° 58' N; 130 ° 00' W) is an active submarine volcano located on the Juan de Fuca Ridge, approximately 300 miles off the coast of Oregon. Lying at the intersection of a seamount chain and a spreading axis, Axial is a unique study site from both the geological and biological perspective. In January of 1998, Axial experienced a week-long series of earthquakes, and subsequent water column and seafloor observations on the southeast portion of the caldera found temperature and chemical anomalies, extensive new seafloor lava flows, large "snow blower" type vents, and other characteristics commonly associated with diking-eruptive events. Due to its high activity and close proximity to shore, Axial was chosen as a site for a multi-year observatory (New Millenium Observatory, NeMO) to document changes and interactions between geology, chemistry, and biology on the mid-ocean ridge system. From 1998 through 2004, we extensively sampled diffuse vents at Axial Seamount to determine the physiological and phylogenetic diversity of subseafloor microbial communities and their relationship to the geochemical environment. Here we present a summary of those studies, including molecular-based phylogenetic surveys of bacteria, archaea, and potential nitrogen-fixing organisms, culturing results of thermophiles and hyperthermophiles from over 20 sites, and the distribution of one particular group of hyperthermophiles at diffuse vents throughout the caldera and how that distribution may be linked to the geochemical habitat. Results indicate that Axial supports a diverse subseafloor microbial community, including hydrogen and sulfur oxidizers, hyperthermophilic methane producers and heterotrophs, and many organisms with the potential to fix nitrogen. In addition, we find that the species composition of the microbial community changes in response to changes in the physical and chemical conditions at each vent site. The extent of seawater mixing with hydrothermal fluids

  1. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers

    Directory of Open Access Journals (Sweden)

    Céline Brochier-Armanet

    2006-01-01

    Full Text Available Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 °C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  2. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus “Ferrovum”

    Science.gov (United States)

    Ullrich, Sophie R.; Poehlein, Anja; Tischler, Judith S.; González, Carolina; Ossandon, Francisco J.; Daniel, Rolf; Holmes, David S.; Schlömann, Michael; Mühling, Martin

    2016-01-01

    Background Members of the genus “Ferrovum” are ubiquitously distributed in acid mine drainage (AMD) waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain “Ferrovum myxofaciens” P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus “Ferrovum” is extremely scarce. Objective In order to access the wider genetic pool of the genus “Ferrovum” we sequenced the genome of a “Ferrovum”-containing mixed culture and successfully assembled the almost complete genome sequence of the novel “Ferrovum” strain JA12. Phylogeny and Lifestyle The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct “Ferrovum” species. “Ferrovum” strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that “Ferrovum” strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively. Unique Metabolic Features The potential utilisation of urea by “Ferrovum” strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs “Ferrovum” strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin) and Acidithiobacillus

  3. Diversity of Sarcocystis spp shed by opossums in Brazil inferred with phylogenetic analysis of DNA coding ITS1, cytochrome B, and surface antigens.

    Science.gov (United States)

    Valadas, Samantha Y O B; da Silva, Juliana I G; Lopes, Estela Gallucci; Keid, Lara B; Zwarg, Ticiana; de Oliveira, Alice S; Sanches, Thaís C; Joppert, Adriana M; Pena, Hilda F J; Oliveira, Tricia M F S; Ferreira, Helena L; Soares, Rodrigo M

    2016-05-01

    Although few species of Sarcocystis are known to use marsupials of the genus Didelphis as definitive host, an extensive diversity of alleles of surface antigen genes (sag2, sag3, and sag4) has been described in samples of didelphid opossums in Brazil. In this work, we studied 25 samples of Sarcocystis derived from gastrointestinal tract of opossums of the genus Didelphis by accessing the variability of sag2, sag3, sag4, gene encoding cytochrome b (cytB) and first internal transcribed spacer (ITS1). Reference samples of Sarcocystis neurona (SN138) and Sarcocystis falcatula (SF1) maintained in cell culture were also analyzed. We found four allele variants of cytB, seven allele variants of ITS1, 10 allele variants of sag2, 13 allele variants of sag3, and 6 allele variants of sag4. None of the sporocyst-derived sequences obtained from Brazilian opossums revealed 100% identity to SN138 at cytB gene, nor to SN138 or SF1 at ITS1 locus. In addition, none of the sag alleles were found identical to either SF1 or SN138 homologous sequences, and a high number of new sag allele types were found other than those previously described in Brazil. Out of ten sag2 alleles, four are novel, while eight out of 13 sag3 alleles are novel and one out of six sag4 alleles is novel. Further studies are needed to clarify if such a vast repertoire of allele variants of Sarcocystis is the consequence of re-assortments driven by sexual exchange, in order to form individuals with highly diverse characteristics, such as pathogenicity, host spectrum, among others or if it only represents allele variants of different species with different biological traits.

  4. Diversity of Sarcocystis spp shed by opossums in Brazil inferred with phylogenetic analysis of DNA coding ITS1, cytochrome B, and surface antigens.

    Science.gov (United States)

    Valadas, Samantha Y O B; da Silva, Juliana I G; Lopes, Estela Gallucci; Keid, Lara B; Zwarg, Ticiana; de Oliveira, Alice S; Sanches, Thaís C; Joppert, Adriana M; Pena, Hilda F J; Oliveira, Tricia M F S; Ferreira, Helena L; Soares, Rodrigo M

    2016-05-01

    Although few species of Sarcocystis are known to use marsupials of the genus Didelphis as definitive host, an extensive diversity of alleles of surface antigen genes (sag2, sag3, and sag4) has been described in samples of didelphid opossums in Brazil. In this work, we studied 25 samples of Sarcocystis derived from gastrointestinal tract of opossums of the genus Didelphis by accessing the variability of sag2, sag3, sag4, gene encoding cytochrome b (cytB) and first internal transcribed spacer (ITS1). Reference samples of Sarcocystis neurona (SN138) and Sarcocystis falcatula (SF1) maintained in cell culture were also analyzed. We found four allele variants of cytB, seven allele variants of ITS1, 10 allele variants of sag2, 13 allele variants of sag3, and 6 allele variants of sag4. None of the sporocyst-derived sequences obtained from Brazilian opossums revealed 100% identity to SN138 at cytB gene, nor to SN138 or SF1 at ITS1 locus. In addition, none of the sag alleles were found identical to either SF1 or SN138 homologous sequences, and a high number of new sag allele types were found other than those previously described in Brazil. Out of ten sag2 alleles, four are novel, while eight out of 13 sag3 alleles are novel and one out of six sag4 alleles is novel. Further studies are needed to clarify if such a vast repertoire of allele variants of Sarcocystis is the consequence of re-assortments driven by sexual exchange, in order to form individuals with highly diverse characteristics, such as pathogenicity, host spectrum, among others or if it only represents allele variants of different species with different biological traits. PMID:26905780

  5. Crystal structure of the S. solfataricus archaeal exosome reveals conformational flexibility in the RNA-binding ring.

    Directory of Open Access Journals (Sweden)

    Changrui Lu

    Full Text Available BACKGROUND: The exosome complex is an essential RNA 3'-end processing and degradation machinery. In archaeal organisms, the exosome consists of a catalytic ring and an RNA-binding ring, both of which were previously reported to assume three-fold symmetry. METHODOLOGY/PRINCIPAL FINDINGS: Here we report an asymmetric 2.9 A Sulfolobus solfataricus archaeal exosome structure in which the three-fold symmetry is broken due to combined rigid body and thermal motions mainly within the RNA-binding ring. Since increased conformational flexibility was also observed in the RNA-binding ring of the related bacterial PNPase, we speculate that this may reflect an evolutionarily conserved mechanism to accommodate diverse RNA substrates for degradation. CONCLUSION/SIGNIFICANCE: This study clearly shows the dynamic structures within the RNA-binding domains, which provides additional insights on mechanism of asymmetric RNA binding and processing.

  6. Crystal structure of an archaeal actin homolog.

    Science.gov (United States)

    Roeben, Annette; Kofler, Christine; Nagy, István; Nickell, Stephan; Hartl, F Ulrich; Bracher, Andreas

    2006-04-21

    Prokaryotic homologs of the eukaryotic structural protein actin, such as MreB and ParM, have been implicated in determination of bacterial cell shape, and in the segregation of genomic and plasmid DNA. In contrast to these bacterial actin homologs, little is known about the archaeal counterparts. As a first step, we expressed a predicted actin homolog of the thermophilic archaeon Thermoplasma acidophilum, Ta0583, and determined its crystal structure at 2.1A resolution. Ta0583 is expressed as a soluble protein in T.acidophilum and is an active ATPase at physiological temperature. In vitro, Ta0583 forms sheets with spacings resembling the crystal lattice, indicating an inherent propensity to form filamentous structures. The fold of Ta0583 contains the core structure of actin and clearly belongs to the actin/Hsp70 superfamily of ATPases. Ta0583 is approximately equidistant from actin and MreB on the structural level, and combines features from both eubacterial actin homologs, MreB and ParM. The structure of Ta0583 co-crystallized with ADP indicates that the nucleotide binds at the interface between the subdomains of Ta0583 in a manner similar to that of actin. However, the conformation of the nucleotide observed in complex with Ta0583 clearly differs from that in complex with actin, but closely resembles the conformation of ParM-bound nucleotide. On the basis of sequence and structural homology, we suggest that Ta0583 derives from a ParM-like actin homolog that was once encoded by a plasmid and was transferred into a common ancestor of Thermoplasma and Ferroplasma. Intriguingly, both genera are characterized by the lack of a cell wall, and therefore Ta0583 could have a function in cellular organization.

  7. Phylogenetic diversity of nitrogenase (nifH) genes in deep-sea and hydrothermal vent environments of the Juan de Fuca Ridge.

    Science.gov (United States)

    Mehta, Mausmi P; Butterfield, David A; Baross, John A

    2003-02-01

    The subseafloor microbial habitat associated with typical unsedimented mid-ocean-ridge hydrothermal vent ecosystems may be limited by the availability of fixed nitrogen, inferred by the low ammonium and nitrate concentrations measured in diffuse hydrothermal fluid. Dissolved N2 gas, the largest reservoir of nitrogen in the ocean, is abundant in deep-sea and hydrothermal vent fluid. In order to test the hypothesis that biological nitrogen fixation plays an important role in nitrogen cycling in the subseafloor associated with unsedimented hydrothermal vents, degenerate PCR primers were designed to amplify the nitrogenase iron protein gene nifH from hydrothermal vent fluid. A total of 120 nifH sequences were obtained from four samples: a nitrogen-poor diffuse vent named marker 33 on Axial Volcano, sampled twice over a period of 1 year as its temperature decreased; a nitrogen-rich diffuse vent near Puffer on Endeavour Segment; and deep seawater with no detectable hydrothermal plume signal. Subseafloor nifH genes from marker 33 and Puffer are related to anaerobic clostridia and sulfate reducers. Other nifH genes unique to the vent samples include proteobacteria and divergent Archaea. All of the nifH genes from the deep-seawater sample are most closely related to the thermophilic, anaerobic archaeon Methanococcus thermolithotrophicus (77 to 83% amino acid similarity). These results provide the first genetic evidence of potential nitrogen fixers in hydrothermal vent environments and indicate that at least two sources contribute to the diverse assemblage of nifH genes detected in hydrothermal vent fluid: nifH genes from an anaerobic, hot subseafloor and nifH genes from cold, oxygenated deep seawater. PMID:12571018

  8. Archaeal-eubacterial mergers in the origin of Eukarya: phylogenetic classification of life

    Science.gov (United States)

    Margulis, L.

    1996-01-01

    A symbiosis-based phylogeny leads to a consistent, useful classification system for all life. "Kingdoms" and "Domains" are replaced by biological names for the most inclusive taxa: Prokarya (bacteria) and Eukarya (symbiosis-derived nucleated organisms). The earliest Eukarya, anaerobic mastigotes, hypothetically originated from permanent whole-cell fusion between members of Archaea (e.g., Thermoplasma-like organisms) and of Eubacteria (e.g., Spirochaeta-like organisms). Molecular biology, life-history, and fossil record evidence support the reunification of bacteria as Prokarya while subdividing Eukarya into uniquely defined subtaxa: Protoctista, Animalia, Fungi, and Plantae.

  9. Plant genotype-specific archaeal and bacterial endophytes but similar Bacillus antagonists colonize Mediterranean olive trees

    Directory of Open Access Journals (Sweden)

    Henry eMueller

    2015-03-01

    Full Text Available Endophytes have an intimate and often symbiotic interaction with their hosts. Less is known about the composition and function of endophytes in trees. In order to evaluate our hypothesis that plant genotype and origin have a strong impact on both, endophytes of leaves from 10 Olea europaea L. cultivars from the Mediterranean basin growing at a single agricultural site in Spain and from nine wild olive trees located in natural habitats in Greece, Cyprus and on Madeira Island were studied. The composition of the bacterial endophytic communities as revealed by 16S rRNA gene amplicon sequencing and the subsequent PCoA analysis showed a strong correlation to the plant genotypes. The bacterial distribution patterns were congruent with the plant origins in Eastern and Western areas of the Mediterranean basin. Subsequently, the endophytic microbiome of wild olives was shown to be closely related to those of cultivated olives of the corresponding geographic origins. The olive leaf endosphere harbored mostly Proteobacteria, followed by Firmicutes, Actinobacteria and Bacteroidetes. The detection of a high portion of archaeal taxa belonging to the phyla Thaumarchaeota, Crenarchaeota and Euryarchaeota in the amplicon libraries was an unexpected discovery, which was confirmed by quantitative real-time PCR revealing an archaeal portion of up to 35.8%. Although the function of these Archaea for their host plant remains speculative, this finding suggests a significant relevance of archaeal endophytes for plant-microbe interactions. In addition, the antagonistic potential of culturable endophytes was determined; all isolates with antagonistic activity against the olive-pathogenic fungus Verticillium dahliae Kleb. belong to Bacillus amyloliquefaciens. In contrast to the specific global structural diversity, BOX-fingerprints of the antagonistic Bacillus isolates were highly similar and independent of the olive genotype from which they were isolated.

  10. Response of Archaeal and Bacterial Soil Communities to Changes Associated with Outdoor Cattle Overwintering.

    Directory of Open Access Journals (Sweden)

    Alica Chroňáková

    Full Text Available Archaea and bacteria are important drivers for nutrient transformations in soils and catalyse the production and consumption of important greenhouse gases. In this study, we investigate changes in archaeal and bacterial communities of four Czech grassland soils affected by outdoor cattle husbandry. Two show short-term (3 years; STI and long-term impact (17 years; LTI, one is regenerating from cattle impact (REG and a control is unaffected by cattle (CON. Cattle manure (CMN, the source of allochthonous microbes, was collected from the same area. We used pyrosequencing of 16S rRNA genes to assess the composition of archaeal and bacterial communities in each soil type and CMN. Both short- and long- term cattle impact negatively altered archaeal and bacterial diversity, leading to increase of homogenization of microbial communities in overwintering soils over time. Moreover, strong shifts in the prokaryotic communities were observed in response to cattle overwintering, with the greatest impact on archaea. Oligotrophic and acidophilic microorganisms (e.g. Thaumarchaeota, Acidobacteria, and α-Proteobacteria dominated in CON and expressed strong negative response to increased pH, total C and N. Whereas copiotrophic and alkalophilic microbes (e.g. methanogenic Euryarchaeota, Firmicutes, Chloroflexi, Actinobacteria, and Bacteroidetes were common in LTI showing opposite trends. Crenarchaeota were also found in LTI, though their trophic interactions remain cryptic. Firmicutes, Bacteroidetes, Methanobacteriaceae, and Methanomicrobiaceae indicated the introduction and establishment of faecal microbes into the impacted soils, while Chloroflexi and Methanosarcinaceae suggested increased abundance of soil-borne microbes under altered environmental conditions. The observed changes in prokaryotic community composition may have driven corresponding changes in soil functioning.

  11. Genomic and metabolic diversity of Marine Group I Thaumarchaeota in the mesopelagic of two subtropical gyres.

    Directory of Open Access Journals (Sweden)

    Brandon K Swan

    Full Text Available Marine Group I (MGI Thaumarchaeota are one of the most abundant and cosmopolitan chemoautotrophs within the global dark ocean. To date, no representatives of this archaeal group retrieved from the dark ocean have been successfully cultured. We used single cell genomics to investigate the genomic and metabolic diversity of thaumarchaea within the mesopelagic of the subtropical North Pacific and South Atlantic Ocean. Phylogenetic and metagenomic recruitment analysis revealed that MGI single amplified genomes (SAGs are genetically and biogeographically distinct from existing thaumarchaea cultures obtained from surface waters. Confirming prior studies, we found genes encoding proteins for aerobic ammonia oxidation and the hydrolysis of urea, which may be used for energy production, as well as genes involved in 3-hydroxypropionate/4-hydroxybutyrate and oxidative tricarboxylic acid pathways. A large proportion of protein sequences identified in MGI SAGs were absent in the marine cultures Cenarchaeum symbiosum and Nitrosopumilus maritimus, thus expanding the predicted protein space for this archaeal group. Identifiable genes located on genomic islands with low metagenome recruitment capacity were enriched in cellular defense functions, likely in response to viral infections or grazing. We show that MGI Thaumarchaeota in the dark ocean may have more flexibility in potential energy sources and adaptations to biotic interactions than the existing, surface-ocean cultures.

  12. 新疆巴州牦牛种群线粒体DNA遗传多样性及其系统发育分析%Analysis on Genetic Diversity and Phylogenetic Relationship of Xingjiang Bazhou Yak Bsed on Mitochondrial DNA

    Institute of Scientific and Technical Information of China (English)

    王兰萍; 耿荣庆; 常洪; 冀德君; 李永红; 常春芳

    2013-01-01

    In the present study,the mitochondrial cytochrome b gene sequences of Xinjiang Bazhou yak population were sequenced and the phylogenetic trees were constructed to analyze genetic status.The results showed that four total haplotypes were detected of seventeen samples with the haplotype diversity 0.0331 and the nucleotide diversity 0.00102.The phylogenesis revealed there were two obvious branches of cytochrome b gene haplotypes,one was clustered with domestic yaks and the other was clustered with wild yaks.It illustrated that there may be two maternal origin for Bazhou yak.%研究测定新疆巴州牦牛种群线粒体DNA细胞色素b基因全长序列,在此基础上构建系统发育树,分析种群的遗传现状.结果表明,在17头巴州牦牛个体中检测到4种Cyt b基因单倍型,单倍型多样性为0.331,核苷酸多样性为0.00102;系统发育关系显示,巴州牦牛Cyt b基因单倍型明显有两个分支,一支与家牦牛单倍型聚在一起,另一支与新疆野牦牛单倍型聚在一起,表明巴州牦牛可能有2个母系起源.

  13. Archaeal Populations in Hypersaline Sediments Underlying Orange Microbial Mats in the Napoli Mud Volcano▿†

    Science.gov (United States)

    Lazar, Cassandre Sara; L'Haridon, Stéphane; Pignet, Patricia; Toffin, Laurent

    2011-01-01

    Microbial mats in marine cold seeps are known to be associated with ascending sulfide- and methane-rich fluids. Hence, they could be visible indicators of anaerobic oxidation of methane (AOM) and methane cycling processes in underlying sediments. The Napoli mud volcano is situated in the Olimpi Area that lies on saline deposits; from there, brine fluids migrate upward to the seafloor. Sediments associated with a brine pool and microbial orange mats of the Napoli mud volcano were recovered during the Medeco cruise. Based on analysis of RNA-derived sequences, the “active” archaeal community was composed of many uncultured lineages, such as rice cluster V or marine benthic group D. Function methyl coenzyme M reductase (mcrA) genes were affiliated with the anaerobic methanotrophic Archaea (ANME) of the ANME-1, ANME-2a, and ANME-2c groups, suggesting that AOM occurred in these sediment layers. Enrichment cultures showed the presence of viable marine methylotrophic Methanococcoides in shallow sediment layers. Thus, the archaeal community diversity seems to show that active methane cycling took place in the hypersaline microbial mat-associated sediments of the Napoli mud volcano. PMID:21335391

  14. Archaeal Genome Guardians Give Insights into Eukaryotic DNA Replication and Damage Response Proteins

    Directory of Open Access Journals (Sweden)

    David S. Shin

    2014-01-01

    Full Text Available As the third domain of life, archaea, like the eukarya and bacteria, must have robust DNA replication and repair complexes to ensure genome fidelity. Archaea moreover display a breadth of unique habitats and characteristics, and structural biologists increasingly appreciate these features. As archaea include extremophiles that can withstand diverse environmental stresses, they provide fundamental systems for understanding enzymes and pathways critical to genome integrity and stress responses. Such archaeal extremophiles provide critical data on the periodic table for life as well as on the biochemical, geochemical, and physical limitations to adaptive strategies allowing organisms to thrive under environmental stress relevant to determining the boundaries for life as we know it. Specifically, archaeal enzyme structures have informed the architecture and mechanisms of key DNA repair proteins and complexes. With added abilities to temperature-trap flexible complexes and reveal core domains of transient and dynamic complexes, these structures provide insights into mechanisms of maintaining genome integrity despite extreme environmental stress. The DNA damage response protein structures noted in this review therefore inform the basis for genome integrity in the face of environmental stress, with implications for all domains of life as well as for biomanufacturing, astrobiology, and medicine.

  15. 抗草甘膦转基因大豆对根际土壤氨氧化古菌群落多样性的影响%Effects of roundup ready transgenic soybean on ammonia-oxidizing archaeal diversity in rhizospheric soil

    Institute of Scientific and Technical Information of China (English)

    刘志华; 徐广惠; 王宏燕; 刘佳

    2012-01-01

    Roundup ready transgenic soybean [ Glycine max (L. ) Merr. ] (RRS) is one of the genetically modified crops and firstly commercialized by the Monsanto Company. In recent years, more attention has been paid on the risk assessment of RRS, including the potential effects on soil biota diversity. Ammonia-oxidizing archaea (AOA) are a group of the key microbes in nitrification, playing an important role in N cycle. By using PCR-DGGE cloning, this paper studied the diversity of AOA communities in the rhizosphere soils of RRS, its non-transgenic parental iso-line (RRS-S) , wild soybean (W-S) , and cultivated soybean (D-46) , aimed to provide theoretical basis for the ecological safety assessment on the transgenic soybean. The RRS had no remarkable effects on the AOA diversity, based on the Shannon diversity index and evenness index. The principal components analysis and DGGE analysis showed that the AOA community structure in the rhizosphere of RRS was significantly different with that in the rhizosphere of WS and D-46, but had no significant difference with that in the rhizosphere of RRS-S. Moreover, the AOA amok gene sequencing of DGGE bands and the phylogenetic analysis revealed that parts of the AOA in the rhizosphere of test soybean cultivars belonged to the clusters already reported in soil/ sediment, others belonged to the unknown clusters or groups in soil, but none of them belonged to the clusters in water or sediment. There was little change in the DGGE bands, among which,bands 1, 20, and 25 were missing, and band 3 was specific for RRS. In conclusion, RRS had no apparent effect on the diversity of AOA in rhizosphere soils, but could alter the composition of AOA community.%抗草甘膦转基因大豆是孟山都公司首次进行商业化生产的转基因作物.近年来其风险评价,包括土壤生物多样性风险评价受到越来越多的重视.氨氧化古菌是硝化过程的关键微生物,在氮素循环中起重要作用.本文

  16. 海岸带沉积物中氮循环功能微生物多样性%Phylogenetic and functional diversity of nitrogen cycling microbes in coastal sediments

    Institute of Scientific and Technical Information of China (English)

    龚骏; 宋延静; 张晓黎

    2013-01-01

    海岸带生境类型多样,环境梯度明显,是研究微生物多样性、群落结构与功能关系及调控机制的天然实验场.沉积物是海岸带环境中营养盐再生与转化发生的重要场所,其中多种微生物类群在氮素循环过程中扮演重要角色.本文重点介绍海岸带沉积物中固氮菌、氨氧化菌、厌氧氨氧化菌、反硝化与硝酸盐铵化微生物的基于16SrRNA基因的物种多样性和基于关键酶基因nifH、amoA、narG、nirS、nirK、nosZ、nrfA、hzo、hzs等的功能多样性;总结了在海岸带特有生境(如河口、潮间带、海草藻床、红树林、盐沼、珊瑚礁、浅海等)及污染胁迫、生物扰动等条件下各功能类群的群落组成特征及时空变化规律,并提出今后需要重点关注新的培养技术和方法的开发,以进一步提高微生物的可培养性,将单细胞基因组测序与分析技术、DNA和RNA结合起来研究,以全面了解氮循环微生物多样性、参与介导硝酸盐铵化过程的微生物多样性等方面.%The coastal zone contains diverse habitats which are usually characterized by strong environmental gradients (e.g.salinity,nutrients and pollutants).This makes the coastal zone an ideal experimental laboratory for describing microbial diversity and testing hypotheses on community structure,function and control.Coastal sediment is of significance in nutrient regeneration and transformation involving different assemblages of microbes in the nitrogen cycle.This review focuses on 16S rRNA gene-based phylogenetic diversity and the key enzyme encoding gene-based (e.g.nifH,amoA,narG,nirS,nirK,nosZ,nrfA,hzo and hzs) functional diversity of nitrogen fixing,ammonia oxidizing and anaerobic ammonia oxidation (Anammox) bacteria as well as bacteria and fungi involved in denitrification and dissimilatory nitrate reduction to ammonium (DNRA).Characteristics of community composition and diversity of nitrogen cycling microbes in different

  17. 丛生盔形珊瑚共附生可培养真菌多样性分析%Phylogenetic diversity analysis of cultured symbiotic fungi of Galaxea fascicularis L.

    Institute of Scientific and Technical Information of China (English)

    徐佳; 陈彬; 雷晓凌; 佘志刚; 肖碧红

    2011-01-01

    To study the diversity of cultured symbiotic fungi isolated from Galaxea fascicularis L. in the South China Sea. By dilution plate technique and ITS-rDNA sequence analysis to research the diversity of the cultured symbiotic fungi with the coral, determined sequences data were submitted to GenBank and compared with those known sequences. Phylogenetic tree were built up with MEGA 4.0 program. 19 different morphological strains were isolated from surface and inner of the coral Galaxea fascicularis. ITS-rDNA sequences analysis showed that, symbiosis cultured fungi mainly included Aspergillus sp., Cladosporium sp., Xylariales sp., Penicillium sp., Stachybotrys sp., Gibberella moniliformis, Fusarium sp. etc. The similarity of strain 4-13 sequence to the most closely related sequences in GenBank was only 89%. It is concluded that there are diverse fungal symbionts with coral Galaxea fascicularis, which have potential new microorganism resources, deserved for further study.%旨在研究珊瑚共附生可培养真菌多样性.运用稀释平板法和基于ITS-rDNA基因序列的系统发育分析对珊瑚共附生可培养真菌多样性进行研究,将所得到的基因序列与NCBI数据库GenBank中的序列进行相似性比较并构建系统发育树.实验中从丛生盔形珊瑚表面和内部共分离得到19株菌落形态各异的真菌.ITS-rDNA序列分析及形态学鉴定表明,丛生盔形珊瑚共附生真菌主要包括曲霉菌Aspergillus sp.、枝孢霉菌Cladosporium sp.、炭角菌Xylariales sp.、青霉菌Penicilliumsp.、葡萄穗霉菌Stachybotrys sp.,赤霉菌Gibberella moniliformis、镰刀霉菌Fusarium sp.等.分离得到的菌株中,4-13与GenBank中已报道的基因序列的相似性仅为89%.结果表明,与丛生盔形珊瑚共附生的可培养真菌较为丰富,是潜在的新的微生物菌种资源,具有进一步研究的价值.

  18. Genetic diversity and phylogenetic analysis of Citrus (L) from north-east India as revealed by meiosis, and molecular analysis of internal transcribed spacer region of rDNA.

    Science.gov (United States)

    Hynniewta, Marlykynti; Malik, Surendra Kumar; Rao, Satyawada Rama

    2014-12-01

    The north-eastern region of India is reported to be the center of origin and rich in diversity of Citrus (L.) species, where some wild and endangered species namely Citrus indica, Citrus macroptera, Citrus latipes, Citrus ichagensis and Citrus assamensis exist in their natural and undisturbed habitat. In order to have comprehensive information about the extent of genetic variability and the occurrence of cryptic genomic hybridity between and within various Citrus species, a combined approach involving morphological, cytogenetical and molecular approaches were adopted in the present study. Cytogenetic approaches are known to resolve taxonomic riddles in a more efficient manner, by clearly delineating taxa at species and sub species levels. Male meiotic studies revealed a gametic chromosome number of n = 9, without any evidence of numerical variations. Bivalents outnumbered all other types of associations in pollen mother cells (PMCs) analyzed at diplotene, diakinesis and metaphase I. Univalents were frequently encountered in nine species presently studied, though their presence appropriately did not influence the distributional pattern of the chromosomes at anaphases I and II. The molecular approaches for phylogenetic analysis based on sequence data related to ITS 1, ITS 2 and ITS 1 + 5.8 s + ITS 2 of rDNA using maximum parsimony method and Bayesian inference have thrown light on species inter-relationship and evolution of Citrus species confirming our cytogenetical interpretations. The three true basic species i.e. Citrus medica, Citrus maxima and Citrus reticulata with their unique status have been resolved into distinct clades with molecular approaches as well. C. indica which occupies a unique position in the phylogenetic ladder of the genus Citrus has been resolved as a distinct clade and almost behaving as an out-group. The presences of quadrivalents in C. indica also echo and support its unique position. From our study it is amply clear that C

  19. Genetic diversity and phylogenetic analysis of Citrus (L from north-east India as revealed by meiosis, and molecular analysis of internal transcribed spacer region of rDNA

    Directory of Open Access Journals (Sweden)

    Marlykynti Hynniewta

    2014-12-01

    Full Text Available The north-eastern region of India is reported to be the center of origin and rich in diversity of Citrus (L. species, where some wild and endangered species namely Citrus indica, Citrus macroptera, Citrus latipes, Citrus ichagensis and Citrus assamensis exist in their natural and undisturbed habitat. In order to have comprehensive information about the extent of genetic variability and the occurrence of cryptic genomic hybridity between and within various Citrus species, a combined approach involving morphological, cytogenetical and molecular approaches were adopted in the present study. Cytogenetic approaches are known to resolve taxonomic riddles in a more efficient manner, by clearly delineating taxa at species and sub species levels. Male meiotic studies revealed a gametic chromosome number of n = 9, without any evidence of numerical variations. Bivalents outnumbered all other types of associations in pollen mother cells (PMCs analyzed at diplotene, diakinesis and metaphase I. Univalents were frequently encountered in nine species presently studied, though their presence appropriately did not influence the distributional pattern of the chromosomes at anaphases I and II. The molecular approaches for phylogenetic analysis based on sequence data related to ITS 1, ITS 2 and ITS 1 + 5.8 s + ITS 2 of rDNA using maximum parsimony method and Bayesian inference have thrown light on species inter-relationship and evolution of Citrus species confirming our cytogenetical interpretations. The three true basic species i.e. Citrus medica, Citrus maxima and Citrus reticulata with their unique status have been resolved into distinct clades with molecular approaches as well. C. indica which occupies a unique position in the phylogenetic ladder of the genus Citrus has been resolved as a distinct clade and almost behaving as an out-group. The presences of quadrivalents in C. indica also echo and support its unique position. From our study it is amply

  20. Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

    Science.gov (United States)

    Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

    2013-01-01

    Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

  1. Familial relationships in hyperthermo- and acidophilic archaeal viruses

    DEFF Research Database (Denmark)

    Happonen, Lotta Johanna; Redder, Peter; Peng, Xu;

    2010-01-01

    Archaea often live in extreme, harsh environments such as acidic hot springs and hypersaline waters. To date, only two icosahedrally symmetric, membrane-containing archaeal viruses, SH1 and Sulfolobus turreted icosahedral virus (STIV), have been described in detail. We report the sequence and three...

  2. Microbial Diversity in Hydrate-bearing and -free Seafloor Surface Sediments in the Shenhu Area, South China Sea

    Science.gov (United States)

    Su, X.

    2015-12-01

    In 2007, the China's first gas hydrate drilling expedition GMGS-1 in the Shenhu area on the northern continental slope of the South China Sea was performed (Zhang et al., 2007). Six holes (namely Sites SH1B, SH2B, SH3B, SH5B, SH5C and SH7B) were drilled, and gas hydrate samples were recovered at three sites: Sites SH2B, SH3B and SH7B. In order to investigate microbial diversity and community features in correlation to gas hydrate-bearing sediments, a study on microbial diversity in the surface sediments at hydrate-bearing sites (SH3B and SH7B) and -free sites (SH1B, SH5B, SH5C) was carried out by using 16S rRNA gene phylogenetic analysis. The phylogenetic results indicated difference in microbial communities between hydrate-bearing and -free sediments. At the gas hydrate-bearing sites, bacterial communities were dominated by Deltaproteobacteria (30.5%), and archaeal communities were dominated by Miscellaneous Crenarchaeotic Group (33.8%); In contrast, Planctomycetes was the major group (43.9%) in bacterial communities, while Marine Benthic Group-D (MBG-D) (32.4%) took up the largest proportion in the archaeal communities. Moreover, the microbial communities have characteristics different from those in other hydrate-related sediments around the world, indicating that the presence of hydrates could affect the microbial distribution and community composition. In addition, the microbial community composition in the studied sediments has its own uniqueness, which may be resulted by co-effect of geochemical characteristics and presence/absence of gas hydrates.

  3. TIPP: taxonomic identification and phylogenetic profiling

    Science.gov (United States)

    Nguyen, Nam-phuong; Mirarab, Siavash; Liu, Bo; Pop, Mihai; Warnow, Tandy

    2014-01-01

    Motivation: Abundance profiling (also called ‘phylogenetic profiling’) is a crucial step in understanding the diversity of a metagenomic sample, and one of the basic techniques used for this is taxonomic identification of the metagenomic reads. Results: We present taxon identification and phylogenetic profiling (TIPP), a new marker-based taxon identification and abundance profiling method. TIPP combines SAT\\'e-enabled phylogenetic placement a phylogenetic placement method, with statistical techniques to control the classification precision and recall, and results in improved abundance profiles. TIPP is highly accurate even in the presence of high indel errors and novel genomes, and matches or improves on previous approaches, including NBC, mOTU, PhymmBL, MetaPhyler and MetaPhlAn. Availability and implementation: Software and supplementary materials are available at http://www.cs.utexas.edu/users/phylo/software/sepp/tipp-submission/. Contact: warnow@illinois.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25359891

  4. Advances in phylogenetic studies of Nematoda

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Nematoda is a metazoan group with extremely high diversity only next to Insecta. Caenorhabditis elegans is now a favorable experimental model animal in modern developmental biology, genetics and genomics studies. However, the phylogeny of Nematoda and the phylogenetic position of the phylum within animal kingdom have long been in debate. Recent molecular phylogenetic studies gave great challenges to the traditional nematode classification. The new phylogenies not only placed the Nematoda in the Ecdysozoan and divided the phylum into five clades, but also provided new insights into animal molecular identification and phylogenetic biodiversity studies. The present paper reviews major progress and remaining problems in the current molecular phylogenetic studies of Nematoda, and prospects the developmental tendencies of this field.

  5. 云南肉山羊黑色品系内不同家系遗传多样性分析%Study on the Genetic Diversity and Phylogenetic Relationship of Yunnan Black Meat Goat Strain

    Institute of Scientific and Technical Information of China (English)

    兰蓉; 朱兰; 王鹏; 洪琼花; 胡钟仁

    2012-01-01

    应用QIAxcel全自动遗传分析仪进行毛细管电泳,对云南肉山羊黑色品系5只公羊134只后代的基因组DNA进行了11个微卫星位点多态性分析,以期为这一品系的选育提高和合理选配提供科学依据.结果表明,在11个微卫星位点共检测到101个等位基因,片段大小在115~249 bp之间,全群平均期望杂合度和平均多态信息含量均在0.5以上,表明云南肉山羊黑色品系遗传多样性丰富.对5只公羊UPGMA聚类分析表明:5只公羊间遗传一致度较高,说明云南肉山羊黑色品系具备了相对统一的遗传基础;系统聚类图直观地显示出公羊N7379和N7373存在较近的亲缘关系,被聚为一支,而公羊N5043、N7303、N5049间也存在较近的亲缘关系,被聚为另一支,分属于不同分支的公羊间亲缘关系相对较远.%The genetic diversity of 134 offspring from 5 bucks of Yunnan black meat goat strain was studied by 11 microsatellites loci and cluster analysis. The results showed that the average expected heterozygosity (He) and the average polymorphism information content (PIC) for population of Yunnan black meat goat strain were above 0.5, indicating its abundant genetic diversity. The gene flow (Nm= 5.728) and the genetic differentiation (Fst=0.04l 8)indicated the low level differentiation in the population of Yunnan black meat goat strain. The UPGMA phylogeny tree of five bucks suggested that there was a close relationship between the buck no.N7379 and no.N7373,as well as the close phylogenetic relationship between buck no.N5043, no.7303 and no.N5049.There is a little further relationship between two groups mentioned above.

  6. High-resolution phylogenetic microbial community profiling

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett; Schwientek, Patrick; Clum, Alicia; Copeland, Alex; Ciobanu, Doina; Cheng, Jan-Fang; Gies, Esther; Hallam, Steve; Tringe, Susannah; Woyke, Tanja

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance our knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.

  7. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park.

    Science.gov (United States)

    Bowen De León, Kara; Gerlach, Robin; Peyton, Brent M; Fields, Matthew W

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park (YNP), Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatures (44°C, 63°C, 75°C). The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi) at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus) at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44 and 63°C springs and a thermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different) to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts.

  8. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    Science.gov (United States)

    Bowen De León, Kara; Gerlach, Robin; Peyton, Brent M.; Fields, Matthew W.

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park (YNP), Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatures (44°C, 63°C, 75°C). The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi) at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus) at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44 and 63°C springs and a thermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different) to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts. PMID:24282404

  9. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    Directory of Open Access Journals (Sweden)

    Kara Bowen De León

    2013-11-01

    Full Text Available The Heart Lake Geyser Basin (HLGB is remotely located at the base of Mount Sheridan in southern Yellowstone National Park, Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5 hot springs with varying temperatures (44°C, 63°C, 75°C. The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44°C and 63°C springs and a hyperthermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts.

  10. Archaeal communities of Arctic methane-containing permafrost.

    Science.gov (United States)

    Shcherbakova, Victoria; Yoshimura, Yoshitaka; Ryzhmanova, Yana; Taguchi, Yukihiro; Segawa, Takahiro; Oshurkova, Victoria; Rivkina, Elizaveta

    2016-10-01

    In the present study, we used culture-independent methods to investigate the diversity of methanogenic archaea and their distribution in five permafrost samples collected from a borehole in the Kolyma River Lowland (north-east of Russia). Total DNA was extracted from methane-containing permafrost samples of different age and amplified by PCR. The resulting DNA fragments were cloned. Phylogenetic analysis of the sequences showed the presence of archaea in all studied samples; 60%-95% of sequences belonged to the Euryarchaeota. Methanogenic archaea were novel representatives of Methanosarcinales, Methanomicrobiales, Methanobacteriales and Methanocellales orders. Bathyarchaeota (Miscellaneous Crenarchaeota Group) representatives were found among nonmethanogenic archaea in all the samples studied. The Thaumarchaeota representatives were not found in the upper sample, whereas Woesearchaeota (formerly DHVEG-6) were found in the three deepest samples. Unexpectedly, the greatest diversity of archaea was observed at a depth of 22.3 m, probably due to the availability of the labile organic carbon and/or due to the migration of the microbial cells during the freezing front towards the bottom. PMID:27312964

  11. A Note on Encodings of Phylogenetic Networks of Bounded Level

    CERN Document Server

    Gambette, Philippe

    2009-01-01

    Driven by the need for better models that allow one to shed light into the question how life's diversity has evolved, phylogenetic networks have now joined phylogenetic trees in the center of phylogenetics research. Like phylogenetic trees, such networks canonically induce collections of phylogenetic trees, clusters, and triplets, respectively. Thus it is not surprising that many network approaches aim to reconstruct a phylogenetic network from such collections. Related to the well-studied perfect phylogeny problem, the following question is of fundamental importance in this context: When does one of the above collections encode (i.e. uniquely describe) the network that induces it? In this note, we present a complete answer to this question for the special case of a level-1 (phylogenetic) network by characterizing those level-1 networks for which an encoding in terms of one (or equivalently all) of the above collections exists. Given that this type of network forms the first layer of the rich hierarchy of lev...

  12. 生姜种质遗传多样性和亲缘关系的SRAP分析%Genetic Diversity and Phylogenetic Relationship of Ginger Germplasm Resources Revealed by SRAPs

    Institute of Scientific and Technical Information of China (English)

    李秀; 徐坤; 巩彪

    2014-01-01

    [Objective]Ginger is vegetatively asexual crop that owns lots of local varieties, and its biological characteristics have been verified in many aspects caused by climate change, natural and artificial selection for thousands of years. This study was conducted to make a scientific classification of ginger germplasm, provide evidence for germplasm collection, protection and innovation of ginger by investigating the genetic diversity and relationship.[Method]Good genomic DNA was extracted from young leaves of 51 ginger accessions from different areas of the world following the CTAB method, and then were amplified by sequence-related amplified polymorphism molecular markers to analyze genetic diversity and phylogenetic relationship. Separation of the amplified fragments was performed on 6% denaturing polyacrylamide gels, The gels were stained with AgNO 3 for visualizing the SRAP fragments, and then“0, 1”matrix was obtained according to the electrophoresis results. The number of polymorphic loci, percentage of polymorphic loci, effective number of alleles, Nei’s genetic similarity coefficient, genetic distance and the indexes of Nei’s genetic diversity and Shannon information were estimated by POPGENE version1.32. The cluster analysis of 51 ginger accessions based on unweighted pair-group method and 7 ginger populations based on Nei’s genetic distance were performed on NTSYS version2.10e to classify the ginger germplasm. Meanwhile, the origin and transmission of ginger were discussed in accordance with genetic diversity and phylogenetic relationship of ginger germplasm in different ecotopes and in light of the relevant characteristics of origin center and historical records.[Result]Among the 305 bands detected by 15 selective primer pairs, 188 (61.68%) were polymorphic. On average, each primer combination amplified 20.33 loci and 12.53 polymorphic loci. This showed that genetic variation of ginger is extensive. The average indexes of Nei’s genetic diversity

  13. Ugan古河道胡杨可培养内生细菌的多样性%Phylogenetic diversity of culturable endophytic bacteria Isolated from the Populus euphratica at the disused ancient Ugan River

    Institute of Scientific and Technical Information of China (English)

    卡依尔·玉素甫; 谢仁娜依·甫拉提; 玛丽帕·吐达洪1; 马丽艳木·阿木东; 艾尼江·尔斯曼; 祖母拉提·阿布都热依木; 艾尔肯·热合曼

    2011-01-01

    [目的[为了了解塔河废弃古河道胡杨可培养内生细菌的多样性.[方法[从2棵胡杨树干部抽出其内存液,采用3种不同的培养基对样品的内生细菌进行了分离纯化;对它们进行16S rDNA测定和系统进化分析.[结果[分离纯化不同表型的细菌62株,对它们的16s rDNA序列分析表明,62株菌分别属于4个大类群;厚壁菌门(Firmicutes)、放线菌门(Actinobacteria)、α-变形菌纲(Alpha Proteobacteria)、γ-变形菌纲(GammaProteobacteria),18个属,32个种;芽孢杆菌属和假单胞菌属是胡杨可培养内生细菌的优势细菌种群,它们分别占已测种群的40.32%、16.13%.其中菌株KTH-63为葡萄球菌科的潜在的新属新种,它与最近源菌株的16s rDNA序列相似率为92.491%;9株菌KLH.21、KLH-1、KTH-8、KTH-14、KNA-26、KLH-18、KTH-20、KNA-3、KLH-25是潜在的新种(16S rDNA相似率为96.089%-97.769%),胡杨树干内存液中潜在新种的发现率高达总分离检测菌株的16.13%.本研究获得的胡杨可培养内生细菌的群落结构数据给植物内生细菌新增了10个属,18个种.[结论[胡杨具有多样性极其丰富的可培养内生细菌菌种资源,土著新种的发现频率超出了预期,胡杨可培养内生细菌的群落结构极大地刷新了植物内生细菌的种群记录,极具进一步发掘的潜力.%[Objective]The aim of this study was to identify the culturable endophytic bacteria recovered from the Populus euphratica at the disused (122 years ago) ancient Ugan river of middle reachs of Tarim river, and to understand their Phylogenetic diversity and community structure.[Methods]Bacteria were isolated from the storage liquid in the stem of 2 Populus euphratica stands by using 3 types of different cultural medium ( Luria -Bertani,Trypticase Soy Agar and Nutrient Agar) , followed carry out 16S rDNA identifications and analysis of their biodiversity.[Results]A total of 62 phenotypically different isolates were sequenced and

  14. Vestige: Maximum likelihood phylogenetic footprinting

    Directory of Open Access Journals (Sweden)

    Maxwell Peter

    2005-05-01

    Full Text Available Abstract Background Phylogenetic footprinting is the identification of functional regions of DNA by their evolutionary conservation. This is achieved by comparing orthologous regions from multiple species and identifying the DNA regions that have diverged less than neutral DNA. Vestige is a phylogenetic footprinting package built on the PyEvolve toolkit that uses probabilistic molecular evolutionary modelling to represent aspects of sequence evolution, including the conventional divergence measure employed by other footprinting approaches. In addition to measuring the divergence, Vestige allows the expansion of the definition of a phylogenetic footprint to include variation in the distribution of any molecular evolutionary processes. This is achieved by displaying the distribution of model parameters that represent partitions of molecular evolutionary substitutions. Examination of the spatial incidence of these effects across regions of the genome can identify DNA segments that differ in the nature of the evolutionary process. Results Vestige was applied to a reference dataset of the SCL locus from four species and provided clear identification of the known conserved regions in this dataset. To demonstrate the flexibility to use diverse models of molecular evolution and dissect the nature of the evolutionary process Vestige was used to footprint the Ka/Ks ratio in primate BRCA1 with a codon model of evolution. Two regions of putative adaptive evolution were identified illustrating the ability of Vestige to represent the spatial distribution of distinct molecular evolutionary processes. Conclusion Vestige provides a flexible, open platform for phylogenetic footprinting. Underpinned by the PyEvolve toolkit, Vestige provides a framework for visualising the signatures of evolutionary processes across the genome of numerous organisms simultaneously. By exploiting the maximum-likelihood statistical framework, the complex interplay between mutational

  15. A higher-level phylogenetic classification of the Fungi

    NARCIS (Netherlands)

    Hibbett, D.S.; Binder, M.; Bischoff, J.F.; Blackwell, M.; Cannon, P.F.; Eriksson, O.E.; Huhndorf, S.; James, T.; Kirk, P.M.; Lücking, R.; Thorsten Lumbsch, H.; Lutzoni, F.; Brandon Matheny, P.; McLaughlin, D.J.; Powell, M.J.; Redhead, S.; Schoch, C.L.; Spatafora, J.W.; Stalpers, J.A.; Vilgalys, R.; Aime, M.C.; Aptroot, A.; Bauer, R.; Begerow, D.; Benny, G.L.; Castlebury, L.A.; Crous, P.W.; Dai, Y.C.; Gams, W.; Geiser, D.M.; Griffith, G.W.; Gueidan, C.; Hawksworth, D.L.; Hestmark, G.; Hosaka, K.; Humber, R.A.; Hyde, K.D.; Ironside, J.E.; Koljalg, U.; Kurtzman, C.P.; Larsson, K.H.; Lichtwardt, R.; Longcore, J.; Miadlikowska, J.; Miller, A.; Moncalvo, J.M.; Mozley-Standridge, S.; Oberwinkler, F.; Parmasto, E.; Reeb, V.; Rogers, J.D.; Roux, Le C.; Ryvarden, L.; Sampaio, J.P.; Schüssler, A.; Sugiyama, J.; Thorn, R.G.; Tibell, L.; Untereiner, W.A.; Walker, C.; Wang, Z.; Weir, A.; Weiss, M.; White, M.M.; Winka, K.; Yao, Y.J.; Zhang, N.

    2007-01-01

    A comprehensive phylogenetic classification of the kingdom Fungi is proposed, with reference to recent molecular phylogenetic analyses, and with input from diverse members of the fungal taxonomic community. The classification includes 195 taxa, down to the level of order, of which 16 are described o

  16. Bacterial and archaeal resistance to ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Confalonieri, F; Sommer, S, E-mail: fabrice.confalonieri@u-psud.fr, E-mail: suzanne.sommer@u-psud.fr [University Paris-Sud, CNRS UMR8621, Institut de Genetique et Microbiologie, Batiments 400-409, Universite Paris-Sud, 91405 Orsay (France)

    2011-01-01

    Organisms living in extreme environments must cope with large fluctuations of temperature, high levels of radiation and/or desiccation, conditions that can induce DNA damage ranging from base modifications to DNA double-strand breaks. The bacterium Deinococcus radiodurans is known for its resistance to extremely high doses of ionizing radiation and for its ability to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Recently, extreme ionizing radiation resistance was also generated by directed evolution of an apparently radiation-sensitive bacterial species, Escherichia coli. Radioresistant organisms are not only found among the Eubacteria but also among the Archaea that represent the third kingdom of life. They present a set of particular features that differentiate them from the Eubacteria and eukaryotes. Moreover, Archaea are often isolated from extreme environments where they live under severe conditions of temperature, pressure, pH, salts or toxic compounds that are lethal for the large majority of living organisms. Thus, Archaea offer the opportunity to understand how cells are able to cope with such harsh conditions. Among them, the halophilic archaeon Halobacterium sp and several Pyrococcus or Thermococcus species, such as Thermococcus gammatolerans, were also shown to display high level of radiation resistance. The dispersion, in the phylogenetic tree, of radioresistant prokaryotes suggests that they have independently acquired radioresistance. Different strategies were selected during evolution including several mechanisms of radiation byproduct detoxification and subtle cellular metabolism modifications to help cells recover from radiation-induced injuries, protection of proteins against oxidation, an efficient DNA repair tool box, an original pathway of DNA double-strand break repair, a condensed nucleoid that may prevent the dispersion of the DNA fragments and specific radiation-induced proteins involved in

  17. Asperisporium and Pantospora (Mycosphaerellaceae): epitypifications and phylogenetic placement

    NARCIS (Netherlands)

    Minnis, A.M.; Kennedy, A.H.; Grenier, D.B.; Rehner, S.A.; Bischoff, J.F.

    2012-01-01

    The species-rich family Mycosphaerellaceae contains considerable morphological diversity and includes numerous anamorphic genera, many of which are economically important plant pathogens. Recent revisions and phylogenetic research have resulted in taxonomic instability. Ameliorating this problem req

  18. A shift in the archaeal nitrifier community in response to natural and anthropogenic disturbances in the northern Gulf of Mexico.

    Science.gov (United States)

    Newell, Silvia E; Eveillard, Damien; McCarthy, Mark J; Gardner, Wayne S; Liu, Zhanfei; Ward, Bess B

    2014-02-01

    The Gulf of Mexico is affected by hurricanes and suffers seasonal hypoxia. The Deepwater Horizon oil spill impacted every trophic level in the coastal region. Despite their importance in bioremediation and biogeochemical cycles, it is difficult to predict the responses of microbial communities to physical and anthropogenic disturbances. Here, we quantify sediment ammonia-oxidizing archaeal (AOA) community diversity, resistance and resilience, and important geochemical factors after major hurricanes and the oil spill. Dominant AOA archetypes correlated with different geochemical factors, suggesting that different AOA are constrained by distinct parameters. Diversity was lowest after the hurricanes, showing weak resistance to physical disturbances. However, diversity was highest during the oil spill and coincided with a community shift, suggesting a new alternative stable state sustained for at least 1 year. The new AOA community was not significantly different from that at the spill site 1 year after the spill. This sustained shift in nitrifier community structure may be a result of oil exposure. PMID:24596268

  19. Distribution of Archaeal and Bacterial communities in a subtropical reservoir

    Directory of Open Access Journals (Sweden)

    Laís Américo Soares

    2015-12-01

    Full Text Available Abstract Aim: Microbial communities play a central role in environmental process such as organic matter mineralization and the nutrient cycling process in aquatic ecosystems. Despite their ecological importance, variability of the structure of archaeal and bacterial communities in freshwater remains understudied. Methods In the present study we investigated the richness and density of archaea and bacteria in the water column and sediments of the Itupararanga Reservoir. We also evaluated the relationship between the communities and the biotic and abiotic characteristics. Samples were taken at five depths in the water column next to the dam and three depths next to the reservoir entrance. Results PCR-DGGE evaluation of the archaeal and bacterial communities showed that both were present in the water column, even in oxygenated conditions. Conclusions The density of the bacteria (qPCR was greater than that of the archaea, a result of the higher metabolic plasticity of bacteria compared with archaea.

  20. Prediction of novel archaeal enzymes from sequence-derived features

    DEFF Research Database (Denmark)

    Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren

    2002-01-01

    The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http://www.cbs.dtu.dk/......The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......://www.cbs.dtu.dk/services/ArchaeaFun/). The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....

  1. Abundance and diversity of ammonia-oxidizing archaea and bacteria on granular activated carbon and their fates during drinking water purification process.

    Science.gov (United States)

    Niu, Jia; Kasuga, Ikuro; Kurisu, Futoshi; Furumai, Hiroaki; Shigeeda, Takaaki; Takahashi, Kazuhiko

    2016-01-01

    Ammonia is a precursor to trichloramine, which causes an undesirable chlorinous odor. Granular activated carbon (GAC) filtration is used to biologically oxidize ammonia during drinking water purification; however, little information is available regarding the abundance and diversity of ammonia-oxidizing archaea (AOA) and bacteria (AOB) associated with GAC. In addition, their sources and fates in water purification process remain unknown. In this study, six GAC samples were collected from five full-scale drinking water purification plants in Tokyo during summer and winter, and the abundance and community structure of AOA and AOB associated with GAC were studied in these two seasons. In summer, archaeal and bacterial amoA genes on GACs were present at 3.7 × 10(5)-3.9 × 10(8) gene copies/g-dry and 4.5 × 10(6)-4.2 × 10(8) gene copies/g-dry, respectively. In winter, archaeal amoA genes remained at the same level, while bacterial amoA genes decreased significantly for all GACs. No differences were observed in the community diversity of AOA and AOB from summer to winter. Phylogenetic analysis revealed high AOA diversity in group I.1a and group I.1b in raw water. Terminal-restriction fragment length polymorphism analysis of processed water samples revealed that AOA diversity decreased dramatically to only two OTUs in group I.1a after ozonation, which were identical to those detected on GAC. It suggests that ozonation plays an important role in determining AOA diversity on GAC. Further study on the cell-specific activity of AOA and AOB is necessary to understand their contributions to in situ nitrification performance.

  2. Abundance and diversity of ammonia-oxidizing archaea and bacteria on granular activated carbon and their fates during drinking water purification process.

    Science.gov (United States)

    Niu, Jia; Kasuga, Ikuro; Kurisu, Futoshi; Furumai, Hiroaki; Shigeeda, Takaaki; Takahashi, Kazuhiko

    2016-01-01

    Ammonia is a precursor to trichloramine, which causes an undesirable chlorinous odor. Granular activated carbon (GAC) filtration is used to biologically oxidize ammonia during drinking water purification; however, little information is available regarding the abundance and diversity of ammonia-oxidizing archaea (AOA) and bacteria (AOB) associated with GAC. In addition, their sources and fates in water purification process remain unknown. In this study, six GAC samples were collected from five full-scale drinking water purification plants in Tokyo during summer and winter, and the abundance and community structure of AOA and AOB associated with GAC were studied in these two seasons. In summer, archaeal and bacterial amoA genes on GACs were present at 3.7 × 10(5)-3.9 × 10(8) gene copies/g-dry and 4.5 × 10(6)-4.2 × 10(8) gene copies/g-dry, respectively. In winter, archaeal amoA genes remained at the same level, while bacterial amoA genes decreased significantly for all GACs. No differences were observed in the community diversity of AOA and AOB from summer to winter. Phylogenetic analysis revealed high AOA diversity in group I.1a and group I.1b in raw water. Terminal-restriction fragment length polymorphism analysis of processed water samples revealed that AOA diversity decreased dramatically to only two OTUs in group I.1a after ozonation, which were identical to those detected on GAC. It suggests that ozonation plays an important role in determining AOA diversity on GAC. Further study on the cell-specific activity of AOA and AOB is necessary to understand their contributions to in situ nitrification performance. PMID:26463999

  3. Controls on bacterial and archaeal community structure and greenhouse gas production in natural, mined, and restored Canadian peatlands

    Directory of Open Access Journals (Sweden)

    Nathan eBasiliko

    2013-07-01

    Full Text Available Northern peatlands are important global C reservoirs, largely because of their slow rates of microbial C mineralization. Particularly in sites that are heavily influenced by anthropogenic disturbances, there is scant information about microbial ecology and whether or not microbial community structure influences greenhouse gas production. This work characterized communities of bacteria and archaea using terminal restriction fragment length polymorphism and sequence analysis of 16S rRNA and functional genes across eight natural, mined, or restored peatlands in two locations in eastern Canada. Correlations were explored among chemical properties of peat, bacterial and archaeal community structure, and carbon dioxide and methane production rates under oxic and anoxic conditions. Bacteria and archaea similar to those found in other peat soil environments were detected. In contrast to other reports, methanogen diversity was low in our study, with only 2 groups of known or suspected methanogens. Although mining and restoration affected substrate availability and microbial activity, these land-uses did not consistently affect bacterial or archaeal community composition. In fact, larger differences were observed between the two locations and between oxic and anoxic peat samples than between mined and restored sites, with anoxic samples characterized by less detectable bacterial diversity and stronger dominance by members of the phylum Acidobacteria. There were also no apparent strong linkages between prokaryote community structure and methane or carbon dioxide production, suggesting that different organisms exhibit functional redundancy and/or that the same taxa function at very different rates when exposed to different peat substrates. In contrast to other earlier work focusing on fungal communities across similar mined and restored peatlands, bacterial and archaeal communities appeared to be more resistant or resilient to peat substrate changes brought

  4. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes.

    Science.gov (United States)

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui

    2010-05-01

    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  5. Ribonucleoproteins in Archaeal Pre-rRNA Processing and Modification

    Directory of Open Access Journals (Sweden)

    W. S. Vincent Yip

    2013-01-01

    Full Text Available Given that ribosomes are one of the most important cellular macromolecular machines, it is not surprising that there is intensive research in ribosome biogenesis. Ribosome biogenesis is a complex process. The maturation of ribosomal RNAs (rRNAs requires not only the precise cleaving and folding of the pre-rRNA but also extensive nucleotide modifications. At the heart of the processing and modifications of pre-rRNAs in Archaea and Eukarya are ribonucleoprotein (RNP machines. They are called small RNPs (sRNPs, in Archaea, and small nucleolar RNPs (snoRNPs, in Eukarya. Studies on ribosome biogenesis originally focused on eukaryotic systems. However, recent studies on archaeal sRNPs have provided important insights into the functions of these RNPs. This paper will introduce archaeal rRNA gene organization and pre-rRNA processing, with a particular focus on the discovery of the archaeal sRNP components, their functions in nucleotide modification, and their structures.

  6. Phylogenetic turnover along local environmental gradients in tropical forest communities.

    Science.gov (United States)

    Baldeck, C A; Kembel, S W; Harms, K E; Yavitt, J B; John, R; Turner, B L; Madawala, S; Gunatilleke, N; Gunatilleke, S; Bunyavejchewin, S; Kiratiprayoon, S; Yaacob, A; Supardi, M N N; Valencia, R; Navarrete, H; Davies, S J; Chuyong, G B; Kenfack, D; Thomas, D W; Dalling, J W

    2016-10-01

    While the importance of local-scale habitat niches in shaping tree species turnover along environmental gradients in tropical forests is well appreciated, relatively little is known about the influence of phylogenetic signal in species' habitat niches in shaping local community structure. We used detailed maps of the soil resource and topographic variation within eight 24-50 ha tropical forest plots combined with species phylogenies created from the APG III phylogeny to examine how phylogenetic beta diversity (indicating the degree of phylogenetic similarity of two communities) was related to environmental gradients within tropical tree communities. Using distance-based redundancy analysis we found that phylogenetic beta diversity, expressed as either nearest neighbor distance or mean pairwise distance, was significantly related to both soil and topographic variation in all study sites. In general, more phylogenetic beta diversity within a forest plot was explained by environmental variables this was expressed as nearest neighbor distance versus mean pairwise distance (3.0-10.3 % and 0.4-8.8 % of variation explained among plots, respectively), and more variation was explained by soil resource variables than topographic variables using either phylogenetic beta diversity metric. We also found that patterns of phylogenetic beta diversity expressed as nearest neighbor distance were consistent with previously observed patterns of niche similarity among congeneric species pairs in these plots. These results indicate the importance of phylogenetic signal in local habitat niches in shaping the phylogenetic structure of tropical tree communities, especially at the level of close phylogenetic neighbors, where similarity in habitat niches is most strongly preserved. PMID:27337965

  7. Search for a 'Tree of Life' in the thicket of the phylogenetic forest

    Directory of Open Access Journals (Sweden)

    Puigbò Pere

    2009-07-01

    Full Text Available Abstract Background Comparative genomics has revealed extensive horizontal gene transfer among prokaryotes, a development that is often considered to undermine the 'tree of life' concept. However, the possibility remains that a statistical central trend still exists in the phylogenetic 'forest of life'. Results A comprehensive comparative analysis of a 'forest' of 6,901 phylogenetic trees for prokaryotic genes revealed a consistent phylogenetic signal, particularly among 102 nearly universal trees, despite high levels of topological inconsistency, probably due to horizontal gene transfer. Horizontal transfers seemed to be distributed randomly and did not obscure the central trend. The nearly universal trees were topologically similar to numerous other trees. Thus, the nearly universal trees might reflect a significant central tendency, although they cannot represent the forest completely. However, topological consistency was seen mostly at shallow tree depths and abruptly dropped at the level of the radiation of archaeal and bacterial phyla, suggesting that early phases of evolution could be non-tree-like (Biological Big Bang. Simulations of evolution under compressed cladogenesis or Biological Big Bang yielded a better fit to the observed dependence between tree inconsistency and phylogenetic depth for the compressed cladogenesis model. Conclusions Horizontal gene transfer is pervasive among prokaryotes: very few gene trees are fully consistent, making the original tree of life concept obsolete. A central trend that most probably represents vertical inheritance is discernible throughout the evolution of archaea and bacteria, although compressed cladogenesis complicates unambiguous resolution of the relationships between the major archaeal and bacterial clades.

  8. A comparative study of microbial diversity and community structure in marine sediments using poly(A tailing and reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Tatsuhiko eHoshino

    2013-06-01

    Full Text Available To obtain a better understanding of metabolically active microbial communities, we tested a molecular ecological approach using poly(A tailing of environmental 16S rRNA, followed by full-length complementary DNA (cDNA synthesis and sequencing to eliminate potential biases caused by mismatching of PCR primer sequences. The RNA pool tested was extracted from marine sediments of the Yonaguni Knoll IV hydrothermal field in the southern Okinawa Trough. The sequences obtained using the ploy(A tailing method were compared statistically and phylogenetically with those obtained using conventional reverse transcription-polymerase chain reaction (RT-PCR with published domain-specific primers. Both methods indicated that Deltaproteobacteria are predominant in sediment (>85% of the total sequence read. The poly(A tailing method indicated that Desulfobacterales were the predominant deltaproteobacteria, while most of the sequences in libraries constructed using RT-PCR were derived from Desulfuromonadales. This discrepancy may have been due to low coverage of Desulfobacterales by the primers used. A comparison of library diversity indices indicated that the poly(A tailing method retrieves more phylogenetically diverse sequences from the environment. The four archaeal 16S rRNA sequences that were obtained using the poly(A tailing method formed deeply branching lineages that were related to Candidatus Parvarchaeum and the Ancient Archaeal Group. These results clearly demonstrate that poly(A tailing followed by cDNA sequencing is a powerful and less biased molecular ecological approach for the study of metabolically active microbial communities.

  9. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    Science.gov (United States)

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  10. Community Composition and Abundance of Bacterial, Archaeal and Nitrifying Populations in Savanna Soils on Contrasting Bedrock Material in Kruger National Park, South Africa

    Science.gov (United States)

    Rughöft, Saskia; Herrmann, Martina; Lazar, Cassandre S.; Cesarz, Simone; Levick, Shaun R.; Trumbore, Susan E.; Küsel, Kirsten

    2016-01-01

    Savannas cover at least 13% of the global terrestrial surface and are often nutrient limited, especially by nitrogen. To gain a better understanding of their microbial diversity and the microbial nitrogen cycling in savanna soils, soil samples were collected along a granitic and a basaltic catena in Kruger National Park (South Africa) to characterize their bacterial and archaeal composition and the genetic potential for nitrification. Although the basaltic soils were on average 5 times more nutrient rich than the granitic soils, all investigated savanna soil samples showed typically low nutrient availabilities, i.e., up to 38 times lower soil N or C contents than temperate grasslands. Illumina MiSeq amplicon sequencing revealed a unique soil bacterial community dominated by Actinobacteria (20–66%), Chloroflexi (9–29%), and Firmicutes (7–42%) and an increase in the relative abundance of Actinobacteria with increasing soil nutrient content. The archaeal community reached up to 14% of the total soil microbial community and was dominated by the thaumarchaeal Soil Crenarchaeotic Group (43–99.8%), with a high fraction of sequences related to the ammonia-oxidizing genus Nitrosopshaera sp. Quantitative PCR targeting amoA genes encoding the alpha subunit of ammonia monooxygenase also revealed a high genetic potential for ammonia oxidation dominated by archaea (~5 × 107 archaeal amoA gene copies g−1 soil vs. mostly < 7 × 104 bacterial amoA gene copies g−1 soil). Abundances of archaeal 16S rRNA and amoA genes were positively correlated with soil nitrate, N and C contents. Nitrospira sp. was detected as the most abundant group of nitrite oxidizing bacteria. The specific geochemical conditions and particle transport dynamics at the granitic catena were found to affect soil microbial communities through clay and nutrient relocation along the hill slope, causing a shift to different, less diverse bacterial and archaeal communities at the footslope. Overall, our

  11. [Prokaryotic microbial diversity of the ancient salt deposits in the Kunming Salt Mine, P.R. China].

    Science.gov (United States)

    Xiao, Wei; Peng, Qian; Liu, Hong-wei; Wen, Meng-liang; Cui, Xiao-long; Yang, Ya-ling; Duan, Dong-cheng; Chen, Wei; Deng, Lan; Li, Qin-yuan; Chen, Yi-guang; Wang, Zhi-gang; Ren, Zhen; Liu, Ji-hui

    2007-04-01

    The prokaryotic microbial diversity of the ancient salt deposits in the Kunming Salt Mine, PR China was investigated using PCR-DGGE and rRNA approaches. Total community DNA was extracted and purified by a direct method, which yielded amplified DNA of high molecular weight for samples. A variable region of 16S rRNA gene was then amplified by PCR with bacterial and archaeal primers and analyzed by denaturing gradient gel electrophoresis (DGGE). Twenty-seven major bands were detected in the bacterial DGGE profile of the sample, but only one band of pure culture strains of bacteria isolated from the Kunming Salt Mine matched with one band of sample. No band of pure culture strains of archaea isolated from the Kunming Salt Mine matched with 18 major bands of sample. The results indicated that most of microbes in this environment are likely uncultivable. Clones on the plate were not the predominant species in the community. Two 16S rRNA gene clone libraries (bacteria and archaea) were also constructed, and 36 and 20 clones were selected for amplified ribosomal DNA restriction analysis (ARDRA). ARDRA with enzymes Afa I, Hha I, Hae III revealed 10 bacterial operational taxonomic units (OTUs), with three most abundant OTUs accounting for 38.9%, 25.0%, 16.7% of all the bacterial 16S rDNA clones, respectively. The remaining 7 OTUs presented at low levels, were represented by a single clone. Eight archaeal OTUs were obtained but no predominant OTUs. Some clones were sequenced and each sequence was compared with all nucleotide sequences in GenBank database. Examination of 16S rDNA clones showed that the ancient salt deposits in the Kunming Salt Mine contained a phylogenetically diverse population of organisms from the Bacteria domain with members of three major lineages represented: alpha-proteobacteria, gamma-Proteobacteria and Actinobacteria, especially Pseudomonas. Surprisingly, we recovered a variety of sequence closely related to Actinobacteria which was not found in other

  12. Microbial diversity of a Brazilian coastal region influenced by an upwelling system and anthropogenic activity.

    Directory of Open Access Journals (Sweden)

    Juliano C Cury

    Full Text Available BACKGROUND: Upwelling systems are characterised by an intense primary biomass production in the surface (warmest water after the outcrop of the bottom (coldest water, which is rich in nutrients. Although it is known that the microbial assemblage plays an important role in the food chain of marine systems and that the upwelling systems that occur in southwest Brazil drive the complex dynamics of the food chain, little is known about the microbial composition present in this region. METHODOLOGY/PRINCIPAL FINDINGS: We carried out a molecular survey based on SSU rRNA gene from the three domains of the phylogenetic tree of life present in a tropical upwelling region (Arraial do Cabo, Rio de Janeiro, Brazil. The aim was to analyse the horizontal and vertical variations of the microbial composition in two geographically close areas influenced by anthropogenic activity (sewage disposal/port activity and upwelling phenomena, respectively. A lower estimated diversity of microorganisms of the three domains of the phylogenetic tree of life was found in the water of the area influenced by anthropogenic activity compared to the area influenced by upwelling phenomena. We observed a heterogenic distribution of the relative abundance of taxonomic groups, especially in the Archaea and Eukarya domains. The bacterial community was dominated by Proteobacteria, Cyanobacteria and Bacteroidetes phyla, whereas the microeukaryotic community was dominated by Metazoa, Fungi, Alveolata and Stramenopile. The estimated archaeal diversity was the lowest of the three domains and was dominated by uncharacterised marine Crenarchaeota that were most closely related to Marine Group I. CONCLUSIONS/SIGNIFICANCE: The variety of conditions and the presence of different microbial assemblages indicated that the area of Arraial do Cabo can be used as a model for detailed studies that contemplate the correlation between pollution-indicating parameters and the depletion of microbial

  13. Yeast-Derived β-1,3-Glucan Substrate Significantly Increased the Diversity of Methanogens DuringIn vitro Fermentation of Porcine Colonic Digesta

    Institute of Scientific and Technical Information of China (English)

    LUO Yu-heng; LI Hua; LUO Jun-qiu; ZHANG Ke-ying

    2013-01-01

    Theβ-1,3-glucan from yeast has been extensively examined for its immuno-enhancing effects in animals. However, investigation on the relationship amongβ-glucan, gut microbiota and immune-modulating effects remains limited particularly in pigs. Considering the critical roles of gut methanogens in the microbial fermentation, energy metabolism and disease resistance, we investigated the phylogenetic diversity of methanogens from fermented cultures of porcine colonic digesta with (G) or without (N) yeastβ-glucan based on sequences of the archaeal 16S rRNA gene. A total of 145 sequences in the G library were assigned into 8 operational taxonomic units (OTUs) with the majority of sequences (114/145) related to strainsMethanobrevibactermillerae orMethanobrevibactergottschalkii with high identities ranging from 97.9 to 98.6%, followed by 23 sequences toMethanobrevibacter ruminantium, 2 sequences toMethanobrevibactersmithii and one sequence toMethanobrevibacter wolinii. The 142 sequences in the N library were assigned to 2 OTUs with most sequences (127/142) related to strainsM.millerae orM.gottschalkii with sequence identities ranging from 97.9 to 98.5%, and 15 sequences related toM.gottschalkiiwith 97.9% identity. Shannon diversity index showed that the G library exhibited signiifcantly higher archaeal diversity (P<0.05) and Libshuff analysis indicated the differences in the community structure between the two libraries were signiifcant (P<0.0001). In conclusion, the current study provides evidence that addition of yeast β-glucan signiifcantly increased the diversity of methanogens inin vitro fermented porcine colonic digesta.

  14. Abundance and diversity of ammonia-oxidizing archaea and bacteria in sediments of trophic end members of the Laurentian Great Lakes, Erie and Superior.

    Science.gov (United States)

    Bollmann, Annette; Bullerjahn, George S; McKay, Robert Michael

    2014-01-01

    Ammonia oxidation is the first step of nitrification carried out by ammonia-oxidizing Archaea (AOA) and Bacteria (AOB). Lake Superior and Erie are part of the Great Lakes system differing in trophic status with Lake Superior being oligotrophic and Lake Erie meso- to eutrophic. Sediment samples were collected from both lakes and used to characterize abundance and diversity of AOA and AOB based on the ammonia monooxygenase (amoA) gene. Diversity was accessed by a pyro-sequencing approach and the obtained sequences were used to determine the phylogeny and alpha and beta diversity of the AOA and AOB populations. In Lake Erie copy numbers of bacterial amoA genes were in the same order of magnitude or even higher than the copy numbers of the archaeal amoA genes, while in Lake Superior up to 4 orders of magnitude more archaeal than bacterial amoA copies were detected. The AOB detected in the samples from Lake Erie belonged to AOB that are frequently detected in freshwater. Differences were detected between the phylogenetic affiliations of the AOA from the two lakes. Most sequences detected in Lake Erie clustered in the Nitrososphaera cluster (Thaumarchaeal soil group I.1b) where as most of the sequences in Lake Superior were found in the Nitrosopumilus cluster (Thaumarchaeal marine group I.1a) and the Nitrosotalea cluster. Pearson correlations and canonical correspondence analysis (CCA) showed that the differences in abundance and diversity of AOA are very likely related to the sampling location and thereby to the different trophic states of the lakes.

  15. Abundance and diversity of ammonia-oxidizing archaea and bacteria in sediments of trophic end members of the Laurentian Great Lakes, Erie and Superior.

    Directory of Open Access Journals (Sweden)

    Annette Bollmann

    Full Text Available Ammonia oxidation is the first step of nitrification carried out by ammonia-oxidizing Archaea (AOA and Bacteria (AOB. Lake Superior and Erie are part of the Great Lakes system differing in trophic status with Lake Superior being oligotrophic and Lake Erie meso- to eutrophic. Sediment samples were collected from both lakes and used to characterize abundance and diversity of AOA and AOB based on the ammonia monooxygenase (amoA gene. Diversity was accessed by a pyro-sequencing approach and the obtained sequences were used to determine the phylogeny and alpha and beta diversity of the AOA and AOB populations. In Lake Erie copy numbers of bacterial amoA genes were in the same order of magnitude or even higher than the copy numbers of the archaeal amoA genes, while in Lake Superior up to 4 orders of magnitude more archaeal than bacterial amoA copies were detected. The AOB detected in the samples from Lake Erie belonged to AOB that are frequently detected in freshwater. Differences were detected between the phylogenetic affiliations of the AOA from the two lakes. Most sequences detected in Lake Erie clustered in the Nitrososphaera cluster (Thaumarchaeal soil group I.1b where as most of the sequences in Lake Superior were found in the Nitrosopumilus cluster (Thaumarchaeal marine group I.1a and the Nitrosotalea cluster. Pearson correlations and canonical correspondence analysis (CCA showed that the differences in abundance and diversity of AOA are very likely related to the sampling location and thereby to the different trophic states of the lakes.

  16. Electroporation of archaeal lipid membranes using MD simulations.

    Science.gov (United States)

    Polak, Andraž; Tarek, Mounir; Tomšič, Matija; Valant, Janez; Ulrih, Nataša Poklar; Jamnik, Andrej; Kramar, Peter; Miklavčič, Damijan

    2014-12-01

    Molecular dynamics (MD) simulations were used to investigate the electroporation of archaeal lipid bilayers when subjected to high transmembrane voltages induced by a charge imbalance, mimicking therefore millisecond electric pulse experiments. The structural characteristics of the bilayer, a 9:91 mol% 2,3-di-O-sesterterpanyl-sn-glicerol-1-phospho-myo-inositol (AI) and 2,3-di-O-sesterterpanyl-sn-glicerol-1-phospho-1'(2'-O-α-D-glucosyl)-myo-inositol (AGI) were compared to small angle X-ray scattering data. A rather good agreement of the electron density profiles at temperatures of 298 and 343 K was found assessing therefore the validity of the protocols and force fields used in simulations. Compared to dipalmitoyl-phosphatidylcholine (DPPC), the electroporation threshold for the bilayer was found to increase from ~2 V to 4.3 V at 323 K, and to 5.2 V at 298 K. Comparing the electroporation thresholds of the archaeal lipids to those of simple diphytanoyl-phosphatidylcholine (DPhPC) bilayers (2.5 V at 323 K) allowed one to trace back the stability of the membranes to the structure of their lipid head groups. Addition of DPPC in amounts of 50 mol% to the archaeal lipid bilayers decreases their stability and lowers the electroporation thresholds to 3.8 V and 4.1 V at respectively 323 and 298 K. The present study therefore shows how membrane compositions can be selected to cover a wide range of responses to electric stimuli. This provides new routes for the design of liposomes that can be efficiently used as drug delivery carriers, as the selection of their composition allows one to tune in their electroporation threshold for subsequent release of their load.

  17. Factors affecting Archaeal Lipid Compositions of the Sulfolobus Species

    Science.gov (United States)

    He, L.; Han, J.; Wei, Y.; Lin, L.; Wei, Y.; Zhang, C.

    2010-12-01

    Temperature is the best known variable affecting the distribution of the archaeal glycerol dibiphytanyl glycerol tetraethers (GDGTs) in marine and freshwater systems. Other variables such as pH, ionic strength, or bicarbonate concentration may also affect archaeal GDGTs in terrestrial systems. Studies of pure cultures can help us pinpoint the specific effects these variables may have on archaeal lipid distribution in natural environments. In this study, three Sulfolobus species (HG4, HB5-2, HB9-6) isolated from Tengchong hot springs (pH 2-3, temperature 73-90°C) in China were used to investigate the effects of temperature, pH, substrate, and type of strain on the composition of GDGTs. Results showed that increase in temperature had negative effects on the relative contents of GDGT-0 (no cyclopentyl rings), GDGT-1 (one cyclopentyl ring), GDGT-2 and GDGT-3 but positive effects on GDGT-4, GDGT-4', GDGT-5 and GDGT-5'. Increase in pH, on the other hand, had negative effects on GDGT-0, GDGT-1, GDGT-4', GDGT-5 and GDGT-5', and positive effects on GDGT-3 and GDGT-4. GDGT-2 remained relatively constant with changing pH. When the HG4 was grown on different substrates, GDGT-5 was five time more abundant in sucrose-grown cultures than in yeast extract- or sulfur- grown cultures, suggesting that carbohydrates may stimulate the production of GDGT-5. For all three species, the ring index (average number of rings) of GDGTs correlated positively with incubation temperature. In HG4, ring index was much lower at optimal pH (3.5) than at other pH values. Ring index of HB5-2 or HB9-6 is higher than that of HG4, suggesting that speciation may affect the degree of cyclization of GDGT of the Sulfolobus. These results indicate that individual archaeal lipids respond differently to changes in environmental variables, which may be also species specific.

  18. The archaeal TFIIE homologue facilitates transcription initiation by enhancing TATA-box recognition

    NARCIS (Netherlands)

    Bell, S.D.; Brinkman, A.B.; Oost, van der J.; Jackson, S.P.

    2001-01-01

    Transcription from many archaeal promoters can be reconstituted in vitro using recombinant TATA-box binding protein (TBP) and transcription factor B (TFB)—homologues of eukaryal TBP and TFIIB—together with purified RNA polymerase (RNAP). However, all archaeal genomes sequenced to date reveal the pre

  19. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  20. Energy for two: New archaeal lineages and the origin of mitochondria.

    Science.gov (United States)

    Martin, William F; Neukirchen, Sinje; Zimorski, Verena; Gould, Sven B; Sousa, Filipa L

    2016-09-01

    Metagenomics bears upon all aspects of microbiology, including our understanding of mitochondrial and eukaryote origin. Recently, ribosomal protein phylogenies show the eukaryote host lineage - the archaeal lineage that acquired the mitochondrion - to branch within the archaea. Metagenomic studies are now uncovering new archaeal lineages that branch more closely to the host than any cultivated archaea do. But how do they grow? Carbon and energy metabolism as pieced together from metagenome assemblies of these new archaeal lineages, such as the Deep Sea Archaeal Group (including Lokiarchaeota) and Bathyarchaeota, do not match the physiology of any cultivated microbes. Understanding how these new lineages live in their environment is important, and might hold clues about how mitochondria arose and how the eukaryotic lineage got started. Here we look at these exciting new metagenomic studies, what they say about archaeal physiology in modern environments, how they impact views on host-mitochondrion physiological interactions at eukaryote origin. PMID:27339178

  1. Analyses of in vivo interactions between transcription factors and the archaeal RNA polymerase.

    Science.gov (United States)

    Walker, Julie E; Santangelo, Thomas J

    2015-09-15

    Transcription factors regulate the activities of RNA polymerase (RNAP) at each stage of the transcription cycle. Many basal transcription factors with common ancestry are employed in eukaryotic and archaeal systems that directly bind to RNAP and influence intramolecular movements of RNAP and modulate DNA or RNA interactions. We describe and employ a flexible methodology to directly probe and quantify the binding of transcription factors to RNAP in vivo. We demonstrate that binding of the conserved and essential archaeal transcription factor TFE to the archaeal RNAP is directed, in part, by interactions with the RpoE subunit of RNAP. As the surfaces involved are conserved in many eukaryotic and archaeal systems, the identified TFE-RNAP interactions are likely conserved in archaeal-eukaryal systems and represent an important point of contact that can influence the efficiency of transcription initiation.

  2. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  3. Structure and cell biology of archaeal virus STIV.

    Science.gov (United States)

    Fu, Chi-yu; Johnson, Johnson E

    2012-04-01

    Recent investigations of archaeal viruses have revealed novel features of their structures and life cycles when compared to eukaryotic and bacterial viruses, yet there are structure-based unifying themes suggesting common ancestral relationships among dsDNA viruses in the three kingdoms of life. Sulfolobus solfataricus and the infecting virus Sulfolobus turreted icosahedral virus (STIV) is one of the well-established model systems to study archaeal virus replication and viral-host interactions. Reliable laboratory conditions to propagate STIV and available genetic tools allowed structural characterization of the virus and viral components that lead to the proposal of common capsid ancestry with PRD1 (bacteriophage), Adenovirus (eukaryotic virus) and PBCV (chlorellavirus). Microarray and proteomics approaches systematically analyzed viral replication and the corresponding host responses. Cellular cryo-electron tomography and thin-section EM studies uncovered the assembly and maturation pathway of STIV and revealed dramatic cellular ultra-structure changes upon infection. The viral-induced pyramid-like protrusions on cell surfaces represent a novel viral release mechanism and previously uncharacterized functions in viral replication. PMID:22482708

  4. Dark matter in archaeal genomes: a rich source of novel mobile elements, defense systems and secretory complexes.

    Science.gov (United States)

    Makarova, Kira S; Wolf, Yuri I; Forterre, Patrick; Prangishvili, David; Krupovic, Mart; Koonin, Eugene V

    2014-09-01

    Microbial genomes encompass a sizable fraction of poorly characterized, narrowly spread fast-evolving genes. Using sensitive methods for sequences comparison and protein structure prediction, we performed a detailed comparative analysis of clusters of such genes, which we denote "dark matter islands", in archaeal genomes. The dark matter islands comprise up to 20% of archaeal genomes and show remarkable heterogeneity and diversity. Nevertheless, three classes of entities are common in these genomic loci: (a) integrated viral genomes and other mobile elements; (b) defense systems, and (c) secretory and other membrane-associated systems. The dark matter islands in the genome of thermophiles and mesophiles show similar general trends of gene content, but thermophiles are substantially enriched in predicted membrane proteins whereas mesophiles have a greater proportion of recognizable mobile elements. Based on this analysis, we predict the existence of several novel groups of viruses and mobile elements, previously unnoticed variants of CRISPR-Cas immune systems, and new secretory systems that might be involved in stress response, intermicrobial conflicts and biogenesis of novel, uncharacterized membrane structures.

  5. Microbial diversity in a Venezuelan orthoquartzite cave is dominated by the Chloroflexi (Class Ktedonobacterales) and Thaumarchaeota Group I.1c.

    Science.gov (United States)

    Barton, Hazel A; Giarrizzo, Juan G; Suarez, Paula; Robertson, Charles E; Broering, Mark J; Banks, Eric D; Vaishampayan, Parag A; Venkateswaran, Kasthisuri

    2014-01-01

    The majority of caves are formed within limestone rock and hence our understanding of cave microbiology comes from carbonate-buffered systems. In this paper, we describe the microbial diversity of Roraima Sur Cave (RSC), an orthoquartzite (SiO4) cave within Roraima Tepui, Venezuela. The cave contains a high level of microbial activity when compared with other cave systems, as determined by an ATP-based luminescence assay and cell counting. Molecular phylogenetic analysis of microbial diversity within the cave demonstrates the dominance of Actinomycetales and Alphaproteobacteria in endolithic bacterial communities close to the entrance, while communities from deeper in the cave are dominated (82-84%) by a unique clade of Ktedonobacterales within the Chloroflexi. While members of this phylum are commonly found in caves, this is the first identification of members of the Class Ktedonobacterales. An assessment of archaeal species demonstrates the dominance of phylotypes from the Thaumarchaeota Group I.1c (100%), which have previously been associated with acidic environments. While the Thaumarchaeota have been seen in numerous cave systems, the dominance of Group I.1c in RSC is unique and a departure from the traditional archaeal community structure. Geochemical analysis of the cave environment suggests that water entering the cave, rather than the nutrient-limited orthoquartzite rock, provides the carbon and energy necessary for microbial community growth and subsistence, while the poor buffering capacity of quartzite or the low pH of the environment may be selecting for this unusual community structure. Together these data suggest that pH, imparted by the geochemistry of the host rock, can play as important a role in niche-differentiation in caves as in other environmental systems. PMID:25505450

  6. Microbial Diversity in a Venezuelan Orthoquartzite Cave is Dominated by the Chloroflexi (Class Ktedonobacterales and Thaumarchaeota Group I.1c.

    Directory of Open Access Journals (Sweden)

    Hazel A Barton

    2014-11-01

    Full Text Available The majority of caves are formed within limestone rock and hence our understanding of cave microbiology comes from carbonate-buffered systems. In this paper, we describe the microbial diversity of Roraima Sur Cave, an orthoquartzite (SiO4 cave within Roraima Tepui, Venezuela. The cave contains a high level of microbial activity when compared with other cave systems, as determined by an ATP-based luminescence assay and cell counting. Molecular phylogenetic analysis of microbial diversity within the cave demonstrate the dominance of Actinomycetales and Alphaproteobacteria in endolithic bacterial communities close to the entrance, while communities from deeper in the cave are dominated (82-84% by a unique clade of Ktedonobacterales within the Chloroflexi. While members of this phylum are commonly found in caves, this is the first identification of members of the Class Ktedonobacterales. An assessment of archaeal species demonstrates the dominance of phylotypes from the Thaumarchaeota Group I.1c (100%, which have previously been associated with acidic environments. While the Thaumarchaeota have been seen in numerous cave systems, the dominance of Group I.1c in Roraima Sur Cave is unique and a departure from the traditional archaeal community structure. Geochemical analysis of the cave environment suggests that water entering the cave, rather than the nutrient-limited orthoquartzite rock, provides the carbon and energy necessary for microbial community growth and subsistence, while the poor buffering capacity of quartzite or the low pH of the environment may be selecting for this unusual community structure. Together these data suggest that pH, imparted by the geochemistry of the host rock, can play as important a role in niche-differentiation in caves as in other environmental systems.

  7. Phyloclimatic modeling: combining phylogenetics and bioclimatic modeling.

    Science.gov (United States)

    Yesson, C; Culham, A

    2006-10-01

    We investigate the impact of past climates on plant diversification by tracking the "footprint" of climate change on a phylogenetic tree. Diversity within the cosmopolitan carnivorous plant genus Drosera (Droseraceae) is focused within Mediterranean climate regions. We explore whether this diversity is temporally linked to Mediterranean-type climatic shifts of the mid-Miocene and whether climate preferences are conservative over phylogenetic timescales. Phyloclimatic modeling combines environmental niche (bioclimatic) modeling with phylogenetics in order to study evolutionary patterns in relation to climate change. We present the largest and most complete such example to date using Drosera. The bioclimatic models of extant species demonstrate clear phylogenetic patterns; this is particularly evident for the tuberous sundews from southwestern Australia (subgenus Ergaleium). We employ a method for establishing confidence intervals of node ages on a phylogeny using replicates from a Bayesian phylogenetic analysis. This chronogram shows that many clades, including subgenus Ergaleium and section Bryastrum, diversified during the establishment of the Mediterranean-type climate. Ancestral reconstructions of bioclimatic models demonstrate a pattern of preference for this climate type within these groups. Ancestral bioclimatic models are projected into palaeo-climate reconstructions for the time periods indicated by the chronogram. We present two such examples that each generate plausible estimates of ancestral lineage distribution, which are similar to their current distributions. This is the first study to attempt bioclimatic projections on evolutionary time scales. The sundews appear to have diversified in response to local climate development. Some groups are specialized for Mediterranean climates, others show wide-ranging generalism. This demonstrates that Phyloclimatic modeling could be repeated for other plant groups and is fundamental to the understanding of

  8. Distribution, abundance, and diversity patterns of the thermoacidophilic Deep-sea Hydrothermal Vent Euryarchaeota 2 (DHVE2.

    Directory of Open Access Journals (Sweden)

    Gilberto E Flores

    2012-02-01

    Full Text Available Cultivation-independent studies have shown that taxa belonging to the Deep-sea Hydrothermal Vent Euryarchaeota 2 (DHVE2 lineage are widespread at deep-sea hydrothermal vents. While this lineage appears to be a common and important member of the microbial community at vent environments, relatively little is known about their overall distribution and phylogenetic diversity. In this study, we examined the distribution, relative abundance, co-occurrence patterns, and genetic diversity of cultivable thermoacidophilic DHVE2 in deposits from globally distributed vent fields. Results of quantitative polymerase chain reaction assays with primers specific for the DHVE2 and Archaea demonstrate the ubiquity of the DHVE2 at deep-sea vents and suggest that they are significant members of the archaeal communities of established vent deposit communities. Local similarity analysis of pyrosequencing data revealed that the distribution of the DHVE2 was positively correlated with ten other Euryarchaeota phylotypes and negatively correlated with mostly Crenarchaeota phylotypes. Targeted cultivation efforts resulted in the isolation of 12 axenic strains from six different vent fields, expanding the cultivable diversity of this lineage to vents along the East Pacific Rise and Mid-Atlantic Ridge. Eleven of these isolates shared greater than 97% 16S rRNA gene sequence similarity with one another and the only described isolate of the DHVE2, Aciduliprofundum boonei T469T. Sequencing and phylogenetic analysis of five protein-coding loci, atpA, EF-2, radA, rpoB, and secY, revealed clustering of isolates according to geographic region of isolation. Overall, this study increases our understanding of the distribution, abundance, and genetic diversity of the DHVE2.

  9. Asperisporium and Pantospora (Mycosphaerellaceae): epitypifications and phylogenetic placement

    OpenAIRE

    Minnis, A.M.; Kennedy, A.H.; Grenier, D.B.; Rehner, S.A.; Bischoff, J.F.

    2012-01-01

    The species-rich family Mycosphaerellaceae contains considerable morphological diversity and includes numerous anamorphic genera, many of which are economically important plant pathogens. Recent revisions and phylogenetic research have resulted in taxonomic instability. Ameliorating this problem requires phylogenetic placement of type species of key genera. We present an examination of the type species of the anamorphic Asperisporium and Pantospora. Cultures isolated from recent port intercep...

  10. Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

    Science.gov (United States)

    Panosyan, Hovik; Birkeland, Nils-Kåre

    2014-11-01

    The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. PMID:24740751

  11. Magnetic Au Nanoparticles on Archaeal S-Layer Ghosts as Templates

    Directory of Open Access Journals (Sweden)

    Sonja Selenska-Pobell

    2011-10-01

    Full Text Available Cell‐ghosts representing empty cells of the archaeon Sulfolobus acidocaldarius, consisting only of their highly ordered and unusually stable outermost proteinaceous surface layer (S‐layer, were used as templates for Au nanoparticles fabrication. The properties of these archaeal Au nanoparticles differ significantly from those produced earlier by us onto bacterial S‐layer sheets. The archaeal Au nanoparticles, with a size of about 2.5 nm, consist exclusively of metallic Au(0, while those produced on the bacterial S‐layer had a size of about 4 nm and represented a mixture of Au(0 and Au(III in the ratio of 40 to 60 %. The most impressive feature of the archaeal Au nanoparticles is that they are strongly paramagnetic, in contrast to the bacterial ones and also to bulk gold. SQUID magnetometry and XMCD measurements demonstrated that the archaeal Au nanoparticles possess a rather large magnetic moment of about 0.1 µB/atom. HR‐ TEM‐EDX analysis revealed that the archaeal Au nanoparticles are linked to the sulfur atoms of the thiol groups of the amino acid cysteine, characteristic only for archaeal S‐layers. This is the first study demonstrating the formation of such unusually strong magnetic Au nanoparticles on a non‐modified archaeal S‐layer.

  12. Phylogenetic molecular function annotation

    OpenAIRE

    Barbara E Engelhardt; Jordan, Michael I.; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic ...

  13. Molecular phylogenetics before sequences

    OpenAIRE

    Mark A. Ragan; Bernard, Guillaume,; Chan, Cheong Xin

    2014-01-01

    From 1971 to 1985, Carl Woese and colleagues generated oligonucleotide catalogs of 16S/18S rRNAs from more than 400 organisms. Using these incomplete and imperfect data, Carl and his colleagues developed unprecedented insights into the structure, function, and evolution of the large RNA components of the translational apparatus. They recognized a third domain of life, revealed the phylogenetic backbone of bacteria (and its limitations), delineated taxa, and explored the tempo and mode of micr...

  14. Canonical phylogenetic ordination.

    Science.gov (United States)

    Giannini, Norberto P

    2003-10-01

    A phylogenetic comparative method is proposed for estimating historical effects on comparative data using the partitions that compose a cladogram, i.e., its monophyletic groups. Two basic matrices, Y and X, are defined in the context of an ordinary linear model. Y contains the comparative data measured over t taxa. X consists of an initial tree matrix that contains all the xj monophyletic groups (each coded separately as a binary indicator variable) of the phylogenetic tree available for those taxa. The method seeks to define the subset of groups, i.e., a reduced tree matrix, that best explains the patterns in Y. This definition is accomplished via regression or canonical ordination (depending on the dimensionality of Y) coupled with Monte Carlo permutations. It is argued here that unrestricted permutations (i.e., under an equiprobable model) are valid for testing this specific kind of groupwise hypothesis. Phylogeny is either partialled out or, more properly, incorporated into the analysis in the form of component variation. Direct extensions allow for testing ecomorphological data controlled by phylogeny in a variation partitioning approach. Currently available statistical techniques make this method applicable under most univariate/multivariate models and metrics; two-way phylogenetic effects can be estimated as well. The simplest case (univariate Y), tested with simulations, yielded acceptable type I error rates. Applications presented include examples from evolutionary ethology, ecology, and ecomorphology. Results showed that the new technique detected previously overlooked variation clearly associated with phylogeny and that many phylogenetic effects on comparative data may occur at particular groups rather than across the entire tree. PMID:14530135

  15. DNA barcoding and phylogenetic relationships in Timaliidae.

    Science.gov (United States)

    Huang, Z H; Ke, D H

    2015-01-01

    The Timaliidae, a diverse family of oscine passerine birds, has long been a subject of debate regarding its phylogeny. The mitochondrial cytochrome c oxidase subunit I (COI) gene has been used as a powerful marker for identification and phylogenetic studies of animal species. In the present study, we analyzed the COI barcodes of 71 species from 21 genera belonging to the family Timaliidae. Every bird species possessed a barcode distinct from that of other bird species. Kimura two-parameter (K2P) distances were calculated between barcodes. The average genetic distance between species was 18 times higher than the average genetic distance within species. The neighbor-joining method was used to construct a phylogenetic tree and all the species could be discriminated by their distinct clades within the phylogenetic tree. The results indicate that some currently recognized babbler genera might not be monophyletic, with the COI gene data supporting the hypothesis of polyphyly for Garrulax, Alcippe, and Minla. Thus, DNA barcoding is an effective molecular tool for Timaliidae species identification and phylogenetic inference. PMID:26125793

  16. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang;

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory...... element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  17. Archaeal promoter architecture and mechanism of gene activation.

    Science.gov (United States)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  18. Useful scars: Physics of the capsids of archaeal viruses

    Science.gov (United States)

    Perotti, L. E.; Dharmavaram, S.; Klug, W. S.; Marian, J.; Rudnick, J.; Bruinsma, R. F.

    2016-07-01

    We propose a physical model for the capsids of tailed archaeal viruses as viscoelastic membranes under tension. The fluidity is generated by thermal motion of scarlike structures that are an intrinsic feature of the ground state of large particle arrays covering surfaces with nonzero Gauss curvature. The tension is generated by a combination of the osmotic pressure of the enclosed genome and an extension force generated by filamentous structure formation that drives the formation of the tails. In continuum theory, the capsid has the shape of a surface of constant mean curvature: an unduloid. Particle arrays covering unduloids are shown to exhibit pronounced subdiffusive and diffusive single-particle transport at temperatures that are well below the melting temperature of defect-free particle arrays on a surface with zero Gauss curvature.

  19. Archaeal enrichment in the hypoxic zone in the northern Gulf of Mexico.

    Science.gov (United States)

    Gillies, Lauren E; Thrash, J Cameron; deRada, Sergio; Rabalais, Nancy N; Mason, Olivia U

    2015-10-01

    Areas of low oxygen have spread exponentially over the past 40 years, and are cited as a key stressor on coastal ecosystems. The world's second largest coastal hypoxic (≤ 2 mg of O2 l(-1)) zone occurs annually in the northern Gulf of Mexico. The net effect of hypoxia is the diversion of energy flow away from higher trophic levels to microorganisms. This energy shunt is consequential to the overall productivity of hypoxic water masses and the ecosystem as a whole. In this study, water column samples were collected at 39 sites in the nGOM, 21 of which were hypoxic. Analysis of the microbial community along a hypoxic to oxic dissolved oxygen gradient revealed that the relative abundance (iTag) of Thaumarchaeota species 16S rRNA genes (> 40% of the microbial community in some hypoxic samples), the absolute abundance (quantitative polymerase chain reaction; qPCR) of Thaumarchaeota 16S rRNA genes and archaeal ammonia-monooxygenase gene copy number (qPCR) were significantly higher in hypoxic samples. Spatial interpolation of the microbial and chemical data revealed a continuous, shelfwide band of low dissolved oxygen waters that were dominated by Thaumarchaeota (and Euryarchaeota), amoA genes and high concentrations of phosphate in the nGOM, thus implicating physicochemical forcing on microbial abundance. PMID:25818237

  20. Characterization of Olkiluoto bacterial and archaeal communities by 454 pyrosequencing

    Energy Technology Data Exchange (ETDEWEB)

    Bomberg, M.; Nyyssoenen, M.; Itaevaara, M. [VTT Technical Research Centre of Finland, Espoo (Finland)

    2012-06-15

    Recent advancement in sequencing technologies, 'Next Generation Sequencing', such as FLX 454 pyrosequencing has made it possible to obtain large amounts of sequence data where previously only few sequences could be obtained. This technique is especially useful for the study of community composition of uncultured microbial populations in environmental samples. In this project, the FLX 454 pyrosequencing technique was used to obtain up to 20 000 16S rRNA sequences or 10 000 mRNA sequences from each sample for identification of the microbial species composition as well as for comparison of the microbial communities between different samples. This project focused on the characterization of active microbial communities in the groundwater at the final disposal site of high radioactive wastes in Olkiluoto by FLX 454 pyrosequencing of the bacterial and archaeal ribosomal RNA as well as of the mRNA transcripts of the dsrB gene and mcrA gene of sulphate reducing bacteria and methanogenic archaea, respectively. Specific emphasis was put on studying the relationship of active and latent sulphate reducers and methanogens by qPCR due to their important roles in deep geobiochemical processes connected to copper corrosion. Seven packered boreholes were sampled anaerobically in Olkiluoto during 2009-2010. Groundwater was pumped from specific depths and the microbial cells werecollected by filtration on a membrane. Active microbial communities were studied based on RNA extracted from the membranes and translated to copy DNA, followed by sequencing by 454 Tag pyrosequencing. A total of 27 different bacterial and 17 archaeal taxonomic groups were detected.

  1. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

  2. Analysis of Bacterial and Archaeal Communities along a High-Molecular-Weight Polyacrylamide Transportation Pipeline System in an Oil Field

    Directory of Open Access Journals (Sweden)

    Cai-Yun Li

    2015-04-01

    Full Text Available Viscosity loss of high-molecular-weight partially hydrolyzed polyacrylamide (HPAM solution was observed in a water injection pipeline before being injected into subterranean oil wells. In order to investigate the possible involvement of microorganisms in HPAM viscosity loss, both bacterial and archaeal community compositions of four samples collected from different points of the transportation pipeline were analyzed using PCR-amplification of the 16S rRNA gene and clone library construction method together with the analysis of physicochemical properties of HPAM solution and environmental factors. Further, the relationship between environmental factors and HPAM properties with microorganisms were delineated by canonical correspondence analysis (CCA. Diverse bacterial and archaeal groups were detected in the four samples. The microbial community of initial solution S1 gathered from the make-up tank is similar to solution S2 gathered from the first filter, and that of solution S3 obtained between the first and the second filter is similar to that of solution S4 obtained between the second filter and the injection well. Members of the genus Acinetobacter sp. were detected with high abundance in S3 and S4 in which HPAM viscosity was considerably reduced, suggesting that they likely played a considerable role in HPAM viscosity loss. This study presents information on microbial community diversity in the HPAM transportation pipeline and the possible involvement of microorganisms in HPAM viscosity loss and biodegradation. The results will help to understand the microbial community contribution made to viscosity change and are beneficial for providing information for microbial control in oil fields.

  3. Non-extremophilic 'extremophiles' - Archaeal dominance in the subsurface and their implication for life

    Science.gov (United States)

    Reitschuler, Christoph; Lins, Philipp; Illmer, Paul

    2014-05-01

    strategies was applied as well as physiological analyses, comprising HPLC and GC analyses, and molecular approaches, covering end-point and quantitative PCRs, DGGE, cloning, and sequencing analyses. Outstanding in the course of this research was that assumed non-extremophilic Archaea clearly outnumbered bacteria within the different moonmilk deposits, while fungi were only of minor importance. Moreover, the Archaeal species formed a constant element within the investigated samples, while bacteria and fungi showed a much more diverse and inhomogeneous community pattern. This indicates that the Archaea might constitute the central element within the microbial communities, holding key positions in nutrient and energy-cycles. Furthermore, it was possible to cultivate the Archaeal community over a certain time period, demonstrating that so far uncultured or as 'not cultivable' regarded organisms are accessible with certain cultivation strategies. On the other hand the vast majority of bacterial and fungal representatives are in close relation to species, which are valuable concerning biotechnological or medical applications. Summing up, further research on cave microbiomes, especially Archaea, might be reasonable with regards to life's evolution, global nutrient cycles, requirements for possible refuges of extraterrestrial life forms and also concerning new technological applications.

  4. Global pattern of phylogenetic species composition of shark and its conservation priority

    OpenAIRE

    Chen, Hungyen; Kishino, Hirohisa

    2015-01-01

    Abstract The diversity of marine communities is in striking contrast with the diversity of terrestrial communities. In all oceans, species richness is low in tropical areas and high at latitudes between 20 and 40°. While species richness is a primary metric used in conservation and management strategies, it is important to take into account the complex phylogenetic patterns of species compositions within communities. We measured the phylogenetic skew and diversity of shark communities through...

  5. Efficient Computation of Popular Phylogenetic Tree Measures

    DEFF Research Database (Denmark)

    Tsirogiannis, Constantinos; Sandel, Brody Steven; Cheliotis, Dimitris

    2012-01-01

    Given a phylogenetic tree $\\mathcal{T}$ of n nodes, and a sample R of its tips (leaf nodes) a very common problem in ecological and evolutionary research is to evaluate a distance measure for the elements in R. Two of the most common measures of this kind are the Mean Pairwise Distance...... ($\\ensuremath{\\mathrm{MPD}} $) and the Phylogenetic Diversity ($\\ensuremath{\\mathrm{PD}} $). In many applications, it is often necessary to compute the expectation and standard deviation of one of these measures over all subsets of tips of $\\mathcal{T}$ that have a certain size. Unfortunately, existing methods...... to calculate the expectation and deviation of these measures are inexact and inefficient. We present analytical expressions that lead to efficient algorithms for computing the expectation and the standard deviation of the MPD and the PD. More specifically, our main contributions are: We present efficient...

  6. Clustering with phylogenetic tools in astrophysics

    CERN Document Server

    Fraix-Burnet, Didier

    2016-01-01

    Phylogenetic approaches are finding more and more applications outside the field of biology. Astrophysics is no exception since an overwhelming amount of multivariate data has appeared in the last twenty years or so. In particular, the diversification of galaxies throughout the evolution of the Universe quite naturally invokes phylogenetic approaches. We have demonstrated that Maximum Parsimony brings useful astrophysical results, and we now proceed toward the analyses of large datasets for galaxies. In this talk I present how we solve the major difficulties for this goal: the choice of the parameters, their discretization, and the analysis of a high number of objects with an unsupervised NP-hard classification technique like cladistics. 1. Introduction How do the galaxy form, and when? How did the galaxy evolve and transform themselves to create the diversity we observe? What are the progenitors to present-day galaxies? To answer these big questions, observations throughout the Universe and the physical mode...

  7. Plant diversity predicts beta but not alpha diversity of soil microbes across grasslands worldwide.

    Science.gov (United States)

    Prober, Suzanne M; Leff, Jonathan W; Bates, Scott T; Borer, Elizabeth T; Firn, Jennifer; Harpole, W Stanley; Lind, Eric M; Seabloom, Eric W; Adler, Peter B; Bakker, Jonathan D; Cleland, Elsa E; DeCrappeo, Nicole M; DeLorenze, Elizabeth; Hagenah, Nicole; Hautier, Yann; Hofmockel, Kirsten S; Kirkman, Kevin P; Knops, Johannes M H; La Pierre, Kimberly J; MacDougall, Andrew S; McCulley, Rebecca L; Mitchell, Charles E; Risch, Anita C; Schuetz, Martin; Stevens, Carly J; Williams, Ryan J; Fierer, Noah

    2015-01-01

    Aboveground-belowground interactions exert critical controls on the composition and function of terrestrial ecosystems, yet the fundamental relationships between plant diversity and soil microbial diversity remain elusive. Theory predicts predominantly positive associations but tests within single sites have shown variable relationships, and associations between plant and microbial diversity across broad spatial scales remain largely unexplored. We compared the diversity of plant, bacterial, archaeal and fungal communities in one hundred and forty-five 1 m(2) plots across 25 temperate grassland sites from four continents. Across sites, the plant alpha diversity patterns were poorly related to those observed for any soil microbial group. However, plant beta diversity (compositional dissimilarity between sites) was significantly correlated with the beta diversity of bacterial and fungal communities, even after controlling for environmental factors. Thus, across a global range of temperate grasslands, plant diversity can predict patterns in the composition of soil microbial communities, but not patterns in alpha diversity. PMID:25430889

  8. Plant diversity predicts beta but not alpha diversity of soil microbes across grasslands worldwide

    Science.gov (United States)

    Prober, Suzanne M.; Leff, Jonathan W.; Bates, Scott T.; Borer, Elizabeth T.; Firn, Jennifer; Harpole, W. Stanley; Lind, Eric M.; Seabloom, Eric W.; Adler, Peter B.; Bakker, Jonathan D.; Cleland, Elsa E.; DeCrappeo, Nicole; DeLorenze, Elizabeth; Hagenah, Nicole; Hautier, Yann; Hofmockel, Kirsten S.; Kirkman, Kevin P.; Knops, Johannes M. H.; La Pierre, Kimberly J.; MacDougall, Andrew S.; McCulley, Rebecca L.; Mitchell, Charles E.; Risch, Anita C.; Schuetz, Martin; Stevens, Carly J.; Williams, Ryan J.; Fierer, Noah

    2015-01-01

    Aboveground–belowground interactions exert critical controls on the composition and function of terrestrial ecosystems, yet the fundamental relationships between plant diversity and soil microbial diversity remain elusive. Theory predicts predominantly positive associations but tests within single sites have shown variable relationships, and associations between plant and microbial diversity across broad spatial scales remain largely unexplored. We compared the diversity of plant, bacterial, archaeal and fungal communities in one hundred and forty-five 1 m2 plots across 25 temperate grassland sites from four continents. Across sites, the plant alpha diversity patterns were poorly related to those observed for any soil microbial group. However, plant beta diversity (compositional dissimilarity between sites) was significantly correlated with the beta diversity of bacterial and fungal communities, even after controlling for environmental factors. Thus, across a global range of temperate grasslands, plant diversity can predict patterns in the composition of soil microbial communities, but not patterns in alpha diversity.

  9. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske;

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  10. Changes in northern Gulf of Mexico sediment bacterial and archaeal communities exposed to hypoxia

    Science.gov (United States)

    Biogeochemical changes in marine sediments during coastal water hypoxia are well described, but less is known about underlying changes in microbial communities. Bacterial and archaeal communities in Louisiana continental shelf (LCS) hypoxic zone sediments were characterized by py...

  11. The essence of being extremophilic : the role of the unique archaeal membrane lipids

    NARCIS (Netherlands)

    Vossenberg, Jack L.C.M. van de; Driessen, Arnold J.M.; Konings, Wil N.

    1998-01-01

    In extreme environments, mainly Archaea are encountered. The archaeal cytoplasmic membrane contains unique ether lipids that cannot easily be degraded, are temperature- and mechanically resistant, and highly salt tolerant. Moreover, thermophilic and extreme acidophilic Archaea possess membrane-spann

  12. Response of Archaeal Communities in Beach Sediments to Spilled Oil and Bioremediation

    OpenAIRE

    Röling, Wilfred F. M.; Couto de Brito, Ivana R.; Swannell, Richard P. J.; Head, Ian M.

    2004-01-01

    While the contribution of Bacteria to bioremediation of oil-contaminated shorelines is well established, the response of Archaea to spilled oil and bioremediation treatments is unknown. The relationship between archaeal community structure and oil spill bioremediation was examined in laboratory microcosms and in a bioremediation field trial. 16S rRNA gene-based PCR and denaturing gradient gel analysis revealed that the archaeal community in oil-free laboratory microcosms was stable for 26 day...

  13. Pyrosequencing reveals the influence of elevated atmospheric CO2 on the composition of archaeal communities in the rhizosphere of C3 and C4 crops

    Science.gov (United States)

    Nelson, D. M.; Cann, I. K.; Mackie, R. I.

    2008-12-01

    The projected increase in atmospheric CO2 concentrations throughout the 21st century is likely to increase aboveground and belowground plant productivity and cause changes in the quantity and quality of plant root exudates, although plants using C4 photosynthesis are likely to be only affected during times of drought (Leakey et al., 2006, Plant Physiology, 140, 779). Evidence is emerging from molecular tools that these changes may influence the abundance and composition of soil microbial communities that regulate key soil processes, such as nitrogen cycling (Lesaulnier et al., 2008, Environmental Microbiology, 10, 926). However, most molecular tools are not well-suited for comparing multiple samples at great sequencing depth, which is critical when considering soil microbial communities of high diversity. To overcome these limitations we used pyrosequencing and quantitative PCR (qPCR) of two genes (the V3 region of 16S rDNA and the amoA gene) to examine intra- and inter-treatment variability in the abundance and composition of microbial communities in the rhizosphere of soybean (C3) and maize (C4) grown in field conditions under ambient (~380 ppm) and elevated (~550 ppm) CO2 using FACE (free-air concentration enrichment) technology during the 2006 growing season in central Illinois. We specifically focused on archaeal communities because of their key role in nitrification (Leininger et al., 2006, Nature, 442, 806). The majority (>97%) of recovered sequences were from members of the phylum Crenarchaeota. Principle component analysis of sequence results from the V3 and amoA genes indicated significant (p<0.05) differences in the composition of rhizosphere archaeal communities between ambient and elevated CO2 beneath soybean, but not maize. qPCR suggested no significant difference in the abundance of archaea between treatments for soybean and maize. The lack of response of archaeal community composition beneath maize to elevated CO2 is consistent with relatively high

  14. Effect of supplementing coconut or krabok oil, rich in medium-chain fatty acids on ruminal fermentation, protozoa and archaeal population of bulls.

    Science.gov (United States)

    Panyakaew, P; Boon, N; Goel, G; Yuangklang, C; Schonewille, J Th; Hendriks, W H; Fievez, V

    2013-12-01

    Medium-chain fatty acids (MCFA), for example, capric acid (C10:0), myristic (C14:0) and lauric (C12:0) acid, have been suggested to decrease rumen archaeal abundance and protozoal numbers. This study aimed to compare the effect of MCFA, either supplied through krabok (KO) or coconut (CO) oil, on rumen fermentation, protozoal counts and archaeal abundance, as well as their diversity and functional organization. KO contains similar amounts of C12:0 as CO (420 and 458 g/kg FA, respectively), but has a higher proportion of C14:0 (464 v. 205 g/kg FA, respectively). Treatments contained 35 g supplemental fat per kg DM: a control diet with tallow (T); a diet with supplemental CO; and a diet with supplemental KO. A 4th treatment consisted of a diet with similar amounts of MCFA (i.e. C10:0+C12:0+C14:0) from CO and KO. To ensure isolipidic diets, extra tallow was supplied in the latter treatment (KO+T). Eight fistulated bulls (two bulls per treatment), fed a total mixed ration predominantly based on cassava chips, rice straw, tomato pomace, rice bran and soybean meal (1.5% of BW), were used. Both KO and CO increased the rumen volatile fatty acids, in particular propionate and decreased acetate proportions. Protozoal numbers were reduced through the supplementation of an MCFA source (CO, KO and KO+T), with the strongest reduction by KO. Quantitative real-time polymerase chain reaction assays based on archaeal primers showed a decrease in abundance of Archaea when supplementing with KO and KO+T compared with T and CO. The denaturing gradient gel electrophoresis profiles of the rumen archaeal population did not result in a grouping of treatments. Richness indices were calculated from the number of DGGE bands, whereas community organization was assessed from the Pareto-Lorenz evenness curves on the basis of DGGE band intensities. KO supplementation (KO and KO+T treatments) increased richness and evenness within the archaeal community. Further research including methane

  15. Global pattern of phylogenetic species composition of shark and its conservation priority.

    Science.gov (United States)

    Chen, Hungyen; Kishino, Hirohisa

    2015-10-01

    The diversity of marine communities is in striking contrast with the diversity of terrestrial communities. In all oceans, species richness is low in tropical areas and high at latitudes between 20 and 40°. While species richness is a primary metric used in conservation and management strategies, it is important to take into account the complex phylogenetic patterns of species compositions within communities. We measured the phylogenetic skew and diversity of shark communities throughout the world. We found that shark communities in tropical seas were highly phylogenetically skewed, whereas temperate sea communities had phylogenetically diversified species compositions. Interestingly, although geographically distant from one another, tropical sea communities were all highly skewed toward requiem sharks (Carcharhinidae), hammerhead sharks (Sphyrnidae), and whale sharks (Rhincodon typus). Worldwide, the greatest phylogenetic evenness in terms of clades was found in the North Sea and coastal regions of countries in temperate zones, such as the United Kingdom, Ireland, southern Australia, and Chile. This study is the first to examine patterns of phylogenetic diversity of shark communities on a global scale. Our findings suggest that when establishing conservation activities, it is important to take full account of phylogenetic patterns of species composition and not solely use species richness as a target. Protecting areas of high phylogenetic diversity in sharks, which were identified in this study, could form a broader strategy for protecting other threatened marine species.

  16. Global pattern of phylogenetic species composition of shark and its conservation priority.

    Science.gov (United States)

    Chen, Hungyen; Kishino, Hirohisa

    2015-10-01

    The diversity of marine communities is in striking contrast with the diversity of terrestrial communities. In all oceans, species richness is low in tropical areas and high at latitudes between 20 and 40°. While species richness is a primary metric used in conservation and management strategies, it is important to take into account the complex phylogenetic patterns of species compositions within communities. We measured the phylogenetic skew and diversity of shark communities throughout the world. We found that shark communities in tropical seas were highly phylogenetically skewed, whereas temperate sea communities had phylogenetically diversified species compositions. Interestingly, although geographically distant from one another, tropical sea communities were all highly skewed toward requiem sharks (Carcharhinidae), hammerhead sharks (Sphyrnidae), and whale sharks (Rhincodon typus). Worldwide, the greatest phylogenetic evenness in terms of clades was found in the North Sea and coastal regions of countries in temperate zones, such as the United Kingdom, Ireland, southern Australia, and Chile. This study is the first to examine patterns of phylogenetic diversity of shark communities on a global scale. Our findings suggest that when establishing conservation activities, it is important to take full account of phylogenetic patterns of species composition and not solely use species richness as a target. Protecting areas of high phylogenetic diversity in sharks, which were identified in this study, could form a broader strategy for protecting other threatened marine species. PMID:26819704

  17. Spatial and temporal patterns in the microbial diversity of a meromictic soda lake in Washington State.

    Science.gov (United States)

    Dimitriu, Pedro A; Pinkart, Holly C; Peyton, Brent M; Mormile, Melanie R

    2008-08-01

    The microbial community diversity and composition of meromictic Soap Lake were studied using culture-dependent and culture-independent approaches. The water column and sediments were sampled monthly for a year. Denaturing gradient gel electrophoresis of bacterial and archaeal 16S rRNA genes showed an increase in diversity with depth for both groups. Late-summer samples harbored the highest prokaryotic diversity, and the bacteria exhibited less seasonal variability than the archaea. Most-probable-number assays targeting anaerobic microbial guilds were performed to compare summer and fall samples. In both seasons, the anoxic samples appeared to be dominated by lactate-oxidizing sulfate-reducing prokaryotes. High numbers of lactate- and acetate-oxidizing iron-reducing bacteria, as well as fermentative microorganisms, were also found, whereas the numbers of methanogens were low or methanogens were undetectable. The bacterial community composition of summer and fall samples was also assessed by constructing 16S rRNA gene clone libraries. A total of 508 sequences represented an estimated >1,100 unique operational taxonomic units, most of which were from the monimolimnion, and the summer samples were more diverse than the fall samples (Chao1 = 530 and Chao1 = 295, respectively). For both seasons, the mixolimnion sequences were dominated by Gammaproteobacteria, and the chemocline and monimolimnion libraries were dominated by members of the low-G+C-content group, followed by the Cytophaga-Flexibacter-Bacteroides (CFB) group; the mixolimnion sediments contained sequences related to uncultured members of the Chloroflexi and the CFB group. Community overlap and phylogenetic analyses, however, not only demonstrated that there was a high degree of spatial turnover but also suggested that there was a degree of temporal variability due to differences in the members and structures of the communities. PMID:18552187

  18. Mapping phylogenetic endemism in R using georeferenced branch extents

    Science.gov (United States)

    Guerin, Greg R.; Lowe, Andrew J.

    2015-12-01

    Applications are needed to map biodiversity from large-scale species occurrence datasets whilst seamlessly integrating with existing functions in R. Phylogenetic endemism (PE) is a biodiversity measure based on range-restricted phylogenetic diversity (PD). Current implementations use area of occupancy (AOO) or frequency to estimate the spatial range of branch-length (i.e. phylogenetic range-rarity), rather than extent of occurrence (EOO; i.e. georeferenced phylogenetic endemism), which is known to produce different range estimates. We present R functions to map PD or PE weighted by AOO or EOO (new georeferenced implementation), taking as inputs georeferenced species occurrences and a phylogeny. Non-parametric statistics distinguish PD/PE from trivial correlates of species richness and sampling intensity.

  19. Identification of an archaeal mercury regulon by chromatin immunoprecipitation.

    Science.gov (United States)

    Rudrappa, Deepak; Yao, Andrew I; White, Derrick; Pavlik, Benjamin J; Singh, Raghuveer; Facciotti, Marc T; Blum, Paul

    2015-12-01

    Mercury is a heavy metal and toxic to all forms of life. Metal exposure can invoke a response to improve survival. In archaea, several components of a mercury response system have been identified, but it is not known whether metal transport is a member of this system. To identify such missing components, a peptide-tagged MerR transcription factor was used to localize enriched chromosome regions by chromosome immunoprecipitation combined with DNA sequence analysis. Such regions could serve as secondary regulatory binding sites to control the expression of additional genes associated with mercury detoxification. Among the 31 highly enriched loci, a subset of five was pursued as potential candidates based on their current annotations. Quantitative reverse transcription-PCR analysis of these regions with and without mercury treatment in WT and mutant strains lacking merR indicated significant regulatory responses under these conditions. Of these, a Family 5 extracellular solute-binding protein and the MarR transcription factor shown previously to control responses to oxidation were most strongly affected. Inactivation of the solute-binding protein by gene disruption increased the resistance of mutant cells to mercury challenge. Inductively coupled plasma-MS analysis of the mutant cell line following metal challenge indicated there was less intracellular mercury compared with the isogenic WT strain. Together, these regulated genes comprise new members of the archaeal MerR regulon and reveal a cascade of transcriptional control not previously demonstrated in this model organism.

  20. Protein phosphorylation and its role in archaeal signal transduction.

    Science.gov (United States)

    Esser, Dominik; Hoffmann, Lena; Pham, Trong Khoa; Bräsen, Christopher; Qiu, Wen; Wright, Phillip C; Albers, Sonja-Verena; Siebers, Bettina

    2016-09-01

    Reversible protein phosphorylation is the main mechanism of signal transduction that enables cells to rapidly respond to environmental changes by controlling the functional properties of proteins in response to external stimuli. However, whereas signal transduction is well studied in Eukaryotes and Bacteria, the knowledge in Archaea is still rather scarce. Archaea are special with regard to protein phosphorylation, due to the fact that the two best studied phyla, the Euryarchaeota and Crenarchaeaota, seem to exhibit fundamental differences in regulatory systems. Euryarchaeota (e.g. halophiles, methanogens, thermophiles), like Bacteria and Eukaryotes, rely on bacterial-type two-component signal transduction systems (phosphorylation on His and Asp), as well as on the protein phosphorylation on Ser, Thr and Tyr by Hanks-type protein kinases. Instead, Crenarchaeota (e.g. acidophiles and (hyper)thermophiles) only depend on Hanks-type protein phosphorylation. In this review, the current knowledge of reversible protein phosphorylation in Archaea is presented. It combines results from identified phosphoproteins, biochemical characterization of protein kinases and protein phosphatases as well as target enzymes and first insights into archaeal signal transduction by biochemical, genetic and polyomic studies.

  1. Protein phosphorylation and its role in archaeal signal transduction

    Science.gov (United States)

    Esser, Dominik; Hoffmann, Lena; Pham, Trong Khoa; Bräsen, Christopher; Qiu, Wen; Wright, Phillip C.; Albers, Sonja-Verena; Siebers, Bettina

    2016-01-01

    Reversible protein phosphorylation is the main mechanism of signal transduction that enables cells to rapidly respond to environmental changes by controlling the functional properties of proteins in response to external stimuli. However, whereas signal transduction is well studied in Eukaryotes and Bacteria, the knowledge in Archaea is still rather scarce. Archaea are special with regard to protein phosphorylation, due to the fact that the two best studied phyla, the Euryarchaeota and Crenarchaeaota, seem to exhibit fundamental differences in regulatory systems. Euryarchaeota (e.g. halophiles, methanogens, thermophiles), like Bacteria and Eukaryotes, rely on bacterial-type two-component signal transduction systems (phosphorylation on His and Asp), as well as on the protein phosphorylation on Ser, Thr and Tyr by Hanks-type protein kinases. Instead, Crenarchaeota (e.g. acidophiles and (hyper)thermophiles) only depend on Hanks-type protein phosphorylation. In this review, the current knowledge of reversible protein phosphorylation in Archaea is presented. It combines results from identified phosphoproteins, biochemical characterization of protein kinases and protein phosphatases as well as target enzymes and first insights into archaeal signal transduction by biochemical, genetic and polyomic studies. PMID:27476079

  2. Enhanced abundance and diversity of ammonia-oxidizing Archaea in the Pearl River estuary

    Science.gov (United States)

    Xie, W.; Zhang, C. L.; Wang, P.; Zhou, X.; Guo, W.

    2014-12-01

    Thaumarchaeota are recently recognized as an important group of Archaea that can perform aerobic oxidation of ammonia in a wide range of environments. The goal of this study was to evaluate changes in abundance and diversity of planktonic ammonia-oxidizing Archaea (e.g., Thaumarchaeota) along a salinity gradient from the lower Pearl River to the northern South China Sea. Quantitative PCR and sequencing of total archaeal 16S rRNA gene and the archaeal amoA gene were performed on suspended particulate organic matter collected in different seasons from the freshwater to the ocean water. Total amoA gene copies and relative abundance of Thaumarchaeota all peaked in the estuary where salinity ranged between 4.5‰ and 26.7‰. The diversity of archaeal amoA gene was also highest in the estuary. Seasonality and SiO32- appear to be two major factors affecting the distribution of subclusters of archaeal amoA genes. For example, Nitrosopumilus subcluster 7.1 was most abundant in winter in fresh water, whereas Nitrososphaera were more abundant in summer. Samples collected from the area around Wanshan Island, which is located at the outermost part of the Pearl River estuary, had high abundance of unclassified archaeal amoA genes, suggesting some new groups of Thaumarchaeota might inhabit this water body. Overall, the high abundance and diversity of Thaumarchaeota in the Pearl River estuary may indicate enhanced role of AOA in nitrogen cycle in this dynamic ecosystem.

  3. Phylogenetic community ecology of soil biodiversity using mitochondrial metagenomics.

    Science.gov (United States)

    Andújar, Carmelo; Arribas, Paula; Ruzicka, Filip; Crampton-Platt, Alex; Timmermans, Martijn J T N; Vogler, Alfried P

    2015-07-01

    High-throughput DNA methods hold great promise for the study of taxonomically intractable mesofauna of the soil. Here, we assess species diversity and community structure in a phylogenetic framework, by sequencing total DNA from bulk specimen samples and assembly of mitochondrial genomes. The combination of mitochondrial metagenomics and DNA barcode sequencing of 1494 specimens in 69 soil samples from three geographic regions in southern Iberia revealed >300 species of soil Coleoptera (beetles) from a broad spectrum of phylogenetic lineages. A set of 214 mitochondrial sequences longer than 3000 bp was generated and used to estimate a well-supported phylogenetic tree of the order Coleoptera. Shorter sequences, including cox1 barcodes, were placed on this mitogenomic tree. Raw Illumina reads were mapped against all available sequences to test for species present in local samples. This approach simultaneously established the species richness, phylogenetic composition and community turnover at species and phylogenetic levels. We find a strong signature of vertical structuring in soil fauna that shows high local community differentiation between deep soil and superficial horizons at phylogenetic levels. Within the two vertical layers, turnover among regions was primarily at the tip (species) level and was stronger in the deep soil than leaf litter communities, pointing to layer-mediated drivers determining species diversification, spatial structure and evolutionary assembly of soil communities. This integrated phylogenetic framework opens the application of phylogenetic community ecology to the mesofauna of the soil, among the most diverse and least well-understood ecosystems, and will propel both theoretical and applied soil science.

  4. Soil bacterial and archaeal communities of the Stringer Creek Watershed in relation to soil moisture, chemistry, and gas fluxes

    Science.gov (United States)

    Jones, R. T.; Du, Z.; Riveros-Iregui, D.; Dore, J. E.; Emanuel, R. E.; McGlynn, B. L.; McDermott, T.; Li, X.

    2013-12-01

    The Stringer Creek watershed within the Tenderfoot Creek Experimental Forest (Montana) is a highly instrumented watershed with long-term hydrologic and gas flux measurements, and is an ideal study system to incorporate microbiological characterizations into landscape scale hydrological and biogeochemical studies. As a first attempt to determine how hydrological processes, soil chemistry, and gas fluxes are correlated with bacterial and archaeal lineages in soil, we collected soil samples across the watershed (July 9 - 11, 2012) and used barcoded high-throughput DNA sequencing to characterize the bacterial and archaeal communities. Soils were collected adjacent to gas well sites at 5 cm, 20 cm, and 50 cm depths, corresponding to the depths of the wells. Gas measurements included CO2, CH4, O2, and N2O; soil measurements included water content, % carbon, and % nitrogen. We analyzed 775,000 16S rRNA gene sequences from 28 soil samples. Relative abundances of certain microbial lineages or groups (e.g. methanotrophs, methanogens, Acidobacteria, Bacteroidetes, Firmicutes, Proteobacteria, etc.) varied significantly with CO2, CH4, and O2 concentrations. Furthermore, beta-diversity analyses showed that microbial community composition was significantly governed by water content, % nitrogen, and % carbon; community composition also significantly varied with CO2, CH4, and O2 concentrations. Together, our results suggest that soil environmental factors such as water content, % carbon, and % nitrogen affect microbial community composition, and that microbial community composition correlates with CO2, O2, and CH4 concentrations. Future work will focus on characterizing microbial communities across the entire summer season as soil conditions drastically change from fully saturated to very dry.

  5. Comprehensive phylogenetic analysis of bacterial reverse transcriptases.

    Directory of Open Access Journals (Sweden)

    Nicolás Toro

    Full Text Available Much less is known about reverse transcriptases (RTs in prokaryotes than in eukaryotes, with most prokaryotic enzymes still uncharacterized. Two surveys involving BLAST searches for RT genes in prokaryotic genomes revealed the presence of large numbers of diverse, uncharacterized RTs and RT-like sequences. Here, using consistent annotation across all sequenced bacterial species from GenBank and other sources via RAST, available from the PATRIC (Pathogenic Resource Integration Center platform, we have compiled the data for currently annotated reverse transcriptases from completely sequenced bacterial genomes. RT sequences are broadly distributed across bacterial phyla, but green sulfur bacteria and cyanobacteria have the highest levels of RT sequence diversity (≤85% identity per genome. By contrast, phylum Actinobacteria, for which a large number of genomes have been sequenced, was found to have a low RT sequence diversity. Phylogenetic analyses revealed that bacterial RTs could be classified into 17 main groups: group II introns, retrons/retron-like RTs, diversity-generating retroelements (DGRs, Abi-like RTs, CRISPR-Cas-associated RTs, group II-like RTs (G2L, and 11 other groups of RTs of unknown function. Proteobacteria had the highest potential functional diversity, as they possessed most of the RT groups. Group II introns and DGRs were the most widely distributed RTs in bacterial phyla. Our results provide insights into bacterial RT phylogeny and the basis for an update of annotation systems based on sequence/domain homology.

  6. Diversity and phylogenetic relationships of hemosporidian parasites in birds of Socorro Island, México, and their role in the re-introduction of the Socorro dove (Zenaida graysoni).

    Science.gov (United States)

    Carlson, Jenny S; Martínez-Gómez, Juan E; Valkiūnas, Gediminas; Loiseau, Claire; Bell, Douglas A; Sehgal, Ravinder N M

    2013-04-01

    The Socorro dove Zenaida graysoni , endemic to Socorro Island, was last reported in the wild in 1972. Fortunately, the species has been propagated in zoos in Europe and the United States, and plans are under way to re-introduce it to its native habitat. This will be the first known attempt to return a bird species extinct in the wild to its ancestral island. In order to assess the disease threats the Socorro dove may face, the avifauna of Socorro Island, with a specific focus on Socorro ground doves Columbina passerina socorroensis and mourning doves Zenaida macroura , as well as Socorro doves in captivity, were screened for blood parasites of the genera Plasmodium , Haemoproteus, Leucocytozoon, and Trypanosoma spp. We found Haemoproteus spp. in 17 (74%) of 23 Socorro ground doves, 23 (92%) of 25 mourning doves, and 3 (14%) of 21 northern mockingbirds; none of the other bird species showed infections. Here, we report the phylogenetic analysis of 19 distinct lineages of Haemoproteus spp. detected in birds of Socorro Island and compare their evolutionary relationships to parasites detected in the avifauna of the Galápagos Islands, continental Latin America, and Europe. Microscopic examination revealed 1 mourning dove infected with Plasmodium ( Haemamoeba ), thus underscoring the importance of using both PCR and microscopy when analyzing avian blood samples for hemosporidian parasites. The study confirms that the Socorro dove will most likely be exposed to Haemoproteus spp. that currently infect mourning doves and Socorro ground doves of Socorro Island. A monitoring program for both birds and vectors should be implemented to establish the prevalence of Plasmodium sp. and as a necessary conservation measure for critically endangered birds on the island. PMID:23043349

  7. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    2013-01-01

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  8. Quartets and unrooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; Berry, Vincent; Paul, Christophe

    2012-08-01

    Phylogenetic networks were introduced to describe evolution in the presence of exchanges of genetic material between coexisting species or individuals. Split networks in particular were introduced as a special kind of abstract network to visualize conflicts between phylogenetic trees which may correspond to such exchanges. More recently, methods were designed to reconstruct explicit phylogenetic networks (whose vertices can be interpreted as biological events) from triplet data. In this article, we link abstract and explicit networks through their combinatorial properties, by introducing the unrooted analog of level-k networks. In particular, we give an equivalence theorem between circular split systems and unrooted level-1 networks. We also show how to adapt to quartets some existing results on triplets, in order to reconstruct unrooted level-k phylogenetic networks. These results give an interesting perspective on the combinatorics of phylogenetic networks and also raise algorithmic and combinatorial questions.

  9. CoBaltDB: Complete bacterial and archaeal orfeomes subcellular localization database and associated resources

    Directory of Open Access Journals (Sweden)

    Lucchetti-Miganeh Céline

    2010-03-01

    Full Text Available Abstract Background The functions of proteins are strongly related to their localization in cell compartments (for example the cytoplasm or membranes but the experimental determination of the sub-cellular localization of proteomes is laborious and expensive. A fast and low-cost alternative approach is in silico prediction, based on features of the protein primary sequences. However, biologists are confronted with a very large number of computational tools that use different methods that address various localization features with diverse specificities and sensitivities. As a result, exploiting these computer resources to predict protein localization accurately involves querying all tools and comparing every prediction output; this is a painstaking task. Therefore, we developed a comprehensive database, called CoBaltDB, that gathers all prediction outputs concerning complete prokaryotic proteomes. Description The current version of CoBaltDB integrates the results of 43 localization predictors for 784 complete bacterial and archaeal proteomes (2.548.292 proteins in total. CoBaltDB supplies a simple user-friendly interface for retrieving and exploring relevant information about predicted features (such as signal peptide cleavage sites and transmembrane segments. Data are organized into three work-sets ("specialized tools", "meta-tools" and "additional tools". The database can be queried using the organism name, a locus tag or a list of locus tags and may be browsed using numerous graphical and text displays. Conclusions With its new functionalities, CoBaltDB is a novel powerful platform that provides easy access to the results of multiple localization tools and support for predicting prokaryotic protein localizations with higher confidence than previously possible. CoBaltDB is available at http://www.umr6026.univ-rennes1.fr/english/home/research/basic/software/cobalten.

  10. Bacterial, archaeal and eukaryal community structures throughout soil horizons of harvested and naturally disturbed forest stands.

    Science.gov (United States)

    Hartmann, Martin; Lee, Sangwon; Hallam, Steven J; Mohn, William W

    2009-12-01

    Disturbances caused by timber harvesting have critical long-term effects on the forest soil microbiota and alter fundamental ecosystem services provided by these communities. This study assessed the effects of organic matter removal and soil compaction on microbial community structures in different soil horizons 13 years after timber harvesting at the long-term soil productivity site at Skulow Lake, British Columbia. A harvested stand was compared with an unmanaged forest stand. Ribosomal intergenic spacer profiles of bacteria, archaea and eukarya indicated significantly different community structures in the upper three soil horizons of the two stands, with differences decreasing with depth. Large-scale sequencing of the ribosomal intergenic spacers coupled to small-subunit ribosomal RNA genes allowed taxonomic identification of major microbial phylotypes affected by harvesting or varying among soil horizons. Actinobacteria and Gemmatimonadetes were the predominant phylotypes in the bacterial profiles, with the relative abundance of these groups highest in the unmanaged stand, particularly in the deeper soil horizons. Predominant eukaryal phylotypes were mainly assigned to known mycorrhizal and saprotrophic species of Basidiomycetes and Ascomycetes. Harvesting affected Basidiomycetes to a minor degree but had stronger effects on some Ascomycetes. Archaeal profiles had low diversity with only a few predominant crenarchaeal phylotypes whose abundance appeared to increase with depth. Detection of these effects 13 years after harvesting may indicate a long-term change in processes mediated by the microbial community with important consequences for forest productivity. These effects warrant more comprehensive investigation of the effects of harvesting on the structure of forest soil microbial communities and the functional consequences. PMID:19659501

  11. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life.

  12. Phylogenetic distribution of fungal sterols.

    Directory of Open Access Journals (Sweden)

    John D Weete

    Full Text Available BACKGROUND: Ergosterol has been considered the "fungal sterol" for almost 125 years; however, additional sterol data superimposed on a recent molecular phylogeny of kingdom Fungi reveals a different and more complex situation. METHODOLOGY/PRINCIPAL FINDINGS: The interpretation of sterol distribution data in a modern phylogenetic context indicates that there is a clear trend from cholesterol and other Delta(5 sterols in the earliest diverging fungal species to ergosterol in later diverging fungi. There are, however, deviations from this pattern in certain clades. Sterols of the diverse zoosporic and zygosporic forms exhibit structural diversity with cholesterol and 24-ethyl -Delta(5 sterols in zoosporic taxa, and 24-methyl sterols in zygosporic fungi. For example, each of the three monophyletic lineages of zygosporic fungi has distinctive major sterols, ergosterol in Mucorales, 22-dihydroergosterol in Dimargaritales, Harpellales, and Kickxellales (DHK clade, and 24-methyl cholesterol in Entomophthorales. Other departures from ergosterol as the dominant sterol include: 24-ethyl cholesterol in Glomeromycota, 24-ethyl cholest-7-enol and 24-ethyl-cholesta-7,24(28-dienol in rust fungi, brassicasterol in Taphrinales and hypogeous pezizalean species, and cholesterol in Pneumocystis. CONCLUSIONS/SIGNIFICANCE: Five dominant end products of sterol biosynthesis (cholesterol, ergosterol, 24-methyl cholesterol, 24-ethyl cholesterol, brassicasterol, and intermediates in the formation of 24-ethyl cholesterol, are major sterols in 175 species of Fungi. Although most fungi in the most speciose clades have ergosterol as a major sterol, sterols are more varied than currently understood, and their distribution supports certain clades of Fungi in current fungal phylogenies. In addition to the intellectual importance of understanding evolution of sterol synthesis in fungi, there is practical importance because certain antifungal drugs (e.g., azoles target reactions in

  13. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications

    Science.gov (United States)

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications.

  14. Bacterial and archaeal diversity in an iron-rich coastal hydrothermal field in Yamagawa, Kagoshima, Japan

    DEFF Research Database (Denmark)

    Kawaichi, Satoshi; Ito, Norihiro; Yoshida, Takashi;

    2013-01-01

    . The environmental settings of the coastal hydrothermal field were similar in some degree to those of deep-sea hydrothermal environments because of its emission of H2, CO2, and sulfide from the bottom of the hot spot. The results of clone analyses based on the 16S rRNA gene led us to speculate the presence...... of a chemo-synthetic microbial ecosystem, where chemolithoautotrophic thermophiles, primarily the bacterial order Aquificales, function as primary producers using H2 or sulfur compounds as their energy source and CO2 as their carbon source, and the organic compounds synthesized by them support the growth...... of chemoheterotrophic thermophiles, such as members of the order Thermales and the family Desulfurococcaceae. In addition, the dominance of members of the bacterial genus Herbaspirillum in the high temperature bottom layer led us to speculate the temporal formation of mesophilic zones where they can also function...

  15. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications

    Science.gov (United States)

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications. PMID:27516755

  16. Influence of DNA isolation method on the investigation of archaeal diversity and abundance in biogas plants.

    Science.gov (United States)

    Theiss, Juliane; Rother, Michael; Röske, Kerstin

    2016-09-01

    Various methods are available for DNA isolation from environmental samples. Because the chemical and biological composition of samples such as soil, sludge, or plant material is different, the effectiveness of DNA isolation can vary depending on the method applied and thus, have a substantial effect on the results of downstream analysis of the microbial community. Although the process of biogas formation is being intensely investigated, a systematic evaluation of kits for DNA isolation from material of biogas plants is still lacking. Since no DNA isolation kit specifically tailored for DNA isolation from sludge of biogas plants is available, this study compares five commercially available kits regarding their influence on downstream analyses such denaturing gradient gel electrophoresis (DGGE) and quantitative real-time PCR (qPCR). The results show that not all kits are equally suited for the DNA isolation from samples of different biogas plants, but highly reproducible DGGE fingerprints as well as qPCR results across the tested samples from biogas reactors using different substrate compositions could be produced using selected kits. PMID:27089887

  17. 繁茂膜海绵中可培养稀有放线菌的多样性%Phylogenetic diversity of the culturable rare actinomycetes in marine sponge Hymeniacidon perlevis by improved isolation media

    Institute of Scientific and Technical Information of China (English)

    信艳娟; 吴佩春; 邓麦村; 张卫

    2009-01-01

    [Objective] Based on the molecular diversity information, seven actinomycete-selective culture media and isolation conditions were modified to isolate and cultivate diverse rare actinomycetes from Hymeniacidon perlevis. [Methods] Modified, selective cultivation and enrichment media were used, with the addition of an elemental solution of simulating the elemental composition of marine sponge H. perlevis. Restriction Fragment Length Polymorphism (RFLP) analysis of 16S rDNA sequence was used to reveal the diversity of culturable rare actinomycetes. [Results] A total of 59 actinomycete strains were isolated from the marine sponge H. perlevis . A total of 27 representative actinomycetes were selected according to their morphological feature, color and pigments. They gave 15 different RFLP patterns after digesting their PCR products of 16s rDNA with Hha I . The results showed that these isolates belonged to 10 genera: Streptomyces, Nocardiopsis, Micromonospora, Cellulosimicrobium, Gordonia, Nocardia, Prauseria, Pseudonocardia, Saccharomonospora and Microbacterium. [ Conclusion] The modified isolation media and selective cultivation procedures are highly effective in the recovery of culturable actinomycetes from the marine sponge H. perlevis , resulting in the highest diversity of culturable rare actinomycetes from any sponges.%[目的]本文旨在尝试改进分离培养方法从大连海域繁茂膜海绵中筛选稀有放线菌,并对其多样性进行研究.[方法]根据繁茂膜海绵元素组成配制微量元素溶液,加入到放线菌分离培养基中,同时将部分培养基稀释成寡营养培养基,结合富集培养法,对繁茂膜海绵中放线菌进行分离培养.采用16S rDNA的限制性片断长度多态性(.Restriction Fragment Length Polymorphism,RFLP)分析和序列分析,揭示其多样性.[结果]共获得可培养放线菌59株,通过形态、颜色观察,将其归为27个类群.RFLP分析表现为15种不同的图谱类型.16S rDNA序列分

  18. Virus-mediated archaeal hecatomb in the deep seafloor

    Science.gov (United States)

    Danovaro, Roberto; Dell’Anno, Antonio; Corinaldesi, Cinzia; Rastelli, Eugenio; Cavicchioli, Ricardo; Krupovic, Mart; Noble, Rachel T.; Nunoura, Takuro; Prangishvili, David

    2016-01-01

    Viruses are the most abundant biological entities in the world’s oceans, and they play a crucial role in global biogeochemical cycles. In deep-sea ecosystems, archaea and bacteria drive major nutrient cycles, and viruses are largely responsible for their mortality, thereby exerting important controls on microbial dynamics. However, the relative impact of viruses on archaea compared to bacteria is unknown, limiting our understanding of the factors controlling the functioning of marine systems at a global scale. We evaluate the selectivity of viral infections by using several independent approaches, including an innovative molecular method based on the quantification of archaeal versus bacterial genes released by viral lysis. We provide evidence that, in all oceanic surface sediments (from 1000- to 10,000-m water depth), the impact of viral infection is higher on archaea than on bacteria. We also found that, within deep-sea benthic archaea, the impact of viruses was mainly directed at members of specific clades of Marine Group I Thaumarchaeota. Although archaea represent, on average, ~12% of the total cell abundance in the top 50 cm of sediment, virus-induced lysis of archaea accounts for up to one-third of the total microbial biomass killed, resulting in the release of ~0.3 to 0.5 gigatons of carbon per year globally. Our results indicate that viral infection represents a key mechanism controlling the turnover of archaea in surface deep-sea sediments. We conclude that interactions between archaea and their viruses might play a profound, previously underestimated role in the functioning of deep-sea ecosystems and in global biogeochemical cycles. PMID:27757416

  19. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs

    NARCIS (Netherlands)

    Frade, P.R.; Roll, K.; Bergauer, K.; Herndl, G.

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associatedwith the surface mucus layer of corals have rarely taken place. It has thereforeremained enigmatic whether mucus-associated archaeal and bacterial communities exhibita similar specificity towards coral hosts a

  20. Quantification of bacterial and archaeal symbionts in high and low microbial abundance sponges using real-time PCR

    KAUST Repository

    Bayer, Kristina

    2014-07-09

    In spite of considerable insights into the microbial diversity of marine sponges, quantitative information on microbial abundances and community composition remains scarce. Here, we established qPCR assays for the specific quantification of four bacterial phyla of representative sponge symbionts as well as the kingdoms Eubacteria and Archaea. We could show that the 16S rRNA gene numbers of Archaea, Chloroflexi, and the candidate phylum Poribacteria were 4-6 orders of magnitude higher in high microbial abundance (HMA) than in low microbial abundance (LMA) sponges and that actinobacterial 16S rRNA gene numbers were 1-2 orders higher in HMA over LMA sponges, while those for Cyanobacteria were stable between HMA and LMA sponges. Fluorescence in situ hybridization of Aplysina aerophoba tissue sections confirmed the numerical dominance of Chloroflexi, which was followed by Poribacteria. Archaeal and actinobacterial cells were detected in much lower numbers. By use of fluorescence-activated cell sorting as a primer- and probe-independent approach, the dominance of Chloroflexi, Proteobacteria, and Poribacteria in A. aerophoba was confirmed. Our study provides new quantitative insights into the microbiology of sponges and contributes to a better understanding of the HMA/LMA dichotomy. The authors quantified sponge symbionts in eight sponge species from three different locations by real time PCR targetting 16S rRNA genes. Additionally, FISH was performed and diversity and abundance of singularized microbial symbionts from Aplysina aerophoba was determined for a comprehensive quantification work. © 2014 Federation of European Microbiological Societies.

  1. Liquid but Durable: Molecular Dynamics Simulations Explain the Unique Properties of Archaeal-Like Membranes

    Science.gov (United States)

    Chugunov, Anton O.; Volynsky, Pavel E.; Krylov, Nikolay A.; Boldyrev, Ivan A.; Efremov, Roman G.

    2014-12-01

    Archaeal plasma membranes appear to be extremely durable and almost impermeable to water and ions, in contrast to the membranes of Bacteria and Eucaryota. Additionally, they remain liquid within a temperature range of 0-100°C. These are the properties that have most likely determined the evolutionary fate of Archaea, and it may be possible for bionanotechnology to adopt these from nature. In this work, we use molecular dynamics simulations to assess at the atomistic level the structure and dynamics of a series of model archaeal membranes with lipids that have tetraether chemical nature and ``branched'' hydrophobic tails. We conclude that the branched structure defines dense packing and low water permeability of archaeal-like membranes, while at the same time ensuring a liquid-crystalline state, which is vital for living cells. This makes tetraether lipid systems promising in bionanotechnology and material science, namely for design of new and unique membrane nanosystems.

  2. Phylogenetic analysis of the Bifidobacterium genus using glycolysis enzyme sequences

    Directory of Open Access Journals (Sweden)

    Katelyn eBrandt

    2016-05-01

    Full Text Available Bifidobacteria are important members of the human gastrointestinal tract that promote the establishment of a healthy microbial consortium in the gut of infants. Recent studies have established that the Bifidobacterium genus is a polymorphic phylogenetic clade, which encompasses a diversity of species and subspecies that encode a broad range of proteins implicated in complex and non-digestible carbohydrate uptake and catabolism, ranging from human breast milk oligosaccharides, to plant fibers. Recent genomic studies have created a need to properly place Bifidobacterium species in a phylogenetic tree. Current approaches, based on core-genome analyses come at the cost of intensive sequencing and demanding analytical processes. Here, we propose a typing method based on sequences of glycolysis genes and the proteins they encode, to provide insights into diversity, typing, and phylogeny in this complex and broad genus. We show that glycolysis genes occur broadly in these genomes, to encode the machinery necessary for the biochemical spine of the cell, and provide a robust phylogenetic marker. Furthermore, glycolytic sequences-based trees are congruent with both the classical 16S rRNA phylogeny, and core genome-based strain clustering. Furthermore, these glycolysis markers can also be used to provide insights into the adaptive evolution of this genus, especially with regards to trends towards a high GC content. This streamlined method may open new avenues for phylogenetic studies on a broad scale, given the widespread occurrence of the glycolysis pathway in bacteria, and the diversity of the sequences they encode.

  3. Microbial communities in high altitude altiplanic wetlands in northern Chile: phylogeny, diversity and function

    OpenAIRE

    Dorador Ortiz, C.

    2007-01-01

    The phylogeny, diversity and function of microbial communities from several altiplanic wetlands was examined using an array of different but complimentary techniques. Results highlighted that microbial diversity exhibited a specific pattern in each wetland. Bacteria were dominant over Archaea in both freshwater and saline systems. Bacterial and archaeal diversity were both higher in sediment than in water samples. Lago Chungará, Laguna de Piacota and Bofedal de Parinacota are freshwater wetla...

  4. Turnover of microbial lipids in the deep biosphere and growth of benthic archaeal populations.

    Science.gov (United States)

    Xie, Sitan; Lipp, Julius S; Wegener, Gunter; Ferdelman, Timothy G; Hinrichs, Kai-Uwe

    2013-04-01

    Deep subseafloor sediments host a microbial biosphere with unknown impact on global biogeochemical cycles. This study tests previous evidence based on microbial intact polar lipids (IPLs) as proxies of live biomass, suggesting that Archaea dominate the marine sedimentary biosphere. We devised a sensitive radiotracer assay to measure the decay rate of ([(14)C]glucosyl)-diphytanylglyceroldiether (GlcDGD) as an analog of archaeal IPLs in continental margin sediments. The degradation kinetics were incorporated in model simulations that constrained the fossil fraction of subseafloor IPLs and rates of archaeal turnover. Simulating the top 1 km in a generic continental margin sediment column, we estimated degradation rate constants of GlcDGD being one to two orders of magnitude lower than those of bacterial IPLs, with half-lives of GlcDGD increasing with depth to 310 ky. Given estimated microbial community turnover times of 1.6-73 ky in sediments deeper than 1 m, 50-96% of archaeal