
Sample records for archaeal gene expression

  1. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Charles J. Daniels


    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

  2. Seasonal changes in bacterial and archaeal gene expression patterns across salinity gradients in the Columbia River coastal margin.

    Directory of Open Access Journals (Sweden)

    Maria W Smith

    Full Text Available Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM. A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April and late summer (August. Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition

  3. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang;


    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory...... element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  4. Archaeal promoter architecture and mechanism of gene activation. (United States)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin


    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  5. A Method for Identification of Selenoprotein Genes in Archaeal Genomes

    Institute of Scientific and Technical Information of China (English)

    Mingfeng Li; Yanzhao Huang; Yi Xiao


    The genetic codon UGA has a dual function: serving as a terminator and encoding selenocysteine. However, most popular gene annotation programs only take it as a stop signal, resulting in misannotation or completely missing selenoprotein genes. We developed a computational method named Asec-Prediction that is specific for the prediction of archaeal selenoprotein genes. To evaluate its effectiveness, we first applied it to 14 archaeal genomes with previously known selenoprotein genes, and Asec-Prediction identified all reported selenoprotein genes without redundant results. When we applied it to 12 archaeal genomes that had not been researched for selenoprotein genes, Asec-Prediction detected a novel selenoprotein gene in Methanosarcina acetivorans. Further evidence was also collected to support that the predicted gene should be a real selenoprotein gene. The result shows that Asec-Prediction is effective for the prediction of archaeal selenoprotein genes.

  6. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China. (United States)

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun


    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  7. Distribution and Diversity of Archaeal Ammonia Monooxygenase Genes Associated with Corals▿ †


    Beman, J. Michael; Roberts, Kathryn J.; Wegley, Linda; Rohwer, Forest; Francis, Christopher A.


    Corals are known to harbor diverse microbial communities of Bacteria and Archaea, yet the ecological role of these microorganisms remains largely unknown. Here we report putative ammonia monooxygenase subunit A (amoA) genes of archaeal origin associated with corals. Multiple DNA samples drawn from nine coral species and four different reef locations were PCR screened for archaeal and bacterial amoA genes, and archaeal amoA gene sequences were obtained from five different species of coral coll...

  8. Co-expression and co-purification of archaeal and eukaryal box C/D RNPs.

    Directory of Open Access Journals (Sweden)

    Yu Peng

    Full Text Available Box C/D ribonucleoprotein particles (RNPs are 2'-O-methylation enzymes required for maturation of ribosomal and small nuclear RNA. Previous biochemical and structural studies of the box C/D RNPs were limited by the unavailability of purified intact RNPs. We developed a bacterial co-expression strategy based on the combined use of a multi-gene expression system and a tRNA-scaffold construct that allowed the expression and purification of homogeneous archaeal and human box C/D RNPs. While the co-expressed and co-purified archaeal box C/D RNP was found to be fully active in a 2'-O-methylation assay, the intact human U14 box C/D RNP showed no detectable catalytic activity, consistent with the earlier findings that assembly of eukaryotic box C/D RNPs is nonspontaneous and requires additional protein factors. Our systems provide a means for further biochemical and structural characterization of box C/D RNPs and their assembly factors.

  9. Gene expression

    International Nuclear Information System (INIS)

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn2+ or Cd2+. We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  10. Phylogenetic Diversity of Archaea and the Archaeal Ammonia Monooxygenase Gene in Uranium Mining-Impacted Locations in Bulgaria

    Directory of Open Access Journals (Sweden)

    Galina Radeva


    Full Text Available Uranium mining and milling activities adversely affect the microbial populations of impacted sites. The negative effects of uranium on soil bacteria and fungi are well studied, but little is known about the effects of radionuclides and heavy metals on archaea. The composition and diversity of archaeal communities inhabiting the waste pile of the Sliven uranium mine and the soil of the Buhovo uranium mine were investigated using 16S rRNA gene retrieval. A total of 355 archaeal clones were selected, and their 16S rDNA inserts were analysed by restriction fragment length polymorphism (RFLP discriminating 14 different RFLP types. All evaluated archaeal 16S rRNA gene sequences belong to the 1.1b/Nitrososphaera cluster of Crenarchaeota. The composition of the archaeal community is distinct for each site of interest and dependent on environmental characteristics, including pollution levels. Since the members of 1.1b/Nitrososphaera cluster have been implicated in the nitrogen cycle, the archaeal communities from these sites were probed for the presence of the ammonia monooxygenase gene (amoA. Our data indicate that amoA gene sequences are distributed in a similar manner as in Crenarchaeota, suggesting that archaeal nitrification processes in uranium mining-impacted locations are under the control of the same key factors controlling archaeal diversity.

  11. Expression, purification and crystallization of an archaeal-type phosphoenolpyruvate carboxylase

    International Nuclear Information System (INIS)

    The expression, purification, crystallization and preliminary diffraction analysis of an archaeal-type phosphoenolpyruvate carboxylase are described. Complete highly redundant X-ray data have been measured from a crystal diffracting to 3.13 Å resolution. An archaeal-type phosphoenolpyruvate carboxylase (PepcA) from Clostridium perfringens has been expressed in Escherichia coli in a soluble form with an amino-terminal His tag. The recombinant protein is enzymatically active and two crystal forms have been obtained. Complete diffraction data extending to 3.13 Å resolution have been measured from a crystal soaked in KAu(CN)2, using radiation at a wavelength just above the Au LIII edge. The asymmetric unit contains two tetramers of PepcA

  12. The UCSC Archaeal Genome Browser: 2012 update


    Chan, Patricia P.; Holmes, Andrew D.; Smith, Andrew M.; Tran, Danny; Lowe, Todd M.


    The UCSC Archaeal Genome Browser ( offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of ...

  13. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve


    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  14. A human CCT5 gene mutation causing distal neuropathy impairs hexadecamer assembly in an archaeal model. (United States)

    Min, Wonki; Angileri, Francesca; Luo, Haibin; Lauria, Antonino; Shanmugasundaram, Maruda; Almerico, Anna Maria; Cappello, Francesco; de Macario, Everly Conway; Lednev, Igor K; Macario, Alberto J L; Robb, Frank T


    Chaperonins mediate protein folding in a cavity formed by multisubunit rings. The human CCT has eight non-identical subunits and the His147Arg mutation in one subunit, CCT5, causes neuropathy. Knowledge is scarce on the impact of this and other mutations upon the chaperone's structure and functions. To make progress, experimental models must be developed. We used an archaeal mutant homolog and demonstrated that the His147Arg mutant has impaired oligomeric assembly, ATPase activity, and defective protein homeostasis functions. These results establish for the first time that a human chaperonin gene defect can be reproduced and studied at the molecular level with an archaeal homolog. The major advantage of the system, consisting of rings with eight identical subunits, is that it amplifies the effects of a mutation as compared with the human counterpart, in which just one subunit per ring is defective. Therefore, the slight deficit of a non-lethal mutation can be detected and characterized.

  15. Phylogeny of bacterial and archaeal genomes using conserved genes: supertrees and supermatrices.

    Directory of Open Access Journals (Sweden)

    Jenna Morgan Lang

    Full Text Available Over 3000 microbial (bacterial and archaeal genomes have been made publically available to date, providing an unprecedented opportunity to examine evolutionary genomic trends and offering valuable reference data for a variety of other studies such as metagenomics. The utility of these genome sequences is greatly enhanced when we have an understanding of how they are phylogenetically related to each other. Therefore, we here describe our efforts to reconstruct the phylogeny of all available bacterial and archaeal genomes. We identified 24, single-copy, ubiquitous genes suitable for this phylogenetic analysis. We used two approaches to combine the data for the 24 genes. First, we concatenated alignments of all genes into a single alignment from which a Maximum Likelihood (ML tree was inferred using RAxML. Second, we used a relatively new approach to combining gene data, Bayesian Concordance Analysis (BCA, as implemented in the BUCKy software, in which the results of 24 single-gene phylogenetic analyses are used to generate a "primary concordance" tree. A comparison of the concatenated ML tree and the primary concordance (BUCKy tree reveals that the two approaches give similar results, relative to a phylogenetic tree inferred from the 16S rRNA gene. After comparing the results and the methods used, we conclude that the current best approach for generating a single phylogenetic tree, suitable for use as a reference phylogeny for comparative analyses, is to perform a maximum likelihood analysis of a concatenated alignment of conserved, single-copy genes.

  16. The UCSC Archaeal Genome Browser: 2012 update. (United States)

    Chan, Patricia P; Holmes, Andrew D; Smith, Andrew M; Tran, Danny; Lowe, Todd M


    The UCSC Archaeal Genome Browser ( offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of the vertebrate UCSC Genome Browser, but also integrates archaeal and bacterial-specific tracks with a few graphic display enhancements. The browser currently contains 115 archaeal genomes, plus 31 genomes of viruses known to infect archaea. Some of the recently developed or enhanced tracks visualize data from published high-throughput RNA-sequencing studies, the NCBI Conserved Domain Database, sequences from pre-genome sequencing studies, predicted gene boundaries from three different protein gene prediction algorithms, tRNAscan-SE gene predictions with RNA secondary structures and CRISPR locus predictions. We have also developed a companion resource, the Archaeal COG Browser, to provide better search and display of arCOG gene function classifications, including their phylogenetic distribution among available archaeal genomes.

  17. MED: a new non-supervised gene prediction algorithm for bacterial and archaeal genomes

    Directory of Open Access Journals (Sweden)

    Yang Yi-Fan


    Full Text Available Abstract Background Despite a remarkable success in the computational prediction of genes in Bacteria and Archaea, a lack of comprehensive understanding of prokaryotic gene structures prevents from further elucidation of differences among genomes. It continues to be interesting to develop new ab initio algorithms which not only accurately predict genes, but also facilitate comparative studies of prokaryotic genomes. Results This paper describes a new prokaryotic genefinding algorithm based on a comprehensive statistical model of protein coding Open Reading Frames (ORFs and Translation Initiation Sites (TISs. The former is based on a linguistic "Entropy Density Profile" (EDP model of coding DNA sequence and the latter comprises several relevant features related to the translation initiation. They are combined to form a so-called Multivariate Entropy Distance (MED algorithm, MED 2.0, that incorporates several strategies in the iterative program. The iterations enable us to develop a non-supervised learning process and to obtain a set of genome-specific parameters for the gene structure, before making the prediction of genes. Conclusion Results of extensive tests show that MED 2.0 achieves a competitive high performance in the gene prediction for both 5' and 3' end matches, compared to the current best prokaryotic gene finders. The advantage of the MED 2.0 is particularly evident for GC-rich genomes and archaeal genomes. Furthermore, the genome-specific parameters given by MED 2.0 match with the current understanding of prokaryotic genomes and may serve as tools for comparative genomic studies. In particular, MED 2.0 is shown to reveal divergent translation initiation mechanisms in archaeal genomes while making a more accurate prediction of TISs compared to the existing gene finders and the current GenBank annotation.

  18. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean

    NARCIS (Netherlands)

    Sintes, Eva; Bergauer, Kristin; De Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.


    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotype

  19. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers

    Directory of Open Access Journals (Sweden)

    Céline Brochier-Armanet


    Full Text Available Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 °C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  20. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne

    Directory of Open Access Journals (Sweden)

    Elisabeth W. Vissers


    Full Text Available Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO. This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA and bacteria (AOB over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally outnumbered AOB. However, in the surface water during summer stratification, when both AO were low in abundance, AOB were more numerous than AOA. Temporal distribution patterns of AOA and AOB were comparable. Higher abundances of amoA gene transcripts were observed at the onset and end of summer stratification. In summer, archaeal amoA genes and transcripts correlated negatively with temperature and conductivity. Concentrations of ammonium and oxygen did not vary enough to explain the amoA gene and transcript dynamics. The observed herbivorous zooplankton may have caused a hidden flux of mineralized ammonium and a change in abundance of genes and transcripts. At the surface, AO might have been repressed during summer stratification due to nutrient limitation caused by active phytoplankton.

  1. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean


    Sintes, Eva; Bergauer, Kristin; de Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.


    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotypes of marine Crenarchaeota Group I (MCGI) were detected in the waters of the tropical Atlantic and the coastal Arctic. The HAC-AOA ecotype (high ammonia concentration AOA) was ≍ 8000 times and 15 ti...

  2. Global Occurrence of Archaeal amoA Genes in Terrestrial Hot Springs▿


    Zhang, Chuanlun L.; Ye, Qi; Huang, Zhiyong; Li, Wenjun; Chen, Jinquan; Song, Zhaoqi; Zhao, Weidong; Bagwell, Christopher; Inskeep, William P.; Ross, Christian; Gao, Lei; Wiegel, Juergen; Romanek, Christopher S.; Shock, Everett L.; Hedlund, Brian P.


    Despite the ubiquity of ammonium in geothermal environments and the thermodynamic favorability of aerobic ammonia oxidation, thermophilic ammonia-oxidizing microorganisms belonging to the crenarchaeota kingdom have only recently been described. In this study, we analyzed microbial mats and surface sediments from 21 hot spring samples (pH 3.4 to 9.0; temperature, 41 to 86°C) from the United States, China, and Russia and obtained 846 putative archaeal ammonia monooxygenase large-subunit (amoA) ...

  3. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea (United States)

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.


    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  4. Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes. (United States)

    Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita


    Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)].

  5. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes. (United States)

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui


    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  6. Phylogenetic analysis of bacterial and archaeal arsC gene sequences suggests an ancient, common origin for arsenate reductase

    Directory of Open Access Journals (Sweden)

    Dugas Sandra L


    Full Text Available Abstract Background The ars gene system provides arsenic resistance for a variety of microorganisms and can be chromosomal or plasmid-borne. The arsC gene, which codes for an arsenate reductase is essential for arsenate resistance and transforms arsenate into arsenite, which is extruded from the cell. A survey of GenBank shows that arsC appears to be phylogenetically widespread both in organisms with known arsenic resistance and those organisms that have been sequenced as part of whole genome projects. Results Phylogenetic analysis of aligned arsC sequences shows broad similarities to the established 16S rRNA phylogeny, with separation of bacterial, archaeal, and subsequently eukaryotic arsC genes. However, inconsistencies between arsC and 16S rRNA are apparent for some taxa. Cyanobacteria and some of the γ-Proteobacteria appear to possess arsC genes that are similar to those of Low GC Gram-positive Bacteria, and other isolated taxa possess arsC genes that would not be expected based on known evolutionary relationships. There is no clear separation of plasmid-borne and chromosomal arsC genes, although a number of the Enterobacteriales (γ-Proteobacteria possess similar plasmid-encoded arsC sequences. Conclusion The overall phylogeny of the arsenate reductases suggests a single, early origin of the arsC gene and subsequent sequence divergence to give the distinct arsC classes that exist today. Discrepancies between 16S rRNA and arsC phylogenies support the role of horizontal gene transfer (HGT in the evolution of arsenate reductases, with a number of instances of HGT early in bacterial arsC evolution. Plasmid-borne arsC genes are not monophyletic suggesting multiple cases of chromosomal-plasmid exchange and subsequent HGT. Overall, arsC phylogeny is complex and is likely the result of a number of evolutionary mechanisms.

  7. Gene Expression Omnibus (GEO) (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  8. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs. (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A


    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  9. Diversity and Abundance of Ammonia-Oxidizing Archaeal Nitrite Reductase (nirK) Genes in Estuarine Sediments of San Francisco Bay (United States)

    Reji, L.; Lee, J. A.; Damashek, J.; Francis, C. A.


    Nitrification, the microbially-mediated aerobic oxidation of ammonia to nitrate via nitrite, is an integral component of the global biogeochemical nitrogen cycle. The first and rate-limiting step of nitrification, ammonia oxidation, is carried out by two distinct microbial groups: ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA). Molecular ecological studies targeting the amoA gene have revealed the abundance and ubiquity of AOA in terrestrial as well as aquatic environments. In addition to the ammonia oxidation machinery that includes the amoA gene, AOA also encode a gene for copper-containing nitrite reductase (nirK). The distribution patterns and functional role of nirK in AOA remain mostly unknown; proposed functions include the indirect involvement in ammonia oxidation through the production of nitric oxide during nitrite reduction, and (2) nitrite detoxification. In the present study, the diversity and abundance of archaeal nirK genes in estuarine sediments were investigated using quantitative polymerase chain reaction, cloning and sequencing approaches. In sediment samples collected from the San Francisco Bay estuary, two archaeal nirK variants (AnirKa and AnirKb) were amplified using specific primer sets. Overall, AnirKa was observed to be significantly more abundant than AnirKb in the sediment samples, with variation in relative abundance spanning two to three orders of magnitude between sampling sites. Phylogenetic analysis revealed a number of unique archaeal nirK sequence types, as well as many that clustered with sequences from previous estuarine studies and cultured AOA isolates, such as Nitrosopumilus maritimus. This study yielded new insights into the diversity and abundance of archaeal nirK genes in estuarine sediments, and highlights the importance of further investigating the physiological role of this gene in AOA, as well as its suitability as a marker gene for studying AOA in the environment.

  10. Tumor-specific gene expression patterns with gene expression profiles

    Institute of Scientific and Technical Information of China (English)

    RUAN Xiaogang; LI Yingxin; LI Jiangeng; GONG Daoxiong; WANG Jinlian


    Gene expression profiles of 14 common tumors and their counterpart normal tissues were analyzed with machine learning methods to address the problem of selection of tumor-specific genes and analysis of their differential expressions in tumor tissues. First, a variation of the Relief algorithm, "RFE_Relief algorithm" was proposed to learn the relations between genes and tissue types. Then, a support vector machine was employed to find the gene subset with the best classification performance for distinguishing cancerous tissues and their counterparts. After tissue-specific genes were removed, cross validation experiments were employed to demonstrate the common deregulated expressions of the selected gene in tumor tissues. The results indicate the existence of a specific expression fingerprint of these genes that is shared in different tumor tissues, and the hallmarks of the expression patterns of these genes in cancerous tissues are summarized at the end of this paper.

  11. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.

    Directory of Open Access Journals (Sweden)

    Jin-Kyung Hong

    Full Text Available Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7% belonged to the MG-I and SCG, which together contained most (93.9% of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and 95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and ecological niche of Thaumarchaeota.

  12. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k+) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k+ gene expression where the H S V-1 t k+ gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([18 F]F H P G; [18 F]-A C V), and pyrimidine- ([123/131 I]I V R F U; [124/131I]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [123/131I]I V R F U imaging with the H S V-1 t k+ reporter gene will be presented

  13. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research


    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  14. Temporal and spatial coexistence of archaeal and bacterial amoA genes and gene transcripts in Lake Lucerne

    NARCIS (Netherlands)

    Vissers, E.W.; Anselmetti, F.S.; Bodelier, P.L.E.; Muyzer, G.; Schleper, C.; Tourna, M.; Laanbroek, H.J.


    Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO). This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA) and bacteria (AOB) over a period of

  15. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean (United States)

    Pedneault, Estelle; Galand, Pierre E.; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie


    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean.

  16. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne


    Vissers, Elisabeth W.; Anselmetti, Flavio S.; Bodelier, Paul L E; Gerard Muyzer; Christa Schleper; Maria Tourna; Hendrikus J. Laanbroek


    Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO). This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA) and bacteria (AOB) over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally o...

  17. Ascidian gene-expression profiles


    William R Jeffery


    With the advent of gene-expression profiling, a large number of genes can now be investigated simultaneously during critical stages of development. This approach will be particularly informative in studies of ascidians, basal chordates whose genomes and embryology are uniquely suited for mapping developmental gene networks.

  18. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali;


    viruses and plasmids. In particular, it has been suggested that ECE-host interactions have shaped the coevolution of ECEs and their archaeal hosts. Furthermore, archaeal hosts have developed defense systems, including the innate restriction-modification (R-M) system and the adaptive CRISPR (clustered...

  19. TBP Domain Symmetry in Basal and Activated Archaeal Transcription


    Ouhammouch, Mohamed; Hausner, Winfried; Geiduschek, E Peter


    The TATA-box binding protein (TBP) is the platform for assembly of archaeal and eukaryotic transcription preinitiation complexes. Ancestral gene duplication and fusion events have produced the saddle-shaped TBP molecule, with its two direct-repeat subdomains and pseudo-two-fold symmetry. Collectively, eukaryotic TBPs have diverged from their present-day archaeal counterparts, which remain highly symmetrical. The similarity of the N- and C-halves of archaeal TBPs is especially pronounced in th...

  20. Homeobox gene expression in Brachiopoda

    DEFF Research Database (Denmark)

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas


    The molecular control that underlies brachiopod ontogeny is largely unknown. In order to contribute to this issue we analyzed the expression pattern of two homeobox containing genes, Not and Cdx, during development of the rhynchonelliform (i.e., articulate) brachiopod Terebratalia transversa....... Not is a homeobox containing gene that regulates the formation of the notochord in chordates, while Cdx (caudal) is a ParaHox gene involved in the formation of posterior tissues of various animal phyla. The T. transversa homolog, TtrNot, is expressed in the ectoderm from the beginning of gastrulation until...... formation. TtrNot expression is absent in unfertilized eggs, in embryos prior to gastrulation, and in settled individuals during and after metamorphosis. Comparison with the expression patterns of Not genes in other metazoan phyla suggests an ancestral role for this gene in gastrulation and germ layer...

  1. Pyrosequencing of mcrA and archaeal 16S rRNA genes reveals diversity and substrate preferences of methanogen communities in anaerobic digesters. (United States)

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng; Lee, Patrick K H


    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield.

  2. Shuffling Yeast Gene Expression Data


    Bilke, Sven


    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent ...

  3. Vascular gene expression: a hypothesis


    Martínez-Navarro, Angélica C.; Galván-Gordillo, Santiago V.; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto


    The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular ti...

  4. Correction of gene expression data

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin;


    This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies....... For maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce...


    Directory of Open Access Journals (Sweden)

    Sjoerd eHolwerda


    Full Text Available Technological developments and intense research over the last years have led to a better understanding of the three-dimensional structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the α- and β-globin gene loci, the antigen receptor loci, the imprinted H19-Igf2 locus and the Hox gene clusters. Collectively, these studies show that regulatory DNA sequences physically contact genes to control their transcription. Proteins set up the three-dimensional configuration of the genome and we will discuss the roles of the key structural organizers CTCF and cohesin, the nuclear lamina and the transcription machinery. Finally, genes adopt non-random positions in the nuclear interior. We will review studies on gene positioning and propose that cell-specific genome conformations can juxtapose a regulatory sequence on one chromosome to a responsive gene on another chromosome to cause altered gene expression in subpopulations of cells.

  6. Shuffling Yeast Gene Expression Data

    CERN Document Server

    Bilke, S


    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent cell clock is identified. The capability of the algorithm to extract information about signal flow in the regulatory network underlying the expression patterns is demonstrated.

  7. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder;


    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... pool) of total RNA from left-sided sporadic colorectal carcinomas. We compared normal tissue to carcinoma tissue from Dukes' stages A-D (noninvasive to distant metastasis) and identified 908 known genes and 4,155 ESTs that changed remarkably from normal to tumor tissue. Based on intensive filtering 226...... known genes and 157 ESTs were found to be highly relevant for CRC. The alteration of known genes was confirmed in >70% of the cases by array analysis of 25 single samples. Two-way hierarchical average linkage cluster analysis clustered normal tissue together with Dukes' A, clustered Dukes' B with Dukes...

  8. Transgenic Arabidopsis Gene Expression System (United States)

    Ferl, Robert; Paul, Anna-Lisa


    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  9. Zipf's Law in Gene Expression

    CERN Document Server

    Furusawa, C; Furusawa, Chikara; Kaneko, Kunihiko


    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1, i.e., they obey Zipf's law. Furthermore, by simulations of a simple model with an intra-cellular reaction network, we found that Zipf's law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  10. Human papillomavirus gene expression

    International Nuclear Information System (INIS)

    To determine the role of tissue differentiation on expression of each of the papillomavirus mRNA species identified by electron microscopy, the authors prepared exon-specific RNA probes that could distinguish the alternatively spliced mRNA species. Radioactively labeled single-stranded RNA probes were generated from a dual promoter vector system and individually hybridized to adjacent serial sections of formalin-fixed, paraffin-embedded biopsies of condylomata. Autoradiography showed that each of the message species had a characteristic tissue distribution and relative abundance. The authors have characterized a portion of the regulatory network of the HPVs by showing that the E2 ORF encodes a trans-acting enhancer-stimulating protein, as it does in BPV-1 (Spalholz et al. 1985). The HPV-11 enhancer was mapped to a 150-bp tract near the 3' end of the URR. Portions of this region are duplicated in some aggressive strains of HPV-6 (Boshart and zur Hausen 1986; Rando et al. 1986). To test the possible biological relevance of these duplications, they cloned tandem arrays of the enhancer and demonstrated, using a chloramphenicol acetyltransferase (CAT) assay, that they led to dramatically increased transcription proportional to copy number. Using the CAT assays, the authors found that the E2 proteins of several papillomavirus types can cross-stimulate the enhancers of most other types. This suggests that prior infection of a tissue with one papillomavirus type may provide a helper effect for superinfection and might account fo the HPV-6/HPV-16 coinfections in condylomata that they have observed

  11. Identifying Gene Interaction Enrichment for Gene Expression Data


    Jigang Zhang; Jian Li; Hong-Wen Deng


    Gene set analysis allows the inclusion of knowledge from established gene sets, such as gene pathways, and potentially improves the power of detecting differentially expressed genes. However, conventional methods of gene set analysis focus on gene marginal effects in a gene set, and ignore gene interactions which may contribute to complex human diseases. In this study, we propose a method of gene interaction enrichment analysis, which incorporates knowledge of predefined gene sets (e.g. gene ...

  12. Vascular Gene Expression: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Angélica Concepción eMartínez-Navarro


    Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.

  13. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean


    Pedneault, Estelle; Pierre E Galand; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie


    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA tr...

  14. Archaeal DNA replication. (United States)

    Kelman, Lori M; Kelman, Zvi


    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

  15. Gene expression profile of pulpitis. (United States)

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A


    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology. PMID:27052691

  16. Gene Expression in Trypanosomatid Parasites

    Directory of Open Access Journals (Sweden)

    Santiago Martínez-Calvillo


    Full Text Available The parasites Leishmania spp., Trypanosoma brucei, and Trypanosoma cruzi are the trypanosomatid protozoa that cause the deadly human diseases leishmaniasis, African sleeping sickness, and Chagas disease, respectively. These organisms possess unique mechanisms for gene expression such as constitutive polycistronic transcription of protein-coding genes and trans-splicing. Little is known about either the DNA sequences or the proteins that are involved in the initiation and termination of transcription in trypanosomatids. In silico analyses of the genome databases of these parasites led to the identification of a small number of proteins involved in gene expression. However, functional studies have revealed that trypanosomatids have more general transcription factors than originally estimated. Many posttranslational histone modifications, histone variants, and chromatin modifying enzymes have been identified in trypanosomatids, and recent genome-wide studies showed that epigenetic regulation might play a very important role in gene expression in this group of parasites. Here, we review and comment on the most recent findings related to transcription initiation and termination in trypanosomatid protozoa.

  17. Temporal and spatial coexistence of archaeal and bacterial amoA genes and gen transcripts in Lake Lucerne

    NARCIS (Netherlands)

    E.W. Vissers; F.S. Anselmetti; P.L.E. Bodelier; G. Muyzer; C. Schleper; M. Tourna; H.J. Laanbroek


    Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO). This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA) and bacteria (AOB) over a period of

  18. The Gene Expression Omnibus Database. (United States)

    Clough, Emily; Barrett, Tanya


    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome-protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at PMID:27008011

  19. The Gene Expression Omnibus database (United States)

    Clough, Emily; Barrett, Tanya


    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome–protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at PMID:27008011

  20. Environmental shaping of sponge associated archaeal communities.

    Directory of Open Access Journals (Sweden)

    Aline S Turque

    Full Text Available BACKGROUND: Archaea are ubiquitous symbionts of marine sponges but their ecological roles and the influence of environmental factors on these associations are still poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We compared the diversity and composition of archaea associated with seawater and with the sponges Hymeniacidon heliophila, Paraleucilla magna and Petromica citrina in two distinct environments: Guanabara Bay, a highly impacted estuary in Rio de Janeiro, Brazil, and the nearby Cagarras Archipelago. For this we used metagenomic analyses of 16S rRNA and ammonia monooxygenase (amoA gene libraries. Hymeniacidon heliophila was more abundant inside the bay, while P. magna was more abundant outside and P. citrina was only recorded at the Cagarras Archipelago. Principal Component Analysis plots (PCA generated using pairwise unweighted UniFrac distances showed that the archaeal community structure of inner bay seawater and sponges was different from that of coastal Cagarras Archipelago. Rarefaction analyses showed that inner bay archaeaoplankton were more diverse than those from the Cagarras Archipelago. Only members of Crenarchaeota were found in sponge libraries, while in seawater both Crenarchaeota and Euryarchaeota were observed. Although most amoA archaeal genes detected in this study seem to be novel, some clones were affiliated to known ammonia oxidizers such as Nitrosopumilus maritimus and Cenarchaeum symbiosum. CONCLUSION/SIGNIFICANCE: The composition and diversity of archaeal communities associated with pollution-tolerant sponge species can change in a range of few kilometers, probably influenced by eutrophication. The presence of archaeal amoA genes in Porifera suggests that Archaea are involved in the nitrogen cycle within the sponge holobiont, possibly increasing its resistance to anthropogenic impacts. The higher diversity of Crenarchaeota in the polluted area suggests that some marine sponges are able to change the composition

  1. Mitochondrial RNA granules: Compartmentalizing mitochondrial gene expression. (United States)

    Jourdain, Alexis A; Boehm, Erik; Maundrell, Kinsey; Martinou, Jean-Claude


    In mitochondria, DNA replication, gene expression, and RNA degradation machineries coexist within a common nondelimited space, raising the question of how functional compartmentalization of gene expression is achieved. Here, we discuss the recently characterized "mitochondrial RNA granules," mitochondrial subdomains with an emerging role in the regulation of gene expression. PMID:26953349

  2. A constructive approach to gene expression dynamics

    International Nuclear Information System (INIS)

    Recently, experiments on mRNA abundance (gene expression) have revealed that gene expression shows a stationary organization described by a scale-free distribution. Here we propose a constructive approach to gene expression dynamics which restores the scale-free exponent and describes the intermediate state dynamics. This approach requires only one assumption: Markov property

  3. Revealing the essentiality of multiple archaeal pcna genes using a mutant propagation assay based on an improved knockout method

    DEFF Research Database (Denmark)

    Zhang, Changyi; Guo, Li; Deng, Ling;


    , a hyperthermophilic crenarchaeon but failed with two conventional knockout methods. Then, a new knockout scheme denoted the marker insertion and target gene deletion (MID) was developed with which transformants were obtained for each pMID-pcna plasmid. We found that mutant cells persisted in transformant cultures...... during incubation of pMID-pcna3 and pMID-araS-pcna1 transformants under counter selection. Studying the propagation of mutant cells by semi-quantitative PCR analysis of the deleted target gene allele (Deltapcna1 or Deltapcna3) revealed that mutant cells lost propagativity, demonstrating that these pcna...

  4. Sedimentary archaeal amoA gene abundance reflects historic nutrient level and salinity fluctuations in Qinghai Lake, Tibetan Plateau (United States)

    Yang, Jian; Jiang, Hongchen; Dong, Hailiang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng


    Integration of DNA derived from ancient phototrophs with their characteristic lipid biomarkers has been successfully employed to reconstruct paleoenvironmental conditions. However, it is poorly known that whether the DNA and lipids of microbial functional aerobes (such as ammonia-oxidizing archaea: AOA) can be used for reconstructing past environmental conditions. Here we identify and quantify the AOA amoA genes (encoding the alpha subunit of ammonia monooxygenases) preserved in a 5.8-m sediment core (spanning the last 18,500 years) from Qinghai Lake. Parallel analyses revealed that low amoA gene abundance corresponded to high total organic carbon (TOC) and salinity, while high amoA gene abundance corresponded to low TOC and salinity. In the Qinghai Lake region, TOC can serve as an indicator of paleo-productivity and paleo-precipitation, which is related to historic nutrient input and salinity. So our data suggest that temporal variation of AOA amoA gene abundance preserved in Qinghai Lake sediment may reflect the variations of nutrient level and salinity throughout the late Pleistocene and Holocene in the Qinghai Lake region.

  5. Sedimentary archaeal amoA gene abundance reflects historic nutrient level and salinity fluctuations in Qinghai Lake, Tibetan Plateau


    Jian Yang; Hongchen Jiang; Hailiang Dong; Weiguo Hou; Gaoyuan Li; Geng Wu


    Integration of DNA derived from ancient phototrophs with their characteristic lipid biomarkers has been successfully employed to reconstruct paleoenvironmental conditions. However, it is poorly known that whether the DNA and lipids of microbial functional aerobes (such as ammonia-oxidizing archaea: AOA) can be used for reconstructing past environmental conditions. Here we identify and quantify the AOA amoA genes (encoding the alpha subunit of ammonia monooxygenases) preserved in a 5.8-m sedim...

  6. Effective Clustering Algorithms for Gene Expression Data

    CERN Document Server

    Chandrasekhar, T; Elayaraja, E


    Microarrays are made it possible to simultaneously monitor the expression profiles of thousands of genes under various experimental conditions. Identification of co-expressed genes and coherent patterns is the central goal in microarray or gene expression data analysis and is an important task in Bioinformatics research. In this paper, K-Means algorithm hybridised with Cluster Centre Initialization Algorithm (CCIA) is proposed Gene Expression Data. The proposed algorithm overcomes the drawbacks of specifying the number of clusters in the K-Means methods. Experimental analysis shows that the proposed method performs well on gene Expression Data when compare with the traditional K- Means clustering and Silhouette Coefficients cluster measure.

  7. Correlating Expression Data with Gene Function Using Gene Ontology

    Institute of Scientific and Technical Information of China (English)

    LIU,Qi; DENG,Yong; WANG,Chuan; SHI,Tie-Liu; LI,Yi-Xue


    Clustering is perhaps one of the most widely used tools for microarray data analysis. Proposed roles for genes of unknown function are inferred from clusters of genes similarity expressed across many biological conditions.However, whether function annotation by similarity metrics is reliable or not and to what extent the similarity in gene expression patterns is useful for annotation of gene functions, has not been evaluated. This paper made a comprehensive research on the correlation between the similarity of expression data and of gene functions using Gene Ontology. It has been found that although the similarity in expression patterns and the similarity in gene functions are significantly dependent on each other, this association is rather weak. In addition, among the three categories of Gene Ontology, the similarity of expression data is more useful for cellular component annotation than for biological process and molecular function. The results presented are interesting for the gene functions prediction research area.

  8. Gene expression analysis identifies global gene dosage sensitivity in cancer

    DEFF Research Database (Denmark)

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata;


    Many cancer-associated somatic copy number alterations (SCNAs) are known. Currently, one of the challenges is to identify the molecular downstream effects of these variants. Although several SCNAs are known to change gene expression levels, it is not clear whether each individual SCNA affects gene...... expression. We reanalyzed 77,840 expression profiles and observed a limited set of 'transcriptional components' that describe well-known biology, explain the vast majority of variation in gene expression and enable us to predict the biological function of genes. On correcting expression profiles...... for these components, we observed that the residual expression levels (in 'functional genomic mRNA' profiling) correlated strongly with copy number. DNA copy number correlated positively with expression levels for 99% of all abundantly expressed human genes, indicating global gene dosage sensitivity. By applying...

  9. A database of phylogenetically atypical genes in archaeal and bacterial genomes, identified using the DarkHorse algorithm

    Directory of Open Access Journals (Sweden)

    Allen Eric E


    Full Text Available Abstract Background The process of horizontal gene transfer (HGT is believed to be widespread in Bacteria and Archaea, but little comparative data is available addressing its occurrence in complete microbial genomes. Collection of high-quality, automated HGT prediction data based on phylogenetic evidence has previously been impractical for large numbers of genomes at once, due to prohibitive computational demands. DarkHorse, a recently described statistical method for discovering phylogenetically atypical genes on a genome-wide basis, provides a means to solve this problem through lineage probability index (LPI ranking scores. LPI scores inversely reflect phylogenetic distance between a test amino acid sequence and its closest available database matches. Proteins with low LPI scores are good horizontal gene transfer candidates; those with high scores are not. Description The DarkHorse algorithm has been applied to 955 microbial genome sequences, and the results organized into a web-searchable relational database, called the DarkHorse HGT Candidate Resource Users can select individual genomes or groups of genomes to screen by LPI score, search for protein functions by descriptive annotation or amino acid sequence similarity, or select proteins with unusual G+C composition in their underlying coding sequences. The search engine reports LPI scores for match partners as well as query sequences, providing the opportunity to explore whether potential HGT donor sequences are phylogenetically typical or atypical within their own genomes. This information can be used to predict whether or not sufficient information is available to build a well-supported phylogenetic tree using the potential donor sequence. Conclusion The DarkHorse HGT Candidate database provides a powerful, flexible set of tools for identifying phylogenetically atypical proteins, allowing researchers to explore both individual HGT events in single genomes, and

  10. Quality Measures for Gene Expression Biclusters


    Beatriz Pontes; Ral Girldez; Aguilar-Ruiz, Jess S.


    An noticeable number of biclustering approaches have been proposed proposed for the study of gene expression data, especially for discovering functionally related gene sets under different subsets of experimental conditions. In this context, recognizing groups of co-expressed or co-regulated genes, that is, genes which follow a similar expression pattern, is one of the main objectives. Due to the problem complexity, heuristic searches are usually used instead of exhaustive algorithms. Further...

  11. Modulation of gene expression made easy

    DEFF Research Database (Denmark)

    Solem, Christian; Jensen, Peter Ruhdal


    A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...

  12. Niche specialization of terrestrial archaeal ammonia oxidizers


    Gubry-Rangin, Cécile; Hai, Brigitte; Quince, Christopher; Engel, Marion; Thomson, Bruce C.; James, Phillip; Schloter, Michael; Robert I. Griffiths; Prosser, James I.; Nicol, Graeme W.


    Soil pH is a major determinant of microbial ecosystem processes and potentially a major driver of evolution, adaptation, and diversity of ammonia oxidizers, which control soil nitrification. Archaea are major components of soil microbial communities and contribute significantly to ammonia oxidation in some soils. To determine whether pH drives evolutionary adaptation and community structure of soil archaeal ammonia oxidizers, sequences of amoA, a key functional gene of ammonia oxidation, were...

  13. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy (Davis, CA); Bachkirova, Elena (Davis, CA); Rey, Michael (Davis, CA)


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  14. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  15. Bayesian biclustering of gene expression data


    Liu Jun S; Gu Jiajun


    Abstract Background Biclustering of gene expression data searches for local patterns of gene expression. A bicluster (or a two-way cluster) is defined as a set of genes whose expression profiles are mutually similar within a subset of experimental conditions/samples. Although several biclustering algorithms have been studied, few are based on rigorous statistical models. Results We developed a Bayesian biclustering model (BBC), and implemented a Gibbs sampling procedure for its statistical in...

  16. Gene expression in the Parkinson's disease brain


    Lewis, Patrick A.; Cookson, Mark R.


    The study of gene expression has undergone a transformation in the past decade as the benefits of the sequencing of the human genome have made themselves felt. Increasingly, genome wide approaches are being applied to the analysis of gene expression in human disease as a route to understanding the underlying pathogenic mechanisms. In this review, we will summarise current state of gene expression studies of the brain in Parkinson's disease, and examine how these techniques can be used to gain...

  17. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin


    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  18. Analysis of Gene Expression Patterns Using Biclustering. (United States)

    Roy, Swarup; Bhattacharyya, Dhruba K; Kalita, Jugal K


    Mining microarray data to unearth interesting expression profile patterns for discovery of in silico biological knowledge is an emerging area of research in computational biology. A group of functionally related genes may have similar expression patterns under a set of conditions or at some time points. Biclustering is an important data mining tool that has been successfully used to analyze gene expression data for biologically significant cluster discovery. The purpose of this chapter is to introduce interesting patterns that may be observed in expression data and discuss the role of biclustering techniques in detecting interesting functional gene groups with similar expression patterns. PMID:26350227

  19. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal


    be met by using promoter libraries. This approach generally consists of inserting a library of promoters in front of the gene to be studied, whereby the individual promoters might deviate either in their spacer sequences or bear slight deviations from the consensus sequence of a vegetative promoter. Here......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...... knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can...

  20. Deriving Trading Rules Using Gene Expression Programming

    Directory of Open Access Journals (Sweden)

    Adrian VISOIU


    Full Text Available This paper presents how buy and sell trading rules are generated using gene expression programming with special setup. Market concepts are presented and market analysis is discussed with emphasis on technical analysis and quantitative methods. The use of genetic algorithms in deriving trading rules is presented. Gene expression programming is applied in a form where multiple types of operators and operands are used. This gives birth to multiple gene contexts and references between genes in order to keep the linear structure of the gene expression programming chromosome. The setup of multiple gene contexts is presented. The case study shows how to use the proposed gene setup to derive trading rules encoded by Boolean expressions, using a dataset with the reference exchange rates between the Euro and the Romanian leu. The conclusions highlight the positive results obtained in deriving useful trading rules.

  1. Gene expression of the endolymphatic sac

    DEFF Research Database (Denmark)

    Friis, Morten; Martin-Bertelsen, Tomas; Friis-Hansen, Lennart;


    that the endolymphatic sac has multiple and diverse functions in the inner ear. Objectives:The objective of this study was to provide a comprehensive review of the genes expressed in the endolymphatic sac in the rat and perform a functional characterization based on measured mRNA abundance. Methods:Microarray technology...... was used to investigate the gene expression of the endolymphatic sac with the surrounding dura. Characteristic and novel endolymphatic sac genes were determined by comparing with expressions in pure dura. Results: In all, 463 genes were identified specific for the endolymphatic sac. Functional annotation...

  2. Quality measures for gene expression biclusters. (United States)

    Pontes, Beatriz; Girldez, Ral; Aguilar-Ruiz, Jess S


    An noticeable number of biclustering approaches have been proposed proposed for the study of gene expression data, especially for discovering functionally related gene sets under different subsets of experimental conditions. In this context, recognizing groups of co-expressed or co-regulated genes, that is, genes which follow a similar expression pattern, is one of the main objectives. Due to the problem complexity, heuristic searches are usually used instead of exhaustive algorithms. Furthermore, most of biclustering approaches use a measure or cost function that determines the quality of biclusters. Having a suitable quality metric for bicluster is a critical aspect, not only for guiding the search, but also for establishing a comparison criteria among the results obtained by different biclustering techniques. In this paper, we analyse a large number of existing approaches to quality measures for gene expression biclusters, as well as we present a comparative study of them based on their capability to recognize different expression patterns in biclusters. PMID:25763839

  3. Positron emission tomography imaging of gene expression

    International Nuclear Information System (INIS)

    The merging of molecular biology and nuclear medicine is developed into molecular nuclear medicine. Positron emission tomography (PET) of gene expression in molecular nuclear medicine has become an attractive area. Positron emission tomography imaging gene expression includes the antisense PET imaging and the reporter gene PET imaging. It is likely that the antisense PET imaging will lag behind the reporter gene PET imaging because of the numerous issues that have not yet to be resolved with this approach. The reporter gene PET imaging has wide application into animal experimental research and human applications of this approach will likely be reported soon

  4. The functional landscape of mouse gene expression

    Directory of Open Access Journals (Sweden)

    Zhang Wen


    Full Text Available Abstract Background Large-scale quantitative analysis of transcriptional co-expression has been used to dissect regulatory networks and to predict the functions of new genes discovered by genome sequencing in model organisms such as yeast. Although the idea that tissue-specific expression is indicative of gene function in mammals is widely accepted, it has not been objectively tested nor compared with the related but distinct strategy of correlating gene co-expression as a means to predict gene function. Results We generated microarray expression data for nearly 40,000 known and predicted mRNAs in 55 mouse tissues, using custom-built oligonucleotide arrays. We show that quantitative transcriptional co-expression is a powerful predictor of gene function. Hundreds of functional categories, as defined by Gene Ontology 'Biological Processes', are associated with characteristic expression patterns across all tissues, including categories that bear no overt relationship to the tissue of origin. In contrast, simple tissue-specific restriction of expression is a poor predictor of which genes are in which functional categories. As an example, the highly conserved mouse gene PWP1 is widely expressed across different tissues but is co-expressed with many RNA-processing genes; we show that the uncharacterized yeast homolog of PWP1 is required for rRNA biogenesis. Conclusions We conclude that 'functional genomics' strategies based on quantitative transcriptional co-expression will be as fruitful in mammals as they have been in simpler organisms, and that transcriptional control of mammalian physiology is more modular than is generally appreciated. Our data and analyses provide a public resource for mammalian functional genomics.

  5. Bimodal gene expression patterns in breast cancer


    Nikolsky Yuri; Bugrim Andrej; Shi Weiwei; Kirillov Eugene; Bessarabova Marina; Nikolskaya Tatiana


    Abstract We identified a set of genes with an unexpected bimodal distribution among breast cancer patients in multiple studies. The property of bimodality seems to be common, as these genes were found on multiple microarray platforms and in studies with different end-points and patient cohorts. Bimodal genes tend to cluster into small groups of four to six genes with synchronised expression within the group (but not between the groups), which makes them good candidates for robust conditional ...

  6. Topological Features In Cancer Gene Expression Data


    Lockwood, Svetlana; Krishnamoorthy, Bala


    We present a new method for exploring cancer gene expression data based on tools from algebraic topology. Our method selects a small relevant subset from tens of thousands of genes while simultaneously identifying nontrivial higher order topological features, i.e., holes, in the data. We first circumvent the problem of high dimensionality by dualizing the data, i.e., by studying genes as points in the sample space. Then we select a small subset of the genes as landmarks to construct topologic...

  7. A comparative gene expression database for invertebrates

    Directory of Open Access Journals (Sweden)

    Ormestad Mattias


    Full Text Available Abstract Background As whole genome and transcriptome sequencing gets cheaper and faster, a great number of 'exotic' animal models are emerging, rapidly adding valuable data to the ever-expanding Evo-Devo field. All these new organisms serve as a fantastic resource for the research community, but the sheer amount of data, some published, some not, makes detailed comparison of gene expression patterns very difficult to summarize - a problem sometimes even noticeable within a single lab. The need to merge existing data with new information in an organized manner that is publicly available to the research community is now more necessary than ever. Description In order to offer a homogenous way of storing and handling gene expression patterns from a variety of organisms, we have developed the first web-based comparative gene expression database for invertebrates that allows species-specific as well as cross-species gene expression comparisons. The database can be queried by gene name, developmental stage and/or expression domains. Conclusions This database provides a unique tool for the Evo-Devo research community that allows the retrieval, analysis and comparison of gene expression patterns within or among species. In addition, this database enables a quick identification of putative syn-expression groups that can be used to initiate, among other things, gene regulatory network (GRN projects.

  8. Differential gene expression during Trypanosoma cruzi metacyclogenesis

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Krieger


    Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.

  9. Multivariate search for differentially expressed gene combinations

    Directory of Open Access Journals (Sweden)

    Klebanov Lev


    Full Text Available Abstract Background To identify differentially expressed genes, it is standard practice to test a two-sample hypothesis for each gene with a proper adjustment for multiple testing. Such tests are essentially univariate and disregard the multidimensional structure of microarray data. A more general two-sample hypothesis is formulated in terms of the joint distribution of any sub-vector of expression signals. Results By building on an earlier proposed multivariate test statistic, we propose a new algorithm for identifying differentially expressed gene combinations. The algorithm includes an improved random search procedure designed to generate candidate gene combinations of a given size. Cross-validation is used to provide replication stability of the search procedure. A permutation two-sample test is used for significance testing. We design a multiple testing procedure to control the family-wise error rate (FWER when selecting significant combinations of genes that result from a successive selection procedure. A target set of genes is composed of all significant combinations selected via random search. Conclusions A new algorithm has been developed to identify differentially expressed gene combinations. The performance of the proposed search-and-testing procedure has been evaluated by computer simulations and analysis of replicated Affymetrix gene array data on age-related changes in gene expression in the inner ear of CBA mice.

  10. Gene Expression Profiling in Porcine Fetal Thymus

    Institute of Scientific and Technical Information of China (English)

    Yanjiong Chen; Shengbin Li; Lin Ye; Jianing Geng; Yajun Deng; Songnian Hu


    obtain an initial overview of gene diversity and expression pattern in porcinethymus, 11,712 ESTs (Expressed Sequence Tags) from 100-day-old porcine thymus(FTY) were sequenced and 7,071 cleaned ESTs were used for gene expressionanalysis. Clustered by the PHRAP program, 959 contigs and 3,074 singlets wereobtained. Blast search showed that 806 contigs and 1,669 singlets (totally 5,442ESTs) had homologues in GenBank and 1,629 ESTs were novel. According to theGene Ontology classification, 36.99% ESTs were cataloged into the gene expressiongroup, indicating that although the functional gene (18.78% in defense group) ofthymus is expressed in a certain degree, the 100-day-old porcine thymus still existsin a developmental stage. Comparative analysis showed that the gene expressionpattern of the 100-day-old porcine thymus is similar to that of the human infantthymus.

  11. Nucleosome repositioning underlies dynamic gene expression. (United States)

    Nocetti, Nicolas; Whitehouse, Iestyn


    Nucleosome repositioning at gene promoters is a fundamental aspect of the regulation of gene expression. However, the extent to which nucleosome repositioning is used within eukaryotic genomes is poorly understood. Here we report a comprehensive analysis of nucleosome positions as budding yeast transit through an ultradian cycle in which expression of >50% of all genes is highly synchronized. We present evidence of extensive nucleosome repositioning at thousands of gene promoters as genes are activated and repressed. During activation, nucleosomes are relocated to allow sites of general transcription factor binding and transcription initiation to become accessible. The extent of nucleosome shifting is closely related to the dynamic range of gene transcription and generally related to DNA sequence properties and use of the coactivators TFIID or SAGA. However, dynamic gene expression is not limited to SAGA-regulated promoters and is an inherent feature of most genes. While nucleosome repositioning occurs pervasively, we found that a class of genes required for growth experience acute nucleosome shifting as cells enter the cell cycle. Significantly, our data identify that the ATP-dependent chromatin-remodeling enzyme Snf2 plays a fundamental role in nucleosome repositioning and the expression of growth genes. We also reveal that nucleosome organization changes extensively in concert with phases of the cell cycle, with large, regularly spaced nucleosome arrays being established in mitosis. Collectively, our data and analysis provide a framework for understanding nucleosome dynamics in relation to fundamental DNA-dependent transactions.

  12. Phytochrome-regulated Gene Expression

    Institute of Scientific and Technical Information of China (English)

    Peter H. Quail


    Identification of all genes involved in the phytochrome (phy)-mediated responses of plants to their light environment is an important goal in providing an overall understanding of light-regulated growth and development. This article highlights and integrates the central findings of two recent comprehensive studies in Arabidopsis that have identified the genome-wide set of phy-regulated genes that respond rapidly to red-light signals upon first exposure of dark-grown seedlings, and have tested the functional relevance to normal seedling photomorphogenesis of an initial subset of these genes. The data: (a) reveal considerable complexity in the channeling of the light signals through the different phy-family members (phyA to phyE) to responsive genes; (b) identify a diversity of transcription-factor-encoding genes as major early, if not primary, targets of phy signaling, and, therefore, as potentially important regulators in the transcriptional-network hierarchy; and (c) identify auxin-related genes as the dominant class among rapidly-regulated, hormone-related genes. However, reverse-genetic functional profiling of a selected subset of these genes reveals that only a limited fraction are necessary for optimal phy-induced seedling deetiolation.

  13. Gene expression profile of sprinter's muscle. (United States)

    Yoshioka, M; Tanaka, H; Shono, N; Shindo, M; St-Amand, J


    We have characterized the global gene expression profile in left vastus lateralis muscles of sprinters and sedentary men. The gene expression profile was analyzed by using serial analysis of gene expression (SAGE) method. The abundantly expressed transcripts in the sprinter's muscle were mainly involved in contraction and energy metabolism, whereas six transcripts were corresponding to potentially novel transcripts. Thirty-eight transcripts were differentially expressed between the sprinter and sedentary individuals. Moreover, sprinters showed higher expressions of both uncharacterized and potentially novel transcripts. Sprinters also highly expressed seven transcripts, such as glycine-rich protein, myosin heavy polypeptide (MYH) 2, expressed sequence tag similar to (EST) fructose-bisphosphate aldolase 1 isoform A (ALDOA), glyceraldehyde-3-phosphate dehydrogenase and ATP synthase F0 subunit 6. On the other hand, 20 transcripts such as MYH1, tropomyosin 2 and 3, troponin C slow, C2 fast, I slow, T1 slow and T3 fast, myoglobin, creatine kinase, ALDOA, glycogen phosphorylase, cytochrome c oxidase II and III, and NADH dehydrogenase 1 and 2 showed lower expression levels in the sprinters than the sedentary controls. The current study has characterized the global gene expressions in sprinters and identified a number of transcripts that can be subjected to further mechanistic analysis.

  14. Extracting expression modules from perturbational gene expression compendia


    Van Dijck Patrick; Maere Steven; Kuiper Martin


    Abstract Background Compendia of gene expression profiles under chemical and genetic perturbations constitute an invaluable resource from a systems biology perspective. However, the perturbational nature of such data imposes specific challenges on the computational methods used to analyze them. In particular, traditional clustering algorithms have difficulties in handling one of the prominent features of perturbational compendia, namely partial coexpression relationships between genes. Biclus...

  15. Gene expression in periodontal tissues following treatment

    Directory of Open Access Journals (Sweden)

    Eisenacher Martin


    Full Text Available Abstract Background In periodontitis, treatment aimed at controlling the periodontal biofilm infection results in a resolution of the clinical and histological signs of inflammation. Although the cell types found in periodontal tissues following treatment have been well described, information on gene expression is limited to few candidate genes. Therefore, the aim of the study was to determine the expression profiles of immune and inflammatory genes in periodontal tissues from sites with severe chronic periodontitis following periodontal therapy in order to identify genes involved in tissue homeostasis. Gingival biopsies from 12 patients with severe chronic periodontitis were taken six to eight weeks following non-surgical periodontal therapy, and from 11 healthy controls. As internal standard, RNA of an immortalized human keratinocyte line (HaCaT was used. Total RNA was subjected to gene expression profiling using a commercially available microarray system focusing on inflammation-related genes. Post-hoc confirmation of selected genes was done by Realtime-PCR. Results Out of the 136 genes analyzed, the 5% most strongly expressed genes compared to healthy controls were Interleukin-12A (IL-12A, Versican (CSPG-2, Matrixmetalloproteinase-1 (MMP-1, Down syndrome critical region protein-1 (DSCR-1, Macrophage inflammatory protein-2β (Cxcl-3, Inhibitor of apoptosis protein-1 (BIRC-1, Cluster of differentiation antigen 38 (CD38, Regulator of G-protein signalling-1 (RGS-1, and Finkel-Biskis-Jinkins murine osteosarcoma virus oncogene (C-FOS; the 5% least strongly expressed genes were Receptor-interacting Serine/Threonine Kinase-2 (RIP-2, Complement component 3 (C3, Prostaglandin-endoperoxide synthase-2 (COX-2, Interleukin-8 (IL-8, Endothelin-1 (EDN-1, Plasminogen activator inhibitor type-2 (PAI-2, Matrix-metalloproteinase-14 (MMP-14, and Interferon regulating factor-7 (IRF-7. Conclusion Gene expression profiles found in periodontal tissues following

  16. Optogenetic Control of Gene Expression in Drosophila.

    Directory of Open Access Journals (Sweden)

    Yick-Bun Chan

    Full Text Available To study the molecular mechanism of complex biological systems, it is important to be able to artificially manipulate gene expression in desired target sites with high precision. Based on the light dependent binding of cryptochrome 2 and a cryptochrome interacting bHLH protein, we developed a split lexA transcriptional activation system for use in Drosophila that allows regulation of gene expression in vivo using blue light or two-photon excitation. We show that this system offers high spatiotemporal resolution by inducing gene expression in tissues at various developmental stages. In combination with two-photon excitation, gene expression can be manipulated at precise sites in embryos, potentially offering an important tool with which to examine developmental processes.

  17. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou


    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  18. Regulation of Gene Expression in Protozoa Parasites

    Directory of Open Access Journals (Sweden)

    Consuelo Gomez


    Full Text Available Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  19. Gene expression profiling in autoimmune diseases

    DEFF Research Database (Denmark)

    Bovin, Lone Frier; Brynskov, Jørn; Hegedüs, Laszlo;


    A central issue in autoimmune disease is whether the underlying inflammation is a repeated stereotypical process or whether disease specific gene expression is involved. To shed light on this, we analysed whether genes previously found to be differentially regulated in rheumatoid arthritis (RA...... differences in peripheral blood mononuclear cell (MNC) gene expression patterns between 15 newly diagnosed HT patients and 15 matched healthy controls. However, the MNC expression levels of five genes were significantly upregulated in 25 IBD patients, compared to 18 matched healthy controls (CD14, FACL2, FCN1...... immunoinflammatory diseases, but only if accompanied by pronounced systemic manifestations. This suggests that at least some of the genes activated in RA are predominantly or solely related to general and disease-nonspecific autoimmune processes...

  20. Energy intake and adiponectin gene expression


    Qiao, Liping; Lee, Bonggi; Kinney, Brice; Yoo, Hyung sun; Shao, Jianhua


    Hypoadiponectinemia and decreased adiponectin gene expression in white adipose tissue (WAT) have been well observed in obese subjects and animal models. However, the mechanism for obesity-associated hypoadiponectinemia is still largely unknown. To investigate the regulatory role of energy intake, dietary fat, and adiposity in adiponectin gene expression and blood adiponectin level, a series of feeding regimens was employed to manipulate energy intake and dietary fat in obese-prone C57BL/6, ge...

  1. Facilitated diffusion buffers noise in gene expression


    Schoech, Armin; Zabet, Nicolae Radu


    Transcription factors perform facilitated diffusion (3D diffusion in the cytosol and 1D diffusion on the DNA) when binding to their target sites to regulate gene expression. Here, we investigated the influence of this binding mechanism on the noise in gene expression. Our results showed that, for biologically relevant parameters, the binding process can be represented by a two-state Markov model and that the accelerated target finding due to facilitated diffusion leads to a reduction in both ...

  2. PRAME gene expression profile in medulloblastoma

    Directory of Open Access Journals (Sweden)

    Tânia Maria Vulcani-Freitas


    Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.

  3. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis. (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana


    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  4. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis. (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana


    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  5. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.

    Directory of Open Access Journals (Sweden)

    Odelta dos Santos

    Full Text Available Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR, one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  6. Inferring gene networks from discrete expression data

    KAUST Repository

    Zhang, L.


    The modeling of gene networks from transcriptional expression data is an important tool in biomedical research to reveal signaling pathways and to identify treatment targets. Current gene network modeling is primarily based on the use of Gaussian graphical models applied to continuous data, which give a closedformmarginal likelihood. In this paper,we extend network modeling to discrete data, specifically data from serial analysis of gene expression, and RNA-sequencing experiments, both of which generate counts of mRNAtranscripts in cell samples.We propose a generalized linear model to fit the discrete gene expression data and assume that the log ratios of the mean expression levels follow a Gaussian distribution.We restrict the gene network structures to decomposable graphs and derive the graphs by selecting the covariance matrix of the Gaussian distribution with the hyper-inverse Wishart priors. Furthermore, we incorporate prior network models based on gene ontology information, which avails existing biological information on the genes of interest. We conduct simulation studies to examine the performance of our discrete graphical model and apply the method to two real datasets for gene network inference. © The Author 2013. Published by Oxford University Press. All rights reserved.

  7. Translational control of gene expression and disease

    NARCIS (Netherlands)

    Calkhoven, Cornelis F; Müller, Christine; Leutz, Achim


    In the past decade, translational control has been shown to be crucial in the regulation of gene expression. Research in this field has progressed rapidly, revealing new control mechanisms and adding constantly to the list of translationally regulated genes. There is accumulating evidence that trans

  8. Perspectives: Gene Expression in Fisheries Management (United States)

    Nielsen, Jennifer L.; Pavey, Scott A.


    Functional genes and gene expression have been connected to physiological traits linked to effective production and broodstock selection in aquaculture, selective implications of commercial fish harvest, and adaptive changes reflected in non-commercial fish populations subject to human disturbance and climate change. Gene mapping using single nucleotide polymorphisms (SNPs) to identify functional genes, gene expression (analogue microarrays and real-time PCR), and digital sequencing technologies looking at RNA transcripts present new concepts and opportunities in support of effective and sustainable fisheries. Genomic tools have been rapidly growing in aquaculture research addressing aspects of fish health, toxicology, and early development. Genomic technologies linking effects in functional genes involved in growth, maturation and life history development have been tied to selection resulting from harvest practices. Incorporating new and ever-increasing knowledge of fish genomes is opening a different perspective on local adaptation that will prove invaluable in wild fish conservation and management. Conservation of fish stocks is rapidly incorporating research on critical adaptive responses directed at the effects of human disturbance and climate change through gene expression studies. Genomic studies of fish populations can be generally grouped into three broad categories: 1) evolutionary genomics and biodiversity; 2) adaptive physiological responses to a changing environment; and 3) adaptive behavioral genomics and life history diversity. We review current genomic research in fisheries focusing on those that use microarrays to explore differences in gene expression among phenotypes and within or across populations, information that is critically important to the conservation of fish and their relationship to humans.

  9. Application of multidisciplinary analysis to gene expression.

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xuefel (University of New Mexico, Albuquerque, NM); Kang, Huining (University of New Mexico, Albuquerque, NM); Fields, Chris (New Mexico State University, Las Cruces, NM); Cowie, Jim R. (New Mexico State University, Las Cruces, NM); Davidson, George S.; Haaland, David Michael; Sibirtsev, Valeriy (New Mexico State University, Las Cruces, NM); Mosquera-Caro, Monica P. (University of New Mexico, Albuquerque, NM); Xu, Yuexian (University of New Mexico, Albuquerque, NM); Martin, Shawn Bryan; Helman, Paul (University of New Mexico, Albuquerque, NM); Andries, Erik (University of New Mexico, Albuquerque, NM); Ar, Kerem (University of New Mexico, Albuquerque, NM); Potter, Jeffrey (University of New Mexico, Albuquerque, NM); Willman, Cheryl L. (University of New Mexico, Albuquerque, NM); Murphy, Maurice H. (University of New Mexico, Albuquerque, NM)


    Molecular analysis of cancer, at the genomic level, could lead to individualized patient diagnostics and treatments. The developments to follow will signal a significant paradigm shift in the clinical management of human cancer. Despite our initial hopes, however, it seems that simple analysis of microarray data cannot elucidate clinically significant gene functions and mechanisms. Extracting biological information from microarray data requires a complicated path involving multidisciplinary teams of biomedical researchers, computer scientists, mathematicians, statisticians, and computational linguists. The integration of the diverse outputs of each team is the limiting factor in the progress to discover candidate genes and pathways associated with the molecular biology of cancer. Specifically, one must deal with sets of significant genes identified by each method and extract whatever useful information may be found by comparing these different gene lists. Here we present our experience with such comparisons, and share methods developed in the analysis of an infant leukemia cohort studied on Affymetrix HG-U95A arrays. In particular, spatial gene clustering, hyper-dimensional projections, and computational linguistics were used to compare different gene lists. In spatial gene clustering, different gene lists are grouped together and visualized on a three-dimensional expression map, where genes with similar expressions are co-located. In another approach, projections from gene expression space onto a sphere clarify how groups of genes can jointly have more predictive power than groups of individually selected genes. Finally, online literature is automatically rearranged to present information about genes common to multiple groups, or to contrast the differences between the lists. The combination of these methods has improved our understanding of infant leukemia. While the complicated reality of the biology dashed our initial, optimistic hopes for simple answers from

  10. Aberrant Gene Expression in Acute Myeloid Leukaemia

    DEFF Research Database (Denmark)

    Bagger, Frederik Otzen

    Summary Acute Myeloid Leukaemia (AML) is an aggressive cancer of the bone marrow, affecting formation of blood cells during haematopoiesis. This thesis presents investigation of AML using mRNA gene expression profiles (GEP) of samples extracted from the bone marrow of healthy and diseased subjects...... genes and genetic signatures and for reducing dimensionally of gene expression data. Next, we have used machine-learning methods to predict survival and to assess important predictors based on these results. General application of a number of these methods has been implemented into two public query...

  11. Gene expression profiling: can we identify the right target genes?

    Directory of Open Access Journals (Sweden)

    J. E. Loyd


    Full Text Available Gene expression profiling allows the simultaneous monitoring of the transcriptional behaviour of thousands of genes, which may potentially be involved in disease development. Several studies have been performed in idiopathic pulmonary fibrosis (IPF, which aim to define genetic links to the disease in an attempt to improve the current understanding of the underlying pathogenesis of the disease and target pathways for intervention. Expression profiling has shown a clear difference in gene expression between IPF and normal lung tissue, and has identified a wide range of candidate genes, including those known to encode for proteins involved in extracellular matrix formation and degradation, growth factors and chemokines. Recently, familial pulmonary fibrosis cohorts have been examined in an attempt to detect specific genetic mutations associated with IPF. To date, these studies have identified families in which IPF is associated with mutations in the gene encoding surfactant protein C, or with mutations in genes encoding components of telomerase. Although rare and clearly not responsible for the disease in all individuals, the nature of these mutations highlight the importance of the alveolar epithelium in disease pathogenesis and demonstrate the potential for gene expression profiling in helping to advance the current understanding of idiopathic pulmonary fibrosis.

  12. Introduction to the Gene Expression Analysis. (United States)

    Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S


    In 1941, Beadle and Tatum published experiments that would explain the basis of the central dogma of molecular biology, whereby the DNA through an intermediate molecule, called RNA, results proteins that perform the functions in cells. Currently, biomedical research attempts to explain the mechanisms by which develops a particular disease, for this reason, gene expression studies have proven to be a great resource. Strictly, the term "gene expression" comprises from the gene activation until the mature protein is located in its corresponding compartment to perform its function and contribute to the expression of the phenotype of cell.The expression studies are directed to detect and quantify messenger RNA (mRNA) levels of a specific gene. The development of the RNA-based gene expression studies began with the Northern Blot by Alwine et al. in 1977. In 1969, Gall and Pardue and John et al. independently developed the in situ hybridization, but this technique was not employed to detect mRNA until 1986 by Coghlan. Today, many of the techniques for quantification of RNA are deprecated because other new techniques provide more information. Currently the most widely used techniques are qPCR, expression microarrays, and RNAseq for the transcriptome analysis. In this chapter, these techniques will be reviewed. PMID:27300529

  13. Regulation of gene expression in human tendinopathy

    Directory of Open Access Journals (Sweden)

    Archambault Joanne M


    Full Text Available Abstract Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics.

  14. Noise minimization in eukaryotic gene expression.

    Directory of Open Access Journals (Sweden)

    Hunter B Fraser


    Full Text Available All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or "noise." Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection.

  15. Soybean physiology and gene expression during drought. (United States)

    Stolf-Moreira, R; Medri, M E; Neumaier, N; Lemos, N G; Pimenta, J A; Tobita, S; Brogin, R L; Marcelino-Guimarães, F C; Oliveira, M C N; Farias, J R B; Abdelnoor, R V; Nepomuceno, A L


    Soybean genotypes MG/BR46 (Conquista) and BR16, drought-tolerant and -sensitive, respectively, were compared in terms of morphophysiological and gene-expression responses to water stress during two stages of development. Gene-expression analysis showed differential responses in Gmdreb1a and Gmpip1b mRNA expression within 30 days of water-deficit initiation in MG/BR46 (Conquista) plants. Within 45 days of initiating stress, Gmp5cs and Gmpip1b had relatively higher expression. Initially, BR16 showed increased expression only for Gmdreb1a, and later (45 days) for Gmp5cs, Gmdefensin and Gmpip1b. Only BR16 presented down-regulated expression of genes, such as Gmp5cs and Gmpip1b, 30 days after the onset of moisture stress, and Gmgols after 45 days of stress. The faster perception of water stress in MG/BR46 (Conquista) and the better maintenance of up-regulated gene expression than in the sensitive BR16 genotype imply mechanisms by which the former is better adapted to tolerate moisture deficiency.

  16. Quality measures for gene expression biclusters.

    Directory of Open Access Journals (Sweden)

    Beatriz Pontes

    Full Text Available An noticeable number of biclustering approaches have been proposed proposed for the study of gene expression data, especially for discovering functionally related gene sets under different subsets of experimental conditions. In this context, recognizing groups of co-expressed or co-regulated genes, that is, genes which follow a similar expression pattern, is one of the main objectives. Due to the problem complexity, heuristic searches are usually used instead of exhaustive algorithms. Furthermore, most of biclustering approaches use a measure or cost function that determines the quality of biclusters. Having a suitable quality metric for bicluster is a critical aspect, not only for guiding the search, but also for establishing a comparison criteria among the results obtained by different biclustering techniques. In this paper, we analyse a large number of existing approaches to quality measures for gene expression biclusters, as well as we present a comparative study of them based on their capability to recognize different expression patterns in biclusters.

  17. Archaeal viruses of the sulfolobales

    DEFF Research Database (Denmark)

    Erdmann, Susanne; Garrett, Roger Antony


    Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2 with an environm......Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2...... in CRISPR loci of Sulfolobus species from a second coinfecting conjugative plasmid or virus (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012; Erdmann et al. Mol Microbiol 91:900-917, 2014). Here we describe, firstly, the isolation of archaeal virus mixtures from terrestrial hot springs...

  18. Alternative-splicing-mediated gene expression (United States)

    Wang, Qianliang; Zhou, Tianshou


    Alternative splicing (AS) is a fundamental process during gene expression and has been found to be ubiquitous in eukaryotes. However, how AS impacts gene expression levels both quantitatively and qualitatively remains to be fully explored. Here, we analyze two common models of gene expression, each incorporating a simple splice mechanism that a pre-mRNA is spliced into two mature mRNA isoforms in a probabilistic manner. In the constitutive expression case, we show that the steady-state molecular numbers of two mature mRNA isoforms follow mutually independent Poisson distributions. In the bursting expression case, we demonstrate that the tail decay of the steady-state distribution for both mature mRNA isoforms that in general are not mutually independent can be characterized by the product of mean burst size and splicing probability. In both cases, we find that AS can efficiently modulate both the variability (measured by variance) and the noise level of the total mature mRNA, and in particular, the latter is always lower than the noise level of the pre-mRNA, implying that AS always reduces the noise. These results altogether reveal that AS is a mechanism of efficiently controlling the gene expression noise.

  19. Archaeal Nitrification in Hot Springs (United States)

    Richter, A.; Daims, H.; Reigstad, L.; Wanek, W.; Wagner, M.; Schleper, C.


    Biological nitrification, i.e. the aerobic conversion of ammonia to nitrate via nitrite, is a major component of the global nitrogen cycle. Until recently, it was thought that the ability to aerobically oxidize ammonia was confined to bacteria of the phylum Proteobacteria. However, it has recently been shown that Archaea of the phylum Crenarchaeota are also capable of ammonia oxidation. As many Crenarchaeota are thermophilic or hyperthermophilic, and at least some of them are capable of ammonia oxidation we speculated on the existence of (hyper)thermophilic ammonia-oxidizing archaea (AOA). Using PCR primers specifically targeting the archaeal ammonia monooxygenase (amoA) gene, we were indeed able to confirm the presence of such organisms in several hot springs in Reykjadalur, Iceland. These hot springs exhibited temperatures well above 80 °C and pH values ranging from 2.0 to 4.5. To proof that nitrification actually took place under these extreme conditions, we measured gross nitrification rates by the isotope pool dilution method; we added 15N-labelled nitrate to the mud and followed the dilution of the label by nitrate production from ammonium either in situ (incubation in the hot spring) or under controlled conditions in the laboratory (at 80 °C). The nitrification rates in the hot springs ranged from 0.79 to 2.22 mg nitrate-N per L of mud and day. Controls, in which microorganisms were killed before the incubations, demonstrated that the nitrification was of biological origin. Addition of ammonium increased the gross nitrification rate approximately 3-fold, indicating that the nitrification was ammonium limited under the conditions used. Collectively, our study provides evidence that (1) AOA are present in hot springs and (2) that they are actively nitrifying. These findings have major implications for our understanding of nitrogen cycling of hot environments.

  20. Gene expression analysis of flax seed development

    Directory of Open Access Journals (Sweden)

    Sharpe Andrew


    Full Text Available Abstract Background Flax, Linum usitatissimum L., is an important crop whose seed oil and stem fiber have multiple industrial applications. Flax seeds are also well-known for their nutritional attributes, viz., omega-3 fatty acids in the oil and lignans and mucilage from the seed coat. In spite of the importance of this crop, there are few molecular resources that can be utilized toward improving seed traits. Here, we describe flax embryo and seed development and generation of comprehensive genomic resources for the flax seed. Results We describe a large-scale generation and analysis of expressed sequences in various tissues. Collectively, the 13 libraries we have used provide a broad representation of genes active in developing embryos (globular, heart, torpedo, cotyledon and mature stages seed coats (globular and torpedo stages and endosperm (pooled globular to torpedo stages and genes expressed in flowers, etiolated seedlings, leaves, and stem tissue. A total of 261,272 expressed sequence tags (EST (GenBank accessions LIBEST_026995 to LIBEST_027011 were generated. These EST libraries included transcription factor genes that are typically expressed at low levels, indicating that the depth is adequate for in silico expression analysis. Assembly of the ESTs resulted in 30,640 unigenes and 82% of these could be identified on the basis of homology to known and hypothetical genes from other plants. When compared with fully sequenced plant genomes, the flax unigenes resembled poplar and castor bean more than grape, sorghum, rice or Arabidopsis. Nearly one-fifth of these (5,152 had no homologs in sequences reported for any organism, suggesting that this category represents genes that are likely unique to flax. Digital analyses revealed gene expression dynamics for the biosynthesis of a number of important seed constituents during seed development. Conclusions We have developed a foundational database of expressed sequences and collection of plasmid

  1. Ocular Surface Development and Gene Expression

    Directory of Open Access Journals (Sweden)

    Shivalingappa K. Swamynathan


    Full Text Available The ocular surface—a continuous epithelial surface with regional specializations including the surface and glandular epithelia of the cornea, conjunctiva, and lacrimal and meibomian glands connected by the overlying tear film—plays a central role in vision. Molecular and cellular events involved in embryonic development, postnatal maturation, and maintenance of the ocular surface are precisely regulated at the level of gene expression by a well-coordinated network of transcription factors. A thorough appreciation of the biological characteristics of the ocular surface in terms of its gene expression profiles and their regulation provides us with a valuable insight into the pathophysiology of various blinding disorders that disrupt the normal development, maturation, and/or maintenance of the ocular surface. This paper summarizes the current status of our knowledge related to the ocular surface development and gene expression and the contribution of different transcription factors to this process.

  2. Gene expression profiles in irradiated cancer cells (United States)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.


    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  3. Gene expression profiles in irradiated cancer cells

    International Nuclear Information System (INIS)

    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses

  4. Gene Expression in the Human Endolymphatic Sac

    DEFF Research Database (Denmark)

    Møller, Martin Nue; Kirkeby, Svend; Vikeså, Jonas;


    OBJECTIVES/HYPOTHESIS: The purpose of the present study is to explore, demonstrate, and describe the expression of genes related to the solute carrier (SLC) molecules of ion transporters in the human endolymphatic sac. STUDY DESIGN: cDNA microarrays and immunohistochemistry were used for analyses...... of fresh human endolymphatic sac tissue samples. METHODS: Twelve tissue samples of the human endolymphatic sac were obtained during translabyrinthine surgery for vestibular schwannoma. Microarray technology was used to investigate tissue sample expression of solute carrier family genes, using adjacent dura...... mater as control. Immunohistochemistry was used for verification of translation of selected genes, as well as localization of the specific protein within the sac. RESULTS: An extensive representation of the SLC family genes were upregulated in the human endolymphatic sac, including SLC26a4 Pendrin, SLC4...

  5. Parsimonious selection of useful genes in microarray gene expression data


    González Navarro, Félix Fernando; Belanche Muñoz, Luis Antonio


    Machine Learning methods have of late made significant efforts to solving multidisciplinary problems in the field of cancer classification in microarray gene expression data. These tasks are characterized by a large number of features and a few observations, making the modeling a non-trivial undertaking. In this work we apply entropic filter methods for gene selection, in combination with several off-the-shelf classifiers. The introduction of bootstrap resampling techniques permits the achiev...

  6. Identification of an archaeal mercury regulon by chromatin immunoprecipitation. (United States)

    Rudrappa, Deepak; Yao, Andrew I; White, Derrick; Pavlik, Benjamin J; Singh, Raghuveer; Facciotti, Marc T; Blum, Paul


    Mercury is a heavy metal and toxic to all forms of life. Metal exposure can invoke a response to improve survival. In archaea, several components of a mercury response system have been identified, but it is not known whether metal transport is a member of this system. To identify such missing components, a peptide-tagged MerR transcription factor was used to localize enriched chromosome regions by chromosome immunoprecipitation combined with DNA sequence analysis. Such regions could serve as secondary regulatory binding sites to control the expression of additional genes associated with mercury detoxification. Among the 31 highly enriched loci, a subset of five was pursued as potential candidates based on their current annotations. Quantitative reverse transcription-PCR analysis of these regions with and without mercury treatment in WT and mutant strains lacking merR indicated significant regulatory responses under these conditions. Of these, a Family 5 extracellular solute-binding protein and the MarR transcription factor shown previously to control responses to oxidation were most strongly affected. Inactivation of the solute-binding protein by gene disruption increased the resistance of mutant cells to mercury challenge. Inductively coupled plasma-MS analysis of the mutant cell line following metal challenge indicated there was less intracellular mercury compared with the isogenic WT strain. Together, these regulated genes comprise new members of the archaeal MerR regulon and reveal a cascade of transcriptional control not previously demonstrated in this model organism.

  7. Sequencing and Gene Expression Analysis of Leishmania tropica LACK Gene.

    Directory of Open Access Journals (Sweden)

    Nour Hammoudeh


    Full Text Available Leishmania Homologue of receptors for Activated C Kinase (LACK antigen is a 36-kDa protein, which provokes a very early immune response against Leishmania infection. There are several reports on the expression of LACK through different life-cycle stages of genus Leishmania, but only a few of them have focused on L.tropica.The present study provides details of the cloning, DNA sequencing and gene expression of LACK in this parasite species. First, several local isolates of Leishmania parasites were typed in our laboratory using PCR technique to verify of Leishmania parasite species. After that, LACK gene was amplified and cloned into a vector for sequencing. Finally, the expression of this molecule in logarithmic and stationary growth phase promastigotes, as well as in amastigotes, was evaluated by Reverse Transcription-PCR (RT-PCR technique.The typing result confirmed that all our local isolates belong to L.tropica. LACK gene sequence was determined and high similarity was observed with the sequences of other Leishmania species. Furthermore, the expression of LACK gene in both promastigotes and amastigotes forms was confirmed.Overall, the data set the stage for future studies of the properties and immune role of LACK gene products.

  8. Extracting expression modules from perturbational gene expression compendia

    Directory of Open Access Journals (Sweden)

    Van Dijck Patrick


    Full Text Available Abstract Background Compendia of gene expression profiles under chemical and genetic perturbations constitute an invaluable resource from a systems biology perspective. However, the perturbational nature of such data imposes specific challenges on the computational methods used to analyze them. In particular, traditional clustering algorithms have difficulties in handling one of the prominent features of perturbational compendia, namely partial coexpression relationships between genes. Biclustering methods on the other hand are specifically designed to capture such partial coexpression patterns, but they show a variety of other drawbacks. For instance, some biclustering methods are less suited to identify overlapping biclusters, while others generate highly redundant biclusters. Also, none of the existing biclustering tools takes advantage of the staple of perturbational expression data analysis: the identification of differentially expressed genes. Results We introduce a novel method, called ENIGMA, that addresses some of these issues. ENIGMA leverages differential expression analysis results to extract expression modules from perturbational gene expression data. The core parameters of the ENIGMA clustering procedure are automatically optimized to reduce the redundancy between modules. In contrast to the biclusters produced by most other methods, ENIGMA modules may show internal substructure, i.e. subsets of genes with distinct but significantly related expression patterns. The grouping of these (often functionally related patterns in one module greatly aids in the biological interpretation of the data. We show that ENIGMA outperforms other methods on artificial datasets, using a quality criterion that, unlike other criteria, can be used for algorithms that generate overlapping clusters and that can be modified to take redundancy between clusters into account. Finally, we apply ENIGMA to the Rosetta compendium of expression profiles for

  9. Gene expression profiling in sinonasal adenocarcinoma.


    Sébille-Rivain Véronique; Malard Olivier; Guisle-Marsollier Isabelle; Ferron Christophe; Renaudin Karine; Quéméner Sylvia; Tripodi Dominique; Verger Christian; Géraut Christian; Gratas-Rabbia-Ré Catherine


    Abstract Background Sinonasal adenocarcinomas are uncommon tumors which develop in the ethmoid sinus after exposure to wood dust. Although the etiology of these tumors is well defined, very little is known about their molecular basis and no diagnostic tool exists for their early detection in high-risk workers. Methods To identify genes involved in this disease, we performed gene expression profiling using cancer-dedicated microarrays, on nine matched samples of sinonasal adenocarcinomas and n...

  10. Visualizing Gene Expression In Situ

    Energy Technology Data Exchange (ETDEWEB)

    Burlage, R.S.


    Visualizing bacterial cells and describing their responses to the environment are difficult tasks. Their small size is the chief reason for the difficulty, which means that we must often use many millions of cells in a sample in order to determine what the average response of the bacteria is. However, an average response can sometimes mask important events in bacterial physiology, which means that our understanding of these organisms will suffer. We have used a variety of instruments to visualize bacterial cells, all of which tell us something different about the sample. We use a fluorescence activated cell sorter to sort cells based on the fluorescence provided by bioreporter genes, and these can be used to select for particular genetic mutations. Cells can be visualized by epifluorescent microscopy, and sensitive photodetectors can be added that allow us to find a single bacterial cell that is fluorescent or bioluminescent. We have also used standard photomultipliers to examine cell aggregates as field bioreporter microorganisms. Examples of each of these instruments show how our understanding of bacterial physiology has changed with the technology.

  11. Epigenetic control of antioxidant gene expression


    Wild, Brigitte


    Tesis doctoral inédita leída en la Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Biología Molecular. Fecha de lectura: 29-10-2015 To respond to exogenous and endogenous stimuli, organisms have developed a variety of mechanisms to modulate the quantity, duration and the type of response to these stimuli. Of these mechanisms, one of the most important is the regulation of gene expression. This regulation of gene expression occurs at various levels but especially by th...

  12. Optogenetics for gene expression in mammalian cells. (United States)

    Müller, Konrad; Naumann, Sebastian; Weber, Wilfried; Zurbriggen, Matias D


    Molecular switches that are controlled by chemicals have evolved as central research instruments in mammalian cell biology. However, these tools are limited in terms of their spatiotemporal resolution due to freely diffusing inducers. These limitations have recently been addressed by the development of optogenetic, genetically encoded, and light-responsive tools that can be controlled with the unprecedented spatiotemporal precision of light. In this article, we first provide a brief overview of currently available optogenetic tools that have been designed to control diverse cellular processes. Then, we focus on recent developments in light-controlled gene expression technologies and provide the reader with a guideline for choosing the most suitable gene expression system.

  13. Genes Expressed in Human Tumor Endothelium (United States)

    St. Croix, Brad; Rago, Carlo; Velculescu, Victor; Traverso, Giovanni; Romans, Katharine E.; Montgomery, Elizabeth; Lal, Anita; Riggins, Gregory J.; Lengauer, Christoph; Vogelstein, Bert; Kinzler, Kenneth W.


    To gain a molecular understanding of tumor angiogenesis, we compared gene expression patterns of endothelial cells derived from blood vessels of normal and malignant colorectal tissues. Of over 170 transcripts predominantly expressed in the endothelium, 79 were differentially expressed, including 46 that were specifically elevated in tumor-associated endothelium. Several of these genes encode extracellular matrix proteins, but most are of unknown function. Most of these tumor endothelial markers were expressed in a wide range of tumor types, as well as in normal vessels associated with wound healing and corpus luteum formation. These studies demonstrate that tumor and normal endothelium are distinct at the molecular level, a finding that may have significant implications for the development of anti-angiogenic therapies.

  14. Sequence and gene expression evolution of paralogous genes in willows. (United States)

    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  15. Shaping the Archaeal Cell Envelope

    NARCIS (Netherlands)

    Ellen, Albert F.; Zolghadr, Behnam; Driessen, Arnold M. J.; Albers, Sonja-Verena


    Although archaea have a similar cellular organization as other prokaryotes, the lipid composition of their membranes and their cell surface is unique. Here we discuss recent developments in our understanding of the archaeal protein secretion mechanisms, the assembly of macromolecular cell surface st

  16. Archaeal virus-host interactions

    NARCIS (Netherlands)

    Quax, T.E.F.


      The work presented in this thesis provides novel insights in several aspects of the molecular biology of archaea, bacteria and their viruses. Three fundamentally different groups of viruses are associated with the three domains of life. Archaeal viruses are characterized by a particularly

  17. Gene expression profiling of human erythroid progenitors by micro-serial analysis of gene expression. (United States)

    Fujishima, Naohito; Hirokawa, Makoto; Aiba, Namiko; Ichikawa, Yoshikazu; Fujishima, Masumi; Komatsuda, Atsushi; Suzuki, Yoshiko; Kawabata, Yoshinari; Miura, Ikuo; Sawada, Ken-ichi


    We compared the expression profiles of highly purified human CD34+ cells and erythroid progenitor cells by micro-serial analysis of gene expression (microSAGE). Human CD34+ cells were purified from granulocyte colony-stimulating factor-mobilized blood stem cells, and erythroid progenitors were obtained by cultivating these cells in the presence of stem cell factor, interleukin 3, and erythropoietin. Our 10,202 SAGE tags allowed us to identify 1354 different transcripts appearing more than once. Erythroid progenitor cells showed increased expression of LRBA, EEF1A1, HSPCA, PILRB, RANBP1, NACA, and SMURF. Overexpression of HSPCA was confirmed by real-time polymerase chain reaction analysis. MicroSAGE revealed an unexpected preferential expression of several genes in erythroid progenitor cells in addition to the known functional genes, including hemoglobins. Our results provide reference data for future studies of gene expression in various hematopoietic disorders, including myelodysplastic syndrome and leukemia.

  18. Global gene expression in Escherichia coli biofilms

    DEFF Research Database (Denmark)

    Schembri, Mark; Kjærgaard, K.; Klemm, Per


    to antimicrobial treatments and host immune defence responses. Escherichia coli has been used as a model organism to study the mechanisms of growth within adhered communities. In this study, we use DNA microarray technology to examine the global gene expression profile of E. coli during sessile growth compared...

  19. Population-level control of gene expression (United States)

    Nevozhay, Dmitry; Adams, Rhys; van Itallie, Elizabeth; Bennett, Matthew; Balazsi, Gabor


    Gene expression is the process that translates genetic information into proteins, that determine the way cells live, function and even die. It was demonstrated that cells with identical genomes exposed to the same environment can differ in their protein composition and therefore phenotypes. Protein levels can vary between cells due to the stochastic nature of intracellular biochemical events, indicating that the genotype-phenotype connection is not deterministic at the cellular level. We asked whether genomes could encode isogenic cell populations more reliably than single cells. To address this question, we built two gene circuits to control three cell population-level characteristics: gene expression mean, coefficient of variation and non-genetic memory of previous expression states. Indeed, we found that these population-level characteristics were more predictable than the gene expression of single cells in a well-controlled environment. This research was supported by the NIH Director's New Innovator Award 1DP2 OD006481-01 and Welch Foundation Grant C-1729.

  20. The Low Noise Limit in Gene Expression.

    Directory of Open Access Journals (Sweden)

    Roy D Dar

    Full Text Available Protein noise measurements are increasingly used to elucidate biophysical parameters. Unfortunately noise analyses are often at odds with directly measured parameters. Here we show that these inconsistencies arise from two problematic analytical choices: (i the assumption that protein translation rate is invariant for different proteins of different abundances, which has inadvertently led to (ii the assumption that a large constitutive extrinsic noise sets the low noise limit in gene expression. While growing evidence suggests that transcriptional bursting may set the low noise limit, variability in translational bursting has been largely ignored. We show that genome-wide systematic variation in translational efficiency can-and in the case of E. coli does-control the low noise limit in gene expression. Therefore constitutive extrinsic noise is small and only plays a role in the absence of a systematic variation in translational efficiency. These results show the existence of two distinct expression noise patterns: (1 a global noise floor uniformly imposed on all genes by expression bursting; and (2 high noise distributed to only a select group of genes.

  1. Gene expression analysis of zebrafish heart regeneration.

    Directory of Open Access Journals (Sweden)

    Ching-Ling Lien


    Full Text Available Mammalian hearts cannot regenerate. In contrast, zebrafish hearts regenerate even when up to 20% of the ventricle is amputated. The mechanism of zebrafish heart regeneration is not understood. To systematically characterize this process at the molecular level, we generated transcriptional profiles of zebrafish cardiac regeneration by microarray analyses. Distinct gene clusters were identified based on temporal expression patterns. Genes coding for wound response/inflammatory factors, secreted molecules, and matrix metalloproteinases are expressed in regenerating heart in sequential patterns. Comparisons of gene expression profiles between heart and fin regeneration revealed a set of regeneration core molecules as well as tissue-specific factors. The expression patterns of several secreted molecules around the wound suggest that they play important roles in heart regeneration. We found that both platelet-derived growth factor-a and -b (pdgf-a and pdgf-b are upregulated in regenerating zebrafish hearts. PDGF-B homodimers induce DNA synthesis in adult zebrafish cardiomyocytes. In addition, we demonstrate that a chemical inhibitor of PDGF receptor decreases DNA synthesis of cardiomyocytes both in vitro and in vivo during regeneration. Our data indicate that zebrafish heart regeneration is associated with sequentially upregulated wound healing genes and growth factors and suggest that PDGF signaling is required.

  2. Cluster Analysis of Gene Expression Data

    CERN Document Server

    Domany, E


    The expression levels of many thousands of genes can be measured simultaneously by DNA microarrays (chips). This novel experimental tool has revolutionized research in molecular biology and generated considerable excitement. A typical experiment uses a few tens of such chips, each dedicated to a single sample - such as tissue extracted from a particular tumor. The results of such an experiment contain several hundred thousand numbers, that come in the form of a table, of several thousand rows (one for each gene) and 50 - 100 columns (one for each sample). We developed a clustering methodology to mine such data. In this review I provide a very basic introduction to the subject, aimed at a physics audience with no prior knowledge of either gene expression or clustering methods. I explain what genes are, what is gene expression and how it is measured by DNA chips. Next I explain what is meant by "clustering" and how we analyze the massive amounts of data from such experiments, and present results obtained from a...

  3. Gene Expression Commons: an open platform for absolute gene expression profiling.

    Directory of Open Access Journals (Sweden)

    Jun Seita

    Full Text Available Gene expression profiling using microarrays has been limited to comparisons of gene expression between small numbers of samples within individual experiments. However, the unknown and variable sensitivities of each probeset have rendered the absolute expression of any given gene nearly impossible to estimate. We have overcome this limitation by using a very large number (>10,000 of varied microarray data as a common reference, so that statistical attributes of each probeset, such as the dynamic range and threshold between low and high expression, can be reliably discovered through meta-analysis. This strategy is implemented in a web-based platform named "Gene Expression Commons" ( which contains data of 39 distinct highly purified mouse hematopoietic stem/progenitor/differentiated cell populations covering almost the entire hematopoietic system. Since the Gene Expression Commons is designed as an open platform, investigators can explore the expression level of any gene, search by expression patterns of interest, submit their own microarray data, and design their own working models representing biological relationship among samples.

  4. Characterization of an archaeal two-component system that regulates methanogenesis in Methanosaeta harundinacea.

    Directory of Open Access Journals (Sweden)

    Jie Li

    Full Text Available Two-component signal transduction systems (TCSs are a major mechanism used by bacteria in response to environmental changes. Although many sequenced archaeal genomes encode TCSs, they remain poorly understood. Previously, we reported that a methanogenic archaeon, Methanosaeta harundinacea, encodes FilI, which synthesizes carboxyl-acyl homoserine lactones, to regulate transitions of cellular morphology and carbon metabolic fluxes. Here, we report that filI, the cotranscribed filR2, and the adjacent filR1 constitute an archaeal TCS. FilI possesses a cytoplasmic kinase domain (histidine kinase A and histidine kinase-like ATPase and its cognate response regulator. FilR1 carries a receiver (REC domain coupled with an ArsR-related domain with potential DNA-binding ability, while FilR2 carries only a REC domain. In a phosphorelay assay, FilI was autophosphorylated and specifically transferred the phosphoryl group to FilR1 and FilR2, confirming that the three formed a cognate TCS. Through chromatin immunoprecipitation-quantitative polymerase chain reaction (ChIP-qPCR using an anti-FilR1 antibody, FilR1 was shown to form in vivo associations with its own promoter and the promoter of the filI-filR2 operon, demonstrating a regulatory pattern common among TCSs. ChIP-qPCR also detected FilR1 associations with key genes involved in acetoclastic methanogenesis, acs4 and acs1. Electrophoretic mobility shift assays confirmed the in vitro tight binding of FilR1 to its own promoter and those of filI-filR2, acs4, and mtrABC. This also proves the DNA-binding ability of the ArsR-related domain, which is found primarily in Archaea. The archaeal promoters of acs4, filI, acs1, and mtrABC also initiated FilR1-modulated expression in an Escherichia coli lux reporter system, suggesting that FilR1 can up-regulate both archaeal and bacterial transcription. In conclusion, this work identifies an archaeal FilI/FilRs TCS that regulates the methanogenesis of M. harundinacea.

  5. Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data (United States)

    Moignard, Victoria; Göttgens, Berthold; Adryan, Boris


    Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete pipeline for the analysis of single cell qPCR data that uses the mathematics behind bursty expression to develop more accurate and robust algorithms for analyzing the origin of heterogeneity in experimental samples, specifically an algorithm for clustering cells by their bursting behavior (Simulated Annealing for Bursty Expression Clustering, SABEC) and a statistical tool for comparing the kinetic parameters of bursty expression across populations of cells (Estimation of Parameter changes in Kinetics, EPiK). We applied these methods to hematopoiesis, including a new single cell dataset in which transcription factors (TFs) involved in the earliest branchpoint of blood differentiation were individually up- and down-regulated. We could identify two unique sub-populations within a seemingly homogenous group of hematopoietic stem cells. In addition, we could predict regulatory mechanisms controlling the expression levels of eighteen key hematopoietic transcription factors throughout differentiation. Detailed information about gene regulatory mechanisms can therefore be obtained simply from high throughput single cell gene expression data, which should be widely applicable given the rapid expansion of single cell genomics. PMID:27551778

  6. Outlier Analysis for Gene Expression Data

    Institute of Scientific and Technical Information of China (English)

    Chao Yan; Guo-Liang Chen; Yi-Fei Shen


    The rapid developments of technologies that generate arrays of gene data enable a global view of the transcription levels of hundreds of thousands of genes simultaneously. The outlier detection problem for gene data has its importance but together with the difficulty of high dimensionality. The sparsity of data in high dimensional space makes each point a relatively good outlier in the view of traditional distance-based definitions. Thus, finding outliers in high dimensional data is more complex. In this paper, sme basic outlier analysis algorithms are discussed and a new genetic algorithm is presented. This algorithm is to find best dimension projections based on a revised cell-based algorithm and to give explanations to solutions. It can solve the outlier detection problem for gene expression data and for other high dimensional data as well.

  7. Coevolution of gene expression among interacting proteins

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, Hunter B.; Hirsh, Aaron E.; Wall, Dennis P.; Eisen,Michael B.


    Physically interacting proteins or parts of proteins are expected to evolve in a coordinated manner that preserves proper interactions. Such coevolution at the amino acid-sequence level is well documented and has been used to predict interacting proteins, domains, and amino acids. Interacting proteins are also often precisely coexpressed with one another, presumably to maintain proper stoichiometry among interacting components. Here, we show that the expression levels of physically interacting proteins coevolve. We estimate average expression levels of genes from four closely related fungi of the genus Saccharomyces using the codon adaptation index and show that expression levels of interacting proteins exhibit coordinated changes in these different species. We find that this coevolution of expression is a more powerful predictor of physical interaction than is coevolution of amino acid sequence. These results demonstrate previously uncharacterized coevolution of gene expression, adding a different dimension to the study of the coevolution of interacting proteins and underscoring the importance of maintaining coexpression of interacting proteins over evolutionary time. Our results also suggest that expression coevolution can be used for computational prediction of protein protein interactions.

  8. Gene expression profiling in sinonasal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Sébille-Rivain Véronique


    Full Text Available Abstract Background Sinonasal adenocarcinomas are uncommon tumors which develop in the ethmoid sinus after exposure to wood dust. Although the etiology of these tumors is well defined, very little is known about their molecular basis and no diagnostic tool exists for their early detection in high-risk workers. Methods To identify genes involved in this disease, we performed gene expression profiling using cancer-dedicated microarrays, on nine matched samples of sinonasal adenocarcinomas and non-tumor sinusal tissue. Microarray results were validated by quantitative RT-PCR and immunohistochemistry on two additional sets of tumors. Results Among the genes with significant differential expression we selected LGALS4, ACS5, CLU, SRI and CCT5 for further exploration. The overexpression of LGALS4, ACS5, SRI, CCT5 and the downregulation of CLU were confirmed by quantitative RT-PCR. Immunohistochemistry was performed for LGALS4 (Galectin 4, ACS5 (Acyl-CoA synthetase and CLU (Clusterin proteins: LGALS4 was highly up-regulated, particularly in the most differentiated tumors, while CLU was lost in all tumors. The expression of ACS5, was more heterogeneous and no correlation was observed with the tumor type. Conclusion Within our microarray study in sinonasal adenocarcinoma we identified two proteins, LGALS4 and CLU, that were significantly differentially expressed in tumors compared to normal tissue. A further evaluation on a new set of tissues, including precancerous stages and low grade tumors, is necessary to evaluate the possibility of using them as diagnostic markers.

  9. Gene expression profiles in skeletal muscle after gene electrotransfer

    Directory of Open Access Journals (Sweden)

    Eriksen Jens


    Full Text Available Abstract Background Gene transfer by electroporation (DNA electrotransfer to muscle results in high level long term transgenic expression, showing great promise for treatment of e.g. protein deficiency syndromes. However little is known about the effects of DNA electrotransfer on muscle fibres. We have therefore investigated transcriptional changes through gene expression profile analyses, morphological changes by histological analysis, and physiological changes by force generation measurements. DNA electrotransfer was obtained using a combination of a short high voltage pulse (HV, 1000 V/cm, 100 μs followed by a long low voltage pulse (LV, 100 V/cm, 400 ms; a pulse combination optimised for efficient and safe gene transfer. Muscles were transfected with green fluorescent protein (GFP and excised at 4 hours, 48 hours or 3 weeks after treatment. Results Differentially expressed genes were investigated by microarray analysis, and descriptive statistics were performed to evaluate the effects of 1 electroporation, 2 DNA injection, and 3 time after treatment. The biological significance of the results was assessed by gene annotation and supervised cluster analysis. Generally, electroporation caused down-regulation of structural proteins e.g. sarcospan and catalytic enzymes. Injection of DNA induced down-regulation of intracellular transport proteins e.g. sentrin. The effects on muscle fibres were transient as the expression profiles 3 weeks after treatment were closely related with the control muscles. Most interestingly, no changes in the expression of proteins involved in inflammatory responses or muscle regeneration was detected, indicating limited muscle damage and regeneration. Histological analysis revealed structural changes with loss of cell integrity and striation pattern in some fibres after DNA+HV+LV treatment, while HV+LV pulses alone showed preservation of cell integrity. No difference in the force generation capacity was observed in

  10. Connecting the dots: Linking nitrogen cycle gene expression to nitrogen fluxes in marine sediment mesocosms

    Directory of Open Access Journals (Sweden)

    Jennifer L. Bowen


    Full Text Available Connecting molecular information directly to microbial transformation rates remains a challenge, despite the availability of molecular methods to investigate microbial biogeochemistry. By combining information on gene abundance and expression for key genes with quantitative modeling of nitrogen fluxes, we can begin to understand the scales on which genetic signals vary and how they relate to key functions. We used quantitative PCR of DNA and cDNA, along with biogeochemical modeling to assess how the abundance and expression of microbes responsible for two steps in the nitrogen cycle changed over time in estuarine sediment mesocosms. Sediments and water were collected from coastal Massachusetts and maintained in replicated 20 L mesocosms for 45 days. Concentrations of all major inorganic nitrogen species were measured daily and used to derive rates of nitrification and denitrification from a Monte Carlo-based nonnegative least-squares analysis of finite difference equations. The mesocosms followed a classic regeneration sequence in which ammonium released from the decomposition of organic matter was subsequently oxidized to nitrite and then further to nitrate, some portion of which was ultimately denitrified. Normalized abundances of ammonia oxidizing archaeal ammonia monoxoygenase (amoA transcripts closely tracked rates of ammonia oxidation throughout the experiment. No such relationship, however, was evident between denitrification rates and the normalized abundance of nitrite reductase (nirS and nirK transcripts. These findings underscore the complexity of directly linking the structure of the microbial community to rates of biogeochemical processes.

  11. Gene expression profiles in skeletal muscle after gene electrotransfer

    DEFF Research Database (Denmark)

    Hojman, Pernille; Zibert, John R; Gissel, Hanne;


    BACKGROUND: Gene transfer by electroporation (DNA electrotransfer) to muscle results in high level long term transgenic expression, showing great promise for treatment of e.g. protein deficiency syndromes. However little is known about the effects of DNA electrotransfer on muscle fibres. We have...... investigated by microarray analysis, and descriptive statistics were performed to evaluate the effects of 1) electroporation, 2) DNA injection, and 3) time after treatment. The biological significance of the results was assessed by gene annotation and supervised cluster analysis.Generally, electroporation...

  12. A systematic screen for genes expressed in definitive endoderm by Serial Analysis of Gene Expression (SAGE

    Directory of Open Access Journals (Sweden)

    Jones Steven JM


    Full Text Available Abstract Background The embryonic definitive endoderm (DE gives rise to organs of the gastrointestinal and respiratory tract including the liver, pancreas and epithelia of the lung and colon. Understanding how DE progenitor cells generate these tissues is critical to understanding the cause of visceral organ disorders and cancers, and will ultimately lead to novel therapies including tissue and organ regeneration. However, investigation into the molecular mechanisms of DE differentiation has been hindered by the lack of early DE-specific markers. Results We describe the identification of novel as well as known genes that are expressed in DE using Serial Analysis of Gene Expression (SAGE. We generated and analyzed three longSAGE libraries from early DE of murine embryos: early whole definitive endoderm (0–6 somite stage, foregut (8–12 somite stage, and hindgut (8–12 somite stage. A list of candidate genes enriched for expression in endoderm was compiled through comparisons within these three endoderm libraries and against 133 mouse longSAGE libraries generated by the Mouse Atlas of Gene Expression Project encompassing multiple embryonic tissues and stages. Using whole mount in situ hybridization, we confirmed that 22/32 (69% genes showed previously uncharacterized expression in the DE. Importantly, two genes identified, Pyy and 5730521E12Rik, showed exclusive DE expression at early stages of endoderm patterning. Conclusion The high efficiency of this endoderm screen indicates that our approach can be successfully used to analyze and validate the vast amount of data obtained by the Mouse Atlas of Gene Expression Project. Importantly, these novel early endoderm-expressing genes will be valuable for further investigation into the molecular mechanisms that regulate endoderm development.

  13. FARO server: Meta-analysis of gene expression by matching gene expression signatures to a compendium of public gene expression data

    DEFF Research Database (Denmark)

    Manijak, Mieszko P.; Nielsen, Henrik Bjørn


    circumvented by instead matching gene expression signatures to signatures of other experiments. FINDINGS: To facilitate this we present the Functional Association Response by Overlap (FARO) server, that match input signatures to a compendium of 242 gene expression signatures, extracted from more than 1700......BACKGROUND: Although, systematic analysis of gene annotation is a powerful tool for interpreting gene expression data, it sometimes is blurred by incomplete gene annotation, missing expression response of key genes and secondary gene expression responses. These shortcomings may be partially...... Arabidopsis microarray experiments. CONCLUSIONS: Hereby we present a publicly available tool for robust characterization of Arabidopsis gene expression experiments which can point to similar experimental factors in other experiments. The server is available at

  14. Gene expression in Pseudomonas aeruginosa swarming motility

    Directory of Open Access Journals (Sweden)

    Déziel Eric


    Full Text Available Abstract Background The bacterium Pseudomonas aeruginosa is capable of three types of motilities: swimming, twitching and swarming. The latter is characterized by a fast and coordinated group movement over a semi-solid surface resulting from intercellular interactions and morphological differentiation. A striking feature of swarming motility is the complex fractal-like patterns displayed by migrating bacteria while they move away from their inoculation point. This type of group behaviour is still poorly understood and its characterization provides important information on bacterial structured communities such as biofilms. Using GeneChip® Affymetrix microarrays, we obtained the transcriptomic profiles of both bacterial populations located at the tip of migrating tendrils and swarm center of swarming colonies and compared these profiles to that of a bacterial control population grown on the same media but solidified to not allow swarming motility. Results Microarray raw data were corrected for background noise with the RMA algorithm and quantile normalized. Differentially expressed genes between the three conditions were selected using a threshold of 1.5 log2-fold, which gave a total of 378 selected genes (6.3% of the predicted open reading frames of strain PA14. Major shifts in gene expression patterns are observed in each growth conditions, highlighting the presence of distinct bacterial subpopulations within a swarming colony (tendril tips vs. swarm center. Unexpectedly, microarrays expression data reveal that a minority of genes are up-regulated in tendril tip populations. Among them, we found energy metabolism, ribosomal protein and transport of small molecules related genes. On the other hand, many well-known virulence factors genes were globally repressed in tendril tip cells. Swarm center cells are distinct and appear to be under oxidative and copper stress responses. Conclusions Results reported in this study show that, as opposed to

  15. Annotation of gene function in citrus using gene expression information and co-expression networks


    Wong, Darren CJ; Sweetman, Crystal; Ford, Christopher M


    Background The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world’s most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a “guilt-by-association” principle whereby genes encoding proteins involved in similar and/or related bi...

  16. Differential expression of cell adhesion genes

    DEFF Research Database (Denmark)

    Stein, Wilfred D; Litman, Thomas; Fojo, Tito;


    It is well known that tumors arising from tissues such as kidney, pancreas, liver and stomach are particularly refractory to treatment. Searching for new anticancer drugs using cells in culture has yielded some effective therapies, but these refractory tumors remain intractable. Studies that comp......It is well known that tumors arising from tissues such as kidney, pancreas, liver and stomach are particularly refractory to treatment. Searching for new anticancer drugs using cells in culture has yielded some effective therapies, but these refractory tumors remain intractable. Studies...... survival might, therefore, act through such a matrix-to-cell suppression of apoptosis. Indeed, correlative mining of gene expression and patient survival databases suggests that poor survival in patients with metastatic cancer correlates highly with tumor expression of a common theme: the genes involved...

  17. Identifying Driver Genes in Cancer by Triangulating Gene Expression, Gene Location, and Survival Data (United States)

    Rouam, Sigrid; Miller, Lance D; Karuturi, R Krishna Murthy


    Driver genes are directly responsible for oncogenesis and identifying them is essential in order to fully understand the mechanisms of cancer. However, it is difficult to delineate them from the larger pool of genes that are deregulated in cancer (ie, passenger genes). In order to address this problem, we developed an approach called TRIAngulating Gene Expression (TRIAGE through clinico-genomic intersects). Here, we present a refinement of this approach incorporating a new scoring methodology to identify putative driver genes that are deregulated in cancer. TRIAGE triangulates – or integrates – three levels of information: gene expression, gene location, and patient survival. First, TRIAGE identifies regions of deregulated expression (ie, expression footprints) by deriving a newly established measure called the Local Singular Value Decomposition (LSVD) score for each locus. Driver genes are then distinguished from passenger genes using dual survival analyses. Incorporating measurements of gene expression and weighting them according to the LSVD weight of each tumor, these analyses are performed using the genes located in significant expression footprints. Here, we first use simulated data to characterize the newly established LSVD score. We then present the results of our application of this refined version of TRIAGE to gene expression data from five cancer types. This refined version of TRIAGE not only allowed us to identify known prominent driver genes, such as MMP1, IL8, and COL1A2, but it also led us to identify several novel ones. These results illustrate that TRIAGE complements existing tools, allows for the identification of genes that drive cancer and could perhaps elucidate potential future targets of novel anticancer therapeutics. PMID:25949096

  18. Regulation of Gene Expression in Protozoa Parasites


    Consuelo Gomez; Esther Ramirez, M.; Mercedes Calixto-Galvez; Olivia Medel; Rodríguez, Mario A


    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or dru...

  19. Gene expression profiling: methods and protocols


    Manuela Monti


    There must be some good reasons to last for a second edition on the very same topic: likely, the topic is crucial to basic and applied science, it is a very rapid evolving topic and there must occurred some breakthroughs meanwhile the two editions. Well, I think that all of these reasons are here to justify this very wellcome second edition of “Gene expression profiling”, a topic that is crucial....

  20. Proteomic and gene expression patterns of keratoconus

    Directory of Open Access Journals (Sweden)

    Arkasubhra Ghosh


    Full Text Available Keratoconus is a progressive corneal thinning disease associated with significant tissue remodeling activities and activation of a variety of signaling networks. However, it is not understood how differential gene and protein expression direct function in keratoconus corneas to drive the underlying pathology, ectasia. Research in the field has focused on discovering differentially expressed genes and proteins and quantifying their levels and activities in keratoconus patient samples. In this study, both microarray analysis of total ribonucleic acid (RNA and whole proteome analyses are carried out using corneal epithelium and tears from keratoconus patients and compared to healthy controls. A number of structural proteins, signaling molecules, cytokines, proteases, and enzymes have been found to be deregulated in keratoconus corneas. Together, the data provide clues to the complex process of corneal degradation which suggest novel ways to clinically diagnose and manage the disease. This review will focus on discussing these recent advances in the knowledge of keratoconus biology from a gene expression and function point-of-view.

  1. Carbon Nanomaterials Alter Global Gene Expression Profiles. (United States)

    Woodman, Sara; Short, John C W; McDermott, Hyoeun; Linan, Alexander; Bartlett, Katelyn; Gadila, Shiva Kumar Goud; Schmelzle, Katie; Wanekaya, Adam; Kim, Kyoungtae


    Carbon nanomaterials (CNMs), which include carbon nanotubes (CNTs) and their derivatives, have diverse technological and biomedical applications. The potential toxicity of CNMs to cells and tissues has become an important emerging question in nanotechnology. To assess the toxicity of CNTs and fullerenol C60(OH)24, we in the present work used the budding yeast Saccharomyces cerevisiae, one of the simplest eukaryotic organisms that share fundamental aspects of eukaryotic cell biology. We found that treatment with CNMs, regardless of their physical shape, negatively affected the growth rates, end-point cell densities and doubling times of CNM-exposed yeast cells when compared to unexposed cells. To investigate potential mechanisms behind the CNMs-induced growth defects, we performed RNA-Seq dependent transcriptional analysis and constructed global gene expression profiles of fullerenol C60(OH)24- and CNT-treated cells. When compared to non-treated control cells, CNM-treated cells displayed differential expression of genes whose functions are implicated in membrane transporters and stress response, although differentially expressed genes were not consistent between CNT- and fullerenol C60(OH)24-treated groups, leading to our conclusion that CNMs could serve as environmental toxic factors to eukaryotic cells. PMID:27483901

  2. Analysis of gene expression in rabbit muscle

    Directory of Open Access Journals (Sweden)

    Alena Gálová


    Full Text Available Increasing consumer knowledge of the link between diet and health has raised the demand for high quality food. Meat and meat products may be considered as irreplaceable in human nutrition. Breeding livestock to higher content of lean meat and the use of modern hybrids entails problems with the quality of meat. Analysing of livestock genomes could get us a great deal of important information, which may significantly affect the improvement process. Domestic animals are invaluable resources for study of the molecular architecture of complex traits. Although the mapping of quantitative trait loci (QTL responsible for economically important traits in domestic animals has achieved remarkable results in recent decades, not all of the genetic variation in the complex traits has been captured because of the low density of markers used in QTL mapping studies. The genome wide association study (GWAS, which utilizes high-density single-nucleotide polymorphism (SNP, provides a new way to tackle this issue. New technologies now allow producing microarrays containing thousands of hybridization probes on a single membrane or other solid support. We used microarray analysis to study gene expression in rabbit muscle during different developmental age stages. The outputs from GeneSpring GX sotware are presented in this work. After the evaluation of gene expression in rabbits, will be selected genes of interest in relation to meat quality parameters and will be further analyzed by the available methods of molecular biology and genetics.

  3. Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Salem, Tamer Z. [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, Giza 12619 (Egypt); Division of Biomedical Sciences, Zewail University, Zewail City of Science and Technology, Giza 12588 (Egypt); Zhang, Fengrui [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Thiem, Suzanne M., E-mail: [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824 (United States)


    Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

  4. Response of Archaeal Communities in Beach Sediments to Spilled Oil and Bioremediation


    Röling, Wilfred F. M.; Couto de Brito, Ivana R.; Swannell, Richard P. J.; Head, Ian M.


    While the contribution of Bacteria to bioremediation of oil-contaminated shorelines is well established, the response of Archaea to spilled oil and bioremediation treatments is unknown. The relationship between archaeal community structure and oil spill bioremediation was examined in laboratory microcosms and in a bioremediation field trial. 16S rRNA gene-based PCR and denaturing gradient gel analysis revealed that the archaeal community in oil-free laboratory microcosms was stable for 26 day...

  5. The transcriptional regulation of regucalcin gene expression. (United States)

    Yamaguchi, Masayoshi


    Regucalcin, which is discovered as a calcium-binding protein in 1978, has been shown to play a multifunctional role in many tissues and cell types; regucalcin has been proposed to play a pivotal role in keeping cell homeostasis and function for cell response. Regucalcin and its gene are identified in over 15 species consisting of regucalcin family. Comparison of the nucleotide sequences of regucalcin from vertebrate species is highly conserved in their coding region with throughout evolution. The regucalcin gene is localized on the chromosome X in rat and human. The organization of rat regucalcin gene consists of seven exons and six introns and several consensus regulatory elements exist upstream of the 5'-flanking region. AP-1, NF1-A1, RGPR-p117, β-catenin, and other factors have been found to be a transcription factor in the enhancement of regucalcin gene promoter activity. The transcription activity of regucalcin gene is enhanced through intracellular signaling factors that are mediated through the phosphorylation and dephosphorylation of nuclear protein in vitro. Regucalcin mRNA and its protein are markedly expressed in the liver and kidney cortex of rats. The expression of regucalcin mRNA in the liver and kidney cortex has been shown to stimulate by hormonal factors (including calcium, calcitonin, parathyroid hormone, insulin, estrogen, and dexamethasone) in vivo. Regucalcin mRNA expression is enhanced in the regenerating liver after partial hepatectomy of rats in vivo. The expression of regucalcin mRNA in the liver and kidney with pathophysiological state has been shown to suppress, suggesting an involvement of regucalcin in disease. Liver regucalcin expression is down-regulated in tumor cells, suggesting a suppressive role in the development of carcinogenesis. Liver regucalcin is markedly released into the serum of rats with chemically induced liver injury in vivo. Serum regucalcin has a potential sensitivity as a specific biochemical marker of chronic

  6. Cholinergic regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan


    Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

  7. The similarity of gene expression between human and mouse tissues


    Dowell, Robin D.


    Meta-analysis of human and mouse microarray data reveals conservation of patterns of gene expression that will help to better characterize the evolution of gene expression. See research article:

  8. Identification of common prognostic gene expression signatures with biological meanings from microarray gene expression datasets.

    Directory of Open Access Journals (Sweden)

    Jun Yao

    Full Text Available Numerous prognostic gene expression signatures for breast cancer were generated previously with few overlap and limited insight into the biology of the disease. Here we introduce a novel algorithm named SCoR (Survival analysis using Cox proportional hazard regression and Random resampling to apply random resampling and clustering methods in identifying gene features correlated with time to event data. This is shown to reduce overfitting noises involved in microarray data analysis and discover functional gene sets linked to patient survival. SCoR independently identified a common poor prognostic signature composed of cell proliferation genes from six out of eight breast cancer datasets. Furthermore, a sequential SCoR analysis on highly proliferative breast cancers repeatedly identified T/B cell markers as favorable prognosis factors. In glioblastoma, SCoR identified a common good prognostic signature of chromosome 10 genes from two gene expression datasets (TCGA and REMBRANDT, recapitulating the fact that loss of one copy of chromosome 10 (which harbors the tumor suppressor PTEN is linked to poor survival in glioblastoma patients. SCoR also identified prognostic genes on sex chromosomes in lung adenocarcinomas, suggesting patient gender might be used to predict outcome in this disease. These results demonstrate the power of SCoR to identify common and biologically meaningful prognostic gene expression signatures.

  9. Identification of common prognostic gene expression signatures with biological meanings from microarray gene expression datasets. (United States)

    Yao, Jun; Zhao, Qi; Yuan, Ying; Zhang, Li; Liu, Xiaoming; Yung, W K Alfred; Weinstein, John N


    Numerous prognostic gene expression signatures for breast cancer were generated previously with few overlap and limited insight into the biology of the disease. Here we introduce a novel algorithm named SCoR (Survival analysis using Cox proportional hazard regression and Random resampling) to apply random resampling and clustering methods in identifying gene features correlated with time to event data. This is shown to reduce overfitting noises involved in microarray data analysis and discover functional gene sets linked to patient survival. SCoR independently identified a common poor prognostic signature composed of cell proliferation genes from six out of eight breast cancer datasets. Furthermore, a sequential SCoR analysis on highly proliferative breast cancers repeatedly identified T/B cell markers as favorable prognosis factors. In glioblastoma, SCoR identified a common good prognostic signature of chromosome 10 genes from two gene expression datasets (TCGA and REMBRANDT), recapitulating the fact that loss of one copy of chromosome 10 (which harbors the tumor suppressor PTEN) is linked to poor survival in glioblastoma patients. SCoR also identified prognostic genes on sex chromosomes in lung adenocarcinomas, suggesting patient gender might be used to predict outcome in this disease. These results demonstrate the power of SCoR to identify common and biologically meaningful prognostic gene expression signatures.

  10. Gene expression regulators--MicroRNAs

    Institute of Scientific and Technical Information of China (English)

    CHEN Fang; YIN Q. James


    A large class of non-coding RNAs found in small molecule RNAs are closely associated with the regulation of gene expression, which are called microRNA (miRNA). MiRNAs are coded in intergenic or intronic regions and can be formed into foldback hairpin RNAs. These transcripts are cleaved by Dicer, generating mature miRNAs that can silence their target genes in different modes of action. Now, research on small molecule RNAs has gotten breakthrough advance in biology. To discover miRNA genes and their target genes has become hot topics in RNA research. This review attempts to look back the history of miRNA discovery, to introduce the methods of screening miRNAs, to localize miRNA loci in genome, to seek miRNA target genes and the biological function, and to discuss the working mechanisms of miRNAs. Finally, we will discuss the potential important roles of miRNAs in modulating the genesis, development, growth, and differentiation of organisms. Thus, it can be predicted that a complete understanding of miRNA functions will bring us some new concepts, approaches and strategies for the study of living beings.

  11. Gene Expression Profiling of Xeroderma Pigmentosum

    Directory of Open Access Journals (Sweden)

    Bowden Nikola A


    Full Text Available Abstract Xeroderma pigmentosum (XP is a rare recessive disorder that is characterized by extreme sensitivity to UV light. UV light exposure results in the formation of DNA damage such as cyclobutane dimers and (6-4 photoproducts. Nucleotide excision repair (NER orchestrates the removal of cyclobutane dimers and (6-4 photoproducts as well as some forms of bulky chemical DNA adducts. The disease XP is comprised of 7 complementation groups (XP-A to XP-G, which represent functional deficiencies in seven different genes, all of which are believed to be involved in NER. The main clinical feature of XP is various forms of skin cancers; however, neurological degeneration is present in XPA, XPB, XPD and XPG complementation groups. The relationship between NER and other types of DNA repair processes is now becoming evident but the exact relationships between the different complementation groups remains to be precisely determined. Using gene expression analysis we have identified similarities and differences after UV light exposure between the complementation groups XP-A, XP-C, XP-D, XP-E, XP-F, XP-G and an unaffected control. The results reveal that there is a graded change in gene expression patterns between the mildest, most similar to the control response (XP-E and the severest form (XP-A of the disease, with the exception of XP-D. Distinct differences between the complementation groups with neurological symptoms (XP-A, XP-D and XP-G and without (XP-C, XP-E and XP-F were also identified. Therefore, this analysis has revealed distinct gene expression profiles for the XP complementation groups and the first step towards understanding the neurological symptoms of XP.

  12. An anatomic gene expression atlas of the adult mouse brain


    Ng, Lydia; Bernard, Amy; Lau, Chris; Overly, Caroline C.; Dong, Hong-Wei; Kuan, Chihchau; Pathak, Sayan; Sunkin, Susan M.; Dang, Chinh; Bohland, Jason W.; Bokil, Hemant; Mitra, Partha P.; Puelles, Luis; Hohmann, John; Anderson, David J.


    Studying gene expression provides a powerful means of understanding structure-function relationships in the nervous system. The availability of genome-scale in situ hybridization datasets enables new possibilities for understanding brain organization based on gene expression patterns. The Anatomic Gene Expression Atlas (AGEA) is a new relational atlas revealing the genetic architecture of the adult C57Bl/6J mouse brain based on spatial correlations across expression data for thousands of gene...

  13. Prediction of novel archaeal enzymes from sequence-derived features

    DEFF Research Database (Denmark)

    Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren


    The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......:// The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....

  14. Response of Archaeal and Bacterial Soil Communities to Changes Associated with Outdoor Cattle Overwintering.

    Directory of Open Access Journals (Sweden)

    Alica Chroňáková

    Full Text Available Archaea and bacteria are important drivers for nutrient transformations in soils and catalyse the production and consumption of important greenhouse gases. In this study, we investigate changes in archaeal and bacterial communities of four Czech grassland soils affected by outdoor cattle husbandry. Two show short-term (3 years; STI and long-term impact (17 years; LTI, one is regenerating from cattle impact (REG and a control is unaffected by cattle (CON. Cattle manure (CMN, the source of allochthonous microbes, was collected from the same area. We used pyrosequencing of 16S rRNA genes to assess the composition of archaeal and bacterial communities in each soil type and CMN. Both short- and long- term cattle impact negatively altered archaeal and bacterial diversity, leading to increase of homogenization of microbial communities in overwintering soils over time. Moreover, strong shifts in the prokaryotic communities were observed in response to cattle overwintering, with the greatest impact on archaea. Oligotrophic and acidophilic microorganisms (e.g. Thaumarchaeota, Acidobacteria, and α-Proteobacteria dominated in CON and expressed strong negative response to increased pH, total C and N. Whereas copiotrophic and alkalophilic microbes (e.g. methanogenic Euryarchaeota, Firmicutes, Chloroflexi, Actinobacteria, and Bacteroidetes were common in LTI showing opposite trends. Crenarchaeota were also found in LTI, though their trophic interactions remain cryptic. Firmicutes, Bacteroidetes, Methanobacteriaceae, and Methanomicrobiaceae indicated the introduction and establishment of faecal microbes into the impacted soils, while Chloroflexi and Methanosarcinaceae suggested increased abundance of soil-borne microbes under altered environmental conditions. The observed changes in prokaryotic community composition may have driven corresponding changes in soil functioning.

  15. Studying the Complex Expression Dependences between Sets of Coexpressed Genes

    Directory of Open Access Journals (Sweden)

    Mario Huerta


    Full Text Available Organisms simplify the orchestration of gene expression by coregulating genes whose products function together in the cell. The use of clustering methods to obtain sets of coexpressed genes from expression arrays is very common; nevertheless there are no appropriate tools to study the expression networks among these sets of coexpressed genes. The aim of the developed tools is to allow studying the complex expression dependences that exist between sets of coexpressed genes. For this purpose, we start detecting the nonlinear expression relationships between pairs of genes, plus the coexpressed genes. Next, we form networks among sets of coexpressed genes that maintain nonlinear expression dependences between all of them. The expression relationship between the sets of coexpressed genes is defined by the expression relationship between the skeletons of these sets, where this skeleton represents the coexpressed genes with a well-defined nonlinear expression relationship with the skeleton of the other sets. As a result, we can study the nonlinear expression relationships between a target gene and other sets of coexpressed genes, or start the study from the skeleton of the sets, to study the complex relationships of activation and deactivation between the sets of coexpressed genes that carry out the different cellular processes present in the expression experiments.

  16. Modelling the evolution of the archaeal tryptophan synthase

    Directory of Open Access Journals (Sweden)

    Merkl Rainer


    Full Text Available Abstract Background Microorganisms and plants are able to produce tryptophan. Enzymes catalysing the last seven steps of tryptophan biosynthesis are encoded in the canonical trp operon. Among the trp genes are most frequently trpA and trpB, which code for the alpha and beta subunit of tryptophan synthase. In several prokaryotic genomes, two variants of trpB (named trpB1 or trpB2 occur in different combinations. The evolutionary history of these trpB genes is under debate. Results In order to study the evolution of trp genes, completely sequenced archaeal and bacterial genomes containing trpB were analysed. Phylogenetic trees indicated that TrpB sequences constitute four distinct groups; their composition is in agreement with the location of respective genes. The first group consisted exclusively of trpB1 genes most of which belonged to trp operons. Groups two to four contained trpB2 genes. The largest group (trpB2_o contained trpB2 genes all located outside of operons. Most of these genes originated from species possessing an operon-based trpB1 in addition. Groups three and four pertain to trpB2 genes of those genomes containing exclusively one or two trpB2 genes, but no trpB1. One group (trpB2_i consisted of trpB2 genes located inside, the other (trpB2_a of trpB2 genes located outside the trp operon. TrpA and TrpB form a heterodimer and cooperate biochemically. In order to characterise trpB variants and stages of TrpA/TrpB cooperation in silico, several approaches were combined. Phylogenetic trees were constructed for all trp genes; their structure was assessed via bootstrapping. Alternative models of trpB evolution were evaluated with parsimony arguments. The four groups of trpB variants were correlated with archaeal speciation. Several stages of TrpA/TrpB cooperation were identified and trpB variants were characterised. Most plausibly, trpB2 represents the predecessor of the modern trpB gene, and trpB1 evolved in an ancestral bacterium

  17. Gene expression in developing watermelon fruit

    Directory of Open Access Journals (Sweden)

    Hernandez Alvaro


    Full Text Available Abstract Background Cultivated watermelon form large fruits that are highly variable in size, shape, color, and content, yet have extremely narrow genetic diversity. Whereas a plethora of genes involved in cell wall metabolism, ethylene biosynthesis, fruit softening, and secondary metabolism during fruit development and ripening have been identified in other plant species, little is known of the genes involved in these processes in watermelon. A microarray and quantitative Real-Time PCR-based study was conducted in watermelon [Citrullus lanatus (Thunb. Matsum. & Nakai var. lanatus] in order to elucidate the flow of events associated with fruit development and ripening in this species. RNA from three different maturation stages of watermelon fruits, as well as leaf, were collected from field grown plants during three consecutive years, and analyzed for gene expression using high-density photolithography microarrays and quantitative PCR. Results High-density photolithography arrays, composed of probes of 832 EST-unigenes from a subtracted, fruit development, cDNA library of watermelon were utilized to examine gene expression at three distinct time-points in watermelon fruit development. Analysis was performed with field-grown fruits over three consecutive growing seasons. Microarray analysis identified three hundred and thirty-five unique ESTs that are differentially regulated by at least two-fold in watermelon fruits during the early, ripening, or mature stage when compared to leaf. Of the 335 ESTs identified, 211 share significant homology with known gene products and 96 had no significant matches with any database accession. Of the modulated watermelon ESTs related to annotated genes, a significant number were found to be associated with or involved in the vascular system, carotenoid biosynthesis, transcriptional regulation, pathogen and stress response, and ethylene biosynthesis. Ethylene bioassays, performed with a closely related watermelon

  18. Gene Expression Profile Changes in Germinating Rice

    Institute of Scientific and Technical Information of China (English)

    Dongli He; Chao Han; Pingfang Yang


    Water absorption is a prerequisite for seed germination.During imbibition,water influx causes the resumption of many physiological and metabolic processes in growing seed.In order to obtain more complete knowledge about the mechanism of seed germination,two-dimensional gel electrophoresis was applied to investigate the protein profile changes of rice seed during the first 48 h of imbibition.Thirtynine differentially expressed proteins were identified,including 19 down-regulated and 20 up-regulated proteins.Storage proteins and some seed development- and desiccation-associated proteins were down regulated.The changed patterns of these proteins indicated extensive mobilization of seed reserves.By contrast,catabolism-associated proteins were up regulated upon imbibition.Semi-quantitative real time polymerase chain reaction analysis showed that most of the genes encoding the down- or upregulated proteins were also down or up regulated at mRNA level.The expression of these genes was largely consistent at mRNA and protein levels.In providing additional information concerning gene regulation in early plant life,this study will facilitate understanding of the molecular mechanisms of seed germination.

  19. Nuclear AXIN2 represses MYC gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S., E-mail:


    Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling.

  20. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.


    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  1. Performance Analysis of Enhanced Clustering Algorithm for Gene Expression Data

    CERN Document Server

    Chandrasekhar, T; Elayaraja, E


    Microarrays are made it possible to simultaneously monitor the expression profiles of thousands of genes under various experimental conditions. It is used to identify the co-expressed genes in specific cells or tissues that are actively used to make proteins. This method is used to analysis the gene expression, an important task in bioinformatics research. Cluster analysis of gene expression data has proved to be a useful tool for identifying co-expressed genes, biologically relevant groupings of genes and samples. In this paper we applied K-Means with Automatic Generations of Merge Factor for ISODATA- AGMFI. Though AGMFI has been applied for clustering of Gene Expression Data, this proposed Enhanced Automatic Generations of Merge Factor for ISODATA- EAGMFI Algorithms overcome the drawbacks of AGMFI in terms of specifying the optimal number of clusters and initialization of good cluster centroids. Experimental results on Gene Expression Data show that the proposed EAGMFI algorithms could identify compact clus...

  2. Novel redox nanomedicine improves gene expression of polyion complex vector


    Kazuko Toh, Toru Yoshitomi, Yutaka Ikeda and Yukio Nagasaki


    Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS) affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP) as an RO...

  3. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko


    Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression

  4. Gene expression profiling of cutaneous wound healing

    Directory of Open Access Journals (Sweden)

    Wang Ena


    Full Text Available Abstract Background Although the sequence of events leading to wound repair has been described at the cellular and, to a limited extent, at the protein level this process has yet to be fully elucidated. Genome wide transcriptional analysis tools promise to further define the global picture of this complex progression of events. Study Design This study was part of a placebo-controlled double-blind clinical trial in which basal cell carcinomas were treated topically with an immunomodifier – toll-like receptor 7 agonist: imiquimod. The fourteen patients with basal cell carcinoma in the placebo arm of the trial received placebo treatment consisting solely of vehicle cream. A skin punch biopsy was obtained immediately before treatment and at the end of the placebo treatment (after 2, 4 or 8 days. 17.5K cDNA microarrays were utilized to profile the biopsy material. Results Four gene signatures whose expression changed relative to baseline (before wound induction by the pre-treatment biopsy were identified. The largest group was comprised predominantly of inflammatory genes whose expression was increased throughout the study. Two additional signatures were observed which included preferentially pro-inflammatory genes in the early post-treatment biopsies (2 days after pre-treatment biopsies and repair and angiogenesis genes in the later (4 to 8 days biopsies. The fourth and smallest set of genes was down-regulated throughout the study. Early in wound healing the expression of markers of both M1 and M2 macrophages were increased, but later M2 markers predominated. Conclusion The initial response to a cutaneous wound induces powerful transcriptional activation of pro-inflammatory stimuli which may alert the host defense. Subsequently and in the absence of infection, inflammation subsides and it is replaced by angiogenesis and remodeling. Understanding this transition which may be driven by a change from a mixed macrophage population to predominately M2

  5. Network Completion for Static Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Natsu Nakajima


    Full Text Available We tackle the problem of completing and inferring genetic networks under stationary conditions from static data, where network completion is to make the minimum amount of modifications to an initial network so that the completed network is most consistent with the expression data in which addition of edges and deletion of edges are basic modification operations. For this problem, we present a new method for network completion using dynamic programming and least-squares fitting. This method can find an optimal solution in polynomial time if the maximum indegree of the network is bounded by a constant. We evaluate the effectiveness of our method through computational experiments using synthetic data. Furthermore, we demonstrate that our proposed method can distinguish the differences between two types of genetic networks under stationary conditions from lung cancer and normal gene expression data.

  6. Differentially expressed genes in pancreatic ductal adenocarcinomas identified through serial analysis of gene expression

    DEFF Research Database (Denmark)

    Hustinx, Steven R; Cao, Dengfeng; Maitra, Anirban;


    Serial analysis of gene expression (SAGE) is a powerful tool for the discovery of novel tumor markers. The publicly available online SAGE libraries of normal and neoplastic tissues ( have recently been expanded; in addition, a more complete annotation of the human...... of this program. Novel differentially expressed genes in a cancer type can be identified by revisiting updated and expanded SAGE databases. TAGmapper should prove to be a powerful tool for the discovery of novel tumor markers through assignment of uncharacterized SAGE tags....

  7. Mining Association Rules among Gene Functions in Clusters of Similar Gene Expression Maps


    An, Li; Obradovic, Zoran; Smith, Desmond; Bodenreider, Olivier; Megalooikonomou, Vasileios


    Association rules mining methods have been recently applied to gene expression data analysis to reveal relationships between genes and different conditions and features. However, not much effort has focused on detecting the relation between gene expression maps and related gene functions. Here we describe such an approach to mine association rules among gene functions in clusters of similar gene expression maps on mouse brain. The experimental results show that the detected association rules ...

  8. Ascorbic Acid and Gene Expression: Another Example of Regulation of Gene Expression by Small Molecules?


    Belin, Sophie; Kaya, Ferdinand; Burtey, Stéphane; Fontes, Michel


    Ascorbic acid (vitamin C, AA) has long been considered a food supplement necessary for life and for preventing scurvy. However, it has been reported that other small molecules such as retinoic acid (vitamin A) and different forms of calciferol (vitamin D) are directly involved in regulating the expression of numerous genes. These molecules bind to receptors that are differentially expressed in the embryo and are therefore crucial signalling molecules in vertebrate development. The question is...

  9. Detection of gene expression pattern in the early stage after spinal cord injury by gene chip

    Institute of Scientific and Technical Information of China (English)

    刘成龙; 靳安民; 童斌辉


    Objective: To study the changes of the gene expression pattern of spinal cord tissues in the early stage after injury by DNA microarray (gene chip). Methods: The contusion model of rat spinal cord was established according to Allen's falling strike method and the gene expression patterns of normal and injured spinal cord tissues were studied by gene chip. Results: The expression of 45 genes was significantly changed in the early stage after spinal cord injury, in which 22 genes up-regulated and 23 genes down-regulated. Conclusions: The expression of some genes changes significantly in the early stage after spinal cord injury, which indicates the complexity of secondary spinal cord injury.

  10. MDR1 gene expression in primary colorectal carcinomas.


    Pirker, R; Wallner, J.; Gsur, A; Götzl, M.; Zöchbauer, S; Scheithauer, W.; Depisch, D


    The expression of the MDR1 gene, a multidrug resistance gene, was prospectively determined in 113 primary colorectal carcinoma specimens and correlated with clinical data including survival durations of the patients. MDR1 RNA was detected in 65% of the carcinomas. No expression of the MDR2 gene was seen, MDR1 gene expression was independent of age and sex of the patients, size and histologic grading of the tumour, lymph node involvement and distant metastasis. Kaplan-Meier analysis revealed t...

  11. Prognostic Gene Expression Profiles in Breast Cancer

    DEFF Research Database (Denmark)

    Sørensen, Kristina Pilekær

    Each year approximately 4,800 Danish women are diagnosed with breast cancer. Several clinical and pathological factors are used as prognostic and predictive markers to categorize the patients into groups of high or low risk. Around 90% of all patients are allocated to the high risk group and offe......Each year approximately 4,800 Danish women are diagnosed with breast cancer. Several clinical and pathological factors are used as prognostic and predictive markers to categorize the patients into groups of high or low risk. Around 90% of all patients are allocated to the high risk group...... clinical courses, and they may be useful as novel prognostic biomarkers in breast cancer. The aim of the present project was to predict the development of metastasis in lymph node negative breast cancer patients by RNA profiling. We collected and analyzed 82 primary breast tumors from patients who...... developed metastasis and 82 primary breast tumors from patients who remained metastasis-free, by microarray gene expression profiling. We employed a nested case-control design, where samples were matched, in this study one-to-one, to exclude differences in gene expression based on tumor type, tumor size...

  12. Regulation of gene expression by hypoxia. (United States)

    Millhorn, D E; Czyzyk-Krzeska, M; Bayliss, D A; Lawson, E E


    The present study was undertaken to determine if gene expression for tyrosine hydroxylase (TH), the rate limiting enzyme in the biosynthesis of catecholamines, is regulated in the carotid body, sympathetic ganglia and adrenal medulla by hypoxia. We found that a reduction in oxygen tension from 21% to 10% caused a substantial increase (200% at 1 hour and 500% at 6 hours exposure) in the concentration of TH mRNA in carotid body type I cells but not in either the sympathetic ganglia or adrenal gland. In addition, we found that hypercapnia, another natural stimulus of carotid body activity, failed to enhance TH mRNA in type I cells. Removal of the sensory and sympathetic innervation of the carotid body failed to prevent the induction of TH mRNA by hypoxia in type I cells. Our results show that TH gene expression is regulated by hypoxia in the carotid body but not in other peripheral catecholamine synthesizing tissue and that the regulatory mechanism is intrinsic to type I cells. PMID:7909954

  13. Peripheral blood gene expression profiles in COPD subjects



    To identify non-invasive gene expression markers for chronic obstructive pulmonary disease (COPD), we performed genome-wide expression profiling of peripheral blood samples from 12 subjects with significant airflow obstruction and an equal number of non-obstructed controls. RNA was isolated from Peripheral Blood Mononuclear Cells (PBMCs) and gene expression was assessed using Affymetrix U133 Plus 2.0 arrays. Tests for gene expression changes that discriminate between COPD cases (FEV1< 70% pre...

  14. Real-time feedback control of gene expression


    Uhlendorf, Jannis


    Gene expression is fundamental for the functioning of cellular processes and is tightly regulated. Inducible promoters allow one to perturb gene expression by changing the expression level of a protein from its physiological level. This is a common tool to decipher the functioning of biological processes: the expression level of a gene is changed and one observes how the perturbed cell behaves differently from an unperturbed cell. A shortcoming of inducible promoters is the difficulty to appl...

  15. Coactivators in PPAR-Regulated Gene Expression

    Directory of Open Access Journals (Sweden)

    Navin Viswakarma


    Full Text Available Peroxisome proliferator-activated receptor (PPARα, β (also known as δ, and γ function as sensors for fatty acids and fatty acid derivatives and control important metabolic pathways involved in the maintenance of energy balance. PPARs also regulate other diverse biological processes such as development, differentiation, inflammation, and neoplasia. In the nucleus, PPARs exist as heterodimers with retinoid X receptor-α bound to DNA with corepressor molecules. Upon ligand activation, PPARs undergo conformational changes that facilitate the dissociation of corepressor molecules and invoke a spatiotemporally orchestrated recruitment of transcription cofactors including coactivators and coactivator-associated proteins. While a given nuclear receptor regulates the expression of a prescribed set of target genes, coactivators are likely to influence the functioning of many regulators and thus affect the transcription of many genes. Evidence suggests that some of the coactivators such as PPAR-binding protein (PBP/PPARBP/thyroid hormone receptor-associated protein 220 (TRAP220/mediator complex subunit 1 (MED1 may exert a broader influence on the functions of several nuclear receptors and their target genes. Investigations into the role of coactivators in the function of PPARs should strengthen our understanding of the complexities of metabolic diseases associated with energy metabolism.

  16. Analysis of multiplex gene expression maps obtained by voxelation

    Directory of Open Access Journals (Sweden)

    Smith Desmond J


    Full Text Available Abstract Background Gene expression signatures in the mammalian brain hold the key to understanding neural development and neurological disease. Researchers have previously used voxelation in combination with microarrays for acquisition of genome-wide atlases of expression patterns in the mouse brain. On the other hand, some work has been performed on studying gene functions, without taking into account the location information of a gene's expression in a mouse brain. In this paper, we present an approach for identifying the relation between gene expression maps obtained by voxelation and gene functions. Results To analyze the dataset, we chose typical genes as queries and aimed at discovering similar gene groups. Gene similarity was determined by using the wavelet features extracted from the left and right hemispheres averaged gene expression maps, and by the Euclidean distance between each pair of feature vectors. We also performed a multiple clustering approach on the gene expression maps, combined with hierarchical clustering. Among each group of similar genes and clusters, the gene function similarity was measured by calculating the average gene function distances in the gene ontology structure. By applying our methodology to find similar genes to certain target genes we were able to improve our understanding of gene expression patterns and gene functions. By applying the clustering analysis method, we obtained significant clusters, which have both very similar gene expression maps and very similar gene functions respectively to their corresponding gene ontologies. The cellular component ontology resulted in prominent clusters expressed in cortex and corpus callosum. The molecular function ontology gave prominent clusters in cortex, corpus callosum and hypothalamus. The biological process ontology resulted in clusters in cortex, hypothalamus and choroid plexus. Clusters from all three ontologies combined were most prominently expressed in

  17. Seed-Based Biclustering of Gene Expression Data


    Jiyuan An; Alan Wee-Chung Liew; Colleen C Nelson


    BACKGROUND: Accumulated biological research outcomes show that biological functions do not depend on individual genes, but on complex gene networks. Microarray data are widely used to cluster genes according to their expression levels across experimental conditions. However, functionally related genes generally do not show coherent expression across all conditions since any given cellular process is active only under a subset of conditions. Biclustering finds gene clusters that have similar e...

  18. A database of phylogenetically atypical genes in archaeal and bacterial genomes, identified using the DarkHorse algorithm


    Allen Eric E; Gaasterland Terry; Podell Sheila


    Abstract Background The process of horizontal gene transfer (HGT) is believed to be widespread in Bacteria and Archaea, but little comparative data is available addressing its occurrence in complete microbial genomes. Collection of high-quality, automated HGT prediction data based on phylogenetic evidence has previously been impractical for large numbers of genomes at once, due to prohibitive computational demands. DarkHorse, a recently described statistical method for discovering phylogeneti...

  19. Expression profiles for six zebrafish genes during gonadal sex differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Morthorst, Jane E.; Andersen, Ole;


    the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. RESULTS: In...... investigated on cDNA from the same fish allowing comparison of the high and low expressers of genes that are expected to be highest expressed in either males or females. There were 78% high or low expressers of all three "male" genes (ar, sox9a and dmrt1) in the investigated period and 81% were high or low...

  20. Phylogenetic diversity of archaeal 16S rRNA and ammonia monooxygenase genes from tropical estuarine sediments on the central west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, S.K.; Verma, P.; Ramaiah, N.; Anil, A.C.; Shouche, Y.S.

    extraction Two replicates of ~0.5 to 1 g sub-samples of all six samples were subjected to DNA extraction. The MOBIO soil DNA extraction kit (MO BIO, USA) was used for extraction as per the protocol provided by the manufacturer. DNA extracts from each sub... manufacturer’s instructions. PCR primers Arch-amoAF: 5’-STAATGGTCTGGCTTAGACG and Arch-amoAR: 5’- GCGGCCATCCATCTGTATGT were used for amplifying AamoA-gene fragments following Francis et al. (2005). The PCR products were pooled and purified as done for 16S r...

  1. Abundance and distribution of archaeal acetyl-CoA/propionyl-CoA carboxylase genes indicative for putatively chemoautotrophic Archaea in the tropical Atlantic's interior


    Bergauer, Kristin; Sintes, Eva; van Bleijswijk, Judith; Witte, Harry; Herndl, Gerhard J.; Lueders, Tillmann


    Recently, evidence suggests that dark CO2 fixation in the pelagic realm of the ocean does not only occur in the suboxic and anoxic water bodies but also in the oxygenated meso- and bathypelagic waters of the North Atlantic. To elucidate the significance and phylogeny of the key organisms mediating dark CO2 fixation in the tropical Atlantic, we quantified functional genes indicative for CO2 fixation. We used a Q-PCR-based assay targeting the bifunctional acetyl-CoA/propionyl-CoA carboxylase (a...

  2. Gene expression during fruit ripening in avocado. (United States)

    Christoffersen, R E; Warm, E; Laties, G G


    The poly(A) (+)RNA populations from avocado fruit (Persea americana Mill cv. Hass) at four stages of ripening were isolated by two cycles of oligo-dT-cellulose chromatography and examined by invitro translation, using the rabbit reticulocyte lysate system, followed by two-dimensional gel electrophoresis (isoelectric focusing followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis) of the resulting translation products. Three mRNAs increased dramatically with the climacteric rise in respiration and ethylene production. The molecular weights of the corresponding translation products from the ripening-related mRNAs are 80,000, 36,000, and 16,500. These results indicate that ripening may be linked to the expression of specific genes.

  3. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.


    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  4. Modulation of R-gene expression across environments. (United States)

    MacQueen, Alice; Bergelson, Joy


    Some environments are more conducive to pathogen growth than others, and, as a consequence, plants might be expected to invest more in resistance when pathogen growth is favored. Resistance (R-) genes in Arabidopsis thaliana have unusually extensive variation in basal expression when comparing the same R-gene among accessions collected from different environments. R-gene expression variation was characterized to explore whether R-gene expression is up-regulated in environments favoring pathogen proliferation and down-regulated when risks of infection are low; down-regulation would follow if costs of R-gene expression negatively impact plant fitness in the absence of disease. Quantitative reverse transcription-PCR was used to quantify the expression of 13 R-gene loci in plants grown in eight environmental conditions for each of 12 A. thaliana accessions, and large effects of the environment on R-gene expression were found. Surprisingly, almost every change in the environment--be it a change in biotic or abiotic conditions--led to an increase in R-gene expression, a response that was distinct from the average transcriptome response and from that of other stress response genes. These changes in expression are functional in that environmental change prior to infection affected levels of specific disease resistance to isolates of Pseudomonas syringae. In addition, there are strong latitudinal clines in basal R-gene expression and clines in R-gene expression plasticity correlated with drought and high temperatures. These results suggest that variation in R-gene expression across environments may be shaped by natural selection to reduce fitness costs of R-gene expression in permissive or predictable environments. PMID:26983577

  5. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR


    Thein Swee; Jiang Jie; Best Steve; Silver Nicholas


    Abstract Background Control genes, which are often referred to as housekeeping genes, are frequently used to normalise mRNA levels between different samples. However, the expression level of these genes may vary among tissues or cells and may change under certain circumstances. Thus, the selection of housekeeping genes is critical for gene expression studies. To address this issue, 7 candidate housekeeping genes including several commonly used ones were investigated in isolated human reticulo...

  6. Expression profiles for six zebrafish genes during gonadal sex differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Morthorst, Jane E.; Andersen, Ole;


    BACKGROUND: The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine...... the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. RESULTS...... "female" genes (fig alpha and cyp19a1a). When comparing all five genes with expected sex related expression 56% show expression expected for either male or female. Furthermore, the expression of all genes was investigated in different tissue of adult male and female zebrafish. CONCLUSION: In zebrafish...

  7. CDX2 gene expression in acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Hanaa H. Arnaoaut


    Full Text Available CDX genes are classically known as regulators of axial elongation during early embryogenesis. An unsuspected role for CDX genes has been revealed during hematopoietic development. The CDX gene family member CDX2 belongs to the most frequent aberrantly expressed proto-oncogenes in human acute leukemias and is highly leukemogenic in experimental models. We used reversed transcriptase polymerase chain reaction (RT-PCR to determine the expression level of CDX2 gene in 30 pediatric patients with acute lymphoblastic leukemia (ALL at diagnosis and 30 healthy volunteers. ALL patients were followed up to detect minimal residual disease (MRD on days 15 and 42 of induction. We found that CDX2 gene was expressed in 50% of patients and not expressed in controls. Associations between gene expression and different clinical and laboratory data of patients revealed no impact on different findings. With follow up, we could not confirm that CDX2 expression had a prognostic significance.

  8. Expression profiling identifies genes involved in emphysema severity

    Directory of Open Access Journals (Sweden)

    Bowman Rayleen V


    Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients. Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples. Class comparison identified 98 differentially expressed genes (p p Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.

  9. Serial Analysis of Gene Expression: Applications in Human Studies


    Renu Tuteja; Narendra Tuteja


    Serial analysis of gene expression (SAGE) is a powerful tool, which provides quantitative and comprehensive expression profile of genes in a given cell population. It works by isolating short fragments of genetic information from the expressed genes that are present in the cell being studied. These short sequences, called SAGE tags, are linked together for efficient sequencing. The frequency of each SAGE tag in the cloned multimers directly reflects the transcript abundance. Therefore, SAGE r...

  10. Gene Expression Data Knowledge Discovery using Global and Local Clustering


    H, Swathi.


    To understand complex biological systems, the research community has produced huge corpus of gene expression data. A large number of clustering approaches have been proposed for the analysis of gene expression data. However, extracting important biological knowledge is still harder. To address this task, clustering techniques are used. In this paper, hybrid Hierarchical k-Means algorithm is used for clustering and biclustering gene expression data is used. To discover both local and global cl...

  11. Regulated system for heterologous gene expression in Penicillium chrysogenum.


    Graessle, S.; de Haas, H.; Friedlin, E; Kürnsteiner, H; Stöffler, G; Redl, B


    A system for regulated heterologous gene expression in the filamentous fungus Penicillium chrysogenum was established. This is the first heterologous expression system to be developed for this organism. Expression of a recombinant fungal xylanase gene (xylp) and the cDNA for the human tear lipocalin (LCNI) was achieved by placing the encoding sequences under the control of the repressible acid phosphatase gene (phoA) promoter of P. chrysogenum. Secreted recombinant proteins were detected in t...

  12. Links between core promoter and basic gene features influence gene expression

    Directory of Open Access Journals (Sweden)

    Sinvani Hadar


    Full Text Available Abstract Background Diversity in rates of gene expression is essential for basic cell functions and is controlled by a variety of intricate mechanisms. Revealing general mechanisms that control gene expression is important for understanding normal and pathological cell functions and for improving the design of expression systems. Here we analyzed the relationship between general features of genes and their contribution to expression levels. Results Genes were divided into four groups according to their core promoter type and their characteristics analyzed statistically. Surprisingly we found that small variations in the TATA box are linked to large differences in gene length. Genes containing canonical TATA are generally short whereas long genes are associated with either non-canonical TATA or TATA-less promoters. These differences in gene length are primarily determined by the size and number of introns. Generally, gene expression was found to be tightly correlated with the strength of the TATA-box. However significant reduction in gene expression levels were linked with long TATA-containing genes (canonical and non-canonical whereas intron length hardly affected the expression of TATA-less genes. Interestingly, features associated with high translation are prevalent in TATA-containing genes suggesting that their protein production is also more efficient. Conclusion Our results suggest that interplay between core promoter type and gene size can generate significant diversity in gene expression.

  13. Differential gene co-expression networks via Bayesian biclustering models


    Gao, Chuan; Zhao, Shiwen; McDowell, Ian C.; Brown, Christopher D.; Barbara E Engelhardt


    Identifying latent structure in large data matrices is essential for exploring biological processes. Here, we consider recovering gene co-expression networks from gene expression data, where each network encodes relationships between genes that are locally co-regulated by shared biological mechanisms. To do this, we develop a Bayesian statistical model for biclustering to infer subsets of co-regulated genes whose covariation may be observed in only a subset of the samples. Our biclustering me...

  14. Biclustering of Linear Patterns In Gene Expression Data


    Gao, Qinghui; Ho, Christine; Jia, Yingmin; Li, Jingyi Jessica; Huang, Haiyan


    Identifying a bicluster, or submatrix of a gene expression dataset wherein the genes express similar behavior over the columns, is useful for discovering novel functional gene interactions. In this article, we introduce a new algorithm for finding biClusters with Linear Patterns (CLiP). Instead of solely maximizing Pearson correlation, we introduce a fitness function that also considers the correlation of complementary genes and conditions. This eliminates the need for a priori determination ...

  15. Differential Expression of Salinity Resistance Gene on Cotton

    Institute of Scientific and Technical Information of China (English)

    YE Wu-wei; YU Shu-xun


    @@ Salinity resistance and differential gene expression associated with salinity in cotton germplasm were studied,because of the large scale area of salinity in China,and its significant negative effects on the cotton production.The salinityresisted genes and their differential expression were studied under the stress of NaCI on cotton.There were found,under the NaCI stress,1644 genes differentially expressed from the salinity-sensitive cotton and only 817 genes differentially expressed from the salinityresisted cotton.

  16. Ribonucleoproteins in Archaeal Pre-rRNA Processing and Modification

    Directory of Open Access Journals (Sweden)

    W. S. Vincent Yip


    Full Text Available Given that ribosomes are one of the most important cellular macromolecular machines, it is not surprising that there is intensive research in ribosome biogenesis. Ribosome biogenesis is a complex process. The maturation of ribosomal RNAs (rRNAs requires not only the precise cleaving and folding of the pre-rRNA but also extensive nucleotide modifications. At the heart of the processing and modifications of pre-rRNAs in Archaea and Eukarya are ribonucleoprotein (RNP machines. They are called small RNPs (sRNPs, in Archaea, and small nucleolar RNPs (snoRNPs, in Eukarya. Studies on ribosome biogenesis originally focused on eukaryotic systems. However, recent studies on archaeal sRNPs have provided important insights into the functions of these RNPs. This paper will introduce archaeal rRNA gene organization and pre-rRNA processing, with a particular focus on the discovery of the archaeal sRNP components, their functions in nucleotide modification, and their structures.

  17. 古菌氨氧化与amoA基因的扩增%Archaeal Ammonia Oxidation and Amplification of amoA Gene

    Institute of Scientific and Technical Information of China (English)

    蒋敏芝; 黄秋雨


    Ammonia oxidation is a obligate aerobic: chemoautotrophic process taken by a small part bacterial community of Hymenomycetes. Ammonia-oxidizing bacteria (AOB) is a inorganic: autntrophic micro-organism, responsible for converting NH4+ to NO2- in the nitrification reaction, ammonia oxidizing archaea (AOA) is independent of the AOB clade. The paper introduced discovery and ammonia oxidation of AOA, extracted, purified and amplified amoA genes according to its features. The results confirmed exist of AOA, and provided basis for follow-up study.%氨氧化过程是由变形菌纲中的一小部分细菌类群所进行的专性好氧的化能自养过程,氨氧化细菌(AOB)是硝化反应中负责将NH4+转化为NO2-的一类无机自养微生物,氨氧化古菌(AOA)是独立于AOB进化枝之外的能进行氨氧化作用的古菌。介绍了AOA古菌的发现过程及其氨氧化作用,提取、纯化了amoA基因并利用amoA基因的特征,对它进行扩增,证实了AOA古菌的存在,并为后续研究提供了依据。

  18. Noise in gene expression is coupled to growth rate


    Keren, Leeat; van Dijk, David; Weingarten-Gabbay, Shira; Davidi, Dan; Jona, Ghil; Weinberger, Adina; Milo, Ron; Segal, Eran


    Genetically identical cells exposed to the same environment display variability in gene expression (noise), with important consequences for the fidelity of cellular regulation and biological function. Although population average gene expression is tightly coupled to growth rate, the effects of changes in environmental conditions on expression variability are not known. Here, we measure the single-cell expression distributions of approximately 900 Saccharomyces cerevisiae promoters across four...

  19. Expression of UGA-Containing Mycoplasma Genes in Bacillus subtilis


    Kannan, T. R.; Baseman, Joel B.


    We used Bacillus subtilis to express UGA-containing Mycoplasma genes encoding the P30 adhesin (one UGA) of Mycoplasma pneumoniae and methionine sulfoxide reductase (two UGAs) of Mycoplasma genitalium. Due to natural UGA suppression, these Mycoplasma genes were expressed as full-length protein products, but at relatively low efficiency, in recombinant wild-type Bacillus. The B. subtilis-expressed Mycoplasma proteins appeared as single bands and not as multiple bands compared to expression in r...

  20. Multiscale Embedded Gene Co-expression Network Analysis


    Song, Won-Min; Zhang, Bin


    Gene co-expression network analysis has been shown effective in identifying functional co-expressed gene modules associated with complex human diseases. However, existing techniques to construct co-expression networks require some critical prior information such as predefined number of clusters, numerical thresholds for defining co-expression/interaction, or do not naturally reproduce the hallmarks of complex systems such as the scale-free degree distribution of small-worldness. Previously, a...

  1. Expressed genes in regenerating rat liver after partial hepatectomy

    Institute of Scientific and Technical Information of China (English)

    Cun-Shuan Xu; Salman Rahrnan; Jing-Bo Zhang; Cui-Fang Chang; Jin-Yun Yuan; Wen-Qiang Li; Hong-Peng Han; Ke-Jin Yang; Li-Feng Zhao; Yu-Chang Li; Hui-Yong Zhang


    AIM: To reveal the liver regeneration (LR) and its controlas well as the occurrence of liver disease and to study the gene expression profiles of 551 genes after partial hepatectomy (PH) in regenerating rat livers.METHODS: Five hundred and fifty-one expressed sequence tags screened by suppression subtractive hybridization were made into an in-house cDNA microarray, and the expressive genes and their expressive profiles in regenerating rat livers were analyzed by microarray and bioinformatics. RESULTS: Three hundred of the analyzed 551 genes were up- or downregulated more than twofolds at one or more time points during LR. Most of the genes were up- or downregulated 2-5 folds, but the highest reached 90 folds of the control. One hundred and thirty-nine of themshowed upregulation, 135 displayed downregulation, and up or down expression of 26 genes revealed a dependence on regenerating livers. The genes expressedin 24-h regenerating livers were much more than those in the others. Cluster analysis and generalization analysis showed that there were at least six distinct temporal patterns of gene expression in the regenerating livers, that is, genes were expressed in the immediate early phase, early phase, intermediate phase, early-late phase, late phase, terminal phase. CONCLUSION: In LR, the number of down-regulated genes was almost similar to that of the upregulated genes; the successively altered genes were more than the rapidly transient genes. The temporal patterns of gene expression were similar 2 and 4 h, 12 and 16 h, 48 and 96 h, 72 and 144 h after PH. Microarray combined with suppressive subtractive hybridization can effectively identify the genes related to LR.

  2. Conserved co-expression for candidate disease gene prioritization

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A


    Full Text Available Abstract Background Genes that are co-expressed tend to be involved in the same biological process. However, co-expression is not a very reliable predictor of functional links between genes. The evolutionary conservation of co-expression between species can be used to predict protein function more reliably than co-expression in a single species. Here we examine whether co-expression across multiple species is also a better prioritizer of disease genes than is co-expression between human genes alone. Results We use co-expression data from yeast (S. cerevisiae, nematode worm (C. elegans, fruit fly (D. melanogaster, mouse and human and find that the use of evolutionary conservation can indeed improve the predictive value of co-expression. The effect that genes causing the same disease have higher co-expression than do other genes from their associated disease loci, is significantly enhanced when co-expression data are combined across evolutionarily distant species. We also find that performance can vary significantly depending on the co-expression datasets used, and just using more data does not necessarily lead to better prioritization. Instead, we find that dataset quality is more important than quantity, and using a consistent microarray platform per species leads to better performance than using more inclusive datasets pooled from various platforms. Conclusion We find that evolutionarily conserved gene co-expression prioritizes disease candidate genes better than human gene co-expression alone, and provide the integrated data as a new resource for disease gene prioritization tools.

  3. Global gene expression analysis for evaluation and design of biomaterials

    Directory of Open Access Journals (Sweden)

    Nobutaka Hanagata, Taro Takemura and Takashi Minowa


    Full Text Available Comprehensive gene expression analysis using DNA microarrays has become a widespread technique in molecular biological research. In the biomaterials field, it is used to evaluate the biocompatibility or cellular toxicity of metals, polymers and ceramics. Studies in this field have extracted differentially expressed genes in the context of differences in cellular responses among multiple materials. Based on these genes, the effects of materials on cells at the molecular level have been examined. Expression data ranging from several to tens of thousands of genes can be obtained from DNA microarrays. For this reason, several tens or hundreds of differentially expressed genes are often present in different materials. In this review, we outline the principles of DNA microarrays, and provide an introduction to methods of extracting information which is useful for evaluating and designing biomaterials from comprehensive gene expression data.

  4. Gene Expression Pattern of Signal Transduction in Chronic Myeloid Leukemia

    Institute of Scientific and Technical Information of China (English)

    LI Huiyu; JIE Shenghua; GUO Tiannan; HUANG Shi'ang


    To explore the transcriptional gene expression profiles of signaling pathway in Chronic myeloid leukemia (CML), a series of cDNA microarray chips were tested. The results showed that differentially expressed genes related to singal transduction in CML were screened out and the genes involved in Phosphoinositide 3-kinases (PI3K), Ras-MAPK (mitogen-activated protein kinase) and other signaling pathway genes simultaneously. The results also showed that most of these genes were up-expression genes , which suggested that signal transduction be overactivated in CML. Further analysis of these differentially expressed signal transduction genes will be helpful to understand the molecular mechanism of CML and find new targets of treatment.

  5. Cross-platform prediction of gene expression signatures.

    Directory of Open Access Journals (Sweden)

    Shu-Hong Lin

    Full Text Available Gene expression signatures can predict the activation of oncogenic pathways and other phenotypes of interest via quantitative models that combine the expression levels of multiple genes. However, as the number of platforms to measure genome-wide gene expression proliferates, there is an increasing need to develop models that can be ported across diverse platforms. Because of the range of technologies that measure gene expression, the resulting signal values can vary greatly. To understand how this variation can affect the prediction of gene expression signatures, we have investigated the ability of gene expression signatures to predict pathway activation across Affymetrix and Illumina microarrays. We hybridized the same RNA samples to both platforms and compared the resultant gene expression readings, as well as the signature predictions. Using a new approach to map probes across platforms, we found that the genes in the signatures from the two platforms were highly similar, and that the predictions they generated were also strongly correlated. This demonstrates that our method can map probes from Affymetrix and Illumina microarrays, and that this mapping can be used to predict gene expression signatures across platforms.

  6. Dynamic covariation between gene expression and proteome characteristics

    Directory of Open Access Journals (Sweden)

    Lehtinen Tommi O


    Full Text Available Abstract Background Cells react to changing intra- and extracellular signals by dynamically modulating complex biochemical networks. Cellular responses to extracellular signals lead to changes in gene and protein expression. Since the majority of genes encode proteins, we investigated possible correlations between protein parameters and gene expression patterns to identify proteome-wide characteristics indicative of trends common to expressed proteins. Results Numerous bioinformatics methods were used to filter and merge information regarding gene and protein annotations. A new statistical time point-oriented analysis was developed for the study of dynamic correlations in large time series data. The method was applied to investigate microarray datasets for different cell types, organisms and processes, including human B and T cell stimulation, Drosophila melanogaster life span, and Saccharomyces cerevisiae cell cycle. Conclusion We show that the properties of proteins synthesized correlate dynamically with the gene expression profile, indicating that not only is the actual identity and function of expressed proteins important for cellular responses but that several physicochemical and other protein properties correlate with gene expression as well. Gene expression correlates strongly with amino acid composition, composition- and sequence-derived variables, functional, structural, localization and gene ontology parameters. Thus, our results suggest that a dynamic relationship exists between proteome properties and gene expression in many biological systems, and therefore this relationship is fundamental to understanding cellular mechanisms in health and disease.

  7. Functional interaction of yeast and human TATA-binding proteins with an archaeal RNA polymerase and promoter.


    Wettach, J; Gohl, H P; Tschochner, H; Thomm, M


    TATA boxes are common structural features of eucaryal class II and archaeal promoters. In addition, a gene encoding a polypeptide with sequence similarity to eucaryal TATA-binding protein (TBP) has recently been detected in Archaea, but its relationship to the archaeal transcription factors A (aTFA) and B (aTFB) was unclear. Here, we demonstrate that yeast and human TBP can substitute for aTFB in a Methanococcus-derived archaeal cell-free transcription system. Template-commitment studies show...

  8. Benzoic Acid-Inducible Gene Expression in Mycobacteria.

    Directory of Open Access Journals (Sweden)

    Marte S Dragset

    Full Text Available Conditional expression is a powerful tool to investigate the role of bacterial genes. Here, we adapt the Pseudomonas putida-derived positively regulated XylS/Pm expression system to control inducible gene expression in Mycobacterium smegmatis and Mycobacterium tuberculosis, the causative agent of human tuberculosis. By making simple changes to a Gram-negative broad-host-range XylS/Pm-regulated gene expression vector, we prove that it is possible to adapt this well-studied expression system to non-Gram-negative species. With the benzoic acid-derived inducer m-toluate, we achieve a robust, time- and dose-dependent reversible induction of Pm-mediated expression in mycobacteria, with low background expression levels. XylS/Pm is thus an important addition to existing mycobacterial expression tools, especially when low basal expression is of particular importance.

  9. Archaeal Enzymes and Applications in Industrial Biocatalysts. (United States)

    Littlechild, Jennifer A


    Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in "extreme" conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  10. Archaeal Enzymes and Applications in Industrial Biocatalysts

    Directory of Open Access Journals (Sweden)

    Jennifer A. Littlechild


    Full Text Available Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in “extreme” conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  11. Large Scale Gene Expression Meta-Analysis Reveals Tissue-Specific, Sex-Biased Gene Expression in Humans (United States)

    Mayne, Benjamin T.; Bianco-Miotto, Tina; Buckberry, Sam; Breen, James; Clifton, Vicki; Shoubridge, Cheryl; Roberts, Claire T.


    The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analyzed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes), followed by the heart (375 genes), kidney (224 genes), colon (218 genes), and thyroid (163 genes). More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs, and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

  12. Microarray gene expression profiling and analysis in renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Sadhukhan Provash


    Full Text Available Abstract Background Renal cell carcinoma (RCC is the most common cancer in adult kidney. The accuracy of current diagnosis and prognosis of the disease and the effectiveness of the treatment for the disease are limited by the poor understanding of the disease at the molecular level. To better understand the genetics and biology of RCC, we profiled the expression of 7,129 genes in both clear cell RCC tissue and cell lines using oligonucleotide arrays. Methods Total RNAs isolated from renal cell tumors, adjacent normal tissue and metastatic RCC cell lines were hybridized to affymatrix HuFL oligonucleotide arrays. Genes were categorized into different functional groups based on the description of the Gene Ontology Consortium and analyzed based on the gene expression levels. Gene expression profiles of the tissue and cell line samples were visualized and classified by singular value decomposition. Reverse transcription polymerase chain reaction was performed to confirm the expression alterations of selected genes in RCC. Results Selected genes were annotated based on biological processes and clustered into functional groups. The expression levels of genes in each group were also analyzed. Seventy-four commonly differentially expressed genes with more than five-fold changes in RCC tissues were identified. The expression alterations of selected genes from these seventy-four genes were further verified using reverse transcription polymerase chain reaction (RT-PCR. Detailed comparison of gene expression patterns in RCC tissue and RCC cell lines shows significant differences between the two types of samples, but many important expression patterns were preserved. Conclusions This is one of the initial studies that examine the functional ontology of a large number of genes in RCC. Extensive annotation, clustering and analysis of a large number of genes based on the gene functional ontology revealed many interesting gene expression patterns in RCC. Most

  13. Expression Divergence of Tandemly Arrayed Genes in Human and Mouse

    Directory of Open Access Journals (Sweden)

    Valia Shoja


    Full Text Available Tandemly arrayed genes (TAGs account for about one third of the duplicated genes in eukaryotic genomes, yet there has not been any systematic study of their gene expression patterns. Taking advantage of recently published large-scale microarray data sets, we studied the expression divergence of 361 two-member TAGs in human and 212 two-member TAGs in mouse and examined the effect of sequence divergence, gene orientation, and chromosomal proximity on the divergence of TAG expression patterns. Our results show that there is a weak negative correlation between sequence divergence of TAG members and their expression similarity. There is also a weak negative correlation between chromosomal proximity of TAG members and their expression similarity. We did not detect any significant relationship between gene orientation and expression similarity. We also found that downstream TAG members do not show significantly narrower expression breadth than upstream members, contrary to what we predict based on TAG expression divergence hypothesis that we propose. Finally, we show that both chromosomal proximity and expression correlation in TAGs do not differ significantly from their neighboring non-TAG gene pairs, suggesting that tandem duplication is unlikely to be the cause for the higher-than-random expression association between neighboring genes on a chromosome in human and mouse.

  14. Gene length and expression level shape genomic novelties


    Grishkevich, Vladislav; YANAI, Itai


    Gene duplication and alternative splicing are important mechanisms in the production of genomic novelties. Previous work has shown that a gene’s family size and the number of splice variants it produces are inversely related, although the underlying reason is not well understood. Here, we report that gene length and expression level together explain this relationship. We found that gene lengths correlate with both gene duplication and alternative splicing: Longer genes are less likely to prod...

  15. A stochastic approach to multi-gene expression dynamics

    International Nuclear Information System (INIS)

    In the last years, tens of thousands gene expression profiles for cells of several organisms have been monitored. Gene expression is a complex transcriptional process where mRNA molecules are translated into proteins, which control most of the cell functions. In this process, the correlation among genes is crucial to determine the specific functions of genes. Here, we propose a novel multi-dimensional stochastic approach to deal with the gene correlation phenomena. Interestingly, our stochastic framework suggests that the study of the gene correlation requires only one theoretical assumption-Markov property-and the experimental transition probability, which characterizes the gene correlation system. Finally, a gene expression experiment is proposed for future applications of the model

  16. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards. (United States)

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang


    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total bacteria, total archaea, and selected functional genes (bacterial and archaeal amoA, bacterial narG, nirK, nirS, and nosZ) were determined by quantitative polymerase chain reaction (qPCR). The results indicate that the structures of bacterial and archaeal communities varied significantly with time and fertilization based on changes in the relative abundance of dominant T-RFs. The abundancy of the detected genes changed with time. The total bacteria, total archaea, and archaeal amoA were less abundant in July. The bacterial amoA and denitrifying genes were less abundant in September, except the nirK gene. The OF treatment increased the abundance of the observed genes, while the CF treatment had little influence on them. The soil temperature significantly affected the bacterial and archaeal community structures. The soil moisture was significantly correlated with the abundance of denitrifying genes. Of the soil chemical properties, soil organic carbon was the most important factor and was significantly correlated with the abundance of the detected genes, except the nirK gene. Overall, this study demonstrated the effects of both temporal alteration and organic fertilizer on the structures of microbial communities and the abundance of genes involved in the nitrogen cycle.

  17. Identification and validation of suitable endogenous reference genes for gene expression studies in human peripheral blood

    Directory of Open Access Journals (Sweden)

    Turner Renee J


    Full Text Available Abstract Background Gene expression studies require appropriate normalization methods. One such method uses stably expressed reference genes. Since suitable reference genes appear to be unique for each tissue, we have identified an optimal set of the most stably expressed genes in human blood that can be used for normalization. Methods Whole-genome Affymetrix Human 2.0 Plus arrays were examined from 526 samples of males and females ages 2 to 78, including control subjects and patients with Tourette syndrome, stroke, migraine, muscular dystrophy, and autism. The top 100 most stably expressed genes with a broad range of expression levels were identified. To validate the best candidate genes, we performed quantitative RT-PCR on a subset of 10 genes (TRAP1, DECR1, FPGS, FARP1, MAPRE2, PEX16, GINS2, CRY2, CSNK1G2 and A4GALT, 4 commonly employed reference genes (GAPDH, ACTB, B2M and HMBS and PPIB, previously reported to be stably expressed in blood. Expression stability and ranking analysis were performed using GeNorm and NormFinder algorithms. Results Reference genes were ranked based on their expression stability and the minimum number of genes needed for nomalization as calculated using GeNorm showed that the fewest, most stably expressed genes needed for acurate normalization in RNA expression studies of human whole blood is a combination of TRAP1, FPGS, DECR1 and PPIB. We confirmed the ranking of the best candidate control genes by using an alternative algorithm (NormFinder. Conclusion The reference genes identified in this study are stably expressed in whole blood of humans of both genders with multiple disease conditions and ages 2 to 78. Importantly, they also have different functions within cells and thus should be expressed independently of each other. These genes should be useful as normalization genes for microarray and RT-PCR whole blood studies of human physiology, metabolism and disease.

  18. Cell cycle gene expression under clinorotation (United States)

    Artemenko, Olga


    Cyclins and cyclin-dependent kinase (CDK) are main regulators of the cell cycle of eukaryotes. It's assumes a significant change of their level in cells under microgravity conditions and by other physical factors actions. The clinorotation use enables to determine the influence of gravity on simulated events in the cell during the cell cycle - exit from the state of quiet stage and promotion presynthetic phase (G1) and DNA synthesis phase (S) of the cell cycle. For the clinorotation effect study on cell proliferation activity is the necessary studies of molecular mechanisms of cell cycle regulation and development of plants under altered gravity condition. The activity of cyclin D, which is responsible for the events of the cell cycle in presynthetic phase can be controlled by the action of endogenous as well as exogenous factors, but clinorotation is one of the factors that influence on genes expression that regulate the cell cycle.These data can be used as a model for further research of cyclin - CDK complex for study of molecular mechanisms regulation of growth and proliferation. In this investigation we tried to summarize and analyze known literature and own data we obtained relatively the main regulators of the cell cycle in altered gravity condition.

  19. Assembly and Expression of Shark Ig Genes. (United States)

    Hsu, Ellen


    Sharks are modern descendants of the earliest vertebrates possessing Ig superfamily receptor-based adaptive immunity. They respond to immunogen with Abs that, upon boosting, appear more rapidly and show affinity maturation. Specific Abs and immunological memory imply that Ab diversification and clonal selection exist in cartilaginous fish. Shark Ag receptors are generated through V(D)J recombination, and because it is a mechanism known to generate autoreactive receptors, this implies that shark lymphocytes undergo selection. In the mouse, the ∼2.8-Mb IgH and IgL loci require long-range, differential activation of component parts for V(D)J recombination, allelic exclusion, and receptor editing. These processes, including class switching, evolved with and appear inseparable from the complex locus organization. In contrast, shark Igs are encoded by 100-200 autonomously rearranging miniloci. This review describes how the shark primary Ab repertoire is generated in the absence of structural features considered essential in mammalian Ig gene assembly and expression. PMID:27183649

  20. Transgenic zebrafish recapitulating tbx16 gene early developmental expression.

    Directory of Open Access Journals (Sweden)

    Simon Wells

    Full Text Available We describe the creation of a transgenic zebrafish expressing GFP driven by a 7.5 kb promoter region of the tbx16 gene. This promoter segment is sufficient to recapitulate early embryonic expression of endogenous tbx16 in the presomitic mesoderm, the polster and, subsequently, in the hatching gland. Expression of GFP in the transgenic lines later in development diverges to some extent from endogenous tbx16 expression with the serendipitous result that one line expresses GFP specifically in commissural primary ascending (CoPA interneurons of the developing spinal cord. Using this line we demonstrate that the gene mafba (valentino is expressed in CoPA interneurons.

  1. Gene ordering in partitive clustering using microarray expressions

    Indian Academy of Sciences (India)

    Shubhra Sankar Ray; Sanghamitra Bandyopadhyay; Sankar K Pal


    A central step in the analysis of gene expression data is the identification of groups of genes that exhibit similar expression patterns. Clustering and ordering the genes using gene expression data into homogeneous groups was shown to be useful in functional annotation, tissue classification, regulatory motif identification, and other applications. Although there is a rich literature on gene ordering in hierarchical clustering framework for gene expression analysis, there is no work addressing and evaluating the importance of gene ordering in partitive clustering framework, to the best knowledge of the authors. Outside the framework of hierarchical clustering, different gene ordering algorithms are applied on the whole data set, and the domain of partitive clustering is still unexplored with gene ordering approaches. A new hybrid method is proposed for ordering genes in each of the clusters obtained from partitive clustering solution, using microarray gene expressions. Two existing algorithms for optimally ordering cities in travelling salesman problem (TSP), namely, FRAG_GALK and Concorde, are hybridized individually with self organizing MAP to show the importance of gene ordering in partitive clustering framework. We validated our hybrid approach using yeast and fibroblast data and showed that our approach improves the result quality of partitive clustering solution, by identifying subclusters within big clusters, grouping functionally correlated genes within clusters, minimization of summation of gene expression distances, and the maximization of biological gene ordering using MIPS categorization. Moreover, the new hybrid approach, finds comparable or sometimes superior biological gene order in less computation time than those obtained by optimal leaf ordering in hierarchical clustering solution.

  2. Gene expression profiles of the developing human retina

    Institute of Scientific and Technical Information of China (English)

    WANG Feng; LI Huiming; LIU Wenwen; XU Ping; HU Gengxi; CHENG Yidong; JIA Libin; HUANG Qian


    Retina is a multilayer and highly specialized tissue important in converting light into neural signals. In humans, the critical period for the formation of complex multiplayer structure takes place during embryogenesis between 12 and 28 weeks. The morphologic changes during retinal development in humans have been studied but little is known about the molecular events essential for the formation of the retina. To gain further insights into this process, cDNA microarrays containing 16361 human gene probes were used to measure the gene expression levels in retinas. Of the 16361 genes, 68.7%, 71.4% and 69.7% showed positive hybridization with cDNAs made from 12-16 week fetal, 22-26 week fetal and adult retinas. A total of 814 genes showed a minimum of 3-fold changes between the lowest and highest expression levels among three time points and among them, 106 genes had expression levels with the hybridization intensity above 100 at one or more time points. The clustering analysis suggested that the majority of differentially expressed genes were down-regulated during the retinal development. The differentially expressed genes were further classified according to functions of known genes, and were ranked in decreasing order according to frequency: development, differentiation, signal transduction, protein synthesis and translation, metabolism, DNA binding and transcription, DNA synthesis-repair-recombination, immuno-response, ion channel- transport, cell receptor, cytoskeleton, cell cycle, pro-oncogene, stress and apoptosis related genes. Among these 106 differentially expressed genes, 60 are already present in NEI retina cDNA or EST Databank but the remaining 46 genes are absent and thus identified as "function unknown". To validate gene expression data from the microarray, real-time RT-PCR was performed for 46 "function unknown" genes and 6 known retina specific expression genes, and β-actin was used as internal control. Twenty-seven of these genes showed very similar

  3. Ranking differentially expressed genes from Affymetrix gene expression data: methods with reproducibility, sensitivity, and specificity

    Directory of Open Access Journals (Sweden)

    Shimizu Kentaro


    Full Text Available Abstract Background To identify differentially expressed genes (DEGs from microarray data, users of the Affymetrix GeneChip system need to select both a preprocessing algorithm to obtain expression-level measurements and a way of ranking genes to obtain the most plausible candidates. We recently recommended suitable combinations of a preprocessing algorithm and gene ranking method that can be used to identify DEGs with a higher level of sensitivity and specificity. However, in addition to these recommendations, researchers also want to know which combinations enhance reproducibility. Results We compared eight conventional methods for ranking genes: weighted average difference (WAD, average difference (AD, fold change (FC, rank products (RP, moderated t statistic (modT, significance analysis of microarrays (samT, shrinkage t statistic (shrinkT, and intensity-based moderated t statistic (ibmT with six preprocessing algorithms (PLIER, VSN, FARMS, multi-mgMOS (mmgMOS, MBEI, and GCRMA. A total of 36 real experimental datasets was evaluated on the basis of the area under the receiver operating characteristic curve (AUC as a measure for both sensitivity and specificity. We found that the RP method performed well for VSN-, FARMS-, MBEI-, and GCRMA-preprocessed data, and the WAD method performed well for mmgMOS-preprocessed data. Our analysis of the MicroArray Quality Control (MAQC project's datasets showed that the FC-based gene ranking methods (WAD, AD, FC, and RP had a higher level of reproducibility: The percentages of overlapping genes (POGs across different sites for the FC-based methods were higher overall than those for the t-statistic-based methods (modT, samT, shrinkT, and ibmT. In particular, POG values for WAD were the highest overall among the FC-based methods irrespective of the choice of preprocessing algorithm. Conclusion Our results demonstrate that to increase sensitivity, specificity, and reproducibility in microarray analyses, we need

  4. Microdissection of the gene expression codes driving nephrogenesis. (United States)

    Potter, S Steven; Brunskill, Eric W; Patterson, Larry T


    The kidney represents an excellent model system for learning the principles of organogenesis. It is intermediate in complexity, and employs many commonly used developmental processes. As such, kidney development has been the subject of intensive study, using a variety of techniques, including in situ hybridization, organ culture and gene targeting, revealing many critical genes and pathways. Nevertheless, proper organogenesis requires precise patterns of cell type specific differential gene expression, involving very large numbers of genes. This review is focused on the use of global profiling technologies to create an atlas of gene expression codes driving development of different mammalian kidney compartments. Such an atlas allows one to select a gene of interest, and to determine its expression level in each element of the developing kidney, or to select a structure of interest, such as the renal vesicle, and to examine its complete gene expression state. Novel component specific molecular markers are identified, and the changing waves of gene expression that drive nephrogenesis are defined. As the tools continue to improve for the purification of specific cell types and expression profiling of even individual cells it is possible to predict an atlas of gene expression during kidney development that extends to single cell resolution. PMID:21220959

  5. Biasogram: visualization of confounding technical bias in gene expression data

    DEFF Research Database (Denmark)

    Krzystanek, Marcin; Szallasi, Zoltan Imre; Eklund, Aron Charles


    Gene expression profiles of clinical cohorts can be used to identify genes that are correlated with a clinical variable of interest such as patient outcome or response to a particular drug. However, expression measurements are susceptible to technical bias caused by variation in extraneous factor...

  6. MEPD: medaka expression pattern database, genes and more. (United States)

    Alonso-Barba, Juan I; Rahman, Raza-Ur; Wittbrodt, Joachim; Mateo, Juan L


    The Medaka Expression Pattern Database (MEPD; is designed as a repository of medaka expression data for the scientific community. In this update we present two main improvements. First, we have changed the previous clone-centric view for in situ data to a gene-centric view. This is possible because now we have linked all the data present in MEPD to the medaka gene annotation in ENSEMBL. In addition, we have also connected the medaka genes in MEPD to their corresponding orthologous gene in zebrafish, again using the ENSEMBL database. Based on this, we provide a link to the Zebrafish Model Organism Database (ZFIN) to allow researches to compare expression data between these two fish model organisms. As a second major improvement, we have modified the design of the database to enable it to host regulatory elements, promoters or enhancers, expression patterns in addition to gene expression. The combination of gene expression, by traditional in situ, and regulatory element expression, typically by fluorescence reporter gene, within the same platform assures consistency in terms of annotation. In our opinion, this will allow researchers to uncover new insights between the expression domain of genes and their regulatory landscape. PMID:26450962

  7. Comparative genomics of the relationship between gene structure and expression

    NARCIS (Netherlands)

    Ren, X.


    The relationship between the structure of genes and their expression is a relatively new aspect of genome organization and regulation. With more genome sequences and expression data becoming available, bioinformatics approaches can help the further elucidation of the relationships between gene struc

  8. FGX : a frequentist gene expression index for Affymetrix arrays

    NARCIS (Netherlands)

    Purutçuoğlu, Vilda; Wit, Ernst


    We consider a new frequentist gene expression index for Affymetrix oligonucleotide DNA arrays, using a similar probe intensity model as suggested previously, called the Bayesian gene expression index (BGX). According to this model, the perfect match and mismatch values are assumed to be correlated a

  9. RNA preparation and characterization for gene expression studies

    DEFF Research Database (Denmark)

    Stangegaard, Michael


    Much information can be obtained from knowledge of the relative expression level of each gene in the transcriptome. With the current advances in technology as little as a single cell is required as starting material for gene expression experiments. The mRNA from a single cell may be linearly ampl...

  10. Peripheral blood gene expression profiles in COPD subjects. (United States)

    Bhattacharya, Soumyaroop; Tyagi, Shivraj; Srisuma, Sorachai; Demeo, Dawn L; Shapiro, Steven D; Bueno, Raphael; Silverman, Edwin K; Reilly, John J; Mariani, Thomas J


    To identify non-invasive gene expression markers for chronic obstructive pulmonary disease (COPD), we performed genome-wide expression profiling of peripheral blood samples from 12 subjects with significant airflow obstruction and an equal number of non-obstructed controls. RNA was isolated from Peripheral Blood Mononuclear Cells (PBMCs) and gene expression was assessed using Affymetrix U133 Plus 2.0 arrays.Tests for gene expression changes that discriminate between COPD cases (FEV1 80% predicted, FEV1/FVC > 0.7) were performed using Significance Analysis of Microarrays (SAM) and Bayesian Analysis of Differential Gene Expression (BADGE). Using either test at high stringency (SAM median FDR = 0 or BADGE p Pearson and Spearman correlation coefficients (p < 0.05), identified a set of 86 genes. A total of 16 markers showed evidence of significant correlation (p < 0.05) with quantitative traits and differential expression between cases and controls. We further compared our peripheral gene expression markers with those we previously identified from lung tissue of the same cohort. Two genes, RP9and NAPE-PLD, were identified as decreased in COPD cases compared to controls in both lung tissue and blood. These results contribute to our understanding of gene expression changes in the peripheral blood of patients with COPD and may provide insight into potential mechanisms involved in the disease. PMID:21884629

  11. Expression and mapping of anthocyanin biosynthesis genes in carrot (United States)

    Anthocyanin gene expression has been extensively studied in leaves, fruits and flowers of numerous plants. Little, however, is known about anthocyanin accumulation in roots, or in carrots or other Apiaceae. We quantified expression of six anthocyanin biosynthetic genes (phenylalanine ammonia-lyase (...

  12. Digital gene expression tag profiling analysis of the gene expression patterns regulating the early stage of mouse spermatogenesis.

    Directory of Open Access Journals (Sweden)

    Xiujun Zhang

    Full Text Available Detailed characterization of the gene expression patterns in spermatogonia and primary spermatocytes is critical to understand the processes which occur prior to meiosis during normal spermatogenesis. The genome-wide expression profiles of mouse type B spermatogonia and primary spermatocytes were investigated using the Solexa/Illumina digital gene expression (DGE system, a tag based high-throughput transcriptome sequencing method, and the developmental processes which occur during early spermatogenesis were systematically analyzed. Gene expression patterns vary significantly between mouse type B spermatogonia and primary spermatocytes. The functional analysis revealed that genes related to junction assembly, regulation of the actin cytoskeleton and pluripotency were most significantly differently expressed. Pathway analysis indicated that the Wnt non-canonical signaling pathway played a central role and interacted with the actin filament organization pathway during the development of spermatogonia. This study provides a foundation for further analysis of the gene expression patterns and signaling pathways which regulate the molecular mechanisms of early spermatogenesis.


    Institute of Scientific and Technical Information of China (English)

    MENG Xu-li; DING Xiao-wen; XU Xiao-hong


    Objective: To investigate the molecular etiology of breast cancer by way of studying the differential expression and initial function of the related genes in the occurrence and development of breast cancer. Methods: Two hundred and eighty-eight human tumor related genes were chosen for preparation of the oligochips probe. mRNA was extracted from 16 breast cancer tissues and the corresponding normal breast tissues, and cDNA probe was prepared through reverse-transcription and hybridized with the gene chip. A laser focused fluorescent scanner was used to scan the chip. The different gene expressions were thereafter automatically compared and analyzed between the two sample groups. Cy3/Cy5>3.5 meant significant up-regulation. Cy3/Cy5<0.25 meant significant down-regulation. Results: The comparison between the breast cancer tissues and their corresponding normal tissues showed that 84 genes had differential expression in the Chip. Among the differently expressed genes, there were 4 genes with significant down-regulation and 6 with significant up-regulation. Compared with normal breast tissues, differentially expressed genes did partially exist in the breast cancer tissues. Conclusion: Changes in multi-gene expression regulations take place during the occurrence and development of breast cancer; and the research on related genes can help understanding the mechanism of tumor occurrence.

  14. Gene Expression Profiling in the Hibernating Primate, Cheirogaleus Medius. (United States)

    Faherty, Sheena L; Villanueva-Cañas, José Luis; Klopfer, Peter H; Albà, M Mar; Yoder, Anne D


    Hibernation is a complex physiological response that some mammalian species employ to evade energetic demands. Previous work in mammalian hibernators suggests that hibernation is activated not by a set of genes unique to hibernators, but by differential expression of genes that are present in all mammals. This question of universal genetic mechanisms requires further investigation and can only be tested through additional investigations of phylogenetically dispersed species. To explore this question, we use RNA-Seq to investigate gene expression dynamics as they relate to the varying physiological states experienced throughout the year in a group of primate hibernators-Madagascar's dwarf lemurs (genus Cheirogaleus). In a novel experimental approach, we use longitudinal sampling of biological tissues as a method for capturing gene expression profiles from the same individuals throughout their annual hibernation cycle. We identify 90 candidate genes that have variable expression patterns when comparing two active states (Active 1 and Active 2) with a torpor state. These include genes that are involved in metabolic pathways, feeding behavior, and circadian rhythms, as might be expected to correlate with seasonal physiological state changes. The identified genes appear to be critical for maintaining the health of an animal that undergoes prolonged periods of metabolic depression concurrent with the hibernation phenotype. By focusing on these differentially expressed genes in dwarf lemurs, we compare gene expression patterns in previously studied mammalian hibernators. Additionally, by employing evolutionary rate analysis, we find that hibernation-related genes do not evolve under positive selection in hibernating species relative to nonhibernators. PMID:27412611

  15. Differential endometrial gene expression in pregnant and nonpregnant sows

    DEFF Research Database (Denmark)

    Østrup, Esben; Bauersachs, Stefan; Blum, Helmut;


    obtained from the endometrium of pregnant sows and sows inseminated with inactivated semen. Analysis of the microarray data revealed 263 genes to be significantly differentially expressed between the pregnant and nonpregnant sows. Most gene ontology terms significantly enriched at pregnancy had allocated......In an attempt to unveil molecular processes controlling the porcine placentation, we have investigated the pregnancy-induced gene expression in the endometrium using the Affymetrix GeneChip Porcine Genome Array. At Day 14 after insemination, at the time of initial placentation, samples were...... the three terms oxidoreductase activity, lipid metabolic process, and organic acid metabolic process had an overrepresentation of down-regulated genes. A gene interaction network based on the genes identified in the gene ontology term developmental processes identified genes likely to be involved...

  16. The effect of negative autoregulation on eukaryotic gene expression (United States)

    Nevozhay, Dmitry; Adams, Rhys; Murphy, Kevin; Josic, Kresimir; Balázsi, G. Ábor


    Negative autoregulation is a frequent motif in gene regulatory networks, which has been studied extensively in prokaryotes. Nevertheless, some effects of negative feedback on gene expression in eukaryotic transcriptional networks remain unknown. We studied how the strength of negative feedback regulation affects the characteristics of gene expression in yeast cells carrying synthetic transcriptional cascades. We observed a drastic reduction of gene expression noise and a change in the shape of the dose-response curve. We explained these experimentally observed effects by stochastic simulations and a simple set of algebraic equations.

  17. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Fang, Lusheng; Li, Bo; Tong, Shurong;


    To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene ...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  18. Gene expression profiling of placentas affected by pre-eclampsia

    DEFF Research Database (Denmark)

    Hoegh, Anne Mette; Borup, Rehannah; Nielsen, Finn Cilius;


    Several studies point to the placenta as the primary cause of pre-eclampsia. Our objective was to identify placental genes that may contribute to the development of pre-eclampsia. RNA was purified from tissue biopsies from eleven pre-eclamptic placentas and eighteen normal controls. Messenger RNA...... expression from pooled samples was analysed by microarrays. Verification of the expression of selected genes was performed using real-time PCR. A surprisingly low number of genes (21 out of 15,000) were identified as differentially expressed. Among these were genes not previously associated with pre-eclampsia...... as bradykinin B1 receptor and a 14-3-3 protein, but also genes that have already been connected with pre-eclampsia, for example, inhibin beta A subunit and leptin. A low number of genes were repeatedly identified as differentially expressed, because they may represent the endpoint of a cascade of events...

  19. Decoupling Linear and Nonlinear Associations of Gene Expression

    KAUST Repository

    Itakura, Alan


    The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.

  20. Fundamental principles of energy consumption for gene expression (United States)

    Huang, Lifang; Yuan, Zhanjiang; Yu, Jianshe; Zhou, Tianshou


    How energy is consumed in gene expression is largely unknown mainly due to complexity of non-equilibrium mechanisms affecting expression levels. Here, by analyzing a representative gene model that considers complexity of gene expression, we show that negative feedback increases energy consumption but positive feedback has an opposite effect; promoter leakage always reduces energy consumption; generating more bursts needs to consume more energy; and the speed of promoter switching is at the cost of energy consumption. We also find that the relationship between energy consumption and expression noise is multi-mode, depending on both the type of feedback and the speed of promoter switching. Altogether, these results constitute fundamental principles of energy consumption for gene expression, which lay a foundation for designing biologically reasonable gene modules. In addition, we discuss possible biological implications of these principles by combining experimental facts.

  1. Evaluating the consistency of gene sets used in the analysis of bacterial gene expression data

    Directory of Open Access Journals (Sweden)

    Tintle Nathan L


    Full Text Available Abstract Background Statistical analyses of whole genome expression data require functional information about genes in order to yield meaningful biological conclusions. The Gene Ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG are common sources of functionally grouped gene sets. For bacteria, the SEED and MicrobesOnline provide alternative, complementary sources of gene sets. To date, no comprehensive evaluation of the data obtained from these resources has been performed. Results We define a series of gene set consistency metrics directly related to the most common classes of statistical analyses for gene expression data, and then perform a comprehensive analysis of 3581 Affymetrix® gene expression arrays across 17 diverse bacteria. We find that gene sets obtained from GO and KEGG demonstrate lower consistency than those obtained from the SEED and MicrobesOnline, regardless of gene set size. Conclusions Despite the widespread use of GO and KEGG gene sets in bacterial gene expression data analysis, the SEED and MicrobesOnline provide more consistent sets for a wide variety of statistical analyses. Increased use of the SEED and MicrobesOnline gene sets in the analysis of bacterial gene expression data may improve statistical power and utility of expression data.

  2. Regulating gene expression : surprises still in store

    NARCIS (Netherlands)

    Jansen, Ritsert C.; Nap, Jan-Peter


    Understanding how genes constitute and contribute to the regulatory networks that result in phenotypic diversity is the major challenge of the post-genome era. Recently, it has been shown that major players in gene regulation can be identified by genome-wide linkage analysis of whole-genome gene exp

  3. Gene expression profiling in adipose tissue from growing broiler chickens (United States)

    Hausman, Gary J; Barb, C Rick; Fairchild, Brian D; Gamble, John; Lee-Rutherford, Laura


    In this study, total RNA was collected from abdominal adipose tissue samples obtained from ten broiler chickens at 3, 4, 5, and 6 weeks of age and prepared for gene microarray analysis with Affymetrix GeneChip Chicken Genome Arrays (Affymetrix) and quantitative real-time PCR analysis. Studies of global gene expression in chicken adipose tissue were initiated since such studies in many animal species show that adipose tissue expresses and secretes many factors that can influence growth and physiology. Microarray results indicated 333 differentially expressed adipose tissue genes between 3 and 6 wk, 265 differentially expressed genes between 4 and 6 wk and 42 differentially expressed genes between 3 and 4 wk. Enrichment scores of Gene Ontology Biological Process categories indicated strong age upregulation of genes involved in the immune system response. In addition to microarray analysis, quantitative real-time PCR analysis was used to confirm the influence of age on the expression of adipose tissue CC chemokine ligands (CCL), toll-like receptor (TLR)-2, lipopolysaccharide-induced TNF factor (LITAF), chemokine (C-C motif) receptor 8 (CCR8), and several other genes. Between 3 and 6 wk of age CCL5, CCL1, and CCR8 expression increased (P = 0.0001) with age. Furthermore, TLR2, CCL19, and LITAF expression increased between 4 and 6 wk of age (P = 0.001). This is the first demonstration of age related changes in CCL, LITAF, and TLR2 gene expression in chicken adipose tissue. Future studies are needed to elucidate the role of these adipose tissue genes in growth and the immune system. PMID:26317054

  4. Gene expression profiles in stages II and III colon cancers

    DEFF Research Database (Denmark)

    Thorsteinsson, Morten; Kirkeby, Lene T; Hansen, Raino;


    PURPOSE: A 128-gene signature has been proposed to predict outcome in patients with stages II and III colorectal cancers. In the present study, we aimed to reproduce and validate the 128-gene signature in external and independent material. METHODS: Gene expression data from the original material ...

  5. Dimensionality of Data Matrices with Applications to Gene Expression Profiles (United States)

    Feng, Xingdong


    Probe-level microarray data are usually stored in matrices. Take a given probe set (gene), for example, each row of the matrix corresponds to an array, and each column corresponds to a probe. Often, people summarize each array by the gene expression level. Is one number sufficient to summarize a whole probe set for a specific gene in an array?…

  6. Regulated expression of foreign genes in vivo after germline transfer.


    Passman, R S; Fishman, G I


    Tight transcriptional control of foreign genes introduced into the germline of transgenic mice would be of great experimental value in studies of gene function. To develop a system in which the spatial and temporal expression of candidate genes implicated in cardiac development or function could be tightly controlled in vivo, we have generated transgenic mice expressing a tetracycline-controlled transactivator (tTA) under the control of a rat alpha myosin heavy chain promoter (MHC alpha-tTA m...

  7. Inducible gene expression system by 3-hydroxypropionic acid


    Zhou, Shengfang; Ainala, Satish Kumar; Seol, Eunhee; Nguyen, Trinh Thi; Park, Sunghoon


    Background 3-Hydroxypropionic acid (3-HP) is an important platform chemical that boasts a variety of industrial applications. Gene expression systems inducible by 3-HP, if available, are of great utility for optimization of the pathways of 3-HP production and excretion. Results Here we report the presence of unique inducible gene expression systems in Pseudomonas denitrificans and other microorganisms. In P. denitrificans, transcription of three genes (hpdH, mmsA and hbdH-4) involved in 3-HP ...

  8. Pancreatic expression of human insulin gene in transgenic mice.


    Bucchini, D; Ripoche, M A; Stinnakre, M G; Desbois, P; Lorès, P; Monthioux, E; Absil, J; Lepesant, J A; Pictet, R; Jami, J


    We have investigated the possibility of obtaining integration and expression of a native human gene in transgenic mice. An 11-kilobase (kb) human chromosomal DNA fragment including the insulin gene (1430 base pairs) was microinjected into fertilized mouse eggs. This fragment was present in the genomic DNA of several developing animals. One transgenic mouse and its progeny were analyzed for expression of the foreign gene. Synthesis and release of human insulin was revealed by detection of the ...

  9. Gene expression profiles of mouse spermatogenesis during recovery from irradiation

    DEFF Research Database (Denmark)

    Shah, Fozia J; Tanaka, Masami; Nielsen, John E;


    the cellular changes that happen during recovery from irradiation by means of histology. We have earlier generated gene expression profiles during induction of spermatogenesis in mouse postnatal developing testes and found a correlation between profiles and the expressing cell types. The aim of the present...... work was to utilize the link between expression profile and cell types to follow the cellular changes that occur during post-irradiation recovery of spermatogenesis in order to describe recovery by means of gene expression. METHODS: Adult mouse testes were subjected to irradiation with 1 Gy...... or a fractionated radiation of two times 1 Gy. Testes were sampled every third or fourth day to follow the recovery of spermatogenesis and gene expression profiles generated by means of differential display RT-PCR. In situ hybridization was in addition performed to verify cell-type specific gene expression patterns...

  10. Regulation of Tryptophan Operon Expression in the Archaeon Methanothermobacter thermautotrophicus


    Xie, Yunwei; Reeve, John N.


    Conserved trp genes encode enzymes that catalyze tryptophan biosynthesis in all three biological domains, and studies of their expression in Bacteria and eukaryotes have revealed a variety of different regulatory mechanisms. The results reported here provide the first detailed description of an archaeal trp gene regulatory system. We have established that the trpEGCFBAD operon in Methanothermobacter thermautotrophicus is transcribed divergently from a gene (designated trpY) that encodes a try...

  11. Performance Analysis of Enhanced Clustering Algorithm for Gene Expression Data

    Directory of Open Access Journals (Sweden)

    T. Chandrasekhar


    Full Text Available Microarrays are made it possible to simultaneously monitor the expression profiles of thousands of genes under various experimental conditions. It is used to identify the co-expressed genes in specific cells or tissues that are actively used to make proteins. This method is used to analysis the gene expression, an important task in bioinformatics research. Cluster analysis of gene expression data has proved to be a useful tool for identifying co-expressed genes, biologically relevant groupings of genes and samples. In this paper we applied K-Means with Automatic Generations of Merge Factor for ISODATA- AGMFI. Though AGMFI has been applied for clustering of Gene Expression Data, this proposed Enhanced Automatic Generations of Merge Factor for ISODATA- EAGMFI Algorithms overcome the drawbacks of AGMFI in terms of specifying the optimal number of clusters and initialization of good cluster centroids. Experimental results on Gene Expression Data show that the proposed EAGMFI algorithms could identify compact clusters with perform well in terms of the Silhouette Coefficients cluster measure.

  12. Biclustering of the Gene Expression Data by Coevolution Cuckoo Search


    Lu Yin; Yongguo Liu


    Biclustering has a potential to discover the local expression patterns analyzing the gene expression data which provide clues about biological processes. However, since it is proven that the biclustering problem is NP-hard, it is necessary to seek more effective algorithm. Cuckoo Search (CS) models the brood parasitism behavior of cuckoo to solve the optimization problem and outperforms the other existing algorithms. In this paper, we introduce a new algorithm for biclustering gene expression...

  13. GEE: An Informatics Tool for Gene Expression Data Explore


    Lee, Soo Youn; Park, Chan Hee; Yoon, Jun Hee; Yun, Sunmin; Kim, Ju Han


    Objectives Major public high-throughput functional genomic data repositories, including the Gene Expression Omnibus (GEO) and ArrayExpress have rapidly expanded. As a result, a large number of diverse high-throughput functional genomic data retrieval systems have been developed. However, high-throughput functional genomic data retrieval remains challenging. Methods We developed Gene Expression data Explore (GEE), the first powerful, flexible web and mobile search application for searching who...

  14. Protein Adaptations in Archaeal Extremophiles

    Directory of Open Access Journals (Sweden)

    Christopher J. Reed


    Full Text Available Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity.

  15. An atlas of gene expression and gene co-regulation in the human retina. (United States)

    Pinelli, Michele; Carissimo, Annamaria; Cutillo, Luisa; Lai, Ching-Hung; Mutarelli, Margherita; Moretti, Maria Nicoletta; Singh, Marwah Veer; Karali, Marianthi; Carrella, Diego; Pizzo, Mariateresa; Russo, Francesco; Ferrari, Stefano; Ponzin, Diego; Angelini, Claudia; Banfi, Sandro; di Bernardo, Diego


    The human retina is a specialized tissue involved in light stimulus transduction. Despite its unique biology, an accurate reference transcriptome is still missing. Here, we performed gene expression analysis (RNA-seq) of 50 retinal samples from non-visually impaired post-mortem donors. We identified novel transcripts with high confidence (Observed Transcriptome (ObsT)) and quantified the expression level of known transcripts (Reference Transcriptome (RefT)). The ObsT included 77 623 transcripts (23 960 genes) covering 137 Mb (35 Mb new transcribed genome). Most of the transcripts (92%) were multi-exonic: 81% with known isoforms, 16% with new isoforms and 3% belonging to new genes. The RefT included 13 792 genes across 94 521 known transcripts. Mitochondrial genes were among the most highly expressed, accounting for about 10% of the reads. Of all the protein-coding genes in Gencode, 65% are expressed in the retina. We exploited inter-individual variability in gene expression to infer a gene co-expression network and to identify genes specifically expressed in photoreceptor cells. We experimentally validated the photoreceptors localization of three genes in human retina that had not been previously reported. RNA-seq data and the gene co-expression network are available online ( PMID:27235414

  16. DNA microarray analysis of genes differentially expressed in adipocyte differentiation

    Indian Academy of Sciences (India)

    Chunyan Yin; Yanfeng Xiao; Wei Zhang; Erdi Xu; Weihua Liu; Xiaoqing Yi; Ming Chang


    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a ≥ 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RT-PCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  17. Expression of HOX C homeobox genes in lymphoid cells. (United States)

    Lawrence, H J; Stage, K M; Mathews, C H; Detmer, K; Scibienski, R; MacKenzie, M; Migliaccio, E; Boncinelli, E; Largman, C


    The class I homeobox genes located in four clusters in mammalian genomes (HOX A, HOX B, HOX C, and HOX D) appear to play a major role in fetal development. Previous surveys of homeobox gene expression in human leukemic cell lines have shown that certain HOX A genes are expressed only in myeloid cell lines, whereas HOX B gene expression is largely restricted to cells with erythroid potential. We now report a survey of the expression patterns of 9 homeobox genes from the HOX C locus in a panel of 24 human and 7 murine leukemic cell lines. The most striking observation is the lymphoid-specific pattern of expression of HOX C4, located at the 3' end of the locus. A major transcript of 1.9 kilobases is observed in both T-cell and B-cell lines. HOX C4 expression is also detected in normal human marrow and peripheral blood lymphocytes, but not in mature granulocytes or monocytes. HOX C8 is also expressed in human lymphoid cells but is expressed in other blood cell types as well. However, the HOX C8 transcript pattern is lineage specific. These data, in conjunction with earlier findings, suggest that homeobox gene expression influences lineage determination during hematopoiesis.

  18. Seed-based biclustering of gene expression data.

    Directory of Open Access Journals (Sweden)

    Jiyuan An

    Full Text Available BACKGROUND: Accumulated biological research outcomes show that biological functions do not depend on individual genes, but on complex gene networks. Microarray data are widely used to cluster genes according to their expression levels across experimental conditions. However, functionally related genes generally do not show coherent expression across all conditions since any given cellular process is active only under a subset of conditions. Biclustering finds gene clusters that have similar expression levels across a subset of conditions. This paper proposes a seed-based algorithm that identifies coherent genes in an exhaustive, but efficient manner. METHODS: In order to find the biclusters in a gene expression dataset, we exhaustively select combinations of genes and conditions as seeds to create candidate bicluster tables. The tables have two columns (a a gene set, and (b the conditions on which the gene set have dissimilar expression levels to the seed. First, the genes with less than the maximum number of dissimilar conditions are identified and a table of these genes is created. Second, the rows that have the same dissimilar conditions are grouped together. Third, the table is sorted in ascending order based on the number of dissimilar conditions. Finally, beginning with the first row of the table, a test is run repeatedly to determine whether the cardinality of the gene set in the row is greater than the minimum threshold number of genes in a bicluster. If so, a bicluster is outputted and the corresponding row is removed from the table. Repeating this process, all biclusters in the table are systematically identified until the table becomes empty. CONCLUSIONS: This paper presents a novel biclustering algorithm for the identification of additive biclusters. Since it involves exhaustively testing combinations of genes and conditions, the additive biclusters can be found more readily.

  19. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    their duplicate were found to be under less purifying selection. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to macromolecular complexes, whereas paralogs with different expression levels were enriched in terms associated...... new functions, or their gene products are in a dosage balance. Regulatory DNA elements - some of which are conserved across species and hence called conserved non-coding sequences (CNSs) - that control expression of duplicated genes are thus under similar purifying selection. In the present study, I...... have performed in-depth analyses of paralogous genes in Arabidopsis thaliana, their expression profile, their sequence conservation, and their functions, in order to investigate the relationship between gene expression and retention of paralogous genes. Paralogs with lower expression than...

  20. Gene expression module-based chemical function similarity search


    Li, Yun; Hao, Pei; Zheng, Siyuan; Tu, Kang; Fan, Haiwei; Zhu, Ruixin; Ding, Guohui; Dong, Changzheng; Wang, Chuan; Li, Xuan; Thiesen, H.-J.; Chen, Y. Eugene; Jiang, HuaLiang; Liu, Lei; Li, Yixue


    Investigation of biological processes using selective chemical interventions is generally applied in biomedical research and drug discovery. Many studies of this kind make use of gene expression experiments to explore cellular responses to chemical interventions. Recently, some research groups constructed libraries of chemical related expression profiles, and introduced similarity comparison into chemical induced transcriptome analysis. Resembling sequence similarity alignment, expression pat...

  1. Gene Body Methylation can alter Gene Expression and is a Therapeutic Target in Cancer (United States)

    Yang, Xiaojing; Han, Han; De Carvalho, Daniel D.; Lay, Fides D.; Jones, Peter A.; Liang, Gangning


    SUMMARY DNA methylation in promoters is well known to silence genes and is the presumed therapeutic target of methylation inhibitors. Gene body methylation is positively correlated with expression yet its function is unknown. We show that 5-aza-2'-deoxycytidine treatment not only reactivates genes but decreases the over-expression of genes, many of which are involved in metabolic processes regulated by c-MYC. Down-regulation is caused by DNA demethylation of the gene bodies and restoration of high levels of expression requires remethylation by DNMT3B. Gene body methylation may therefore be an unexpected therapeutic target for DNA methylation inhibitors, resulting in the normalization of gene over-expression induced during carcinogenesis. Our results provide direct evidence for a causal relationship between gene body methylation and transcription. PMID:25263941

  2. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression. (United States)

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  3. Noise in gene expression is coupled to growth rate. (United States)

    Keren, Leeat; van Dijk, David; Weingarten-Gabbay, Shira; Davidi, Dan; Jona, Ghil; Weinberger, Adina; Milo, Ron; Segal, Eran


    Genetically identical cells exposed to the same environment display variability in gene expression (noise), with important consequences for the fidelity of cellular regulation and biological function. Although population average gene expression is tightly coupled to growth rate, the effects of changes in environmental conditions on expression variability are not known. Here, we measure the single-cell expression distributions of approximately 900 Saccharomyces cerevisiae promoters across four environmental conditions using flow cytometry, and find that gene expression noise is tightly coupled to the environment and is generally higher at lower growth rates. Nutrient-poor conditions, which support lower growth rates, display elevated levels of noise for most promoters, regardless of their specific expression values. We present a simple model of noise in expression that results from having an asynchronous population, with cells at different cell-cycle stages, and with different partitioning of the cells between the stages at different growth rates. This model predicts non-monotonic global changes in noise at different growth rates as well as overall higher variability in expression for cell-cycle-regulated genes in all conditions. The consistency between this model and our data, as well as with noise measurements of cells growing in a chemostat at well-defined growth rates, suggests that cell-cycle heterogeneity is a major contributor to gene expression noise. Finally, we identify gene and promoter features that play a role in gene expression noise across conditions. Our results show the existence of growth-related global changes in gene expression noise and suggest their potential phenotypic implications. PMID:26355006

  4. Gene Expression Prediction by Soft Integration and the Elastic Net—Best Performance of the DREAM3 Gene Expression Challenge


    Mika Gustafsson; Michael Hörnquist


    Background: To predict gene expressions is an important endeavour within computational systems biology. It can both be a way to explore how drugs affect the system, as well as providing a framework for finding which genes are interrelated in a certain process. A practical problem, however, is how to assess and discriminate among the various algorithms which have been developed for this purpose. Therefore, the DREAM project invited the year 2008 to a challenge for predicting gene expression va...

  5. The RosR transcription factor is required for gene expression dynamics in response to extreme oxidative stress in a hypersaline-adapted archaeon

    Directory of Open Access Journals (Sweden)

    Sharma Kriti


    Full Text Available Abstract Background Previous work has shown that the hypersaline-adapted archaeon, Halobacterium salinarum NRC-1, is highly resistant to oxidative stress caused by exposure to hydrogen peroxide, UV, and gamma radiation. Dynamic alteration of the gene regulatory network (GRN has been implicated in such resistance. However, the molecular functions of transcription regulatory proteins involved in this response remain unknown. Results Here we have reanalyzed several existing GRN and systems biology datasets for H. salinarum to identify and characterize a novel winged helix-turn-helix transcription factor, VNG0258H, as a regulator required for reactive oxygen species resistance in this organism. This protein appears to be unique to the haloarchaea at the primary sequence level. High throughput quantitative growth assays in a deletion mutant strain implicate VNG0258H in extreme oxidative stress resistance. According to time course gene expression analyses, this transcription factor is required for the appropriate dynamic response of nearly 300 genes to reactive oxygen species damage from paraquat and hydrogen peroxide. These genes are predicted to function in repair of oxidative damage to proteins and DNA. In vivo DNA binding assays demonstrate that VNG0258H binds DNA to mediate gene regulation. Conclusions Together these results suggest that VNG0258H is a novel archaeal transcription factor that regulates gene expression to enable adaptation to the extremely oxidative, hypersaline niche of H. salinarum. We have therefore renamed VNG0258H as RosR, for reactive oxygen species regulator.

  6. Extracting gene expression patterns and identifying co-expressed genes from microarray data reveals biologically responsive processes

    Directory of Open Access Journals (Sweden)

    Paules Richard S


    Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying

  7. Flies selected for longevity retain a young gene expression profile

    DEFF Research Database (Denmark)

    Sarup, Pernille Merete; Sørensen, Peter; Loeschcke, Volker


      We investigated correlated responses in the transcriptomes of longevity-selected lines of Drosophila melanogaster to identify pathways that affect life span in metazoan systems. We evaluated the gene expression profile in young, middle-aged, and old male flies, finding that 530 genes were...... differentially expressed between selected and control flies when measured at the same chronological age. The longevity-selected flies consistently showed expression profiles more similar to control flies one age class younger than control flies of the same age. This finding is in accordance with a younger gene...... expression profile in longevity-selected lines. Among the genes down-regulated in longevity-selected lines, we found a clear over-representation of genes involved in immune functions, supporting the hypothesis of a life-shortening effect of an overactive immune system, known as inflammaging. We judged...

  8. Positive selection on gene expression in the human brain

    DEFF Research Database (Denmark)

    Khaitovich, Philipp; Tang, Kun; Franz, Henriette;


    shows more changes than other tissues in the human lineage compared to the chimpanzee lineage [1] , [2] and [3] . There are two possible explanations for this: either positive selection drove more gene expression changes to fixation in the human brain than in the chimpanzee brain, or genes expressed...... in the brain experienced less purifying selection in humans than in chimpanzees, i.e. gene expression in the human brain is functionally less constrained. The first scenario would be supported if genes that changed their expression in the brain in the human lineage showed more selective sweeps than other genes....... Unfortunately, current human genome-wide DNA sequence variation do not allow signatures of selective sweeps to be inferred using frequency-based approaches [4] and [5] . However, estimates of linkage disequilibrium (LD) - i.e. the extent of non-random association of alleles along chromosomes - are expected...

  9. Computational gene expression profiling under salt stress reveals patterns of co-expression. (United States)

    Sanchita; Sharma, Ashok


    Plants respond differently to environmental conditions. Among various abiotic stresses, salt stress is a condition where excess salt in soil causes inhibition of plant growth. To understand the response of plants to the stress conditions, identification of the responsible genes is required. Clustering is a data mining technique used to group the genes with similar expression. The genes of a cluster show similar expression and function. We applied clustering algorithms on gene expression data of Solanum tuberosum showing differential expression in Capsicum annuum under salt stress. The clusters, which were common in multiple algorithms were taken further for analysis. Principal component analysis (PCA) further validated the findings of other cluster algorithms by visualizing their clusters in three-dimensional space. Functional annotation results revealed that most of the genes were involved in stress related responses. Our findings suggest that these algorithms may be helpful in the prediction of the function of co-expressed genes. PMID:26981411

  10. Gene expression profiles of Nitrosomonas europaea, an obligate chemolitotroph

    Energy Technology Data Exchange (ETDEWEB)

    Daniel J. Arp


    Nitrosomonas europaea is an aerobic lithoautotrophic bacterium that uses ammonia (NH3) as its energy source. As a nitrifier, it is an important participant in the nitrogen cycle, which can also influence the carbon cycle. The focus of this work was to explore the genetic structure and mechanisms underlying the lithoautotrophic growth style of N. europaea. Whole genome gene expression: The gene expression profile of cells in exponential growth and during starvation was analyzed using microarrays. During growth, 98% of the genes increased in expression at least two fold compared to starvation conditions. In growing cells, approximately 30% of the genes were expressed eight fold higher, Approximately 10% were expressed more than 15 fold higher. Approximately 3% (91 genes) were expressed to more than 20 fold of their levels in starved cells. Carbon fixation gene expression: N. europaea fixes carbon via the Calvin-Benson-Bassham (CBB) cycle via a type I ribulose bisphosphate carboxylase/oxygenase (RubisCO). This study showed that transcription of cbb genes was up-regulated when the carbon source was limited, while amo, hao and other energy harvesting related genes were down-regulated. Iron related gene expression: Because N. europaea has a relatively high content of hemes, sufficient Fe must be available in the medium for it to grow. The genome revealed that approximately 5% of the coding genes in N. europaea are dedicated to Fe transport and assimilation. Nonetheless, with the exception of citrate biosynthesis genes, N. europaea lacks genes for siderophore production. The Fe requirements for growth and the expression of the putative membrane siderophore receptors were determined. The N. europaea genome has over 100 putative genes ({approx}5% of the coding genes) related to Fe uptake and its siderophore receptors could be grouped phylogenetically in four clusters. Fe related genes, such as a number of TonB-dependent Fe-siderophore receptors for ferrichrome and

  11. Gene expression profiles of Nitrosomonas europaea, an obligate chemolitotroph

    Energy Technology Data Exchange (ETDEWEB)

    Daniel J Arp


    Nitrosomonas europaea is an aerobic lithoautotrophic bacterium that uses ammonia (NH3) as its energy source. As a nitrifier, it is an important participant in the nitrogen cycle, which can also influence the carbon cycle. The focus of this work was to explore the genetic structure and mechanisms underlying the lithoautotrophic growth style of N. europaea. Whole genome gene expression. The gene expression profile of cells in exponential growth and during starvation was analyzed using microarrays. During growth, 98% of the genes increased in expression at least two fold compared to starvation conditions. In growing cells, approximately 30% of the genes were expressed eight fold higher, Approximately 10% were expressed more than 15 fold higher. Approximately 3% (91 genes) were expressed to more than 20 fold of their levels in starved cells. Carbon fixation gene expression. N. europaea fixes carbon via the Calvin-Benson-Bassham (CBB) cycle via a type I ribulose bisphosphate carboxylase/oxygenase (RubisCO). This study showed that transcription of cbb genes was up-regulated when the carbon source was limited, while amo, hao and other energy harvesting related genes were down-regulated. Iron related gene expression. Because N. europaea has a relatively high content of hemes, sufficient Fe must be available in the medium for it to grow. The genome revealed that approximately 5% of the coding genes in N. europaea are dedicated to Fe transport and assimilation. Nonetheless, with the exception of citrate biosynthesis genes, N. europaea lacks genes for siderophore production. The Fe requirements for growth and the expression of the putative membrane siderophore receptors were determined. The N. europaea genome has over 100 putative genes ({approx}5% of the coding genes) related to Fe uptake and its siderophore receptors could be grouped phylogenetically in four clusters. Fe related genes, such as a number of TonB-dependent Fe-siderophore receptors for ferrichrome and

  12. Detecting microRNA activity from gene expression data.

    LENUS (Irish Health Repository)

    Madden, Stephen F


    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  13. Detecting microRNA activity from gene expression data

    LENUS (Irish Health Repository)

    Madden, Stephen F


    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  14. An Interactive Database of Cocaine-Responsive Gene Expression

    Directory of Open Access Journals (Sweden)

    Willard M. Freeman


    Full Text Available The postgenomic era of large-scale gene expression studies is inundating drug abuse researchers and many other scientists with findings related to gene expression. This information is distributed across many different journals, and requires laborious literature searches. Here, we present an interactive database that combines existing information related to cocaine-mediated changes in gene expression in an easy-to-use format. The database is limited to statistically significant changes in mRNA or protein expression after cocaine administration. The Flash-based program is integrated into a Web page, and organizes changes in gene expression based on neuroanatomical region, general function, and gene name. Accompanying each gene is a description of the gene, links to the original publications, and a link to the appropriate OMIM (Online Mendelian Inheritance in Man entry. The nature of this review allows for timely modifications and rapid inclusion of new publications, and should help researchers build second-generation hypotheses on the role of gene expression changes in the physiology and behavior of cocaine abuse. Furthermore, this method of organizing large volumes of scientific information can easily be adapted to assist researchers in fields outside of drug abuse.

  15. Expression of homeobox genes in the mouse olfactory epithelium. (United States)

    Parrilla, Marta; Chang, Isabelle; Degl'Innocenti, Andrea; Omura, Masayo


    Homeobox genes constitute a large family of genes widely studied because of their role in the establishment of the body pattern. However, they are also involved in many other events during development and adulthood. The main olfactory epithelium (MOE) is an excellent model to study neurogenesis in the adult nervous system. Analyses of homeobox genes during development show that some of these genes are involved in the formation and establishment of cell diversity in the MOE. Moreover, the mechanisms of expression of odorant receptors (ORs) constitute one of the biggest enigmas in the field. Analyses of OR promoters revealed the presence of homeodomain binding sites in their sequences. Here we characterize the expression patterns of a set of 49 homeobox genes in the MOE with in situ hybridization. We found that seven of them (Dlx3, Dlx5, Dlx6, Msx1, Meis1, Isl1, and Pitx1) are zonally expressed. The homeobox gene Emx1 is expressed in three guanylate cyclase(+) populations, two located in the MOE and the third one in an olfactory subsystem known as Grüneberg ganglion located at the entrance of the nasal cavity. The homeobox gene Tshz1 is expressed in a unique patchy pattern across the MOE. Our findings provide new insights to guide functional studies that aim to understand the complexity of transcription factor expression and gene regulation in the MOE. J. Comp. Neurol. 524:2713-2739, 2016. © 2016 Wiley Periodicals, Inc. PMID:27243442

  16. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    Directory of Open Access Journals (Sweden)

    Emond Mary


    Full Text Available Abstract Background Marfan syndrome (MFS is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value -6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status. An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater.

  17. Applications of Little's Law to stochastic models of gene expression

    CERN Document Server

    Elgart, Vlad; Kulkarni, Rahul V


    The intrinsic stochasticity of gene expression can lead to large variations in protein levels across a population of cells. To explain this variability, different sources of mRNA fluctuations ('Poisson' and 'Telegraph' processes) have been proposed in stochastic models of gene expression. Both Poisson and Telegraph scenario models explain experimental observations of noise in protein levels in terms of 'bursts' of protein expression. Correspondingly, there is considerable interest in establishing relations between burst and steady-state protein distributions for general stochastic models of gene expression. In this work, we address this issue by considering a mapping between stochastic models of gene expression and problems of interest in queueing theory. By applying a general theorem from queueing theory, Little's Law, we derive exact relations which connect burst and steady-state distribution means for models with arbitrary waiting-time distributions for arrival and degradation of mRNAs and proteins. The de...

  18. The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes. (United States)

    Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques


    The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

  19. Novel redox nanomedicine improves gene expression of polyion complex vector

    International Nuclear Information System (INIS)

    Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS) affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP) as an ROS scavenger. When polyethyleneimine (PEI)/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI)/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF)-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

  20. Novel redox nanomedicine improves gene expression of polyion complex vector (United States)

    Toh, Kazuko; Yoshitomi, Toru; Ikeda, Yutaka; Nagasaki, Yukio


    Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS) affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP) as an ROS scavenger. When polyethyleneimine (PEI)/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI)/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF)-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

  1. Novel redox nanomedicine improves gene expression of polyion complex vector

    Directory of Open Access Journals (Sweden)

    Kazuko Toh, Toru Yoshitomi, Yutaka Ikeda and Yukio Nagasaki


    Full Text Available Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP as an ROS scavenger. When polyethyleneimine (PEI/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

  2. Design and Implementation of Visual Dynamic Display Software of Gene Expression Based on GTK

    Institute of Scientific and Technical Information of China (English)

    JIANG Wei; MENG Fanjiang; LI Yong; YU Xiao


    The paper presented an implement method for a dynamic gene expression display software based on the GTK. This method established the dynamic presentation system of gene expression which according to gene expression data from gene chip hybridize at different time, adopted a linearity combination model and Pearson correlation coefficient algorithm. The system described the gene expression changes in graphic form, the gene expression changes with time and the changes in characteristics of the gene expression, also the changes in relations of the gene expression and regulation relationships among genes. The system also provided an integrated platform for analysis on gene chips data, especially for the research on the network of gene regulation.

  3. Integrated analysis of DNA methylation profiles and gene expression profiles to identify genes associated with pilocytic astrocytomas


    Zhou, Ruigang; MAN, YIGANG


    The present study performed an integral analysis of the gene expression and DNA methylation profile of pilocytic astrocytomas (PAs). Weighted gene co-expression network analysis (WGCNA) was also performed to examine and identify the genes correlated to PAs, to identify candidate therapeutic targets for the treatment of PAs. The DNA methylation profile and gene expression profile were downloaded from the Gene Expression Omnibus database. Following screening of the differentially expressed gene...

  4. Crystal structure of an archaeal actin homolog. (United States)

    Roeben, Annette; Kofler, Christine; Nagy, István; Nickell, Stephan; Hartl, F Ulrich; Bracher, Andreas


    Prokaryotic homologs of the eukaryotic structural protein actin, such as MreB and ParM, have been implicated in determination of bacterial cell shape, and in the segregation of genomic and plasmid DNA. In contrast to these bacterial actin homologs, little is known about the archaeal counterparts. As a first step, we expressed a predicted actin homolog of the thermophilic archaeon Thermoplasma acidophilum, Ta0583, and determined its crystal structure at 2.1A resolution. Ta0583 is expressed as a soluble protein in T.acidophilum and is an active ATPase at physiological temperature. In vitro, Ta0583 forms sheets with spacings resembling the crystal lattice, indicating an inherent propensity to form filamentous structures. The fold of Ta0583 contains the core structure of actin and clearly belongs to the actin/Hsp70 superfamily of ATPases. Ta0583 is approximately equidistant from actin and MreB on the structural level, and combines features from both eubacterial actin homologs, MreB and ParM. The structure of Ta0583 co-crystallized with ADP indicates that the nucleotide binds at the interface between the subdomains of Ta0583 in a manner similar to that of actin. However, the conformation of the nucleotide observed in complex with Ta0583 clearly differs from that in complex with actin, but closely resembles the conformation of ParM-bound nucleotide. On the basis of sequence and structural homology, we suggest that Ta0583 derives from a ParM-like actin homolog that was once encoded by a plasmid and was transferred into a common ancestor of Thermoplasma and Ferroplasma. Intriguingly, both genera are characterized by the lack of a cell wall, and therefore Ta0583 could have a function in cellular organization.

  5. Gene expression profiling reveals multiple toxicity endpoints induced by hepatotoxicants

    Energy Technology Data Exchange (ETDEWEB)

    Huang Qihong; Jin Xidong; Gaillard, Elias T.; Knight, Brian L.; Pack, Franklin D.; Stoltz, James H.; Jayadev, Supriya; Blanchard, Kerry T


    Microarray technology continues to gain increased acceptance in the drug development process, particularly at the stage of toxicology and safety assessment. In the current study, microarrays were used to investigate gene expression changes associated with hepatotoxicity, the most commonly reported clinical liability with pharmaceutical agents. Acetaminophen, methotrexate, methapyrilene, furan and phenytoin were used as benchmark compounds capable of inducing specific but different types of hepatotoxicity. The goal of the work was to define gene expression profiles capable of distinguishing the different subtypes of hepatotoxicity. Sprague-Dawley rats were orally dosed with acetaminophen (single dose, 4500 mg/kg for 6, 24 and 72 h), methotrexate (1 mg/kg per day for 1, 7 and 14 days), methapyrilene (100 mg/kg per day for 3 and 7 days), furan (40 mg/kg per day for 1, 3, 7 and 14 days) or phenytoin (300 mg/kg per day for 14 days). Hepatic gene expression was assessed using toxicology-specific gene arrays containing 684 target genes or expressed sequence tags (ESTs). Principal component analysis (PCA) of gene expression data was able to provide a clear distinction of each compound, suggesting that gene expression data can be used to discern different hepatotoxic agents and toxicity endpoints. Gene expression data were applied to the multiplicity-adjusted permutation test and significantly changed genes were categorized and correlated to hepatotoxic endpoints. Repression of enzymes involved in lipid oxidation (acyl-CoA dehydrogenase, medium chain, enoyl CoA hydratase, very long-chain acyl-CoA synthetase) were associated with microvesicular lipidosis. Likewise, subsets of genes associated with hepatotocellular necrosis, inflammation, hepatitis, bile duct hyperplasia and fibrosis have been identified. The current study illustrates that expression profiling can be used to: (1) distinguish different hepatotoxic endpoints; (2) predict the development of toxic endpoints; and

  6. Molecular subsets in the gene expression signatures of scleroderma skin.

    Directory of Open Access Journals (Sweden)

    Ausra Milano

    Full Text Available BACKGROUND: Scleroderma is a clinically heterogeneous disease with a complex phenotype. The disease is characterized by vascular dysfunction, tissue fibrosis, internal organ dysfunction, and immune dysfunction resulting in autoantibody production. METHODOLOGY AND FINDINGS: We analyzed the genome-wide patterns of gene expression with DNA microarrays in skin biopsies from distinct scleroderma subsets including 17 patients with systemic sclerosis (SSc with diffuse scleroderma (dSSc, 7 patients with SSc with limited scleroderma (lSSc, 3 patients with morphea, and 6 healthy controls. 61 skin biopsies were analyzed in a total of 75 microarray hybridizations. Analysis by hierarchical clustering demonstrates nearly identical patterns of gene expression in 17 out of 22 of the forearm and back skin pairs of SSc patients. Using this property of the gene expression, we selected a set of 'intrinsic' genes and analyzed the inherent data-driven groupings. Distinct patterns of gene expression separate patients with dSSc from those with lSSc and both are easily distinguished from normal controls. Our data show three distinct patient groups among the patients with dSSc and two groups among patients with lSSc. Each group can be distinguished by unique gene expression signatures indicative of proliferating cells, immune infiltrates and a fibrotic program. The intrinsic groups are statistically significant (p<0.001 and each has been mapped to clinical covariates of modified Rodnan skin score, interstitial lung disease, gastrointestinal involvement, digital ulcers, Raynaud's phenomenon and disease duration. We report a 177-gene signature that is associated with severity of skin disease in dSSc. CONCLUSIONS AND SIGNIFICANCE: Genome-wide gene expression profiling of skin biopsies demonstrates that the heterogeneity in scleroderma can be measured quantitatively with DNA microarrays. The diversity in gene expression demonstrates multiple distinct gene expression programs

  7. Dopamine receptor-mediated regulation of neuronal "clock" gene expression. (United States)

    Imbesi, M; Yildiz, S; Dirim Arslan, A; Sharma, R; Manev, H; Uz, T


    Using a transgenic mice model (i.e. "clock" knockouts), clock transcription factors have been suggested as critical regulators of dopaminergic behaviors induced by drugs of abuse. Moreover, it has been shown that systemic administration of psychostimulants, such as cocaine and methamphetamine regulates the striatal expression of clock genes. However, it is not known whether dopamine receptors mediate these regulatory effects of psychostimulants at the cellular level. Primary striatal neurons in culture express dopamine receptors as well as clock genes and have been successfully used in studying dopamine receptor functioning. Therefore, we investigated the role of dopamine receptors on neuronal clock gene expression in this model using specific receptor agonists. We found an inhibitory effect on the expression of mClock and mPer1 genes with the D2-class (i.e. D2/D3) receptor agonist quinpirole. We also found a generalized stimulatory effect on the expression of clock genes mPer1, mClock, mNPAS2 (neuronal PAS domain protein 2), and mBmal1 with the D1-class (i.e. D1) receptor agonist SKF38393. Further, we tested whether systemic administration of dopamine receptor agonists causes similar changes in striatal clock gene expression in vivo. We found quinpirole-induced alterations in mPER1 protein levels in the mouse striatum (i.e. rhythm shift). Collectively, our results indicate that the dopamine receptor system may mediate psychostimulant-induced changes in clock gene expression. Using striatal neurons in culture as a model, further research is needed to better understand how dopamine signaling modulates the expression dynamics of clock genes (i.e. intracellular signaling pathways) and thereby influences neuronal gene expression, neuronal transmission, and brain functioning. PMID:19017537

  8. Gene Expression Profiling Predicts Survival in Conventional Renal Cell Carcinoma.

    Directory of Open Access Journals (Sweden)


    Full Text Available BACKGROUND: Conventional renal cell carcinoma (cRCC accounts for most of the deaths due to kidney cancer. Tumor stage, grade, and patient performance status are used currently to predict survival after surgery. Our goal was to identify gene expression features, using comprehensive gene expression profiling, that correlate with survival. METHODS AND FINDINGS: Gene expression profiles were determined in 177 primary cRCCs using DNA microarrays. Unsupervised hierarchical clustering analysis segregated cRCC into five gene expression subgroups. Expression subgroup was correlated with survival in long-term follow-up and was independent of grade, stage, and performance status. The tumors were then divided evenly into training and test sets that were balanced for grade, stage, performance status, and length of follow-up. A semisupervised learning algorithm (supervised principal components analysis was applied to identify transcripts whose expression was associated with survival in the training set, and the performance of this gene expression-based survival predictor was assessed using the test set. With this method, we identified 259 genes that accurately predicted disease-specific survival among patients in the independent validation group (p < 0.001. In multivariate analysis, the gene expression predictor was a strong predictor of survival independent of tumor stage, grade, and performance status (p < 0.001. CONCLUSIONS: cRCC displays molecular heterogeneity and can be separated into gene expression subgroups that correlate with survival after surgery. We have identified a set of 259 genes that predict survival after surgery independent of clinical prognostic factors.

  9. Bacterial and Archaeal Diversity From the Eastern Lau Spreading Center (United States)

    Reysenbach, A.; Banta, A.; Kelly, S.; Kirshstein, J.; Voytek, M.


    Due to the diversity of venting styles, geological settings and variations in fluid geochemistry, the Valu Fa Ridge and Eastern Lau Spreading Center (ELSC) provide a unique opportunity to explore the effects geological and geochemical variables on patterns of microbial phylogenetic and metabolic diversity. High temperature sulfides, diffuse flow fluids and microbial mats were collected from six active vent fields on the Valu Fa Ridge and Eastern Lau Spreading Center during the R/V Melville cruise TUIM05MV. All samples were subsampled for molecular and microbial culturing purposes. The archaeal and bacterial 16S rRNA genes were amplified by PCR from a selection of samples. Additionally, the presence of Aquificales and an unidentified lineage, the DHVE archaeal group, was explored using PCR primers specific for these groups. A selection of DNAs were also screened for functional genes that are diagnostic for certain pathways, viz, aclB (reductive TCA cycle), mcrA (methanogenesis), nirS and nirK (nitrite reduction), amoA (ammonia oxidation). Culturing of thermophiles, both acidophiles and neutrophiles, was initiated. Over 20 hydrogen oxidizing (hydrogen and oxygen) or nitrate reducing (hydrogen and nitrate) chemolithoautotrophs were isolated as colonies and grow at 70 degrees C. All are related to Persephonella hydrogenophila, with the exception of 2 cultures that perhaps represent new species of Hydrogenivirga and Aquifex. Preliminary analysis of patterns of Aquificales diversity using both culturing and molecular approaches suggest that the distributions of this group alone are very different from that observed at other hydrothermal sites such as along the East Pacific Rise or Central Indian Ridge. As yet, the most commonly isolated Aquificales, P. marina, has not been detected in enrichment cultures from ELSC, and the diversity of Aquificales-related sequences is much greater than detected from sites along the EPR. It is therefore also likely, that patterns of

  10. Differential network analysis from cross-platform gene expression data (United States)

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong


    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  11. Spatial gene expression quantification in changing morphologies

    NARCIS (Netherlands)

    D. Botman


    In systems biology, an organisms’ behavior is explained from the interactions among individual components such as genes and proteins. With few exceptions, interactions among genes and proteins are not measured directly and are therefore inferred from the observed output of a biological system. A net

  12. In plants, expression breadth and expression level distinctly and non-linearly correlate with gene structure

    Directory of Open Access Journals (Sweden)

    Yang Hangxing


    Full Text Available Abstract Background Compactness of highly/broadly expressed genes in human has been explained as selection for efficiency, regional mutation biases or genomic design. However, highly expressed genes in flowering plants were shown to be less compact than lowly expressed ones. On the other hand, opposite facts have also been documented that pollen-expressed Arabidopsis genes tend to contain shorter introns and highly expressed moss genes are compact. This issue is important because it provides a chance to compare the selectionism and the neutralism views about genome evolution. Furthermore, this issue also helps to understand the fates of introns, from the angle of gene expression. Results In this study, I used expression data covering more tissues and employ new analytical methods to reexamine the correlations between gene expression and gene structure for two flowering plants, Arabidopsis thaliana and Oryza sativa. It is shown that, different aspects of expression pattern correlate with different parts of gene sequences in distinct ways. In detail, expression level is significantly negatively correlated with gene size, especially the size of non-coding regions, whereas expression breadth correlates with non-coding structural parameters positively and with coding region parameters negatively. Furthermore, the relationships between expression level and structural parameters seem to be non-linear, with the extremes of structural parameters possibly scale as power-laws or logrithmic functions of expression levels. Conclusion In plants, highly expressed genes are compact, especially in the non-coding regions. Broadly expressed genes tend to contain longer non-coding sequences, which may be necessary for complex regulations. In combination with previous studies about other plants and about animals, some common scenarios about the correlation between gene expression and gene structure begin to emerge. Based on the functional relationships between

  13. State-related alterations of gene expression in bipolar disorder

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Vinberg, Maj; Berk, Michael;


    Munkholm K, Vinberg M, Berk M, Kessing LV. State-related alterations of gene expression in bipolar disorder: a systematic review. Bipolar Disord 2012: 14: 684-696. © 2012 The Authors. Journal compilation © 2012 John Wiley & Sons A/S. Objective:  Alterations in gene expression in bipolar disorder...... on comprehensive database searches for studies on gene expression in patients with bipolar disorder in specific mood states, was conducted. We searched Medline, Embase, PsycINFO, and The Cochrane Library, supplemented by manually searching reference lists from retrieved publications. Results:  A total of 17...

  14. Gene expression signatures for colorectal cancer microsatellite status and HNPCC

    DEFF Research Database (Denmark)

    Kruhøffer, M; Jensen, J L; Laiho, P;


    is correlated to prognosis and response to chemotherapy. Gene expression signatures as predictive markers are being developed for many cancers, and the identification of a signature for MMR deficiency would be of interest both clinically and biologically. To address this issue, we profiled the gene expression......-deficient tumours into sporadic MSI and HNPCC cases, and validated this by a mathematical cross-validation approach. The demonstration that this two-step classification approach can identify MSI as well as HNPCC cases merits further gene expression studies to identify prognostic signatures....

  15. Gene expression during testis development in Duroc boars

    DEFF Research Database (Denmark)

    Lervik, Siri; Kristoffersen, Anja Bråthen; Conley, Lene;


    . Nine clusters of genes with significant differential expression over time and 49 functional charts were found in the analysed testis samples. Prominent pathways in the prepubertal testis were associated with tissue renewal, cell respiration and increased endocytocis. E-cadherines may be associated...... with the onset of pubertal development. With elevated steroidogenesis (weeks 16 to 27), there was an increase in the expression of genes in the MAPK pathway, STAR and its analogue STARD6. A pubertal shift in genes coding for cellular cholesterol transport was observed. Increased expression of meiotic pathways...

  16. pH dominates variation in tropical soil archaeal diversity and community structure. (United States)

    Tripathi, Binu M; Kim, Mincheol; Lai-Hoe, Ang; Shukor, Nor A A; Rahim, Raha A; Go, Rusea; Adams, Jonathan M


    Little is known of the factors influencing soil archaeal community diversity and composition in the tropics. We sampled soils across a range of forest and nonforest environments in the equatorial tropics of Malaysia, covering a wide range of pH values. DNA was PCR-amplified for the V1-V3 region of the 16S rRNA gene, and 454-pyrosequenced. Soil pH was the best predictor of diversity and community composition of Archaea, being a stronger predictor than land use. Archaeal OTU richness was highest in the most acidic soils. Overall archaeal abundance in tropical soils (determined by qPCR) also decreased at higher pH. This contrasts with the opposite trend previously found in temperate soils. Thaumarcheota group 1.1b was more abundant in alkaline soils, whereas group 1.1c was only detected in acidic soils. These results parallel those found in previous studies in cooler climates, emphasizing niche conservatism among broad archaeal groups. Among the most abundant operational taxonomic units (OTUs), there was clear evidence of niche partitioning by pH. No individual OTU occurred across the entire range of pH values. Overall, the results of this study show that pH plays a major role in structuring tropical soil archaeal communities.

  17. Composition of bacterial and archaeal communities during landfill refuse decomposition processes. (United States)

    Song, Liyan; Wang, Yangqing; Zhao, Heping; Long, David T


    Little is known about the archaeal and the bacterial diversities in a landfill during different phases of decomposition. In this study, the archaeal and the bacterial diversities of Laogang landfill (Shanghai, China) at two different decomposition phases (i.e., initial methanogenic phase (IMP) and stable methanogenic phase (SMP)), were culture-independently examined using PCR-based 454 pyrosequencing. A total of 47,753 sequences of 16S rRNA genes were retrieved from 69,954 reads and analyzed to evaluate the diversities of the archaeal and bacterial communities. The most predominant types of archaea were hydrogenotrophic Methanomicrobiales, and of bacteria were Proteobacteria, Firmicutes, and Bacteroidetes. As might be expected, their abundances varied at decomposition phases. Archaea Methanomicrobiales accounts for 97.6% of total archaeal population abundance in IMP and about 57.6% in SMP. The abundance of archaeal genus Halobacteriale was 0.1% in IMP and was 20.3% in the SMP. The abundance of Firmicutes was 21.3% in IMP and was 4.3% in SMP. The abundance of Bacteroidetes represented 11.5% of total bacterial in IMP and was dominant (49.4%) in SMP. Both the IMP and SMP had unique cellulolytic bacteria compositions. IMP consisted of members of Bacillus, Fibrobacter, and Eubacterium, while SMP harbored groups of Microbacterium. Both phases had Clostridium with different abundance, 4-5 folds higher in SMP.

  18. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring

    Directory of Open Access Journals (Sweden)

    Sonu Bhatia


    Full Text Available The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche.

  19. A longitudinal study of gene expression in healthy individuals

    Directory of Open Access Journals (Sweden)

    Tessier Michel


    Full Text Available Abstract Background The use of gene expression in venous blood either as a pharmacodynamic marker in clinical trials of drugs or as a diagnostic test requires knowledge of the variability in expression over time in healthy volunteers. Here we defined a normal range of gene expression over 6 months in the blood of four cohorts of healthy men and women who were stratified by age (22–55 years and > 55 years and gender. Methods Eleven immunomodulatory genes likely to play important roles in inflammatory conditions such as rheumatoid arthritis and infection in addition to four genes typically used as reference genes were examined by quantitative reverse transcription-polymerase chain reaction (qRT-PCR, as well as the full genome as represented by Affymetrix HG U133 Plus 2.0 microarrays. Results Gene expression levels as assessed by qRT-PCR and microarray were relatively stable over time with ~2% of genes as measured by microarray showing intra-subject differences over time periods longer than one month. Fifteen genes varied by gender. The eleven genes examined by qRT-PCR remained within a limited dynamic range for all individuals. Specifically, for the seven most stably expressed genes (CXCL1, HMOX1, IL1RN, IL1B, IL6R, PTGS2, and TNF, 95% of all samples profiled fell within 1.5–2.5 Ct, the equivalent of a 4- to 6-fold dynamic range. Two subjects who experienced severe adverse events of cancer and anemia, had microarray gene expression profiles that were distinct from normal while subjects who experienced an infection had only slightly elevated levels of inflammatory markers. Conclusion This study defines the range and variability of gene expression in healthy men and women over a six-month period. These parameters can be used to estimate the number of subjects needed to observe significant differences from normal gene expression in clinical studies. A set of genes that varied by gender was also identified as were a set of genes with elevated

  20. Membrane channel gene expression in human costal and articular chondrocytes. (United States)

    Asmar, A; Barrett-Jolley, R; Werner, A; Kelly, R; Stacey, M


    Chondrocytes are the uniquely resident cells found in all types of cartilage and key to their function is the ability to respond to mechanical loads with changes of metabolic activity. This mechanotransduction property is, in part, mediated through the activity of a range of expressed transmembrane channels; ion channels, gap junction proteins, and porins. Appropriate expression of ion channels has been shown essential for production of extracellular matrix and differential expression of transmembrane channels is correlated to musculoskeletal diseases such as osteoarthritis and Albers-Schönberg. In this study we analyzed the consistency of gene expression between channelomes of chondrocytes from human articular and costal (teenage and fetal origin) cartilages. Notably, we found 14 ion channel genes commonly expressed between articular and both types of costal cartilage chondrocytes. There were several other ion channel genes expressed only in articular (6 genes) or costal chondrocytes (5 genes). Significant differences in expression of BEST1 and KCNJ2 (Kir2.1) were observed between fetal and teenage costal cartilage. Interestingly, the large Ca(2+) activated potassium channel (BKα, or KCNMA1) was very highly expressed in all chondrocytes examined. Expression of the gap junction genes for Panx1, GJA1 (Cx43) and GJC1 (Cx45) was also observed in chondrocytes from all cartilage samples. Together, this data highlights similarities between chondrocyte membrane channel gene expressions in cells derived from different anatomical sites, and may imply that common electrophysiological signaling pathways underlie cellular control. The high expression of a range of mechanically and metabolically sensitive membrane channels suggest that chondrocyte mechanotransduction may be more complex than previously thought. PMID:27116676

  1. Integration of biological networks and gene expression data using Cytoscape

    DEFF Research Database (Denmark)

    Cline, M.S.; Smoot, M.; Cerami, E.;


    Cytoscape is a free software package for visualizing, modeling and analyzing molecular and genetic interaction networks. This protocol explains how to use Cytoscape to analyze the results of mRNA expression profiling, and other functional genomics and proteomics experiments, in the context...... of an interaction network obtained for genes of interest. Five major steps are described: (i) obtaining a gene or protein network, (ii) displaying the network using layout algorithms, (iii) integrating with gene expression and other functional attributes, (iv) identifying putative complexes and functional modules...... and (v) identifying enriched Gene Ontology annotations in the network. These steps provide a broad sample of the types of analyses performed by Cytoscape....

  2. Prediction of Tumor Outcome Based on Gene Expression Data

    Institute of Scientific and Technical Information of China (English)

    Liu Juan; Hitoshi Iba


    Gene expression microarray data can be used to classify tumor types. We proposed a new procedure to classify human tumor samples based on microarray gene expressions by using a hybrid supervised learning method called MOEA+WV (Multi-Objective Evolutionary Algorithm+Weighted Voting). MOEA is used to search for a relatively few subsets of informative genes from the high-dimensional gene space, and WV is used as a classification tool. This new method has been applied to predicate the subtypes of lymphoma and outcomes of medulloblastoma. The results are relatively accurate and meaningful compared to those from other methods.

  3. Reference genes for gene expression studies in wheat flag leaves grown under different farming conditions

    Directory of Open Access Journals (Sweden)

    Cordeiro Raposo Fernando


    Full Text Available Abstract Background Internal control genes with highly uniform expression throughout the experimental conditions are required for accurate gene expression analysis as no universal reference genes exists. In this study, the expression stability of 24 candidate genes from Triticum aestivum cv. Cubus flag leaves grown under organic and conventional farming systems was evaluated in two locations in order to select suitable genes that can be used for normalization of real-time quantitative reverse-transcription PCR (RT-qPCR reactions. The genes were selected among the most common used reference genes as well as genes encoding proteins involved in several metabolic pathways. Findings Individual genes displayed different expression rates across all samples assayed. Applying geNorm, a set of three potential reference genes were suitable for normalization of RT-qPCR reactions in winter wheat flag leaves cv. Cubus: TaFNRII (ferredoxin-NADP(H oxidoreductase; AJ457980.1, ACT2 (actin 2; TC234027, and rrn26 (a putative homologue to RNA 26S gene; AL827977.1. In addition of these three genes that were also top-ranked by NormFinder, two extra genes: CYP18-2 (Cyclophilin A, AY456122.1 and TaWIN1 (14-3-3 like protein, AB042193 were most consistently stably expressed. Furthermore, we showed that TaFNRII, ACT2, and CYP18-2 are suitable for gene expression normalization in other two winter wheat varieties (Tommi and Centenaire grown under three treatments (organic, conventional and no nitrogen and a different environment than the one tested with cv. Cubus. Conclusions This study provides a new set of reference genes which should improve the accuracy of gene expression analyses when using wheat flag leaves as those related to the improvement of nitrogen use efficiency for cereal production.

  4. Metagenomic evaluation of bacterial and archaeal diversity in the geothermal hot springs of manikaran, India. (United States)

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Green, Stefan J; Joshi, Amit; Chauhan, Ashvini


    Bacterial and archaeal diversity in geothermal spring water were investigated using 16S rRNA gene amplicon metagenomic sequencing. This revealed the dominance of Firmicutes, Aquificae, and the Deinococcus-Thermus group in this thermophilic environment. A number of sequences remained taxonomically unresolved, indicating the presence of potentially novel microbes in this unique habitat.

  5. Simultaneous tracking of fly movement and gene expression using GFP

    Directory of Open Access Journals (Sweden)

    Tavaré Simon


    Full Text Available Abstract Background Green Fluorescent Protein (GFP is used extensively as a reporter for transgene expression in Drosophila and other organisms. However, GFP has not generally been used as a reporter for circadian patterns of gene expression, and it has not previously been possible to correlate patterns of reporter expression with 3D movement and behavior of transgenic animals. Results We present a video tracking system that allows tissue-specific GFP expression to be quantified and correlated with 3D animal movement in real time. eyeless/Pax6 reporter expression had a 12 hr period that correlated with fly activity levels. hsp70 and hsp22 gene reporters were induced during fly aging in circadian patterns (24 hr and 18 hr periods, respectively, and spiked in the hours preceding and overlapping the death of the animal. The phase of hsp gene reporter expression relative to fly activity levels was different for each fly, and remained the same throughout the life span. Conclusion These experiments demonstrate that GFP can readily be used to assay longitudinally fly movement and tissue-specific patterns of gene expression. The hsp22-GFP and hsp70-GFP expression patterns were found to reflect accurately the endogenous gene expression patterns, including induction during aging and circadian periodicity. The combination of these new tracking methods with the hsp-GFP reporters revealed additional information, including a spike in hsp22 and hsp70 reporter expression preceding death, and an intriguing fly-to-fly variability in the phase of hsp70 and hsp22 reporter expression patterns. These methods allow specific temporal patterns of gene expression to be correlated with temporal patterns of animal activity, behavior and mortality.

  6. Imputing Gene Expression in Uncollected Tissues Within and Beyond GTEx (United States)

    Wang, Jiebiao; Gamazon, Eric R.; Pierce, Brandon L.; Stranger, Barbara E.; Im, Hae Kyung; Gibbons, Robert D.; Cox, Nancy J.; Nicolae, Dan L.; Chen, Lin S.


    Gene expression and its regulation can vary substantially across tissue types. In order to generate knowledge about gene expression in human tissues, the Genotype-Tissue Expression (GTEx) program has collected transcriptome data in a wide variety of tissue types from post-mortem donors. However, many tissue types are difficult to access and are not collected in every GTEx individual. Furthermore, in non-GTEx studies, the accessibility of certain tissue types greatly limits the feasibility and scale of studies of multi-tissue expression. In this work, we developed multi-tissue imputation methods to impute gene expression in uncollected or inaccessible tissues. Via simulation studies, we showed that the proposed methods outperform existing imputation methods in multi-tissue expression imputation and that incorporating imputed expression data can improve power to detect phenotype-expression correlations. By analyzing data from nine selected tissue types in the GTEx pilot project, we demonstrated that harnessing expression quantitative trait loci (eQTLs) and tissue-tissue expression-level correlations can aid imputation of transcriptome data from uncollected GTEx tissues. More importantly, we showed that by using GTEx data as a reference, one can impute expression levels in inaccessible tissues in non-GTEx expression studies. PMID:27040689

  7. Differential gene expression between visceral and subcutaneous fat depots. (United States)

    Atzmon, G; Yang, X M; Muzumdar, R; Ma, X H; Gabriely, I; Barzilai, N


    Abdominal obesity has been linked to the development of insulin resistance and Type 2 diabetes mellitus (DM2). By surgical removal of visceral fat (VF) in a variety of rodent models, we prevented insulin resistance and glucose intolerance, establishing a cause-effect relationship between VF and the metabolic syndrome. To characterize the biological differences between visceral and peripheral fat depots, we obtained perirenal visceral (VF) and subcutaneous (SC) fat from 5 young rats. We extracted mRNA from the fat tissue and performed gene array hybridization using Affymetrix technology with a platform containing 9 000 genes. Out of the 1 660 genes that were expressed in fat tissue, 297 (17.9 %) genes show a two-fold or higher difference in their expression between the two tissues. We present the 20 genes whose expression is higher in VF fat (by 3 - 7 fold) and the 20 genes whose expression is higher in SC fat (by 3 - 150 fold), many of which are predominantly involved in glucose homeostasis, insulin action, and lipid metabolism. We confirmed the findings of gene array expression and quantified the changes in expression in VF of genes involved in insulin resistance (PPARgamma leptin) and its syndrome (angiotensinogen and plasminogen activating inhibitor-1, PAI-1) by real-time PCR (qRT-PCR) technology. Finally, we demonstrated increased expression of resistin in VF by around 12-fold and adiponectin by around 4-fold, peptides that were not part of the gene expression platform. These results indicate that visceral fat and subcutaneous fat are biologically distinct. PMID:12660871

  8. SIGNATURE: A workbench for gene expression signature analysis

    Directory of Open Access Journals (Sweden)

    Chang Jeffrey T


    Full Text Available Abstract Background The biological phenotype of a cell, such as a characteristic visual image or behavior, reflects activities derived from the expression of collections of genes. As such, an ability to measure the expression of these genes provides an opportunity to develop more precise and varied sets of phenotypes. However, to use this approach requires computational methods that are difficult to implement and apply, and thus there is a critical need for intelligent software tools that can reduce the technical burden of the analysis. Tools for gene expression analyses are unusually difficult to implement in a user-friendly way because their application requires a combination of biological data curation, statistical computational methods, and database expertise. Results We have developed SIGNATURE, a web-based resource that simplifies gene expression signature analysis by providing software, data, and protocols to perform the analysis successfully. This resource uses Bayesian methods for processing gene expression data coupled with a curated database of gene expression signatures, all carried out within a GenePattern web interface for easy use and access. Conclusions SIGNATURE is available for public use at

  9. [Expression of bioinformatically identified genes in skin of psoriasis patients]. (United States)


    Gene expression analysis for EPHA2 (EPH receptor A2), EPHB2 (EPH receptor B2), S100A9 (S100 calcium binding protein A9), PBEF(nicotinamide phosphoribosyltransferase), LILRB2 (leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2), PLAUR (plasminogen activator, urokinase receptor), LTB (lymphotoxin beta (TNF superfamily, member 3)), WNT5A (wingless-type MMTV integration site family, member 5A) has been conducted using real-time polymerase chain reaction in specimens affected by psoriasis versus visually intact skin in 18 patients. It was revealed that the expression of the nine examined genes was upregulated in the affected by psoriasis compared to visually intact skin specimens. The highest expression was observed for S100A9, S100AS, PBEF, WNT5A2, and EPHB2 genes. S100A9 and S100A8 gene expression in the affected by psoriasis skin was 100-fold higher versus visually intact skin while PBEF, WNT5A, and EPHB2 gene expression was upregulated more than five-fold. We suggested that the high expression of these genes might be associated with the state of the pathological process in psoriasis. Moreover, the transcriptional activity of these genes might serve a molecular indicator of the efficacy of treatment in psoriasis. PMID:25508677

  10. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer.

    Directory of Open Access Journals (Sweden)

    Jennifer S Myers

    Full Text Available Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The "transforming growth factor-beta signaling" and "Ran regulation of mitotic spindle formation" pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran for investigation in prostate cancer pathogenesis.

  11. Ion channel gene expression predicts survival in glioma patients. (United States)

    Wang, Rong; Gurguis, Christopher I; Gu, Wanjun; Ko, Eun A; Lim, Inja; Bang, Hyoweon; Zhou, Tong; Ko, Jae-Hong


    Ion channels are important regulators in cell proliferation, migration, and apoptosis. The malfunction and/or aberrant expression of ion channels may disrupt these important biological processes and influence cancer progression. In this study, we investigate the expression pattern of ion channel genes in glioma. We designate 18 ion channel genes that are differentially expressed in high-grade glioma as a prognostic molecular signature. This ion channel gene expression based signature predicts glioma outcome in three independent validation cohorts. Interestingly, 16 of these 18 genes were down-regulated in high-grade glioma. This signature is independent of traditional clinical, molecular, and histological factors. Resampling tests indicate that the prognostic power of the signature outperforms random gene sets selected from human genome in all the validation cohorts. More importantly, this signature performs better than the random gene signatures selected from glioma-associated genes in two out of three validation datasets. This study implicates ion channels in brain cancer, thus expanding on knowledge of their roles in other cancers. Individualized profiling of ion channel gene expression serves as a superior and independent prognostic tool for glioma patients.

  12. A biphasic pattern of gene expression during mouse retina development

    Directory of Open Access Journals (Sweden)

    Soares Marcelo


    Full Text Available Abstract Background Between embryonic day 12 and postnatal day 21, six major neuronal and one glia cell type are generated from multipotential progenitors in a characteristic sequence during mouse retina development. We investigated expression patterns of retina transcripts during the major embryonic and postnatal developmental stages to provide a systematic view of normal mouse retina development, Results A tissue-specific cDNA microarray was generated using a set of sequence non-redundant EST clones collected from mouse retina. Eleven stages of mouse retina, from embryonic day 12.5 (El2.5 to postnatal day 21 (PN21, were collected for RNA isolation. Non-amplified RNAs were labeled for microarray experiments and three sets of data were analyzed for significance, hierarchical relationships, and functional clustering. Six individual gene expression clusters were identified based on expression patterns of transcripts through retina development. Two developmental phases were clearly divided with postnatal day 5 (PN5 as a separate cluster. Among 4,180 transcripts that changed significantly during development, approximately 2/3 of the genes were expressed at high levels up until PN5 and then declined whereas the other 1/3 of the genes increased expression from PN5 and remained at the higher levels until at least PN21. Less than 1% of the genes observed showed a peak of expression between the two phases. Among the later increased population, only about 40% genes are correlated with rod photoreceptors, indicating that multiple cell types contributed to gene expression in this phase. Within the same functional classes, however, different gene populations were expressed in distinct developmental phases. A correlation coefficient analysis of gene expression during retina development between previous SAGE studies and this study was also carried out. Conclusion This study provides a complementary genome-wide view of common gene dynamics and a broad molecular

  13. A sequence-based approach to identify reference genes for gene expression analysis

    Directory of Open Access Journals (Sweden)

    Chari Raj


    Full Text Available Abstract Background An important consideration when analyzing both microarray and quantitative PCR expression data is the selection of appropriate genes as endogenous controls or reference genes. This step is especially critical when identifying genes differentially expressed between datasets. Moreover, reference genes suitable in one context (e.g. lung cancer may not be suitable in another (e.g. breast cancer. Currently, the main approach to identify reference genes involves the mining of expression microarray data for highly expressed and relatively constant transcripts across a sample set. A caveat here is the requirement for transcript normalization prior to analysis, and measurements obtained are relative, not absolute. Alternatively, as sequencing-based technologies provide digital quantitative output, absolute quantification ensues, and reference gene identification becomes more accurate. Methods Serial analysis of gene expression (SAGE profiles of non-malignant and malignant lung samples were compared using a permutation test to identify the most stably expressed genes across all samples. Subsequently, the specificity of the reference genes was evaluated across multiple tissue types, their constancy of expression was assessed using quantitative RT-PCR (qPCR, and their impact on differential expression analysis of microarray data was evaluated. Results We show that (i conventional references genes such as ACTB and GAPDH are highly variable between cancerous and non-cancerous samples, (ii reference genes identified for lung cancer do not perform well for other cancer types (breast and brain, (iii reference genes identified through SAGE show low variability using qPCR in a different cohort of samples, and (iv normalization of a lung cancer gene expression microarray dataset with or without our reference genes, yields different results for differential gene expression and subsequent analyses. Specifically, key established pathways in lung

  14. Expression of a Carrot Antifreeze Protein Gene in Escherichia coli

    Institute of Scientific and Technical Information of China (English)

    Ma Xinyu; Shen Xin; Lu Cunfu


    The recombinant expression vectorpET43. lb-AFP, which contains full encoding region of a carrot 36 kD antifreeze protein (AFP) gene was constructed. The recombinant was transformed into expression host carrying T7 RNA polymerase gene (DE3 lysogen) and induced by 1 mmol. L-1 IPTG (isopropyl-β-D-thiogalactoside) to express 110 kD polypeptide of AFP fusion protein.The analysis of product solubility revealed that pET43. 1b-AFP was predominately soluble, and the expressed amount reached the maximum after the IPTG treatment for 3 h.

  15. Development of soybean gene expression database (SGED) (United States)

    Large volumes of microarray expression data is a challenge for analysis. To address this problem a web-based database, Soybean Expression Database (SGED) was built, using PERL/CGI, C and an ORACLE database management system. SGED contains three components. The Data Mining component serves as a repos...

  16. GeneSigDB—A Curated Database of Gene Expression Signatures


    Culhane, Aedín C.; Schwarzl, Thomas; Sultana, Razvan; Picard, Shaita C.; Lu, Tim H.; Franklin, Katherine R.; French, Simon J.; Papenhausen, Gerald; Correll, Mick; Picard, Kermshlise; Quackenbush, John


    The primary objective of most gene expression studies is the identification of one or more gene signatures; lists of genes whose transcriptional levels are uniquely associated with a specific biological phenotype. Whilst thousands of experimentally derived gene signatures are published, their potential value to the community is limited by their computational inaccessibility. Gene signatures are embedded in published article figures, tables or in supplementary materials, and are frequently pre...


    Institute of Scientific and Technical Information of China (English)

    吕桂泉; 许沈华; 牟瀚舟; 朱赤红; 羊正炎; 高永良; 楼洪坤; 刘祥麟; 杨文; 程勇


    To study the gene expression of high metastatic human ovarian carcinoma cell line (HO-8910PM) and to screen for novel metastasis- associated genes by cDNA microarray. Methods: The cDNA was retro-transcribed from equal quantity mRNA derived from tissues of highly metastatic ovarian carcinoma cell line and normal ovarian, and was labeled with Cy5 and Cy3 fluorescence as probes. The mixed probes were hybridized with BioDoor 4096 double dot human whole gene chip. The chip was scanned by scanArray 3000 laser scanner. The acquired image was analyzed by ImaGene 3.0 software. Results: By applying the cDNA microarray we found: A total of 323 genes whose expression level were 3 times higher or lower in HO-8910PM cell than normal ovarian epithelium cell were screened out, with 71 higher and 252 lower respectively. Among these 10 were new genes. 67 genes showed expression difference bigger than 6 times between HO-8910PM cell and normal ovarian epithelium cell, among these genes 12 were higher, 55 lower, and two new genes were found. Conclusion: cDNA microarray technique is effective in screening the differentially expressed genes between human ovarian cancer cell line (HO-8910PM) and normal ovarian epithelium cell. Using the cDNA microarray to analyze of human ovarian cancer cell line gene expression profile difference will help the gene diagnosis, treatment and protection.

  18. Gene expression profile differences in gastric cancer, pericancerous epithelium and normal gastric mucosa by gene chip

    Institute of Scientific and Technical Information of China (English)

    Chuan-Ding Yu; Shen-Hua Xu; Hang-Zhou Mou; Zhi-Ming Jiang; Chi-Hong Zhu; Xiang-Lin Liu


    AIM: To study the difference of gene expression in gastric cancer (T), pericancerous epithelium (P) and normal tissue of gastric mucosa (C), and to screen an associated novel gene in early gastric carcinogenesis by oligonudeotide microarray.METHODS: U133A (Affymetrix, Santa Clara, CA) gene chip was used to detect the gene expression profile difference in T, P and C, respectively. Bioinformatics was used to analyze the detected results.RESULTS: When gastric cancer was compared with normal gastric mucosa, 766 genes were found, with a difference of more than four times in expression levels. Of the 766 genes,530 were up-regulated (Signal Log Ratio [SLR]>2), and 236 were down-regulated (SLR<-2). When pericancerous epithelium was compared with normal gastric mucosa, 64genes were found, with a difference of more than four times in expression levels. Of the 64 genes, 50 were up-regulated (SLR>2), and 14 were down-regulated (SLR<-2). Compared with normal gastric mucosa, a total of 143 genes with a difference in expression levels (more than four times, either in cancer or in pericancerous epithelium) were found in gastric cancer (T) and pericancerous epithelium (P). Of the 143 genes, 108 were up-regulated (SLR>2), and 35were down-regulated (SLR<-2).CONCLUSION: To apply a gene chip could find 143 genes associated with the genes of gastric cancer in pericancerous epithelium, although there were no pathological changes in the tissue slices. More interesting, six genes of pericancerous epithelium were up-regulated in comparison with genes of gastric cancer and three genes were down-regulated in comparison with genes of gastric cancer. It is suggested that these genes may be related to the carcinogenesis and development of early gastric cancer.

  19. Gene Expression Measurement Module (GEMM) - A Fully Automated, Miniaturized Instrument for Measuring Gene Expression in Space (United States)

    Pohorille, Andrew; Peyvan, Kia; Karouia, Fathi; Ricco, Antonio


    The capability to measure gene expression on board spacecraft opens the door to a large number of high-value experiments on the influence of the space environment on biological systems. For example, measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, and determine the metabolic bases of microbial pathogenicity and drug resistance. These and other applications hold significant potential for discoveries in space biology, biotechnology, and medicine. Supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measurement of expression of several hundreds of microbial genes from multiple samples. The instrument will be capable of (1) lysing cell walls of bacteria sampled from cultures grown in space, (2) extracting and purifying RNA released from cells, (3) hybridizing the RNA on a microarray and (4) providing readout of the microarray signal, all in a single microfluidics cartridge. The device is suitable for deployment on nanosatellite platforms developed by NASA Ames' Small Spacecraft Division. To meet space and other technical constraints imposed by these platforms, a number of technical innovations are being implemented. The integration and end-to-end technological and biological validation of the instrument are carried out using as a model the photosynthetic bacterium Synechococcus elongatus, known for its remarkable metabolic diversity and resilience to adverse conditions. Each step in the measurement process-lysis, nucleic acid extraction, purification, and hybridization to an array-is assessed through comparison of the results obtained using the instrument with

  20. Clinicopathologic and gene expression parameters predict liver cancer prognosis

    Directory of Open Access Journals (Sweden)

    Hao Ke


    Full Text Available Abstract Background The prognosis of hepatocellular carcinoma (HCC varies following surgical resection and the large variation remains largely unexplained. Studies have revealed the ability of clinicopathologic parameters and gene expression to predict HCC prognosis. However, there has been little systematic effort to compare the performance of these two types of predictors or combine them in a comprehensive model. Methods Tumor and adjacent non-tumor liver tissues were collected from 272 ethnic Chinese HCC patients who received curative surgery. We combined clinicopathologic parameters and gene expression data (from both tissue types in predicting HCC prognosis. Cross-validation and independent studies were employed to assess prediction. Results HCC prognosis was significantly associated with six clinicopathologic parameters, which can partition the patients into good- and poor-prognosis groups. Within each group, gene expression data further divide patients into distinct prognostic subgroups. Our predictive genes significantly overlap with previously published gene sets predictive of prognosis. Moreover, the predictive genes were enriched for genes that underwent normal-to-tumor gene network transformation. Previously documented liver eSNPs underlying the HCC predictive gene signatures were enriched for SNPs that associated with HCC prognosis, providing support that these genes are involved in key processes of tumorigenesis. Conclusion When applied individually, clinicopathologic parameters and gene expression offered similar predictive power for HCC prognosis. In contrast, a combination of the two types of data dramatically improved the power to predict HCC prognosis. Our results also provided a framework for understanding the impact of gene expression on the processes of tumorigenesis and clinical outcome.

  1. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  2. Visually Relating Gene Expression and in vivo DNA Binding Data

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd


    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  3. On TADs and LADs: Spatial Control Over Gene Expression. (United States)

    Gonzalez-Sandoval, Adriana; Gasser, Susan M


    The combinatorial action of transcription factors drives cell-type-specific gene expression patterns. However, transcription factor binding and gene regulation occur in the context of chromatin, which modulates DNA accessibility. High-resolution chromatin interaction maps have defined units of chromatin that are in spatial proximity, called topologically associated domains (TADs). TADs can be further classified based on expression activity, replication timing, or the histone marks or non-histone proteins associated with them. Independently, other chromatin domains have been defined by their likelihood to interact with non-DNA structures, such as the nuclear lamina. Lamina-associated domains (LADs) correlate with low gene expression and late replication timing. TADs and LADs have recently been evaluated with respect to cell-type-specific gene expression. The results shed light on the relevance of these forms of chromatin organization for transcriptional regulation, and address specifically how chromatin sequestration influences cell fate decisions during organismal development. PMID:27312344

  4. Peripheral blood collection: the first step towards gene expression profiling. (United States)

    Franken, Carmen; Remy, Sylvie; Lambrechts, Nathalie; Hollanders, Karen; Den Hond, Elly; Schoeters, Greet


    A crucial challenge for gene expression analysis in human biomonitoring studies on whole blood samples is rapid sample handling and mRNA stabilization. This study was designed to evaluate the impact of short bench times (less than 30 min) on yield, quality and gene expression of mRNA in the presence of different stabilization buffers (Tempus(TM) Blood RNA tube and RNAlater(®) Stabilization Reagent). Microarray analyzes showed significant changes over short periods of time in expression of a considerate part of the transcriptome (2356 genes) with a prominent role for NFкB-, cancer- and glucocorticoid-mediated networks, and specifically interleukin-8 (IL-8). These findings suggest that even short bench times affect gene expression, requiring to carry out blood collection in a strictly standardized way. PMID:26984061

  5. Bi-clustering of Gene Expression Data Using Conditional Entropy (United States)

    Olomola, Afolabi; Dua, Sumeet

    The inherent sparseness of gene expression data and the rare exhibition of similar expression patterns across a wide range of conditions make traditional clustering techniques unsuitable for gene expression analysis. Biclustering methods currently used to identify correlated gene patterns based on a subset of conditions do not effectively mine constant, coherent, or overlapping biclusters, partially because they perform poorly in the presence of noise. In this paper, we present a new methodology (BiEntropy) that combines information entropy and graph theory techniques to identify co-expressed gene patterns that are relevant to a subset of the sample. Our goal is to discover different types of biclusters in the presence of noise and to demonstrate the superiority of our method over existing methods in terms of discovering functionally enriched biclusters. We demonstrate the effectiveness of our method using both synthetic and real data.

  6. Differential Expression of Salinity Resistance Gene on Cotton

    Institute of Scientific and Technical Information of China (English)


    Salinity resistance and differential gene expression associated with salinity in cotton germplasm were studied,because of the large scale area of salinity in China,and its significant negative effects on

  7. The evolution of gene expression levels in mammalian organs

    DEFF Research Database (Denmark)

    Brawand, David; Soumillon, Magali; Necsulea, Anamaria;


    Changes in gene expression are thought to underlie many of the phenotypic differences between species. However, large-scale analyses of gene expression evolution were until recently prevented by technological limitations. Here we report the sequencing of polyadenylated RNA from six organs across...... ten species that represent all major mammalian lineages (placentals, marsupials and monotremes) and birds (the evolutionary outgroup), with the goal of understanding the dynamics of mammalian transcriptome evolution. We show that the rate of gene expression evolution varies among organs, lineages...... and chromosomes, owing to differences in selective pressures: transcriptome change was slow in nervous tissues and rapid in testes, slower in rodents than in apes and monotremes, and rapid for the X chromosome right after its formation. Although gene expression evolution in mammals was strongly shaped...

  8. Super-paramagnetic clustering of yeast gene expression profiles

    CERN Document Server

    Getz, G; Domany, E; Zhang, M Q


    High-density DNA arrays, used to monitor gene expression at a genomic scale, have produced vast amounts of information which require the development of efficient computational methods to analyze them. The important first step is to extract the fundamental patterns of gene expression inherent in the data. This paper describes the application of a novel clustering algorithm, Super-Paramagnetic Clustering (SPC) to analysis of gene expression profiles that were generated recently during a study of the yeast cell cycle. SPC was used to organize genes into biologically relevant clusters that are suggestive for their co-regulation. Some of the advantages of SPC are its robustness against noise and initialization, a clear signature of cluster formation and splitting, and an unsupervised self-organized determination of the number of clusters at each resolution. Our analysis revealed interesting correlated behavior of several groups of genes which has not been previously identified.

  9. Expression of streptavidin gene in bacteria and plants

    International Nuclear Information System (INIS)

    Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot

  10. Biclustering of linear patterns in gene expression data. (United States)

    Gao, Qinghui; Ho, Christine; Jia, Yingmin; Li, Jingyi Jessica; Huang, Haiyan


    Identifying a bicluster, or submatrix of a gene expression dataset wherein the genes express similar behavior over the columns, is useful for discovering novel functional gene interactions. In this article, we introduce a new algorithm for finding biClusters with Linear Patterns (CLiP). Instead of solely maximizing Pearson correlation, we introduce a fitness function that also considers the correlation of complementary genes and conditions. This eliminates the need for a priori determination of the bicluster size. We employ both greedy search and the genetic algorithm in optimization, incorporating resampling for more robust discovery. When applied to both real and simulation datasets, our results show that CLiP is superior to existing methods. In analyzing RNA-seq fly and worm time-course data from modENCODE, we uncover a set of similarly expressed genes suggesting maternal dependence. Supplementary Material is available online (at PMID:22697238

  11. Gene expression profiles identify inflammatory signatures in dendritic cells.

    Directory of Open Access Journals (Sweden)

    Anna Torri

    Full Text Available Dendritic cells (DCs constitute a heterogeneous group of antigen-presenting leukocytes important in activation of both innate and adaptive immunity. We studied the gene expression patterns of DCs incubated with reagents inducing their activation or inhibition. Total RNA was isolated from DCs and gene expression profiling was performed with oligonucleotide microarrays. Using a supervised learning algorithm based on Random Forest, we generated a molecular signature of inflammation from a training set of 77 samples. We then validated this molecular signature in a testing set of 38 samples. Supervised analysis identified a set of 44 genes that distinguished very accurately between inflammatory and non inflammatory samples. The diagnostic performance of the signature genes was assessed against an independent set of samples, by qRT-PCR. Our findings suggest that the gene expression signature of DCs can provide a molecular classification for use in the selection of anti-inflammatory or adjuvant molecules with specific effects on DC activity.

  12. Gene expression profiling of soft and firm Atlantic salmon fillet.

    Directory of Open Access Journals (Sweden)

    Thomas Larsson

    Full Text Available Texture of salmon fillets is an important quality trait for consumer acceptance as well as for the suitability for processing. In the present work we measured fillet firmness in a population of farmed Atlantic salmon with known pedigree and investigated the relationship between this trait and gene expression. Transcriptomic analyses performed with a 21 K oligonucleotide microarray revealed strong correlations between firmness and a large number of genes. Highly similar expression profiles were observed in several functional groups. Positive regression was found between firmness and genes encoding proteasome components (41 genes and mitochondrial proteins (129 genes, proteins involved in stress responses (12 genes, and lipid metabolism (30 genes. Coefficients of determination (R(2 were in the range of 0.64-0.74. A weaker though highly significant negative regression was seen in sugar metabolism (26 genes, R(2 = 0.66 and myofiber proteins (42 genes, R(2 = 0.54. Among individual genes that showed a strong association with firmness, there were extracellular matrix proteins (negative correlation, immune genes, and intracellular proteases (positive correlation. Several genes can be regarded as candidate markers of flesh quality (coiled-coil transcriptional coactivator b, AMP deaminase 3, and oligopeptide transporter 15 though their functional roles are unclear. To conclude, fillet firmness of Atlantic salmon depends largely on metabolic properties of the skeletal muscle; where aerobic metabolism using lipids as fuel, and the rapid removal of damaged proteins, appear to play a major role.

  13. Expression of a human placental alkaline phosphatase gene in transfected cells: Use as a reporter for studies of gene expression

    International Nuclear Information System (INIS)

    The human placental alkaline phosphatase gene has been cloned and reintroduced into mammalian cells. When a plasmid carrying the gene under control of the simian virus 40 early promoter (pSV2Apap) is transfected into a variety of different cell types, placental alkaline phosphatase activity can readily be detected by using whole cell suspensions or cell lysates. Alkaline phosphatase activity can also be visualized directly in individual transfected cells by histochemical staining. The gene is appropriate for use as a reporter in studies of gene regulation since its expression is dependent on the presence of exogenous transcription control elements. The overall assay to detect the expression of the gene is quantitative, very rapid, and inexpensive. Cotransfections of cells with pSV2Apap and a related plasmid carrying the bacterial chloramphenicol acetyltransferase gene (pSV2Acat) indicate that transcription of these two genes is detected with roughly the same sensitivity

  14. Spotlight on differentially expressed genes in urinary bladder cancer.

    Directory of Open Access Journals (Sweden)

    Apostolos Zaravinos

    Full Text Available INTRODUCTION: We previously identified common differentially expressed (DE genes in bladder cancer (BC. In the present study we analyzed in depth, the expression of several groups of these DE genes. MATERIALS AND METHODS: Samples from 30 human BCs and their adjacent normal tissues were analyzed by whole genome cDNA microarrays, qRT-PCR and Western blotting. Our attention was focused on cell-cycle control and DNA damage repair genes, genes related to apoptosis, signal transduction, angiogenesis, as well as cellular proliferation, invasion and metastasis. Four publicly available GEO Datasets were further analyzed, and the expression data of the genes of interest (GOIs were compared to those of the present study. The relationship among the GOI was also investigated. GO and KEGG molecular pathway analysis was performed to identify possible enrichment of genes with specific biological themes. RESULTS: Unsupervised cluster analysis of DNA microarray data revealed a clear distinction in BC vs. control samples and low vs. high grade tumors. Genes with at least 2-fold differential expression in BC vs. controls, as well as in non-muscle invasive vs. muscle invasive tumors and in low vs. high grade tumors, were identified and ranked. Specific attention was paid to the changes in osteopontin (OPN, SPP1 expression, due to its multiple biological functions. Similarly, genes exhibiting equal or low expression in BC vs. the controls were scored. Significant pair-wise correlations in gene expression were scored. GO analysis revealed the multi-facet character of the GOIs, since they participate in a variety of mechanisms, including cell proliferation, cell death, metabolism, cell shape, and cytoskeletal re-organization. KEGG analysis revealed that the most significant pathway was that of Bladder Cancer (p = 1.5×10(-31. CONCLUSIONS: The present work adds to the current knowledge on molecular signature identification of BC. Such works should progress in order

  15. RNA Binding Proteins that Control Human Papillomavirus Gene Expression.


    Naoko Kajitani; Stefan Schwartz


    The human papillomavirus (HPV) life cycle is strictly linked to the differentiation program of the infected mucosal epithelial cell. In the basal and lower levels of the epithelium, early genes coding for pro-mitotic proteins and viral replication factors are expressed, while terminal cell differentiation is required for activation of late gene expression and production of viral particles at the very top of the epithelium. Such productive infections are normally cleared within 18–24 months. I...

  16. Freedom of expression: cell-type-specific gene profiling. (United States)

    Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H


    Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling.

  17. A comparative analysis of biclustering algorithms for gene expression data


    Eren, Kemal; Deveci, Mehmet; Küçüktunç, Onur; Çatalyürek, Ümit V.


    The need to analyze high-dimension biological data is driving the development of new data mining methods. Biclustering algorithms have been successfully applied to gene expression data to discover local patterns, in which a subset of genes exhibit similar expression levels over a subset of conditions. However, it is not clear which algorithms are best suited for this task. Many algorithms have been published in the past decade, most of which have been compared only to a small number of algori...

  18. Evaluation of Plaid Models in Biclustering of Gene Expression Data


    Hamid Alavi Majd; Soodeh Shahsavari; Ahmad Reza Baghestani; Seyyed Mohammad Tabatabaei; Naghme Khadem Bashi; Mostafa Rezaei Tavirani; Mohsen Hamidpour


    Background. Biclustering algorithms for the analysis of high-dimensional gene expression data were proposed. Among them, the plaid model is arguably one of the most flexible biclustering models up to now. Objective. The main goal of this study is to provide an evaluation of plaid models. To that end, we will investigate this model on both simulation data and real gene expression datasets. Methods. Two simulated matrices with different degrees of overlap and noise are generated and then the in...

  19. Randomized Algorithmic Approach for Biclustering of Gene Expression Data


    Sradhanjali Nayak; Debahuti Mishra; Satyabrata Das; Amiya Kumar Rath


    Microarray data processing revolves around the pivotal issue of locating genes altering their expression in response to pathogens, other organisms or other multiple environmental conditions resulted out of a comparison between infected and uninfected cells or tissues. To have a comprehensive analysis of the corollaries of certain treatments, deseases and developmental stages embodied as a data matrix on gene expression data is possible through simultaneous observation and monitoring of the ex...

  20. Probing Pineal-specific Gene Expression with Transgenic Zebrafish†


    Kojima, Daisuke; Dowling, John E.; Fukada, Yoshitaka


    The pineal gland of zebrafish (Danio rerio) contains lightsensitive photoreceptor cells and plays an important role in the neuroendocrine system. The zebrafish exorhodopsin gene encodes a pineal-specific photoreceptive protein, whose promoter region harbors a cis-acting element, pineal expression-promoting element (PIPE), directing pineal-specific gene expression. For in vivo genetic studies on PIPE-binding proteins and their regulatory mechanisms, we generated a transgenic zebrafish line, Tg...

  1. Gene Expression Profiling Predicts the Development of Oral Cancer


    Saintigny, Pierre; Zhang, Li; Fan, You-Hong; El-Naggar, Adel K.; Papadimitrakopoulou, Vali; Feng, Lei; Lee, J. Jack; Kim, Edward S.; Hong, Waun Ki; Mao, Li


    Patients with oral preneoplastic lesion (OPL) have high risk of developing oral cancer. Although certain risk factors such as smoking status and histology are known, our ability to predict oral cancer risk remains poor. The study objective was to determine the value of gene expression profiling in predicting oral cancer development. Gene expression profile was measured in 86 of 162 OPL patients who were enrolled in a clinical chemoprevention trial that used the incidence of oral cancer develo...

  2. Time course of gene expression during mouse skeletal muscle hypertrophy


    Chaillou, Thomas; Lee, Jonah D.; England, Jonathan H.; Esser, Karyn A.; McCarthy, John J.


    The purpose of this study was to perform a comprehensive transcriptome analysis during skeletal muscle hypertrophy to identify signaling pathways that are operative throughout the hypertrophic response. Global gene expression patterns were determined from microarray results on days 1, 3, 5, 7, 10, and 14 during plantaris muscle hypertrophy induced by synergist ablation in adult mice. Principal component analysis and the number of differentially expressed genes (cutoffs ≥2-fold increase or ≥50...

  3. Expression data on liver metabolic pathway genes and proteins


    Mooli Raja Gopal Reddy; Chodisetti Pavan Kumar; Malleswarapu Mahesh; Manchiryala Sravan Kumar; Jeyakumar, Shanmugam M


    Here, we present the expression data on various metabolic pathways of liver with special emphasize on lipid and carbohydrate metabolism and long chain polyunsaturated fatty acid (PUFA) synthesis, both at gene and protein levels. The data were obtained to understand the effect of vitamin A deficiency on the expression status (both gene and protein levels) of some of the key factors involved in lipogenesis, fatty acid oxidation, triglyceride secretion, long chain PUFA, resolvin D1 synthesis, gl...

  4. Hyperthermophilic Archaeal Viruses as Novel Nanoplatforms

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch

    ; attachment, alignment, and fusion. Upon infection, the intracellular replication cycle lasts 8 h at which point the virus particles are released as spindle-shaped tailless particles. Chapter II builds on the replication and purification methods in Chapter I to study the interaction between the two...... nanoplatforms than mammalian viruses because they cannot proliferate in humans and hence are less likely to trigger adverse effects. Another group of viruses that fits this criterion is archaeal viruses yet their potential remains untapped. As a group, archaeal viruses offer distinct advantages such as unique...

  5. [Gene expression profile of spinal ventral horn in ALS]. (United States)

    Yamamoto, Masahiko; Tanaka, Fumiaki; Sobue, Gen


    The causative pathomechanism of sporadic amyotrophic lateral sclerosis (ALS) is not clearly understood. Using microarray technology combined with laser-captured microdissection, gene expression profiles of degenerating spinal motor neurons as well as spinal ventral horn from autopsied patients with sporadic ALS were examined. Spinal motor neurons showed a distinct gene expression profile from the whole spinal ventral horn. Three percent of genes examined were significantly downregulated, and 1% were upregulated in motor neurons. In contrast with motor neurons, the total spinal ventral horn homogenates demonstrated 0.7% and 0.2% significant upregulation and downregulation of gene expression, respectively. Downregulated genes in motor neurons included those associated with cytoskeleton/axonal transport, transcription and cell surface antigens/receptors, such as dynactin 1 (DCTN1) and early growth response 3 (EGR3). In particular, DCTN1 was markedly downregulated in most residual motor neurons prior to the accumulation of pNF-H and ubiquitylated protein. Promoters for cell death pathway, death receptor 5 (DR5), cyclins C (CCNC) and A1 (CCNA), and caspases were upregulated, whereas cell death inhibitors, acetyl-CoA transporter (ACATN) and NF-kappaB (NFKB) were also upregulated. In terms of spinal ventral horn, the expression of genes related to cell surface antigens/receptors, transcription and cell adhesion/ECM were increased. The gene expression resulting in neurodegenerative and neuroprotective changes were both present in spinal motor neurons and ventral horn. Moreover, Inflammation-related genes, such as belonging to the cytokine family were not, however, significantly upregulated in either motor neurons or ventral horn. The sequence of motor neuron-specific gene expression changes from early DCTN1 downregulation to late CCNC upregulation in sporadic ALS can provide direct information on the genes leading to neurodegeneration and neuronal death, and are helpful

  6. [Gene expression profile of spinal ventral horn in ALS]. (United States)

    Yamamoto, Masahiko; Tanaka, Fumiaki; Sobue, Gen


    The causative pathomechanism of sporadic amyotrophic lateral sclerosis (ALS) is not clearly understood. Using microarray technology combined with laser-captured microdissection, gene expression profiles of degenerating spinal motor neurons as well as spinal ventral horn from autopsied patients with sporadic ALS were examined. Spinal motor neurons showed a distinct gene expression profile from the whole spinal ventral horn. Three percent of genes examined were significantly downregulated, and 1% were upregulated in motor neurons. In contrast with motor neurons, the total spinal ventral horn homogenates demonstrated 0.7% and 0.2% significant upregulation and downregulation of gene expression, respectively. Downregulated genes in motor neurons included those associated with cytoskeleton/axonal transport, transcription and cell surface antigens/receptors, such as dynactin 1 (DCTN1) and early growth response 3 (EGR3). In particular, DCTN1 was markedly downregulated in most residual motor neurons prior to the accumulation of pNF-H and ubiquitylated protein. Promoters for cell death pathway, death receptor 5 (DR5), cyclins C (CCNC) and A1 (CCNA), and caspases were upregulated, whereas cell death inhibitors, acetyl-CoA transporter (ACATN) and NF-kappaB (NFKB) were also upregulated. In terms of spinal ventral horn, the expression of genes related to cell surface antigens/receptors, transcription and cell adhesion/ECM were increased. The gene expression resulting in neurodegenerative and neuroprotective changes were both present in spinal motor neurons and ventral horn. Moreover, Inflammation-related genes, such as belonging to the cytokine family were not, however, significantly upregulated in either motor neurons or ventral horn. The sequence of motor neuron-specific gene expression changes from early DCTN1 downregulation to late CCNC upregulation in sporadic ALS can provide direct information on the genes leading to neurodegeneration and neuronal death, and are helpful

  7. Gene Expression Profiling in the Hibernating Primate, Cheirogaleus Medius (United States)

    Faherty, Sheena L.; Villanueva-Cañas, José Luis; Klopfer, Peter H.; Albà, M. Mar; Yoder, Anne D.


    Hibernation is a complex physiological response that some mammalian species employ to evade energetic demands. Previous work in mammalian hibernators suggests that hibernation is activated not by a set of genes unique to hibernators, but by differential expression of genes that are present in all mammals. This question of universal genetic mechanisms requires further investigation and can only be tested through additional investigations of phylogenetically dispersed species. To explore this question, we use RNA-Seq to investigate gene expression dynamics as they relate to the varying physiological states experienced throughout the year in a group of primate hibernators—Madagascar’s dwarf lemurs (genus Cheirogaleus). In a novel experimental approach, we use longitudinal sampling of biological tissues as a method for capturing gene expression profiles from the same individuals throughout their annual hibernation cycle. We identify 90 candidate genes that have variable expression patterns when comparing two active states (Active 1 and Active 2) with a torpor state. These include genes that are involved in metabolic pathways, feeding behavior, and circadian rhythms, as might be expected to correlate with seasonal physiological state changes. The identified genes appear to be critical for maintaining the health of an animal that undergoes prolonged periods of metabolic depression concurrent with the hibernation phenotype. By focusing on these differentially expressed genes in dwarf lemurs, we compare gene expression patterns in previously studied mammalian hibernators. Additionally, by employing evolutionary rate analysis, we find that hibernation-related genes do not evolve under positive selection in hibernating species relative to nonhibernators. PMID:27412611

  8. Expression analysis of five zebrafish RXFP3 homologues reveals evolutionary conservation of gene expression pattern. (United States)

    Donizetti, Aldo; Fiengo, Marcella; Iazzetti, Giovanni; del Gaudio, Rosanna; Di Giaimo, Rossella; Pariante, Paolo; Minucci, Sergio; Aniello, Francesco


    Relaxin peptides exert different functions in reproduction and neuroendocrine processes via interaction with two evolutionarily unrelated groups of receptors: RXFP1 and RXFP2 on one hand, RXFP3 and RXFP4 on the other hand. Evolution of receptor genes after splitting of tetrapods and teleost lineage led to a different retention rate between mammals and fish, with the latter having more gene copies compared to the former. In order to improve our knowledge on the evolution of the relaxin ligands/receptors system and have insights on their function in early stages of life, in the present paper we analyzed the expression pattern of five zebrafish RXFP3 homologue genes during embryonic development. In our analysis, we show that only two of the five genes are expressed during embryogenesis and that their transcripts are present in all the developmental stages. Spatial localization analysis of these transcripts revealed that the gene expression is restricted in specific territories starting from early pharyngula stage. Both genes are expressed in the brain but in different cell clusters and in extra-neural territories, one gene in the interrenal gland and the other in the pancreas. These two genes share expression territories with the homologue mammalian counterpart, highlighting a general conservation of gene expression regulatory processes and their putative function during evolution that are established early in vertebrate embryogenesis. PMID:25384467

  9. Gene expression profiling in peanut using high density oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Burow Mark


    Full Text Available Abstract Background Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently has a significant number of ESTs been released into the public domain. Utilization of these ESTs for oligonucleotide microarrays provides a means to investigate large-scale transcript responses to a variety of developmental and environmental signals, ultimately improving our understanding of plant biology. Results We have developed a high-density oligonucleotide microarray for peanut using 49,205 publicly available ESTs and tested the utility of this array for expression profiling in a variety of peanut tissues. To identify putatively tissue-specific genes and demonstrate the utility of this array for expression profiling in a variety of peanut tissues, we compared transcript levels in pod, peg, leaf, stem, and root tissues. Results from this experiment showed 108 putatively pod-specific/abundant genes, as well as transcripts whose expression was low or undetected in pod compared to peg, leaf, stem, or root. The transcripts significantly over-represented in pod include genes responsible for seed storage proteins and desiccation (e.g., late-embryogenesis abundant proteins, aquaporins, legumin B, oil production, and cellular defense. Additionally, almost half of the pod-abundant genes represent unknown genes allowing for the possibility of associating putative function to these previously uncharacterized genes. Conclusion The peanut oligonucleotide array represents the majority of publicly available peanut ESTs and can be used as a tool for expression profiling studies in diverse tissues.

  10. A Rough Set based Gene Expression Clustering Algorithm

    Directory of Open Access Journals (Sweden)

    J. J. Emilyn


    Full Text Available Problem statement: Microarray technology helps in monitoring the expression levels of thousands of genes across collections of related samples. Approach: The main goal in the analysis of large and heterogeneous gene expression datasets was to identify groups of genes that get expressed in a set of experimental conditions. Results: Several clustering techniques have been proposed for identifying gene signatures and to understand their role and many of them have been applied to gene expression data, but with partial success. The main aim of this work was to develop a clustering algorithm that would successfully indentify gene patterns. The proposed novel clustering technique (RCGED provides an efficient way of finding the hidden and unique gene expression patterns. It overcomes the restriction of one object being placed in only one cluster. Conclusion/Recommendations: The proposed algorithm is termed intelligent because it automatically determines the optimum number of clusters. The proposed algorithm was experimented with colon cancer dataset and the results were compared with Rough Fuzzy K Means algorithm.

  11. Quantitative analysis of laminin 5 gene expression in human keratinocytes. (United States)

    Akutsu, Nobuko; Amano, Satoshi; Nishiyama, Toshio


    To examine the expression of laminin 5 genes (LAMA3, LAMB3, and LAMC2) encoding the three polypeptide chains alpha3, beta3, and gamma2, respectively, in human keratinocytes, we developed novel quantitative polymerase chain reaction (PCR) methods utilizing Thermus aquaticus DNA polymerase, specific primers, and fluorescein-labeled probes with the ABI PRISM 7700 sequence detector system. Gene expression levels of LAMA3, LAMB3, and LAMC2 and glyceraldehyde-3-phosphate dehydrogenase were quantitated reproducibly and sensitively in the range from 1 x 10(2) to 1 x 10(8) gene copies. Basal gene expression level of LAMB3 was about one-tenth of that of LAMA3 or LAMC2 in human keratinocytes, although there was no clear difference among immunoprecipitated protein levels of alpha3, beta3, and gamma2 synthesized in radio-labeled keratinocytes. Human serum augmented gene expressions of LAMA3, LAMB3, and LAMC2 in human keratinocytes to almost the same extent, and this was associated with an increase of the laminin 5 protein content measured by a specific sandwich enzyme-linked immunosorbent assay. These results demonstrate that the absolute mRNA levels generated from the laminin 5 genes do not determine the translated protein levels of the laminin 5 chains in keratinocytes, and indicate that the expression of the laminin 5 genes may be controlled by common regulation mechanisms. PMID:15854126

  12. A Gene Expression Barcode for Microarray Data


    Zilliox, Michael J.; Irizarry, Rafael A.


    The ability to measure genome-wide expression holds great promise for characterizing cells and distinguishing diseased from normal tissues. Thus far, microarray technology has only been useful for measuring relative expression between two or more samples, which has handicapped its ability to classify tissue types. This paper presents the first method that can successfully predict tissue type based on data from a single hybridization. A preliminary web-tool is available at http://rafalab.jhsph...

  13. Paternal irradiation perturbs the expression of circadian genes in offspring

    Energy Technology Data Exchange (ETDEWEB)

    Gomes, Andre M.G.F.; Barber, Ruth C.; Dubrova, Yuri E., E-mail:


    Highlights: • We have analysed gene expression in the offspring of irradiated male mice. • CBA/Ca and BALB/c male mice were used in our study. • The pattern of gene expression was established in four tissues. • Expression of genes in involved in rhythmic process/circadian rhythm is compromised. • Our data may explain the phenomenon of transgenerational genomic instability. - Abstract: The circadian system represents a complex network which influences the timing of many biological processes. Recent studies have established that circadian alterations play an important role in the susceptibility to many human diseases, including cancer. Here we report that paternal irradiation in mice significantly affects the expression of genes involved in rhythmic processes in their first-generation offspring. Using microarrays, the patterns of gene expression were established for brain, kidney, liver and spleen samples from the non-exposed offspring of irradiated CBA/Ca and BALB/c male mice. The most over-represented categories among the genes differentially expressed in the offspring of control and irradiated males were those involved in rhythmic process, circadian rhythm and DNA-dependent regulation of transcription. The results of our study therefore provide a plausible explanation for the transgenerational effects of paternal irradiation, including increased transgenerational carcinogenesis described in other studies.

  14. Gene expression as a biomarker for human radiation exposure. (United States)

    Omaruddin, Romaica A; Roland, Thomas A; Wallace, H James; Chaudhry, M Ahmad


    Accidental exposure to ionizing radiation can be unforeseen, rapid, and devastating. The detonation of a radiological device leading to such an exposure can be detrimental to the exposed population. The radiation-induced damage may manifest as acute effects that can be detected clinically or may be more subtle effects that can lead to long-term radiation-induced abnormalities. Accurate identification of the individuals exposed to radiation is challenging. The availability of a rapid and effective screening test that could be used as a biomarker of radiation exposure detection is mandatory. We tested the suitability of alterations in gene expression to serve as a biomarker of human radiation exposure. To develop a useful gene expression biomonitor, however, gene expression changes occurring in response to irradiation in vivo must be measured directly. Patients undergoing radiation therapy provide a suitable test population for this purpose. We examined the expression of CC3, MADH7, and SEC PRO in blood samples of these patients before and after radiotherapy to measure the in vivo response. The gene expression after ionizing radiation treatment varied among different patients, suggesting the complexity of the response. The expression of the SEC PRO gene was repressed in most of the patients. The MADH7 gene was found to be upregulated in most of the subjects and could serve as a molecular marker of radiation exposure. PMID:23446844

  15. Paternal irradiation perturbs the expression of circadian genes in offspring

    International Nuclear Information System (INIS)

    Highlights: • We have analysed gene expression in the offspring of irradiated male mice. • CBA/Ca and BALB/c male mice were used in our study. • The pattern of gene expression was established in four tissues. • Expression of genes in involved in rhythmic process/circadian rhythm is compromised. • Our data may explain the phenomenon of transgenerational genomic instability. - Abstract: The circadian system represents a complex network which influences the timing of many biological processes. Recent studies have established that circadian alterations play an important role in the susceptibility to many human diseases, including cancer. Here we report that paternal irradiation in mice significantly affects the expression of genes involved in rhythmic processes in their first-generation offspring. Using microarrays, the patterns of gene expression were established for brain, kidney, liver and spleen samples from the non-exposed offspring of irradiated CBA/Ca and BALB/c male mice. The most over-represented categories among the genes differentially expressed in the offspring of control and irradiated males were those involved in rhythmic process, circadian rhythm and DNA-dependent regulation of transcription. The results of our study therefore provide a plausible explanation for the transgenerational effects of paternal irradiation, including increased transgenerational carcinogenesis described in other studies

  16. Gene expression of the mismatch repair gene MSH2 in primary colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Kuramochi, Hidekazu; Crüger, Dorthe Gylling;


    and lymphnode metastases were analyzed with immunohistochemistry, methylation and MSI analyses, and quantitative polymerase chain reaction (PCR). The median gene expression of MSH2 was 1.00 (range 0.16-11.2, quartiles 0.70-1.51) and there was good agreement between the gene expression in primary tumor and lymph......Microsatellite instability (MSI) is caused by defective mismatch repair (MMR) and is one of the very few molecular markers with proven clinical importance in colorectal cancer with respect to heredity, prognosis, and treatment effect. The gene expression of the MMR gene MSH2 may be a quantitative...... marker for the level of MMR and a potential molecular marker with clinical relevance. The aim was to investigate the gene expression of MSH2 in primary operable colorectal cancer in correlation with MSI, protein expression, and promoter hypermethylation. In a cohort of 210 patients, the primary tumor...

  17. Seasonal Effects in a Lake Sediment Archaeal Community of the Brazilian Savanna

    Directory of Open Access Journals (Sweden)

    Thiago Rodrigues


    Full Text Available The Cerrado is a biome that corresponds to 24% of Brazil’s territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked differences between the archaeal communities found in the two seasons. I.1a and I.1c Thaumarchaeota were found in greater numbers in the transition period, while MCG Archaea was dominant on the dry season. Methanogens were only found in the dry season. Analysis of 16S rRNA sequences revealed lower diversity on the transition period. We detected archaeal amoA sequences in both seasons, but there were more OTUs during the dry season. These sequences were within the same cluster as Nitrosotalea devanaterra’s amoA gene. The principal coordinate analysis (PCoA test revealed significant differences between samples from different seasons. These results provide information on archaeal diversity in freshwater lake sediments of the Cerrado and indicates that rain is likely a factor that impacts these communities.

  18. Gene expression profiling of chicken intestinal host responses

    NARCIS (Netherlands)

    Hemert, van S.


    Chicken lines differ in genetic disease susceptibility. The scope of the research described in this thesis was to identify genes involved in genetic disease resistance in the chicken intestine. Therefore gene expression in the jejunum was investigated using a microarray approach. An intestine specif

  19. GOBO: gene expression-based outcome for breast cancer online.

    Directory of Open Access Journals (Sweden)

    Markus Ringnér

    Full Text Available Microarray-based gene expression analysis holds promise of improving prognostication and treatment decisions for breast cancer patients. However, the heterogeneity of breast cancer emphasizes the need for validation of prognostic gene signatures in larger sample sets stratified into relevant subgroups. Here, we describe a multifunctional user-friendly online tool, GOBO (, allowing a range of different analyses to be performed in an 1881-sample breast tumor data set, and a 51-sample breast cancer cell line set, both generated on Affymetrix U133A microarrays. GOBO supports a wide range of applications including: 1 rapid assessment of gene expression levels in subgroups of breast tumors and cell lines, 2 identification of co-expressed genes for creation of potential metagenes, 3 association with outcome for gene expression levels of single genes, sets of genes, or gene signatures in multiple subgroups of the 1881-sample breast cancer data set. The design and implementation of GOBO facilitate easy incorporation of additional query functions and applications, as well as additional data sets irrespective of tumor type and array platform.

  20. Statistical framework for phylogenomic analysis of gene family expression profiles. (United States)

    Gu, Xun


    Microarray technology has produced massive expression data that are invaluable for investigating the genome-wide evolutionary pattern of gene expression. To this end, phylogenetic expression analysis is highly desirable. On the basis of the Brownian process, we developed a statistical framework (called the E(0) model), assuming the independent expression of evolution between lineages. Several evolutionary mechanisms are integrated to characterize the pattern of expression diversity after gene duplications, including gradual drift and dramatic shift (punctuated equilibrium). When the phylogeny of a gene family is given, we show that the likelihood function follows a multivariate normal distribution; the variance-covariance matrix is determined by the phylogenetic topology and evolutionary parameters. Maximum-likelihood methods for multiple microarray experiments are developed, and likelihood-ratio tests are designed for testing the evolutionary pattern of gene expression. To reconstruct the evolutionary trace of expression diversity after gene (or genome) duplications, we developed a Bayesian-based method and use the posterior mean as predictors. Potential applications in evolutionary genomics are discussed. PMID:15166175

  1. Probabilistic estimation of microarray data reliability and underlying gene expression

    Directory of Open Access Journals (Sweden)

    Sigvardsson Mikael


    Full Text Available Abstract Background The availability of high throughput methods for measurement of mRNA concentrations makes the reliability of conclusions drawn from the data and global quality control of samples and hybridization important issues. We address these issues by an information theoretic approach, applied to discretized expression values in replicated gene expression data. Results Our approach yields a quantitative measure of two important parameter classes: First, the probability P(σ|S that a gene is in the biological state σ in a certain variety, given its observed expression S in the samples of that variety. Second, sample specific error probabilities which serve as consistency indicators of the measured samples of each variety. The method and its limitations are tested on gene expression data for developing murine B-cells and a t-test is used as reference. On a set of known genes it performs better than the t-test despite the crude discretization into only two expression levels. The consistency indicators, i.e. the error probabilities, correlate well with variations in the biological material and thus prove efficient. Conclusions The proposed method is effective in determining differential gene expression and sample reliability in replicated microarray data. Already at two discrete expression levels in each sample, it gives a good explanation of the data and is comparable to standard techniques.

  2. Screening of differentially expressed genes related to differentiation and proliferation by gene expression profiling of different grade astrocytoma cell lines

    Institute of Scientific and Technical Information of China (English)

    Yi Zeng; Zhong Yang; Yangyun Han; Chao You


    BACKGROUND: The detection of differential gene expression in brain is possible by cDNA microarray technology, and the screening of differentially expressed genes might provide a biological basis for gene-targeted therapy for tumors. OBJECTIVE: To detect the differential expression of genes among astrocytoma SHG-44 (WHO grade IV), CHG-5 (WHO grade II), and ATRA-treated SHG-44 cell lines by cDNA microarray. DESIGN: Laboratory experiments in vitro.SETTING: Department of Neurobiology, the Third Military Medical University. MATERIALS: The experiment was performed at the Department of Neurobiology in the Third Military Medical University of the Chinese PLA from January to October 2007. The SHG-44 cell line (WHO grade Ⅳ) was established by Prof. Ziwei Du, and the CHG-5 cell line (WHO grade II) was set up by Prof. Xiuwu Bian from the Third Military Medical University of the Chinese PLA. The cDNA microarray containing 9182 known genes was prepared and provided by Dr. Yang Zhong at the City University of Hong Kong. MAIN OUTCOME MEASURES: The identification of genes that were similarly regulated (overlapping) during tumor progression and differentiation, by comparison of gene expression profiles between CHG-5 and SHG-44 cells, and between SHG-44 cells with or without treatment with ATRA. RESULTS: Thirty-one overlapping genes were found to have similar regulatory effects on astrocytomas; among them, twenty genes were up-regulated and eleven were down-regulated in both comparisons between CHG-5 and SHG-44 cells, and between SHG-44 cells with or without treatment with ATRA. The four reported genes, SERPINF1, MAPK11, HIF1A and SOD2, were up-regulated in this study.CONCLUSION: The differentially expressed genes in different grade astrocytoma cell lines were revealed primarily by cDNA microarray; among them, five identified overlapping genes, SERPINF1, MAPK11, DCTN2, HIF1A and SOD2, were related to the malignant progression of astrocytoma cells.

  3. The genetic basis of evolutionary change in gene expression levels


    Emerson, J. J.; Li, Wen-Hsiung


    The regulation of gene expression is an important determinant of organismal phenotype and evolution. However, the widespread recognition of this fact occurred long after the synthesis of evolution and genetics. Here, we give a brief sketch of thoughts regarding gene regulation in the history of evolution and genetics. We then review the development of genome-wide studies of gene regulatory variation in the context of the location and mode of action of the causative genetic changes. In particu...

  4. Alteration of gene expression by alcohol exposure at early neurulation

    Directory of Open Access Journals (Sweden)

    McClintick Jeanette N


    Full Text Available Abstract Background We have previously demonstrated that alcohol exposure at early neurulation induces growth retardation, neural tube abnormalities, and alteration of DNA methylation. To explore the global gene expression changes which may underline these developmental defects, microarray analyses were performed in a whole embryo mouse culture model that allows control over alcohol and embryonic variables. Result Alcohol caused teratogenesis in brain, heart, forelimb, and optic vesicle; a subset of the embryos also showed cranial neural tube defects. In microarray analysis (accession number GSM9545, adopting hypothesis-driven Gene Set Enrichment Analysis (GSEA informatics and intersection analysis of two independent experiments, we found that there was a collective reduction in expression of neural specification genes (neurogenin, Sox5, Bhlhe22, neural growth factor genes [Igf1, Efemp1, Klf10 (Tieg, and Edil3], and alteration of genes involved in cell growth, apoptosis, histone variants, eye and heart development. There was also a reduction of retinol binding protein 1 (Rbp1, and de novo expression of aldehyde dehydrogenase 1B1 (Aldh1B1. Remarkably, four key hematopoiesis genes (glycophorin A, adducin 2, beta-2 microglobulin, and ceruloplasmin were absent after alcohol treatment, and histone variant genes were reduced. The down-regulation of the neurospecification and the neurotrophic genes were further confirmed by quantitative RT-PCR. Furthermore, the gene expression profile demonstrated distinct subgroups which corresponded with two distinct alcohol-related neural tube phenotypes: an open (ALC-NTO and a closed neural tube (ALC-NTC. Further, the epidermal growth factor signaling pathway and histone variants were specifically altered in ALC-NTO, and a greater number of neurotrophic/growth factor genes were down-regulated in the ALC-NTO than in the ALC-NTC embryos. Conclusion This study revealed a set of genes vulnerable to alcohol exposure and

  5. Expression of the cystic fibrosis gene in adult human lung.


    Engelhardt, J F; Zepeda, M; Cohn, J.A.; Yankaskas, J R; Wilson, J. M.


    Critical to an understanding of the pulmonary disease in cystic fibrosis (CF) and the development of effective gene therapies is a definition of the distribution and regulation of CF gene expression in adult human lung. Previous studies have detected the product of the CF gene, the CF transmembrane conductance regulator (CFTR), in submucosal glands of human bronchi. In this report, we have characterized the distribution of CFTR RNA and protein in the distal airway and alveoli of human lungs. ...

  6. Daunomycin-TFO Conjugates for Downregulation of Gene Expression (United States)

    Capobianco, Massimo L.; Catapano, Carlo V.

    Daunomycin has shown interesting properties as a stabilizing agent for the antigene methodology. This approach consists of targeting a polypurine region of a given gene, with a triplex forming oligonucleotide (TFO), realizing a triple helix complex (triplex), with the aim of down-regulating gene expression. This chapter describes the basic principles of the triplex approach, the chemistry underlining the binding of daunomycin to oligonucleotides, and some results of gene-inhibition obtained with daunomycin-TFO conjugates with different targets.

  7. Relationships between PROMPT and gene expression

    DEFF Research Database (Denmark)

    Llinares, Marta Lloret; Mapendano, Christophe K; Martlev, Lasse H;


    Most mammalian protein-coding gene promoters are divergent, yielding promoter upstream transcripts (PROMPTs) in the reverse direction from their conventionally produced mRNAs. PROMPTs are rapidly degraded by the RNA exosome rendering a general function of these molecules elusive. Yet, levels...... of certain PROMPTs are altered in stress conditions, like the DNA damage response (DDR), suggesting a possible regulatory role for at least a subset of these molecules. Here we manipulate PROMPT levels by either exosome depletion or UV treatment and analyze possible effects on their neighboring genes...

  8. The Medicago truncatula gene expression atlas web server

    Directory of Open Access Journals (Sweden)

    Tang Yuhong


    Full Text Available Abstract Background Legumes (Leguminosae or Fabaceae play a major role in agriculture. Transcriptomics studies in the model legume species, Medicago truncatula, are instrumental in helping to formulate hypotheses about the role of legume genes. With the rapid growth of publically available Affymetrix GeneChip Medicago Genome Array GeneChip data from a great range of tissues, cell types, growth conditions, and stress treatments, the legume research community desires an effective bioinformatics system to aid efforts to interpret the Medicago genome through functional genomics. We developed the Medicago truncatula Gene Expression Atlas (MtGEA web server for this purpose. Description The Medicago truncatula Gene Expression Atlas (MtGEA web server is a centralized platform for analyzing the Medicago transcriptome. Currently, the web server hosts gene expression data from 156 Affymetrix GeneChip® Medicago genome arrays in 64 different experiments, covering a broad range of developmental and environmental conditions. The server enables flexible, multifaceted analyses of transcript data and provides a range of additional information about genes, including different types of annotation and links to the genome sequence, which help users formulate hypotheses about gene function. Transcript data can be accessed using Affymetrix probe identification number, DNA sequence, gene name, functional description in natural language, GO and KEGG annotation terms, and InterPro domain number. Transcripts can also be discovered through co-expression or differential expression analysis. Flexible tools to select a subset of experiments and to visualize and compare expression profiles of multiple genes have been implemented. Data can be downloaded, in part or full, in a tabular form compatible with common analytical and visualization software. The web server will be updated on a regular basis to incorporate new gene expression data and genome annotation, and is accessible

  9. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter (United States)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  10. Salmonella induces prominent gene expression in the rat colon

    Directory of Open Access Journals (Sweden)

    Roosing Susanne


    Full Text Available Abstract Background Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point. As fructo-oligosaccharides (FOS affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Results Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase, antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2, inflammation (e.g. calprotectin, oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2 and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9. Furthermore, Salmonella translocation increased serum IFNγ and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap, showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. Conclusion We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in

  11. Conditional gene expression in the mouse using a Sleeping Beauty gene-trap transposon

    Directory of Open Access Journals (Sweden)

    Hackett Perry B


    Full Text Available Abstract Background Insertional mutagenesis techniques with transposable elements have been popular among geneticists studying model organisms from E. coli to Drosophila and, more recently, the mouse. One such element is the Sleeping Beauty (SB transposon that has been shown in several studies to be an effective insertional mutagen in the mouse germline. SB transposon vector studies have employed different functional elements and reporter molecules to disrupt and report the expression of endogenous mouse genes. We sought to generate a transposon system that would be capable of reporting the expression pattern of a mouse gene while allowing for conditional expression of a gene of interest in a tissue- or temporal-specific pattern. Results Here we report the systematic development and testing of a transposon-based gene-trap system incorporating the doxycycline-repressible Tet-Off (tTA system that is capable of activating the expression of genes under control of a Tet response element (TRE promoter. We demonstrate that the gene trap system is fully functional in vitro by introducing the "gene-trap tTA" vector into human cells by transposition and identifying clones that activate expression of a TRE-luciferase transgene in a doxycycline-dependent manner. In transgenic mice, we mobilize gene-trap tTA vectors, discover parameters that can affect germline mobilization rates, and identify candidate gene insertions to demonstrate the in vivo functionality of the vector system. We further demonstrate that the gene-trap can act as a reporter of endogenous gene expression and it can be coupled with bioluminescent imaging to identify genes with tissue-specific expression patterns. Conclusion Akin to the GAL4/UAS system used in the fly, we have made progress developing a tool for mutating and revealing the expression of mouse genes by generating the tTA transactivator in the presence of a secondary TRE-regulated reporter molecule. A vector like the gene

  12. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A


    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  13. Exon Expression and Alternatively Spliced Genes in Tourette Syndrome

    NARCIS (Netherlands)

    Tian, Yingfang; Liao, Isaac H.; Zhan, Xinhua; Gunther, Joan R.; Ander, Bradley P.; Liu, Dazhi; Lit, Lisa; Jickling, Glen C.; Corbett, Blythe A.; Bos-Veneman, Netty G. P.; Hoekstra, Pieter J.; Sharp, Frank R.


    Tourette Syndrome (TS) is diagnosed based upon clinical criteria including motor and vocal tics. We hypothesized that differences in exon expression and splicing might be useful for pathophysiology and diagnosis. To demonstrate exon expression and alternatively spliced gene differences in blood of i

  14. Gene-expression Classifier in Papillary Thyroid Carcinoma

    DEFF Research Database (Denmark)

    Londero, Stefano Christian; Jespersen, Marie Louise; Krogdahl, Annelise;


    BACKGROUND: No reliable biomarker for metastatic potential in the risk stratification of papillary thyroid carcinoma exists. We aimed to develop a gene-expression classifier for metastatic potential. MATERIALS AND METHODS: Genome-wide expression analyses were used. Development cohort: freshly...

  15. VESPUCCI: Exploring Patterns of Gene Expression in Grapevine. (United States)

    Moretto, Marco; Sonego, Paolo; Pilati, Stefania; Malacarne, Giulia; Costantini, Laura; Grzeskowiak, Lukasz; Bagagli, Giorgia; Grando, Maria Stella; Moser, Claudio; Engelen, Kristof


    Large-scale transcriptional studies aim to decipher the dynamic cellular responses to a stimulus, like different environmental conditions. In the era of high-throughput omics biology, the most used technologies for these purposes are microarray and RNA-Seq, whose data are usually required to be deposited in public repositories upon publication. Such repositories have the enormous potential to provide a comprehensive view of how different experimental conditions lead to expression changes, by comparing gene expression across all possible measured conditions. Unfortunately, this task is greatly impaired by differences among experimental platforms that make direct comparisons difficult. In this paper, we present the Vitis Expression Studies Platform Using COLOMBOS Compendia Instances (VESPUCCI), a gene expression compendium for grapevine which was built by adapting an approach originally developed for bacteria, and show how it can be used to investigate complex gene expression patterns. We integrated nearly all publicly available microarray and RNA-Seq expression data: 1608 gene expression samples from 10 different technological platforms. Each sample has been manually annotated using a controlled vocabulary developed ad hoc to ensure both human readability and computational tractability. Expression data in the compendium can be visually explored using several tools provided by the web interface or can be programmatically accessed using the REST interface. VESPUCCI is freely accessible at

  16. VESPUCCI: exploring patterns of gene expression in grapevine

    Directory of Open Access Journals (Sweden)

    Marco eMoretto


    Full Text Available Large-scale transcriptional studies aim to decipher the dynamic cellular responses to a stimulus, like different environmental conditions. In the era of high-throughput omics biology, the most used technologies for these purposes are microarray and RNA-Seq, whose data are usually required to be deposited in public repositories upon publication. Such repositories have the enormous potential to provide a comprehensive view of how different experimental conditions lead to expression changes, by comparing gene expression across all possible measured conditions. Unfortunately, this task is greatly impaired by differences among experimental platforms that make direct comparisons difficult.In this paper we present the Vitis Expression Studies Platform Using COLOMBOS Compendia Instances (VESPUCCI, a gene expression compendium for grapevine which was built by adapting an approach originally developed for bacteria, and show how it can be used to investigate complex gene expression patterns. We integrated nearly all publicly available microarray and RNA-Seq expression data: 1608 gene expression samples from 10 different technological platforms. Each sample has been manually annotated using a controlled vocabulary developed ad hoc to ensure both human readability and computational tractability. Expression data in the compendium can be visually explored using several tools provided by the web interface or can be programmatically accessed using the REST interface. VESPUCCI is freely accessible at

  17. Statistical adjustment of signal censoring in gene expression experiments

    NARCIS (Netherlands)

    Wit, Ernst; McClure, John


    Motivation: Numerical output of spotted microarrays displays censoring of pixel intensities at some software dependent threshold. This reduces the quality of gene expression data, because it seriously violates the linearity of expression with respect to signal intensity. Statistical methods based on

  18. Geometry of the Gene Expression Space of Individual Cells.

    Directory of Open Access Journals (Sweden)

    Yael Korem


    Full Text Available There is a revolution in the ability to analyze gene expression of single cells in a tissue. To understand this data we must comprehend how cells are distributed in a high-dimensional gene expression space. One open question is whether cell types form discrete clusters or whether gene expression forms a continuum of states. If such a continuum exists, what is its geometry? Recent theory on evolutionary trade-offs suggests that cells that need to perform multiple tasks are arranged in a polygon or polyhedron (line, triangle, tetrahedron and so on, generally called polytopes in gene expression space, whose vertices are the expression profiles optimal for each task. Here, we analyze single-cell data from human and mouse tissues profiled using a variety of single-cell technologies. We fit the data to shapes with different numbers of vertices, compute their statistical significance, and infer their tasks. We find cases in which single cells fill out a continuum of expression states within a polyhedron. This occurs in intestinal progenitor cells, which fill out a tetrahedron in gene expression space. The four vertices of this tetrahedron are each enriched with genes for a specific task related to stemness and early differentiation. A polyhedral continuum of states is also found in spleen dendritic cells, known to perform multiple immune tasks: cells fill out a tetrahedron whose vertices correspond to key tasks related to maturation, pathogen sensing and communication with lymphocytes. A mixture of continuum-like distributions and discrete clusters is found in other cell types, including bone marrow and differentiated intestinal crypt cells. This approach can be used to understand the geometry and biological tasks of a wide range of single-cell datasets. The present results suggest that the concept of cell type may be expanded. In addition to discreet clusters in gene-expression space, we suggest a new possibility: a continuum of states within a

  19. Gene expression of beta carotene genes in transgenic biofortified cassava


    Telengech, P. K.; Maling’a, J. N.; Nyende, A. B.; Gichuki, S. T.; Wanjala, B. W.


    Cassava is an important food for millions of people around the world. However, cassava is deficient in protein, iron, zinc, pro-vitamin A and vitamin E. Cassava biofortified with pro-vitamin A can help reduce Vitamin A Deficiency among the undernourished communities that rely upon it for sustenance. BioCassava Plus project has developed transgenic cassava that expresses beta carotene in roots using root specific patatin promoter. This study aimed at confirming expression of nptII, crtB and DX...

  20. Patterns of expression of cell wall related genes in sugarcane

    Directory of Open Access Journals (Sweden)

    Lima D.U.


    Full Text Available Our search for genes related to cell wall metabolism in the sugarcane expressed sequence tag (SUCEST database ( resulted in 3,283 reads (1% of the total reads which were grouped into 459 clusters (potential genes with an average of 7.1 reads per cluster. To more clearly display our correlation coefficients, we constructed surface maps which we used to investigate the relationship between cell wall genes and the sugarcane tissues libraries from which they came. The only significant correlations that we found between cell wall genes and/or their expression within particular libraries were neutral or synergetic. Genes related to cellulose biosynthesis were from the CesA family, and were found to be the most abundant cell wall related genes in the SUCEST database. We found that the highest number of CesA reads came from the root and stem libraries. The genes with the greatest number of reads were those involved in cell wall hydrolases (e.g. beta-1,3-glucanases, xyloglucan endo-beta-transglycosylase, beta-glucosidase and endo-beta-mannanase. Correlation analyses by surface mapping revealed that the expression of genes related to biosynthesis seems to be associated with the hydrolysis of hemicelluloses, pectin hydrolases being mainly associated with xyloglucan hydrolases. The patterns of cell wall related gene expression in sugarcane based on the number of reads per cluster reflected quite well the expected physiological characteristics of the tissues. This is the first work to provide a general view on plant cell wall metabolism through the expression of related genes in almost all the tissues of a plant at the same time. For example, developing flowers behaved similarly to both meristematic tissues and leaf-root transition zone tissues. Besides providing a basis for future research on the mechanisms of plant development which involve the cell wall, our findings will provide valuable tools for plant engineering in the

  1. Repressor-mediated tissue-specific gene expression in plants (United States)

    Meagher, Richard B.; Balish, Rebecca S.; Tehryung, Kim; McKinney, Elizabeth C.


    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  2. Complexity, Post-genomic Biology and Gene Expression Programs (United States)

    Williams, Rohan B. H.; Luo, Oscar Junhong

    Gene expression represents the fundamental phenomenon by which information encoded in a genome is utilised for the overall biological objectives of the organism. Understanding this level of information transfer is therefore essential for dissecting the mechanistic basis of form and function of organisms. We survey recent developments in the methodology of the life sciences that is relevant for understanding the organisation and function of the genome and review our current understanding of the regulation of gene expression, and finally, outline some new approaches that may be useful in understanding the organisation of gene regulatory systems.

  3. In situ gene expression and ecophysiology of thermophilic Cyanobacteria

    DEFF Research Database (Denmark)

    Jensen, Sheila Ingemann

    -378), the expression patterns of various functional genes (with an emphasis on nif genes involved in N2-fixation), the protein levels of nitrogenase (NifH), the N2-fixation activity, as well as microsensor based measurements on O2 availability, production and consumption were investigated in situ over the entire diel...... cycle. Interestingly, it was found that while the nif genes are expressed, and nitrogenase is synthesized once the mat gets anoxic in the early evening, the largest N2-fixation activity occurs as a burst during dim light in the early morning, albeit protein levels remained high over the entire course...

  4. Differential neutrophil gene expression in early bovine pregnancy

    Directory of Open Access Journals (Sweden)

    Kizaki Keiichiro


    Full Text Available Abstract Background In food production animals, especially cattle, the diagnosis of gestation is important because the timing of gestation directly affects the running of farms. Various methods have been used to detect gestation, but none of them are ideal because of problems with the timing of detection or the accuracy, simplicity, or cost of the method. A new method for detecting gestation, which involves assessing interferon-tau (IFNT-stimulated gene expression in peripheral blood leukocytes (PBL, was recently proposed. PBL fractionation methods were used to examine whether the expression profiles of various PBL populations could be used as reliable diagnostic markers of bovine gestation. Methods PBL were collected on days 0 (just before artificial insemination, 7, 14, 17, 21, and 28 of gestation. The gene expression levels of the PBL were assessed with microarray analysis and/or quantitative real-time reverse transcription (q PCR. PBL fractions were collected by flow cytometry or density gradient cell separation using Histopaque 1083 or Ficoll-Conray solutions. The expression levels of four IFNT-stimulated genes, interferon-stimulated protein 15 kDa (ISG15, myxovirus-resistance (MX 1 and 2, and 2′-5′-oligoadenylate synthetase (OAS1, were then analyzed in each fraction through day 28 of gestation using qPCR. Results Microarray analysis detected 72 and 28 genes in whole PBL that were significantly higher on days 14 and 21 of gestation, respectively, than on day 0. The upregulated genes included IFNT-stimulated genes. The expression levels of these genes increased with the progression of gestation until day 21. In flow cytometry experiments, on day 14 the expression levels of all of the genes were significantly higher in the granulocyte fraction than in the other fractions. Their expression gradually decreased through day 28 of gestation. Strong correlations were observed between the expression levels of the four genes in the granulocyte

  5. Gene Cloning of Murine α-Fetoprotein Gene and Construction of Its Eukaryotic Expression Vector and Expression in CHO Cells

    Institute of Scientific and Technical Information of China (English)

    易继林; 田耕


    To clone the murine α-fetoprotein (AFP) gene, construct the eukaryotic expression vector of AFP and express in CHO cells, total RNA were extracted from Hepa 1-6 cells, and then the murine α-fetoprotein gene was amplified by RT-PCR and cloned into the eukaryotic expression vector pcDNA3.1. The recombinant of vector was identified by restriction enzyme analysis and sequencing. A fter transient transfection of CHO cells with the vector, Western blotting was used to detect the expression of AFP. It is concluded that the 1.8kb murine α-fetoprotein gene was successfully cloned and its eukaryotic expression vector was successfully constructed.

  6. Difference of Gene Expression Profiles between Barrett's Esophagus and Cardia Intestinal Metaplasia by Gene Chip

    Institute of Scientific and Technical Information of China (English)

    CHANG Ying; LIU Bin


    The difference of gene expression profile changes in Barrettes esophagus (BE) and cardia intestinal metaplasia (CIM) epithelium was studied and the novel associated genes were screened in the early stage by cDNA microarray. The cDNA retro-transcribed from equal quantity mRNA from BE and CIM epithelial tissues were labeled with Cy3 and Cy5 fluorescence as probes. The mixed probe was hybridized with three pieces BiostarH-40s double dot human whole gene chip. The chips were scanned with a ScanArray 4000. The acquired images were analyzed using GenePix Pro 3.0 software. It was found a total of 141 genes were screened out that exhibited differentially expression more than 2 times in all three chips. It was identified that in gene expression profiles of BE, 74 genes were up-regulated and 67 down-regulated as compared with CIM. The comparison between the difference of gene expression profile changes in BE and CIM epithelia revealed that there existed the difference between BE and CIM at gene level. 141 genes with the expression more than two time were probably related to the occurrence and development of BE and the promotion or progress in adenocarcinoma.

  7. Reliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutrition.

    Directory of Open Access Journals (Sweden)

    Anna Warzybok

    Full Text Available In plants, nitrogen is the most important nutritional factor limiting the yield of cultivated crops. Since nitrogen is essential for synthesis of nucleotides, amino acids and proteins, studies on gene expression in plants cultivated under different nitrogen availability require particularly careful selection of suitable reference genes which are not affected by nitrogen limitation. Therefore, the objective of this study was to select the most reliable reference genes for qPCR analysis of target cucumber genes under varying nitrogen source and availability. Among twelve candidate cucumber genes used in this study, five are highly homologous to the commonly used internal controls, whereas seven novel candidates were previously identified through the query of the cucumber genome. The expression of putative reference genes and the target CsNRT1.1 gene was analyzed in roots, stems and leaves of cucumbers grown under nitrogen deprivation, varying nitrate availability or different sources of nitrogen (glutamate, glutamine or NH3. The stability of candidate genes expression significantly varied depending on the tissue type and nitrogen supply. However, in most of the outputs genes encoding CACS, TIP41, F-box protein and EFα proved to be the most suitable for normalization of CsNRT1.1 expression. In addition, our results suggest the inclusion of 3 or 4 references to obtain highly reliable results of target genes expression in all cucumber organs under nitrogen-related stress.

  8. Expressing PHB synthetic genes through chloroplast genetic engineering

    Institute of Scientific and Technical Information of China (English)


    Chloroplast integration and expression vector containing expression cassettes for phbB, phbA, phbC and aadA genes was constructed and bombarded into the tobacco chloroplast genome. Transplastomic plants were analyzed with PCR and Southern blot. Their homoplastomy was also judged. Northern dot and RT-PCR analysis were employed to investigate transgene expression at transcriptional level. The results indicate that the chloroplast transformation system is compatible for poly-3-hydroxybutyrate (PHB) production.

  9. Modular Analysis of Peripheral Blood Gene Expression in Rheumatoid Arthritis Captures Reproducible Gene Expression Changes in TNF Responders (United States)

    Oswald, Michaela; Curran, Mark; Lamberth, Sarah; Townsend, Robert; Hamilton, Jennifer D.; Chernoff, David N.; Carulli, John; Townsend, Michael; Weinblatt, Michael; Kern, Marlena; Pond, Cassandra; Lee, Annette; Gregersen, Peter K.


    Objective To establish whether the analysis of whole blood gene expression can be useful in predicting or monitoring response to anti-TNF therapy in RA. Methods Whole blood RNA (PAXgene) was obtained at baseline and 14 weeks on three independent cohorts with a combined total of 250 patients with rheumatoid arthritis beginning anti-TNF therapy. We employed an approach to gene expression analysis that is based on gene expression “modules”. Results Good and Moderate Responders by EULAR criteria exhibited highly significant and consistent changes in multiple gene expression modules using a hyper geometric analysis after 14 weeks of therapy. Strikingly, non responders exhibited very little change in any modules, despite exposure to TNF blockade. These patterns of change were highly consistent across all three cohorts, indicating that immunological changes after TNF treatment are specific to the combination of both drug exposure and responder status. In contrast, modular patterns of gene expression did not exhibit consistent differences between responders and non-responders at baseline in the three cohorts. Conclusions These data provide evidence that using gene expression modules related to inflammatory disease may provide a valuable method for objective monitoring of the response of RA patients who are treated with TNF inhibitors. PMID:25371395

  10. Moraxella osloensis Gene Expression in the Slug Host Deroceras reticulatum

    Directory of Open Access Journals (Sweden)

    Sreevatsan Srinand


    Full Text Available Abstract Background The bacterium Moraxella osloensis is a mutualistic symbiont of the slug-parasitic nematode Phasmarhabditis hermaphrodita. In nature, P. hermaphrodita vectors M. osloensis into the shell cavity of the slug host Deroceras reticulatum in which the bacteria multiply and kill the slug. As M. osloensis is the main killing agent, genes expressed by M. osloensis in the slug are likely to play important roles in virulence. Studies on pathogenic interactions between bacteria and lower order hosts are few, but such studies have the potential to shed light on the evolution of bacterial virulence. Therefore, we investigated such an interaction by determining gene expression of M. osloensis in its slug host D. reticulatum by selectively capturing transcribed sequences. Results Thirteen M. osloensis genes were identified to be up-regulated post infection in D. reticulatum. Compared to the in vitro expressed genes in the stationary phase, we found that genes of ubiquinone synthetase (ubiS and acyl-coA synthetase (acs were up-regulated in both D. reticulatum and stationary phase in vitro cultures, but the remaining 11 genes were exclusively expressed in D. reticulatum and are hence infection specific. Mutational analysis on genes of protein-disulfide isomerase (dsbC and ubiS showed that the virulence of both mutants to slugs was markedly reduced and could be complemented. Further, compared to the growth rate of wild-type M. osloensis, the dsbC and ubiS mutants showed normal and reduced growth rate in vitro, respectively. Conclusion We conclude that 11 out of the 13 up-regulated M. osloensis genes are infection specific. Distribution of these identified genes in various bacterial pathogens indicates that the virulence genes are conserved among different pathogen-host interactions. Mutagenesis, growth rate and virulence bioassays further confirmed that ubiS and dsbC genes play important roles in M. osloensis survival and virulence, respectively

  11. Identifying set-wise differential co-expression in gene expression microarray data

    Directory of Open Access Journals (Sweden)

    Kim Jihun


    Full Text Available Abstract Background Previous differential coexpression analyses focused on identification of differentially coexpressed gene pairs, revealing many insightful biological hypotheses. However, this method could not detect coexpression relationships between pairs of gene sets. Considering the success of many set-wise analysis methods for microarray data, a coexpression analysis based on gene sets may elucidate underlying biological processes provoked by the conditional changes. Here, we propose a differentially coexpressed gene sets (dCoxS algorithm that identifies the differentially coexpressed gene set pairs between conditions. Results dCoxS is a two-step analysis method. In each condition, dCoxS measures the interaction score (IS, which represents the expression similarity between two gene sets using Renyi relative entropy. When estimating the relative entropy, multivariate kernel density estimation was used to model gene-gene correlation structure. Statistical tests for the conditional difference between the ISs determined the significance of differential coexpression of the gene set pair. Simulation studies supported that the IS is a representative measure of similarity between gene expression matrices. Single gene coexpression analysis of two publicly available microarray datasets detected no significant results. However, the dCoxS analysis of the datasets revealed differentially coexpressed gene set pairs related to the biological conditions of the datasets. Conclusion dCoxS identified differentially coexpressed gene set pairs not found by single gene analysis. The results indicate that set-wise differential coexpression analysis is useful for understanding biological processes induced by conditional changes.

  12. Assessment of Suitable Reference Genes for Quantitative Gene Expression Studies in Melon Fruits. (United States)

    Kong, Qiusheng; Gao, Lingyun; Cao, Lei; Liu, Yue; Saba, Hameed; Huang, Yuan; Bie, Zhilong


    Melon (Cucumis melo L.) is an attractive model plant for investigating fruit development because of its morphological, physiological, and biochemical diversity. Quantification of gene expression by quantitative reverse transcription polymerase chain reaction (qRT-PCR) with stably expressed reference genes for normalization can effectively elucidate the biological functions of genes that regulate fruit development. However, the reference genes for data normalization in melon fruits have not yet been systematically validated. This study aims to assess the suitability of 20 genes for their potential use as reference genes in melon fruits. Expression variations of these genes were measured in 24 samples that represented different developmental stages of fertilized and parthenocarpic melon fruits by qRT-PCR analysis. GeNorm identified ribosomal protein L (CmRPL) and cytosolic ribosomal protein S15 (CmRPS15) as the best pair of reference genes, and as many as five genes including CmRPL, CmRPS15, TIP41-like family protein (CmTIP41), cyclophilin ROC7 (CmCYP7), and ADP ribosylation factor 1 (CmADP) were required for more reliable normalization. NormFinder ranked CmRPS15 as the best single reference gene, and RAN GTPase gene family (CmRAN) and TATA-box binding protein (CmTBP2) as the best combination of reference genes in melon fruits. Their effectiveness was further validated by parallel analyses on the activities of soluble acid invertase and sucrose phosphate synthase, and expression profiles of their respective encoding genes CmAIN2 and CmSPS1, as well as sucrose contents during melon fruit ripening. The validated reference genes will help to improve the accuracy of gene expression studies in melon fruits.

  13. Assessment of Suitable Reference Genes for Quantitative Gene Expression Studies in Melon Fruits (United States)

    Kong, Qiusheng; Gao, Lingyun; Cao, Lei; Liu, Yue; Saba, Hameed; Huang, Yuan; Bie, Zhilong


    Melon (Cucumis melo L.) is an attractive model plant for investigating fruit development because of its morphological, physiological, and biochemical diversity. Quantification of gene expression by quantitative reverse transcription polymerase chain reaction (qRT-PCR) with stably expressed reference genes for normalization can effectively elucidate the biological functions of genes that regulate fruit development. However, the reference genes for data normalization in melon fruits have not yet been systematically validated. This study aims to assess the suitability of 20 genes for their potential use as reference genes in melon fruits. Expression variations of these genes were measured in 24 samples that represented different developmental stages of fertilized and parthenocarpic melon fruits by qRT-PCR analysis. GeNorm identified ribosomal protein L (CmRPL) and cytosolic ribosomal protein S15 (CmRPS15) as the best pair of reference genes, and as many as five genes including CmRPL, CmRPS15, TIP41-like family protein (CmTIP41), cyclophilin ROC7 (CmCYP7), and ADP ribosylation factor 1 (CmADP) were required for more reliable normalization. NormFinder ranked CmRPS15 as the best single reference gene, and RAN GTPase gene family (CmRAN) and TATA-box binding protein (CmTBP2) as the best combination of reference genes in melon fruits. Their effectiveness was further validated by parallel analyses on the activities of soluble acid invertase and sucrose phosphate synthase, and expression profiles of their respective encoding genes CmAIN2 and CmSPS1, as well as sucrose contents during melon fruit ripening. The validated reference genes will help to improve the accuracy of gene expression studies in melon fruits. PMID:27536316

  14. Gene expression characterizes different nutritional strategies among three mixotrophic protists. (United States)

    Liu, Zhenfeng; Campbell, Victoria; Heidelberg, Karla B; Caron, David A


    Mixotrophic protists, i.e. protists that can carry out both phototrophy and heterotrophy, are a group of organisms with a wide range of nutritional strategies. The ecological and biogeochemical importance of these species has recently been recognized. In this study, we investigated and compared the gene expression of three mixotrophic protists, Prymnesium parvum, Dinobyron sp. and Ochromonas sp. under light and dark conditions in the presence of prey using RNA-Seq. Gene expression of the obligately phototrophic P. parvum and Dinobryon sp. changed significantly between light and dark treatments, while that of primarily heterotrophic Ochromonas sp. was largely unchanged. Gene expression of P. parvum and Dinobryon sp. shared many similarities, especially in the expression patterns of genes related to reproduction. However, key genes involved in central carbon metabolism and phagotrophy had different expression patterns between these two species, suggesting differences in prey consumption and heterotrophic nutrition in the dark. Transcriptomic data also offered clues to other physiological traits of these organisms such as preference of nitrogen sources and photo-oxidative stress. These results provide potential target genes for further exploration of the mechanisms of mixotrophic physiology and demonstrate the potential usefulness of molecular approaches in characterizing the nutritional modes of mixotrophic protists. PMID:27194617

  15. Interpreting physiological responses to environmental change through gene expression profiling. (United States)

    Gracey, Andrew Y


    Identification of differentially expressed genes in response to environmental change offers insights into the roles of the transcriptome in the regulation of physiological responses. A variety of methods are now available to implement large-scale gene expression screens, and each method has specific advantages and disadvantages. Construction of custom cDNA microarrays remains the most popular route to implement expression screens in the non-model organisms favored by comparative physiologists, and we highlight some factors that should be considered when embarking along this path. Using a carp cDNA microarray, we have undertaken a broad, system-wide gene expression screen to investigate the physiological mechanisms underlying cold and hypoxia acclimation. This dataset provides a starting point from which to explore a range of specific mechanistic hypotheses at all levels of organization, from individual biochemical pathways to the level of the whole organism. We demonstrate the utility of two data analysis methods, Gene Ontology profiling and rank-based statistical methods, to summarize the probable physiological function of acclimation-induced gene expression changes, and to prioritize specific genes as candidates for further study. PMID:17449823

  16. 56. Synthesis and Prokaryotic Expression of Insect Antifungal Gene (Thanatin)

    Institute of Scientific and Technical Information of China (English)


    Thanatin of podisus maculiventr is one of the six Insect antifugal peptides that have been found in the recent years. It is an induced peptide composed of 21 amino acids not only exhibits a large antifungal spectrum, but shows antimicrobial activity against Gram-positive bacteria and Gram-negative bacteria as well. The cDNA sequence was designed based on the amino acid sequence of Thanatin. The Thanatin gene was obtained through oligodeoxynucletides synthesis and PCR amplifying. The PCR product was cloned into the pGEM-T Easy vector by means of T-A pairing direct molecular cloning method. The synthesized thanatin gene was proved correct by DNA sequence analysis. The thanatin gene of 87 bp was subcloned into the pET-21 d vector through the linkage of the cohesive ends. The recombinant expression vector pET-21 d-th was constructed. The recombinant expression plasmid pET-21d-th was transformed into E.coli BL21(DE3) and the thanatin gene was expressed in fusion form when induced by IPTG. The transcript activity of the thanatin gene in induced cells was verified by two method of RT-PCR and Dot-blotting. We determined bio-activity of its expression product by agar plate assay. The results showed that the expression products of thanatin gene exhibit antifungal activity against the two pathogenic fungi: Aspergillus fumigatus and Tricholderma riricle.

  17. AGEMAP: a gene expression database for aging in mice.

    Directory of Open Access Journals (Sweden)

    Jacob M Zahn


    Full Text Available We present the AGEMAP (Atlas of Gene Expression in Mouse Aging Project gene expression database, which is a resource that catalogs changes in gene expression as a function of age in mice. The AGEMAP database includes expression changes for 8,932 genes in 16 tissues as a function of age. We found great heterogeneity in the amount of transcriptional changes with age in different tissues. Some tissues displayed large transcriptional differences in old mice, suggesting that these tissues may contribute strongly to organismal decline. Other tissues showed few or no changes in expression with age, indicating strong levels of homeostasis throughout life. Based on the pattern of age-related transcriptional changes, we found that tissues could be classified into one of three aging processes: (1 a pattern common to neural tissues, (2 a pattern for vascular tissues, and (3 a pattern for steroid-responsive tissues. We observed that different tissues age in a coordinated fashion in individual mice, such that certain mice exhibit rapid aging, whereas others exhibit slow aging for multiple tissues. Finally, we compared the transcriptional profiles for aging in mice to those from humans, flies, and worms. We found that genes involved in the electron transport chain show common age regulation in all four species, indicating that these genes may be exceptionally good markers of aging. However, we saw no overall correlation of age regulation between mice and humans, suggesting that aging processes in mice and humans may be fundamentally different.

  18. Tool for quantification of staphylococcal enterotoxin gene expression in cheese. (United States)

    Duquenne, Manon; Fleurot, Isabelle; Aigle, Marina; Darrigo, Claire; Borezée-Durant, Elise; Derzelle, Sylviane; Bouix, Marielle; Deperrois-Lafarge, Véronique; Delacroix-Buchet, Agnès


    Cheese is a complex and dynamic microbial ecosystem characterized by the presence of a large variety of bacteria, yeasts, and molds. Some microorganisms, including species of lactobacilli or lactococci, are known to contribute to the organoleptic quality of cheeses, whereas the presence of other microorganisms may lead to spoilage or constitute a health risk. Staphylococcus aureus is recognized worldwide as an important food-borne pathogen, owing to the production of enterotoxins in food matrices. In order to study enterotoxin gene expression during cheese manufacture, we developed an efficient procedure to recover total RNA from cheese and applied a robust strategy to study gene expression by reverse transcription-quantitative PCR (RT-qPCR). This method yielded pure preparations of undegraded RNA suitable for RT-qPCR. To normalize RT-qPCR data, expression of 10 potential reference genes was investigated during S. aureus growth in milk and in cheese. The three most stably expressed reference genes during cheese manufacture were ftsZ, pta, and gyrB, and these were used as internal controls for RT-qPCR of the genes sea and sed, encoding staphylococcal enterotoxins A and D, respectively. Expression of these staphylococcal enterotoxin genes was monitored during the first 72 h of the cheese-making process, and mRNA data were correlated with enterotoxin production.

  19. Tiam1 gene expression and its significance in colorectal carcinoma

    Institute of Scientific and Technical Information of China (English)

    Li Liu; De-Hua Wu; Yan-Qing Ding


    AIM: To explore the expression of Tiam1 gene in colorectal carcinoma and its correlation with tumor metastasis.METHODS: Expressions of Tiam1 gene in 8 colorectal carcinoma cell lines were detected by reverse transcriptasepolymerase chain reaction. In vitro invasiveness was determined by means of Matrigel invasion assay. The correlation of Tiam1 expression with the invasive ability was also analyzed.RESULTS: Tiam1 gene was highly expressed in LoVo and SW620, which were established from metastatic colorectal carcinomas in comparison with LS174T, SW480, HCT116,LST, HRT-18 and Hee8693, which were established from primary colorectal carcinomas. In vitro cell invasivion demonstrated that LoVo and SW620 had a higher invasive ability than LS174T, SW480, HCT116, LST, HRT-18 and Hee8693. The expression of Tiam1 gene was highly related to the metastatic potential of colorectal carcinoma cells.CONCLUSION: Tiam1 gene may play an important role in invasion and metastasis of colorectal carcinoma and is a metastasis-related gene.

  20. Antisense transcription as a tool to tune gene expression. (United States)

    Brophy, Jennifer A N; Voigt, Christopher A


    A surprise that has emerged from transcriptomics is the prevalence of genomic antisense transcription, which occurs counter to gene orientation. While frequent, the roles of antisense transcription in regulation are poorly understood. We built a synthetic system in Escherichia coli to study how antisense transcription can change the expression of a gene and tune the response characteristics of a regulatory circuit. We developed a new genetic part that consists of a unidirectional terminator followed by a constitutive antisense promoter and demonstrate that this part represses gene expression proportionally to the antisense promoter strength. Chip-based oligo synthesis was applied to build a large library of 5,668 terminator-promoter combinations that was used to control the expression of three repressors (PhlF, SrpR, and TarA) in a simple genetic circuit (NOT gate). Using the library, we demonstrate that antisense promoters can be used to tune the threshold of a regulatory circuit without impacting other properties of its response function. Finally, we determined the relative contributions of antisense RNA and transcriptional interference to repressing gene expression and introduce a biophysical model to capture the impact of RNA polymerase collisions on gene repression. This work quantifies the role of antisense transcription in regulatory networks and introduces a new mode to control gene expression that has been previously overlooked in genetic engineering.

  1. The Physcomitrella patens System for Transient Gene Expression Assays. (United States)

    Thévenin, Johanne; Xu, Wenjia; Vaisman, Louise; Lepiniec, Loïc; Dubreucq, Bertrand; Dubos, Christian


    Transient expression assays are valuable techniques to study in vivo the transcriptional regulation of gene expression. These methods allow to assess the transcriptional properties of a given transcription factor (TF) or a complex of regulatory proteins against specific DNA motifs, called cis-regulatory elements. Here, we describe a fast, efficient, and reliable method based on the use of Physcomitrella patens protoplasts that allows the study of gene expression in a qualitative and quantitative manner by combining the advantage of GFP (green fluorescent protein) as a marker of promoter activity with flow cytometry for accurate measurement of fluorescence in individual cells. PMID:27557766

  2. Sex-Dependent Gene Expression in Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Daniel Ronen


    Full Text Available Males and females have a variety of sexually dimorphic traits, most of which result from hormonal differences. However, differences between male and female embryos initiate very early in development, before hormonal influence begins, suggesting the presence of genetically driven sexual dimorphisms. By comparing the gene expression profiles of male and X-inactivated female human pluripotent stem cells, we detected Y-chromosome-driven effects. We discovered that the sex-determining gene SRY is expressed in human male pluripotent stem cells and is induced by reprogramming. In addition, we detected more than 200 differentially expressed autosomal genes in male and female embryonic stem cells. Some of these genes are involved in steroid metabolism pathways and lead to sex-dependent differentiation in response to the estrogen precursor estrone. Thus, we propose that the presence of the Y chromosome and specifically SRY may drive sex-specific differences in the growth and differentiation of pluripotent stem cells.

  3. Biologically supervised hierarchical clustering algorithms for gene expression data. (United States)

    Boratyn, Grzegorz M; Datta, Susmita; Datta, Somnath


    Cluster analysis has become a standard part of gene expression analysis. In this paper, we propose a novel semi-supervised approach that offers the same flexibility as that of a hierarchical clustering. Yet it utilizes, along with the experimental gene expression data, common biological information about different genes that is being complied at various public, Web accessible databases. We argue that such an approach is inherently superior than the standard unsupervised approach of grouping genes based on expression data alone. It is shown that our biologically supervised methods produce better clustering results than the corresponding unsupervised methods as judged by the distance from the model temporal profiles. R-codes of the clustering algorithm are available from the authors upon request. PMID:17947147

  4. New feature extraction in gene expression data for tumor classification

    Institute of Scientific and Technical Information of China (English)

    HE Renya; CHENG Qiansheng; WU Lianwen; YUAN Kehong


    Using gene expression data to discriminate tumor from the normal ones is a powerful method. However, it is sometimes difficult because the gene expression data are in high dimension and the object number of the data sets is very small. The key technique is to find a new gene expression profiling that can provide understanding and insight into tumor related cellular processes. In this paper, we propose a new feature extraction method based on variance to the center of the class and employ the support vector machine to recognize the gene data either normal or tumor. Two tumor data sets are used to demonstrate the effectiveness of our methods. The results show that the performance has been significantly improved.

  5. Floating Escherichia coli by expressing cyanobacterial gas vesicle genes (United States)

    Wang, Tianhe; Kang, Li; Li, Jiaheng; Wu, Wenjie; Zhang, Peiran; Gong, Minghao; Lai, Weihong; Zhang, Chunyan; Chang, Lei; Peng, Yong; Yang, Zhongzhou; Li, Lian; Bao, Yingying; Xu, Haowen; Zhang, Xiaohua; Sui, Zhenghong; Yang, Guanpin; Wang, Xianghong


    Gas vesicles are hollow, air-filled polyprotein structures that provide the buoyancy to cells. They are found in a variety of prokaryotes. In this study, we isolated a partial gas vesicle protein gene cluster containing gvpA and gvpC20Ψ from Planktothrix rubescens, and inserted it into an expression vector and expressed it in E. coli. The gas vesicle was developed in bacterial cells, which made bacterial cells to float on medium surface. We also amplified gvpA and gvpC20Ψ separately and synthesized an artificial operon by fusing these two genes with the standardized gene expression controlling elements of E. coli. The artificial operon was expressed in E. coli, forming gas vesicles and floating bacteria cells. Our findings verified that the whole set of genes and the overall structure of gas vesicle gene cluster are not necessary for developing gas vesicles in bacteria cells. Two genes, gvpA and gvpC20Ψ, of the gas vesicle gene cluster are sufficient for synthesizing an artificial operon that can develop gas vesicles in bacteria cells. Our findings provided a wide range of applications including easing the harvest of cultured microalgae and bacteria, as well as enriching and remediating aquatic pollutants by constructing gas vesicles in their cells.

  6. Expression pattern of GASA, downstream genes of DELLA, in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    ZHANG ShengChun; WANG XiaoJing


    Separation and functional research of related components involved in gibberellins (GAs) signaling are important to clarify the mechanism of GA functioning. Research on the downstream components of DELLA, the key factor of the GA signaling pathway, is limited at present. GASA (GA-Stimulated in Arabidopsis) family contains 15 genes usually regulated by GA in Arabidopsis thaliana. All GASA proteins have a cleavable signal peptide in N terminus and a conserved GASA domain including 12 cysteines in C terminus. RT-PCR analysis revealed that the expression of GASA4 and GASA6 were down-regulated, but GASA1 and GASA9were up-regulated in the DELLA mutants, gai-t6 and rga-24, as well as the double mutant, consisting with the results that GASA4 and GASA6 were induced, but GASA1 and GASA9 were inhibited by exogenous GA3. In addition, the expression patterns of other GASA genes were regulated by GA and ABA, separately or cooperatively. Most of GASA genes were expressed in roots, stems, leaves, flowers and developing siliques. GUS gene driven by the promoters of GASA6, GASA7, GASAS, GASA9, GASA10, GASA11 and GASA12were used as reporters and it was found that all GASA genes expressed in the growing and differentiating organs and abscission zones,suggesting the role of these genes in cell growth and differentiation. This study provided an important basis for functional study of the GASA gene family in the GA and ABA signaling pathway.

  7. Expression of Fox genes in the cephalochordate Branchiostoma lanceolatum

    Directory of Open Access Journals (Sweden)

    Daniel eAldea


    Full Text Available Forkhead box (Fox genes code for transcription factors that play important roles in different biological processes. They are found in a wide variety of organisms and appeared in unicellular eukaryotes. In metazoans, the gene family includes many members that can be subdivided into 24 classes. Cephalochordates are key organisms to understand the functional evolution of gene families in the chordate lineage due to their phylogenetic position as an early divergent chordate, their simple anatomy and genome structure. In the genome of the cephalochordate amphioxus Branchiostoma floridae, 32 Fox genes were identified, with at least one member for each of the classes that were present in the ancestor of bilaterians. In this work we describe the expression pattern of 13 of these genes during the embryonic development of the Mediterranean amphioxus, Branchiostoma lanceolatum. We found that FoxK and FoxM genes present an ubiquitous expression while all the others show specific expression patterns restricted to diverse embryonic territories. Many of these expression patterns are conserved with vertebrates, suggesting that the main functions of Fox genes in chordates were present in their common ancestor.

  8. In vitro maturation alters gene expression in bovine oocytes. (United States)

    Adona, Paulo R; Leal, Cláudia L V; Biase, Fernando H; De Bem, Tiago H; Mesquita, Lígia G; Meirelles, Flávio V; Ferraz, André L; Furlan, Luiz R; Monzani, Paulo S; Guemra, Samuel


    Gene expression profiling of in vivo- and in vitro-matured bovine oocytes can identify transcripts related to the developmental potential of oocytes. Nonetheless, the effects of in vitro culturing oocytes are yet to be fully understood. We tested the effects of in vitro maturation on the transcript profile of oocytes collected from Bos taurus indicus cows. We quantified the expression of 1488 genes in in vivo- and in vitro-matured oocytes. Of these, 51 genes were up-regulated, whereas 56 were down-regulated (≥2-fold) in in vivo-matured oocytes in comparison with in vitro-matured oocytes. Quantitative real-time polymerase chain reaction (PCR) of nine genes confirmed the microarray results of differential expression between in vivo- and in vitro-matured oocytes (EZR, EPN1, PSEN2, FST, IGFBP3, RBBP4, STAT3, FDPS and IRS1). We interrogated the results for enrichment of Gene Ontology categories and overlap with protein-protein interactions. The results revealed that the genes altered by in vitro maturation are mostly related to the regulation of oocyte metabolism. Additionally, analysis of protein-protein interactions uncovered two regulatory networks affected by the in vitro culture system. We propose that the differentially expressed genes are candidates for biomarkers of oocyte competence. In vitro oocyte maturation can affect the abundance of specific transcripts and are likely to deplete the developmental competence.

  9. Aging and Gene Expression in the Primate Brain

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, Hunter B.; Khaitovich, Philipp; Plotkin, Joshua B.; Paabo, Svante; Eisen, Michael B.


    It is well established that gene expression levels in many organisms change during the aging process, and the advent of DNA microarrays has allowed genome-wide patterns of transcriptional changes associated with aging to be studied in both model organisms and various human tissues. Understanding the effects of aging on gene expression in the human brain is of particular interest, because of its relation to both normal and pathological neurodegeneration. Here we show that human cerebral cortex, human cerebellum, and chimpanzee cortex each undergo different patterns of age-related gene expression alterations. In humans, many more genes undergo consistent expression changes in the cortex than in the cerebellum; in chimpanzees, many genes change expression with age in cortex, but the pattern of changes in expression bears almost no resemblance to that of human cortex. These results demonstrate the diversity of aging patterns present within the human brain, as well as how rapidly genome-wide patterns of aging can evolve between species; they may also have implications for the oxidative free radical theory of aging, and help to improve our understanding of human neurodegenerative diseases.

  10. Gene expression changes in patients with fulminant type 1 diabetes

    Institute of Scientific and Technical Information of China (English)

    WANG Zhen; ZHENG Chao; TAN Yu-yu; LI Yi-jun; YANG Lin; HUANG Gan; LIN Jian; ZHOU Zhi-guang


    Background Fulminant type 1 diabetes (F1D) is a complex disease.Microarray analysis was used to identify gene expression changes and obtain understanding of the underlying mechanisms.Methods Microarray analysis was performed on peripheral blood mononuclear cells from six F1D patients and six matched healthy subjects.Real-time polymerase chain reaction was used to verify the differentially expressed genes.NK cell activity was detected by methyl thiazoleterazolium assay.Results Microarray analysis identified 759 genes differing in expression between F1D patients and controls at a false discovery rate of 0.05.Expression of TLR9,ELF4 and IL1RAP were verified and consistent with changes in microarray results.NK cell activity was decreased in F1D.With use of a knowledge base,differentially expressed genes could be placed within different pathways with predicted functions including interleukin-1,and tumor necrosis factor-α signaling.Conclusions These results identify several genes indicating possible mechanisms in F1D.NK cell dysfunction resulting from changes in expression of TLR9,ELF4 and IL1RAP,and pathways of interleukin-1 and tumor necrosis factor-α signaling might be involved in F1D through inducing β-cell dysfunction.

  11. Aging and gene expression in the primate brain.

    Directory of Open Access Journals (Sweden)


    Full Text Available It is well established that gene expression levels in many organisms change during the aging process, and the advent of DNA microarrays has allowed genome-wide patterns of transcriptional changes associated with aging to be studied in both model organisms and various human tissues. Understanding the effects of aging on gene expression in the human brain is of particular interest, because of its relation to both normal and pathological neurodegeneration. Here we show that human cerebral cortex, human cerebellum, and chimpanzee cortex each undergo different patterns of age-related gene expression alterations. In humans, many more genes undergo consistent expression changes in the cortex than in the cerebellum; in chimpanzees, many genes change expression with age in cortex, but the pattern of changes in expression bears almost no resemblance to that of human cortex. These results demonstrate the diversity of aging patterns present within the human brain, as well as how rapidly genome-wide patterns of aging can evolve between species; they may also have implications for the oxidative free radical theory of aging, and help to improve our understanding of human neurodegenerative diseases.

  12. Hygromycin-resistance vectors for gene expression in Pichia pastoris. (United States)

    Yang, Junjie; Nie, Lei; Chen, Biao; Liu, Yingmiao; Kong, Yimeng; Wang, Haibin; Diao, Liuyang


    Pichia pastoris is a common host organism for heterologous protein expression and metabolic engineering. Zeocin-, G418-, nourseothricin- and blasticidin-resistance genes are the only dominant selectable markers currently available for selecting P. pastoris transformants. We describe here new P. pastoris expression vectors that confer a hygromycin resistance base on the Klebsiella pneumoniae hph gene. To demonstrate the application of the vectors for intracellular and secreted protein expression, green fluorescent protein (GFP) and human serum albumin (HSA) were cloned into the vectors and transformed into P. pastoris cells. The resulting strains expressed GFP and HSA constitutively or inducibly. The hygromycin resistance marker was also suitable for post-transformational vector amplication (PTVA) for obtaining strains with high plasmid copy numbers. A strain with multiple copies of the HSA expression cassette after PTVA had increased HSA expression compared with a strain with a single copy of the plasmid. To demonstrate compatibility of the new vectors with other vectors bearing antibiotic-resistance genes, P. pastoris was transformed with the Saccharomyces cerevisiae genes GSH1, GSH2 or SAM2 on plasmids containing genes for resistance to Zeocin, G418 or hygromycin. The resulting strain produced glutathione and S-adenosyl-L-methionine at levels approximately twice those of the parent strain. The new hygromycin-resistance vectors allow greater flexibility and potential applications in recombinant protein production and other research using P. pastoris. PMID:24822243

  13. Copper induces the expression of cholesterogenic genes in human macrophages. (United States)

    Svensson, Per Arne; Englund, Mikael C O; Markström, Emilia; Ohlsson, Bertil G; Jernås, Margareta; Billig, Håkan; Torgerson, Jarl S; Wiklund, Olov; Carlsson, Lena M S; Carlsson, Björn


    Accumulation of lipids and cholesterol by macrophages and subsequent transformation into foam cells are key features in development of atherosclerosis. Serum copper concentrations have been shown to be associated with cardiovascular disease. However, the mechanism behind the proatherogenic effect of copper is not clear. We used DNA microarrays to define the changes in gene expression profile in response to copper exposure of human macrophages. Expression monitoring by DNA microarray revealed 91 genes that were regulated. Copper increased the expression of seven cholesterogenic genes (3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) synthase, IPP isomerase, squalene synthase, squalene epoxidase, methyl sterol oxidase, H105e3 mRNA and sterol-C5-desaturase) and low-density lipoprotein receptor (LDL-R), and decreased the expression of CD36 and lipid binding proteins. The expression of LDL-R and HMG CoA reductase was also investigated using real time PCR. The expression of both of these genes was increased after copper treatment of macrophages (Pmechanism for the association between copper and atherosclerosis. The effect of copper on cholesterogenic genes may also have implications for liver steatosis in early stages of Wilson's disease.

  14. An anatomic gene expression atlas of the adult mouse brain. (United States)

    Ng, Lydia; Bernard, Amy; Lau, Chris; Overly, Caroline C; Dong, Hong-Wei; Kuan, Chihchau; Pathak, Sayan; Sunkin, Susan M; Dang, Chinh; Bohland, Jason W; Bokil, Hemant; Mitra, Partha P; Puelles, Luis; Hohmann, John; Anderson, David J; Lein, Ed S; Jones, Allan R; Hawrylycz, Michael


    Studying gene expression provides a powerful means of understanding structure-function relationships in the nervous system. The availability of genome-scale in situ hybridization datasets enables new possibilities for understanding brain organization based on gene expression patterns. The Anatomic Gene Expression Atlas (AGEA) is a new relational atlas revealing the genetic architecture of the adult C57Bl/6J mouse brain based on spatial correlations across expression data for thousands of genes in the Allen Brain Atlas (ABA). The AGEA includes three discovery tools for examining neuroanatomical relationships and boundaries: (1) three-dimensional expression-based correlation maps, (2) a hierarchical transcriptome-based parcellation of the brain and (3) a facility to retrieve from the ABA specific genes showing enriched expression in local correlated domains. The utility of this atlas is illustrated by analysis of genetic organization in the thalamus, striatum and cerebral cortex. The AGEA is a publicly accessible online computational tool integrated with the ABA ( PMID:19219037

  15. Novel gene expression tools for rice biotechnology (United States)

    Biotechnology is an effective and important method of improving both quality and agronomic traits in rice. We are developing novel molecular tools for genetic engineering, with a focus on developing novel transgene expression control elements (i.e. promoters) for rice. A suite of monocot grass promo...

  16. Clustering based gene expression feature selection method: A computational approach to enrich the classifier efficiency of differentially expressed genes

    KAUST Repository

    Abusamra, Heba


    The native nature of high dimension low sample size of gene expression data make the classification task more challenging. Therefore, feature (gene) selection become an apparent need. Selecting a meaningful and relevant genes for classifier not only decrease the computational time and cost, but also improve the classification performance. Among different approaches of feature selection methods, however most of them suffer from several problems such as lack of robustness, validation issues etc. Here, we present a new feature selection technique that takes advantage of clustering both samples and genes. Materials and methods We used leukemia gene expression dataset [1]. The effectiveness of the selected features were evaluated by four different classification methods; support vector machines, k-nearest neighbor, random forest, and linear discriminate analysis. The method evaluate the importance and relevance of each gene cluster by summing the expression level for each gene belongs to this cluster. The gene cluster consider important, if it satisfies conditions depend on thresholds and percentage otherwise eliminated. Results Initial analysis identified 7120 differentially expressed genes of leukemia (Fig. 15a), after applying our feature selection methodology we end up with specific 1117 genes discriminating two classes of leukemia (Fig. 15b). Further applying the same method with more stringent higher positive and lower negative threshold condition, number reduced to 58 genes have be tested to evaluate the effectiveness of the method (Fig. 15c). The results of the four classification methods are summarized in Table 11. Conclusions The feature selection method gave good results with minimum classification error. Our heat-map result shows distinct pattern of refines genes discriminating between two classes of leukemia.

  17. Intra- and interspecific variation in primate gene expression patterns. (United States)

    Enard, Wolfgang; Khaitovich, Philipp; Klose, Joachim; Zöllner, Sebastian; Heissig, Florian; Giavalisco, Patrick; Nieselt-Struwe, Kay; Muchmore, Elaine; Varki, Ajit; Ravid, Rivka; Doxiadis, Gaby M; Bontrop, Ronald E; Pääbo, Svante


    Although humans and their closest evolutionary relatives, the chimpanzees, are 98.7% identical in their genomic DNA sequences, they differ in many morphological, behavioral, and cognitive aspects. The underlying genetic basis of many of these differences may be altered gene expression. We have compared the transcriptome in blood leukocytes, liver, and brain of humans, chimpanzees, orangutans, and macaques using microarrays, as well as protein expression patterns of humans and chimpanzees using two-dimensional gel electrophoresis. We also studied three mouse species that are approximately as related to each other as are humans, chimpanzees, and orangutans. We identified species-specific gene expression patterns indicating that changes in protein and gene expression have been particularly pronounced in the human brain. PMID:11951044

  18. Adipose tissue resistin gene expression in DIO and DR rats

    Institute of Scientific and Technical Information of China (English)

    Yuanyuan Zhao; Yuhui Ni; Xirong Guo; Haixia Gong; Xia Chi; Ronghua Chen


    Objective: To investigate the expression of resistin gene in diet-induced obesity (DIO) and diet resistance (DR)rats. Methods: DIO and DR models were prepared with male SD rats after 6 weeks feeding by a diet of relatively high fat, sucrose, and caloric content (HE diet). Body-weight, fat mass, and the concentration of serum insulin were measured, and the expression of resistin and Peroxisome proliferator-activated receptory-γ(PPAR-γ) gene in whit adipose tissue (WAT) was also detected by RT-PCR. Results: ①Body weight, fat mass and the concentration of serum insulin were significantly increased in DIO rats and decreased in DR rats. ② The expression of resistin and PPARγ gene was upregulated in DIO group and supressed in DR group, but the expression of resistin was not detectable in all samples within three groups. Conclusion: Resistin may serve as a link between obesity and insulin resistance, but the individual difference is enormous.

  19. Cloning and expression of Neisseria meningitides luxS gene

    Institute of Scientific and Technical Information of China (English)

    Bahram Kazemi; Nazila Baghalzadeh-Mohammadi; Reza Hadavi; Mojgan Bandehpour; Elham Ghayour; Majid Moghbeli; Kazem Parivar


    Neisseria meningitides is a Gram-negative bacterium which is an important causative agent of septicemia and meningitis.Numerous pathogenic bacteria contain luxS,which is required for autoinducer-2 production.Neis-seria meningitides contains a functional copy of luxS that is necessary for full meningococcal virulence.Neisse-ria meningitides DNA was extracted and its luxS gene was amplified by nested PCR.PCR product was purified and cloned in to pQE-30 expression vector.Recombinant plasmid was transformed and mass cultured.luxS was expressed in E.coli and confirmed by western blot analysis.In this study,N.meningitides luxS was amplified, cloned and expressed successfully.The sequencing of PCR product confirmed that amplified gene was luxS. Gene was expressed and observed in SDS-PAGE.Protein was reacted by his tag monoclonal antibody through western blot analysis.

  20. Network Security via Biometric Recognition of Patterns of Gene Expression (United States)

    Shaw, Harry C.


    Molecular biology provides the ability to implement forms of information and network security completely outside the bounds of legacy security protocols and algorithms. This paper addresses an approach which instantiates the power of gene expression for security. Molecular biology provides a rich source of gene expression and regulation mechanisms, which can be adopted to use in the information and electronic communication domains. Conventional security protocols are becoming increasingly vulnerable due to more intensive, highly capable attacks on the underlying mathematics of cryptography. Security protocols are being undermined by social engineering and substandard implementations by IT organizations. Molecular biology can provide countermeasures to these weak points with the current security approaches. Future advances in instruments for analyzing assays will also enable this protocol to advance from one of cryptographic algorithms to an integrated system of cryptographic algorithms and real-time expression and assay of gene expression products.

  1. Expression Patterns of Glucose Transporter-1 Gene and Thyroid Specific Genes in Human Papillary Thyroid Carcinoma

    International Nuclear Information System (INIS)

    The expression of glucose transporter-1 (Glut-1) gene and those of major thyroid-specific genes were examined in papillary carcinoma tissues, and the expressions of these genes were compared with cancer differentiation grades. Twenty-four human papillary carcinoma tissues were included in this study. The expressions of Glut-1- and thyroid-specific genes [sodium/iodide symporter (NIS), thyroid peroxidase, thyroglobulin, TSH receptor and pendrin] were analyzed by RT-PCR. Expression levels were expressed as ratios versus the expression of beta-actin. Pathologic differentiation of papillary carcinoma was classified into a relatively well-differentiated group (n=13) and relatively less differentiated group (n=11). Glut-1 gene expression was significantly higher in the less differentiated group (0.66±0.04) than in the well-differentiated group (0.59±0.07). The expression levels of the NIS, PD and TG genes were significantly higher in the well-differentiated group (NIS: 0.67±0.20, PD: 0.65±0.21, TG: 0.74±0.16) than in the less differentiated group (NIS: 0.36±0.05, PD: 0.49±0.08, TG: 0.60±0.11), respectively. A significant negative correlation was found between Glut-1 and NIS expression, and positive correlations were found between NIS and TG, and between NIS and PD. The NIS, PD and TG genes were highly expressed in well-differentiated thyroid carcinomas, whereas the Glut-1 gene was highly expressed in less differentiated thyroid carcinomas. These findings provide a molecular rationale for the management of papillary carcinoma, especially in the selection of FDG PET or radioiodine whole-body scan and I-131-based therapy

  2. Expression Patterns of Glucose Transporter-1 Gene and Thyroid Specific Genes in Human Papillary Thyroid Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sungeun; Chung, Junekey; Min Haesook and others


    The expression of glucose transporter-1 (Glut-1) gene and those of major thyroid-specific genes were examined in papillary carcinoma tissues, and the expressions of these genes were compared with cancer differentiation grades. Twenty-four human papillary carcinoma tissues were included in this study. The expressions of Glut-1- and thyroid-specific genes [sodium/iodide symporter (NIS), thyroid peroxidase, thyroglobulin, TSH receptor and pendrin] were analyzed by RT-PCR. Expression levels were expressed as ratios versus the expression of beta-actin. Pathologic differentiation of papillary carcinoma was classified into a relatively well-differentiated group (n=13) and relatively less differentiated group (n=11). Glut-1 gene expression was significantly higher in the less differentiated group (0.66±0.04) than in the well-differentiated group (0.59±0.07). The expression levels of the NIS, PD and TG genes were significantly higher in the well-differentiated group (NIS: 0.67±0.20, PD: 0.65±0.21, TG: 0.74±0.16) than in the less differentiated group (NIS: 0.36±0.05, PD: 0.49±0.08, TG: 0.60±0.11), respectively. A significant negative correlation was found between Glut-1 and NIS expression, and positive correlations were found between NIS and TG, and between NIS and PD. The NIS, PD and TG genes were highly expressed in well-differentiated thyroid carcinomas, whereas the Glut-1 gene was highly expressed in less differentiated thyroid carcinomas. These findings provide a molecular rationale for the management of papillary carcinoma, especially in the selection of FDG PET or radioiodine whole-body scan and I-131-based therapy.

  3. Differences in the Composition of Archaeal Communities in Sediments from Contrasting Zones of Lake Taihu (United States)

    Fan, Xianfang; Xing, Peng


    In shallow lakes, different primary producers might impact the physiochemical characteristics of the sediment and the associated microbial communities. Until now, little was known about the features of sediment Archaea and their variation across different primary producer-dominated ecosystems. Lake Taihu provides a suitable study area with cyanobacteria- and macrophyte-dominated zones co-occurring in one ecosystem. The composition of the sediment archaeal community was assessed using 16S rRNA gene amplicon sequencing technology, based on which the potential variation with respect to the physiochemical characteristics of the sediment was analyzed. Euryarchaeota (30.19% of total archaeal sequences) and Bathyarchaeota (28.00%) were the two most abundant phyla, followed by Crenarchaeota (11.37%), Aigarchaeota (10.24%) and Thaumarchaeota (5.98%). The differences found in the composition of the archaeal communities between the two zones was significant (p = 0.005). Sediment from macrophyte-dominated zones had high TOC and TN content and an abundance of archaeal lineages potentially involved in the degradation of complex organic compounds, such as the order Thermoplasmatales. In the area dominated by Cyanobacteria, archaeal lineages related to sulfur metabolism, for example, Sulfolobales and Desulfurococcales, were significantly enriched. Among Bathyarchaeota, subgroups MCG-6 and MCG-15 were significantly accumulated in the sediment of areas dominated by macrophytes whereas MCG-4 was consistently dominant in both type of sediments. The present study contributes to the knowledge of sediment archaeal communities with different primary producers and their possible biogeochemical functions in sediment habitats. PMID:27708641

  4. A compendium of canine normal tissue gene expression.

    Directory of Open Access Journals (Sweden)

    Joseph Briggs

    Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

  5. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  6. A mammalianized synthetic nitroreductase gene for high-level expression

    International Nuclear Information System (INIS)

    The nitroreductase/5-(azaridin-1-yl)-2,4-dinitrobenzamide (NTR/CB1954) enzyme/prodrug system is considered as a promising candidate for anti-cancer strategies by gene-directed enzyme prodrug therapy (GDEPT) and has recently entered clinical trials. It requires the genetic modification of tumor cells to express the E. coli enzyme nitroreductase that bioactivates the prodrug CB1954 to a powerful cytotoxin. This metabolite causes apoptotic cell death by DNA interstrand crosslinking. Enhancing the enzymatic NTR activity for CB1954 should improve the therapeutical potential of this enzyme-prodrug combination in cancer gene therapy. We performed de novo synthesis of the bacterial nitroreductase gene adapting codon usage to mammalian preferences. The synthetic gene was investigated for its expression efficacy and ability to sensitize mammalian cells to CB1954 using western blotting analysis and cytotoxicity assays. In our study, we detected cytoplasmic protein aggregates by expressing GFP-tagged NTR in COS-7 cells, suggesting an impaired translation by divergent codon usage between prokaryotes and eukaryotes. Therefore, we generated a synthetic variant of the nitroreductase gene, called ntro, adapted for high-level expression in mammalian cells. A total of 144 silent base substitutions were made within the bacterial ntr gene to change its codon usage to mammalian preferences. The codon-optimized ntro either tagged to gfp or c-myc showed higher expression levels in mammalian cell lines. Furthermore, the ntro rendered several cell lines ten times more sensitive to the prodrug CB1954 and also resulted in an improved bystander effect. Our results show that codon optimization overcomes expression limitations of the bacterial ntr gene in mammalian cells, thereby improving the NTR/CB1954 system at translational level for cancer gene therapy in humans

  7. Construction of Prokaryotic Expression Vector of Mouse Nanog Gene and Its Expression

    Institute of Scientific and Technical Information of China (English)

    LI Jun; L(U) Chang-rong; DOU Lin; DOU Zhong-ying


    The aim of this study is to construct a prokaryotic expression vector of mouse Nanog gene andto express it in E. Coli. A pair of primers was designed according to digestion sites in plasmid pGEX-KG and the Nanog gene sequence published by GenBank. The DNA fragment of 918 bp was amplified by polymerase chain reaction (PCR) from the pNA992 recombinant plasmid with Nanog gene, then cloned into pGEX-KG and transformed into the host E. Coli strain TG I. The sequence of the fragment was matched with the original sequence of pNA992. It indicated that fusion expression vector, pGEX-KGNanog, was constructed successfully. The pGEX-KG-Nanog plasmid was extracted from E. Coli strain TG I and was transformed into BL21(DE3) for expression. After induction by isopropyl-β-D-thiogalactoside (IPTG) at 37℃, the expression product of Nanog gene was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the expression condition was optimized. Nanog fusion protein was successfully expressed in the form of inclusion bodies. The molecular weight of the inclusion body was 63 kDa. Meanwhile, the optimum condition for the expression of Nanog fusion protein was induced with 0.8 mmol L-1 IPTG for 5 h. The mouse Nanog gene was successfully expressed in E. Coli, which laid a foundation for the purification of Nanog protein and for the preparation of polyclonal antibody.

  8. A weakened transcriptional enhancer yields variegated gene expression.

    Directory of Open Access Journals (Sweden)

    Cathy Collins

    Full Text Available Identical genes in the same cellular environment are sometimes expressed differently. In some cases, including the immunoglobulin heavy chain (IgH locus, this type of differential gene expression has been related to the absence of a transcriptional enhancer. To gain additional information on the role of the IgH enhancer, we examined expression driven by enhancers that were merely weakened, rather than fully deleted, using both mutations and insulators to impair enhancer activity. For this purpose we used a LoxP/Cre system to place a reporter gene at the same genomic site of a stable cell line. Whereas expression of the reporter gene was uniformly high in the presence of the normal, uninsulated enhancer and undetectable in its absence, weakened enhancers yielded variegated expression of the reporter gene; i.e., the average level of expression of the same gene differed in different clones, and expression varied significantly among cells within individual clones. These results indicate that the weakened enhancer allows the reporter gene to exist in at least two states. Subtle aspects of the variegation suggest that the IgH enhancer decreases the average duration (half-life of the silent state. This analysis has also tested the conventional wisdom that enhancer activity is independent of distance and orientation. Thus, our analysis of mutant (truncated forms of the IgH enhancer revealed that the 250 bp core enhancer was active in its normal position, approximately 1.4 kb 3' of the promoter, but inactive approximately 6 kb 3', indicating that the activity of the core enhancer was distance-dependent. A longer segment--the core enhancer plus approximately 1 kb of 3' flanking material, including the 3' matrix attachment region--was active, and the activity of this longer segment was orientation-dependent. Our data suggest that this 3' flank includes binding sites for at least two activators.

  9. Toll-Like Receptor Gene Expression during Trichinella spiralis Infection. (United States)

    Kim, Sin; Park, Mi Kyung; Yu, Hak Sun


    In Trichinella spiralis infection, type 2 helper T (Th2) cell-related and regulatory T (Treg) cell-related immune responses are the most important immune events. In order to clarify which Toll-like receptors (TLRs) are closely associated with these responses, we analyzed the expression of mouse TLR genes in the small intestine and muscle tissue during T. spiralis infection. In addition, the expression of several chemokine- and cytokine-encoding genes, which are related to Th2 and Treg cell mediated immune responses, were analyzed in mouse embryonic fibroblasts (MEFs) isolated from myeloid differentiation factor 88 (MyD88)/TIR-associated proteins (TIRAP) and Toll receptor-associated activator of interferons (TRIF) adapter protein deficient and wild type (WT) mice. The results showed significantly increased TLR4 and TLR9 gene expression in the small intestine after 2 weeks of T. spiralis infection. In the muscle, TLR1, TLR2, TLR5, and TLR9 gene expression significantly increased after 4 weeks of infection. Only the expression of the TLR4 and TLR9 genes was significantly elevated in WT MEF cells after treatment with excretory-secretory (ES) proteins. Gene expression for Th2 chemokine genes were highly enhanced by ES proteins in WT MEF cells, while this elevation was slightly reduced in MyD88/TIRAP(-/-) MEF cells, and quite substantially decreased in TRIF(-/-) MEF cells. In contrast, IL-10 and TGF-β expression levels were not elevated in MyD88/TIRAP(-/-) MEF cells. In conclusion, we suggest that TLR4 and TLR9 might be closely linked to Th2 cell and Treg cell mediated immune responses, although additional data are needed to convincingly prove this observation. PMID:26323841

  10. Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis. (United States)

    Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C


    The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species. PMID:26149127

  11. A prognostic gene expression signature in infratentorial ependymoma. (United States)

    Wani, Khalida; Armstrong, Terri S; Vera-Bolanos, Elizabeth; Raghunathan, Aditya; Ellison, David; Gilbertson, Richard; Vaillant, Brian; Goldman, Stewart; Packer, Roger J; Fouladi, Maryam; Pollack, Ian; Mikkelsen, Tom; Prados, Michael; Omuro, Antonio; Soffietti, Riccardo; Ledoux, Alicia; Wilson, Charmaine; Long, Lihong; Gilbert, Mark R; Aldape, Ken


    Patients with ependymoma exhibit a wide range of clinical outcomes that are currently unexplained by clinical or histological factors. Little is known regarding molecular biomarkers that could predict clinical behavior. Since recent data suggest that these tumors display biological characteristics according to their location (cerebral vs. infratentorial vs. spinal cord), rather than explore a broad spectrum of ependymoma, we focused on molecular alterations in ependymomas arising in the infratentorial compartment. Unsupervised clustering of available gene expression microarray data revealed two major subgroups of infratentorial ependymoma. Group 1 tumors over expressed genes that were associated with mesenchyme, Group 2 tumors showed no distinct gene ontologies. To assess the prognostic significance of these gene expression subgroups, real-time reverse transcriptase polymerase chain reaction assays were performed on genes defining the subgroups in a training set. This resulted in a 10-gene prognostic signature. Multivariate analysis showed that the 10-gene signature was an independent predictor of recurrence-free survival after adjusting for clinical factors. Evaluation of an external dataset describing subgroups of infratentorial ependymomas showed concordance of subgroup definition, including validation of the mesenchymal subclass. Importantly, the 10-gene signature was validated as a predictor of recurrence-free survival in this dataset. Taken together, the results indicate a link between clinical outcome and biologically identified subsets of infratentorial ependymoma and offer the potential for prognostic testing to estimate clinical aggressiveness in these tumors.

  12. Identification of novel Trichoderma hamatum genes expressed during mycoparasitism

    Institute of Scientific and Technical Information of China (English)

    Margaret Carpenter; Alison Stewart; Hayley Ridgway


    @@ Trichoderma species are currently used as biocontrol agents for crop diseases caused by a number of fungal plant pathogens. However, their biocontrol performance in the field can be unreliable and it is likely that more consistent performance could be achieved through knowledge and manipulation of the genes involved. For example, induction of the genes could be optimised for variable environmental and physiological conditions, superior strains could be selected more effectively and novel strains could be created. One method by which Trichoderma species accomplish biocontrol is mycoparasitism. Several genes involved in the mycoparasitic interaction have previously been characterised, however these consist predominantly of those that encode enzymes that degrade fungal cell walls. In the current study subtractive hybridisation was used to target genes expressed when Trichoderma hamatum and the plant pathogen Sclerotinia sclerotiorum were cultured together, subtracting genes expressed when each are grown individually. This experimental design has the potential to yield T.hamatum genes involved in mycoparasitism of S. sclerotiorum, and S. sclerotiorum genes upregulated in host defence. The cDNA fragments yielded by the subtraction were characterised with respect to expression, sequence and species of origin. A number of novel T. hamatum genes which were up-regulated during mycoparasitism were identified.

  13. Changes in skeletal muscle gene expression following clenbuterol administration

    Directory of Open Access Journals (Sweden)

    McIntyre Lauren M


    Full Text Available Abstract Background Beta-adrenergic receptor agonists (BA induce skeletal muscle hypertrophy, yet specific mechanisms that lead to this effect are not well understood. The objective of this research was to identify novel genes and physiological pathways that potentially facilitate BA induced skeletal muscle growth. The Affymetrix platform was utilized to identify gene expression changes in mouse skeletal muscle 24 hours and 10 days after administration of the BA clenbuterol. Results Administration of clenbuterol stimulated anabolic activity, as indicated by decreased blood urea nitrogen (BUN; P P Conclusion Global evaluation of gene expression after administration of clenbuterol identified changes in gene expression and overrepresented functional categories of genes that may regulate BA-induced muscle hypertrophy. Changes in mRNA abundance of multiple genes associated with myogenic differentiation may indicate an important effect of BA on proliferation, differentiation, and/or recruitment of satellite cells into muscle fibers to promote muscle hypertrophy. Increased mRNA abundance of genes involved in the initiation of translation suggests that increased levels of protein synthesis often associated with BA administration may result from a general up-regulation of translational initiators. Additionally, numerous other genes and physiological pathways were identified that will be important targets for further investigations of the hypertrophic effect of BA on skeletal muscle.

  14. Development of Gene Expression Signatures for Practical Radiation Biodosimetry

    International Nuclear Information System (INIS)

    Purpose: In a large-scale radiologic emergency, estimates of exposure doses and radiation injury would be required for individuals without physical dosimeters. Current methods are inadequate for the task, so we are developing gene expression profiles for radiation biodosimetry. This approach could provide both an estimate of physical radiation dose and an indication of the extent of individual injury or future risk. Methods and Materials: We used whole genome microarray expression profiling as a discovery platform to identify genes with the potential to predict radiation dose across an exposure range relevant for medical decision making in a radiologic emergency. Human peripheral blood from 10 healthy donors was irradiated ex vivo, and global gene expression was measured both 6 and 24 h after exposure. Results: A 74-gene signature was identified that distinguishes between four radiation doses (0.5, 2, 5, and 8 Gy) and controls. More than one third of these genes are regulated by TP53. A nearest centroid classifier using these same 74 genes correctly predicted 98% of samples taken either 6 h or 24 h after treatment as unexposed, exposed to 0.5, 2, or ≥5 Gy. Expression patterns of five genes (CDKN1A, FDXR, SESN1, BBC3, and PHPT1) from this signature were also confirmed by real-time polymerase chain reaction. Conclusion: The ability of a single gene set to predict radiation dose throughout a window of time without need for individual pre-exposure controls represents an important advance in the development of gene expression for biodosimetry

  15. Host genetic variation influences gene expression response to rhinovirus infection.

    Directory of Open Access Journals (Sweden)

    Minal Çalışkan


    Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

  16. Single-cell PCR profiling of gene expression in hematopoiesis. (United States)

    Teles, José; Enver, Tariq; Pina, Cristina


    Single-cell analysis of gene expression offers the possibility of exploring cellular and molecular heterogeneity in stem and developmental cell systems, including cancer, to infer routes of cellular specification and their respective gene regulatory modules. PCR-based technologies, although limited to the analysis of a predefined set of genes, afford a cost-effective balance of throughput and biological information and have become a method of choice in stem cell laboratories. Here we describe an experimental and analytical protocol based on the Fluidigm microfluidics platform for the simultaneous expression analysis of 48 or 96 genes in multiples of 48 or 96 cells. We detail wet laboratory procedures and describe clustering, principal component analysis, correlation, and classification tools for the inference of cellular pathways and gene networks. PMID:25062620

  17. Some statistical properties of gene expression clustering for array data

    DEFF Research Database (Denmark)

    Abreu, G C G; Pinheiro, A; Drummond, R D;


    for simulated as well as for two real data sets. We also implement a bootstrap-based pre-processing procedure for SOM, that improves the false discovery ratio of differentially expressed genes. Code in Matlab is freely available, as well as some supplementary material, at the following address: https......DNA arrays have been a rich source of data for the study of genomic expression of a wide variety of biological systems. Gene clustering is one of the paradigms quite used to assess the significance of a gene (or group of genes). However, most of the gene clustering techniques are applied to c......DNA array data without a corresponding statistical error measure. We propose an easy-to-implement and simple-to-use technique that uses bootstrap re-sampling to evaluate the statistical error of the nodes provided by SOM-based clustering. Comparisons between SOM and parametric clustering are presented...

  18. Differential expression of granulopoiesis related genes in neutrophil subsets distinguished by membrane expression of CD177

    DEFF Research Database (Denmark)

    Hu, Nan; Mora-Jensen, Helena; Theilgaard-Mønch, Kim;


    OBJECTIVE: Differential gene expression in CD177+ and CD177- neutrophils was investigated, in order to detect possible differences in neutrophil function which could be related to the pathogenesis of ANCA-associated Vasculitides (AAV). METHODS: Neutrophils were isolated from healthy controls (HC......) with high, negative or bimodal CD177 expression, and sorted into CD177+ and CD177- subpopulations. Total RNA was screened for expression of 24,000 probes with Illumina Ref-8 Beadchips. Genes showing differential expression between CD177+ and CD177- subsets in microarray analysis were re-assessed using...... quantitative-PCR. CD177 expression on neutrophil precursors in bone marrow was analyzed using quantitative PCR and flowcytometry. RESULTS: The proportion of CD177+ cells increased during neutrophil maturation in bone marrow. Fold change analysis of gene expression profile of sorted CD177+ and CD177...

  19. Transcriptome database resource and gene expression atlas for the rose

    Directory of Open Access Journals (Sweden)

    Dubois Annick


    Full Text Available Abstract Background For centuries roses have been selected based on a number of traits. Little information exists on the genetic and molecular basis that contributes to these traits, mainly because information on expressed genes for this economically important ornamental plant is scarce. Results Here, we used a combination of Illumina and 454 sequencing technologies to generate information on Rosa sp. transcripts using RNA from various tissues and in response to biotic and abiotic stresses. A total of 80714 transcript clusters were identified and 76611 peptides have been predicted among which 20997 have been clustered into 13900 protein families. BLASTp hits in closely related Rosaceae species revealed that about half of the predicted peptides in the strawberry and peach genomes have orthologs in Rosa dataset. Digital expression was obtained using RNA samples from organs at different development stages and under different stress conditions. qPCR validated the digital expression data for a selection of 23 genes with high or low expression levels. Comparative gene expression analyses between the different tissues and organs allowed the identification of clusters that are highly enriched in given tissues or under particular conditions, demonstrating the usefulness of the digital gene expression analysis. A web interface ROSAseq was created that allows data interrogation by BLAST, subsequent analysis of DNA clusters and access to thorough transcript annotation including best BLAST matches on Fragaria vesca, Prunus persica and Arabidopsis. The rose peptides dataset was used to create the ROSAcyc resource pathway database that allows access to the putative genes and enzymatic pathways. Conclusions The study provides useful information on Rosa expressed genes, with thorough annotation and an overview of expression patterns for transcripts with good accuracy.

  20. Effect of surgical procedures on prostate tumor gene expression profiles

    Institute of Scientific and Technical Information of China (English)

    Jie Li; Zhi-Hong Zhang; Chang-Jun Yin; Christian Pavlovich; Jun Luo; Robert Getzenberg; Wei Zhang


    Current surgical treatment of prostate cancer is typically accomplished by either open radical prostatectomy (ORP) or robotic-assisted laparoscopic radical prostatectomy (RALRP).Intra-operative procedural differences between the two surgical approaches may alter the molecular composition of resected surgical specimens,which are indispensable for molecular analysis and biomarker evaluation.The objective of this study is to investigate the effect of different surgical procedures on RNA quality and genome-wide expression signature.RNA integrity number (RIN) values were compared between total RNA samples extracted from consecutive LRP (n=11 ) and ORP (n=24) prostate specimens.Expression profiling was performed using the Agilent human whole-genome expression microarrays.Expression differences by surgical type were analyzed by Volcano plot analysis and gene ontology analysis.Quantitative reverse transcription (RT)-PCR was used for expression validation in an independent set of LRP (n=8) and ORP (n=8) samples.The LRP procedure did not compromise RNA integrity.Differential gene expression by surgery types was limited to a small subset of genes,the number of which was smaller than that expected by chance.Unexpectedly,this small subset of differentially expressed genes was enriched for those encoding transcription factors,oxygen transporters and other previously reported surgery-induced stress-response genes,and demonstrated unidirectional reduction in LRP specimens in comparison to ORP specimens.The effect of the LRP procedure on RNA quality and genome-wide transcript levels is negligible,supporting the suitability of LRP surgical specimens for routine molecular analysis.Blunted in vivo stress response in LRP specimens,likely mediated by CO2 insufflation but not by longer ischemia time,is manifested in the reduced expression of stress-response genes in these specimens.

  1. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes (United States)

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.


    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring.

  2. Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1) promoter optimization

    Institute of Scientific and Technical Information of China (English)

    Ti Liu; Tianhong Wang; Xian Li; Xuan Liu


    To improve heterologous gene expression in Trichoderma reesei, a set of optimal artificial cellobiohydrolase I gene (cbh1) promoters was obtained. The region from-677 to -724 with three potential glucose repressor binding sites was deleted. Then the region from-620 to-820 of the modified cbh1 promoter, including the CCAAT box and the Ace2 binding site, was repeatedly inserted into the modified cbh1 promoter, obtaining promoters with copy numbers 2, 4,and 6. The results showed that the glucose repression effects were abolished and the expression level of the glucuronidase (gus) reporter gene regulated by these multi-copy promoters was markedly enhanced as the copy number increased simultaneously. The data showed the great promise of using the promoter artificial modification strategy to increase heterologous gene expression in filamentous fungi and provided a set of optional high-expression vectors for gene function investigation and strain modification.

  3. Time-Course Gene Set Analysis for Longitudinal Gene Expression Data.

    Directory of Open Access Journals (Sweden)

    Boris P Hejblum


    Full Text Available Gene set analysis methods, which consider predefined groups of genes in the analysis of genomic data, have been successfully applied for analyzing gene expression data in cross-sectional studies. The time-course gene set analysis (TcGSA introduced here is an extension of gene set analysis to longitudinal data. The proposed method relies on random effects modeling with maximum likelihood estimates. It allows to use all available repeated measurements while dealing with unbalanced data due to missing at random (MAR measurements. TcGSA is a hypothesis driven method that identifies a priori defined gene sets with significant expression variations over time, taking into account the potential heterogeneity of expression within gene sets. When biological conditions are compared, the method indicates if the time patterns of gene sets significantly differ according to these conditions. The interest of the method is illustrated by its application to two real life datasets: an HIV therapeutic vaccine trial (DALIA-1 trial, and data from a recent study on influenza and pneumococcal vaccines. In the DALIA-1 trial TcGSA revealed a significant change in gene expression over time within 69 gene sets during vaccination, while a standard univariate individual gene analysis corrected for multiple testing as well as a standard a Gene Set Enrichment Analysis (GSEA for time series both failed to detect any significant pattern change over time. When applied to the second illustrative data set, TcGSA allowed the identification of 4 gene sets finally found to be linked with the influenza vaccine too although they were found to be associated to the pneumococcal vaccine only in previous analyses. In our simulation study TcGSA exhibits good statistical properties, and an increased power compared to other approaches for analyzing time-course expression patterns of gene sets. The method is made available for the community through an R package.

  4. The effect of bisphosphonates on gene expression: GAPDH as a housekeeping or a new target gene?

    International Nuclear Information System (INIS)

    RT-PCR has been widely used for the analysis of gene expression in many systems, including tumor samples. GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) has been frequently considered as a constitutive housekeeping gene and used to normalize changes in specific gene expression. However, GAPDH has been shown to be up-regulated in many cancers and down-regulated by chemotherapic drugs. Bisphosphonates, potent inhibitors of bone resorption, have recently shown a direct and indirect antitumor effect in vitro and in animal models. They exert their effects mainly by inhibiting the mevalonate pathway but also by modulating the expression of many genes not only in osteoclasts but also in cancer cells. We evaluated GAPDH gene expression by real time RT PCR in breast (MCF-7 and T47D) and prostate (PC3 and DU-145) cancer cell lines treated with amino and non-amino bisphosphonates. Our results showed that amino-bisphosphonates significantly decrease in a dose-dependent manner the expression of GAPDH gene. Therefore, GAPDH is inaccurate to normalize mRNA levels in studies investigating the effect of bisphosphonates on gene expression and it should be avoided. On the other hand, this gene could be considered a potential target to observe the effects of bisphosphonates on cancer cells

  5. Gene expression profiles of hepatic cell-type specific marker genes in progression of liver fibrosis

    Institute of Scientific and Technical Information of China (English)

    Yoshiyuki Takahara; Mitsuo Takahashi; Hiroki Wagatsuma; Fumihiko Yokoya; Qing-Wei Zhang; Mutsuyo Yamaguchi; Hiroyuki Aburatani; Norifumi Kawada


    AIM: To determine the gene expression profile data for the whole liver during development of dimethylnitrosamine (DMN)-induced hepatic fibrosis.METHODS: Marker genes were identified for different types of hepatic cells, including hepatic stellate cells (HSCs), Kupffer cells (including other inflammatory cells),and hepatocytes, using independent temporal DNA microarray data obtained from isolated hepatic cells.RESULTS: The cell-type analysis of gene expression gave several key results and led to formation of three hypotheses: (1) changes in the expression of HSCspecific marker genes during fibrosis were similar to gene expression data in in vitro cultured HSCs, suggesting a major role of the self-activating characteristics of HSCs in formation of fibrosis; (2) expression of mast cell-specific marker genes reached a peak during liver fibrosis,suggesting a possible role of mast cells in formation of fibrosis; and (3) abnormal expression of hepatocytespecific marker genes was found across several metabolic pathways during fibrosis, including sulfur-containing amino acid metabolism, fatty acid metabolism, and drug metabolism, suggesting a mechanistic relationship between these abnormalities and symptoms of liver fibrosis.CONCLUSION: Analysis of marker genes for specific hepatic cell types can identify the key aspects of fibrogenesis. Sequential activation of inflammatory cells and the self-supporting properties of HSCs play an important role in development of fibrosis.

  6. Structure and expression of the Plasmodium falciparum SERA gene. (United States)

    Li, W B; Bzik, D J; Horii, T; Inselburg, J


    Plasmodium falciparum, strain FCR3, genomic DNA that encodes the SERA gene of P. falciparum was isolated and sequenced. The SERA gene coding region was interrupted by 3 introns, the largest number observed, so far, in any Plasmodium gene. Two SERA gene alleles, allele I and allele II, were identified in the FCR3 strain, while only allele I was found in the Honduras-1 strain. Allele I mRNA was abundant in vivo during the late trophozoite and schizont stages. Allele II mRNA was either not expressed, or it was labile. PMID:2651911

  7. act Operon Control of Developmental Gene Expression in Myxococcus xanthus


    Gronewold, Thomas M. A.; Kaiser, Dale


    Cell-bound C-signal guides the building of a fruiting body and triggers the differentiation of myxospores. Earlier work has shown that transcription of the csgA gene, which encodes the C-signal, is directed by four genes of the act operon. To see how expression of the genes encoding components of the aggregation and sporulation processes depends on C-signaling, mutants with loss-of-function mutations in each of the act genes were investigated. These mutations were found to have no effect on g...

  8. Altered Chromosomal Positioning, Compaction, and Gene Expression with a Lamin A/C Gene Mutation (United States)

    Abuisneineh, Fida; Fahrenbach, John P.; Zhang, Yuan; MacLeod, Heather; Dellefave, Lisa; Pytel, Peter; Selig, Sara; Labno, Christine M.; Reddy, Karen; Singh, Harinder; McNally, Elizabeth


    Background Lamins A and C, encoded by the LMNA gene, are filamentous proteins that form the core scaffold of the nuclear lamina. Dominant LMNA gene mutations cause multiple human diseases including cardiac and skeletal myopathies. The nuclear lamina is thought to regulate gene expression by its direct interaction with chromatin. LMNA gene mutations may mediate disease by disrupting normal gene expression. Methods/Findings To investigate the hypothesis that mutant lamin A/C changes the lamina's ability to interact with chromatin, we studied gene misexpression resulting from the cardiomyopathic LMNA E161K mutation and correlated this with changes in chromosome positioning. We identified clusters of misexpressed genes and examined the nuclear positioning of two such genomic clusters, each harboring genes relevant to striated muscle disease including LMO7 and MBNL2. Both gene clusters were found to be more centrally positioned in LMNA-mutant nuclei. Additionally, these loci were less compacted. In LMNA mutant heart and fibroblasts, we found that chromosome 13 had a disproportionately high fraction of misexpressed genes. Using three-dimensional fluorescence in situ hybridization we found that the entire territory of chromosome 13 was displaced towards the center of the nucleus in LMNA mutant fibroblasts. Additional cardiomyopathic LMNA gene mutations were also shown to have abnormal positioning of chromosome 13, although in the opposite direction. Conclusions These data support a model in which LMNA mutations perturb the intranuclear positioning and compaction of chromosomal domains and provide a mechanism by which gene expression may be altered. PMID:21179469

  9. Altered chromosomal positioning, compaction, and gene expression with a lamin A/C gene mutation.

    Directory of Open Access Journals (Sweden)

    Stephanie K Mewborn

    Full Text Available BACKGROUND: Lamins A and C, encoded by the LMNA gene, are filamentous proteins that form the core scaffold of the nuclear lamina. Dominant LMNA gene mutations cause multiple human diseases including cardiac and skeletal myopathies. The nuclear lamina is thought to regulate gene expression by its direct interaction with chromatin. LMNA gene mutations may mediate disease by disrupting normal gene expression. METHODS/FINDINGS: To investigate the hypothesis that mutant lamin A/C changes the lamina's ability to interact with chromatin, we studied gene misexpression resulting from the cardiomyopathic LMNA E161K mutation and correlated this with changes in chromosome positioning. We identified clusters of misexpressed genes and examined the nuclear positioning of two such genomic clusters, each harboring genes relevant to striated muscle disease including LMO7 and MBNL2. Both gene clusters were found to be more centrally positioned in LMNA-mutant nuclei. Additionally, these loci were less compacted. In LMNA mutant heart and fibroblasts, we found that chromosome 13 had a disproportionately high fraction of misexpressed genes. Using three-dimensional fluorescence in situ hybridization we found that the entire territory of chromosome 13 was displaced towards the center of the nucleus in LMNA mutant fibroblasts. Additional cardiomyopathic LMNA gene mutations were also shown to have abnormal positioning of chromosome 13, although in the opposite direction. CONCLUSIONS: These data support a model in which LMNA mutations perturb the intranuclear positioning and compaction of chromosomal domains and provide a mechanism by which gene expression may be altered.

  10. Arabidopsis gene co-expression network and its functional modules

    Directory of Open Access Journals (Sweden)

    Dash Sudhansu


    Full Text Available Abstract Background Biological networks characterize the interactions of biomolecules at a systems-level. One important property of biological networks is the modular structure, in which nodes are densely connected with each other, but between which there are only sparse connections. In this report, we attempted to find the relationship between the network topology and formation of modular structure by comparing gene co-expression networks with random networks. The organization of gene functional modules was also investigated. Results We constructed a genome-wide Arabidopsis gene co-expression network (AGCN by using 1094 microarrays. We then analyzed the topological properties of AGCN and partitioned the network into modules by using an efficient graph clustering algorithm. In the AGCN, 382 hub genes formed a clique, and they were densely connected only to a small subset of the network. At the module level, the network clustering results provide a systems-level understanding of the gene modules that coordinate multiple biological processes to carry out specific biological functions. For instance, the photosynthesis module in AGCN involves a very large number (> 1000 of genes which participate in various biological processes including photosynthesis, electron transport, pigment metabolism, chloroplast organization and biogenesis, cofactor metabolism, protein biosynthesis, and vitamin metabolism. The cell cycle module orchestrated the coordinated expression of hundreds of genes involved in cell cycle, DNA metabolism, and cytoskeleton organization and biogenesis. We also compared the AGCN constructed in this study with a graphical Gaussian model (GGM based Arabidopsis gene network. The photosynthesis, protein biosynthesis, and cell cycle modules identified from the GGM network had much smaller module sizes compared with the modules found in the AGCN, respectively. Conclusion This study reveals new insight into the topological properties of

  11. GSMA: Gene Set Matrix Analysis, An Automated Method for Rapid Hypothesis Testing of Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Chris Cheadle


    Full Text Available Background: Microarray technology has become highly valuable for identifying complex global changes in gene expression patterns. The assignment of functional information to these complex patterns remains a challenging task in effectively interpreting data and correlating results from across experiments, projects and laboratories. Methods which allow the rapid and robust evaluation of multiple functional hypotheses increase the power of individual researchers to data mine gene expression data more efficiently.Results: We have developed (gene set matrix analysis GSMA as a useful method for the rapid testing of group-wise up- or downregulation of gene expression simultaneously for multiple lists of genes (gene sets against entire distributions of gene expression changes (datasets for single or multiple experiments. The utility of GSMA lies in its flexibility to rapidly poll gene sets related by known biological function or as designated solely by the end-user against large numbers of datasets simultaneously.Conclusions: GSMA provides a simple and straightforward method for hypothesis testing in which genes are tested by groups across multiple datasets for patterns of expression enrichment.

  12. Effect of SNPs in protein kinase Czgene on gene expression in the reporter gene detection system

    Institute of Scientific and Technical Information of China (English)

    Zhuo Liu; Hong-Xia Sun; Yong-Wei Zhang; Yun-Feng Li; Jin Zuo; Yan Meng; Fu-De Fang


    AIM: To investigated the effects of the SNPs (rs411021,rs436045, rs427811, rs385039 and rs809912) on gene expression and further identify the susceptibility genes of type 2 diabetes.METHODS: Ten allele fragments (49 bp each) were synthesized according to the 5 SNPs mentioned above.These fragments were cloned into luciferase reporter gene vector and then transfected into HepG2 cells. The activity of the luciferase was assayed. Effects of the SNPs on RNA splicing were analyzed by bioinformatics.RESULTS: rs427811T allele and rs809912G allele enhanced the activity of the reporter gene expression. None of the 5 SNPs affected RNA splicing.CONCLUSION: SNPs in protein kinase Cz (PKCZ) gene probably play a role in the susceptibility to type 2 diabetes by affecting the expression level of the relevant genes.

  13. Biased gene fractionation and dominant gene expression among the subgenomes of Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Feng Cheng

    Full Text Available Polyploidization, both ancient and recent, is frequent among plants. A "two-step theory" was proposed to explain the meso-triplication of the Brassica "A" genome: Brassica rapa. By accurately partitioning of this genome, we observed that genes in the less fractioned subgenome (LF were dominantly expressed over the genes in more fractioned subgenomes (MFs: MF1 and MF2, while the genes in MF1 were slightly dominantly expressed over the genes in MF2. The results indicated that the dominantly expressed genes tended to be resistant against gene fractionation. By re-sequencing two B. rapa accessions: a vegetable turnip (VT117 and a Rapid Cycling line (L144, we found that genes in LF had less non-synonymous or frameshift mutations than genes in MFs; however mutation rates were not significantly different between MF1 and MF2. The differences in gene expression patterns and on-going gene death among the three subgenomes suggest that "two-step" genome triplication and differential subgenome methylation played important roles in the genome evolution of B. rapa.

  14. Evaluation of reference genes for gene expression studies in human brown adipose tissue. (United States)

    Taube, Magdalena; Andersson-Assarsson, Johanna C; Lindberg, Kristin; Pereira, Maria J; Gäbel, Markus; Svensson, Maria K; Eriksson, Jan W; Svensson, Per-Arne


    Human brown adipose tissue (BAT) has during the last 5 year been subjected to an increasing research interest, due to its putative function as a target for future obesity treatments. The most commonly used method for molecular studies of human BAT is the quantitative polymerase chain reaction (qPCR). This method requires normalization to a reference gene (genes with uniform expression under different experimental conditions, e.g. similar expression levels between human BAT and WAT), but so far no evaluation of reference genes for human BAT has been performed. Two different microarray datasets with samples containing human BAT were used to search for genes with low variability in expression levels. Seven genes (FAM96B, GNB1, GNB2, HUWE1, PSMB2, RING1 and TPT1) identified by microarray analysis, and 8 commonly used reference genes (18S, B2M, GAPDH, LRP10, PPIA, RPLP0, UBC, and YWHAZ) were selected and further analyzed by quantitative PCR in both BAT containing perirenal adipose tissue and subcutaneous adipose tissue. Results were analyzed using 2 different algorithms (Normfinder and geNorm). Most of the commonly used reference genes displayed acceptably low variability (geNorm M-values genes identified by microarray displayed an even lower variability (M-values genes for qPCR analysis of human BAT and we recommend that they are included in future gene expression studies of human BAT.

  15. A microfluidic DNA computing processor for gene expression analysis and gene drug synthesis. (United States)

    Zhang, Yu; Yu, Hao; Qin, Jianhua; Lin, Bingcheng


    Boolean logic performs a logical operation on one or more logic input and produces a single logic output. Here, we describe a microfluidic DNA computing processor performing Boolean logic operations for gene expression analysis and gene drug synthesis. Multiple cancer-related genes were used as input molecules. Their expression levels were identified by interacting with the computing related DNA strands, which were designed according to the sequences of cancer-related genes and the suicide gene. When all the expressions of the cancer-related genes fit in with the diagnostic criteria, positive diagnosis would be confirmed and then a complete suicide gene (gene drug) could be synthesized as an output molecule. Microfluidic chip was employed as an effective platform to realize the computing process by integrating multistep biochemical reactions involving hybridization, displacement, denaturalization, and ligation. By combining the specific design of the computing related molecules and the integrated functions of the microfluidics, the microfluidic DNA computing processor is able to analyze the multiple gene expressions simultaneously and realize the corresponding gene drug synthesis with simplicity and fast speed, which demonstrates the potential of this platform for DNA computing in biomedical applications.

  16. Validation of suitable reference genes for quantitative gene expression analysis in Panax ginseng

    Directory of Open Access Journals (Sweden)

    Meizhen eWang


    Full Text Available Reverse transcription-qPCR (RT-qPCR has become a popular method for gene expression studies. Its results require data normalization by housekeeping genes. No single gene is proved to be stably expressed under all experimental conditions. Therefore, systematic evaluation of reference genes is necessary. With the aim to identify optimum reference genes for RT-qPCR analysis of gene expression in different tissues of Panax ginseng and the seedlings grown under heat stress, we investigated the expression stability of eight candidate reference genes, including elongation factor 1-beta (EF1-β, elongation factor 1-gamma (EF1-γ, eukaryotic translation initiation factor 3G (IF3G, eukaryotic translation initiation factor 3B (IF3B, actin (ACT, actin11 (ACT11, glyceraldehyde-3-phosphate dehydrogenase (GAPDH and cyclophilin ABH-like protein (CYC, using four widely used computational programs: geNorm, Normfinder, BestKeeper, and the comparative ΔCt method. The results were then integrated using the web-based tool RefFinder. As a result, EF1-γ, IF3G and EF1-β were the three most stable genes in different tissues of P. ginseng, while IF3G, ACT11 and GAPDH were the top three-ranked genes in seedlings treated with heat. Using three better reference genes alone or in combination as internal control, we examined the expression profiles of MAR, a multiple function-associated mRNA-like non-coding RNA (mlncRNA in P. ginseng. Taken together, we recommended EF1-γ/IF3G and IF3G/ACT11 as the suitable pair of reference genes for RT-qPCR analysis of gene expression in different tissues of P. ginseng and the seedlings grown under heat stress, respectively. The results serve as a foundation for future studies on P. ginseng functional genomics.

  17. Suitability of commonly used housekeeping genes in gene expression studies for space radiation research (United States)

    Arenz, A.; Stojicic, N.; Lau, P.; Hellweg, C. E.; Baumstark-Khan, C.

    Research on the effects of ionizing radiation exposure involves the use of real-time reverse transcription polymerase chain reaction (qRT-PCR) for measuring changes in gene expression. Several variables need to be controlled for gene expression analysis, such as different amounts of starting material between the samples, variations in enzymatic efficiencies of the reverse transcription step, and differences in RNA integrity. Normalization of the obtained data to an invariant endogenous control gene (reference gene) is the elementary step in relative quantification strategy. There is a strong correlation between the quality of the normalized data and the stability of the reference gene itself. This is especially relevant when the samples have been obtained after exposure to radiation qualities inducing different amounts and kinds of damage, leading to effects on cell cycle delays or even on cell cycle blocks. In order to determine suitable reference genes as internal controls in qRT-PCR assays after exposure to ionizing radiation, we studied the gene expression levels of nine commonly used reference genes which are constitutively expressed in A549 lung cancer cells. Expression levels obtained for ACTB, B2M, GAPDH, PBGD, 18S rRNA, G6PDH, HPRT, UBC, TFRC and SDHA were determined after exposure to 2 and 6 Gy X-radiation. Gene expression data for Growth arrest and damage-inducible gene 45 (GADD45α) and Cyclin-dependent kinase inhibitor 1A (CDKN1A/p21CIP1) were selected to elucidate the influence of normalization by using appropriate and inappropriate internal control genes. According to these results, we strongly recommend the use of a panel of reference genes instead of only one.

  18. Gene expression profiling predicts a three-gene expression signature of endometrial adenocarcinoma in a rat model

    Directory of Open Access Journals (Sweden)

    Klinga-Levan Karin


    Full Text Available Abstract Background In the Western world, endometrial cancers are the most common gynaecological neoplastic disorders among women. Initial symptoms are often vague and may be confused with several other conditions or disorders. Thus, there is a need for an easy and reliable diagnostic tool. The objective of this work was to identify a gene expression signature specific for endometrial adenocarcinomas to be used for testing potential endometrial biomarkers. Results Changes in expression between endometrial adenocarcinomas and non-/pre-malignant endometrium from the BDII EAC rat model were compared in cDNA microarray assays. By employing classification analysis (Weka on the expression data from approximately 5600 cDNA clones and TDT analysis on genotype data, we identified a three-gene signature (Gpx3, Bgn and Tgfb3. An independent analysis of differential expression, revealed a total of 354 cDNA clones with significant changes in expression. Among the 10 best ranked clones, Gpx3, Bgn and Tgfb3 were found. Conclusion Taken together, we present a unique data set of genes with different expression patterns between EACs and non-/pre-malignant endometrium, and specifically we found three genes that were confirmed in two independent analyses. These three genes are candidates for an EAC signature and further evaluations of their involvement in EAC tumorigenesis will be undertaken.

  19. Evaluation and Validation of Housekeeping Genes as Reference for Gene Expression Studies in Pigeonpea (Cajanus cajan) Under Drought Stress Conditions


    Sinha, Pallavi; Vikas K Singh; V Suryanarayana; Krishnamurthy, L.; Saxena, Rachit K.; Varshney, Rajeev K.


    Gene expression analysis using quantitative real-time PCR (qRT-PCR) is a very sensitive technique and its sensitivity depends on the stable performance of reference gene(s) used in the study. A number of housekeeping genes have been used in various expression studies in many crops however, their expression were found to be inconsistent under different stress conditions. As a result, species specific housekeeping genes have been recommended for different expression studies in several crop spec...

  20. Gene expression changes after hypoxic preconditioning in rat hepatocytes

    Institute of Scientific and Technical Information of China (English)

    Wei Chen; Jiang-Feng Qiu; Zhi-Qi Zhang; Hai-Feng Luo; Joan Rosello-Catafau; Zhi-Yong Wu


    BACKGROUND: Hypoxic preconditioning can protect hepatocytes against hypoxic injury, but its mechanism has not been elucidated. The aim of this study was to proifle gene expression patterns involved in hypoxic preconditioning and probable mechanism at the level of gene expression. METHODS: Hepatocytes were divided into 2 groups:control group and hypoxic preconditioning group. Biotin-labeled cRNA from the control group and the hypoxic preconditioning group was hybridized by oligonucleotide microarray. Genes that were signiifcantly associated with hypoxic preconditioning were ifltered, and validated at the level of transcript expression. RESULTS: Forty-three genes with signiifcantly altered expression patterns were discovered and most of them had not been previously reported. Among these genes, genes encoding superoxide dismutase 2 (SOD2)and interleukin 10 (IL-10) in the hypoxic preconditioning group were conifrmed to be up-regulated with real-time quantitative PCR. CONCLUSIONS:Many cytokines are involved in hypoxic preconditioning and protect hepatocytes from hypoxia-reoxygenation injury, and the increase of oxygen free-radical scavengers and anti-inlfammatory factors may play a key role in this phenomenon. Diverse signal pathways are probably involved.

  1. Tools for regulated gene expression in the chloroplast of Chlamydomonas. (United States)

    Rochaix, Jean-David; Surzycki, Raymond; Ramundo, Silvia


    The green unicellular alga Chlamydomonas reinhardtii has emerged as a very attractive model system for chloroplast genetic engineering. Algae can be transformed readily at the chloroplast level through bombardment of cells with a gene gun, and transformants can be selected using antibiotic resistance or phototrophic growth. An inducible chloroplast gene expression system could be very useful for several reasons. First, it could be used to elucidate the function of essential chloroplast genes required for cell growth and survival. Second, it could be very helpful for expressing proteins which are toxic to the algal cells. Third, it would allow for the reversible depletion of photosynthetic complexes thus making it possible to study their biogenesis in a controlled fashion. Fourth, it opens promising possibilities for hydrogen production in Chlamydomonas. Here we describe an inducible/repressible chloroplast gene expression system in Chlamydomonas in which the copper-regulated Cyc6 promoter drives the expression of the nuclear Nac2 gene encoding a protein which is targeted to the chloroplast where it acts specifically on the chloroplast psbD 5'-untranslated region and is required for the stable accumulation of the psbD mRNA and photosystem II. The system can be used for any chloroplast gene or transgene by placing it under the control of the psbD 5'-untranslated region. PMID:24599871

  2. The evolution of gene expression QTL in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    James Ronald

    Full Text Available Understanding the evolutionary forces that influence patterns of gene expression variation will provide insights into the mechanisms of evolutionary change and the molecular basis of phenotypic diversity. To date, studies of gene expression evolution have primarily been made by analyzing how gene expression levels vary within and between species. However, the fundamental unit of heritable variation in transcript abundance is the underlying regulatory allele, and as a result it is necessary to understand gene expression evolution at the level of DNA sequence variation. Here we describe the evolutionary forces shaping patterns of genetic variation for 1206 cis-regulatory QTL identified in a cross between two divergent strains of Saccharomyces cerevisiae. We demonstrate that purifying selection against mildly deleterious alleles is the dominant force governing cis-regulatory evolution in S. cerevisiae and estimate the strength of selection. We also find that essential genes and genes with larger codon bias are subject to slightly stronger cis-regulatory constraint and that positive selection has played a role in the evolution of major trans-acting QTL.

  3. Sleep Deprivation Influences Circadian Gene Expression in the Lateral Habenula (United States)

    Gao, Yanxia


    Sleep is governed by homeostasis and the circadian clock. Clock genes play an important role in the generation and maintenance of circadian rhythms but are also involved in regulating sleep homeostasis. The lateral habenular nucleus (LHb) has been implicated in sleep-wake regulation, since LHb gene expression demonstrates circadian oscillation characteristics. This study focuses on the participation of LHb clock genes in regulating sleep homeostasis, as the nature of their involvement is unclear. In this study, we observed changes in sleep pattern following sleep deprivation in LHb-lesioned rats using EEG recording techniques. And then the changes of clock gene expression (Per1, Per2, and Bmal1) in the LHb after 6 hours of sleep deprivation were detected by using real-time quantitative PCR (qPCR). We found that sleep deprivation increased the length of Non-Rapid Eye Movement Sleep (NREMS) and decreased wakefulness. LHb-lesioning decreased the amplitude of reduced wake time and increased NREMS following sleep deprivation in rats. qPCR results demonstrated that Per2 expression was elevated after sleep deprivation, while the other two genes were unaffected. Following sleep recovery, Per2 expression was comparable to the control group. This study provides the basis for further research on the role of LHb Per2 gene in the regulation of sleep homeostasis. PMID:27413249

  4. Xylella fastidiosa gene expression analysis by DNA microarrays

    Directory of Open Access Journals (Sweden)

    Regiane F. Travensolo


    Full Text Available Xylella fastidiosa genome sequencing has generated valuable data by identifying genes acting either on metabolic pathways or in associated pathogenicity and virulence. Based on available information on these genes, new strategies for studying their expression patterns, such as microarray technology, were employed. A total of 2,600 primer pairs were synthesized and then used to generate fragments using the PCR technique. The arrays were hybridized against cDNAs labeled during reverse transcription reactions and which were obtained from bacteria grown under two different conditions (liquid XDM2 and liquid BCYE. All data were statistically analyzed to verify which genes were differentially expressed. In addition to exploring conditions for X. fastidiosa genome-wide transcriptome analysis, the present work observed the differential expression of several classes of genes (energy, protein, amino acid and nucleotide metabolism, transport, degradation of substances, toxins and hypothetical proteins, among others. The understanding of expressed genes in these two different media will be useful in comprehending the metabolic characteristics of X. fastidiosa, and in evaluating how important certain genes are for the functioning and survival of these bacteria in plants.

  5. Width of gene expression profile drives alternative splicing.

    Directory of Open Access Journals (Sweden)

    Daniel Wegmann

    Full Text Available Alternative splicing generates an enormous amount of functional and proteomic diversity in metazoan organisms. This process is probably central to the macromolecular and cellular complexity of higher eukaryotes. While most studies have focused on the molecular mechanism triggering and controlling alternative splicing, as well as on its incidence in different species, its maintenance and evolution within populations has been little investigated. Here, we propose to address these questions by comparing the structural characteristics as well as the functional and transcriptional profiles of genes with monomorphic or polymorphic splicing, referred to as MS and PS genes, respectively. We find that MS and PS genes differ particularly in the number of tissues and cell types where they are expressed.We find a striking deficit of PS genes on the sex chromosomes, particularly on the Y chromosome where it is shown not to be due to the observed lower breadth of expression of genes on that chromosome. The development of a simple model of evolution of cis-regulated alternative splicing leads to predictions in agreement with these observations. It further predicts the conditions for the emergence and the maintenance of cis-regulated alternative splicing, which are both favored by the tissue specific expression of splicing variants. We finally propose that the width of the gene expression profile is an essential factor for the acquisition of new transcript isoforms that could later be maintained by a new form of balancing selection.

  6. Garlic Influences Gene Expression In Vivo and In Vitro. (United States)

    Charron, Craig S; Dawson, Harry D; Novotny, Janet A


    There is a large body of preclinical research aimed at understanding the roles of garlic and garlic-derived preparations in the promotion of human health. Most of this research has targeted the possible functions of garlic in maintaining cardiovascular health and in preventing and treating cancer. A wide range of outcome variables has been used to investigate the bioactivity of garlic, ranging from direct measures of health status such as cholesterol concentrations, blood pressure, and changes in tumor size and number, to molecular and biochemical measures such as mRNA gene expression, protein concentration, enzyme activity, and histone acetylation status. Determination of how garlic influences mRNA gene expression has proven to be a valuable approach to elucidating the mechanisms of garlic bioactivity. Preclinical studies investigating the health benefits of garlic far outnumber human studies and have made frequent use of mRNA gene expression measurement. There is an immediate need to understand mRNA gene expression in humans as well. Although safety and ethical constraints limit the types of available human tissue, peripheral whole blood is readily accessible, and measuring mRNA gene expression in whole blood may provide a unique window to understanding how garlic intake affects human health. PMID:26764328

  7. Candidate genes of hypertension with defective environmental expression

    Institute of Scientific and Technical Information of China (English)



    Previous studies in our laboratory have demonstrated that the thermosensitivity locus cosegregates with blood pressure and that the elevated expression and restriction fragment length polymorphism of HSP70 gene are associated with hypertension.Cell protection against environmental stressors such as heat and chemicals is often accompanied by up-regulated expression of a wide spectrum of heat shock genes(HSP).To further investigate the interrelation between HSP expression and blood pressure regulation,we employed an effective method of cloning 2 potential hypertension-related HSPs.Synthetic oligonucleotides corresponding either to a highly-conserved region of the known HSP family or a repetitive sequence in the proteinencoding gene were used as target primers for polymerase chain reaction(PCR).cDNA prepared from heat-stressed and non-stressed vascular smooth muscle cells(VSMC)of Brown Norway rats(BN.1x)and spontaneously hypertensive rats(SHRp) respectively served as template in the reaction.The PCR products were subsequently analyzed in a single-stranded conformational polymorphism(SSCP) electrophoresing system.Differential gene expression in BN.1x and SHRp was seen on autoradiographs of SSCP gel by comparing the migration patterns of PCR-amplified DNA fragments.Using this technique,we also found that HSP27 and a new member of the large HSP gene family were differentially expressed in BN.1x and SHRp VSMC.

  8. Expression of genes encoding extracellular matrix proteins: a macroarray study. (United States)

    Futyma, Konrad; Miotła, Paweł; Różyńska, Krystyna; Zdunek, Małgorzata; Semczuk, Andrzej; Rechberger, Tomasz; Wojcierowski, Jacek


    Endometrial cancer (EC) is one of the most common gynecological malignancies in Poland, with well-established risk factors. Genetic instability and molecular alterations responsible for endometrial carcinogenesis have been systematically investigated. The aim of the present study was to investigate, by means of cDNA macroarrays, the expression profiles of genes encoding extracellular matrix (ECM) proteins in ECs. Tissue specimens were collected during surgical procedures from 40 patients with EC, and control tissue was collected from 9 patients with uterine leiomyomas. RNA was isolated and RT-PCR with radioisotope-labeled cDNA was performed. The levels of ECM protein gene expression in normal endometrial tissues were compared to the expression of these genes in EC specimens. Statistically significant differences in gene expression, stratified by clinical stage of the ECs, were detected for aggrecan, vitronectin, tenascin R, nidogen and two collagen proteins: type VIII chain α1 and type XI chain α2. All of these proteins were overexpressed in stage III endometrial carcinomas compared to levels in stage I and II uterine neoplasms. In conclusion, increased expression of genes encoding ECM proteins may play an important role in facilitating accelerated disease progression of human ECs.

  9. Selection of reliable reference genes for gene expression studies in peach using real-time PCR

    Directory of Open Access Journals (Sweden)

    Zhou Jun


    Full Text Available Abstract Background RT-qPCR is a preferred method for rapid and reliable quantification of gene expression studies. Appropriate application of RT-qPCR in such studies requires the use of reference gene(s as an internal control to normalize mRNA levels between different samples for an exact comparison of gene expression level. However, recent studies have shown that no single reference gene is universal for all experiments. Thus, the identification of high quality reference gene(s is of paramount importance for the interpretation of data generated by RT-qPCR. Only a few studies on reference genes have been done in plants and none in peach (Prunus persica L. Batsch. Therefore, the present study was conducted to identify suitable reference gene(s for normalization of gene expression in peach. Results In this work, eleven reference genes were investigated in different peach samples using RT-qPCR with SYBR green. These genes are: actin 2/7 (ACT, cyclophilin (CYP2, RNA polymerase II (RP II, phospholipase A2 (PLA2, ribosomal protein L13 (RPL13, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 18S ribosomal RNA (18S rRNA, tubblin beta (TUB, tubblin alpha (TUA, translation elongation factor 2 (TEF2 and ubiquitin 10 (UBQ10. All eleven reference genes displayed a wide range of Cq values in all samples, indicating that they expressed variably. The stability of these genes except for RPL13 was determined by three different descriptive statistics, geNorm, NormFinder and BestKeeper, which produced highly comparable results. Conclusion Our study demonstrates that expression stability varied greatly between genes studied in peach. Based on the results from geNorm, NormFinder and BestKeeper analyses, for all the sample pools analyzed, TEF2, UBQ10 and RP II were found to be the most suitable reference genes with a very high statistical reliability, and TEF2 and RP II for the other sample series, while 18S rRNA, RPL13 and PLA2 were unsuitable as internal controls

  10. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  11. Gene expression in the urinary bladder: a common carcinoma in situ gene expression signature exists disregarding histopathological classification

    DEFF Research Database (Denmark)

    Andersen, Lars Dyrskjøt; Kruhøffer, Mogens; Andersen, Thomas Thykjær;


    The presence of carcinoma in situ (CIS) lesions in the urinary bladder is associated with a high risk of disease progression to a muscle invasive stage. In this study, we used microarray expression profiling to examine the gene expression patterns in superficial transitional cell carcinoma (sTCC......) with surrounding CIS (13 patients), without surrounding CIS lesions (15 patients), and in muscle invasive carcinomas (mTCC; 13 patients). Hierarchical cluster analysis separated the sTCC samples according to the presence or absence of CIS in the surrounding urothelium. We identified a few gene clusters...... that contained genes with similar expression levels in transitional cell carcinoma (TCC) with surrounding CIS and invasive TCC. However, no close relationship between TCC with adjacent CIS and invasive TCC was observed using hierarchical cluster analysis. Expression profiling of a series of biopsies from normal...

  12. Embryo quality predictive models based on cumulus cells gene expression

    Directory of Open Access Journals (Sweden)

    Devjak R


    Full Text Available Since the introduction of in vitro fertilization (IVF in clinical practice of infertility treatment, the indicators for high quality embryos were investigated. Cumulus cells (CC have a specific gene expression profile according to the developmental potential of the oocyte they are surrounding, and therefore, specific gene expression could be used as a biomarker. The aim of our study was to combine more than one biomarker to observe improvement in prediction value of embryo development. In this study, 58 CC samples from 17 IVF patients were analyzed. This study was approved by the Republic of Slovenia National Medical Ethics Committee. Gene expression analysis [quantitative real time polymerase chain reaction (qPCR] for five genes, analyzed according to embryo quality level, was performed. Two prediction models were tested for embryo quality prediction: a binary logistic and a decision tree model. As the main outcome, gene expression levels for five genes were taken and the area under the curve (AUC for two prediction models were calculated. Among tested genes, AMHR2 and LIF showed significant expression difference between high quality and low quality embryos. These two genes were used for the construction of two prediction models: the binary logistic model yielded an AUC of 0.72 ± 0.08 and the decision tree model yielded an AUC of 0.73 ± 0.03. Two different prediction models yielded similar predictive power to differentiate high and low quality embryos. In terms of eventual clinical decision making, the decision tree model resulted in easy-to-interpret rules that are highly applicable in clinical practice.

  13. Biased Gene Fractionation and Dominant Gene Expression among the Subgenomes of Brassica rapa


    Feng Cheng; Jian Wu; Lu Fang; Silong Sun; Bo Liu; Ke Lin; Guusje Bonnema; Xiaowu Wang


    Polyploidization, both ancient and recent, is frequent among plants. A ‘‘two-step theory’’ was proposed to explain the meso-triplication of the Brassica ‘‘A’’ genome: Brassica rapa. By accurately partitioning of this genome, we observed that genes in the less fractioned subgenome (LF) were dominantly expressed over the genes in more fractioned subgenomes (MFs: MF1 and MF2), while the genes in MF1 were slightly dominantly expressed over the genes in MF2. The results indicated that the dominant...

  14. The expression of tga1a gene from tobacco affects the expression of exogenous gene in transgenic plant

    Institute of Scientific and Technical Information of China (English)

    路子显; 常团结; 李旭刚; 徐军望; 李慧芬; 陈宛新; 冯德江; 肖桂芳; 朱祯


    The DNA-binding protein TGA1a of tobacco can specially interact with the enhancer sequence as-1 (-83 to -63) of CaMV35S promoter and show the function of transcriptional activation. In order to study the expression of exogenous gene affected by TGA1a, a trans-actingregulation system was formed by tandem connecting tga1a under the control of the phloem-specific promoter rolC with reporter gene under the control of CaMV35S. Then, the system abovewas utilized to construct a plant expression vector. Moreover, two plant expression vectors wereconstructed with the report gene controlled by CaMV35S and rolC promoter respectively as positive controls. Tobacco leaf disc transformed by Agrobacterium-mediated method and transgenic plants were regenerated. It was proved that the reporter gene existed in the genome of transgenic plants by Southern hybridization. The results of GUS activity indicated that the expression of tga1a controlled by rolC remarkably increased the expression of the reporter gene controlled by CaMV35S. GUS activity of transgenic plants containing trans-acting regulation system was higher than that of transgenic plants containing the reporter gene under the control of CaMV35S and rolC respectively, with the highest GUS activity of about tenfolds of two positive controls. Histochemical method demonstrated that GUS staining amassed mainly in phloem tissue of transgenic plantscontaining the trans-acting regulation system. A new model for arising the expression level and tissue-specific expression of exogenous gene in transgenic plant was established in this study.

  15. Construction and Expression of Eukaryotic