WorldWideScience

Sample records for arabidopsis map kinase

  1. Arabidopsis map kinase 4 negatively regulates systemic acquired resistance

    DEFF Research Database (Denmark)

    Brodersen, P; Johansen, Bo; Petersen, M;

    2000-01-01

    Transposon inactivation of Arabidopsis MAP kinase 4 produced the mpk4 mutant exhibiting constitutive systemic acquired resistance (SAR) including elevated salicylic acid (SA) levels, increased resistance to virulent pathogens, and constitutive pathogenesis-related gene expression shown by Northern...... of NPR1. PDF1.2 and THI2.1 gene induction by jasmonate was blocked in mpk4 expressing NahG, suggesting that MPK4 is required for jasmonic acid-responsive gene expression....

  2. Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance

    DEFF Research Database (Denmark)

    Petersen, M.; Brodersen, P.; Naested, H.

    2000-01-01

    Transposon inactivation of Arabidopsis MAP kinase 4 produced the mpk4 mutant exhibiting constitutive systemic acquired resistance (SAR) including elevated salicylic acid (SA) revels, increased resistance to virulent pathogens, and constitutive pathogenesis-related gene expression shown by Northern...... of NPR1. PDF1.2 and THI2.1 gene induction by jasmonate was blocked in mpk4 expressing NahG, suggesting that MPK4 is required for jasmonic acid-responsive gene expression....

  3. MAP kinase cascades in Arabidopsis innate immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt; Roux, Milena Edna; Petersen, Morten

    2012-01-01

    Plant mitogen-activated protein kinase (MAPK) cascades generally transduce extracellular stimuli into cellular responses. These stimuli include the perception of pathogen-associated molecular patterns (PAMPs) by host transmembrane pattern recognition receptors which trigger MAPK-dependent innate ...

  4. Phosphorylation sites of Arabidopsis MAP Kinase Substrate 1 (MKS1)

    DEFF Research Database (Denmark)

    Caspersen, M.B.; Qiu, J.-L.; Zhang, X.

    2007-01-01

    The Arabidopsis MAP kinase 4 (MPK4) substrate MKS1 was expressed in Escherichia coli and purified, full-length, 6x histidine (His)-tagged MKS1 was phosphorylated in vitro by hemagglutinin (HA)-tagged MPK4 immuno-precipitated from plants. MKS1 phosphorylation was initially verified by electrophore......The Arabidopsis MAP kinase 4 (MPK4) substrate MKS1 was expressed in Escherichia coli and purified, full-length, 6x histidine (His)-tagged MKS1 was phosphorylated in vitro by hemagglutinin (HA)-tagged MPK4 immuno-precipitated from plants. MKS1 phosphorylation was initially verified...... phosphopeptide detection. As MAP kinases generally phosphorylate serine or threonine followed by proline (Ser/Thr-Pro), theoretical masses of potentially phosphorylated peptides were calculated and mass spectrometric peaks matching these masses were fragmented and searched for a neutral-loss signal...... at approximately 98 Da indicative of phosphorylation. Additionally, mass spectrometric peaks present in the MPK4-treated MKS1, but not in the control peptide map of untreated MKS1, were fragmented. Fragmentation spectra were subjected to a MASCOT database search which identified three of the twelve Ser-Pro serine...

  5. Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus

    2008-01-01

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP...... supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation....

  6. Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus.

    Science.gov (United States)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus; Nielsen, Henrik Bjørn; Botanga, Christopher J; Thorgrimsen, Stephan; Palma, Kristoffer; Suarez-Rodriguez, Maria Cristina; Sandbech-Clausen, Signe; Lichota, Jacek; Brodersen, Peter; Grasser, Klaus D; Mattsson, Ole; Glazebrook, Jane; Mundy, John; Petersen, Morten

    2008-08-20

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP kinase 4 (MPK4) exists in nuclear complexes with the WRKY33 transcription factor. This complex depends on the MPK4 substrate MKS1. Challenge with Pseudomonas syringae or flagellin leads to the activation of MPK4 and phosphorylation of MKS1. Subsequently, complexes with MKS1 and WRKY33 are released from MPK4, and WRKY33 targets the promoter of PHYTOALEXIN DEFICIENT3 (PAD3) encoding an enzyme required for the synthesis of antimicrobial camalexin. Hence, wrky33 mutants are impaired in the accumulation of PAD3 mRNA and camalexin production upon infection. That WRKY33 is an effector of MPK4 is further supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation.

  7. Comprehensive gene expression atlas for the Arabidopsis MAP kinase signalling pathways.

    Science.gov (United States)

    Menges, Margit; Dóczi, Róbert; Okrész, László; Morandini, Piero; Mizzi, Luca; Soloviev, Mikhail; Murray, James A H; Bögre, László

    2008-01-01

    * Mitogen activated protein kinase (MAPK) pathways are signal transduction modules with layers of protein kinases having c. 120 genes in Arabidopsis, but only a few have been linked experimentally to functions. * We analysed microarray expression data for 114 MAPK signalling genes represented on the ATH1 Affymetrix arrays; determined their expression patterns during development, and in a wide range of time-course microarray experiments for their signal-dependent transcriptional regulation and their coregulation with other signalling components and transcription factors. * Global expression correlation of the MAPK genes with each of the represented 21 692 Arabidopsis genes was determined by calculating Pearson correlation coefficients. To group MAPK signalling genes based on similarities in global regulation, we performed hierarchical clustering on the pairwise correlation values. This should allow inferring functional information from well-studied MAPK components to functionally uncharacterized ones. Statistical overrepresentation of specific gene ontology (GO) categories in the gene lists showing high expression correlation values with each of the MAPK components predicted biological themes for the gene functions. * The combination of these methods provides functional information for many uncharacterized MAPK genes, and a framework for complementary future experimental dissection of the function of this complex family.

  8. Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana

    KAUST Repository

    Danquah, Agyemang

    2015-04-01

    Summary Abscisic acid (ABA) is a major phytohormone involved in important stress-related and developmental plant processes. Recent phosphoproteomic analyses revealed a large set of ABA-triggered phosphoproteins as putative mitogen-activated protein kinase (MAPK) targets, although the evidence for MAPKs involved in ABA signalling is still scarce. Here, we identified and reconstituted in vivo a complete ABA-activated MAPK cascade, composed of the MAP3Ks MAP3K17/18, the MAP2K MKK3 and the four C group MAPKs MPK1/2/7/14. In planta, we show that ABA activation of MPK7 is blocked in mkk3-1 and map3k17mapk3k18 plants. Coherently, both mutants exhibit hypersensitivity to ABA and altered expression of a set of ABA-dependent genes. A genetic analysis further reveals that this MAPK cascade is activated by the PYR/PYL/RCAR-SnRK2-PP2C ABA core signalling module through protein synthesis of the MAP3Ks, unveiling an atypical mechanism for MAPK activation in eukaryotes. Our work provides evidence for a role of an ABA-induced MAPK pathway in plant stress signalling. Significance Statement We report in this article the identification of a complete MAPK module, composed of MAP3K17/18, MKK3 and MPK1/2/7/14, which is activated by ABA through the ABA core signalling complex. We showed that the activation of this module requires the MAP3K protein synthesis which occurs after hours of stress treatment, suggesting that the pathway is involved in a delayed wave of cellular responses to ABA and drought. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  9. Genetic analysis of the Arabidopsis protein kinases MAP3Kε1 and MAP3Kε2 indicates roles in cell expansion and embryo development.

    Science.gov (United States)

    Chaiwongsar, Suraphon; Strohm, Allison K; Su, Shih-Heng; Krysan, Patrick J

    2012-01-01

    MAP3Kε1 and MAP3Kε2 are a pair of Arabidopsis thaliana genes that encode protein kinases related to cdc7p from Saccharomyces cerevisiae. We have previously shown that the map3kε1;map3kε2 double-mutant combination causes pollen lethality. In this study, we have used an ethanol-inducible promoter construct to rescue this lethal phenotype and create map3kε1(-/-);map3kε2(-/-) double-mutant plants in order to examine the function of these genes in the sporophyte. These rescued double-mutant plants carry a yellow fluorescent protein (YFP)-MAP3Kε1 transgene under the control of the alcohol-inducible AlcA promoter from Aspergillus nidulans. The double-mutant plants were significantly smaller and had shorter roots than wild-type when grown in the absence of ethanol treatment. Microscopic analysis indicated that cell elongation was reduced in the roots of the double-mutant plants and cell expansion was reduced in rosette leaves. Treatment with ethanol to induce expression of YFP-MAP3Kε1 largely rescued the leaf phenotypes. The double-mutant combination also caused embryos to arrest in the early stages of development. Through the use of YFP reporter constructs we determined that MAP3Kε1 and MAP3Kε2 are expressed during embryo development, and also in root tissue. Our results indicate that MAP3Kε1 and MAP3Kε2 have roles outside of pollen development and that these genes affect several aspects of sporophyte development.

  10. Phosphorylation of MAP65-1 by Arabidopsis Aurora Kinases Is Required for Efficient Cell Cycle Progression1[OPEN

    Science.gov (United States)

    Weimer, Annika K.; Stoppin-Mellet, Virginie; Kosetsu, Ken; Cedeño, Cesyen; Jaquinod, Michel; Njo, Maria; De Milde, Liesbeth; Tompa, Peter; Inzé, Dirk; Beeckman, Tom; Vantard, Marylin

    2017-01-01

    Aurora kinases are key effectors of mitosis. Plant Auroras are functionally divided into two clades. The alpha Auroras (Aurora1 and Aurora2) associate with the spindle and the cell plate and are implicated in controlling formative divisions throughout plant development. The beta Aurora (Aurora3) localizes to centromeres and likely functions in chromosome separation. In contrast to the wealth of data available on the role of Aurora in other kingdoms, knowledge on their function in plants is merely emerging. This is exemplified by the fact that only histone H3 and the plant homolog of TPX2 have been identified as Aurora substrates in plants. Here we provide biochemical, genetic, and cell biological evidence that the microtubule-bundling protein MAP65-1—a member of the MAP65/Ase1/PRC1 protein family, implicated in central spindle formation and cytokinesis in animals, yeasts, and plants—is a genuine substrate of alpha Aurora kinases. MAP65-1 interacts with Aurora1 in vivo and is phosphorylated on two residues at its unfolded tail domain. Its overexpression and down-regulation antagonistically affect the alpha Aurora double mutant phenotypes. Phospho-mutant analysis shows that Aurora contributes to the microtubule bundling capacity of MAP65-1 in concert with other mitotic kinases. PMID:27879390

  11. Arabidopsis MAP kinase 4 regulates salicylic acid- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4.

    Science.gov (United States)

    Brodersen, Peter; Petersen, Morten; Bjørn Nielsen, Henrik; Zhu, Shijiang; Newman, Mari-Anne; Shokat, Kevan M; Rietz, Steffen; Parker, Jane; Mundy, John

    2006-08-01

    Arabidopsis MPK4 has been implicated in plant defense regulation because mpk4 knockout plants exhibit constitutive activation of salicylic acid (SA)-dependent defenses, but fail to induce jasmonic acid (JA) defense marker genes in response to JA. We show here that mpk4 mutants are also defective in defense gene induction in response to ethylene (ET), and that they are more susceptible than wild-type (WT) to Alternaria brassicicola that induces the ET/JA defense pathway(s). Both SA-repressing and ET/JA-(co)activating functions depend on MPK4 kinase activity and involve the defense regulators EDS1 and PAD4, as mutations in these genes suppress de-repression of the SA pathway and suppress the block of the ET/JA pathway in mpk4. EDS1/PAD4 thus affect SA-ET/JA signal antagonism as activators of SA but as repressors of ET/JA defenses, and MPK4 negatively regulates both of these functions. We also show that the MPK4-EDS1/PAD4 branch of ET defense signaling is independent of the ERF1 transcription factor, and use comparative microarray analysis of ctr1, ctr1/mpk4, mpk4 and WT to show that MPK4 is required for induction of a small subset of ET-regulated genes. The regulation of some, but not all, of these genes involves EDS1 and PAD4.

  12. Arabidopsis MAP kinase 4 regulates salicylic acid- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4

    DEFF Research Database (Denmark)

    Brodersen, Klaus Peter; Petersen, Morten; Nielsen, Henrik Bjørn

    2006-01-01

    Arabidopsis MPK4 has been implicated in plant defense regulation because mpk4 knockout plants exhibit constitutive activation of salicylic acid (SA)-dependent defenses, but fail to induce jasmonic acid (JA) defense marker genes in response to JA. We show here that mpk4 mutants are also defective...

  13. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    YongliangZhang; ChenDong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses. Cellular & Molecular Immunology. 2005;2(1):20-27.

  14. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    Yongliang Zhang; Chen Dong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses.

  15. Arabidopsis mitogen-activated protein kinase kinases MKK1 and MKK2 have overlapping functions in defense signaling mediated by MEKK1, MPK4, and MKS1

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Zhou, Lu; Yun, Byung-Wook

    2008-01-01

    The Arabidopsis thaliana MKK1 and MKK2 MAP kinase kinases have been implicated in biotic and abiotic stress responses as part of a signalling cascade including MEKK1 and MPK4. Here, the double loss-of-function mutant (mkk1/2) of MKK1 and MKK2 is shown to have marked phenotypes in development...

  16. MAP Kinase 4 Substrates and Plant Innate Immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt

    recognition, which also induce its localization to cytoplasmic processing bodies. All three proteins; PAT1, AOC3 and eIF4E also interacts with MPK4 in vivo although the functional outcome of these interactions are still elusive. The thesis comprise a general introduction to plant innate immunity followed...... by two review articles “MAP kinase cascades in Arabidopsis innate immunity” published in Frontiers in Plant Science and “mRNA decay in plant immunity” under revision for Cellular and Molecular Life Science. Together these sections gives a comprehensive overview of Arabidopsis defense signaling...

  17. Kinome profiling of Arabidopsis using arrays of kinase consensus substrates

    Directory of Open Access Journals (Sweden)

    Pieterse Corné MJ

    2007-02-01

    Full Text Available Abstract Background Kinome profiling aims at the parallel analysis of kinase activities in a cell. Novel developed arrays containing consensus substrates for kinases are used to assess those kinase activities. The arrays described in this paper were already used to determine kinase activities in mammalian systems, but since substrates from many organisms are present we decided to test these arrays for the determination of kinase activities in the model plant species Arabidopsis thaliana. Results Kinome profiling using Arabidopsis cell extracts resulted in the labelling of many consensus peptides by kinases from the plant, indicating the usefulness of this kinome profiling tool for plants. Method development showed that fresh and frozen plant material could be used to make cell lysates containing active kinases. Dilution of the plant extract increased the signal to noise ratio and non-radioactive ATP enhances full development of spot intensities. Upon infection of Arabidopsis with an avirulent strain of the bacterial pathogen Pseudomonas syringae pv. tomato, we could detect differential kinase activities by measuring phosphorylation of consensus peptides. Conclusion We show that kinome profiling on arrays with consensus substrates can be used to monitor kinase activities in plants. In a case study we show that upon infection with avirulent P. syringae differential kinase activities can be found. The PepChip can for example be used to purify (unknown kinases that play a role in P. syringae infection. This paper shows that kinome profiling using arrays of consensus peptides is a valuable new tool to study signal-transduction in plants. It complements the available methods for genomics and proteomics research.

  18. The MAP kinase substrate MKS1 is a regulator of plant defense responses

    DEFF Research Database (Denmark)

    Andreasson, Erik; Jenkins, Thomas; Brodersen, Peter

    2005-01-01

    Arabidopsis MAP kinase 4 (MPK4) functions as a regulator of pathogen defense responses, because it is required for both repression of salicylic acid (SA)-dependent resistance and for activation of jasmonate (JA)-dependent defense gene expression. To understand MPK4 signaling mechanisms, we used...

  19. MAP Kinase Cascades in Plant Innate Immunity

    Directory of Open Access Journals (Sweden)

    Magnus Wohlfahrt Rasmussen

    2012-07-01

    Full Text Available Plant mitogen-activated protein kinase (MAPK cascades generally transduce extracellular stimuli into cellular responses. These stimuli include the perception of pathogen-associated molecular patterns (PAMPs by host transmembrane pattern recognition receptors (PRRs which trigger MAPK-dependent innate immune responses. In the model Arabidopsis, molecular genetic evidence implicates a number of MAPK cascade components in PAMP signaling, and in responses to immunity-related phytohormones such as ethylene, jasmonate and salicylate. In a few cases, cascade components have been directly linked to the transcription of target genes or to the regulation of phytohormone synthesis. Thus MAPKs are obvious targets for bacterial effector proteins and are likely guardees of resistance (R proteins, which mediate defense signaling in response to the action of effectors, or effector-triggered immunity (ETI. This mini-review discusses recent progress in this field with a focus on the Arabidopsis MAPKs MPK3, 4, 6 and 11 in their apparent pathways.

  20. Adenosine-5'-phosphosulfate kinase is essential for Arabidopsis viability.

    Science.gov (United States)

    Mugford, Sarah G; Matthewman, Colette A; Hill, Lionel; Kopriva, Stanislav

    2010-01-04

    In Arabidopsis thaliana, adenosine-5'-phosphosulfate kinase (APK) provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. We have successfully isolated three of the four possible triple homozygous mutant combinations of this family. The APK1 isoform alone was sufficient to maintain WT levels of growth and development. Analysis of apk1 apk2 apk3 and apk1 apk3 apk4 mutants suggests that APK3 and APK4 are functionally redundant, despite being located in cytosol and plastids, respectively. We were, however, unable to isolate apk1 apk3 apk4 mutants, most probably because the apk1 apk3 apk4 triple mutant combination is pollen lethal. Therefore, we conclude that APS kinase is essential for plant reproduction and viability.

  1. MAP kinases and histone modification

    Institute of Scientific and Technical Information of China (English)

    Tamaki Suganuma; Jerry L. Workman

    2012-01-01

    Signal transduction pathways alter the gene expression program in response to extracellular or intracellular cues.Mitogen-activated protein kinases (MAPKs) govern numerous cellular processes including cell growth,stress response,apoptosis,and differentiation.In the past decade,MAPKs have been shown to regulate the transcription machinery and associate with chromatin-modifying complexes.Moreover,recent studies demonstrate that several MAPKs bind directly to chromatin at target genes.This review highlights the recent discoveries of MAPK signaling in regard to histone modifications and chromatin regulation.Evidence suggesting that further unknown mechanisms integrate signal transduction with chromatin biology is discussed.

  2. Constitutive activation of AtMEK5, a MAPK kinase, induces salicylic acid-independent cell death in Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    LIU Hongxia; WANG Ying; ZHOU Tianhong; SUN Yujing; LIU Guoqin; REN Dongtao

    2004-01-01

    AtMEK5DD is an active mutant of AtMEK5, a MAP kinase kinase in Arabidopsis. Induction of AtMEK5DD expression in transgenic plants leads to activation of 44 and 48 kD MAPKs and causes a rapid cell death. To compare the cell death induced by the expression of AtMEK5DD with the HR-cell death induced by avirulence pathogen infection, we analyzed the activation of downstream MAP Kinase and induction of PR genes expression in permanent transgenic Arabidopsis plants. In-gel kinase activity assay revealed that the infection of Pseudomonas syringae DC3000 harboring Avr Rpt2 gene also lead to activation of 44 and 48 kD MAPKs. PAL, PR1 and PR5 were strongly induced in plants undergoing HR-cell death caused by the infection of P. Syringae DC3000, while only the expression of PR5 was strongly induced in transgenic plants expressing AtMEK5DD protein. NahG protein in AtMEK5DD×NahG plants cannot suppress the cell death induced by AtMEK5DD. And AtMEK5DD protein expressed AtMEK5DD×NahG plants showed no significant change in salicylic acid (SA)level.All these suggest that the cell death induced by the activation of AtMEK5 is salicylic acid-independent.

  3. User guide for mapping-by-sequencing in Arabidopsis.

    Science.gov (United States)

    James, Geo Velikkakam; Patel, Vipul; Nordström, Karl J V; Klasen, Jonas R; Salomé, Patrice A; Weigel, Detlef; Schneeberger, Korbinian

    2013-06-17

    Mapping-by-sequencing combines genetic mapping with whole-genome sequencing in order to accelerate mutant identification. However, application of mapping-by-sequencing requires decisions on various practical settings on the experimental design that are not intuitively answered. Following an experimentally determined recombination landscape of Arabidopsis and next generation sequencing-specific biases, we simulated more than 400,000 mapping-by-sequencing experiments. This allowed us to evaluate a broad range of different types of experiments and to develop general rules for mapping-by-sequencing in Arabidopsis. Most importantly, this informs about the properties of different crossing scenarios, the number of recombinants and sequencing depth needed for successful mapping experiments.

  4. Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress.

    Science.gov (United States)

    Xing, Yu; Chen, Wei-hua; Jia, Wensuo; Zhang, Jianhua

    2015-09-01

    Superoxide dismutases (SODs) are involved in plant adaptive responses to biotic and abiotic stresses but the upstream signalling process that modulates their expression is not clear. Expression of two iron SODs, FSD2 and FSD3, was significantly increased in Arabidopsis in response to NaCl treatment but blocked in transgenic MKK5-RNAi plant, mkk5. Using an assay system for transient expression in protoplasts, it was found that mitogen-activated protein kinase kinase 5 (MKK5) was also activated in response to salt stress. Overexpression of MKK5 in wild-type plants enhanced their tolerance to salt treatments, while mkk5 mutant exhibited hypersensitivity to salt stress in germination on salt-containing media. Moreover, another kinase, MPK6, was also involved in the MKK5-mediated iron superoxide dismutase (FSD) signalling pathway in salt stress. The kinase activity of MPK6 was totally turned off in mkk5, whereas the activity of MPK3 was only partially blocked. MKK5 interacted with the MEKK1 protein that was also involved in the salt-induced FSD signalling pathway. These data suggest that salt-induced FSD2 and FSD3 expressions are influenced by MEKK1 via MKK5-MPK6-coupled signalling. This MAP kinase cascade (MEKK1, MKK5, and MPK6) mediates the salt-induced expression of iron superoxide dismutases.

  5. Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase

    KAUST Repository

    Kim, Dongjin

    2015-10-09

    Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.

  6. MAP kinase meets mitosis: A role for Raf Kinase Inhibitory Protein in spindle checkpoint regulation

    Directory of Open Access Journals (Sweden)

    Rosner Marsha

    2007-01-01

    Full Text Available Abstract Raf Kinase Inhibitory Protein (RKIP is an evolutionarily conserved protein that functions as a modulator of signaling by the MAP kinase cascade. Implicated as a metastasis suppressor, Raf Kinase Inhibitory Protein depletion correlates with poor prognosis for breast, prostate and melanoma tumors but the mechanism is unknown. Recent evidence indicates that Raf Kinase Inhibitory Protein regulates the mitotic spindle assembly checkpoint by controlling Aurora B Kinase activity, and the mechanism involves Raf/MEK/ERK signaling. In contrast to elevated MAP kinase signaling during the G1, S or G2 phases of the cell cycle that activates checkpoints and induces arrest or senescence, loss of RKIP during M phase leads to bypass of the spindle assembly checkpoint and the generation of chromosomal abnormalities. These results reveal a role for Raf Kinase Inhibitory Protein and the MAP kinase cascade in ensuring the fidelity of chromosome segregation prior to cell division. Furthermore, these data highlight the need for precise titration of the MAP kinase signal to ensure the integrity of the spindle assembly process and provide a mechanism for generating genomic instability in tumors. Finally, these results raise the possibility that RKIP status in tumors could influence the efficacy of treatments such as poisons that stimulate the Aurora B-dependent spindle assembly checkpoint.

  7. Regulation and function of TPL-2,an IκB kinase-regulated MAP kinase kinase kinase

    Institute of Scientific and Technical Information of China (English)

    Thorsten Gantke; Srividya Sriskantharajah; Steven C Ley

    2011-01-01

    The IκB kinase(IKK)complex plays a well-documented role in innate and adaptive immunity.This function has been widely attributed to its role as the central activator of the NF-κB family of transcription factors.However,another important consequence of IKK activation is the regulation of TPL-2,a MEK kinase that is required for activation of ERK-1/2 MAP kinases in myeioid cells following Toll-like receptor and TNF receptor stimulation.In unstimulated cells,TPL-2 is stoichiometrically complexed with the NF-κB inhibitory protein NF-κB1 p105,which blocks TPL-2 access to its substrate MEK,and the ubiquitin-binding protein ABIN-2(A20-binding inhibitor of NF-κB 2),both of which are required to maintain TPL-2 protein stability.Following agonist stimulation,the IKK complex phosphorylates p105,triggering its K48-1inked ubiquitination and degradation by the proteasome.This releases TPL-2 from p105-mediated inhibition,facilitating activation of MEK,in addition to modulating NF-κB activation by liberating associated Rel subunits for translocation into the nucleus.IKK-induced proteolysis of 0105,therefore,can directly regulate both NF-κB and ERK MAP kinase activation via NF-κB1 p105.TPL-2 is critical for production of the proinflammatory cytokine TNF during inflammatory responses.Consequently,there has been considerable interest in the pharmaceutical industry to develop selective TPL-2 inhibitors as drugs for the treatment of TNF-dependent inflammatory,diseases,such as rheumatoid arthritis and inflammatory bowel disease.This review summarizes our current understanding of the regulation of TPL-2 signaling function,and also the complex positive and negative roles of TPL-2 in immune and inflammatory responses.

  8. The Arabidopsis kinase-associated protein phosphatase controls internalization of the somatic embryogenesis receptor kinase 1

    NARCIS (Netherlands)

    Shah, K.; Russinova, E.; Gadella, T.W.J.; Willemse, J.; Vries, de S.C.

    2002-01-01

    The AtSERK1 protein is a plasma membrane-located LRR receptor-like serine threonine kinase that is transiently expressed during plant embryogenesis. Our results show that AtSERK1 interacts with the kinase-associated protein phosphatase (KAPP) in vitro. The kinase interaction (KI) domain of KAPP does

  9. Fine-mapping of an Arabidopsis cell death mutation locus

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    An Arabidopsis cell death mutation locus was mapped to chromosome 2 between IGS1 and mi421. The YAC clone ends, CIC9A3R, CIC11C7L, CIC2G5R and RFLP marker CDs3 within this interval, were used to probe TAMU BAC library and 31 BAC clones were obtained. A BAC contig encompassing the mutation locus, which consists of T6P5, T7M23, T12A21, T8L6 and T18A18, was identified by Southern hybridization with the BAC ends as probes. 11 CAPS and 12 STS markers were developed in this region. These results will facilitate map-based cloning of the genes and sequencing of the genomic DNA in this region.

  10. Fine-mapping of an Arabidopsis cell death mutation locus

    Institute of Scientific and Technical Information of China (English)

    牟中林; 戴亚; 李家洋

    2000-01-01

    An Arabidopsis cell death mutation locus was mapped to chromosome 2 between lGS1 and mi421. The YAC clone ends, CIC9A3R, CIC11C7L, CIC2G5R and RFLP marker CDs3 within this interval, were used to probe TAMU BAC library and 31 BAC clones were obtained. A BAC contig encompassing the mutation locus, which consists of T6P5, T7M23, T12A21, T8L6 and T18A18, was identified by Southern hybridization with the BAC ends as probes. 11 CAPS and 12 STS markers were developed in this region. These results will facilitate map-based cloning of the genes and sequencing of the genomic DNA in this region.

  11. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  12. MAP kinases in inflammatory bowel disease

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Olsen, Jørgen; Seidelin, Jakob Benedict;

    2011-01-01

    The mammalian family of mitogen-activated protein kinases (MAPKs) is activated by diverse extracellular and intracellular stimuli, and thereby they play an essential role in connecting cell-surface receptors to changes in transcriptional programs. The MAPK signaling pathways regulate a wide range...

  13. NITRIC OXIDE BINDS TO AND MODULATES THE ACTIVITY OF A POLLEN SPECIFIC ARABIDOPSIS DIACYLGLYCEROL KINASE

    KAUST Repository

    Wong, Aloysius Tze

    2014-06-01

    Nitric oxide (NO) is an important signaling molecule in plants. In the pollen of Arabidopsis thaliana, NO causes re-orientation of the growing tube and this response is mediated by 3′,5′-cyclic guanosine monophosphate (cGMP). However, in plants, NO-sensors have remained somewhat elusive. Here, the findings of an NO-binding candidate, Arabidopsis thaliana DIACYLGLYCEROL KINASE 4 (ATDGK4; AT5G57690) is presented. In addition to the annotated diacylglycerol kinase domain, this molecule also harbors a predicted heme-NO/oxygen (H-NOX) binding site and a guanylyl cyclase (GC) catalytic domain which have been identified based on the alignment of functionally conserved amino acid residues across species. A 3D model of the molecule was constructed, and from which the locations of the kinase catalytic center, the ATP-binding site, the GC and H-NOX domains were estimated. Docking of ATP to the kinase catalytic center was also modeled. The recombinant ATDGK4 demonstrated kinase activity in vitro, catalyzing the ATP-dependent conversion of sn-1,2-diacylglycerol (DAG) to phosphatidic acid (PA). This activity was inhibited by the mammalian DAG kinase inhibitor R59949 and importantly also by the NO donors diethylamine NONOate (DEA NONOate) and sodium nitroprusside (SNP). Recombinant ATDGK4 also has GC activity in vitro, catalyzing the conversion of guanosine-5\\'-triphosphate (GTP) to cGMP. The catalytic domains of ATDGK4 kinase and GC may be independently regulated since the kinase but not the GC, was inhibited by NO while Ca2+ only stimulates the GC. It is likely that the DAG kinase product, PA, causes the release of Ca2+ from the intracellular stores and Ca2+ in turn activates the GC domain of ATDGK4 through a feedback mechanism. Analysis of publicly available microarray data has revealed that ATDGK4 is highly expressed in the pollen. Here, the pollen tubes of mis-expressing atdgk4 recorded slower growth rates than the wild-type (Col-0) and importantly, they showed altered

  14. Calcium-Dependent Protein Kinase CPK21 Functions in Abiotic Stress Response in Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    Sandra Franz; Britta Ehlert; Anja Liese; Joachim Kurth; Anne-Claire Cazalé; Tina Romeis

    2011-01-01

    Calcium-dependent protein kinases(CDPKs)comprise a family of plant serine/threonine protein kinases in which the calcium sensing domain and the kinase effector domain are combined within one molecule.So far,a biological function in abiotic stress signaling has only been reported for few CDPK isoforms,whereas the underlying biochemical mechanism for these CDPKs is still mainly unknown.Here,we show that CPK21 from Arabidopsis thaliana is biochemically activated in vivo in response to hyperosmotic stress.Loss-of-function seedlings of cpk21 are more tolerant to hyperosmotic stress and mutant plants show increased stress responses with respect to marker gene expression and metabolite accumulation.In transgenic Arabidopsis complementation lines in the cpk21 mutant background,in which either CPK21 wildtype,or a full-length enzyme variant carrying an amino-acid substitution were stably expressed,stress responsitivity was restored by CPK21 but not with the kinase inactive variant.The biochemical characterization of in planta synthesized and purified CPK21 protein revealed that within the calcium-binding domain,N-terminal EF1- and EF2-motifs compared to C-terminal EF3- and EF4-motifs differ in their contribution to calcium-regulated kinase activity,suggesting a crucial role for the N-terminal EF-hand pair.Our data provide evidence for CPK21 contributing in abiotic stress signaling and suggest that the N-terminal EF-hand pair is a calcium-sensing determinant controlling specificity of CPK21 function.

  15. Ras, Raf, and MAP kinase in melanoma.

    Science.gov (United States)

    Solus, Jason F; Kraft, Stefan

    2013-07-01

    A growing understanding of the biology and molecular mechanisms of melanoma has led to the identification of a number of driver mutations for this aggressive tumor. The most common mutations affect signaling of the Ras/Raf/MAPK (mitogen-activated protein kinase) pathway. This review will focus on mutations in genes encoding proteins that play a role in the MAPK pathway and that have been implicated in melanoma biology, such as BRAF, NRAS, and MEK (MAPK kinase), and detail the current understanding of their role in melanoma progression from a molecular biology perspective. Furthermore, this review will also consider some additional mutations in genes such as KIT, GNAQ, and GNA11, which can be seen in certain subtypes of melanoma and whose gene products interact with the MAPK pathway. In addition, the association of these molecular changes with clinical and classical histopathologic characteristics of melanoma will be outlined and their role in diagnosis of melanocytic lesions discussed. Finally, a basic overview of the current targeted therapy landscape, as far as relevant to the pathologist, will be provided.

  16. A sequence based synteny map between soybean and Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Lightfoot David A

    2007-01-01

    Full Text Available Abstract Background Soybean (Glycine max, L. Merr. is one of the world's most important crops, however, its complete genomic sequence has yet to be determined. Nonetheless, a large body of sequence information exists, particularly in the form of expressed sequence tags (ESTs. Herein, we report the use of the model organism Arabidopsis thaliana (thale cress for which the entire genomic sequence is available as a framework to align thousands of short soybean sequences. Results A series of JAVA-based programs were created that processed and compared 341,619 soybean DNA sequences against A. thaliana chromosomal DNA. A. thaliana DNA was probed for short, exact matches (15 bp to each soybean sequence, and then checked for the number of additional 7 bp matches in the adjacent 400 bp region. The position of these matches was used to order soybean sequences in relation to the A. thaliana genome. Conclusion Reported associations between soybean sequences and A. thaliana were within a 95% confidence interval of e-30 – e-100. In addition, the clustering of soybean expressed sequence tags (ESTs based on A. thaliana sequence was accurate enough to identify potential single nucleotide polymorphisms (SNPs within the soybean sequence clusters. An EST, bacterial artificial chromosome (BAC end sequence and marker amplicon sequence synteny map of soybean and A. thaliana is presented. In addition, all JAVA programs used to create this map are available upon request and on the WEB.

  17. Positional signaling mediated by a receptor-like kinase in Arabidopsis.

    Science.gov (United States)

    Kwak, Su-Hwan; Shen, Ronglai; Schiefelbein, John

    2005-02-18

    The position-dependent specification of root epidermal cells in Arabidopsis provides an elegant paradigm for cell patterning during development. Here, we describe a new gene, SCRAMBLED (SCM), required for cells to appropriately interpret their location within the developing root epidermis. SCM encodes a receptor-like kinase protein with a predicted extracellular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain. SCM regulates the expression of the GLABRA2, CAPRICE, WEREWOLF, and ENHANCER OF GLABRA3 transcription factor genes that define the cell fates. Further, the SCM gene is expressed throughout the developing root. Therefore, SCM likely enables developing epidermal cells to detect positional cues and establish an appropriate cell-type pattern.

  18. An Arabidopsis example of association mapping in structured samples.

    Directory of Open Access Journals (Sweden)

    Keyan Zhao

    2007-01-01

    Full Text Available A potentially serious disadvantage of association mapping is the fact that marker-trait associations may arise from confounding population structure as well as from linkage to causative polymorphisms. Using genome-wide marker data, we have previously demonstrated that the problem can be severe in a global sample of 95 Arabidopsis thaliana accessions, and that established methods for controlling for population structure are generally insufficient. Here, we use the same sample together with a number of flowering-related phenotypes and data-perturbation simulations to evaluate a wider range of methods for controlling for population structure. We find that, in terms of reducing the false-positive rate while maintaining statistical power, a recently introduced mixed-model approach that takes genome-wide differences in relatedness into account via estimated pairwise kinship coefficients generally performs best. By combining the association results with results from linkage mapping in F2 crosses, we identify one previously known true positive and several promising new associations, but also demonstrate the existence of both false positives and false negatives. Our results illustrate the potential of genome-wide association scans as a tool for dissecting the genetics of natural variation, while at the same time highlighting the pitfalls. The importance of study design is clear; our study is severely under-powered both in terms of sample size and marker density. Our results also provide a striking demonstration of confounding by population structure. While statistical methods can be used to ameliorate this problem, they cannot always be effective and are certainly not a substitute for independent evidence, such as that obtained via crosses or transgenic experiments. Ultimately, association mapping is a powerful tool for identifying a list of candidates that is short enough to permit further genetic study.

  19. Genetic mapping of adaptation reveals fitness tradeoffs in Arabidopsis thaliana.

    Science.gov (United States)

    Ågrena, Jon; Oakley, Christopher G; McKay, John K; Lovell, John T; Schemske, Douglas W

    2013-12-24

    Organisms inhabiting different environments are often locally adapted, and yet despite a considerable body of theory, the genetic basis of local adaptation is poorly understood. Unanswered questions include the number and effect sizes of adaptive loci, whether locally favored loci reduce fitness elsewhere (i.e., fitness tradeoffs), and whether a lack of genetic variation limits adaptation. To address these questions, we mapped quantitative trait loci (QTL) for total fitness in 398 recombinant inbred lines derived from a cross between locally adapted populations of the highly selfing plant Arabidopsis thaliana from Sweden and Italy and grown for 3 consecutive years at the parental sites (>40,000 plants monitored). We show that local adaptation is controlled by relatively few genomic regions of small to modest effect. A third of the 15 fitness QTL we detected showed evidence of tradeoffs, which contrasts with the minimal evidence for fitness tradeoffs found in previous studies. This difference may reflect the power of our multiyear study to distinguish conditionally neutral QTL from those that reflect fitness tradeoffs. In Sweden, but not in Italy, the local genotype underlying fitness QTL was often maladaptive, suggesting that adaptation there is constrained by a lack of adaptive genetic variation, attributable perhaps to genetic bottlenecks during postglacial colonization of Scandinavia or to recent changes in selection regime caused by climate change. Our results suggest that adaptation to markedly different environments can be achieved through changes in relatively few genomic regions, that fitness tradeoffs are common, and that lack of genetic variation can limit adaptation.

  20. Mitogen-activated protein kinase kinase 4 (MAP2K4 promotes human prostate cancer metastasis.

    Directory of Open Access Journals (Sweden)

    Janet M Pavese

    Full Text Available Prostate cancer (PCa is the second leading cause of cancer death in the US. Death from PCa primarily results from metastasis. Mitogen-activated protein kinase kinase 4 (MAP2K4 is overexpressed in invasive PCa lesions in humans, and can be inhibited by small molecule therapeutics that demonstrate favorable activity in phase II studies. However, MAP2K4's role in regulating metastatic behavior is controversial and unknown. To investigate, we engineered human PCa cell lines which overexpress either wild type or constitutive active MAP2K4. Orthotopic implantation into mice demonstrated MAP2K4 increases formation of distant metastasis. Constitutive active MAP2K4, though not wild type, increases tumor size and circulating tumor cells in the blood and bone marrow. Complementary in vitro studies establish stable MAP2K4 overexpression promotes cell invasion, but does not affect cell growth or migration. MAP2K4 overexpression increases the expression of heat shock protein 27 (HSP27 protein and protease production, with the largest effect upon matrix metalloproteinase 2 (MMP-2, both in vitro and in mouse tumor samples. Further, MAP2K4-mediated increases in cell invasion are dependent upon heat shock protein 27 (HSP27 and MMP-2, but not upon MAP2K4's immediate downstream targets, p38 MAPK or JNK. We demonstrate that MAP2K4 increases human PCa metastasis, and prolonged over expression induces long term changes in cell signaling pathways leading to independence from p38 MAPK and JNK. These findings provide a mechanistic explanation for human studies linking increases in HSP27 and MMP-2 to progression to metastatic disease. MAP2K4 is validated as an important therapeutic target for inhibiting human PCa metastasis.

  1. Activation and signaling of the p38 MAP kinase pathway

    Institute of Scientific and Technical Information of China (English)

    Tyler ZARUBIN; Jiahuai HAN

    2005-01-01

    The family members of the mitogen-activated protein (MAP) kinases mediate a wide variety of cellular behaviors in response to extracellular stimuli. One of the four main sub-groups, the p38 group of MAP kinases, serve as a nexus for signal transduction and play a vital role in numerous biological processes. In this review, we highlight the known characteristics and components of the p38 pathway along with the mechanism and consequences of p38 activation. We focus on the role of p38 as a signal transduction mediator and examine the evidence linking p38 to inflammation, cell cycle, cell death, development, cell differentiation, senescence and tumorigenesis in specific cell types. Upstream and downstream components of p38 are described and questions remaining to be answered are posed. Finally, we propose several directions for future research on p38.

  2. Enhanced Arabidopsis pattern-triggered immunity by overexpression of cysteine-rich receptor-like kinases

    Directory of Open Access Journals (Sweden)

    Yu-Hung eYeh

    2015-05-01

    Full Text Available Upon recognition of microbe-associated molecular patterns (MAMPs such as the bacterial flagellin (or the derived peptide flg22 by pattern-recognition receptors (PRRs such as the FLAGELLIN SENSING2 (FLS2, plants activate the pattern-triggered immunity (PTI response. The L-type lectin receptor kinase-VI.2 (LecRK-VI.2 is a positive regulator of Arabidopsis thaliana PTI. Cysteine-rich receptor-like kinases (CRKs possess two copies of the C-X8-C-X2-C (DUF26 motif in their extracellular domains and are thought to be involved in plant stress resistance, but data about CRK functions are scarce. Here we show that Arabidopsis overexpressing the LecRK-VI.2-responsive CRK4, CRK6 and CRK36 demonstrated an enhanced PTI response and were resistant to virulent bacteria Pseudomonas syringae pv. tomato DC3000. Notably, the flg22-triggered oxidative burst was primed in CRK4, CRK6, and CRK36 transgenics and up-regulation of the PTI-responsive gene FLG22-INDUCED RECEPTOR-LIKE 1 (FRK1 was potentiated upon flg22 treatment in CRK4 and CRK6 overexpression lines or constitutively increased by CRK36 overexpression. PTI-mediated callose deposition was not affected by overexpression of CRK4 and CRK6, while CRK36 overexpression lines demonstrated constitutive accumulation of callose. In addition, Pst DC3000-mediated stomatal reopening was blocked in CRK4 and CRK36 overexpression lines, while overexpression of CRK6 induced constitutive stomatal closure suggesting a strengthening of stomatal immunity. Finally, bimolecular fluorescence complementation and co-immunoprecipitation analyses in Arabidopsis protoplasts suggested that the plasma membrane localized CRK4, CRK6 and CRK36 associate with the PRR FLS2. Association with FLS2 and the observation that overexpression of CRK4, CRK6, and CRK36 boosts specific PTI outputs and resistance to bacteria suggest a role for these CRKs in Arabidopsis innate immunity.

  3. D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.

    Science.gov (United States)

    Willige, Björn C; Ahlers, Siv; Zourelidou, Melina; Barbosa, Inês C R; Demarsy, Emilie; Trevisan, Martine; Davis, Philip A; Roelfsema, M Rob G; Hangarter, Roger; Fankhauser, Christian; Schwechheimer, Claus

    2013-05-01

    Phototropic hypocotyl bending in response to blue light excitation is an important adaptive process that helps plants to optimize their exposure to light. In Arabidopsis thaliana, phototropic hypocotyl bending is initiated by the blue light receptors and protein kinases phototropin1 (phot1) and phot2. Phototropic responses also require auxin transport and were shown to be partially compromised in mutants of the PIN-FORMED (PIN) auxin efflux facilitators. We previously described the D6 PROTEIN KINASE (D6PK) subfamily of AGCVIII kinases, which we proposed to directly regulate PIN-mediated auxin transport. Here, we show that phototropic hypocotyl bending is strongly dependent on the activity of D6PKs and the PIN proteins PIN3, PIN4, and PIN7. While early blue light and phot-dependent signaling events are not affected by the loss of D6PKs, we detect a gradual loss of PIN3 phosphorylation in d6pk mutants of increasing complexity that is most severe in the d6pk d6pkl1 d6pkl2 d6pkl3 quadruple mutant. This is accompanied by a reduction of basipetal auxin transport in the hypocotyls of d6pk as well as in pin mutants. Based on our data, we propose that D6PK-dependent PIN regulation promotes auxin transport and that auxin transport in the hypocotyl is a prerequisite for phot1-dependent hypocotyl bending.

  4. Regulation of WRKY46 transcription factor function by mitogen-activated protein kinases in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Arsheed Hussain Sheikh

    2016-02-01

    Full Text Available AbstractMitogen-activated protein kinase (MAPK cascades are central signalling pathways activated in plants after sensing internal developmental and external stress cues. Knowledge about the downstream substrate proteins of MAPKs is still limited in plants. We screened Arabidopsis WRKY transcription factors as potential targets downstream of MAPKs, and concentrated on characterizing WRKY46 as a substrate of the MAPK, MPK3. Mass spectrometry revealed in vitro phosphorylation of WRKY46 at amino acid position S168 by MPK3. However, mutagenesis studies showed that a second phosphosite, S250, can also be phosphorylated. Elicitation with pathogen-associated molecular patterns (PAMPs, such as the bacterial flagellin-derived flg22 peptide led to in vivo destabilization of WRKY46 in Arabidopsis protoplasts. Mutation of either phosphorylation site reduced the PAMP-induced degradation of WRKY46. Furthermore, the protein for the double phosphosite mutant is expressed at higher levels compared to wild-type proteins or single phosphosite mutants. In line with its nuclear localization and predicted function as a transcriptional activator, overexpression of WRKY46 in protoplasts raised basal plant defence as reflected by the increase in promoter activity of the PAMP-responsive gene, NHL10, in a MAPK-dependent manner. Thus, MAPK-mediated regulation of WRKY46 is a mechanism to control plant defence.

  5. The role of the SCRAMBLED receptor-like kinase in patterning the Arabidopsis root epidermis.

    Science.gov (United States)

    Kwak, Su-Hwan; Schiefelbein, John

    2007-02-01

    Cell-type patterning in the Arabidopsis root epidermis is achieved by a network of transcription factors and influenced by a position-dependent mechanism. The SCRAMBLED receptor-like kinase is required for the normal pattern to arise, but its precise role is not understood. Here we describe genetic and molecular studies to define the spatial and temporal role of SCM in epidermal patterning and its relationship to the transcriptional network. Our results suggest that SCM helps unspecified epidermal cells interpret their position in relation to the underlying cortical cells and establish distinct cell identities. Furthermore, SCM loss-of-function and overexpression analyses suggest that SCM influences cell fate through its negative transcriptional regulation of the WEREWOLF MYB gene in epidermal cells at the H position. We also find that SCM function is specifically required for patterning the post-embryonic root epidermis and not for the analogous epidermal cell-type patterning during embryogenesis or hypocotyl development. In addition, we show that two closely related SCM-like genes in Arabidopsis (SRF1 and SRF3) are not required alone or together with SCM for proper epidermal patterning. These findings help define the developmental and mechanistic role of SCM and suggest a new model for its action in root epidermal cell patterning.

  6. An Autophosphorylation Site of the Protein Kinase SOS2 Is Important for Salt Tolerance in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Hiroaki Fujii; Jian-Kang Zhu

    2009-01-01

    The protein kinase SOS2 (Salt Overly Sensitive 2) is essential for salt-stress signaling and tolerance in Arabidopsis. SOS2 is known to be activated by calcium-SOS3 and by phosphorylation at its activation loop. SOS2 is autophosphorylated in vitro, but the autophosphorylation site and its role in salt tolerance are not known. In this study, we identified an autophosphorylation site in SOS2 and analyzed its role in the responses of Arabidopsis to salt stress. Mass spectrometry analysis showed that Ser 228 of SOS2 is autophosphorylated. When this site was mutated to Ala, the autophosphorylation rate of SOS2 decreased. The substrate phosphorylation by the mutated SOS2 was also less than that by the wild-type SOS2. In contrast, changing Ser228 to Asp to mimic the autophosphorylation enhanced substrate phosphorylation by SOS2. Complementation tests in a sos2 mutant showed that the S228A but not the S228D mutation partially disrupted the function of SOS2 in salt tolerance. We also show that activation loop phosphorylation at Thr168 and autophosphorylation at Ser228 cannot substitute for each other, suggesting that both are required for salt tolerance. Our results indicate that Ser 228 of SOS2 is autophosphorylated and that this autophosphorylation is important for SOS2 function under salt stress.

  7. Arabidopsis Fused kinase TWO-IN-ONE dominantly inhibits male meiotic cytokinesis.

    Science.gov (United States)

    Oh, Sung Aeong; Bourdon, Valérie; Dickinson, Hugh G; Twell, David; Park, Soon Ki

    2014-03-01

    Arabidopsis Fused kinase TWO-IN-ONE (TIO) controls phragmoplast expansion through its interaction with the Kinesin-12 subfamily proteins that anchor the plus ends of interdigitating microtubules in the phragmoplast midzone. Previous analyses of loss-of-function mutants and RNA interference lines revealed that TIO positively controls both somatic and gametophytic cell cytokinesis; however, knowledge of the full spectrum of TIO functions during plant development remains incomplete. To characterize TIO functions further, we expressed TIO and a range of TIO variants under control of the TIO promoter in wild-type Arabidopsis plants. We discovered that TIO-overexpressing transgenic lines produce enlarged pollen grains, arising from incomplete cytokinesis during male meiosis, and show sporophytic abnormalities indicative of polyploidy. These phenotypes arose independently in TIO variants in which either gametophytic function or the ability of TIO to interact with Kinesin-12 subfamily proteins was abolished. Interaction assays in yeast showed TIO to bind to the AtNACK2/TETRASPORE, and plants doubly homozygous for kinesin-12a and kinesin-12b knockout mutations to produce enlarged pollen grains. Our results show TIO to dominantly inhibit male meiotic cytokinesis in a dosage-dependent manner that may involve direct binding to a component of the canonical NACK-PQR cytokinesis signaling pathway.

  8. LIK1, a CERK1-interacting kinase, regulates plant immune responses in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Mi Ha Le

    Full Text Available Chitin, an integral component of the fungal cell wall, is one of the best-studied microbe-associated molecular patterns. Previous work identified a LysM receptor-like kinase (LysM-RLK1/CERK1 as the primary chitin receptor in Arabidopsis. In order to identify proteins that interact with CERK1, we conducted a yeast two-hybrid screen using the intracellular kinase domain of CERK1 as the bait. This screen identified 54 putative CERK1-interactors. Screening mutants defective in 43 of these interacting proteins identified only two, a calmodulin like protein (At3g10190 and a leucine-rich repeat receptor like kinase (At3g14840, which differed in their response to pathogen challenge. In the present work, we focused on characterizing the LRR-RLK gene where mutations altered responses to chitin elicitation. This LRR-RLK was named LysM RLK1-interacting kinase 1 (LIK1. The interaction between CERK1 and LIK1 was confirmed by co-immunoprecipitation using protoplasts and transgenic plants. In vitro experiments showed that LIK1 was directly phosphorylated by CERK1. In vivo phosphorylation assays showed that Col-0 wild-type plants have more phosphorylated LIK1 than cerk1 mutant plants, suggesting that LIK1 may be directly phosphorylated by CERK1. Lik1 mutant plants showed an enhanced response to both chitin and flagellin elicitors. In comparison to the wild-type plants, lik1 mutant plants were more resistant to the hemibiotrophic pathogen Pseudomonas syringae, but more susceptible to the necrotrophic pathogen Sclerotinia sclerotiorum. Consistent with the enhanced susceptibility to necrotrophs, lik1 mutants showed reduced expression of genes involved in jasmonic acid and ethylene signaling pathways. These data suggest that LIK1 directly interacts with CERK1 and regulates MAMP-triggered innate immunity.

  9. Structural and Functional Characterization of the Protein Kinase Mps1 in Arabidopsis thaliana

    Science.gov (United States)

    de Oliveira, Eduardo Alves Gamosa; Romeiro, Nelilma Correia; Ribeiro, Elane da Silva; Santa-Catarina, Claudete; Oliveira, Antônia Elenir Amâncio; Silveira, Vanildo; de Souza Filho, Gonçalo Apolinário; Venancio, Thiago Motta; Cruz, Marco Antônio Lopes

    2012-01-01

    In eukaryotes, protein kinases catalyze the transfer of a gamma-phosphate from ATP (or GTP) to specific amino acids in protein targets. In plants, protein kinases have been shown to participate in signaling cascades driving responses to environmental stimuli and developmental processes. Plant meristems are undifferentiated tissues that provide the major source of cells that will form organs throughout development. However, non-dividing specialized cells can also dedifferentiate and re-initiate cell division if exposed to appropriate conditions. Mps1 (Monopolar spindle) is a dual-specificity protein kinase that plays a critical role in monitoring the accuracy of chromosome segregation in the mitotic checkpoint mechanism. Although Mps1 functions have been clearly demonstrated in animals and fungi, its role in plants is so far unclear. Here, using structural and biochemical analyses here we show that Mps1 has highly similar homologs in many plant genomes across distinct lineages (e.g. AtMps1 in Arabidopsis thaliana). Several structural features (i.e. catalytic site, DFG motif and threonine triad) are clearly conserved in plant Mps1 kinases. Structural and sequence analysis also suggest that AtMps1 interact with other cell cycle proteins, such as Mad2 and MAPK1. By using a very specific Mps1 inhibitor (SP600125) we show that compromised AtMps1 activity hampers the development of A. thaliana seedlings in a dose-dependent manner, especially in secondary roots. Moreover, concomitant administration of the auxin IAA neutralizes the AtMps1 inhibition phenotype, allowing secondary root development. These observations let us to hypothesize that AtMps1 might be a downstream regulator of IAA signaling in the formation of secondary roots. Our results indicate that Mps1 might be a universal component of the Spindle Assembly Checkpoint machinery across very distant lineages of eukaryotes. PMID:23049844

  10. The MAP kinase substrate MKS1 is a regulator of plant defense responses.

    Science.gov (United States)

    Andreasson, Erik; Jenkins, Thomas; Brodersen, Peter; Thorgrimsen, Stephan; Petersen, Nikolaj H T; Zhu, Shijiang; Qiu, Jin-Long; Micheelsen, Pernille; Rocher, Anne; Petersen, Morten; Newman, Mari-Anne; Bjørn Nielsen, Henrik; Hirt, Heribert; Somssich, Imre; Mattsson, Ole; Mundy, John

    2005-07-20

    Arabidopsis MAP kinase 4 (MPK4) functions as a regulator of pathogen defense responses, because it is required for both repression of salicylic acid (SA)-dependent resistance and for activation of jasmonate (JA)-dependent defense gene expression. To understand MPK4 signaling mechanisms, we used yeast two-hybrid screening to identify the MPK4 substrate MKS1. Analyses of transgenic plants and genome-wide transcript profiling indicated that MKS1 is required for full SA-dependent resistance in mpk4 mutants, and that overexpression of MKS1 in wild-type plants is sufficient to activate SA-dependent resistance, but does not interfere with induction of a defense gene by JA. Further yeast two-hybrid screening revealed that MKS1 interacts with the WRKY transcription factors WRKY25 and WRKY33. WRKY25 and WRKY33 were shown to be in vitro substrates of MPK4, and a wrky33 knockout mutant was found to exhibit increased expression of the SA-related defense gene PR1. MKS1 may therefore contribute to MPK4-regulated defense activation by coupling the kinase to specific WRKY transcription factors.

  11. Role of calcium, protein kinase C and MAP kinase in the activation of mast cells

    Directory of Open Access Journals (Sweden)

    Michael A. Beaven

    1996-01-01

    Full Text Available The mechanisms of activation of mast cells have been studied in most detail in rat RBL-2H3 cells. These cells respond to antigen via the IgE receptor (FceRI through sequential activation of the tyrosine kinases, Lyn and Syk, and to adenosine analogs via the adenosine A3 receptor (A3R and a pertussis toxin-sensitive G protein, most likely Gi-3. Other receptors, introduced through gene transfection, include the muscarinic ml receptor (mlR which acts via Gq/11. Stimulation of cells via FceRI, A3R or ml R leads to the activation of phospholipase (PL C, PLD and mitogen-activated protein (MAP kinase resulting in the generation of inositol phosphates and diglycerides, an increase of cytosolic Ca2+, the activation of protein kinase C (PKC and the phosphorylation of various proteins by PKC and MAP kinase. The extent and time course of these events varies for each receptor. These variations, as well as the effects of pharmacologic probes, gene transfection and reconstitution of responses in washed permeabilized cells, indicate how these events relate to functional responses. A modest but sustained elevation of cytosolic Ca2+ through an influx of extracellular Ca2+ and activation of PKCβ and PKCδ are sufficient for optimal release of preformed secretory granules. Phosphorylation of a cytosolic PLAj by AMP kinase (p42mapk and a modest increase in cytosolic Ca2+ are necessary for the activation of Pl^ and the binding of PLA2 to membranes, respectively. Finally, both de novo generation and secretion via Golgi-derived vesicles of certain cytokines are dependent on Ca2+ and PKC as well as additional signals most probably phosphorylation of proteins by Syk and p42mapk.

  12. APS kinase from Arabidopsis thaliana: genomic organization, expression, and kinetic analysis of the recombinant enzyme.

    Science.gov (United States)

    Lee, S; Leustek, T

    1998-06-09

    The gene encoding 5'-adenylylsulfate (APS) kinase (EC 2.7.1.25) (APK) was cloned from Arabidopsis thaliana. There is a single APK locus in A. thaliana. The coding sequence of the gene is composed of 7 exons, interrupted by 6 introns. A transcriptional initiation site was detected 120 bp 5' of the initiation codon. APK mRNA is slightly more abundant in leaves than in roots of A. thaliana and its level does not change in response to sulfur starvation. The APK protein, synthesized in vitro, is able to enter isolated intact chloroplasts. Recombinant APS kinase shows maximal activity at 10 microM APS with 5 mM ATP, but it is inhibited at APS concentrations above 10 microM. The inhibition is alleviated at higher ATP concentrations. Reciprocal plot analysis showed that the theoretical Vmax is approximately 1.2 mumol min-1 mg-1 at 25 degrees C, pH 8.0; the K(m) values are 3.6 microM APS and 1.8 mM ATP.

  13. Activation of a mitogen-activated protein kinase pathway in Arabidopsis by chitin.

    Science.gov (United States)

    Wan, Jinrong; Zhang, Shuqun; Stacey, Gary

    2004-03-01

    SUMMARY Chitin, a polysaccharide composed of beta-1-->4-linked N-acetyl-d-glucosamine, has been shown or implicated as a signal in plant defence and development. However, the key components of chitin perception and downstream signalling in non-leguminous plants are largely unknown. In recent years, mitogen-activated protein kinases (MAPKs) and their cascades were shown to transduce various extracellular stimuli into internal cellular responses. To investigate the possible involvement of MAPKs in chitin signalling in plants, the model plant Arabidopsis thaliana was treated with crab-shell chitin and also with the purified chitin oligomers (degree of polymerization, d.p. = 2-8). Both mRNA levels and kinase activity of two MAPK genes, AtMPK6 and AtMPK3, were monitored after treatment. The mRNA of AtMPK3 was strongly up-regulated by both chitin and its larger oligomers (d.p. = 6-8), but the mRNA of AtMPK6 did not appear to be regulated by these treatments. However, the kinase activity of both MAPKs was induced by chitin and the larger oligomers (d.p. = 6-8), with AtMPK6 much more strongly induced. In addition, WRKY22, WRKY29, WRKY33 and WRKY53, which encode four WRKY transcription factors that recognize TTGAC(C/T) W-box elements in promoters of numerous plant defence-related genes, were up-regulated by these treatments. WRKY33 and WRKY53 expression was induced by the transgenic expression of the tobacco MAPKK NtMEK2 active mutant NtMEK2(DD), suggesting a potential role for these WRKY transcription factors in relaying the signal generated from the MAPK cascade to downstream genes. These data suggest that AtMPK6/AtMPK3 and WRKY transcription factors (such as WRKY33 and WRKY53) may be important components of a pathway involved in chitin signalling in Arabidopsis plants.

  14. Arabidopsis Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Gene Raf43 Is Required for Tolerance to Multiple Abiotic Stresses.

    Directory of Open Access Journals (Sweden)

    Nasar Virk

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are critical signaling modules that mediate the transduction of extracellular stimuli into intracellular response. A relatively large number of MAPKKKs have been identified in a variety of plant genomes but only a few of them have been studied for their biological function. In the present study, we identified an Arabidopsis Raf-like MAPKKK gene Raf43 and studied its function in biotic and abiotic stress response using a T-DNA insertion mutant raf43-1 and two Raf43-overexpressing lines Raf43-OE#1 and Raf43-OE#13. Expression of Raf43 was induced by multiple abiotic and biotic stresses including treatments with drought, mannitol and oxidative stress or defense signaling molecule salicylic acid and infection with necrotrophic fungal pathogen Botrytis cinerea. Seed germination and seedling root growth of raf43-1 were significantly inhibited on MS medium containing mannitol, NaCl, H2O2 or methyl viologen (MV while seed germination and seedling root growth of the Raf43-OE#1 and Raf43-OE#13 lines was similar to wild type Col-0 under the above stress conditions. Soil-grown raf43-1 plants exhibited reduced tolerance to MV, drought and salt stress. Abscisic acid inhibited significantly seed germination and seedling root growth of the raf43-1 line but had no effect on the two Raf43-overexpressing lines. Expression of stress-responsive RD17 and DREB2A genes was significantly down-regulated in raf43-1 plants. However, the raf43-1 and Raf43-overexpressing plants showed similar disease phenotype to the wild type plants after infection with B. cinerea or Pseudomonas syringae pv. tomato DC3000. Our results demonstrate that Raf43, encoding for a Raf-like MAPKKK, is required for tolerance to multiple abiotic stresses in Arabidopsis.

  15. Modulation of the MAP kinase signaling cascade by Raf kinase inhibitory protein

    Institute of Scientific and Technical Information of China (English)

    Nicholas TRAKUL; Marsha R. ROSNER

    2005-01-01

    Proteins like Raf kinase inhibitory protein (RKIP) that serve as modulators of signaling pathways, either by promoting or inhibiting the formation of productive signaling complexes through protein-protein interactions, have been demonstrated to play an increasingly important role in a number of cell types and organisms. These proteins have been implicated in development as well as the progression of cancer. RKIP is a particularly interesting regulator, as it is a highly conserved, ubiquitously expressed protein that has been shown to play a role in growth and differentiation in a number of organisms and can regulate multiple signaling pathways. RKIP is also the first MAP kinase signaling modulator to be identified as playing a role in cancer metastasis, and identification of the mechanism by which it regulates Raf-1 activation provides new targets for therapeutic intervention.

  16. Regulation of the S-locus receptor kinase and self-incompatibility in Arabidopsis thaliana.

    Science.gov (United States)

    Strickler, Susan R; Tantikanjana, Titima; Nasrallah, June B

    2013-02-01

    Intraspecific mate selectivity often is enforced by self-incompatibility (SI), a barrier to self-pollination that inhibits productive pollen-pistil interactions. In the Brassicaceae, SI specificity is determined by two highly-polymorphic proteins: the stigmatic S-locus receptor kinase (SRK) and its pollen coat-localized ligand, the S-locus cysteine-rich protein (SCR). Arabidopsis thaliana is self fertile, but several of its accessions can be made to express SI, albeit to various degrees, by transformation with functional SRK-SCR gene pairs isolated from its close self-incompatible relative, Arabidopsis lyrata. Here, we use a newly identified induced mutation that suppresses the SI phenotype in stigmas of SRK-SCR transformants of the Col-0 accession to investigate the regulation of SI and the SRK transgene. This mutation disrupts NRPD1a, a gene that encodes a plant-specific nuclear RNA polymerase required for genomic methylation and production of some types of silencing RNAs. We show that NRPD1a, along with the RNA-dependent RNA polymerase RDR2, is required for SI in some A. thaliana accessions. We also show that Col-0 nrpd1a mutants exhibit decreased accumulation of SRK transcripts in stigmas, which is not, however, responsible for loss of SI in these plants. Together, our analysis of the nrpd1a mutation and of SRK promoter activity in various accessions reveals that the SRK transgene is subject to several levels of regulation, which vary substantially by tissue type and by accession. This study thus helps explain the well-documented differences in expression of SI exhibited by SRK-SCR transformants of different A. thaliana accessions.

  17. In Vivo Phosphorylation Site Mapping and Functional Characterization of Arabidopsis Phototropin 1

    Institute of Scientific and Technical Information of China (English)

    Stuart Sullivan; Catriona E. Thomson; Douglas J.Lamont; Matthew A. Jones; John M.Christie

    2008-01-01

    Phototropins (phot1 and phot2) are blue-light receptor kinases controlling a range of responses that optimize the photosynthetic efficiency of plants. Light sensing is mediated by two flavin-binding motifs, known as LOV1 and LOV2,located within the N-terminal region of the protein. Photoexcitation via LOV2 leads to activation of the C-terminal kinase domain and consequently receptor autophosphorylation. However, knowledge of the in-vivo phosphorylation sites for Arabidopsis phototropins is lacking and has impeded progress in elucidating the functional significance of receptor phosphorylation. We have purified phot1 from Arabidopsis and identified the in-vivo sites of receptor phosphorylation by liquid chromatography tandem mass spectrometry. Arabidopsis-derived phot1 binds flavin mononucleotide as chromophore and is phosphorylated at four major sites located upstream of LOV2 (Ser58, Ser85, Ser350, and Ser410), three of which are induced by blue light. Nevertheless, structure-function analysis indicates that the biological activity of phot1 can be attributed to a modular unit comprising the LOV2-kinase region of the protein. Thus, peptide regions upstream of LOV2, including the sites of receptor phosphorylation identified here, do not appear to be important for receptor signaling. By contrast, these regions may be necessary for maximizing stomatal performance and possibly light-induced relocalization of phot1.

  18. Structure of Arabidopsis thaliana 5-methylthioribose Kinase Reveals a More Occluded Active Site Than its Bacterial Homolog

    Energy Technology Data Exchange (ETDEWEB)

    Ku,S.; Cornell, K.; Howell, P.

    2007-01-01

    Metabolic variations exist between the methionine salvage pathway of humans and a number of plants and microbial pathogens. 5-Methylthioribose (MTR) kinase is a key enzyme required for methionine salvage in plants and many bacteria. The absence of a mammalian homolog suggests that MTR kinase is a good target for the design of specific herbicides or antibiotics. The structure of Arabidopsis thaliana MTR kinase co-crystallized with ATP?S and MTR has been determined at 1.9 Angstroms resolution. The structure is similar to B. subtilis MTR kinase and has the same protein kinase fold observed in other evolutionarily related protein kinase-like phosphotransferases. The active site is comparable between the two enzymes with the DXE-motif coordinating the nucleotide-Mg, the D238 of the HGD catalytic loop polarizing the MTR O1 oxygen, and the RR-motif interacting with the substrate MTR. Unlike its bacterial homolog, however, the Gly-rich loop (G-loop) of A. thaliana MTR kinase has an extended conformation, which shields most of the active site from solvent, a feature that resembles eukaryotic protein kinases more than the bacterial enzyme. The G- and W-loops of A. thaliana and B. subtilis MTR kinase adopt different conformations despite high sequence similarity. The ATP?S analog was hydrolyzed during the co-crystallization procedure, resulting in ADP in the active site. This suggests that the A. thaliana enzyme, like its bacterial homolog, may have significant ATPase activity in the absence of MTR. The structure of A. thaliana MTR kinase provides a template for structure-based design of agrochemicals, particularly herbicides whose effectiveness could be regulated by nutrient levels. Features of the MTR binding site offer an opportunity for a simple organic salt of an MTR analog to specifically inhibit MTR kinase.

  19. Cellular pattern formation by SCRAMBLED, a leucine-rich repeat receptor-like kinase in Arabidopsis.

    Science.gov (United States)

    Kwak, Su-Hwan; Schiefelbein, John

    2008-02-01

    The appropriate specification of distinct cell types is important for generating the proper tissues and bodies of multicellular organisms. In the root epidermis of Arabidopsis, cell fate determination is accomplished by a transcriptional regulatory circuit that is influenced by positional signaling. A leucine-rich repeat receptor-like kinase, SCRAMBLED (SCM), has been shown to be responsible for the position-dependent aspect of this epidermal pattern. In a recent report, we find that SCM affects the transcriptional regulatory network by down-regulating the WEREWOLF (WER) MYB gene expression in a set of epidermal cells located in a specific position. We also find that SCM and the SCM-related SRF1 and SRF3 are not required for embryonic epidermal patterning and that SRF1 and SRF3 do not act redundantly with SCM. This suggests that distinct positional signaling mechanisms exist for embryonic and post-embryonic epidermal patterning. In this addendum, we discuss the implications of our recent findings and extend our working model for epidermal cell pattering.

  20. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Ines eLassowskat

    2014-10-01

    Full Text Available Mitogen-activated protein kinases (MAPKs target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3 and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phosphoproteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g. WRKY transcription factors and proteins encoded by the genes from the PEN pathway required for penetration resistance to filamentous pathogens. Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org.

  1. Identification of p38α MAP kinase inhibitors by pharmacophore based virtual screening

    DEFF Research Database (Denmark)

    Gangwal, Rahul P; Das, Nihar R; Thanki, Kaushik;

    2014-01-01

    The p38α mitogen-activated protein (MAP) kinase plays a vital role in treating many inflammatory diseases. In the present study, a combined ligand and structure based pharmacophore model was developed to identify potential DFG-in selective p38 MAP kinase inhibitors. Conformations of co-crystallised...

  2. The cAMP Signaling and MAP Kinase Pathways in Plant Pathogenic Fungi

    NARCIS (Netherlands)

    Mehrabi, R.; Zhao, X.; Kim, Y.; Xu, J.R.

    2009-01-01

    The key components of the well conserved cyclic AMP signaling and MAP kinase pathways have been functionally characterized in the corn smut Ustilago maydis, rice blast fungus Magnaporthe grisea, and a few other fungal pathogens. In general, the cAMP signaling and the MAP kinase cascade homologous to

  3. Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor.

    Science.gov (United States)

    Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill

    2016-03-25

    TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction.

  4. Genome wide association mapping for the tolerance to the polyamine oxidase inhibitor guazatine in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Kostadin Evgeniev eAtanasov

    2016-04-01

    Full Text Available Guazatine is a potent inhibitor of polyamine oxidase (PAO activity. In agriculture, guazatine is used as non-systemic contact fungicide efficient in the protection of cereals and citrus fruits against disease. The composition of guazatine is complex, mainly constituted by a mixture of synthetic guanidated polyamines (polyaminoguanidines. Here we have studied the effects from exposure to guazatine in the weed Arabidopsis thaliana. We report that micromolar concentrations of guazatine are sufficient to inhibit growth of Arabidopsis seedlings and induce chlorosis, whereas germination is barely affected. We observed the occurrence of quantitative variation in the response to guazatine between 107 randomly chosen Arabidopsis accessions. This enabled us to undertake genome-wide association (GWA mapping that identified a locus on chromosome one associated with guazatine tolerance. CHLOROPHYLLASE 1 (CLH1 within this locus was studied as candidate gene, together with its paralog (CLH2. The analysis of independent clh1-2, clh1-3, clh2-3, clh2-2 and double clh1-2 clh2-3 mutant alleles indicated that CLH1 and/or CLH2 loss-of-function or expression down-regulation promote guazatine tolerance in Arabidopsis. We report a natural mechanism by which Arabidopsis populations can overcome toxicity by the fungicide guazatine.

  5. The histidine kinase AHK5 integrates endogenous and environmental signals in Arabidopsis guard cells.

    Directory of Open Access Journals (Sweden)

    Radhika Desikan

    Full Text Available BACKGROUND: Stomatal guard cells monitor and respond to environmental and endogenous signals such that the stomatal aperture is continually optimised for water use efficiency. A key signalling molecule produced in guard cells in response to plant hormones, light, carbon dioxide and pathogen-derived signals is hydrogen peroxide (H(2O(2. The mechanisms by which H(2O(2 integrates multiple signals via specific signalling pathways leading to stomatal closure is not known. PRINCIPAL FINDINGS: Here, we identify a pathway by which H(2O(2, derived from endogenous and environmental stimuli, is sensed and transduced to effect stomatal closure. Histidine kinases (HK are part of two-component signal transduction systems that act to integrate environmental stimuli into a cellular response via a phosphotransfer relay mechanism. There is little known about the function of the HK AHK5 in Arabidopsis thaliana. Here we report that in addition to the predicted cytoplasmic localisation of this protein, AHK5 also appears to co-localise to the plasma membrane. Although AHK5 is expressed at low levels in guard cells, we identify a unique role for AHK5 in stomatal signalling. Arabidopsis mutants lacking AHK5 show reduced stomatal closure in response to H(2O(2, which is reversed by complementation with the wild type gene. Over-expression of AHK5 results in constitutively less stomatal closure. Abiotic stimuli that generate endogenous H(2O(2, such as darkness, nitric oxide and the phytohormone ethylene, also show reduced stomatal closure in the ahk5 mutants. However, ABA caused closure, dark adaptation induced H(2O(2 production and H(2O(2 induced NO synthesis in mutants. Treatment with the bacterial pathogen associated molecular pattern (PAMP flagellin, but not elf peptide, also exhibited reduced stomatal closure and H(2O(2 generation in ahk5 mutants. SIGNIFICANCE: Our findings identify an integral signalling function for AHK5 that acts to integrate multiple signals via H

  6. The structure of arabidopsis thaliana OST1 provides insights into the kinase regulation mechanism in response to osmotic stress

    KAUST Repository

    Yunta, Cristina

    2011-11-01

    SnRK [SNF1 (sucrose non-fermenting-1)-related protein kinase] 2.6 [open stomata 1 (OST1)] is well characterized at molecular and physiological levels to control stomata closure in response to water-deficit stress. OST1 is a member of a family of 10 protein kinases from Arabidopsis thaliana (SnRK2) that integrates abscisic acid (ABA)-dependent and ABA-independent signals to coordinate the cell response to osmotic stress. A subgroup of protein phosphatases type 2C binds OST1 and keeps the kinase dephosphorylated and inactive. Activation of OST1 relies on the ABA-dependent inhibition of the protein phosphatases type 2C and the subsequent self-phosphorylation of the kinase. The OST1 ABA-independent activation depends on a short sequence motif that is conserved among all the members of the SnRK2 family. However, little is known about the molecular mechanism underlying this regulation. The crystallographic structure of OST1 shows that ABA-independent regulation motif stabilizes the conformation of the kinase catalytically essential α C helix, and it provides the basis of the ABA-independent regulation mechanism for the SnRK2 family of protein kinases. © 2011 Elsevier Ltd. All rights reserved.

  7. Integration of linkage maps for the Amphidiploid Brassica napus and comparative mapping with Arabidopsis and Brassica rapa

    Directory of Open Access Journals (Sweden)

    Delourme Régine

    2011-02-01

    Full Text Available Abstract Background The large number of genetic linkage maps representing Brassica chromosomes constitute a potential platform for studying crop traits and genome evolution within Brassicaceae. However, the alignment of existing maps remains a major challenge. The integration of these genetic maps will enhance genetic resolution, and provide a means to navigate between sequence-tagged loci, and with contiguous genome sequences as these become available. Results We report the first genome-wide integration of Brassica maps based on an automated pipeline which involved collation of genome-wide genotype data for sequence-tagged markers scored on three extensively used amphidiploid Brassica napus (2n = 38 populations. Representative markers were selected from consolidated maps for each population, and skeleton bin maps were generated. The skeleton maps for the three populations were then combined to generate an integrated map for each LG, comparing two different approaches, one encapsulated in JoinMap and the other in MergeMap. The BnaWAIT_01_2010a integrated genetic map was generated using JoinMap, and includes 5,162 genetic markers mapped onto 2,196 loci, with a total genetic length of 1,792 cM. The map density of one locus every 0.82 cM, corresponding to 515 Kbp, increases by at least three-fold the locus and marker density within the original maps. Within the B. napus integrated map we identified 103 conserved collinearity blocks relative to Arabidopsis, including five previously unreported blocks. The BnaWAIT_01_2010a map was used to investigate the integrity and conservation of order proposed for genome sequence scaffolds generated from the constituent A genome of Brassica rapa. Conclusions Our results provide a comprehensive genetic integration of the B. napus genome from a range of sources, which we anticipate will provide valuable information for rapeseed and Canola research.

  8. Lectin receptor kinases participate in protein-protein interactions to mediate plasma membrane-cell wall adhesions in Arabidopsis.

    Science.gov (United States)

    Gouget, Anne; Senchou, Virginie; Govers, Francine; Sanson, Arnaud; Barre, Annick; Rougé, Pierre; Pont-Lezica, Rafael; Canut, Hervé

    2006-01-01

    Interactions between plant cell walls and plasma membranes are essential for cells to function properly, but the molecules that mediate the structural continuity between wall and membrane are unknown. Some of these interactions, which are visualized upon tissue plasmolysis in Arabidopsis (Arabidopsis thaliana), are disrupted by the RGD (arginine-glycine-aspartic acid) tripeptide sequence, a characteristic cell adhesion motif in mammals. In planta induced-O (IPI-O) is an RGD-containing protein from the plant pathogen Phytophthora infestans that can disrupt cell wall-plasma membrane adhesions through its RGD motif. To identify peptide sequences that specifically bind the RGD motif of the IPI-O protein and potentially play a role in receptor recognition, we screened a heptamer peptide library displayed in a filamentous phage and selected two peptides acting as inhibitors of the plasma membrane RGD-binding activity of Arabidopsis. Moreover, the two peptides also disrupted cell wall-plasma membrane adhesions. Sequence comparison of the RGD-binding peptides with the Arabidopsis proteome revealed 12 proteins containing amino acid sequences in their extracellular domains common with the two RGD-binding peptides. Eight belong to the receptor-like kinase family, four of which have a lectin-like extracellular domain. The lectin domain of one of these, At5g60300, recognized the RGD motif both in peptides and proteins. These results imply that lectin receptor kinases are involved in protein-protein interactions with RGD-containing proteins as potential ligands, and play a structural and signaling role at the plant cell surfaces.

  9. Lectin Receptor Kinases Participate in Protein-Protein Interactions to Mediate Plasma Membrane-Cell Wall Adhesions in Arabidopsis1

    Science.gov (United States)

    Gouget, Anne; Senchou, Virginie; Govers, Francine; Sanson, Arnaud; Barre, Annick; Rougé, Pierre; Pont-Lezica, Rafael; Canut, Hervé

    2006-01-01

    Interactions between plant cell walls and plasma membranes are essential for cells to function properly, but the molecules that mediate the structural continuity between wall and membrane are unknown. Some of these interactions, which are visualized upon tissue plasmolysis in Arabidopsis (Arabidopsis thaliana), are disrupted by the RGD (arginine-glycine-aspartic acid) tripeptide sequence, a characteristic cell adhesion motif in mammals. In planta induced-O (IPI-O) is an RGD-containing protein from the plant pathogen Phytophthora infestans that can disrupt cell wall-plasma membrane adhesions through its RGD motif. To identify peptide sequences that specifically bind the RGD motif of the IPI-O protein and potentially play a role in receptor recognition, we screened a heptamer peptide library displayed in a filamentous phage and selected two peptides acting as inhibitors of the plasma membrane RGD-binding activity of Arabidopsis. Moreover, the two peptides also disrupted cell wall-plasma membrane adhesions. Sequence comparison of the RGD-binding peptides with the Arabidopsis proteome revealed 12 proteins containing amino acid sequences in their extracellular domains common with the two RGD-binding peptides. Eight belong to the receptor-like kinase family, four of which have a lectin-like extracellular domain. The lectin domain of one of these, At5g60300, recognized the RGD motif both in peptides and proteins. These results imply that lectin receptor kinases are involved in protein-protein interactions with RGD-containing proteins as potential ligands, and play a structural and signaling role at the plant cell surfaces. PMID:16361528

  10. Involvement of Phosphatidylinositol 3-kinase in the regulation of proline catabolism in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Anne-Sophie eLeprince

    2015-01-01

    Full Text Available Plant adaptation to abiotic stresses such as drought and salinity involves complex regulatory processes. Deciphering the signalling components that are involved in stress signal transduction and cellular responses is of importance to understand how plants cope with salt stress. Accumulation of osmolytes such as proline is considered to participate in the osmotic adjustment of plant cells to salinity. Proline accumulation results from a tight regulation between its biosynthesis and catabolism. Lipid signal components such as phospholipases C and D have previously been shown to be involved in the regulation of proline metabolism in Arabidopsis thaliana. In this study, we demonstrate that proline metabolism is also regulated by class-III Phosphatidylinositol 3-kinase (PI3K, VPS34, which catalyses the formation of phosphatidylinositol 3-phosphate (PI3P from phosphatidylinositol. Using pharmacological and biochemical approaches, we show that the PI3K inhibitor, LY294002, affects PI3P levels in vivo and that it triggers a decrease in proline accumulation in response to salt treatment of A. thaliana seedlings. The lower proline accumulation is correlated with a lower transcript level of Pyrroline-5-carboxylate synthetase 1 biosynthetic enzyme and higher transcript and protein levels of Proline dehydrogenase 1 (ProDH1, a key-enzyme in proline catabolism. We also found that the ProDH1 expression is induced in a pi3k-hemizygous mutant, further demonstrating that PI3K is involved in the regulation of proline catabolism through transcriptional regulation of ProDH1. A broader metabolomic analysis indicates that LY294002 also reduced other metabolites, such as hydrophobic and aromatic amino acids and sugars like raffinose.

  11. A mitotically inheritable unit containing a MAP kinase module.

    Science.gov (United States)

    Kicka, Sébastien; Bonnet, Crystel; Sobering, Andrew K; Ganesan, Latha P; Silar, Philippe

    2006-09-05

    Prions are novel kinds of hereditary units, relying solely on proteins, that are infectious and inherited in a non-Mendelian fashion. To date, they are either based on autocatalytic modification of a 3D conformation or on autocatalytic cleavage. Here, we provide further evidence that in the filamentous fungus Podospora anserina, a MAP kinase cascade is probably able to self-activate and generate C, a hereditary unit that bears many similarities to prions and triggers cell degeneration. We show that in addition to the MAPKKK gene, both the MAPKK and MAPK genes are necessary for the propagation of C, and that overexpression of MAPK as that of MAPKKK facilitates the appearance of C. We also show that a correlation exists between the presence of C and localization of the MAPK inside nuclei. These data emphasize the resemblance between prions and a self-positively regulated cascade in terms of their transmission. This thus further expands the concept of protein-base inheritance to regulatory networks that have the ability to self-activate.

  12. Cyclin-dependent kinase-activating kinases CDKD;1 and CDKD;3 are essential for preserving mitotic activity in Arabidopsis thaliana.

    Science.gov (United States)

    Takatsuka, Hirotomo; Umeda-Hara, Chikage; Umeda, Masaaki

    2015-06-01

    For the full activation of cyclin-dependent kinases (CDKs), not only cyclin binding but also CDK phosphorylation is required. This activating phosphorylation is mediated by CDK-activating kinases (CAKs). Arabidopsis has four genes showing similarity to vertebrate-type CAKs, three CDKDs (CDKD;1-CDKD;3) and one CDKF (CDKF;1). We previously found that the cdkf;1 mutant is defective in post-embryonic development, even though the kinase activities of core CDKs remain unchanged relative to the wild type. This raised a question about the involvement of CDKDs in CDK activation in planta. Here we report that the cdkd;1 cdkd;3 double mutant showed gametophytic lethality. Most cdkd;1-1 cdkd;3-1 pollen grains were defective in pollen mitosis I and II, producing one-cell or two-cell pollen grains that lacked fertilization ability. We also found that the double knock-out of CDKD;1 and CDKD;3 caused arrest and/or delay in the progression of female gametogenesis at multiple steps. Our genetic analyses revealed that the functions of CDKF;1 and CDKD;1 or CDKD;3 do not overlap, either during gametophyte and embryo development or in post-embryonic development. Consistent with these analyses, CDKF;1 expression in the cdkd;1-1 cdkd;3-1 mutant could not rescue the gametophytic lethality. These results suggest that, in Arabidopsis, CDKD;1 and CDKD;3 function as CAKs controlling mitosis, whereas CDKF;1 plays a distinct role, mainly in post-embryonic development. We propose that CDKD;1 and CDKD;3 phosphorylate and activate all core CDKs, CDKA, CDKB1 and CDKB2, thereby governing cell cycle progression throughout plant development.

  13. Regulation of MAP kinase-dependent apoptotic pathway: implication of reactive oxygen and nitrogen species.

    Science.gov (United States)

    Sumbayev, Vadim V; Yasinska, Inna M

    2005-04-15

    Mitogen-activated protein (MAP) kinase signaling cascades are multi-functional signaling networks that influence cell growth, differentiation, apoptosis, and cellular responses to stress. Apoptosis signal-regulating kinase 1 (ASK1) is a MAP kinase kinase kinase that triggers apoptogenic kinase cascade leading to the phosphorylation/activation of c-Jun N-terminal kinases and p38-MAP kinase, which are responsible for inducing apoptotic cell death. This pathway plays a pivotal role in transduction of signals from different apoptotic stimuli. In the present review, we summarized the recent evidence concerning MAP kinase-dependent apoptotic pathway and its regulation in the mammalian cells and organism in vivo. We have shown that the key messengers of regulation of this pathway are the reactive oxygen and nitrogen species. The role of protein oxidation and S-nitrosation in induction of apoptotic cell death via ASK1 is discussed. Also we have outlined other recently discovered signal transduction processes involved in the regulation of ASK1 activity and downstream pathway.

  14. Diverse Transcriptional Programs Associated with Environmental Stress and Hormones in the Arabidopsis Receptor-Like Kinase Gene Family

    Institute of Scientific and Technical Information of China (English)

    Lee Chae; Sylvia Sudat; Sandrine Dudoit; Tong Zhu; Sheng Luan

    2009-01-01

    The genome of Arabidopsis thaliana encodes more than 600 receptor-like kinase (RLK) genes, by far the dominant class of receptors found in land plants. Although similar to the mammalian receptor tyrosine kinases, plant RLKs are serine/threonine kinases that represent a novel signaling innovation unique to plants and, consequently, an excellent opportunity to understand how extracellular signaling evolved and functions in plants as opposed to animals. RLKs are predicted to be major components of the signaling pathways that allow plants to respond to environmental and developmental conditions. However, breakthroughs in identifying these processes have been limited to only a handful of individual RLKs. Here, we used a Syngenta custom Arabidopsis GeneChip array to compile a detailed profile of the transcriptional activity of 604 receptor-like kinase genes after exposure to a cross-section of known signaling factors in plants,including abiotic stresses, biotic stresses, and hormones. In the 68 experiments comprising the study, we found that 582 of the 604 RLK genes displayed a two-fold or greater change in expression to at least one of 12 types of treatments, thereby providing a large body of experimental evidence for targeted functional screens of individual RLK genes. We investigated whether particular subfamilies of RLK genes are responsive to specific types of signals and found that each subfamily displayed broad ranges of expression, as opposed to being targeted towards particular signal classes. Finally, by analyzing the divergence of sequence and gene expression among the RLK subfamilies, we present evidence as to the functional basis for the expansion of the RLKs and how this expansion may have affected conservation and divergences in their function. Taken as a whole, our study represents a preliminary, working model of processes and interactions in which the members of the RLK gene family may be involved, where such information has remained elusive for so many

  15. Overproduction of the membrane-bound receptor-like protein kinase 1, RPK1, enhances abiotic stress tolerance in Arabidopsis.

    Science.gov (United States)

    Osakabe, Yuriko; Mizuno, Shinji; Tanaka, Hidenori; Maruyama, Kyonoshin; Osakabe, Keishi; Todaka, Daisuke; Fujita, Yasunari; Kobayashi, Masatomo; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2010-03-19

    RPK1 (receptor-like protein kinase 1) localizes to the plasma membrane and functions as a regulator of abscisic acid (ABA) signaling in Arabidopsis. In our current study, we investigated the effect of RPK1 disruption and overproduction upon plant responses to drought stress. Transgenic Arabidopsis overexpressing the RPK1 protein showed increased ABA sensitivity in their root growth and stomatal closure and also displayed less transpirational water loss. In contrast, a mutant lacking RPK1 function, rpk1-1, was found to be resistant to ABA during these processes and showed increased water loss. RPK1 overproduction in these transgenic plants thus increased their tolerance to drought stress. We performed microarray analysis of RPK1 transgenic plants and observed enhanced expression of several stress-responsive genes, such as Cor15a, Cor15b, and rd29A, in addition to H(2)O(2)-responsive genes. Consistently, the expression levels of ABA/stress-responsive genes in rpk1-1 had decreased compared with wild type. The results suggest that the overproduction of RPK1 enhances both the ABA and drought stress signaling pathways. Furthermore, the leaves of the rpk1-1 plants exhibit higher sensitivity to oxidative stress upon ABA-pretreatment, whereas transgenic plants overproducing RPK1 manifest increased tolerance to this stress. Our current data suggest therefore that RPK1 overproduction controls reactive oxygen species homeostasis and enhances both water and oxidative stress tolerance in Arabidopsis.

  16. Control of signaling in a MAP-kinase pathway by an RNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Susanne Prinz

    Full Text Available Signaling-protein mRNAs tend to have long untranslated regions (UTRs containing binding sites for RNA-binding proteins regulating gene expression. Here we show that a PUF-family RNA-binding protein, Mpt5, represses the yeast MAP-kinase pathway controlling differentiation to the filamentous form. Mpt5 represses the protein levels of two pathway components, the Ste7 MAP-kinase kinase and the Tec1 transcriptional activator, and negatively regulates the kinase activity of the Kss1 MAP kinase. Moreover, Mpt5 specifically inhibits the output of the pathway in the absence of stimuli, and thereby prevents inappropriate cell differentiation. The results provide an example of what may be a genome-scale level of regulation at the interface of signaling networks and protein-RNA binding networks.

  17. Involvement of the MAP kinase cascade in Xenopus mesoderm induction.

    OpenAIRE

    Gotoh, Y.; Masuyama, N; Suzuki, A.; Ueno, N; Nishida, E

    1995-01-01

    Mitogen-activated protein kinase (MAPK) is activated by MAPK kinase (MAPKK) in a variety of signaling pathways. This kinase cascade has been shown to function in cell proliferation and differentiation, but its role in early vertebrate development remains to be investigated. During early vertebrate embryogenesis, the induction and patterning of mesoderm are thought to be determined by signals from intercellular factors such as members of the fibroblast growth factor (FGF) family and members of...

  18. Crystal Structure of the MAP3K TAO2 Kinase Domain Bound by an Inhibitor Staurosporine

    Institute of Scientific and Technical Information of China (English)

    Tian-Jun ZHOU; Li-Guang SUN; Yan GAO; Elizabeth J. GOLDSMITH

    2006-01-01

    Mitogen-activated protein kinase (MAPK) signal transduction pathways are ubiquitous in eukaryotic cells, which transfer signals from the cell surface to the nucleus, controlling multiple cellular programs. MAPKs are activated by MAPK kinases [MAP2Ks or MAP/extracellular signal-regulated kinase (ERK) kinases (MEK)], which in turn are activated by MAPK kinase kinases (MAP3Ks). TAO2 is a MAP3K level kinase that activates the MAP2Ks MEK3 and MEK6 to activate p38 MAPKs. Because p38 MAPKs are key regulators of expression of inflammatory cytokines, they appear to be involved in human diseases such as asthma and autoimmunity. As an upstream activator of p38s, TAO2 represents a potential drug target. Here we report the crystal structure of active TAO2 kinase domain in complex with staurosporine, a broadrange protein kinase inhibitor that inhibits TAO2 with an IC50 of 3 μM. The structure reveals that staurosporine occupies the position where the adenosine of ATP binds in TAO2, and the binding of the inhibitor mimics many features of ATP binding. Both polar and nonpolar interactions contribute to the enzyme-inhibitor recognition. Staurosporine induces conformational changes in TAO2 residues that surround the inhibitor molecule, but causes very limited global changes in the kinase. The structure provides atomic details for TAO2-staurosporine interactions, and explains the relatively low potency of staurosporine against TAO2. The structure presented here should aid in the design of inhibitors specific to TAO2 and related kinases.

  19. Cloning and Characterization of Two NAD Kinases from Arabidopsis. Identification of a Calmodulin Binding Isoform1[w

    Science.gov (United States)

    Turner, William L.; Waller, Jeffrey C.; Vanderbeld, Barb; Snedden, Wayne A.

    2004-01-01

    NAD kinase (NADK; ATP:NAD 2′-phosphotransferase, EC 2.7.1.23), an enzyme found in both prokaryotes and eukaryotes, generates the important pyridine nucleotide NADP from substrates ATP and NAD. The role of NADKs in plants is poorly understood, and cDNAs encoding plant NADKs have not previously been described to our knowledge. We have cloned two cDNAs from Arabidopsis predicted to encode NADK isoforms, designated NADK1 and NADK2, respectively. Expressed as recombinant proteins in bacteria, both NADK1 and NADK2 were catalytically active, thereby confirming their identity as NADKs. Transcripts for both isoforms were detected in all tissues examined and throughout development. Although the predicted catalytic regions for NADK1 and NADK2 show sequence similarity to NADKs from other organisms, NADK2 possesses a large N-terminal extension that appears to be unique to plants. Using recombinant glutathione-S-transferase fusion proteins and calmodulin (CaM)-affinity chromatography, we delineated a Ca2+-dependent CaM-binding domain to a 45-residue region within the N-terminal extension of NADK2. Although recombinant NADK2 was not responsive to CaM in vitro, immunoblot analysis suggests that native NADK2 is a CaM-binding protein. In Arabidopsis crude extracts, CaM-dependent NADK activity was much greater than CaM-independent activity throughout development, particularly in young seedlings. A native CaM-dependent NADK was partially purified from Arabidopsis seedlings (KmNAD = 0.20 mM, KmMg2+−ATP = 0.17 mM). The enzyme was fully activated by conserved CaM (S0.5 = 2.2 nm) in the presence of calcium but displayed differential responsiveness to eight CaM-like Arabidopsis proteins. Possible roles for NADKs in plants are discussed in light of our observations. PMID:15247403

  20. Arabidopsis lectin receptor kinases LecRK-IX.1 and LecRK-IX.2 are functional analogs in regulating phytophthora resistance and plant cell death

    NARCIS (Netherlands)

    Wang, Yan; Cordewener, Jan H G; America, Antoine H P; Shan, Weixing; Bouwmeester, Klaas; Govers, Francine

    2015-01-01

    L-type lectin receptor kinases (LecRK) are potential immune receptors. Here, we characterized two closely-related Arabidopsis LecRK, LecRK-IX.1 and LecRK-IX.2, of which T-DNA insertion mutants showed compromised resistance to Phytophthora brassicae and Phytophthora capsici, with double mutants showi

  1. Roles of MAP kinase signaling pathway in oocyte meiosis

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Mitogen-activated protein kinase (MAPK) is a family of Ser/Thr protein kinases expressed widely in eukaryotic cells. MAPK is activated by a cascade of protein kinase phosphorylation and plays pivotal roles in regulating meiosis process in oocytes. As an important physical substrate of MAPK, p90rsk mediates numerous MAPK functions. MAPK was activated at G2/M transition during meiosis. Its activity reached the peak at MⅠ stage and maintained at this level until the time before the pronuclear formation after fertilization. There is complex interplay between MAPK and MPF in the meiosis regulation. Furthermore, other intracellular signal transducers, such as cAMP, protein kinase C and protein phosphotase, ect., also regulated the activity of MAPK at different stages during meiosis in oocytes. In the present article, the roles of MAPK signaling pathway in oocyte meiosis are reviewed and discussed.

  2. Structure-function analysis of STRUBBELIG, an Arabidopsis atypical receptor-like kinase involved in tissue morphogenesis.

    Directory of Open Access Journals (Sweden)

    Prasad Vaddepalli

    Full Text Available Tissue morphogenesis in plants requires the coordination of cellular behavior across clonally distinct histogenic layers. The underlying signaling mechanisms are presently being unraveled and are known to include the cell surface leucine-rich repeat receptor-like kinase STRUBBELIG in Arabidopsis. To understand better its mode of action an extensive structure-function analysis of STRUBBELIG was performed. The phenotypes of 20 EMS and T-DNA-induced strubbelig alleles were assessed and homology modeling was applied to rationalize their possible effects on STRUBBELIG protein structure. The analysis was complemented by phenotypic, cell biological, and pharmacological investigations of a strubbelig null allele carrying genomic rescue constructs encoding fusions between various mutated STRUBBELIG proteins and GFP. The results indicate that STRUBBELIG accepts quite some sequence variation, reveal the biological importance for the STRUBBELIG N-capping domain, and reinforce the notion that kinase activity is not essential for its function in vivo. Furthermore, individual protein domains of STRUBBELIG cannot be related to specific STRUBBELIG-dependent biological processes suggesting that process specificity is mediated by factors acting together with or downstream of STRUBBELIG. In addition, the evidence indicates that biogenesis of a functional STRUBBELIG receptor is subject to endoplasmic reticulum-mediated quality control, and that an MG132-sensitive process regulates its stability. Finally, STRUBBELIG and the receptor-like kinase gene ERECTA interact synergistically in the control of internode length. The data provide genetic and molecular insight into how STRUBBELIG regulates intercellular communication in tissue morphogenesis.

  3. Arabidopsis decuple mutant reveals the importance of SnRK2 kinases in osmotic stress responses in vivo

    KAUST Repository

    Fujii, Hiroaki

    2011-01-10

    Osmotic stress associated with drought or salinity is a major factor that limits plant productivity. Protein kinases in the SNF1-related protein kinase 2 (SnRK2) family are activated by osmotic stress, suggesting that the kinases are involved in osmotic stress signaling. However, due to functional redundancy, their contribution to osmotic stress responses remained unclear. In this report, we constructed an Arabidopsis line carrying mutations in all 10 members of the SnRK2 family. The decuple mutant snrk2.1/2/3/4/5/6/7/8/9/10 grew poorly under hyperosmotic stress conditions but was similar to the wild type in culture media in the absence of osmotic stress. The mutant was also defective in gene regulation and the accumulation of abscisic acid (ABA), proline, and inositol 1,4,5-trisphosphate under osmotic stress. In addition, analysis of mutants defective in the ABA-activated SnRK2s (snrk2.2/3/6) and mutants defective in the rest of the SnRK2s (snrk2.1/4/5/7/8/9/10) revealed that SnRK2s are a merging point of ABA-dependent and -independent pathways for osmotic stress responses. These results demonstrate critical functions of the SnRK2s in mediating osmotic stress signaling and tolerance.

  4. D6PK AGCVIII Kinases Are Required for Auxin Transport and Phototropic Hypocotyl Bending in Arabidopsis[C][W

    Science.gov (United States)

    Willige, Björn C.; Ahlers, Siv; Zourelidou, Melina; Barbosa, Inês C.R.; Demarsy, Emilie; Trevisan, Martine; Davis, Philip A.; Roelfsema, M. Rob G.; Hangarter, Roger; Fankhauser, Christian; Schwechheimer, Claus

    2013-01-01

    Phototropic hypocotyl bending in response to blue light excitation is an important adaptive process that helps plants to optimize their exposure to light. In Arabidopsis thaliana, phototropic hypocotyl bending is initiated by the blue light receptors and protein kinases phototropin1 (phot1) and phot2. Phototropic responses also require auxin transport and were shown to be partially compromised in mutants of the PIN-FORMED (PIN) auxin efflux facilitators. We previously described the D6 PROTEIN KINASE (D6PK) subfamily of AGCVIII kinases, which we proposed to directly regulate PIN-mediated auxin transport. Here, we show that phototropic hypocotyl bending is strongly dependent on the activity of D6PKs and the PIN proteins PIN3, PIN4, and PIN7. While early blue light and phot-dependent signaling events are not affected by the loss of D6PKs, we detect a gradual loss of PIN3 phosphorylation in d6pk mutants of increasing complexity that is most severe in the d6pk d6pkl1 d6pkl2 d6pkl3 quadruple mutant. This is accompanied by a reduction of basipetal auxin transport in the hypocotyls of d6pk as well as in pin mutants. Based on our data, we propose that D6PK-dependent PIN regulation promotes auxin transport and that auxin transport in the hypocotyl is a prerequisite for phot1-dependent hypocotyl bending. PMID:23709629

  5. The Carboxy-terminus of BAK1 regulates kinase activity and is required for normal growth of Arabidopsis

    Directory of Open Access Journals (Sweden)

    Man-Ho eOh

    2014-02-01

    Full Text Available Binding of brassinolide to the BRASSINOSTEROID-INSENSTIVE 1 (BRI1 receptor kinase promotes interaction with its co-receptor, BRI1-ASSOCIATED RECEPTOR KINASE 1 (BAK1. Juxtaposition of the kinase domains that occurs then allows reciprocal transphosphorylation and activation of both kinases, but details of that process are not entirely clear. In the present study we show that the carboxy (C - terminal polypeptide of BAK1 may play a role. First, we demonstrate that the C-terminal domain is a strong inhibitor of the transphosphorylation activity of the recombinant BAK1 cytoplasmic domain protein. However, recombinant BAK1 lacking the C-terminal domain is unable to transactivate the peptide kinase activity of BRI1 in vitro. Thus, the C-terminal domain may play both a positive and negative role. Interestingly, a synthetic peptide corresponding to the full C-terminal domain (residues 576 to 615 of BAK1 interacted with recombinant BRI1 in vitro, and that interaction was enhanced by phosphorylation at the Tyr-610 site. Expression of a BAK1 C-terminal domain truncation (designated BAK1-ΔCT-Flag in transgenic Arabidopsis plants lacking endogenous bak1 and its functional paralog, bkk1, produced plants that were wild type in appearance but much smaller than plants expressing full-length BAK1-Flag. The reduction in growth may be attributed to a partial inhibition of BR signaling in vivo as reflected in root growth assays but other factors are likely involved as well. Our working model is that in vivo, the inhibitory action of the C-terminal domain of BAK1 is relieved by binding to BRI1. However, that interaction is not essential for BR signaling, but other aspects of cellular signaling are impacted when the C-terminal domain is truncated and result in inhibition of growth. These results increase the molecular understanding of the C-terminal domain of BAK1 as a regulator of kinase activity that may serve as a model for other receptor kinases.

  6. The impact of PEPC phosphorylation on growth and development of Arabidopsis thaliana: molecular and physiological characterization of PEPC kinase mutants.

    Science.gov (United States)

    Meimoun, Patrice; Gousset-Dupont, Aurélie; Lebouteiller, Bénédicte; Ambard-Bretteville, Françoise; Besin, Evelyne; Lelarge, Caroline; Mauve, Caroline; Hodges, Michael; Vidal, Jean

    2009-05-19

    Two phosphoenolpyruvate carboxylase (PEPC) kinase genes (PPCk1 and PPCk2) are present in the Arabidopsis genome; only PPCk1 is expressed in rosette leaves. Homozygous lines of two independent PPCk1 T-DNA-insertional mutants showed very little (dln1), or no (csi8) light-induced PEPC phosphorylation and a clear retard in growth under our greenhouse conditions. A mass-spectrometry-based analysis revealed significant changes in metabolite profiles. However, the anaplerotic pathway initiated by PEPC was only moderately altered. These data establish the PPCk1 gene product as responsible for leaf PEPC phosphorylation in planta and show that the absence of PEPC phosphorylation has pleiotropic consequences on plant metabolism.

  7. The Arabidopsis lectin receptor kinase LecRK-I.9 enhances resistance to Phytophthora infestans in Solanaceous plants.

    Science.gov (United States)

    Bouwmeester, Klaas; Han, Miao; Blanco-Portales, Rosario; Song, Wei; Weide, Rob; Guo, Li-Yun; van der Vossen, Edwin A G; Govers, Francine

    2014-01-01

    Late blight caused by the plant pathogenic oomycete Phytophthora infestans is known as one of the most destructive potato diseases. Plant breeders tend to employ NB-LRR-based resistance for introducing genetically controlled late blight resistance in their breeding lines. However, P. infestans is able to rapidly escape this type of resistance, and hence, NB-LRR-based resistance in potato cultivars is often not durable. Previously, we identified a novel type of Phytophthora resistance in Arabidopsis. This resistance is mediated by the cell surface receptor LecRK-I.9, which belongs to the family of L-type lectin receptor kinases. In this study, we report that expression of the Arabidopsis LecRK-I.9 gene in potato and Nicotiana benthamiana results in significantly enhanced late blight resistance. Transcriptional profiling showed strong reduction in salicylic acid (SA)-mediated defence gene expression in LecRK-I.9 transgenic potato lines (TPLs). In contrast, transcripts of two protease inhibitor genes accumulated to extreme high levels, suggesting that LecRK-I.9-mediated late blight resistance is relying on a defence response that includes activation of protease inhibitors. These results demonstrate that the functionality of LecRK-I.9 in Phytophthora resistance is maintained after interfamily transfer to potato and N. benthamiana and suggest that this novel type of LecRK-based resistance can be exploited in breeding strategies to improve durable late blight resistance in Solanaceous crops.

  8. Characterization of temperature-sensitive mutants reveals a role for receptor-like kinase SCRAMBLED/STRUBBELIG in coordinating cell proliferation and differentiation during Arabidopsis leaf development.

    Science.gov (United States)

    Lin, Lin; Zhong, Si-Hui; Cui, Xiao-Feng; Li, Jianming; He, Zu-Hua

    2012-12-01

    The balance between cell proliferation and cell differentiation is essential for leaf patterning. However, identification of the factors coordinating leaf patterning and cell growth behavior is challenging. Here, we characterized a temperature-sensitive Arabidopsis mutant with leaf blade and venation defects. We mapped the mutation to the sub-2 allele of the SCRAMBLED/STRUBBELIG (SCM/SUB) receptor-like kinase gene whose functions in leaf development have not been demonstrated. The sub-2 mutant displayed impaired blade development, asymmetric leaf shape and altered venation patterning under high ambient temperature (30°C), but these defects were less pronounced at normal growth temperature (22°C). Loss of SCM/SUB function results in reduced cell proliferation and abnormal cell expansion, as well as altered auxin patterning. SCM/SUB is initially expressed throughout leaf primordia and becomes restricted to the vascular cells, coinciding with its roles in early leaf patterning and venation formation. Furthermore, constitutive expression of the SCM/SUB gene also restricts organ growth by inhibiting the transition from cell proliferation to expansion. We propose the existence of a SCM/SUB-mediated developmental stage-specific signal for leaf patterning, and highlight the importance of the balance between cell proliferation and differentiation for leaf morphogenesis.

  9. Arabidopsis cysteine-rich receptor-like kinase 45 functions in the responses to abscisic acid and abiotic stresses

    KAUST Repository

    Zhang, Xiujuan

    2013-06-01

    The phytohormone abscisic acid (ABA) regulates seed germination, plant growth and development, and response to abiotic stresses such as drought and salt stresses. Receptor-like kinases are well known signaling components that mediate plant responses to developmental and environmental stimuli. Here, we characterized the biological function of an ABA and stress-inducible cysteine-rich receptor-like protein kinase, CRK45, in ABA signaling in Arabidopsis thaliana. The crk45 mutant was less sensitive to ABA than the wild type during seed germination and early seedling development, whereas CRK45 overexpression plants were more sensitive to ABA compared to the wild type. Furthermore, overexpression of CRK45 led to hypersensitivity to salt and glucose inhibition of seed germination, whereas the crk45 mutant showed the opposite phenotypes. In addition, CRK45 overexpression plants had enhanced tolerance to drought. Gene expression analyses revealed that the expression of representative stress-responsive genes was significantly enhanced in CRK45 overexpression plants in response to salt stress. ABA biosynthetic genes such as NCED3,. 22NCED3, 9-Cis-Epoxycarotenoid Dioxygenase 3.NCED5,. 33NCED5, 9-Cis-Epoxycarotenoid Dioxygenase 5.ABA2,. 44ABA2, Abscisic Acid Deficient 2. and AAO355AAO3, Abscisic Aldehyde Oxidase 3. were also constitutively elevated in the CRK45 overexpression plants. We concluded that CRK45 plays an important role in ABA signaling that regulates Arabidopsis seeds germination, early seedling development and abiotic stresses response, by positively regulating ABA responses in these processes. © 2013 Elsevier Masson SAS.

  10. SENESCENCE-SUPPRESSED PROTEIN PHOSPHATASE Directly Interacts with the Cytoplasmic Domain of SENESCENCE-ASSOCIATED RECEPTOR-LIKE KINASE and Negatively Regulates Leaf Senescence in Arabidopsis.

    Science.gov (United States)

    Xiao, Dong; Cui, Yanjiao; Xu, Fan; Xu, Xinxin; Gao, Guanxiao; Wang, Yaxin; Guo, Zhaoxia; Wang, Dan; Wang, Ning Ning

    2015-10-01

    Reversible protein phosphorylation mediated by protein kinases and phosphatases plays an important role in the regulation of leaf senescence. We previously reported that the leucine-rich repeat receptor-like kinase SENESCENCE-ASSOCIATED RECEPTOR-LIKE KINASE (AtSARK) positively regulates leaf senescence in Arabidopsis (Arabidopsis thaliana). Here, we report the involvement of a protein serine/threonine phosphatase 2C-type protein phosphatase, SENESCENCE-SUPPRESSED PROTEIN PHOSPHATASE (SSPP), in the negative regulation of Arabidopsis leaf senescence. SSPP transcript levels decreased greatly during both natural senescence and SARK-induced precocious senescence. Overexpression of SSPP significantly delayed leaf senescence in Arabidopsis. Protein pull-down and bimolecular fluorescence complementation assays demonstrated that the cytosol-localized SSPP could interact with the cytoplasmic domain of the plasma membrane-localized AtSARK. In vitro assays showed that SSPP has protein phosphatase function and can dephosphorylate the cytosolic domain of AtSARK. Consistent with these observations, overexpression of SSPP effectively rescued AtSARK-induced precocious leaf senescence and changes in hormonal responses. All our results suggested that SSPP functions in sustaining proper leaf longevity and preventing early senescence by suppressing or perturbing SARK-mediated senescence signal transduction.

  11. A protein–protein interaction network linking the energy-sensor kinase SnRK1 to multiple signaling pathways in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Madlen Nietzsche

    2016-04-01

    Full Text Available In plants, the sucrose non-fermenting (SNF1-related protein kinase 1 (SnRK1 represents a central integrator of low energy signaling and acclimation towards many environmental stress responses. Although SnRK1 acts as a convergent point for many different environmental and metabolic signals to control growth and development, it is currently unknown how these many different signals could be translated into a cell-type or stimulus specific response since many components of SnRK1-regulated signaling pathways remain unidentified. Recently, we have demonstrated that proteins containing a domain of unknown function (DUF 581 interact with the catalytic α subunits of SnRK1 (AKIN10/11 from Arabidopsis thaliana and could potentially act as mediators conferring tissue- and stimulus-type specific differences in SnRK1 regulation. To further extend the SnRK1 signaling network in plants, we systematically screened for novel DUF581 interaction partners using the yeast two-hybrid system. A deep and exhaustive screening identified 17 interacting partners for 10 of the DUF581 proteins tested. Many of these novel interaction partners are implicated in cellular processes previously associated with SnRK1 signaling. Furthermore, we mined publicly available interaction data to identify additional DUF581 interacting proteins. A protein–protein interaction network resulting from our studies suggests connections between SnRK1 signaling and other central signaling pathways involved in growth regulation and environmental responses. These include TOR and MAP-kinase signaling as well as hormonal pathways. The resulting protein–protein interaction network promises to be effective in generating hypotheses to study the precise mechanisms SnRK1 signaling on a functional level.

  12. Fine mapping of an Arabidopsis thaliana male sterile mutant EC2-157

    Institute of Scientific and Technical Information of China (English)

    LIU Huijuan; ZHANG Zaibao; LI Hui; GAO Jufang; YANG Zhongnan

    2006-01-01

    An Arabidopsis thaliana male sterile mutant EC2-157 has been isolated using an EMS mutagenesis strategy.Genetic analysis indicated that it was controlled by a single recessive gene called ms157.No pollen grains have been observed in mutant anthers.ms157 Has been mapped to a region of 74 kb located in BAC clone T6K22 on chromosome Ⅳ using a map-based cloning strategy.As no male sterile genes have been reported in this region.ms157 could be a novel gene related to fertility.The further molecular cloning and functional analysis on this gene should facilitate our understanding of A.thaliana anther development.

  13. Neurotrophins stimulate phosphorylation of synapsin I by MAP kinase and regulate synapsin I-actin interactions.

    OpenAIRE

    Jovanovic, J. N.; Benfenati, F; Siow, Y L; SIHRA, T. S.; Sanghera, J.S.; Pelech, S L; Greengard, P; Czernik, A J

    1996-01-01

    The ability of neurotrophins to modulate the survival and differentiation of neuronal populations involves the Trk/MAP (mitogen-activated protein kinase) kinase signaling pathway. More recently, neurotrophins have also been shown to regulate synaptic transmission. The synapsins are a family of neuron-specific phosphoproteins that play a role in regulation of neurotransmitter release, in axonal elongation, and in formation and maintenance of synaptic contacts. We report here that synapsin I is...

  14. Regulation of salt and ABA responses by CIPK14, a calcium sensor interacting protein kinase in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Calcium and protein kinase serve as the common mediators to regulate plant responses to multiple stresses including salt and ABA stimulus. Here we reported a novel protein kinase (CIPK14) that regulated the responses to ABA treatment and salt stress in Arabidopsis. CIPK14 transcripts, capable been checked in roots, stems, leaves and flowers, were highly expressed in flowers and roots. CIPK14 was induced by ABA and salt treatments. The disruption of CIPK14 altered the transcriptional pattern of a gene marker line related to ABA and salt responses, and the results suggested that CIPK14 probably was responsible to the control of the salt and ABA responses. Comparing with wild types, the lines inserted with the T-DNA in which CIPK14 gene expression was knocked out were also more sensitive to ABA and salt stimulus, showing low germination rate and the less root elongation. While, when these conditioned seeds were treated with norflurazon, their germination percentages could recover to a certain extent. We also found that exogenous calcium could have an effect on the transcription of CIPK14 under ABA and salt treatments, and it seemed that calcium ion might work upstream CIPK14 to regulate the plant response to ABA and salt response.

  15. Uveitis as a Result of MAP Kinase Pathway Inhibition

    Directory of Open Access Journals (Sweden)

    Lavnish Joshi

    2013-11-01

    Full Text Available We report the case of a patient treated with dabrafenib and trametinib (mitogen-activated protein kinase pathway inhibitors for stage 3b cutaneous melanoma who developed bilateral uveitis. Although there have been reports of ocular side effects with this class of drugs, uveitis has not been previously reported to the best of our knowledge. This case indicates the wide range of side effects that can be seen with the newer targeted biological therapies.

  16. An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis

    OpenAIRE

    Brachmann, Andreas; Schirawski, Jan; Müller, Philip; Kahmann, Regine

    2003-01-01

    In Ustilago maydis, pathogenic development is controlled by a heterodimer of the two homeodomain proteins bW and bE. We have identified by RNA fingerprinting a b-regulated gene, kpp6, which encodes an unusual MAP kinase. Kpp6 is similar to a number of other fungal MAP kinases involved in mating and pathogenicity, but contains an additional N-terminal domain unrelated to other proteins. Transcription of the kpp6 gene yields two transcripts differing in length, but encoding proteins of identica...

  17. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Yuan Tong

    2010-01-01

    Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

  18. The germinal center kinase GCK-1 is a negative regulator of MAP kinase activation and apoptosis in the C. elegans germline.

    Directory of Open Access Journals (Sweden)

    Katherine R Schouest

    Full Text Available The germinal center kinases (GCK constitute a large, highly conserved family of proteins that has been implicated in a wide variety of cellular processes including cell growth and proliferation, polarity, migration, and stress responses. Although diverse, these functions have been attributed to an evolutionarily conserved role for GCKs in the activation of ERK, JNK, and p38 MAP kinase pathways. In addition, multiple GCKs from different species promote apoptotic cell death. In contrast to these paradigms, we found that a C. elegans GCK, GCK-1, functions to inhibit MAP kinase activation and apoptosis in the C. elegans germline. In the absence of GCK-1, a specific MAP kinase isoform is ectopically activated and oocytes undergo abnormal development. Moreover, GCK-1- deficient animals display a significant increase in germ cell death. Our results suggest that individual germinal center kinases act in mechanistically distinct ways and that these functions are likely to depend on organ- and developmental-specific contexts.

  19. Structural Bioinformatics-Based Prediction of Exceptional Selectivity of p38 MAP Kinase Inhibitor PH-797804

    Energy Technology Data Exchange (ETDEWEB)

    Xing, Li; Shieh, Huey S.; Selness, Shaun R.; Devraj, Rajesh V.; Walker, John K.; Devadas, Balekudru; Hope, Heidi R.; Compton, Robert P.; Schindler, John F.; Hirsch, Jeffrey L.; Benson, Alan G.; Kurumbail, Ravi G.; Stegeman, Roderick A.; Williams, Jennifer M.; Broadus, Richard M.; Walden, Zara; Monahan, Joseph B.; Pfizer

    2009-07-24

    PH-797804 is a diarylpyridinone inhibitor of p38{alpha} mitogen-activated protein (MAP) kinase derived from a racemic mixture as the more potent atropisomer (aS), first proposed by molecular modeling and subsequently confirmed by experiments. On the basis of structural comparison with a different biaryl pyrazole template and supported by dozens of high-resolution crystal structures of p38{alpha} inhibitor complexes, PH-797804 is predicted to possess a high level of specificity across the broad human kinase genome. We used a structural bioinformatics approach to identify two selectivity elements encoded by the TXXXG sequence motif on the p38{alpha} kinase hinge: (i) Thr106 that serves as the gatekeeper to the buried hydrophobic pocket occupied by 2,4-difluorophenyl of PH-797804 and (ii) the bidentate hydrogen bonds formed by the pyridinone moiety with the kinase hinge requiring an induced 180{sup o} rotation of the Met109-Gly110 peptide bond. The peptide flip occurs in p38{alpha} kinase due to the critical glycine residue marked by its conformational flexibility. Kinome-wide sequence mining revealed rare presentation of the selectivity motif. Corroboratively, PH-797804 exhibited exceptionally high specificity against MAP kinases and the related kinases. No cross-reactivity was observed in large panels of kinase screens (selectivity ratio of >500-fold). In cellular assays, PH-797804 demonstrated superior potency and selectivity consistent with the biochemical measurements. PH-797804 has met safety criteria in human phase I studies and is under clinical development for several inflammatory conditions. Understanding the rationale for selectivity at the molecular level helps elucidate the biological function and design of specific p38{alpha} kinase inhibitors.

  20. Involvement of PI3 kinase and MAP kinase in IGF-I and insulin-induced ovarian steroidogenesis in common carp Cyprinus carpio.

    Science.gov (United States)

    Paul, Sudipta; Pramanick, Kousik; Kundu, Sourav; Roy Moulik, Sujata; Pal, Puja; Mukherjee, Dilip

    2013-01-15

    Previously, we observed that in vitro steroidogenesis in intact ovarian follicles of common carp Cyprinus carpio can alone be induced by recombinant human insulin-like growth factor (IGF-I) and bovine insulin (b-insulin) and this induction was gonadotropin-independent. To investigate early signal transduction components involved in this process, the possible role of phosphatidylinositol 3-kinase (PI3 kinase) during ovarian steroidogenesis was examined. IGF-I and b-insulin induced testosterone and 17β-estradiol production in carp ovarian theca and granulosa cells in short-term coincubation and this induction was significantly inhibited by Wortmannin and LY294002, two mechanistically different specific inhibitors of PI3 kinase. IGF-I and b-insulin were shown to activate PI3 kinase from 30 min onwards with a maximum at 90 min. In this study, we found the involvement of mitogen-activated protein kinase (MAP kinase) in the regulation of IGF-I- and b-insulin-induced steroidogenesis in carp ovary. An antagonist of mitogen-activated protein kinase kinase1/2 (MEK1/2) markedly attenuated IGF-I- and b-insulin-induced steroid production. Cells treated with IGF-I and b-insulin stimulated ERK1/2-dependent phosphorylation of extracellular signal regulated protein kinase1/2 (ERKs1/2) in a time-dependent manner, which was significantly attenuated in presence of MEK1/2 inhibitor. PI3 kinase inhibitors strongly attenuated phosphorylation and activation of MAP kinase, which was increased during IGF-I and b-insulin-induced steroidogenesis. Taken together, these results suggest that PI3 kinase is an initial component of the signal transduction pathway which precedes the MAP kinase during IGF-I- and b-insulin-induced steroidogenesis in C. carpio ovarian follicles.

  1. MAP kinase pathways in the yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Gustin, M. C.; Albertyn, J.; Alexander, M.; Davenport, K.; McIntire, L. V. (Principal Investigator)

    1998-01-01

    A cascade of three protein kinases known as a mitogen-activated protein kinase (MAPK) cascade is commonly found as part of the signaling pathways in eukaryotic cells. Almost two decades of genetic and biochemical experimentation plus the recently completed DNA sequence of the Saccharomyces cerevisiae genome have revealed just five functionally distinct MAPK cascades in this yeast. Sexual conjugation, cell growth, and adaptation to stress, for example, all require MAPK-mediated cellular responses. A primary function of these cascades appears to be the regulation of gene expression in response to extracellular signals or as part of specific developmental processes. In addition, the MAPK cascades often appear to regulate the cell cycle and vice versa. Despite the success of the gene hunter era in revealing these pathways, there are still many significant gaps in our knowledge of the molecular mechanisms for activation of these cascades and how the cascades regulate cell function. For example, comparison of different yeast signaling pathways reveals a surprising variety of different types of upstream signaling proteins that function to activate a MAPK cascade, yet how the upstream proteins actually activate the cascade remains unclear. We also know that the yeast MAPK pathways regulate each other and interact with other signaling pathways to produce a coordinated pattern of gene expression, but the molecular mechanisms of this cross talk are poorly understood. This review is therefore an attempt to present the current knowledge of MAPK pathways in yeast and some directions for future research in this area.

  2. TaSK5, an abiotic stress-inducible GSK3/shaggy-like kinase from wheat, confers salt and drought tolerance in transgenic Arabidopsis.

    Science.gov (United States)

    Christov, Nikolai Kirilov; Christova, Petya Koeva; Kato, Hideki; Liu, Yuelin; Sasaki, Kentaro; Imai, Ryozo

    2014-11-01

    A novel cold-inducible GSK3/shaggy-like kinase, TaSK5, was isolated from winter wheat using a macroarray-based differential screening approach. TaSK5 showed high similarity to Arabidopsis subgroup I GSK3/shaggy-like kinases ASK-alpha, AtSK-gamma and ASK-epsilon. RNA gel blot analyses revealed TaSK5 induction by cold and NaCl treatments and to a lesser extent by drought treatment. TaSK5 functionally complemented the cold- and salt-sensitive phenotypes of a yeast GSK3/shaggy-like kinase mutant, △mck1. Transgenic Arabidopsis plants overexpressing TaSK5 cDNA showed enhanced tolerance to salt and drought stresses. By contrast, the tolerance of the transgenic plants to freezing stress was not altered. Microarray analysis revealed that a number of abiotic stress-inducible genes were constitutively induced in the transgenic Arabidopsis plants, suggesting that TaSK5 may function in a novel signal transduction pathway that appears to be unrelated to DREB1/CBF regulon and may involve crosstalk between abiotic and hormonal signals.

  3. The MAP kinase pathway is required for entry into mitosis and cell survival.

    Science.gov (United States)

    Liu, Xiaoqi; Yan, Shi; Zhou, Tianhua; Terada, Yasuhiko; Erikson, Raymond L

    2004-01-22

    In this communication, we examined the role of the MAP kinase pathway in the G2/M phase of the cell cycle. Activation of the Plk1 and MAP kinase pathways was initially evaluated in FT210 cells, which arrest at G2 phase at the restrictive temperature (39 degrees C), due to a mutation in the cdc2 gene. Previous studies had shown that these cells enter mitosis at the nonpermissive temperature upon incubation with okadaic acid, a protein phosphatase 1 and 2A inhibitor. We show that treatment of FT210 cells at 39 degrees C with okadaic acid activated Plk1, as shown by hyperphosphorylation and elevated protein kinase activity, and also induced activation of the MAP kinase pathway. The specific Mek inhibitor PD98059 antagonized the okadaic acid-induced activation of both Plk1 and MAP kinases. This suggests that activation of the MAP kinase pathway may contribute to the okadaic acid-induced activation of Plk1 in FT210 cells at 39 degrees C. We also found that PD98059 strongly attenuated progression of HeLa cells through mitosis, and active Mek colocalizes with Plk1 at mitotic structures. To study the potential function of the MAP kinase pathway during mitosis, RNAi was used to specifically deplete five members of this pathway (Raf1, Mek1/2, Erk1/2). Each of these five protein kinases is required for cell proliferation and survival, and depletion of any of these proteins eventually leads to apoptosis. Treatment with Mek inhibitors also inhibited cell proliferation and caused apoptosis. A dramatic increase of Plk1 activities and a moderate increase of Cdc2 activities in Raf1-depleted cells indicate that Raf1-depleted cells arrest in the late G2 or M phase. Mek1 and Erk1 depletion also caused cell cycle arrest at G2, suggesting that these enzymes are required for the G2/M transition, whereas the loss of Mek2 or Erk2 caused arrest at G1.

  4. Natural variation at Strubbelig Receptor Kinase 3 drives immune-triggered incompatibilities between Arabidopsis thaliana accessions

    NARCIS (Netherlands)

    Alcazar, R.; Garcia, A.V.; Kronholm, I.; Meaux, De J.; Koornneef, M.; Parker, J.E.; Reymond, M.

    2010-01-01

    Accumulation of genetic incompatibilities within species can lead to reproductive isolation and, potentially, speciation. In this study, we show that allelic variation at SRF3 (Strubbelig Receptor Family 3), encoding a receptor-like kinase, conditions the occurrence of incompatibility between Arabid

  5. Identification and genetic mapping of four novel genes that regulate leaf development in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Molecular and genetic characterizations of mutants have led to a better understanding of many developmental processes in the model system Arabidopsis thaliana. However, the leaf development that is specific to plants has been little studied. With the aim of contributing to the genetic dissection of leaf development, we have performed a large-scare screening for mutants with abnormal leaves. Among a great number of leaf mutants we have generated by T-DNA and transposon tagging and ethylmethae sulfonate (EMS) mutagenesis, four independent mutant lines have been identified and studied genetically. Phenotypes of these mutant lines represent the defects of four novel nuclear genes designated LL1 (LOTUS LEAF 1), LL2 (LOTUS LEAF 2), URO (UPRIGHT ROSETTE), and EIL (ENVIRONMENTCONDITION INDUCED LESION). The phenotypic analysis indicates that these genes play important roles during leaf development. For the further genetic analysis of these genes and the map-based cloning of LL1 and LL2, we have mapped these genes to chromosome regions with an efficient and rapid mapping method.

  6. Identification and genetic mapping of four novel genes that regulate leaf development in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    SUNYUE; YingLiGuo; 等

    2000-01-01

    Molecular and genetic characterizations of mutants have led to a better understanding of many developmental processes in the model system Arabidopsis thaliana.However,the leaf development that is specific to plants has been little studies.With the aim of contributing to the genetic dissection of leaf development,we have performed a large-scare screening for mutants with abnormal leaves.Among a great number of leaf mutants we have generated by T-DNA and transposon tagging and ethylmethae sulfonate (EMS) mutagenesis,four independent mutant lines have been identified and studied genetically.Phenotypes of these mutant lines represent the defects of four novel muclear genes designated LL1(LOTUS LEAF 1),LL2(LOTUS LEAF2),URO(UPRIGHT ROSETTE),and EIL(ENVIRONMENT CONDITION INDUCED LESION).The phenotypic analysis indicates that these genes play important roles during leaf development.For the further genetic analysis of these genes and the map-based cloning of LL1 and LL2,we have mapped these genes to chromosome regions with an efficient and rapid mapping method.

  7. Regulation of salt and ABA responses by CIPK14, a calcium sensor interacting protein kinase in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    QIN YuZhi; LI Xu; GUO Ming; DENG KeQin; LIN dianZhong; TANG DongYing; GUO XinHong; LIU XuanMing

    2008-01-01

    Calcium and protein kinsse serve as the common mediators to regulate plant responses to multiple stresses including salt and ABA stimulus. Here we reported a novel protein kinase (CIPK14) that regulated the responses to ABA treatment and salt stress in Arabidopsis. CIPK14 transcripts, capable been checked in roots, stems, leaves and flowers, were highly expressed in flowers and roots. CIPK14 was induced by ABA and salt treatments. The disruption of CIPK14 altered the transcriptional pattern of a gene marker line related to ABA and salt responses, and the results suggested that CIPK14 probably was responsible to the control of the salt and ABA responses. Comparing with wild types, the lines inserted with the T-DNA in which CIPK14 gene expression was knocked out were also more sensitive to ABA and salt stimulus, showing low germination rate and the less root elongation. While, when these conditioned seeds were treated with norflurazon, their germination percentages could recover to a certain extent. We also found that exogenous calcium could have an effect on the transcription of CIPK14 under ABA end salt treatments, and it seemed that calcium ion might work upstream ClPK14 to regulate the plant response to ABA and salt response.

  8. Arabidopsis inositol 1,3,4-trisphosphate 5/6 kinase 2 is required for seed coat development

    Institute of Scientific and Technical Information of China (English)

    Yong Tang; Shutang Tan; Hongwei Xue

    2013-01-01

    Inositol 1,3,4-trisphosphate 5/6 kinase (ITPK) phosphorylates inositol 1,3,4-trisphosphate to form inositol 1,3,4,5-tetrakisphosphate and inositol 1,3,4,6-tetrakisphosphate which can be finally transferred to inositoi hexaphosphate (IP6) and play important roles during plant growth and development.There are 4 putative ITPK members in Arabidopsis.Expression pattern analysis showed that ITPK2 is constitutively expressed in various tissues.A TDNA knockout mutant of ITPK2 was identified and scanning electron microscopy (SEM) analysis showed that the epidermis structure of seed coat was irregularly formed in seeds of itpk2-1 mutant,resulting in the increased permeability of seed coat to tetrazolium salts.Further analysis by gas chromatography coupled with mass spectrometry of lipid polyester monomers in cell wall confirmed a dramatic decrease in composition of suberin and cutin,which relate to the permeability of seed coat and the formation of which is accompanied with seed coat development.These results indicate that ITPK2 plays an essential role in seed coat development and lipid polyester barrier formation.

  9. A cytosolic Arabidopsis D-xylulose kinase catalyzes the phosphorylation of 1-deoxy-D-xylulose into a precursor of the plastidial isoprenoid pathway.

    Science.gov (United States)

    Hemmerlin, Andréa; Tritsch, Denis; Hartmann, Michael; Pacaud, Karine; Hoeffler, Jean-François; van Dorsselaer, Alain; Rohmer, Michel; Bach, Thomas J

    2006-10-01

    Plants are able to integrate exogenous 1-deoxy-D-xylulose (DX) into the 2C-methyl-D-erythritol 4-phosphate pathway, implicated in the biosynthesis of plastidial isoprenoids. Thus, the carbohydrate needs to be phosphorylated into 1-deoxy-D-xylulose 5-phosphate and translocated into plastids, or vice versa. An enzyme capable of phosphorylating DX was partially purified from a cell-free Arabidopsis (Arabidopsis thaliana) protein extract. It was identified by mass spectrometry as a cytosolic protein bearing D-xylulose kinase (XK) signatures, already suggesting that DX is phosphorylated within the cytosol prior to translocation into the plastids. The corresponding cDNA was isolated and enzymatic properties of a recombinant protein were determined. In Arabidopsis, xylulose kinases are encoded by a small gene family, in which only two genes are putatively annotated. The additional gene is coding for a protein targeted to plastids, as was proved by colocalization experiments using green fluorescent protein fusion constructs. Functional complementation assays in an Escherichia coli strain deleted in xk revealed that the cytosolic enzyme could exclusively phosphorylate xylulose in vivo, not the enzyme that is targeted to plastids. xk activities could not be detected in chloroplast protein extracts or in proteins isolated from its ancestral relative Synechocystis sp. PCC 6803. The gene encoding the plastidic protein annotated as "xylulose kinase" might in fact yield an enzyme having different phosphorylation specificities. The biochemical characterization and complementation experiments with DX of specific Arabidopsis knockout mutants seedlings treated with oxo-clomazone, an inhibitor of 1-deoxy-D-xylulose 5-phosphate synthase, further confirmed that the cytosolic protein is responsible for the phosphorylation of DX in planta.

  10. Plant protein kinase genes induced by drought, high salt and cold stresses

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Drought, high salt and cold are three different kinds of environment stresses that severely influence the growth, development and productivity of crops. They all decrease the water state of plant cells, and consequently result in the harm of plant from water deficit. Several genes encoding protein kinases and induced by drought, high salt and low temperature have been isolated from Arabidopsis. These protein kinases include receptor protein kinase (RPK), MAP kinases, ribosomal-protein kinases and transcription-regulation protein kinase. The expression features of these genes and the regulatory roles of these protein kinases in stress response and signal transduction are discussed.

  11. Linkage and association mapping of Arabidopsis thaliana flowering time in nature.

    Directory of Open Access Journals (Sweden)

    Benjamin Brachi

    2010-05-01

    Full Text Available Flowering time is a key life-history trait in the plant life cycle. Most studies to unravel the genetics of flowering time in Arabidopsis thaliana have been performed under greenhouse conditions. Here, we describe a study about the genetics of flowering time that differs from previous studies in two important ways: first, we measure flowering time in a more complex and ecologically realistic environment; and, second, we combine the advantages of genome-wide association (GWA and traditional linkage (QTL mapping. Our experiments involved phenotyping nearly 20,000 plants over 2 winters under field conditions, including 184 worldwide natural accessions genotyped for 216,509 SNPs and 4,366 RILs derived from 13 independent crosses chosen to maximize genetic and phenotypic diversity. Based on a photothermal time model, the flowering time variation scored in our field experiment was poorly correlated with the flowering time variation previously obtained under greenhouse conditions, reinforcing previous demonstrations of the importance of genotype by environment interactions in A. thaliana and the need to study adaptive variation under natural conditions. The use of 4,366 RILs provides great power for dissecting the genetic architecture of flowering time in A. thaliana under our specific field conditions. We describe more than 60 additive QTLs, all with relatively small to medium effects and organized in 5 major clusters. We show that QTL mapping increases our power to distinguish true from false associations in GWA mapping. QTL mapping also permits the identification of false negatives, that is, causative SNPs that are lost when applying GWA methods that control for population structure. Major genes underpinning flowering time in the greenhouse were not associated with flowering time in this study. Instead, we found a prevalence of genes involved in the regulation of the plant circadian clock. Furthermore, we identified new genomic regions lacking

  12. Quantitative trait locus mapping for seed mineral concentrations in two Arabidopsis thaliana recombinant inbred populations.

    Science.gov (United States)

    Waters, Brian M; Grusak, Michael A

    2008-01-01

    Biofortification of foods, achieved by increasing the concentrations of minerals such as iron (Fe) and zinc (Zn), is a goal of plant scientists. Understanding genes that influence seed mineral concentration in a model plant such as Arabidopsis could help in the development of nutritionally enhanced crop cultivars. Quantitative trait locus (QTL) mapping for seed concentrations of calcium (Ca), copper (Cu), Fe, potassium (K), magnesium (Mg), manganese (Mn), phosphorus (P), sulfur (S), and Zn was performed using two recombinant inbred line (RIL) populations, Columbia (Col) x Landsberg erecta (Ler) and Cape Verde Islands (Cvi) x Ler, grown on multiple occasions. QTL mapping was also performed using data from silique hulls and the ratio of seed:hull mineral concentration of the Cvi x Ler population. Over 100 QTLs that affected seed mineral concentration were identified. Twenty-nine seed QTLs were found in more than one experiment, and several QTLs were found for both seed and hull mineral traits. A number of candidate genes affecting seed mineral concentration are discussed. These results indicate that A. thaliana is a suitable and convenient model for discovery of genes that affect seed mineral concentration. Some strong QTLs had no obvious candidate genes, offering the possibility of identifying unknown genes that affect mineral uptake and translocation to seeds.

  13. The alkaline tolerance in Arabidopsis requires stabilizing microfilament partially through inactivation of PKS5 kinase

    Institute of Scientific and Technical Information of China (English)

    Juntao Liu; Yan Guo

    2011-01-01

    High soil pH is harmful to plant growth and development. The organization and dynamics of microfilament (MF) cytoskeleton play important roles in the plant anti-alkaline process. In the previous study, we determined that alkaline stress induces a signal that triggers MF dynamicsdependent root growth. In this study we identified that PKS5 kinase involves in this regulatory process to facilitate the signal to reach the downstream target MF. Under pH 8.3 treatment, the depolymerization of MF was faster in pks5-4 (PKS5 kinase constitutively activated) than that in wild-type plants. The inhibition of wild-type, pks5-1, and pks5-4 root growth by pH 8.3 was correlated to their MF depolymerization rate.When the plants were treated with phalioidin to stabilize MF, the high pH sensitive phenotype of pks5-4 can be partially rescued. When the plants were treated with a kinase inhibitor Staurosporine, the MF depolymerization rate in pks5-4 was similar as that in wild-type under pH 8.3 treatment and the sensitivity of root growth was also rescued. However, when the plants were treated with LaCl3, a calcium channel blocker, the root growth sensitivity ofpks5-4 under pH 8.3 was rescued but MF depolymerization was even faster than that of plants without LaCl3 treatment.These results suggest that the PKS5 involves in external high pH signal mediated MF depolymerization, and that may be independent of calcium signal.

  14. Next-Gen Sequencing-Based Mapping and Identification of Ethyl Methanesulfonate-Induced Mutations in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Xue-Cheng; Millet, Yves; Ausubel, Frederick M; Borowsky, Mark

    2014-10-01

    Forward genetic analysis using ethyl methanesulfonate (EMS) mutagenesis has proven to be a powerful tool in biological research, but identification and cloning of causal mutations by conventional genetic mapping approaches is a painstaking process. Recent advances in next-gen sequencing have greatly invigorated the process of identifying EMS-induced mutations corresponding to a specific phenotype in model genetic hosts, including the plant Arabidopsis thaliana and the nematode Caenorhabditis elegans. Next-gen sequencing of bulked F2 mutant recombinants produces a wealth of high-resolution genetic data, provides enhanced delimitation of the genomic location of mutations, and greatly reduces hands-on time while maintaining high accuracy and reproducibility. In this unit, a detailed procedure to simultaneously map and identify EMS mutations in Arabidopsis is described.

  15. The Arabidopsis thaliana cysteine-rich receptor-like kinase CRK20 modulates host responses to Pseudomonas syringae pv. tomato DC3000 infection

    KAUST Repository

    Ederli, Luisa

    2011-10-01

    In plants, the cysteine-rich repeat kinases (CRKs) are a sub-family of receptor-like protein kinases that contain the DUF26 motif in their extracellular domains. It has been shown that in Arabidopsis thaliana, CRK20 is transcriptionally induced by pathogens, salicylic acid and ozone (O3). However, its role in responses to biotic and abiotic stress remains to be elucidated. To determine the function of CRK20 in such responses, two CRK20 loss-of-function mutants, crk20-1 and crk20-2, were isolated from public collections of Arabidopsis T-DNA tagged lines and examined for responses to O3 and Pseudomonas syringae pv. tomato (Pst) DC3000. crk20-1 and crk20-2 showed similar O3 sensitivities and no differences in the expression of defense genes when compared with the wild-type. However, pathogen growth was significantly reduced, while there were no differences in the induction of salicylic acid related defense genes or salicylic acid accumulation. Furthermore, correlation analysis of CRK20 gene expression suggests that it has a role in the control of H2O and/or nutrient transport. We therefore propose that CRK20 promotes conditions that are favorable for Pst DC3000 growth in Arabidopsis, possibly through the regulation of apoplastic homeostasis, and consequently, of the environment of this biotrophic pathogen. © 2011 Elsevier GmbH.

  16. Mitogen activated protein kinase kinase kinase 3 (MAP3K3/MEKK3) overexpression is an early event in esophageal tumorigenesis and is a predictor of poor disease prognosis

    OpenAIRE

    2014-01-01

    Background Mitogen-activated protein kinase kinase kinase3 (MAP3K3/MEKK3) was identified to be differentially expressed in esophageal squamous cell carcinoma (ESCC) using cDNA microarrays by our laboratory. Here in we determined the clinical significance of MEKK3 in ESCC. Methods Immunohistochemical analysis of MEKK3 expression was carried out in archived tissue sections from 93 ESCCs, 47 histologically normal and 61 dysplastic esophageal tissues and correlated with clinicopathological parame...

  17. RKIP regulates MAP kinase signaling in cells with defective B-Raf activity.

    Science.gov (United States)

    Zeng, Lingchun; Ehrenreiter, Karin; Menon, Jyotsana; Menard, Ray; Kern, Florian; Nakazawa, Yoko; Bevilacqua, Elena; Imamoto, Akira; Baccarini, Manuela; Rosner, Marsha Rich

    2013-05-01

    MAP kinase (MAPK) signaling results from activation of Raf kinases in response to external or internal stimuli. Here, we demonstrate that Raf kinase inhibitory protein (RKIP) regulates the activation of MAPK when B-Raf signaling is defective. We used multiple models including mouse embryonic fibroblasts (MEFs) and primary keratinocytes from RKIP- or Raf-deficient mice as well as allografts in mice to investigate the mechanism. Loss of B-Raf protein or activity significantly reduces MAPK activation in these cells. We show that RKIP depletion can rescue the compromised ERK activation and promote proliferation, and this rescue occurs through a Raf-1 dependent mechanism. These results provide formal evidence that RKIP is a bona fide regulator of Raf-1. We propose a new model in which RKIP plays a key role in regulating the ability of cells to signal through Raf-1 to ERK in B-Raf compromised cells.

  18. BDNF stimulation of protein synthesis in cortical neurons requires the MAP kinase-interacting kinase MNK1.

    Science.gov (United States)

    Genheden, Maja; Kenney, Justin W; Johnston, Harvey E; Manousopoulou, Antigoni; Garbis, Spiros D; Proud, Christopher G

    2015-01-21

    Although the MAP kinase-interacting kinases (MNKs) have been known for >15 years, their roles in the regulation of protein synthesis have remained obscure. Here, we explore the involvement of the MNKs in brain-derived neurotrophic factor (BDNF)-stimulated protein synthesis in cortical neurons from mice. Using a combination of pharmacological and genetic approaches, we show that BDNF-induced upregulation of protein synthesis requires MEK/ERK signaling and the downstream kinase, MNK1, which phosphorylates eukaryotic initiation factor (eIF) 4E. Translation initiation is mediated by the interaction of eIF4E with the m(7)GTP cap of mRNA and with eIF4G. The latter interaction is inhibited by the interactions of eIF4E with partner proteins, such as CYFIP1, which acts as a translational repressor. We find that BDNF induces the release of CYFIP1 from eIF4E, and that this depends on MNK1. Finally, using a novel combination of BONCAT and SILAC, we identify a subset of proteins whose synthesis is upregulated by BDNF signaling via MNK1 in neurons. Interestingly, this subset of MNK1-sensitive proteins is enriched for functions involved in neurotransmission and synaptic plasticity. Additionally, we find significant overlap between our subset of proteins whose synthesis is regulated by MNK1 and those encoded by known FMRP-binding mRNAs. Together, our data implicate MNK1 as a key component of BDNF-mediated translational regulation in neurons.

  19. Interdomain allosteric regulation of Polo kinase by Aurora B and Map205 is required for cytokinesis.

    Science.gov (United States)

    Kachaner, David; Pinson, Xavier; El Kadhi, Khaled Ben; Normandin, Karine; Talje, Lama; Lavoie, Hugo; Lépine, Guillaume; Carréno, Sébastien; Kwok, Benjamin H; Hickson, Gilles R; Archambault, Vincent

    2014-10-27

    Drosophila melanogaster Polo and its human orthologue Polo-like kinase 1 fulfill essential roles during cell division. Members of the Polo-like kinase (Plk) family contain an N-terminal kinase domain (KD) and a C-terminal Polo-Box domain (PBD), which mediates protein interactions. How Plks are regulated in cytokinesis is poorly understood. Here we show that phosphorylation of Polo by Aurora B is required for cytokinesis. This phosphorylation in the activation loop of the KD promotes the dissociation of Polo from the PBD-bound microtubule-associated protein Map205, which acts as an allosteric inhibitor of Polo kinase activity. This mechanism allows the release of active Polo from microtubules of the central spindle and its recruitment to the site of cytokinesis. Failure in Polo phosphorylation results in both early and late cytokinesis defects. Importantly, the antagonistic regulation of Polo by Aurora B and Map205 in cytokinesis reveals that interdomain allosteric mechanisms can play important roles in controlling the cellular functions of Plks.

  20. A Cytosolic Arabidopsis d-Xylulose Kinase Catalyzes the Phosphorylation of 1-Deoxy-d-Xylulose into a Precursor of the Plastidial Isoprenoid Pathway1

    Science.gov (United States)

    Hemmerlin, Andréa; Tritsch, Denis; Hartmann, Michael; Pacaud, Karine; Hoeffler, Jean-François; van Dorsselaer, Alain; Rohmer, Michel; Bach, Thomas J.

    2006-01-01

    Plants are able to integrate exogenous 1-deoxy-d-xylulose (DX) into the 2C-methyl-d-erythritol 4-phosphate pathway, implicated in the biosynthesis of plastidial isoprenoids. Thus, the carbohydrate needs to be phosphorylated into 1-deoxy-d-xylulose 5-phosphate and translocated into plastids, or vice versa. An enzyme capable of phosphorylating DX was partially purified from a cell-free Arabidopsis (Arabidopsis thaliana) protein extract. It was identified by mass spectrometry as a cytosolic protein bearing d-xylulose kinase (XK) signatures, already suggesting that DX is phosphorylated within the cytosol prior to translocation into the plastids. The corresponding cDNA was isolated and enzymatic properties of a recombinant protein were determined. In Arabidopsis, xylulose kinases are encoded by a small gene family, in which only two genes are putatively annotated. The additional gene is coding for a protein targeted to plastids, as was proved by colocalization experiments using green fluorescent protein fusion constructs. Functional complementation assays in an Escherichia coli strain deleted in xk revealed that the cytosolic enzyme could exclusively phosphorylate xylulose in vivo, not the enzyme that is targeted to plastids. xk activities could not be detected in chloroplast protein extracts or in proteins isolated from its ancestral relative Synechocystis sp. PCC 6803. The gene encoding the plastidic protein annotated as “xylulose kinase” might in fact yield an enzyme having different phosphorylation specificities. The biochemical characterization and complementation experiments with DX of specific Arabidopsis knockout mutants seedlings treated with oxo-clomazone, an inhibitor of 1-deoxy-d-xylulose 5-phosphate synthase, further confirmed that the cytosolic protein is responsible for the phosphorylation of DX in planta. PMID:16920870

  1. FAK acts as a suppressor of RTK-MAP kinase signalling in Drosophila melanogaster epithelia and human cancer cells.

    OpenAIRE

    2014-01-01

    Receptor Tyrosine Kinases (RTKs) and Focal Adhesion Kinase (FAK) regulate multiple signalling pathways, including mitogen-activated protein (MAP) kinase pathway. FAK interacts with several RTKs but little is known about how FAK regulates their downstream signalling. Here we investigated how FAK regulates signalling resulting from the overexpression of the RTKs RET and EGFR. FAK suppressed RTKs signalling in Drosophila melanogaster epithelia by impairing MAPK pathway. This regulation was also ...

  2. Blue Light-excited Light-Oxygen-Voltage-sensing Domain 2 (LOV2) Triggers a Rearrangement of the Kinase Domain to Induce Phosphorylation Activity in Arabidopsis Phototropin1.

    Science.gov (United States)

    Oide, Mao; Okajima, Koji; Kashojiya, Sachiko; Takayama, Yuki; Oroguchi, Tomotaka; Hikima, Takaaki; Yamamoto, Masaki; Nakasako, Masayoshi

    2016-09-16

    Phototropin1 is a blue light (BL) receptor in plants and shows BL-dependent kinase activation. The BL-excited light-oxygen-voltage-sensing domain 2 (LOV2) is primarily responsible for the activation of the kinase domain; however, the molecular mechanism by which conformational changes in LOV2 are transmitted to the kinase domain remains unclear. Here, we investigated BL-induced structural changes of a minimum functional fragment of Arabidopsis phototropin1 composed of LOV2, the kinase domain, and a linker connecting the two domains using small-angle x-ray scattering (SAXS). The fragment existed as a dimer and displayed photoreversible SAXS changes reflected in the radii of gyration of 42.9 Å in the dark and 48.8 Å under BL irradiation. In the dark, the molecular shape reconstructed from the SAXS profiles appeared as two bean-shaped lobes in a twisted arrangement that was 170 Å long, 80 Å wide, and 50 Å thick. The molecular shape under BL became slightly elongated from that in the dark. By fitting the crystal structure of the LOV2 dimer and a homology model of the kinase domain to their inferred shapes, the BL-dependent change could be interpreted as the positional shift in the kinase domain relative to that of the LOV2 dimer. In addition, we found that lysine 475, a functionally important residue, in the N-terminal region of LOV2 plays a critical role in transmitting the structural changes in LOV2 to the kinase domain. The interface between the domains is critical for signaling, suitably changing the structure to activate the kinase in response to conformational changes in the adjoining LOV2.

  3. Arabidopsis Lectin Receptor Kinases LecRK-IX.1 and LecRK-IX.2 Are Functional Analogs in Regulating Phytophthora Resistance and Plant Cell Death.

    Science.gov (United States)

    Wang, Yan; Cordewener, Jan H G; America, Antoine H P; Shan, Weixing; Bouwmeester, Klaas; Govers, Francine

    2015-09-01

    L-type lectin receptor kinases (LecRK) are potential immune receptors. Here, we characterized two closely-related Arabidopsis LecRK, LecRK-IX.1 and LecRK-IX.2, of which T-DNA insertion mutants showed compromised resistance to Phytophthora brassicae and Phytophthora capsici, with double mutants showing additive susceptibility. Overexpression of LecRK-IX.1 or LecRK-IX.2 in Arabidopsis and transient expression in Nicotiana benthamiana increased Phytophthora resistance but also induced cell death. Phytophthora resistance required both the lectin domain and kinase activity, but for cell death, the lectin domain was not needed. Silencing of the two closely related mitogen-activated protein kinase genes NbSIPK and NbNTF4 in N. benthamiana completely abolished LecRK-IX.1-induced cell death but not Phytophthora resistance. Liquid chromatography-mass spectrometry analysis of protein complexes coimmunoprecipitated in planta with LecRK-IX.1 or LecRK-IX.2 as bait, resulted in the identification of the N. benthamiana ABC transporter NbPDR1 as a potential interactor of both LecRK. The closest homolog of NbPDR1 in Arabidopsis is ABCG40, and coimmunoprecipitation experiments showed that ABCG40 associates with LecRK-IX.1 and LecRK-IX.2 in planta. Similar to the LecRK mutants, ABCG40 mutants showed compromised Phytophthora resistance. This study shows that LecRK-IX.1 and LecRK-IX.2 are Phytophthora resistance components that function independent of each other and independent of the cell-death phenotype. They both interact with the same ABC transporter, suggesting that they exploit similar signal transduction pathways.

  4. Lectin receptor kinases participate in protein-protein interactions to mediate plasma membrane-cell wall adhesions in Arabidopsis

    NARCIS (Netherlands)

    Gouget, A.; Senchou, V.; Govers, F.; Sanson, A.; Barre, A.; Rougé, P.; Pont-Lezica, R.; Canut, H.

    2006-01-01

    Interactions between plant cell walls and plasma membranes are essential for cells to function properly, but the molecules that mediate the structural continuity between wall and membrane are unknown. Some of these interactions, which are visualized upon tissue plasmolysis in Arabidopsis (Arabidopsi

  5. Combinatory action of VEGFR2 and MAP kinase pathways maintains endothelial-cell integrity

    Institute of Scientific and Technical Information of China (English)

    Hanbing Zhong; Danyang Wang; Nan Wang; Yesenia Rios; Haigen Huang; Song Li; Xinrong Wu; Shuo Lin

    2011-01-01

    Blood vessels normally maintain stereotyped lumen diameters and their stable structures are crucial for vascular function. However, very little is known about the molecular mechanisms controlling the maintenance of vessel diameters and the integrity of endothelial cells. We investigated this issue in zebrafish embryos by a chemical genetics approach. Small molecule libraries were screened using live Tg(kdrl:GRCFP)zn1 transgenic embryos in which endothelial cells are specifically labeled with GFP. By analyzing the effects of compounds on the morphology and function of embryonic blood vessels after lumen formation, PP1, a putative Src kinase inhibitor, was identified as capable of specifically reducing vascular lumen size by interrupting endothelial-cell integrity. The inhibitory effect is not due to Src or general VEGF signaling inhibition because another Src inhibitor and Src morpholino as well as several VEGFR inhibitors failed to produce a similar phenotype. After profiling a panel of 22 representative mammalian kinases and surveying published data, we selected a few possible new candidates. Combinational analysis of these candidate kinase inhibitors established that PP1 induced endothelial collapse by inhibiting both the VEGFR2 and MAP kinase pathways. More importantly, combinatory use of two clinically approved drugs Dasatinib and Sunitinib produced the same phenotype. This is the first study to elucidate the pathways controlling maintenance of endothelial integrity using a chemical genetics approach, indicating that endothelial integrity is controlled by the combined action of the VEGFR2 and MAP kinase pathways. Our results also suggest the possible side effect of the combination of two anticancer drugs on the circulatory system.

  6. Mapping of a liver phosphorylase kinase [alpha]-subunit gene on the mouse x chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Yan; Derry, J.M.J.; Barnard, P.J. (MRC Molecular Neurobiology Unit, Cambridge (United Kingdom)); Hendrickx, J.; Coucke, P.; Willems, P.R. (Univ. of Antwerp (Belgium))

    1993-01-01

    Phosphorylase kinase (PHK) is a regulatory enzyme of the glycogenolytic pathway composed of a complex of four subunits. We recently mapped the muscle [alpha]-subunit gene (Phka) to the mouse X chromosome in a region syntenic with the proximal long arm of the human X chromosome and containing the human homologue of this gene, PHKA. We now report the mapping of the liver [alpha]-subunit gene to the telomeric end of the mouse X chromosome. This mapping position would suggest a location for the human liver [alpha]-subunit gene on the proximal short arm of the X chromosome, a region recently implicated in X-linked liver glycogenosis (XLG). 20 refs., 2 figs.

  7. A Dominant Allele of Arabidopsis Pectin-Binding Wall-Associated Kinase Induces a Stress Response Suppressed by MPK6 but Not MPK3 Mutations

    Institute of Scientific and Technical Information of China (English)

    Bruce D.Kohorn; Susan L.Kohorn; Tanya Todorova; Gillian Baptiste; Kevin Stansky; Meghan McCullough

    2012-01-01

    The plant cell wall is composed of a matrix of cellulose fibers,flexible pectin polymers,and an array of assorted carbohydrates and proteins.The receptor-like Wall-Associated Kinases(WAKs)of Arabidopsis bind pectin in the wall,and are necessary both for cell expansion during development and for a response to pathogens and wounding.Mitogen Activated Protein Kinases(MPKs)form a major signaling link between cell surface receptors and both transcriptional and enzyme regulation in eukaryotes,and Arabidopsis MPK6 and MPK3 indeed have important roles in development and the response to stress and pathogens.A dominant allele of WAK2 requires kinase activity and activates a stress response that includes an increased ROS accumulation and the up-regulation of numerous genes involved in pathogen resistance,wounding,and cell wall biogenesis.This dominant allele requires a functional pectin binding and kinase domain,indicating that it is engaged in a WAK signaling pathway.A null mutant of the major plasma membrane ROS-producing enzyme complex,rbohd/f does not suppress the WAK2cTAP-induced phenotype.A mpk6,but not a mpk3,null allele is able to suppress the effects of this dominant WAK2 mutation,thus distinguishing MPK3 and MPK6,whose activity previously was thought to be redundant.Pectin activation of gene expression is abated in a wak2-null,but is tempered by the WAK-dominant allele that induces elevated basal stress-related transcript levels.The results suggest a mechanism in which changes to the cell wall can lead to a large change in cellular responses and help to explain how pathogens and wounding can have general effects on growth.

  8. Expression, Purification, and Characterization of a Sucrose Nonfermenting 1-Related Protein Kinases 2 of Arabidopsis thaliana in E. coli-Based Cell-Free System

    Directory of Open Access Journals (Sweden)

    Xu Zhang

    2016-01-01

    Full Text Available The plant-specific sucrose nonfermenting 1-related protein kinase 2 (SnRK2 family is considered an important regulator of plant responses to abiotic stresses such as drought, cold, salinity, and nutrition deficiency. However, little information is available on how SnRK2s regulate sulfur deprivation responses in Arabidopsis. Large-scale production of SnRK2 kinases in vitro can help to elucidate the biochemical properties and physiological functions of this protein family. However, heterogenous expression of SnRK2s usually leads to inactive proteins. In this study, we expressed a recombinant Arabidopsis SnRK2.1 in a modified E. coli cell-free system, which combined two kinds of extracts allowing for a convenient and affordable protein preparation. The recombinant SnRK2.1 was produced in large-scale and the autophosphorylation activity of purified SnRK2.1 was characterized, allowing for further biochemical and substrate binding analysis in sulfur signaling. The application of this improved E. coli cell-free system provides us a promising and convenient platform to enhance expression of the target proteins economically.

  9. MicroRNA biogenesis factor DRB1 is a phosphorylation target of mitogen activated protein kinase MPK3 in both rice and Arabidopsis.

    Science.gov (United States)

    Raghuram, Badmi; Sheikh, Arsheed H; Rustagi, Yashika; Sinha, Alok K

    2015-02-01

    MicroRNA (miRNA) biogenesis requires AtDRB1 (double-stranded RNA binding protein)/HYL1 (Hyponastic Leaves1) protein for processing and maturation of miRNA precursors. The AtDRB1/HYL1 protein associates with AtDCL1 (Dicer-Like1) and accurately processes primary-miRNAs (pri-mRNAs) first to precursor-miRNAs (pre-miRNAs) and finally to mature miRNAs. The dephosphorylation of AtDRB1/HYL1 protein is very important for the precise processing of miRNA precursors. The monocot model crop plant Oryza sativa encodes four orthologues of AtDRB1/HYL1 protein, the only one encoded by Arabidopsis thaliana. The present study focuses on the functionality of the O. sativa DRBs as the orthologues of AtDRB1/HYL1 by using RNA binding assays and in planta protein-protein interaction analysis. Further, mitogen-activated protein kinase MPK3 is established as the kinase phosphorylating DRB1 protein in both the model plants, O. sativa and Arabidopsis. MicroRNA microarray analysis in atmpk3 and atmpk6 mutants indicate the importance of AtMPK3 in maintaining the level of miRNAs in the plant.

  10. Involvement of the mitogen-activated protein (MAP kinase signalling pathway in host cell invasion by Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Robert-Gangneux F.

    2000-06-01

    Full Text Available Little is known about signalling in Toxoplasma gondii, but it is likely that protein kinases might play a key role in the parasite proliferation, differentiation and probably invasion. We previously characterized Mitogen-Activated Protein (MAP kinases in T. gondii lysates. In this study, cultured cells were tested for their susceptibility to Toxoplasma gondii infection after tachyzoite pretreatment with drugs interfering with AMP kinase activation pathways. Protein kinases inhibitors, i.e. genistein, R031-8220 and PD098059, reduced tachyzoite infectivity by 38 ± 4.5 %, 85.5 ± 9 % and 56 ± 10 %, respectively. Conversely, protein kinases activators, i.e. bombesin and PMA, markedly increased infectivity (by 202 ± 37 % and 258 ± 14 %, respectively. These results suggest that signalling pathways involving PKC and AAAP kinases play a role in host cell invasion by Toxoplasma.

  11. PSM/SH2-B distributes selected mitogenic receptor signals to distinct components in the PI3-kinase and MAP kinase signaling pathways.

    Science.gov (United States)

    Deng, Youping; Xu, Hu; Riedel, Heimo

    2007-02-15

    The Pro-rich, PH, and SH2 domain containing mitogenic signaling adapter PSM/SH2-B has been implicated as a cellular partner of various mitogenic receptor tyrosine kinases and related signaling mechanisms. Here, we report in a direct comparison of three peptide hormones, that PSM participates in the assembly of distinct mitogenic signaling complexes in response to insulin or IGF-I when compared to PDGF in cultured normal fibroblasts. The complex formed in response to insulin or IGF-I involves the respective peptide hormone receptor and presumably the established components leading to MAP kinase activation. However, our data suggest an alternative link from the PDGF receptor via PSM directly to MEK1/2 and consequently also to p44/42 activation, possibly through a scaffold protein. At least two PSM domains participate, the SH2 domain anticipated to link PSM to the respective receptor and the Pro-rich region in an association with an unidentified downstream component resulting in direct MEK1/2 and p44/42 regulation. The PDGF receptor signaling complex formed in response to PDGF involves PI 3-kinase in addition to the same components and interactions as described for insulin or IGF-I. PSM associates with PI 3-kinase via p85 and in addition the PSM PH domain participates in the regulation of PI 3-kinase activity, presumably through membrane interaction. In contrast, the PSM Pro-rich region appears to participate only in the MAP kinase signal. Both pathways contribute to the mitogenic response as shown by cell proliferation, survival, and focus formation. PSM regulates p38 MAP kinase activity in a pathway unrelated to the mitogenic response.

  12. Family-based linkage and association mapping reveals novel genes affecting Plum pox virus infection in Arabidopsis thaliana.

    Science.gov (United States)

    Pagny, Gaëlle; Paulstephenraj, Pauline S; Poque, Sylvain; Sicard, Ophélie; Cosson, Patrick; Eyquard, Jean-Philippe; Caballero, Mélodie; Chague, Aurélie; Gourdon, Germain; Negrel, Lise; Candresse, Thierry; Mariette, Stéphanie; Decroocq, Véronique

    2012-11-01

    Sharka is a devastating viral disease caused by the Plum pox virus (PPV) in stone fruit trees and few sources of resistance are known in its natural hosts. Since any knowledge gained from Arabidopsis on plant virus susceptibility factors is likely to be transferable to crop species, Arabidopsis's natural variation was searched for host factors essential for PPV infection. To locate regions of the genome associated with susceptibility to PPV, linkage analysis was performed on six biparental populations as well as on multiparental lines. To refine quantitative trait locus (QTL) mapping, a genome-wide association analysis was carried out using 147 Arabidopsis accessions. Evidence was found for linkage on chromosomes 1, 3 and 5 with restriction of PPV long-distance movement. The most relevant signals occurred within a region at the bottom of chromosome 3, which comprises seven RTM3-like TRAF domain-containing genes. Since the resistance mechanism analyzed here is recessive and the rtm3 knockout mutant is susceptible to PPV infection, it suggests that other gene(s) present in the small identified region encompassing RTM3 are necessary for PPV long-distance movement. In consequence, we report here the occurrence of host factor(s) that are indispensable for virus long-distance movement.

  13. Mitogen-activated protein kinase signaling in plants

    DEFF Research Database (Denmark)

    Rodriguez, Maria Cristina Suarez; Petersen, Morten; Mundy, John

    2010-01-01

    Eukaryotic mitogen-activated protein kinase (MAPK) cascades have evolved to transduce environmental and developmental signals into adaptive and programmed responses. MAPK cascades relay and amplify signals via three types of reversibly phosphorylated kinases leading to the phosphorylation of subs...... the Arabidopsis thaliana MAPKs MPK3, 4, and 6 and MAP2Ks MKK1, 2, 4, and 5. Future work needs to focus on identifying substrates of MAPKs, and on understanding how specificity is achieved among MAPK signaling pathways....

  14. Regulation of the MAP kinase cascade in PC12 cells: B-Raf activates MEK-1 (MAP kinase or ERK kinase) and is inhibited by cAMP

    DEFF Research Database (Denmark)

    Peraldi, P; Frödin, M; Barnier, J V

    1995-01-01

    the role of B-Raf in this process. We observed that NGF, PMA and cAMP induce the phosphorylation of B-Raf as well as an upward shift in its electrophoretic mobility. We show that B-Raf is activated following NGF and PMA treatment of PC12 cells, and that it can phosphorylate and activate MEK-1. However, c......AMP inhibits B-Raf autokinase activity as well as its ability to phosphorylate and activate MEK-1. This inhibition is likely to be due to a direct effect since we found that PKA phosphorylates B-Raf in vitro. Further, we show that B-Raf binds to p21ras, but more important, this binding to p21ras is virtually...... abolished with B-Raf from PC12 cells treated with CPT-cAMP. Hence, these data indicate that the PKA-mediated phosphorylation of B-Raf hampers its interaction with p21ras, which is responsible for the PKA-mediated decrease in B-Raf activity. Finally, our work suggests that in PC12 cells, cAMP stimulates MAP...

  15. Inhibition of fast axonal transport by pathogenic SOD1 involves activation of p38 MAP kinase.

    Directory of Open Access Journals (Sweden)

    Gerardo A Morfini

    Full Text Available Dying-back degeneration of motor neuron axons represents an established feature of familial amyotrophic lateral sclerosis (FALS associated with superoxide dismutase 1 (SOD1 mutations, but axon-autonomous effects of pathogenic SOD1 remained undefined. Characteristics of motor neurons affected in FALS include abnormal kinase activation, aberrant neurofilament phosphorylation, and fast axonal transport (FAT deficits, but functional relationships among these pathogenic events were unclear. Experiments in isolated squid axoplasm reveal that FALS-related SOD1 mutant polypeptides inhibit FAT through a mechanism involving a p38 mitogen activated protein kinase pathway. Mutant SOD1 activated neuronal p38 in mouse spinal cord, neuroblastoma cells and squid axoplasm. Active p38 MAP kinase phosphorylated kinesin-1, and this phosphorylation event inhibited kinesin-1. Finally, vesicle motility assays revealed previously unrecognized, isoform-specific effects of p38 on FAT. Axon-autonomous activation of the p38 pathway represents a novel gain of toxic function for FALS-linked SOD1 proteins consistent with the dying-back pattern of neurodegeneration characteristic of ALS.

  16. Intermittent hypoxia-induced endothelial barrier dysfunction requires ROS-dependent MAP kinase activation.

    Science.gov (United States)

    Makarenko, Vladislav V; Usatyuk, Peter V; Yuan, Guoxiang; Lee, May M; Nanduri, Jayasri; Natarajan, Viswanathan; Kumar, Ganesh K; Prabhakar, Nanduri R

    2014-04-15

    The objective of the present study was to determine the impact of simulated apnea with intermittent hypoxia (IH) on endothelial barrier function and assess the underlying mechanism(s). Experiments were performed on human lung microvascular endothelial cells exposed to IH-consisting alternating cycles of 1.5% O2 for 30s followed by 20% O2 for 5 min. IH decreased transendothelial electrical resistance (TEER) suggesting attenuated endothelial barrier function. The effect of IH on TEER was stimulus dependent and reversible after reoxygenation. IH-exposed cells exhibited stress fiber formation and redistribution of cortactin, vascular endothelial-cadherins, and zona occludens-1 junction proteins along with increased intercellular gaps at cell-cell boundaries. Extracellular signal-regulated kinase (ERK) and c-jun NH2-terminal kinase (JNK) were phosphorylated in IH-exposed cells. Inhibiting either ERK or JNK prevented the IH-induced decrease in TEER and the reorganization of the cytoskeleton and junction proteins. IH increased reactive oxygen species (ROS) levels, and manganese (III) tetrakis (1-methyl-4-pyridyl) porphyrin pentachloride, a membrane-permeable antioxidant, prevented ERK and JNK phosphorylation as well as IH-induced changes in endothelial barrier function. These results demonstrate that IH via ROS-dependent activation of MAP kinases leads to reorganization of cytoskeleton and junction proteins resulting in endothelial barrier dysfunction.

  17. Rapamycin induces mitogen-activated protein (MAP) kinase phosphatase-1 (MKP-1) expression through activation of protein kinase B and mitogen-activated protein kinase kinase pathways.

    Science.gov (United States)

    Rastogi, Ruchi; Jiang, Zhongliang; Ahmad, Nisar; Rosati, Rita; Liu, Yusen; Beuret, Laurent; Monks, Robert; Charron, Jean; Birnbaum, Morris J; Samavati, Lobelia

    2013-11-22

    Mitogen-activated protein kinase phosphatase-1 (MKP-1), also known as dual specificity phosphatase-1 (DUSP-1), plays a crucial role in the deactivation of MAPKs. Several drugs with immune-suppressive properties modulate MKP-1 expression as part of their mechanism of action. We investigated the effect of mTOR inhibition through rapamycin and a dual mTOR inhibitor (AZD2014) on MKP-1 expression. Low dose rapamycin led to a rapid activation of both AKT and ERK pathways with a subsequent increase in MKP-1 expression. Rapamycin treatment led to phosphorylation of CREB, transcription factor 1 (ATF1), and ATF2, three transcription factors that bind to the cyclic AMP-responsive elements on the Mkp-1 promoter. Inhibition of either the MEK/ERK or the AKT pathway attenuated rapamycin-mediated MKP-1 induction. AZD2014 did not activate AKT but activated the ERK pathway, leading to a moderate MKP-1 induction. Using bone marrow-derived macrophages (BMDMs) derived from wild-type (WT) mice or mice deficient in AKT1 and AKT2 isoforms or BMDM from targeted deficiency in MEK1 and MEK2, we show that rapamycin treatment led to an increased MKP1 expression in BMDM from WT but failed to do so in BMDMs lacking the AKT1 isoform or MEK1 and MEK2. Importantly, rapamycin pretreatment inhibited LPS-mediated p38 activation and decreased nitric oxide and IL-6 production. Our work provides a conceptual framework for the observed immune modulatory effect of mTOR inhibition.

  18. Lz-0 × Berkeley: a new Arabidopsis recombinant inbred line population for the mapping of complex traits.

    Science.gov (United States)

    Capron, Arnaud; Chang, Xue Feng; Shi, Chun; Beatson, Rodger; Berleth, Thomas

    2014-06-01

    This study describes the generation and test of a genetic resource suited to identify determinants of cell biological traits in plants. The use of quantitative trait loci (QTL) mapping for a better genetic understanding of cell biological traits is still at an early stage, even for biotechnologically important cell properties, such as the dimensions of fiber cells. A common strategy, the mapping of QTLs in recombinant inbred line (RIL) populations, is limited by the fact that the existing RIL populations exploit only a small fraction of the existing natural variation. Here, we report the mapping of QTLs impacting on the length of fiber cells in Arabidopsis inflorescence stems in a newly generated RIL population derived from a cross between the accessions Berkeley and the little known Lz-0. Through inbreeding of individual F(2) plants, a total of 159 new F8 lines were produced and genotyped with a set of 49 single nucleotide polymorphism markers. The population was successfully used not only for the mapping of three QTLs controlling fiber length, but also to map five QTL controlling flowering time under short and long-day conditions. Our study demonstrates the usefulness of this new genetic resource by mapping in it QTLs underlying a poorly explored cellular trait as well as an already better explored regulatory pathway. The new RIL population and an online platform for the continuous supplementation of genetic markers will be generally available to substantially broaden the genetic diversity through which loci with impact on plant quantitative traits can be identified.

  19. Role of signal transduction crosstalk between adenylyl cyclase and MAP kinase in hippocampus-dependent memory.

    Science.gov (United States)

    Xia, Zhengui; Storm, Daniel R

    2012-08-16

    One of the intriguing questions in neurobiology is how long-term memory (LTM) traces are established and maintained in the brain. Memory can be divided into at least two temporally and mechanistically distinct forms. Short-term memory (STM) lasts no longer than several hours, while LTM persists for days or longer. A crucial step in the generation of LTM is consolidation, a process in which STM is converted to LTM. Hippocampus-dependent LTM depends on activation of Ca(2+), Erk/MAP kinase (MAPK), and cAMP signaling pathways, as well as de novo gene expression and translation. One of the transcriptional pathways strongly implicated in LTM is the CREB/CRE (calcium, cAMP response element) transcriptional pathway. Interestingly, this transcriptional pathway may also contribute to other forms of neuroplasticity including adaptive responses to drugs. Evidence discussed in this review indicates that activation of the Erk1/2 MAP Kinase (MAPK)/CRE transcriptional pathway during the formation of hippocampus-dependent memory depends on calmodulin (CaM)-stimulated adenylyl cyclases.

  20. An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis.

    Science.gov (United States)

    Brachmann, Andreas; Schirawski, Jan; Müller, Philip; Kahmann, Regine

    2003-05-01

    In Ustilago maydis, pathogenic development is controlled by a heterodimer of the two homeodomain proteins bW and bE. We have identified by RNA fingerprinting a b-regulated gene, kpp6, which encodes an unusual MAP kinase. Kpp6 is similar to a number of other fungal MAP kinases involved in mating and pathogenicity, but contains an additional N-terminal domain unrelated to other proteins. Transcription of the kpp6 gene yields two transcripts differing in length, but encoding proteins of identical mass. One transcript is upregulated by the bW/bE heterodimer, while the other is induced after pheromone stimulation. kpp6 deletion mutants are attenuated in pathogenicity. kpp6(T355A,Y357F) mutants carrying a non-activatable allele of kpp6 are more severely compromised in pathogenesis. These strains can still form appressoria, but are defective in the subsequent penetration of the plant cuticle. Kpp6 is expressed during all stages of the sexual life cycle except mature spores. We speculate that Kpp6 may respond to a plant signal and regulate the genes necessary for efficient penetration of plant tissue.

  1. Valproate inhibits MAP kinase signalling and cell cycle progression in S. cerevisiae

    Science.gov (United States)

    Desfossés-Baron, Kristelle; Hammond-Martel, Ian; Simoneau, Antoine; Sellam, Adnane; Roberts, Stephen; Wurtele, Hugo

    2016-01-01

    The mechanism of action of valproate (VPA), a widely prescribed short chain fatty acid with anticonvulsant and anticancer properties, remains poorly understood. Here, the yeast Saccharomyces cerevisiae was used as model to investigate the biological consequences of VPA exposure. We found that low pH strongly potentiates VPA-induced growth inhibition. Transcriptional profiling revealed that under these conditions, VPA modulates the expression of genes involved in diverse cellular processes including protein folding, cell wall organisation, sexual reproduction, and cell cycle progression. We further investigated the impact of VPA on selected processes and found that this drug: i) activates markers of the unfolded protein stress response such as Hac1 mRNA splicing; ii) modulates the cell wall integrity pathway by inhibiting the activation of the Slt2 MAP kinase, and synergizes with cell wall stressors such as micafungin and calcofluor white in preventing yeast growth; iii) prevents activation of the Kss1 and Fus3 MAP kinases of the mating pheromone pathway, which in turn abolishes cellular responses to alpha factor; and iv) blocks cell cycle progression and DNA replication. Overall, our data identify heretofore unknown biological responses to VPA in budding yeast, and highlight the broad spectrum of cellular pathways influenced by this chemical in eukaryotes. PMID:27782169

  2. DETORQUEO, QUIRKY, and ZERZAUST represent novel components involved in organ development mediated by the receptor-like kinase STRUBBELIG in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Lynette Fulton

    2009-01-01

    Full Text Available Intercellular signaling plays an important role in controlling cellular behavior in apical meristems and developing organs in plants. One prominent example in Arabidopsis is the regulation of floral organ shape, ovule integument morphogenesis, the cell division plane, and root hair patterning by the leucine-rich repeat receptor-like kinase STRUBBELIG (SUB. Interestingly, kinase activity of SUB is not essential for its in vivo function, indicating that SUB may be an atypical or inactive receptor-like kinase. Since little is known about signaling by atypical receptor-like kinases, we used forward genetics to identify genes that potentially function in SUB-dependent processes and found recessive mutations in three genes that result in a sub-like phenotype. Plants with a defect in DETORQEO (DOQ, QUIRKY (QKY, and ZERZAUST (ZET show corresponding defects in outer integument development, floral organ shape, and stem twisting. The mutants also show sub-like cellular defects in the floral meristem and in root hair patterning. Thus, SUB, DOQ, QKY, and ZET define the STRUBBELIG-LIKE MUTANT (SLM class of genes. Molecular cloning of QKY identified a putative transmembrane protein carrying four C(2 domains, suggesting that QKY may function in membrane trafficking in a Ca(2+-dependent fashion. Morphological analysis of single and all pair-wise double-mutant combinations indicated that SLM genes have overlapping, but also distinct, functions in plant organogenesis. This notion was supported by a systematic comparison of whole-genome transcript profiles during floral development, which molecularly defined common and distinct sets of affected processes in slm mutants. Further analysis indicated that many SLM-responsive genes have functions in cell wall biology, hormone signaling, and various stress responses. Taken together, our data suggest that DOQ, QKY, and ZET contribute to SUB-dependent organogenesis and shed light on the mechanisms, which are dependent on

  3. The arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes

    KAUST Repository

    Meier, Stuart

    2010-01-26

    Background: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3?,5?-cyclic monophosphate (cGMP), has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC) enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. Principal Findings: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10) as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently coexpressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. Conclusions: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP. © 2010 Meier et al.

  4. Requirement for pectin methyl esterase and preference for fragmented over native pectins for wall-associated kinase-activated, EDS1/PAD4-dependent stress response in Arabidopsis.

    Science.gov (United States)

    Kohorn, Bruce D; Kohorn, Susan L; Saba, Nicholas J; Martinez, Victoriano Meco

    2014-07-01

    The wall-associated kinases (WAKs) have a cytoplasmic protein kinase domain that spans the plasma membrane and binds pectin in the extracellular matrix of plants. WAKs are required for cell expansion during Arabidopsis seedling development but are also an integral part of the response to pathogens and stress that present oligogalacturonides (OGs), which subsequently bind to WAKs and activate a MPK6 (mitogen-activated protein kinase)-dependent pathway. It was unclear how WAKs distinguish native pectin polymers and OGs to activate one or the other of these two pathways. A dominant allele of WAK2 constitutively activates the stress response, and we show here that the effect is dependent upon EDS1 and PAD4, transcriptional activators involved in the pathogen response. Moreover, the WAK2 dominant allele is suppressed by a null allele of a pectin methyl esterase (PME3) whose activity normally leads to cross-linking of pectins in the cell wall. Although OGs activate a transcriptional response in wild type, the response is enhanced in a pme3/pme3 null, consistent with a competition by OG and native polymers for activation of WAKs. This provides a plausible mechanism for WAKs to distinguish an expansion from a stress pathway.

  5. The Arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes.

    Directory of Open Access Journals (Sweden)

    Stuart Meier

    Full Text Available BACKGROUND: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3',5'-cyclic monophosphate (cGMP, has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. PRINCIPAL FINDINGS: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10 as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10(431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently co-expressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. CONCLUSIONS: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP.

  6. Comparison of mixed-model approaches for association mapping in rapeseed, potato, sugar beet, maize, and Arabidopsis

    Directory of Open Access Journals (Sweden)

    Stich Benjamin

    2009-02-01

    Full Text Available Abstract Background In recent years, several attempts have been made in plant genetics to detect QTL by using association mapping methods. The objectives of this study were to (i evaluate various methods for association mapping in five plant species and (ii for three traits in each of the plant species compare the Topt, the restricted maximum likelihood (REML estimate of the conditional probability that two genotypes carry at the same locus alleles that are identical in state but not identical by descent. In order to compare the association mapping methods based on scenarios with realistic estimates of population structure and familial relatedness, we analyzed phenotypic and genotypic data of rapeseed, potato, sugar beet, maize, and Arabidopsis. For the same reason, QTL effects were simulated on top of the observed phenotypic values when examining the adjusted power for QTL detection. Results The correlation between the Topt values identified using REML deviance profiles and profiles of the mean of squared difference between observed and expected P values was 0.83. Conclusion The mixed-model association mapping approaches using a kinship matrix, which was based on Topt, were more appropriate for association mapping than the recently proposed QK method with respect to the adherence to the nominal α level and the adjusted power for QTL detection. Furthermore, we showed that Topt differs considerably among the five plant species but only marginally among different traits.

  7. A maize calcium-dependent protein kinase gene, ZmCPK4, positively regulated abscisic acid signaling and enhanced drought stress tolerance in transgenic Arabidopsis.

    Science.gov (United States)

    Jiang, Shanshan; Zhang, Dan; Wang, Li; Pan, Jiaowen; Liu, Yang; Kong, Xiangpei; Zhou, Yan; Li, Dequan

    2013-10-01

    Calcium-dependent protein kinases (CDPKs) play essential roles in calcium-mediated signal transductions in plant response to abiotic stress. Several members have been identified to be regulators for plants response to abscisic acid (ABA) signaling. Here, we isolated a subgroup I CDPK gene, ZmCPK4, from maize. Quantitative real time PCR (qRT-PCR) analysis revealed that the ZmCPK4 transcripts were induced by various stresses and signal molecules. Transient and stable expression of the ZmCPK4-GFP fusion proteins revealed ZmCPK4 localized to the membrane. Moreover, overexpression of ZmCPK4 in the transgenic Arabidopsis enhanced ABA sensitivity in seed germination, seedling growth and stomatal movement. The transgenic plants also enhanced drought stress tolerance. Taken together, the results suggest that ZmCPK4 might be involved in ABA-mediated regulation of stomatal closure in response to drought stress.

  8. Arabidopsis thaliana Somatic Embryogenesis Receptor Kinase I protein is present in sporophytic and gametophytic cells and undergoes endocytosis

    NARCIS (Netherlands)

    Kwaaitaal, M.A.C.J.; Vries, de S.C.; Russinova, E.T.

    2005-01-01

    Arabidopsis thaliana plants expressing AtSERK1 fused to yellow-fluorescent protein were generated. Fluorescence was detected predominantly at the cell periphery, most likely the plasma membrane, of cells in ovules, embryo sacs, anthers, and embryos and in seedlings. The AtSERK1 protein was detected

  9. The functional interplay between protein kinase CK2 and CCA1 transcriptional activity is essential for clock temperature compensation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sergi Portolés

    2010-11-01

    Full Text Available Circadian rhythms are daily biological oscillations driven by an endogenous mechanism known as circadian clock. The protein kinase CK2 is one of the few clock components that is evolutionary conserved among different taxonomic groups. CK2 regulates the stability and nuclear localization of essential clock proteins in mammals, fungi, and insects. Two CK2 regulatory subunits, CKB3 and CKB4, have been also linked with the Arabidopsis thaliana circadian system. However, the biological relevance and the precise mechanisms of CK2 function within the plant clockwork are not known. By using ChIP and Double-ChIP experiments together with in vivo luminescence assays at different temperatures, we were able to identify a temperature-dependent function for CK2 modulating circadian period length. Our study uncovers a previously unpredicted mechanism for CK2 antagonizing the key clock regulator CIRCADIAN CLOCK-ASSOCIATED 1 (CCA1. CK2 activity does not alter protein accumulation or subcellular localization but interferes with CCA1 binding affinity to the promoters of the oscillator genes. High temperatures enhance the CCA1 binding activity, which is precisely counterbalanced by the CK2 opposing function. Altering this balance by over-expression, mutation, or pharmacological inhibition affects the temperature compensation profile, providing a mechanism by which plants regulate circadian period at changing temperatures. Therefore, our study establishes a new model demonstrating that two opposing and temperature-dependent activities (CCA1-CK2 are essential for clock temperature compensation in Arabidopsis.

  10. Purification of reversibly oxidized proteins (PROP reveals a redox switch controlling p38 MAP kinase activity.

    Directory of Open Access Journals (Sweden)

    Dennis J Templeton

    Full Text Available Oxidation of cysteine residues of proteins is emerging as an important means of regulation of signal transduction, particularly of protein kinase function. Tools to detect and quantify cysteine oxidation of proteins have been a limiting factor in understanding the role of cysteine oxidation in signal transduction. As an example, the p38 MAP kinase is activated by several stress-related stimuli that are often accompanied by in vitro generation of hydrogen peroxide. We noted that hydrogen peroxide inhibited p38 activity despite paradoxically increasing the activating phosphorylation of p38. To address the possibility that cysteine oxidation may provide a negative regulatory effect on p38 activity, we developed a biochemical assay to detect reversible cysteine oxidation in intact cells. This procedure, PROP, demonstrated in vivo oxidation of p38 in response to hydrogen peroxide and also to the natural inflammatory lipid prostaglandin J2. Mutagenesis of the potential target cysteines showed that oxidation occurred preferentially on residues near the surface of the p38 molecule. Cysteine oxidation thus controls a functional redox switch regulating the intensity or duration of p38 activity that would not be revealed by immunodetection of phosphoprotein commonly interpreted as reflective of p38 activity.

  11. Overexpression of a maize SNF-related protein kinase gene, ZmSnRK2.11, reduces salt and drought tolerance in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    ZHANG Fan; CHEN Xun-ji; WANG Jian-hua; ZHENG Jun

    2015-01-01

    Sucrose non-fermenting-1 related protein kinase 2 (SnRK2) is a unique family of protein kinases associated with abiotic stress signal transduction in plants. In this study, a maize SnRK2 gene ZmSnRK2.11 was cloned and characterized. The results showed that ZmSnRK2.11 is up-regulated by high-salinity and dehydration treatment, and it is expressed mainly in maize mature leaf. A transient expression assay using onion epidermal cel s revealed that ZmSnRK2.11-GFP fusion proteins are localized to both the nucleus and cytoplasm. Overexpressing-ZmSnRK2.11 in Arabidopsis resulted in salt and drought sensitivity phenotypes that exhibited an increased rate of water loss, reduced relative water content, delayed stoma closure, accumulated less free proline content and increased malondialdehyde (MDA) content relative to the phenotypes observed in wild-type (WT) control. Furthermore, overexpression of ZmSnRK2.11 up-regulated the expression of the genes ABI1 and ABI2 and decreased the expression of DREB2A and P5CS1. Taken together, our results suggest that ZmSnRK2.11 is a possible negative regulator involved in the salt and drought stress signal transduction pathways in plants.

  12. The MAP kinase-activated protein kinase Rck2p regulates cellular responses to cell wall stresses, filamentation and virulence in the human fungal pathogen Candida albicans.

    Science.gov (United States)

    Li, Xichuan; Du, Wei; Zhao, Jingwen; Zhang, Lilin; Zhu, Zhiyan; Jiang, Linghuo

    2010-06-01

    Rck2p is the Hog1p-MAP kinase-activated protein kinase required for the attenuation of protein synthesis in response to an osmotic challenge in Saccharomyces cerevisiae. Rck2p also regulates rapamycin sensitivity in both S. cerevisiae and Candida albicans. In this study, we demonstrate that the deletion of CaRCK2 renders C. albicans cells sensitive to, and CaRck2p translocates from the cytosol to the nucleus in response to, cell wall stresses caused by Congo red, Calcoflor White, elevated heat and zymolyase. However, the kinase activity of CaRck2p is not required for the cellular response to these cell wall stresses. Furthermore, transcripts of cell wall protein-encoding genes CaBGL2, CaHWP1 and CaXOG1 are reduced in C. albicans cells lacking CaRCK2. The deletion of CaRCK2 also reduces the in vitro filamentation of C. albicans and its virulence in a mouse model of systemic candidasis. The kinase activity of CaRck2p is required for the virulence, but not for the in vitro filamentation, in C. albicans. Therefore, Rck2p regulates cellular responses to cell wall stresses, filamentation and virulence in the human fungal pathogen C. albicans.

  13. Protein kinase D stabilizes aldosterone-induced ERK1/2 MAP kinase activation in M1 renal cortical collecting duct cells to promote cell proliferation.

    LENUS (Irish Health Repository)

    McEneaney, Victoria

    2010-01-01

    Aldosterone elicits transcriptional responses in target tissues and also rapidly stimulates the activation of protein kinase signalling cascades independently of de novo protein synthesis. Here we investigated aldosterone-induced cell proliferation and extra-cellular regulated kinase 1 and 2 (ERK1\\/2) mitogen activated protein (MAP) kinase signalling in the M1 cortical collecting duct cell line (M1-CCD). Aldosterone promoted the proliferative growth of M1-CCD cells, an effect that was protein kinase D1 (PKD1), PKCdelta and ERK1\\/2-dependent. Aldosterone induced the rapid activation of ERK1\\/2 with peaks of activation at 2 and 10 to 30 min after hormone treatment followed by sustained activation lasting beyond 120 min. M1-CCD cells suppressed in PKD1 expression exhibited only the early, transient peaks in ERK1\\/2 activation without the sustained phase. Aldosterone stimulated the physical association of PKD1 with ERK1\\/2 within 2 min of treatment. The mineralocorticoid receptor (MR) antagonist RU28318 inhibited the early and late phases of aldosterone-induced ERK1\\/2 activation, and also aldosterone-induced proliferative cell growth. Aldosterone induced the sub-cellular redistribution of ERK1\\/2 to the nuclei at 2 min and to cytoplasmic sites, proximal to the nuclei after 30 min. This sub-cellular distribution of ERK1\\/2 was inhibited in cells suppressed in the expression of PKD1.

  14. Adiponectin inhibits neutrophil apoptosis via activation of AMP kinase, PKB and ERK 1/2 MAP kinase.

    Science.gov (United States)

    Rossi, Alessandra; Lord, Janet M

    2013-12-01

    Neutrophils are abundant, short-lived leukocytes that play a key role in the immune defense against microbial infections. These cells die by apoptosis following activation and uptake of microbes and will also enter apoptosis spontaneously at the end of their lifespan if they do not encounter a pathogen. Adiponectin exerts anti-inflammatory effects on neutrophil antimicrobial functions, but whether this abundant adipokine influences neutrophil apoptosis is unknown. Here we report that adiponectin in the physiological range (1-10 μg/ml) reduced apoptosis in resting neutrophils, decreasing caspase-3 cleavage and maintaining Mcl-1 expression by stabilizing this anti-apoptotic protein. We show that adiponectin induced phosphorylation of AMP-activated kinase (AMPK), protein kinase B (PKB), extracellular signal-regulated kinase (ERK 1/2) and p38 mitogen activated protein kinase (MAPK). Pharmacological inhibition of AMPK, PKB and ERK 1/2 ablated the pro-survival effects of adiponectin and treatment of neutrophils with an AMPK specific activator (AICAR) and AMPK inhibitor (compound C) respectively decreased and increased apoptosis. Finally, activation of AMPK by AICAR or adiponectin also decreased ceramide accumulation in the neutrophil cell membrane, a process involved in the early stages of spontaneous apoptosis, giving another possible mechanism downstream of AMPK activation for the inhibition of neutrophil apoptosis.

  15. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Science.gov (United States)

    Kim, Tae-Hwan; Kwak, Yi-Seong; Kim, Na-Mi; Kim, Seung-Hyung

    2017-01-01

    Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin's effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun) activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound's potential as a candidate anti-inflammatory agent. PMID:28316375

  16. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Directory of Open Access Journals (Sweden)

    Mehari Endale

    2017-01-01

    Full Text Available Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin’s effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound’s potential as a candidate anti-inflammatory agent.

  17. Panaxynol induces neurite outgrowth in PC12D cells via cAMP- and MAP kinase-dependent mechanisms.

    Science.gov (United States)

    Wang, Ze-Jian; Nie, Bao-Ming; Chen, Hong-Zhuan; Lu, Yang

    2006-01-05

    Panaxynol, a polyacetylene ((3R)-heptadeca-1,9-diene-4,6-diyn-3-ol; syn. falcarinol), was isolated from the lipophilic fractions of Panax notoginseng, a Chinese traditional medicinal plant. In the present study, we reported the neurotrophic effects of panaxynol on PC12D cells and mechanism involved in neurite outgrowth of the cells. Panaxynol could morphologically promote neurite outgrowth in PC12D cells, concentration-dependently reduce cell division and up-regulate molecular marker (MAP1B) expression in PC12D cells. Panaxynol induces the elevation of intracellular cAMP in PC12D cells. The neurite outgrowth in PC12D cells induced by panaxynol could be inhibited by the protein kinase A inhibitor RpcAMPS and by MAP kinase kinase 1/2 inhibitor U0126. These observations reveal that panaxynol could induce the differentiation of PC12D cells in a process similar to but distinct from that of NGF and the panaxynol's effects were via cAMP- and MAP kinase-dependent mechanisms.

  18. Dual role for membrane localization in yeast MAP kinase cascade activation and its contribution to signaling fidelity.

    Science.gov (United States)

    Lamson, Rachel E; Takahashi, Satoe; Winters, Matthew J; Pryciak, Peter M

    2006-03-21

    Distinct MAP kinase pathways in yeast share several signaling components , including the PAK Ste20 and the MAPKKK Ste11, yet signaling is specific. Mating pheromones trigger an initial step in which Ste20 activates Ste11 , and this requires plasma membrane recruitment of the MAP kinase cascade scaffold protein, Ste5 . Here, we demonstrate an additional role for Ste5 membrane localization. Once Ste11 is activated, signaling through the mating pathway remains minimal but is substantially amplified when Ste5 is recruited to the membrane either by the Gbetagamma dimer or by direct membrane targeting, even to internal membranes. Ste11 signaling is also amplified by Ste5 oligomerization and by a hyperactivating mutation in the Ste7 binding region of Ste5. We suggest a model in which membrane recruitment of Ste5 concentrates its binding partners and thereby amplifies signaling through the kinase cascade. We find similar behavior in the osmotically responsive HOG pathway. Remarkably, while both pheromone and hyperosmotic stimuli amplify signaling from constitutively active Ste11, the resulting signaling output remains pathway specific. These findings suggest a common mode of regulation in which pathway stimuli both initiate and amplify MAP kinase cascade signaling. The regulation of rate-limiting steps that lie after a branchpoint from shared components helps ensure signaling specificity.

  19. The plastid-localized pfkB-type carbohydrate kinases FRUCTOKINASE-LIKE 1 and 2 are essential for growth and development of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gilkerson Jonathan

    2012-07-01

    Full Text Available Abstract Background Transcription of plastid-encoded genes requires two different DNA-dependent RNA polymerases, a nuclear-encoded polymerase (NEP and plastid-encoded polymerase (PEP. Recent studies identified two related pfkB-type carbohydrate kinases, named FRUCTOKINASE-LIKE PROTEIN (FLN1 and FLN2, as components of the thylakoid bound PEP complex in both Arabidopsis thaliana and Sinapis alba (mustard. Additional work demonstrated that RNAi-mediated reduction in FLN expression specifically diminished transcription of PEP-dependent genes. Results Here, we report the characterization of Arabidopsis FLN knockout alleles to examine the contribution of each gene in plant growth, chloroplast development, and in mediating PEP-dependent transcription. We show that fln plants have severe phenotypes with fln1 resulting in an albino phenotype that is seedling lethal without a source of exogenous carbon. In contrast, fln2 plants display chlorosis prior to leaf expansion, but exhibit slow greening, remain autotrophic, can grow to maturity, and set viable seed. fln1 fln2 double mutant analysis reveals haplo-insufficiency, and fln1 fln2 plants have a similar, but more severe phenotype than either single mutant. Normal plastid development in both light and dark requires the FLNs, but surprisingly skotomorphogenesis is unaffected in fln seedlings. Seedlings genetically fln1-1 with dexamethasone-inducible FLN1-HA expression at germination are phenotypically indistinguishable from wild-type. Induction of FLN-HA after 24 hours of germination cannot rescue the mutant phenotype, indicating that the effects of loss of FLN are not always reversible. Examination of chloroplast gene expression in fln1-1 and fln2-1 by qRT-PCR reveals that transcripts of PEP-dependent genes were specifically reduced compared to NEP-dependent genes in both single mutants. Conclusions Our results demonstrate that each FLN protein contributes to wild type growth, and acting additively are

  20. Mitogen-activated protein kinase 4 is a salicylic acid-independent regulator of growth but not of photosynthesis in Arabidopsis.

    Science.gov (United States)

    Gawroński, Piotr; Witoń, Damian; Vashutina, Kateryna; Bederska, Magdalena; Betliński, Błażej; Rusaczonek, Anna; Karpiński, Stanisław

    2014-07-01

    Mitogen-activated protein kinase (MAPK) pathways regulate signal transduction from different cellular compartments and from the extracellular environment to the nucleus in all eukaryotes. One of the best-characterized MAPKs in Arabidopsis thaliana is MPK4, which was shown to be a negative regulator of systemic-acquired resistance. The mpk4 mutant accumulates salicylic acid (SA), possesses constitutive expression of pathogenesis-related (PR) genes, and has an extremely dwarf phenotype. We show that suppression of SA and phylloquinone synthesis in chloroplasts by knocking down the ICS1 gene (by crossing it with the ics1 mutant) in the mpk4 mutant background did not revert mpk4-impaired growth. However, it did cause changes in the photosynthetic apparatus and severely impaired the quantum yield of photosystem II. Transmission microscopy analysis revealed that the chloroplasts' structure was strongly altered in the mpk4 and mpk4/ics1 double mutant. Analysis of reactive oxygen species (ROS)-scavenging enzymes expression showed that suppression of SA and phylloquinone synthesis in the chloroplasts of the mpk4 mutant caused imbalances in ROS homeostasis which were more pronounced in mpk4/ics1 than in mpk4. Taken together, the presented results strongly suggest that MPK4 is an ROS/hormonal rheostat hub that negatively, in an SA-dependent manner, regulates immune defenses, but at the same time positively regulates photosynthesis, ROS metabolism, and growth. Therefore, we concluded that MPK4 is a complex regulator of chloroplastic retrograde signaling for photosynthesis, growth, and immune defenses in Arabidopsis.

  1. Analysis of the Mitogen-activated protein kinase kinase 4 (MAP2K4 tumor suppressor gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Ryland Georgina L

    2011-05-01

    Full Text Available Abstract Background MAP2K4 is a putative tumor and metastasis suppressor gene frequently found to be deleted in various cancer types. We aimed to conduct a comprehensive analysis of this gene to assess its involvement in ovarian cancer. Methods We screened for mutations in MAP2K4 using High Resolution Melt analysis of 149 primary ovarian tumors and methylation at the promoter using Methylation-Specific Single-Stranded Conformation Polymorphism analysis of 39 tumors. We also considered the clinical impact of changes in MAP2K4 using publicly available expression and copy number array data. Finally, we used siRNA to measure the effect of reducing MAP2K4 expression in cell lines. Results In addition to 4 previously detected homozygous deletions, we identified a homozygous 16 bp truncating deletion and a heterozygous 4 bp deletion, each in one ovarian tumor. No promoter methylation was detected. The frequency of MAP2K4 homozygous inactivation was 5.6% overall, and 9.8% in high-grade serous cases. Hemizygous deletion of MAP2K4 was observed in 38% of samples. There were significant correlations of copy number and expression in three microarray data sets. There was a significant correlation between MAP2K4 expression and overall survival in one expression array data set, but this was not confirmed in an independent set. Treatment of JAM and HOSE6.3 cell lines with MAP2K4 siRNA showed some reduction in proliferation. Conclusions MAP2K4 is targeted by genetic inactivation in ovarian cancer and restricted to high grade serous and endometrioid carcinomas in our cohort.

  2. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    Science.gov (United States)

    Jandric, Zeljkica; Gregori, Christa; Klopf, Eva; Radolf, Martin; Schüller, Christoph

    2013-01-01

    Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in C. glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologs CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG) pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species and it required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway. PMID:24324463

  3. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    Directory of Open Access Journals (Sweden)

    Zeljkica eJandric

    2013-11-01

    Full Text Available Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in Candida glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologues CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species, and required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway.

  4. Lck is involved in interleukin-2 induced proliferation but not cell survival in human T cells through a MAP kinase-independent pathway

    DEFF Research Database (Denmark)

    Brockdorff, J; Nielsen, M; Kaltoft, K;

    2000-01-01

    found that an IL-2-sensitive, human mycosis fungoides-derived tumor T cell line is Lck negative, and that the IL-2-induced MAP kinase activation is comparable to non-cancerous T cells, although a little delayed in kinetics. An Lck expressing clone was established by transfecting Lck into mycosis...... fungoides tumor T cells, but Lck had no influence on the delayed kinetics of MAP kinase activation, indicating that Lck is not essential for MAP kinase activation in mycosis fungoides tumor T cells or in non-cancerous T cells. Taken together, this indicates that Lck is involved in IL-2-induced proliferation...

  5. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Serena A D'Souza

    2016-04-01

    Full Text Available The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle's plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue.

  6. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.

    Science.gov (United States)

    D'Souza, Serena A; Rajendran, Luckshika; Bagg, Rachel; Barbier, Louis; van Pel, Derek M; Moshiri, Houtan; Roy, Peter J

    2016-04-01

    The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle's plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue.

  7. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans

    Science.gov (United States)

    D’Souza, Serena A.; Rajendran, Luckshika; Bagg, Rachel; van Pel, Derek M.; Moshiri, Houtan; Roy, Peter J.

    2016-01-01

    The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle’s plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue. PMID:27123983

  8. The Arabidopsis thaliana lectin receptor kinase LecRK-I.9 is required for full resistance to Pseudomonas syringae and affects jasmonate signalling.

    Science.gov (United States)

    Balagué, Claudine; Gouget, Anne; Bouchez, Olivier; Souriac, Camille; Haget, Nathalie; Boutet-Mercey, Stéphanie; Govers, Francine; Roby, Dominique; Canut, Hervé

    2016-07-11

    On microbial attack, plants can detect invaders and activate plant innate immunity. For the detection of pathogen molecules or cell wall damage, plants employ receptors that trigger the activation of defence responses. Cell surface proteins that belong to large families of lectin receptor kinases are candidates to function as immune receptors. Here, the function of LecRK-I.9 (At5g60300), a legume-type lectin receptor kinase involved in cell wall-plasma membrane contacts and in extracellular ATP (eATP) perception, was studied through biochemical, gene expression and reverse genetics approaches. In Arabidopsis thaliana, LecRK-I.9 expression is rapidly, highly and locally induced on inoculation with avirulent strains of Pseudomonas syringae pv. tomato (Pst). Two allelic lecrk-I.9 knock-out mutants showed decreased resistance to Pst. Conversely, over-expression of LecRK-I.9 led to increased resistance to Pst. The analysis of defence gene expression suggests an alteration of both the salicylic acid (SA) and jasmonic acid (JA) signalling pathways. In particular, LecRK-I.9 expression during plant-pathogen interaction was dependent on COI1 (CORONATINE INSENSITIVE 1) and JAR1 (JASMONATE RESISTANT 1) components, and JA-responsive transcription factors (TFs) showed altered levels of expression in plants over-expressing LecRK-I.9. A similar misregulation of these TFs was obtained by JA treatment. This study identified LecRK-I.9 as necessary for full resistance to Pst and demonstrated its involvement in the control of defence against pathogens through a regulation of JA signalling components. The role of LecRK-I.9 is discussed with regard to the potential molecular mechanisms linking JA signalling to cell wall damage and/or eATP perception.

  9. A Cyclin Dependent Kinase Regulatory Subunit (CKS) Gene of Pigeonpea Imparts Abiotic Stress Tolerance and Regulates Plant Growth and Development in Arabidopsis.

    Science.gov (United States)

    Tamirisa, Srinath; Vudem, Dashavantha R; Khareedu, Venkateswara R

    2017-01-01

    Frequent climatic changes in conjunction with other extreme environmental factors are known to affect growth, development and productivity of diverse crop plants. Pigeonpea, a major grain legume of the semiarid tropics, endowed with an excellent deep-root system, is known as one of the important drought tolerant crop plants. Cyclin dependent kinases (CDKs) are core cell cycle regulators and play important role in different aspects of plant growth and development. The cyclin-dependent kinase regulatory subunit gene (CKS) was isolated from the cDNA library of pigeonpea plants subjected to drought stress. Pigeonpea CKS (CcCKS) gene expression was detected in both the root and leaf tissues of pigeonpea and was upregulated by polyethylene glycol (PEG), mannitol, NaCl and abscisic acid (ABA) treatments. The overexpression of CcCKS gene in Arabidopsis significantly enhanced tolerance of transgenics to drought and salt stresses as evidenced by different physiological parameters. Under stress conditions, transgenics showed higher biomass, decreased rate of water loss, decreased MDA levels, higher free proline contents, and glutathione levels. Moreover, under stress conditions transgenics exhibited lower stomatal conductance, lower transpiration, and higher photosynthetic rates. However, under normal conditions, CcCKS-transgenics displayed decreased plant growth rate, increased cell size and decreased stomatal number compared to those of wild-type plants. Real-time polymerase chain reaction revealed that CcCKS could regulate the expression of both ABA-dependent and ABA-independent genes associated with abiotic stress tolerance as well as plant growth and development. As such, the CcCKS seems promising and might serve as a potential candidate gene for enhancing the abiotic stress tolerance of crop plants.

  10. Context Specificity of Stress-activated Mitogen-activated Protein (MAP) Kinase Signaling: The Story as Told by Caenorhabditis elegans.

    Science.gov (United States)

    Andrusiak, Matthew G; Jin, Yishi

    2016-04-01

    Stress-associated p38 and JNK mitogen-activated protein (MAP) kinase signaling cascades trigger specific cellular responses and are involved in multiple disease states. At the root of MAP kinase signaling complexity is the differential use of common components on a context-specific basis. The roundwormCaenorhabditis eleganswas developed as a system to study genes required for development and nervous system function. The powerful genetics ofC. elegansin combination with molecular and cellular dissections has led to a greater understanding of how p38 and JNK signaling affects many biological processes under normal and stress conditions. This review focuses on the studies revealing context specificity of different stress-activated MAPK components inC. elegans.

  11. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  12. Mycosporine-Like Amino Acids Promote Wound Healing through Focal Adhesion Kinase (FAK and Mitogen-Activated Protein Kinases (MAP Kinases Signaling Pathway in Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yun-Hee Choi

    2015-11-01

    Full Text Available Mycosporine-like amino acids (MAAs are secondary metabolites found in diverse marine, freshwater, and terrestrial organisms. Evidence suggests that MAAs have several beneficial effects on skin homeostasis such as protection against UV radiation and reactive oxygen species (ROS. In addition, MAAs are also involved in the modulation of skin fibroblasts proliferation. However, the regulatory function of MAAs on wound repair in human skin is not yet clearly elucidated. To investigate the roles of MAAs on the wound healing process in human keratinocytes, three MAAs, Shinorine (SH, Mycosporine-glycine (M-Gly, and Porphyra (P334 were purified from Chlamydomonas hedlyei and Porphyra yezoensis. We found that SH, M-Gly, and P334 have significant effects on the wound healing process in human keratinocytes and these effects were mediated by activation of focal adhesion kinases (FAK, extracellular signal-regulated kinases (ERK, and c-Jun N-terminal kinases (JNK. These results suggest that MAAs accelerate wound repair by activating the FAK-MAPK signaling pathways. This study also indicates that MAAs can act as a new wound healing agent and further suggests that MAAs might be a novel biomaterial for wound healing therapies.

  13. Novel Genes Affecting the Interaction between the Cabbage Whitefly and Arabidopsis Uncovered by Genome-Wide Association Mapping.

    Science.gov (United States)

    Broekgaarden, Colette; Bucher, Johan; Bac-Molenaar, Johanna; Keurentjes, Joost J B; Kruijer, Willem; Voorrips, Roeland E; Vosman, Ben

    2015-01-01

    Plants have evolved a variety of ways to defend themselves against biotic attackers. This has resulted in the presence of substantial variation in defense mechanisms among plants, even within a species. Genome-wide association (GWA) mapping is a useful tool to study the genetic architecture of traits, but has so far only had limited exploitation in studies of plant defense. Here, we study the genetic architecture of defense against the phloem-feeding insect cabbage whitefly (Aleyrodes proletella) in Arabidopsis thaliana. We determined whitefly performance, i.e. the survival and reproduction of whitefly females, on 360 worldwide selected natural accessions and subsequently performed GWA mapping using 214,051 SNPs. Substantial variation for whitefly adult survival and oviposition rate (number of eggs laid per female per day) was observed between the accessions. We identified 39 candidate SNPs for either whitefly adult survival or oviposition rate, all with relatively small effects, underpinning the complex architecture of defense traits. Among the corresponding candidate genes, i.e. genes in linkage disequilibrium (LD) with candidate SNPs, none have previously been identified as a gene playing a role in the interaction between plants and phloem-feeding insects. Whitefly performance on knock-out mutants of a number of candidate genes was significantly affected, validating the potential of GWA mapping for novel gene discovery in plant-insect interactions. Our results show that GWA analysis is a very useful tool to gain insight into the genetic architecture of plant defense against herbivorous insects, i.e. we identified and validated several genes affecting whitefly performance that have not previously been related to plant defense against herbivorous insects.

  14. The signalling mucin Msb2 regulates surface sensing and host penetration via BMP1 MAP kinase signalling in Botrytis cinerea.

    Science.gov (United States)

    Leroch, Michaela; Mueller, Nathalie; Hinsenkamp, Isabel; Hahn, Matthias

    2015-10-01

    Botrytis cinerea is a necrotrophic fungus that infects a wide range of fruit, vegetable and flower crops. Penetration of the host cuticle occurs via infection structures that are formed in response to appropriate plant surface signals. The differentiation of these structures requires a highly conserved mitogen-activated protein (MAP) kinase cascade including the MAP kinase BMP1. In yeast and several plant-pathogenic fungi, the signalling mucin Msb2 has been shown to be involved in surface recognition and MAP kinase activation. In this study, a B. cinerea msb2 mutant was generated and characterized. The mutant showed normal growth, sporulation, sclerotia formation and stress resistance. In the absence of nutrients, abnormal germination with multiple germ tubes was observed. In the presence of sugars, normal germination occurred, but msb2 germlings were almost unable to form appressoria or infection cushions on hard surfaces. Nevertheless, the msb2 mutant showed only a moderate delay in lesion formation on different host plants, and formed expanding lesions similar to the wild-type. Although the wild-type showed increasing BMP1 phosphorylation during the first hours of germination on hard surfaces, the phosphorylation levels in the msb2 mutant were strongly reduced. Several genes encoding secreted proteins were found to be co-regulated by BMP1 and Msb2 during germination. Taken together, B. cinerea Msb2 is likely to represent a hard surface sensor of germlings and hyphae that triggers infection structure formation via the activation of the BMP1 MAP kinase pathway.

  15. Functional screening of willow alleles in Arabidopsis combined with QTL mapping in willow (Salix) identifies SxMAX4 as a coppicing response gene.

    Science.gov (United States)

    Salmon, Jemma; Ward, Sally P; Hanley, Steven J; Leyser, Ottoline; Karp, Angela

    2014-05-01

    Willows (Salix spp.) are important biomass crops due to their ability to grow rapidly with low fertilizer inputs and ease of cultivation in short-rotation coppice cycles. They are relatively undomesticated and highly diverse, but functional testing to identify useful allelic variation is time-consuming in trees and transformation is not yet possible in willow. Arabidopsis is heralded as a model plant from which knowledge can be transferred to advance the improvement of less tractable species. Here, knowledge and methodologies from Arabidopsis were successfully used to identify a gene influencing stem number in coppiced willows, a complex trait of key biological and industrial relevance. The strigolactone-related More AXillary growth (MAX) genes were considered candidates due to their role in shoot branching. We previously demonstrated that willow and Arabidopsis show similar response to strigolactone and that transformation rescue of Arabidopsis max mutants with willow genes could be used to detect allelic differences. Here, this approach was used to screen 45 SxMAX1, SxMAX2, SxMAX3 and SxMAX4 alleles cloned from 15 parents of 11 mapping populations varying in shoot-branching traits. Single-nucleotide polymorphism (SNP) frequencies were locus dependent, ranging from 29.2 to 74.3 polymorphic sites per kb. SxMAX alleles were 98%-99% conserved at the amino acid level, but different protein products varying in their ability to rescue Arabidopsis max mutants were identified. One poor rescuing allele, SxMAX4D, segregated in a willow mapping population where its presence was associated with increased shoot resprouting after coppicing and colocated with a QTL for this trait.

  16. Arabidopsis eIF2α kinase GCN2 is essential for growth in stress conditions and is activated by wounding

    Directory of Open Access Journals (Sweden)

    Robaglia Christophe

    2008-12-01

    Full Text Available Abstract Background Phosphorylation of eIF2α provides a key mechanism for down-regulating protein synthesis in response to nutrient starvation or stresses in mammalian and yeast cells. However, this process has not been well characterized in plants Results We show here that in response to amino acid and purine starvations, UV, cold shock and wounding, the Arabidopsis GCN2 kinase (AtGCN2 is activated and phosphorylates eIF2α. We show that AtGCN2 is essential for plant growth in stress situations and that its activity results in a strong reduction in global protein synthesis. Conclusion Our results suggest that a general amino acid control response is conserved between yeast and plants but that the plant enzyme evolved to fulfill a more general function as an upstream sensor and regulator of diverse stress-response pathways. The activation of AtGCN2 following wounding or exposure to methyl jasmonate, the ethylene precursor 1-Aminocyclopropane-1-carboxylic acid (ACC and salicylic acid, further suggests that this enzyme could play a role in plant defense against insect herbivores.

  17. Stimulation of MAP kinase pathways after maternal IL-1β exposure induces fetal lung fluid absorption in guinea pigs

    Directory of Open Access Journals (Sweden)

    Carter Ethan P

    2007-03-01

    Full Text Available Abstract Background We tested the hypothesis that maternal interleukin-1β (IL-1β pretreatment and induction of fetal cortisol synthesis activates MAP kinases and thereby affects lung fluid absorption in preterm guinea pigs. Methods IL-1β was administered subcutaneously daily to timed-pregnant guinea pigs for three days. Fetuses were obtained by abdominal hysterotomy and instilled with isosmolar 5% albumin into the lungs and lung fluid movement was measured over 1 h by mass balance. MAP kinase expression was measured by western blot. Results Lung fluid absorption was induced at 61 days (D gestation and stimulated at 68D gestation by IL-1β. Maternal IL-1β pretreatment upregulated ERK and upstream MEK expression at both 61 and 68D gestation, albeit being much more pronounced at 61D gestation. U0126 instillation completely blocked IL-1β-induced lung fluid absorption as well as IL-1β-induced/stimulated ERK expression. Cortisol synthesis inhibition by metyrapone attenuated ERK expression and lung fluid absorption in IL-1β-pretreated fetal lungs. JNK expression after maternal IL-1β pretreatment remained unaffected at either gestation age. Conclusion These data implicate the ERK MAP kinase pathway as being important for IL-1β induction/stimulation of lung fluid absorption in fetal guinea pigs.

  18. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro.

    Science.gov (United States)

    Roth, G; Kotzka, J; Kremer, L; Lehr, S; Lohaus, C; Meyer, H E; Krone, W; Müller-Wieland, D

    2000-10-27

    Sterol regulatory element-binding protein (SREBP)-1a is a transcription factor sensing cellular cholesterol levels and integrating gene regulatory signals mediated by MAP kinase cascades. Here we report the identification of serine 117 in SREBP-1a as the major phosphorylation site of the MAP kinases Erk1/2. This site was identified by nanoelectrospray mass spectrometry and peptide sequencing of recombinant fusion proteins phosphorylated by Erk1/2 in vitro. Serine 117 was verified as the major phosphorylation site by in vitro mutagenesis. Mutation of serine 117 to alanine abolished Erk2-mediated phosphorylation in vitro and the MAP kinase-related transcriptional activation of SREBP-1a by insulin and platelet-derived growth factor in vivo. Our data indicate that the MAP kinase-mediated effects on SREBP-1a-regulated target genes are linked to this phosphorylation site.

  19. Genome-wide association mapping of time-dependent growth responses to moderate drought stress in Arabidopsis.

    Science.gov (United States)

    Bac-Molenaar, Johanna A; Granier, Christine; Keurentjes, Joost J B; Vreugdenhil, Dick

    2016-01-01

    Large areas of arable land are often confronted with irregular rainfall resulting in limited water availability for part(s) of the growing seasons, which demands research for drought tolerance of plants. Natural variation was observed for biomass accumulation upon controlled moderate drought stress in 324 natural accessions of Arabidopsis. Improved performance under drought stress was correlated with early flowering and lack of vernalization requirement, indicating overlap in the regulatory networks of flowering time and drought response or correlated responses of these traits to natural selection. In addition, plant size was negatively correlated with relative water content (RWC) independent of the absolute water content (WC), indicating a prominent role for soluble compounds. Growth in control and drought conditions was determined over time and was modelled by an exponential function. Genome-wide association (GWA) mapping of temporal plant size data and of model parameters resulted in the detection of six time-dependent quantitative trait loci (QTLs) strongly associated with drought. Most QTLs would not have been identified if plant size was determined at a single time point. Analysis of earlier reported gene expression changes upon drought enabled us to identify for each QTL the most likely candidates.

  20. Activation of the Cph1-dependent MAP kinase signaling pathway induces white-opaque switching in Candida albicans.

    Directory of Open Access Journals (Sweden)

    Bernardo Ramírez-Zavala

    Full Text Available Depending on the environmental conditions, the pathogenic yeast Candida albicans can undergo different developmental programs, which are controlled by dedicated transcription factors and upstream signaling pathways. C. albicans strains that are homozygous at the mating type locus can switch from the normal yeast form (white to an elongated cell type (opaque, which is the mating-competent form of this fungus. Both white and opaque cells use the Ste11-Hst7-Cek1/Cek2 MAP kinase signaling pathway to react to the presence of mating pheromone. However, while opaque cells employ the transcription factor Cph1 to induce the mating response, white cells recruit a different downstream transcription factor, Tec1, to promote the formation of a biofilm that facilitates mating of opaque cells in the population. The switch from the white to the opaque cell form is itself induced by environmental signals that result in the upregulation of the transcription factor Wor1, the master regulator of white-opaque switching. To get insight into the upstream signaling pathways controlling the switch, we expressed all C. albicans protein kinases from a tetracycline-inducible promoter in a switching-competent strain. Screening of this library of strains showed that a hyperactive form of Ste11 lacking its N-terminal domain (Ste11(ΔN467 efficiently stimulated white cells to switch to the opaque phase, a behavior that did not occur in response to pheromone. Ste11(ΔN467-induced switching specifically required the downstream MAP kinase Cek1 and its target transcription factor Cph1, but not Cek2 and Tec1, and forced expression of Cph1 also promoted white-opaque switching in a Wor1-dependent manner. Therefore, depending on the activation mechanism, components of the pheromone-responsive MAP kinase pathway can be reconnected to stimulate an alternative developmental program, switching of white cells to the mating-competent opaque phase.

  1. Translational control of myelin basic protein expression by ERK2 MAP kinase regulates timely remyelination in the adult brain.

    Science.gov (United States)

    Michel, Kelly; Zhao, Tianna; Karl, Molly; Lewis, Katherine; Fyffe-Maricich, Sharyl L

    2015-05-20

    Successful myelin repair in the adult CNS requires the robust and timely production of myelin proteins to generate new myelin sheaths. The underlying regulatory mechanisms and complex molecular basis of myelin regeneration, however, remain poorly understood. Here, we investigate the role of ERK MAP kinase signaling in this process. Conditional deletion of Erk2 from cells of the oligodendrocyte lineage resulted in delayed remyelination following demyelinating injury to the adult mouse corpus callosum. The delayed repair occurred as a result of a specific deficit in the translation of the major myelin protein, MBP. In the absence of ERK2, activation of the ribosomal protein S6 kinase (p70S6K) and its downstream target, ribosomal protein S6 (S6RP), was impaired at a critical time when premyelinating oligodendrocytes were transitioning to mature cells capable of generating new myelin sheaths. Thus, we have described an important link between the ERK MAP kinase signaling cascade and the translational machinery specifically in remyelinating oligodendrocytes in vivo. These results suggest an important role for ERK2 in the translational control of MBP, a myelin protein that appears critical for ensuring the timely generation of new myelin sheaths following demyelinating injury in the adult CNS.

  2. STATE OF JNK AND P38 MAP-KINASE SYSTEM IN BLOOD monon uclea r le ucocytes DUR ING INFLAMMATION

    Directory of Open Access Journals (Sweden)

    N. Y. Chasovskih

    2009-01-01

    Full Text Available Abstract. Pogrammed cell death of peripheral blood mononuclear leucocytes from patients with acute inflammatory diseases (non-nosocomial pneumonia, acute appendicitis was investigated under ex vivo conditions, upon cultivation of the cells with selective inhibitors of JNK (SP600125 and р38 МАРК (ML3403. In vitro addition of SP600125 and ML3403 under oxidative stress conditions prevents increase of annexinpositive mononuclear cells numbers, thus suggesting JNK and р38 МАР-kinases to be involved into oxidative mechanisms of apoptosis deregulation. A role of JNK in IL-8 production by mononuclear leucocytes was revealed in cases of acute inflammation. Regulatory effect of JNK and p38 MAP-kinases can be mediated through activation of redox-sensitive apoptogenic signal transduction systems, as well as due to changes in cellular cytokine-producing function.

  3. Neuronal development in Caenorhabditis elegans is regulated by inhibition of an MLK MAP kinase pathway.

    Science.gov (United States)

    Baker, Scott T; Turgeon, Shane M; Tulgren, Erik D; Wigant, Jeanne; Rahimi, Omeed; Opperman, Karla J; Grill, Brock

    2015-01-01

    We show that loss-of-function mutations in kinases of the MLK-1 pathway (mlk-1, mek-1, and kgb-1/jnk) function cell-autonomously in neurons to suppress defects in synapse formation and axon termination caused by rpm-1 loss of function. Our genetic analysis also suggests that the phosphatase PPM-1, like RPM-1, is a potential inhibitor of kinases in the MLK-1 pathway.

  4. Arabidopsis phosphatidylinositol monophosphate 5-kinase 2 is involved in root gravitropism through regulation of polar auxin transport by affecting the cycling of PIN proteins

    Institute of Scientific and Technical Information of China (English)

    Yu Mei; Wen-Jing Jia; Yu-Jia Chu; Hong-Wei Xue

    2012-01-01

    Phosphatidylinositol monophosphate 5-kinase(PIP5K)catalyzes the synthesis of PI-4,5-bisphosphate(PtdIns(4,5)P2)by phosphorylation of PI-4-phosphate at the 5 position of the inositol ring,and is involved in regulating multiple developmental processes and stress responses.We here report on the functional characterization of Arabidopsis PIP5K2,which is expressed during lateral root initiation and elongation,and whose expression is enhanced by exogenous auxin.The knockout mutant pip5k2 shows reduced lateral root formation,which could be recovered with exogenous auxin,and interestingly,delayed root gravity response that could not be recovered with exogenous auxin.Crossing with the DR5-GUS marker line and measurement of free IAA content confirmed the reduced auxin accumulation in pip5k2.In addition,analysis using the membrane-selective dye FM4-64 revealed the decelerated vesicle trafficking caused by PtdIns(4,5)P2 reduction,which hence results in suppressed cycling of PIN proteins(PIN2 and 3),and delayed redistribution of PIN2 and auxin under gravistimulation in pipSk2 roots.On the contrary,PtdIns(4,5)P2 significantly enhanced the vesicle trafficking and cycling of PIN proteins.These results demonstrate that PIP5K2 is involved in regulating lateral root formation and root gravity response,and reveal a critical role of PIP5K2/Ptdlns(4,5)P2 in root development through regulation of PIN proteins,providing direct evidence of crosstalk between the phosphatidylinositol signaling pathway and auxin response,and new insights into the control of polar auxin transport.

  5. Arabidopsis inositol pentakisphosphate 2-kinase, AtIPK1, is required for growth and modulates phosphate homeostasis at the transcriptional level.

    Science.gov (United States)

    Kuo, Hui-Fen; Chang, Tzu-Yun; Chiang, Su-Fen; Wang, Wei-Di; Charng, Yee-Yung; Chiou, Tzyy-Jen

    2014-11-01

    Inositol hexakisphosphate (IP6 ) provides a phosphorous reservoir in plant seeds; in addition, along with its biosynthesis intermediates and derivatives, IP6 also plays important roles in diverse developmental and physiological processes. Disruption of the Arabidopsis inositol pentakisphosphate 2-kinase coding gene AtIPK1 was previously shown to reduce IP6 content in vegetative tissues and affect phosphate (Pi) sensing. Here we show that AtIPK1 is required for sustaining plant growth, as null mutants are non-viable. An incomplete loss-of-function mutant, atipk1-1, exhibited disturbed Pi homeostasis and overaccumulated Pi as a consequence of increased Pi uptake activity and root-to-shoot Pi translocation. The atipk1-1 mutants also showed a Pi deficiency-like root system architecture with reduced primary root and enhanced lateral root growth. Transcriptome analysis indicated that a subset of Pi starvation-responsive genes was transcriptionally perturbed in the atipk1-1 mutants and the expression of multiple genes involved in Pi uptake, allocation, and remobilization was increased. Genetic and transcriptional analyses suggest that disturbance of Pi homeostasis caused by atipk1 mutation involved components in addition to PHR1(-like) transcription factors. Notably, the transcriptional increase of a number of Pi starvation-responsive genes in the atipk1-1 mutants is correlated with the reduction of histone variant H2A.Z occupation in chromatin. The myo-inositol-1-phosphate synthase mutants, atmips1 and atmips2 with comparable reduction in vegetative IP6 to that in the atipk1-1 mutants did not overaccumulate Pi, suggesting that Pi homeostasis modulated by AtIPK1 is not solely attributable to IP6 level. This study reveals that AtIPK1 has important roles in growth and Pi homeostasis.

  6. Pinoid kinase regulates root gravitropism through modulation of PIN2-dependent basipetal auxin transport in Arabidopsis thaliana

    Science.gov (United States)

    Muday, Gloria; Sukumar, Poornima; Edwards, Karin; Delong, Alison; Rahman, Abidur

    Reversible protein phosphorylation is a key regulatory mechanism governing polar auxin transport. We tested the hypothesis that PINOID (PID)-mediated phosphorylation and RCN1- regulated dephosphorylation might antagonistically regulate auxin transport and gravity response in seedling roots. Here we show that basipetal IAA transport and gravitropism are reduced in pid mutant seedlings, while acropetal transport and lateral root development are unchanged. Treatment of wild-type seedlings with the protein kinase inhibitor, staurosporine, phenocopied the reduced auxin transport and gravity response of pid-9 and reduced formation of asymmetric DR5-revGFP expression at the root tip after reorientation relative to gravity. Gravitropism and auxin transport in pid are resistant to further inhibition by staurosporine. Gravity response defects of rcn1 and pid-9 are partially rescued by treatment with staurosporine or the phosphatase inhibitor, cantharidin, respectively, and in the pid-9 rcn1 double mutant. Furthermore, the effect of staurosporine is lost in pin2, and a PIN2::GFP fusion protein accumulates in endomembrane compartments after staurosporine treatment. In the pid-9 mutant, immunological techniques find a similar PIN2 localization. These data suggest that staurosporine inhibits gravitropism and basipetal IAA transport by blocking PID action and altering PIN2 localization and support the model that PID and RCN1 reciprocally regulate root gravitropic curvature.

  7. Gene for the catalytic subunit of mouse DNA-dependent protein kinase maps to the scid locus.

    Science.gov (United States)

    Miller, R D; Hogg, J; Ozaki, J H; Gell, D; Jackson, S P; Riblet, R

    1995-01-01

    The gene encoding the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) has been proposed recently as a candidate gene for the mouse severe combined immune deficiency (scid) locus. We have used a partial cDNA clone for human DNA-PKcs to map the mouse homologue using a large interspecific backcross panel. We found that the mouse gene for DNA-PKcs does not recombine with scid, consistent with the hypothesis that scid is a mutation in the mouse gene for DNA-PKcs. Images Fig. 3 PMID:7479885

  8. Gene-Environment Interactions Target Mitogen-activated Protein 3 Kinase 1 (MAP3K1) Signaling in Eyelid Morphogenesis*

    Science.gov (United States)

    Mongan, Maureen; Meng, Qinghang; Wang, Jingjing; Kao, Winston W.-Y.; Puga, Alvaro; Xia, Ying

    2015-01-01

    Gene-environment interactions determine the biological outcomes through mechanisms that are poorly understood. Mouse embryonic eyelid closure is a well defined model to study the genetic control of developmental programs. Using this model, we investigated how exposure to dioxin-like environmental pollutants modifies the genetic risk of developmental abnormalities. Our studies reveal that mitogen-activated protein 3 kinase 1 (MAP3K1) signaling is a focal point of gene-environment cross-talk. Dioxin exposure, acting through the aryl hydrocarbon receptor (AHR), blocked eyelid closure in genetic mutants in which MAP3K1 signaling was attenuated but did not disturb this developmental program in either wild type or mutant mice with attenuated epidermal growth factor receptor or WNT signaling. Exposure also markedly inhibited c-Jun phosphorylation in Map3k1+/− embryonic eyelid epithelium, suggesting that dioxin-induced AHR pathways can synergize with gene mutations to inhibit MAP3K1 signaling. Our studies uncover a novel mechanism through which the dioxin-AHR axis interacts with the MAP3K1 signaling pathways during fetal development and provide strong empirical evidence that specific gene alterations can increase the risk of developmental abnormalities driven by environmental pollutant exposure. PMID:26109068

  9. MAP kinase pathways and calcitonin influence CD44 alternate isoform expression in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Yang Kui

    2008-09-01

    Full Text Available Abstract Background Dysregulated expression and splicing of cell adhesion marker CD44 is found in many types of cancer. In prostate cancer (PC specifically, the standard isoform (CD44s has been found to be downregulated compared with benign tissue whereas predominant variant isoform CD44v7-10 is upregulated. Mitogen-activated protein kinase pathways and paracrine calcitonin are two common factors linked to dysregulated expression and splicing of CD44 in cancer. Calcitonin has been found to increase proliferation and invasion in PC acting through the protein kinase A pathway. Methods In androgen-independent PC with known high CD44v7-10 expression, CD44 total and CD44v7-10 RNA or protein were assessed in response to exogenous and endogenous calcitonin and to inhibitors of protein kinase A, MEK, JNK, or p38 kinase. Benign cells and calcitonin receptor-negative PC cells were also tested. Results MEK or p38 but not JNK reduced CD44 total RNA by 40%–65% in cancer and benign cells. Inhibition of protein kinase A reduced CD44 total and v7-10 protein expression. In calcitonin receptor-positive cells only, calcitonin increased CD44 variant RNA and protein by 3 h and persisting to 48 h, apparently dependent on an uninhibited p38 pathway. Cells with constitutive CT expression showed an increase in CD44v7-10 mRNA but a decrease in CD44 total RNA. Conclusion The MEK pathway increases CD44 RNA, while calcitonin, acting through the protein kinase A and p38 pathway, facilitates variant splicing. These findings could be used in the formulation of therapeutic methods for PC targeting CD44 alternate splicing.

  10. A Myb transcription factor of Phytophthora sojae, regulated by MAP kinase PsSAK1, is required for zoospore development.

    Directory of Open Access Journals (Sweden)

    Meng Zhang

    Full Text Available PsSAK1, a mitogen-activated protein (MAP kinase from Phytophthora sojae, plays an important role in host infection and zoospore viability. However, the downstream mechanism of PsSAK1 remains unclear. In this study, the 3'-tag digital gene expression (DGE profiling method was applied to sequence the global transcriptional sequence of PsSAK1-silenced mutants during the cysts stage and 1.5 h after inoculation onto susceptible soybean leaf tissues. Compared with the gene expression levels of the recipient P. sojae strain, several candidates of Myb family were differentially expressed (up or down in response to the loss of PsSAK1, including of a R2R3-type Myb transcription factor, PsMYB1. qRT-PCR indicated that the transcriptional level of PsMYB1 decreased due to PsSAK1 silencing. The transcriptional level of PsMYB1 increased during sporulating hyphae, in germinated cysts, and early infection. Silencing of PsMYB1 results in three phenotypes: a no cleavage of the cytoplasm into uninucleate zoospores or release of normal zoospores, b direct germination of sporangia, and c afunction in zoospore-mediated plant infection. Our data indicate that the PsMYB1 transcription factor functions downstream of MAP kinase PsSAK1 and is required for zoospore development of P. sojae.

  11. QSAR Analysis of Some Antagonists for p38 map kinase Using Combination of Principal Component Analysis and Artificial Intelligence.

    Science.gov (United States)

    Doosti, Elham; Shahlaei, Mohsen

    2015-01-01

    Quantitative relationships between structures of a set of p38 map kinase inhibitors and their activities were investigated by principal component regression (PCR) and principal componentartificial neural network (PC-ANN). Latent variables (called components) generated by principal component analysis procedure were applied as the input of developed Quantitative structure- activity relationships (QSAR) models. An exact study of predictability of PCR and PC-ANN showed that the later model has much higher ability to calculate the biological activity of the investigated molecules. Also, experimental and estimated biological activities of compounds used in model development step have indicated a good correlation. Obtained results show that a non-linear model explaining the relationship between the pIC50s and the calculated principal components (that extract from structural descriptors of the studied molecules) is superior than linear model. Some typical figures of merit for QSAR studies explaining the accuracy and predictability of the suggested models were calculated. Therefore, to design novel inhibitors of p38 map kinase with high potency and low undesired effects the developed QSAR models were used to estimate biological pIC50 of the studied compounds.

  12. Inducible activation of ERK5 MAP kinase enhances adult neurogenesis in the olfactory bulb and improves olfactory function.

    Science.gov (United States)

    Wang, Wenbin; Lu, Song; Li, Tan; Pan, Yung-Wei; Zou, Junhui; Abel, Glen M; Xu, Lihong; Storm, Daniel R; Xia, Zhengui

    2015-05-20

    Recent discoveries have suggested that adult neurogenesis in the subventricular zone (SVZ) and olfactory bulb (OB) may be required for at least some forms of olfactory behavior in mice. However, it is unclear whether conditional and selective enhancement of adult neurogenesis by genetic approaches is sufficient to improve olfactory function under physiological conditions or after injury. Furthermore, specific signaling mechanisms regulating adult neurogenesis in the SVZ/OB are not fully defined. We previously reported that ERK5, a MAP kinase selectively expressed in the neurogenic regions of the adult brain, plays a critical role in adult neurogenesis in the SVZ/OB. Using a site-specific knock-in mouse model, we report here that inducible and targeted activation of the endogenous ERK5 in adult neural stem/progenitor cells enhances adult neurogenesis in the OB by increasing cell survival and neuronal differentiation. This conditional ERK5 activation also improves short-term olfactory memory and odor-cued associative olfactory learning under normal physiological conditions. Furthermore, these mice show enhanced recovery of olfactory function and have more adult-born neurons after a zinc sulfate-induced lesion of the main olfactory epithelium. We conclude that ERK5 MAP kinase is an important endogenous signaling pathway regulating adult neurogenesis in the SVZ/OB, and that conditional activation of endogenous ERK5 is sufficient to enhance adult neurogenesis in the OB thereby improving olfactory function both under normal conditions and after injury.

  13. A genome-wide RNAi screen reveals MAP kinase phosphatases as key ERK pathway regulators during embryonic stem cell differentiation.

    Directory of Open Access Journals (Sweden)

    Shen-Hsi Yang

    Full Text Available Embryonic stem cells and induced pluripotent stem cells represent potentially important therapeutic agents in regenerative medicine. Complex interlinked transcriptional and signaling networks control the fate of these cells towards maintenance of pluripotency or differentiation. In this study we have focused on how mouse embryonic stem cells begin to differentiate and lose pluripotency and, in particular, the role that the ERK MAP kinase and GSK3 signaling pathways play in this process. Through a genome-wide siRNA screen we have identified more than 400 genes involved in loss of pluripotency and promoting the onset of differentiation. These genes were functionally associated with the ERK and/or GSK3 pathways, providing an important resource for studying the roles of these pathways in controlling escape from the pluripotent ground state. More detailed analysis identified MAP kinase phosphatases as a focal point of regulation and demonstrated an important role for these enzymes in controlling ERK activation kinetics and subsequently determining early embryonic stem cell fate decisions.

  14. MAP kinase specifically mediates the ABA-induced H2O2 generation in guard cells of Vicia faba L

    Institute of Scientific and Technical Information of China (English)

    JIANG Jing; AN Guoyong; WANG Pengcheng; WANG Pengtao; HAN Jinfeng; JIA Yanbin; SONG Chunpeng

    2003-01-01

    Mitogen-activated protein (MAP) kinase is involved in ABA- or H2O2-signaling, and H2O2 acts as intermediate in the downstream of ABA signal transduction pathway, which has recently emerged as a secondary messenger of ABA signaling. Using an epidermal strip bioassay and laser scanning confocal microscope, we provided the first evidence that MAP kinase plays an important role in H2O2 signal initial, amplification and specific targeting in response to stimuli in guard cells. ABA- or H2O2-induced Vicia faba stomatal closure was inhibited or reversed by the specific inhibitor PD98059 of MEK1/2; the guard cells were pre-incubated or -microinjected by 10 (mol·L-1 PD98059, ABA could not enhance the fluorescence intensity of H2O2 probe dichlorofluorescein (DCF). Meanwhile, after ABA induced the H2O2 accumulation in guard cells, the exogenous or intracellular PD98059 could reduce the DCF fluorescence intensity. Most interestingly, on the contrary to ABA, the DCF fluorescence intensity of guard cells treated by 100 (mol·L-1 salicylic acid (SA) was not down-regulated by PD98059, yet PD98059 did not regulate the stomatal movement being induced by light, dark or salicylic acid. These results suggest that MEK1/2 could mediate stomatal closure by abolishing the ABA-induced H2O2 generation/accumula- tion in the specific manner.

  15. Activation of the MAP Kinase Cascade by Exogenous Calcium-Sensing Receptor

    Energy Technology Data Exchange (ETDEWEB)

    Hobson, Susan A.; Wright, Jay W.; Lee, Fred; Mcneil, Scott; Bilderback, Tim R.; Rodland, Karin D.

    2003-02-01

    In Rat-1 fibroblasts and ovarian surface epithelial cells, extracellular calcium induces a proliferative response which appears to be mediated by the G-protein coupled Calcium-sensing Receptor (CaR), as expression of the non-functional CaR-R795W mutant inhibits both thymidine incorporation and activation of the extracellular-regulated kinase (ERK) in response to calcium. In this report we utilized CaR-transfected HEK293 cells to demonstrate that functional CaR is necessary and sufficient for calcium-induced ERK activation. CaR-dependent ERK activation was blocked by co-expression of the Ras dominant-negative mutant, Ras N17, and by exposure to the phosphatidyl inositol 3' kinase inhibitors wortmannin and LY294002. In contrast to Rat-1 fibroblasts, CaR-mediated in vitro kinase activity of ERK2 was unaffected by tyrosine kinase inhibitor herbimycin in CaR-transfected HEK293 cells. These results suggest that usage of distinct pathways downstream of the CaR varies in a cell-type specific manner, suggesting a potential mechanism by which activation of the CaR could couple to distinct calcium-dependent responses.

  16. Novel mechanisms of sildenafil in pulmonary hypertension involving cytokines/chemokines, MAP kinases and Akt.

    Directory of Open Access Journals (Sweden)

    Tamas Kiss

    Full Text Available Pulmonary arterial hypertension (PH is associated with high mortality due to right ventricular failure and hypoxia, therefore to understand the mechanism by which pulmonary vascular remodeling initiates these processes is very important. We used a well-characterized monocrotaline (MCT-induced rat PH model, and analyzed lung morphology, expression of cytokines, mitogen-activated protein kinase (MAPK phosphorylation, and phosphatidylinositol 3-kinase-Akt (PI-3k-Akt pathway and nuclear factor (NF-κB activation in order to elucidate the mechanisms by which sildenafil's protective effect in PH is exerted. Besides its protective effect on lung morphology, sildenafil suppressed multiple cytokines involved in neutrophil and mononuclear cells recruitment including cytokine-induced neutrophil chemoattractant (CINC-1, CINC-2α/β, tissue inhibitor of metalloproteinase (TIMP-1, interleukin (IL-1α, lipopolysaccharide induced CXC chemokine (LIX, monokine induced by gamma interferon (MIG, macrophage inflammatory protein (MIP-1α, and MIP-3α. NF-κB activation and phosphorylation were also attenuated by sildenafil. Furthermore, sildenafil reduced extracellular signal-regulated kinase (ERK1/2 and p38 MAPK activation while enhanced activation of the cytoprotective Akt pathway in PH. These data suggest a beneficial effect of sildenafil on inflammatory and kinase signaling mechanisms that substantially contribute to its protective effects, and may have potential implications in designing future therapeutic strategies in the treatment of pulmonary hypertension.

  17. Mutations in the Arabidopsis homolog of LST8/GβL, a partner of the target of Rapamycin kinase, impair plant growth, flowering, and metabolic adaptation to long days.

    Science.gov (United States)

    Moreau, Manon; Azzopardi, Marianne; Clément, Gilles; Dobrenel, Thomas; Marchive, Chloé; Renne, Charlotte; Martin-Magniette, Marie-Laure; Taconnat, Ludivine; Renou, Jean-Pierre; Robaglia, Christophe; Meyer, Christian

    2012-02-01

    The conserved Target of Rapamycin (TOR) kinase forms high molecular mass complexes and is a major regulator of cellular adaptations to environmental cues. The Lethal with Sec Thirteen 8/G protein β subunit-like (LST8/GβL) protein is a member of the TOR complexes, and two putative LST8 genes are present in Arabidopsis thaliana, of which only one (LST8-1) is significantly expressed. The Arabidopsis LST8-1 protein is able to complement yeast lst8 mutations and interacts with the TOR kinase. Mutations in the LST8-1 gene resulted in reduced vegetative growth and apical dominance with abnormal development of flowers. Mutant plants were also highly sensitive to long days and accumulated, like TOR RNA interference lines, higher amounts of starch and amino acids, including proline and glutamine, while showing reduced concentrations of inositol and raffinose. Accordingly, transcriptomic and enzymatic analyses revealed a higher expression of genes involved in nitrate assimilation when lst8-1 mutants were shifted to long days. The transcriptome of lst8-1 mutants in long days was found to share similarities with that of a myo-inositol 1 phosphate synthase mutant that is also sensitive to the extension of the light period. It thus appears that the LST8-1 protein has an important role in regulating amino acid accumulation and the synthesis of myo-inositol and raffinose during plant adaptation to long days.

  18. Extracellular simian virus 40 induces an ERK/MAP kinase-independent signalling pathway that activates primary response genes and promotes virus entry.

    Science.gov (United States)

    Dangoria, N S; Breau, W C; Anderson, H A; Cishek, D M; Norkin, L C

    1996-09-01

    Simian virus 40 (SV40) binding to growth-arrested cells activated an intracellular signalling pathway that induced the up-regulation of the primary response genes c-myc, c-jun and c-sis within 30 min and of JE within 90 min. The up-regulation of the primary response genes occurred in the presence of cycloheximide and when UV-inactivated SV40 was adsorbed to cells. SV40 binding did not activate Raf or mitogen-activated protein kinase (MAP/ERK1), or mobilize intracellular Ca2+. The SV40-induced up-regulation of c-myc and c-jun was blocked by the tyrosine kinase inhibitor, genistein, and by the protein kinase C (PKC) inhibitor, calphostin C, but not by expression of the MAP kinase-specific phosphatase, MKP-1. These results suggest that the SV40-induced signalling pathway includes the activities of a tyrosine kinase and a Ca(2+)-independent isoform of PKC, but not of Raf or MAP kinase. Finally, SV40 infectious entry into cells was specifically and reversibly blocked by genistein.

  19. Construction of a high-resolution linkage map of Rfd1, a restorer-of-fertility locus for cytoplasmic male sterility conferred by DCGMS cytoplasm in radish (Raphanus sativus L.) using synteny between radish and Arabidopsis genomes.

    Science.gov (United States)

    Cho, Youngcho; Lee, Young-Pyo; Park, Beom-Seok; Han, Tae-Ho; Kim, Sunggil

    2012-08-01

    Cytoplasmic male sterility caused by Dongbu cytoplasmic and genic male-sterility (DCGMS) cytoplasm and its nuclear restorer-of-fertility locus (Rfd1) with a linked molecular marker (A137) have been reported in radish (Raphanus sativus L.). To construct a linkage map of the Rfd1 locus, linked amplified fragment length polymorphism (AFLP) markers were screened using bulked segregant analysis. A 220-bp linked AFLP fragment sequence from radish showed homology with an Arabidopsis coding sequence. Using this Arabidopsis gene sequence, a simple PCR marker (A220) was developed. The A137 and A220 markers flanked the Rfd1 locus. Two homologous Arabidopsis genes with both marker sequences were positioned on Arabidopsis chromosome-3 with an interval of 2.4 Mb. To integrate the Rfd1 locus into a previously reported expressed sequence tag (EST)-simple sequence repeat (SSR) linkage map, the radish EST sequences located in three syntenic blocks within the 2.4-Mb interval were used to develop single nucleotide polymorphism (SNP) markers for tagging each block. The SNP marker in linkage group-2 co-segregated with male fertility in an F(2) population. Using radish ESTs positioned in linkage group-2, five intron length polymorphism (ILP) markers and one cleaved amplified polymorphic sequence (CAPS) marker were developed and used to construct a linkage map of the Rfd1 locus. Two closely linked markers delimited the Rfd1 locus within a 985-kb interval of Arabidopsis chromosome-3. Synteny between the radish and Arabidopsis genomes in the 985-kb interval were used to develop three ILP and three CAPS markers. Two ILP markers further delimited the Rfd1 locus to a 220-kb interval of Arabidopsis chromosome-3.

  20. The Arabidopsis microtubule-associated protein MAP65-3 supports infection by filamentous biotrophic pathogens by down-regulating salicylic acid-dependent defenses.

    Science.gov (United States)

    Quentin, Michaël; Baurès, Isabelle; Hoefle, Caroline; Caillaud, Marie-Cécile; Allasia, Valérie; Panabières, Franck; Abad, Pierre; Hückelhoven, Ralph; Keller, Harald; Favery, Bruno

    2016-03-01

    The oomycete Hyaloperonospora arabidopsidis and the ascomycete Erysiphe cruciferarum are obligate biotrophic pathogens causing downy mildew and powdery mildew, respectively, on Arabidopsis. Upon infection, the filamentous pathogens induce the formation of intracellular bulbous structures called haustoria, which are required for the biotrophic lifestyle. We previously showed that the microtubule-associated protein AtMAP65-3 plays a critical role in organizing cytoskeleton microtubule arrays during mitosis and cytokinesis. This renders the protein essential for the development of giant cells, which are the feeding sites induced by root knot nematodes. Here, we show that AtMAP65-3 expression is also induced in leaves upon infection by the downy mildew oomycete and the powdery mildew fungus. Loss of AtMAP65-3 function in the map65-3 mutant dramatically reduced infection by both pathogens, predominantly at the stages of leaf penetration. Whole-transcriptome analysis showed an over-represented, constitutive activation of genes involved in salicylic acid (SA) biosynthesis, signaling, and defense execution in map65-3, whereas jasmonic acid (JA)-mediated signaling was down-regulated. Preventing SA synthesis and accumulation in map65-3 rescued plant susceptibility to pathogens, but not the developmental phenotype caused by cytoskeleton defaults. AtMAP65-3 thus has a dual role. It positively regulates cytokinesis, thus plant growth and development, and negatively interferes with plant defense against filamentous biotrophs. Our data suggest that downy mildew and powdery mildew stimulate AtMAP65-3 expression to down-regulate SA signaling for infection.

  1. Cell-permeable p38 MAP kinase promotes migration of adult neural stem/progenitor cells

    Science.gov (United States)

    Hamanoue, Makoto; Morioka, Kazuhito; Ohsawa, Ikuroh; Ohsawa, Keiko; Kobayashi, Masaaki; Tsuburaya, Kayo; Akasaka, Yoshikiyo; Mikami, Tetsuo; Ogata, Toru; Takamatsu, Ken

    2016-01-01

    Endogenous neural stem/progenitor cells (NPCs) can migrate toward sites of injury, but the migration activity of NPCs is insufficient to regenerate damaged brain tissue. In this study, we showed that p38 MAP kinase (p38) is expressed in doublecortin-positive adult NPCs. Experiments using the p38 inhibitor SB203580 revealed that endogenous p38 participates in NPC migration. To enhance NPC migration, we generated a cell-permeable wild-type p38 protein (PTD-p38WT) in which the HIV protein transduction domain (PTD) was fused to the N-terminus of p38. Treatment with PTD-p38WT significantly promoted the random migration of adult NPCs without affecting cell survival or differentiation; this effect depended on the cell permeability and kinase activity of the fusion protein. These findings indicate that PTD-p38WT is a novel and useful tool for unraveling the roles of p38, and that this protein provides a reasonable approach for regenerating the injured brain by enhancing NPC migration. PMID:27067799

  2. Regulation of endothelial protein C receptor shedding by cytokines is mediated through differential activation of MAP kinase signaling pathways

    Energy Technology Data Exchange (ETDEWEB)

    Menschikowski, Mario, E-mail: Mario.Menschikowski@uniklinikum-dresden.de [Institute of Clinical Chemistry and Laboratory Medicine, Technical University of Dresden, Medical Faculty ' Carl Gustav Carus' , Fetscherstrasse 74, D-01307 Dresden (Germany); Hagelgans, Albert; Eisenhofer, Graeme; Siegert, Gabriele [Institute of Clinical Chemistry and Laboratory Medicine, Technical University of Dresden, Medical Faculty ' Carl Gustav Carus' , Fetscherstrasse 74, D-01307 Dresden (Germany)

    2009-09-10

    The endothelial protein C receptor (EPCR) plays a pivotal role in coagulation, inflammation, cell proliferation, and cancer, but its activity is markedly changed by ectodomain cleavage and release as the soluble protein (sEPCR). In this study we examined the mechanisms involved in the regulation of EPCR shedding in human umbilical endothelial cells (HUVEC). Interleukin-1{beta} (IL-1{beta}) and tumor necrosis factor-{alpha} (TNF-{alpha}), but not interferon-{gamma} and interleukin-6, suppressed EPCR mRNA transcription and cell-associated EPCR expression in HUVEC. The release of sEPCR induced by IL-1{beta} and TNF-{alpha} correlated with activation of p38 MAPK and c-Jun N-terminal kinase (JNK). EPCR shedding was also induced by phorbol 12-myristate 13-acetate, ionomycin, anisomycin, thiol oxidants or alkylators, thrombin, and disruptors of lipid rafts. Both basal and induced shedding of EPCR was blocked by the metalloproteinase inhibitors, TAPI-0 and GM6001, and by the reduced non-protein thiols, glutathione, dihydrolipoic acid, dithiothreitol, and N-acetyl-L-cysteine. Because other antioxidants and scavengers of reactive oxygen species failed to block the cleavage of EPCR, a direct suppression of metalloproteinase activity seems responsible for the observed effects of reduced thiols. In summary, the shedding of EPCR in HUVEC is effectively regulated by IL-1{beta} and TNF-{alpha}, and downstream by MAP kinase signaling pathways and metalloproteinases.

  3. The Arabidopsis EDR1 Protein Kinase Negatively Regulates the ATL1 E3 Ubiquitin Ligase to Suppress Cell Death[W

    Science.gov (United States)

    Serrano, Irene; Gu, Yangnan; Qi, Dong; Dubiella, Ullrich

    2014-01-01

    Loss-of-function mutations in the Arabidopsis thaliana ENHANCED DISEASE RESISTANCE1 (EDR1) gene confer enhanced programmed cell death under a variety of abiotic and biotic stress conditions. All edr1 mutant phenotypes can be suppressed by missense mutations in the KEEP ON GOING gene, which encodes a trans-Golgi network/early endosome (TGN/EE)-localized E3 ubiquitin ligase. Here, we report that EDR1 interacts with a second E3 ubiquitin ligase, ARABIDOPSIS TOXICOS EN LEVADURA1 (ATL1), and negatively regulates its activity. Overexpression of ATL1 in transgenic Arabidopsis induced severe growth inhibition and patches of cell death, while transient overexpression in Nicotiana benthamiana leaves induced cell death and tissue collapse. The E3 ligase activity of ATL1 was required for both of these processes. Importantly, we found that ATL1 interacts with EDR1 on TGN/EE vesicles and that EDR1 suppresses ATL1-mediated cell death in N. benthamiana and Arabidopsis. Lastly, knockdown of ATL1 expression suppressed cell death phenotypes associated with the edr1 mutant and made Arabidopsis hypersusceptible to powdery mildew infection. Taken together, our data indicate that ATL1 is a positive regulator of programmed cell death and EDR1 negatively regulates ATL1 activity at the TGN/EE and thus controls stress responses initiated by ATL1-mediated ubiquitination events. PMID:25398498

  4. The Pelargonium sidoides Extract EPs 7630 Drives the Innate Immune Defense by Activating Selected MAP Kinase Pathways in Human Monocytes.

    Science.gov (United States)

    Witte, Katrin; Koch, Egon; Volk, Hans-Dieter; Wolk, Kerstin; Sabat, Robert

    2015-01-01

    Pelargonium sidoides is a medical herb and respective extracts are used very frequently for the treatment of respiratory tract infections. However, the effects of Pelargonium sidoides and a special extract prepared from its roots (EPs 7630) on human immune cells are not fully understood. Here we demonstrate that EPs 7630 induced a rapid and dose-dependent production of TNF-α, IL-6, and IL-10 by human blood immune cells. This EPs 7630-induced cytokine profile was more pro-inflammatory in comparison with the profile induced by viral or bacterial infection-mimicking agents. The search for EPs 7630 target cells revealed that T-cells did not respond to EPs 7630 stimulation by production of TNF-α, IL-6, or IL-10. Furthermore, pretreatment of T-cells with EPs 7630 did not modulate their TNF-α, IL-6, and IL-10 secretion during subsequent activation. In contrast to lymphocytes, monocytes showed clear intracellular TNF-α staining after EPs 7630 treatment. Accordingly, EPs 7630 predominantly provoked activation of MAP kinases and inhibition of p38 strongly reduced the monocyte TNF-α production. The pretreatment of blood immune cells with EPs 7630 lowered their secretion of TNF-α and IL-10 and caused an IL-6 dominant response during second stimulation with viral or bacterial infection-mimicking agents. In summary, we demonstrate that EPs 7630 activates human monocytes, induces MAP kinase-dependent pro-inflammatory cytokines in these cells, and specifically modulates their production capacity of mediators known to lead to an increase of acute phase protein production in the liver, neutrophil generation in the bone marrow, and the generation of adaptive Th17 and Th22 cells.

  5. The Pelargonium sidoides Extract EPs 7630 Drives the Innate Immune Defense by Activating Selected MAP Kinase Pathways in Human Monocytes.

    Directory of Open Access Journals (Sweden)

    Katrin Witte

    Full Text Available Pelargonium sidoides is a medical herb and respective extracts are used very frequently for the treatment of respiratory tract infections. However, the effects of Pelargonium sidoides and a special extract prepared from its roots (EPs 7630 on human immune cells are not fully understood. Here we demonstrate that EPs 7630 induced a rapid and dose-dependent production of TNF-α, IL-6, and IL-10 by human blood immune cells. This EPs 7630-induced cytokine profile was more pro-inflammatory in comparison with the profile induced by viral or bacterial infection-mimicking agents. The search for EPs 7630 target cells revealed that T-cells did not respond to EPs 7630 stimulation by production of TNF-α, IL-6, or IL-10. Furthermore, pretreatment of T-cells with EPs 7630 did not modulate their TNF-α, IL-6, and IL-10 secretion during subsequent activation. In contrast to lymphocytes, monocytes showed clear intracellular TNF-α staining after EPs 7630 treatment. Accordingly, EPs 7630 predominantly provoked activation of MAP kinases and inhibition of p38 strongly reduced the monocyte TNF-α production. The pretreatment of blood immune cells with EPs 7630 lowered their secretion of TNF-α and IL-10 and caused an IL-6 dominant response during second stimulation with viral or bacterial infection-mimicking agents. In summary, we demonstrate that EPs 7630 activates human monocytes, induces MAP kinase-dependent pro-inflammatory cytokines in these cells, and specifically modulates their production capacity of mediators known to lead to an increase of acute phase protein production in the liver, neutrophil generation in the bone marrow, and the generation of adaptive Th17 and Th22 cells.

  6. Mapping moves on Arabidopsis

    OpenAIRE

    Kloth, K.J.

    2016-01-01

                    Aphids are pest insects in a wide variety of crops. They penetrate the host plant in order to feed on the sugar-rich phloem sap. Apart from the removal of nutrients from the host, they can transmit plant viruses. To control aphid populations and virus transmission in agriculture, insecticides are applied on a large scale with often negative effects on biodiversity. Improvement of crop resistance to aphids would be a more sustainable pes...

  7. Mechanisms of cell signaling by nitric oxide and peroxynitrite: from mitochondria to MAP kinases

    Science.gov (United States)

    Levonen, A. L.; Patel, R. P.; Brookes, P.; Go, Y. M.; Jo, H.; Parthasarathy, S.; Anderson, P. G.; Darley-Usmar, V. M.

    2001-01-01

    Many of the biological and pathological effects of nitric oxide (NO) are mediated through cell signaling pathways that are initiated by NO reacting with metalloproteins. More recently, it has been recognized that the reaction of NO with free radicals such as superoxide and the lipid peroxyl radical also has the potential to modulate redox signaling. Although it is clear that NO can exert both cytotoxic and cytoprotective actions, the focus of this overview are those reactions that could lead to protection of the cell against oxidative stress in the vasculature. This will include the induction of antioxidant defenses such as glutathione, activation of mitogen-activated protein kinases in response to blood flow, and modulation of mitochondrial function and its impact on apoptosis. Models are presented that show the increased synthesis of glutathione in response to shear stress and inhibition of cytochrome c release from mitochondria. It appears that in the vasculature NO-dependent signaling pathways are of three types: (i) those involving NO itself, leading to modulation of mitochondrial respiration and soluble guanylate cyclase; (ii) those that involve S-nitrosation, including inhibition of caspases; and (iii) autocrine signaling that involves the intracellular formation of peroxynitrite and the activation of the mitogen-activated protein kinases. Taken together, NO plays a major role in the modulation of redox cell signaling through a number of distinct pathways in a cellular setting.

  8. Reference: 711 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available of the RLK signaling pathway, which also mediates adaptation to Na(+) stress. RLK pathway components, known... The Arabidopsis kinase-associated protein phosphatase regulates adaptation to Na+ stress. 2 612-22 18162596

  9. The p38 MAP kinase inhibitor SB203580 enhances nuclear factor-kappa B transcriptional activity by a non-specific effect upon the ERK pathway

    NARCIS (Netherlands)

    Birkenkamp, KU; Tuyt, LML; Lummen, C; Wierenga, LTJ; Kruijer, W; Vellenga, E

    2000-01-01

    1 In the present study we investigated a possible role for the p38 mitogen-activated protein (MAP) kinase pathway in mediating nuclear factor-kappa B (NF-kappa B) transcriptional activity in the erythroleukaemic cell line TF-1. 2 TF-1 cells stimulated with the phosphatase inhibitor okadaic acid (OA)

  10. Using "Arabidopsis" Genetic Sequences to Teach Bioinformatics

    Science.gov (United States)

    Zhang, Xiaorong

    2009-01-01

    This article describes a new approach to teaching bioinformatics using "Arabidopsis" genetic sequences. Several open-ended and inquiry-based laboratory exercises have been designed to help students grasp key concepts and gain practical skills in bioinformatics, using "Arabidopsis" leucine-rich repeat receptor-like kinase (LRR…

  11. A review of redox signaling and the control of MAP kinase pathway in plants

    Directory of Open Access Journals (Sweden)

    Yukun Liu

    2017-04-01

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are evolutionarily conserved modules among eukaryotic species that range from yeast, plants, flies to mammals. In eukaryotic cells, reactive oxygen species (ROS has both physiological and toxic effects. Both MAPK cascades and ROS signaling are involved in plant response to various biotic and abiotic stresses. It has been observed that not only can ROS induce MAPK activation, but also that disturbing MAPK cascades can modulate ROS production and responses. This review will discuss the potential mechanisms by which ROS may activate and/or regulate MAPK cascades in plants. The role of MAPK cascades and ROS signaling in regulating gene expression, stomatal function, and programmed cell death (PCD is also discussed. In addition, the relationship between Rboh-dependent ROS production and MAPK activation in PAMP-triggered immunity will be reviewed.

  12. Synergistic effect of vasoactive intestinal peptides on TNF-alpha-induced IL-6 synthesis in osteoblasts: amplification of p44/p42 MAP kinase activation.

    Science.gov (United States)

    Natsume, Hideo; Tokuda, Haruhiko; Mizutani, Jun; Adachi, Seiji; Matsushima-Nishiwaki, Rie; Minamitani, Chiho; Kato, Kenji; Kozawa, Osamu; Otsuka, Takanobu

    2010-05-01

    We previously showed that tumor necrosis factor-alpha (TNF-alpha) stimulates synthesis of interleukin-6 (IL-6), a potent bone resorptive agent, via p44/p42 mitogen-activated protein (MAP) kinase and phosphatidylinositol 3-kinase/Akt in osteoblast-like MC3T3-E1 cells. In the present study, we investigated the effect of vasoactive intestinal peptide (VIP) on TNF-alpha-induced IL-6 synthesis in these cells. VIP, which by itself slightly stimulated IL-6 synthesis, synergistically enhanced the TNF-alpha-induced IL-6 synthesis in MC3T3-E1 cells. The synergistic effect of VIP on the TNF-alpha-induced IL-6 synthesis was concentration-dependent in the range between 1 and 70 nM. We previously reported that VIP stimulated cAMP production in MC3T3-E1 cells. Forskolin, a direct activator of adenylyl cyclase, or 8-bromoadenosine-3',5'-cyclic monophosphate (8bromo-cAMP), a plasma membrane-permeable cAMP analogue, markedly enhanced the TNF-alpha-induced IL-6 synthesis as well as VIP. VIP markedly up-regulated the TNF-alpha-induced p44/p42 MAP kinase phosphorylation. The Akt phosphorylation stimulated by TNF-alpha was only slightly affected by VIP. PD98059, a specific inhibitor of MEK1/2, significantly suppressed the enhancement of TNF-alpha-induced IL-6 synthesis by VIP. The synergistic effect of a combination of VIP and TNF-alpha on the phosphorylation of p44/p42 MAP kinase was diminished by H-89, an inhibitor of cAMP-dependent protein kinase. These results strongly suggest that VIP synergistically enhances TNF-alpha-stimulated IL-6 synthesis via up-regulating p44/p42 MAP kinase through the adenylyl cyclase-cAMP system in osteoblasts.

  13. Mapping of Tonoplast Intrinsic Proteins in Maturing and Germinating Arabidopsis Seeds Reveals Dual Localization of Embryonic TIPS to the Tonoplast and Plasma Membrane

    Institute of Scientific and Technical Information of China (English)

    Stefano Gattolin; Mathias Sorieul; Lorenzo Frigerio

    2011-01-01

    We have mapped the expression of the tonoplast intrinsic protein (TIP) gene family members in Arabidopsis seeds by fluorescent protein tagging of their genomic sequences and confocal microscopy. Three isoforms (TIP1;1, TIP2;1,and TIP2;2) have distinct patterns of expression in maternal tissues (outer integument and placento-chalazal region). Two isoforms, TIP3;1 and the previously uncharacterized TIP3;2, are the only detectable TIPS in embryos during seed maturation and the early stages of seed germination. Throughout these developmental stages, both isoforms co-locate to the tonoplast of the protein storage vacuoles, but also appear to label the plasma membrane. Plasma membrane labeling is specific to TIP3;1 and TIP3;2, is independent of the position of the fluorescent protein tag, and appears to be specific to early seed maturation and early germination stages. We discuss these results in the context of the predicted distribution of aquaporins in Arabidopsis seeds.

  14. Reference: 598 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available omoter is markedly reduced in the cdkc;2 and cyct1;5 mutants, indicating that the kinase complexes are important... flowering. These results establish Arabidopsis CDKC kinase complexes as important...T1;4 and CYCT1;5, play important roles in infection with Cauliflower mosaic virus...hat Arabidopsis thaliana CDK9-like proteins, CDKC;1 and CDKC;2, and their interacting cyclin T partners, CYC

  15. UVB-irradiated human keratinocytes and interleukin-1αindirectly increase MAP kinase/AP-1 activation and MMP-1 production in UVA-irradiated dermal fibroblasts

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-yong; BI Zhi-gang

    2006-01-01

    Background Solar ultraviolet (UV) irradiation induces the production of matrix metalloproteinases (MMPs) by activating cellular signalling transduction pathways. MMPs are responsible for the degradation and/or inhibition of synthesis of collagenous extracellular matrix in connective tissues. We mimicked the action of environmental ultraviolet on skin and investigated the effects of UVB-irradiated human keratinocytes HaCaT and IL-1α on mitogen activated protein (MAP) kinase activation, c-Jun and c-Fos (AP-1 is composed of Jun and Fos proteins)mRNA expression and MMP-1 production in UVA-irradiated dermal fibroblasts.Methods Following UVA irradiation, the culture medium of fibroblasts was replaced by culture medium from UVB-irradiated HaCaT, or replaced by the complete culture medium with interleukin (IL)-1α. MAP kinase activity expression in fibroblasts was detected by Western blot. c-Jun and c-Fos mRNA expressions were determined by reverse transcriptional polymerase chain reaction (RT-PCR); MMP-1 production in culture medium was detected by enzyme-linked immunosorbent assay (ELISA).Results Culture medium from UVB-irradiated keratinocytes increased MAP kinase activity and c-Jun mRNA expression in UVA-irradiated fibroblasts. IL-1α increased MAP kinase activity and c-Jun mRNA expression,IL-1 α also increased c-Fos mRNA expression. Both culture media from UVB-irradiated human keratinocytes and externally applied IL-1 α increased MMP-1 production in UVA-irradiated fibroblasts.Conclusions UVB-irradiated keratinocytes and IL-1α indirectly promote MMP-1 production in UVA-irradiated fibroblasts by increasing MAP kinase/AP-1 activity. IL-1 may play an important role in the paracrine activation and dermal collagen excessive degradation leading to skin photoaging.

  16. Perturbation of EGF-induced MAP kinase activation by TGF-ß1

    Directory of Open Access Journals (Sweden)

    Wenner C.E.

    1999-01-01

    Full Text Available TGF-ß1 regulates both cellular growth and phenotypic plasticity important for maintaining a growth advantage and increased invasiveness in progressively malignant cells. Recent studies indicate that TGF-ß-1 stimulates the conversion of epitheliod to fibroblastoid phenotype which presumably leads to the inactivation of growth-inhibitory effects by TGF-ß1 (Portella et al. (1998 Cell Growth and Differentiation, 9: 393-404. Therefore, the investigation of TGF-ß1 signaling that leads to altered growth and migration may provide novel targets for the prevention of increased cell growth and invasion. Although much attention has been paid to TGF-ß1 responses in epithelial cells, the above studies suggest that examination of signal transduction pathways in fibroblasts are important as well. Data from our laboratory are consistent with the concept that TGF-ß1 can act as a regulatory switch in density-dependent C3H 10T1/2 fibroblasts capable of either promoting or delaying G1 traverse. The regulation of this switch is proposed to occur prior to pRb phosphorylation, namely prior to activation of cyclin-dependent kinases. The current study is concerned with the evaluation of a key cyclin (cyclin D1 which activates cdk4 and p27KIP1 which in turn inhibit cdk2 in the proliferative responses of epidermal growth factor (EGF and platelet-derived growth factor (PDGF and their modulation by TGF-ß1. Although the molecular events that lead to elevation of cyclin D1 are not completely understood, it appears likely that activation of p42/p44MAPK kinases is involved in its transcriptional regulation. TGF-ß1 delayed EGF- or PDGF-induced cyclin D1 expression and blocked the induction of active p42/p44MAPK. The mechanism by which TGF-ß1 induces a block in p42/p44MAPK activation is being examined and the possibility that TGF-ß1 regulates phosphatase activity is being tested.

  17. The LysM Receptor-Like Kinase LysM RLK1 Is Required to Activate Defense and Abiotic-Stress Responses Induced by Overexpression of Fungal Chitinases in Arabidopsis Plants

    Institute of Scientific and Technical Information of China (English)

    Yariv Brotman; Ada Viterbo; Udi Landau; Smadar Pnini; Jan Lisec; Salma Balazadeh; Bernd Mueller-Roeber; Aviah Zilberstein; Lothar Willmitzer; Ilan Chet

    2012-01-01

    Application of crab shell chitin or pentamer chitin oligosaccharide to Arabidopsis seedlings increased tolerance to salinity in wild-type but not in knockout mutants of the LysM Receptor-Like Kinase1 (CERK1/LysM RLK1) gene,known to play a critical role in signaling defense responses induced by exogenous chitin.Arabidopsis plants overexpressing the endochitinase chit36 and hexoaminidase excy1 genes from the fungus Trichoderma asperelleoides T203 showed increased tolerance to salinity,heavy-metal stresses,and Botrytis cinerea infection.Resistant lines,overexpressing fungal chitinases at different levels,were outcrossed to lysm rlk1 mutants.Independent homozygous hybrids lost resistance to biotic and abiotic stresses,despite enhanced chitinase activity.Expression analysis of 270 stress-related genes,including those induced by reactive oxygen species (ROS) and chitin,revealed constant up-regulation (at least twofold) of 10 genes in the chitinase-overexpressing line and an additional 76 salt-induced genes whose expression was not elevated in the lysm rlk1 knockout mutant or the hybrids harboring the mutation.These findings elucidate that chitin-induced signaling mediated by LysM RLK1 receptor is not limited to biotic stress response but also encompasses abiotic-stress signaling and can be conveyed by ectopic expression of chitinases in plants.

  18. Mapping of protein-protein interactions within the DNA-dependent protein kinase complex.

    Science.gov (United States)

    Gell, D; Jackson, S P

    1999-01-01

    In mammalian cells, the Ku and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) proteins are required for the correct and efficient repair of DNA double-strand breaks. Ku comprises two tightly-associated subunits of approximately 69 and approximately 83 kDa, which are termed Ku70 and Ku80 (or Ku86), respectively. Previously, a number of regions of both Ku subunits have been demonstrated to be involved in their interaction, but the molecular mechanism of this interaction remains unknown. We have identified a region in Ku70 (amino acid residues 449-578) and a region in Ku80 (residues 439-592) that participate in Ku subunit interaction. Sequence analysis reveals that these interaction regions share sequence homology and suggests that the Ku subunits are structurally related. On binding to a DNA double-strand break, Ku is able to interact with DNA-PKcs, but how this interaction is mediated has not been defined. We show that the extreme C-terminus of Ku80, specifically the final 12 amino acid residues, mediates a highly specific interaction with DNA-PKcs. Strikingly, these residues appear to be conserved only in Ku80 sequences from vertebrate organisms. These data suggest that Ku has evolved to become part of the DNA-PK holo-enzyme by acquisition of a protein-protein interaction motif at the C-terminus of Ku80. PMID:10446239

  19. Mite and cockroach proteases activate p44/p42 MAP kinases in human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kong Xiaoyuan

    2003-10-01

    Full Text Available Abstract Background The mechanisms underlying epithelial cell activation by indoor inhaled antigens are poorly understood. Methods In this study, we investigated the role of mitogen-activated protein kinases (MAPKs in A549 epithelial cells upon exposure to antigens of house dust mite (HDMA, German cockroach (GCA, and American cockroach (ACA. Results Each of these antigens induced a significant increase in IL-8 levels compared to the medium control. Exposure of A549 cells to these antigens induced the phosphorylation of p44/42 MAPKs within 5 minutes, which reached a peak at 25 minutes later and reached baseline levels at 1 hour after exposure. PD98059, a MEK1 inhibitor, significantly decreased phosphorylation of p44/p42 MAPKs and IL-8 production. Exposure of A549 cells with antigens, which had been preincubated with different protease inhibitors, also resulted in a reduction of both MAPK phosphorylation and IL-8 production. Conclusion Thus, proteolytic antigens present in HDMA, GCA and ACA activate the p44/42 MAPKs airway epithelial cells, which lead to elevated IL-8 production and initiation of the inflammatory cascade.

  20. Network Modeling Reveals Cross Talk of MAP Kinases during Adaptation to Caspofungin Stress in Aspergillus fumigatus.

    Science.gov (United States)

    Altwasser, Robert; Baldin, Clara; Weber, Jakob; Guthke, Reinhard; Kniemeyer, Olaf; Brakhage, Axel A; Linde, Jörg; Valiante, Vito

    2015-01-01

    Mitogen activated protein kinases (MAPKs) are highly conserved in eukaryotic organisms. In pathogenic fungi, their activities were assigned to different physiological functions including drug adaptation and resistance. Aspergillus fumigatus is a human pathogenic fungus, which causes life-threatening invasive infections. Therapeutic options against invasive mycoses are still limited. One of the clinically used drugs is caspofungin, which specifically targets the fungal cell wall biosynthesis. A systems biology approach, based on comprehensive transcriptome data sets and mathematical modeling, was employed to infer a regulatory network and identify key interactions during adaptation to caspofungin stress in A. fumigatus. Mathematical modeling and experimental validations confirmed an intimate cross talk occurring between the cell wall-integrity and the high osmolarity-glycerol signaling pathways. Specifically, increased concentrations of caspofungin promoted activation of these signalings. Moreover, caspofungin affected the intracellular transport, which caused an additional osmotic stress that is independent of glucan inhibition. High concentrations of caspofungin reduced this osmotic stress, and thus decreased its toxic activity. Our results demonstrated that MAPK signaling pathways play a key role during caspofungin adaptation and are contributing to the paradoxical effect exerted by this drug.

  1. ERK1/2 map kinase metabolic pathway is responsible for phosphorylation of translation initiation factor eIF4E during in vitro maturation of pig oocytes.

    Science.gov (United States)

    Ellederová, Zdenka; Cais, Ondrej; Susor, Andrej; Uhlírová, Katka; Kovárová, Hana; Jelínková, Lucie; Tomek, Wolfgang; Kubelka, Michal

    2008-02-01

    Eukaryotic initiation factor 4E (eIF4E) plays an important role in mRNA translation by binding the 5'-cap structure of the mRNA and facilitating the recruitment to the mRNA of other translation factors and the 40S ribosomal subunit. eIF4E undergoes regulated phosphorylation on Ser-209 and this phosphorylation is believed to be important for its binding to mRNA and to other initiation factors. The findings showing that the translation initiation factor eIF4E becomes gradually phosphorylated during in vitro maturation (IVM) of pig oocytes with a maximum in metaphase II (M II) stage oocytes have been documented by us recently (Ellederova et al., 2006). The aim of this work was to study in details the metabolic pathways involved in this process. Using inhibitors of cyclin-dependent kinases, Butyrolactone I (BL I) and protein phosphatases, okadaic acid (OA) we show that ERK1/2 MAP kinase pathway is involved in this phosphorylation. We also demonstrate that activation and phosphorylation of ERK1/2 MAP kinase and eIF4E is associated with the activating phosphorylation of Mnk1 kinase, one of the two main kinases phosphorylating eIF4E in somatic cells.

  2. MAP-kinase activity in etiolated Cucumis sativus cotyledons: the effect of red and far-red light irradiation.

    Science.gov (United States)

    Alvarez-Flórez, Fagua; Vidal, Dolors; Simón, Esther

    2013-02-01

    Phytochrome (phy) signalling in plants may be transduced through protein phosphorylation. Mitogen-activated protein kinase (MAP-kinase, MAPK) activity and the effect of R (red) and FR (far-red) light irradiation on MAPK activity were studied in etiolated Cucumis sativus L. cotyledons. By in vitro protein phosphorylation and in-gel assays with myelin basic protein (MBP), a protein band (between 48 and 45 kDa) with MAPK-like activity was detected. The addition to the phosphorylation buffer of specific protein phosphatase (PTP) inhibitors (Na(3)VO(4) and NaF) and genistein, apigenin or PD98059 as MAPK inhibitors allowed us to confirm the MAPK activity of the protein band. Irradiation of etiolated cotyledons with FR light for 5, 10 or 60 min rapidly and transiently stimulated the MAPK activity of the protein band. This suggests that there was a very low fluence response (VLFR) of phys. In addition, 15 min of R light irradiation or a sequential treatment of 15 min of R plus 5 min of FR also increased MAPK activity. The stimulatory effect of R light was also attributed to the same photoreceptor, which suggests that MAPKs are involved in phytochrome signal transduction. Protein immunoprecipitation and immunoblotting analysis with the polyclonal antibody anti-pERK1/2 (Tyr 204) and the monoclonal antibody anti-phosphotyrosine PY20 allowed us to recognize the above mentioned protein band as two proteins with molecular masses (M(r)) of approximately 47 and 45 kDa, and MAPK activity. The biochemical and immunological properties showed by the proteins detected indicated that they were members of the MAPK family phosphorylated in tyrosine residues.

  3. Conserved regulation of MAP kinase expression by PUF RNA-binding proteins.

    Directory of Open Access Journals (Sweden)

    Myon-Hee Lee

    2007-12-01

    Full Text Available Mitogen-activated protein kinase (MAPK and PUF (for Pumilio and FBF [fem-3 binding factor] RNA-binding proteins control many cellular processes critical for animal development and tissue homeostasis. In the present work, we report that PUF proteins act directly on MAPK/ERK-encoding mRNAs to downregulate their expression in both the Caenorhabditis elegans germline and human embryonic stem cells. In C. elegans, FBF/PUF binds regulatory elements in the mpk-1 3' untranslated region (3' UTR and coprecipitates with mpk-1 mRNA; moreover, mpk-1 expression increases dramatically in FBF mutants. In human embryonic stem cells, PUM2/PUF binds 3'UTR elements in both Erk2 and p38alpha mRNAs, and PUM2 represses reporter constructs carrying either Erk2 or p38alpha 3' UTRs. Therefore, the PUF control of MAPK expression is conserved. Its biological function was explored in nematodes, where FBF promotes the self-renewal of germline stem cells, and MPK-1 promotes oocyte maturation and germ cell apoptosis. We found that FBF acts redundantly with LIP-1, the C. elegans homolog of MAPK phosphatase (MKP, to restrict MAPK activity and prevent apoptosis. In mammals, activated MAPK can promote apoptosis of cancer cells and restrict stem cell self-renewal, and MKP is upregulated in cancer cells. We propose that the dual negative regulation of MAPK by both PUF repression and MKP inhibition may be a conserved mechanism that influences both stem cell maintenance and tumor progression.

  4. Plant phosphatidylinositol 3-kinase

    NARCIS (Netherlands)

    Lee, Y.; Munnik, T.; Munnik, T.

    2010-01-01

    Phosphatidylinositol 3-kinase (PI3K) phosphorylates the D-3 position of phosphoinositides. In Arabidopsis, only one PI3K exists, which belongs to the class-III PI3K subfamily which makes phosphatidylinositol 3-phosphate (PtdIns3P). The single AtPI3K gene is essential for survival, since loss of its

  5. MAP kinase pathway gene copy alterations in NRAS/BRAF wild-type advanced melanoma.

    Science.gov (United States)

    Orouji, Elias; Orouji, Azadeh; Gaiser, Timo; Larribère, Lionel; Gebhardt, Christoffer; Utikal, Jochen

    2016-05-01

    Recent therapeutic advances have improved melanoma patientś clinical outcome. Novel therapeutics targeting BRAF, NRAS and cKit mutant melanomas are widely used in clinical practice. However therapeutic options in NRAS(wild-type) /BRAF(wild-type) /cKit(wild-type) melanoma patients are limited. Our study shows that gene copy numbers of members of the MAPK signaling pathway vary in different melanoma subgroups. NRAS(wild-type) /BRAF(wild-type) melanoma metastases are characterized by significant gains of MAP2K1 (MEK1) and MAPK3 (ERK1) gene loci. These additional gene copies could lead to an activation of the MAPK signaling pathway via a gene-dosage effect. Our results suggest that downstream analyses of the pMEK and pERK expression status in NRAS(wild-type) /BRAF(wild-type) melanoma patients identify patients that could benefit from targeted therapies with MEK and ERK inhibitors.

  6. Intein-mediated peptide arrays for epitope mapping and kinase/phosphatase assays.

    Science.gov (United States)

    Xu, Ming-Qun; Ghosh, Inca; Kochinyan, Samvel; Sun, Luo

    2007-01-01

    Synthetic peptides are widely used for production and analysis of antibodies as well as in the study of protein modification enzymes. To circumvent the technical challenges of the existing techniques regarding peptide quantization and normalization, a new method of producing peptide arrays has been developed. This approach utilizes intein-mediated protein ligation that involves linkage of a carrier protein possessing a reactive carboxyl-terminal thioester to a peptide with an amino-terminal cysteine through a native peptide bond. Ligated protein substrates or enzyme-treated samples are arrayed on nitrocellulose membranes with a standard dot-blot apparatus and analyzed by immunoassay. This technique has improved sensitivity and reproducibility, and is suitable for various peptide-based applications. In this report, several experimental procedures including epitope mapping and the study of protein modifications were described.

  7. Heterodimerization and endocytosis of Arabidopsis brassinosteroid receptors BRI1 and AtSERK3 (BAK1)

    DEFF Research Database (Denmark)

    Russinova, Eugenia; Borst, Jan-Willem; Kwaaitaal, Mark Adrianus Cornelis J

    2004-01-01

    In Arabidopsis thaliana brassinosteroid (BR), perception is mediated by two Leu-rich repeat receptor-like kinases, BRASSINOSTEROID INSENSITIVE1 (BRI1) and BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1) (Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR-like KINASE3 [AtSERK3]). Genetic, biochemical, and yeast (...

  8. Expression of protein phosphatases (PP-1, PP-2A, PP-2B and PTP-1B) and protein kinases (MAP kinase and P34cdc2) in the hippocampus of patients with Alzheimer disease and normal aged individuals.

    Science.gov (United States)

    Pei, J J; Sersen, E; Iqbal, K; Grundke-Iqbal, I

    1994-08-29

    Microtubule-associated protein tau is abnormally hyperphosphorylated in the brain of patients with Alzheimer disease (AD). Previous studies have shown (i) that in vitro tau can be phosphorylated to an Alzheimer abnormally phosphorylated state-like protein by proline-directed protein kinases MAP kinase and p34cdc2, and (ii) that the AD abnormally phosphorylated tau can be in vitro dephosphorylated by protein phosphatases PP-2B, PP-2A and PP-1 and not by PP-2C. However, to have a direct effect on the regulation of phosphorylation of tau, these enzymes should be present in the affected neurons. In the present study immunocytochemical localization of protein phosphatases PP-1, PP-2A, PP-2B and PTP, and protein kinases MAP kinase and p34cdc2 were studied in the hippocampal formation of AD and as a control in non-demented elderly patients. All the protein phosphatases and protein kinases studied were localized to both granular and pyramidal neurons. In the pyramidal neurons, the enzymes staining was observed in neuronal soma and neurites. PTP-1B, PP-1 and PP-2A were also highly expressed in microglia. The topographical distributions of all the enzymes studied were similar, i.e. the intensity of immunostaining in hippocampus in end-plate (CA3 and CA4) > prosubiculum, subiculum > entorhinal cortex > dentate gyrus > CA2 > CA1. Furthermore, the expression of all the enzymes was also observed in the tangle-bearing neurons. The PP-2B staining of the tangle-bearing neurons was weaker than the unaffected neurons in the same tissue section field in AD cases.

  9. The ERK MAP kinase-PEA3/ETV4-MMP-1 axis is operative in oesophageal adenocarcinoma

    LENUS (Irish Health Repository)

    Keld, Richard

    2010-12-09

    Abstract Background Many members of the ETS-domain transcription factor family are important drivers of tumourigenesis. In this context, their activation by Ras-ERK pathway signaling is particularly relevant to the tumourigenic properties of many ETS-domain transcription factors. The PEA3 subfamily of ETS-domain transcription factors have been implicated in tumour metastasis in several different cancers. Results Here, we have studied the expression of the PEA3 subfamily members PEA3\\/ETV4 and ER81\\/ETV1 in oesophageal adenocarcinomas and determined their role in oesophageal adenocarcinoma cell function. PEA3 plays an important role in controlling both the proliferation and invasive properties of OE33 oesophageal adenocarcinoma cells. A key target gene is MMP-1. The ERK MAP kinase pathway activates PEA3 subfamily members and also plays a role in these PEA3 controlled events, establishing the ERK-PEA3-MMP-1 axis as important in OE33 cells. PEA3 subfamily members are upregulated in human adenocarcinomas and expression correlates with MMP-1 expression and late stage metastatic disease. Enhanced ERK signaling is also more prevalent in late stage oesophageal adenocarcinomas. Conclusions This study shows that the ERK-PEA3-MMP-1 axis is upregulated in oesophageal adenocarcinoma cells and is a potentially important driver of the metastatic progression of oesophageal adenocarcinomas.

  10. Conditional deletion of ERK5 MAP kinase in the nervous system impairs pheromone information processing and pheromone-evoked behaviors.

    Directory of Open Access Journals (Sweden)

    Junhui Zou

    Full Text Available ERK5 MAP kinase is highly expressed in the developing nervous system but absent in most regions of the adult brain. It has been implicated in regulating the development of the main olfactory bulb and in odor discrimination. However, whether it plays an essential role in pheromone-based behavior has not been established. Here we report that conditional deletion of the Mapk7 gene which encodes ERK5 in mice in neural stem cells impairs several pheromone-mediated behaviors including aggression and mating in male mice. These deficits were not caused by a reduction in the level of testosterone, by physical immobility, by heightened fear or anxiety, or by depression. Using mouse urine as a natural pheromone-containing solution, we provide evidence that the behavior impairment was associated with defects in the detection of closely related pheromones as well as with changes in their innate preference for pheromones related to sexual and reproductive activities. We conclude that expression of ERK5 during development is critical for pheromone response and associated animal behavior in adult mice.

  11. The ERK MAP kinase-PEA3/ETV4-MMP-1 axis is operative in oesophageal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Gulmann Christian

    2010-12-01

    Full Text Available Abstract Background Many members of the ETS-domain transcription factor family are important drivers of tumourigenesis. In this context, their activation by Ras-ERK pathway signaling is particularly relevant to the tumourigenic properties of many ETS-domain transcription factors. The PEA3 subfamily of ETS-domain transcription factors have been implicated in tumour metastasis in several different cancers. Results Here, we have studied the expression of the PEA3 subfamily members PEA3/ETV4 and ER81/ETV1 in oesophageal adenocarcinomas and determined their role in oesophageal adenocarcinoma cell function. PEA3 plays an important role in controlling both the proliferation and invasive properties of OE33 oesophageal adenocarcinoma cells. A key target gene is MMP-1. The ERK MAP kinase pathway activates PEA3 subfamily members and also plays a role in these PEA3 controlled events, establishing the ERK-PEA3-MMP-1 axis as important in OE33 cells. PEA3 subfamily members are upregulated in human adenocarcinomas and expression correlates with MMP-1 expression and late stage metastatic disease. Enhanced ERK signaling is also more prevalent in late stage oesophageal adenocarcinomas. Conclusions This study shows that the ERK-PEA3-MMP-1 axis is upregulated in oesophageal adenocarcinoma cells and is a potentially important driver of the metastatic progression of oesophageal adenocarcinomas.

  12. Comparative mapping of Brassica juncea and Arabidopsis thaliana using Intron Polymorphism (IP markers: homoeologous relationships, diversification and evolution of the A, B and C Brassica genomes

    Directory of Open Access Journals (Sweden)

    Gupta Vibha

    2008-03-01

    Full Text Available Abstract Background Extensive mapping efforts are currently underway for the establishment of comparative genomics between the model plant, Arabidopsis thaliana and various Brassica species. Most of these studies have deployed RFLP markers, the use of which is a laborious and time-consuming process. We therefore tested the efficacy of PCR-based Intron Polymorphism (IP markers to analyze genome-wide synteny between the oilseed crop, Brassica juncea (AABB genome and A. thaliana and analyzed the arrangement of 24 (previously described genomic block segments in the A, B and C Brassica genomes to study the evolutionary events contributing to karyotype variations in the three diploid Brassica genomes. Results IP markers were highly efficient and generated easily discernable polymorphisms on agarose gels. Comparative analysis of the segmental organization of the A and B genomes of B. juncea (present study with the A and B genomes of B. napus and B. nigra respectively (described earlier, revealed a high degree of colinearity suggesting minimal macro-level changes after polyploidization. The ancestral block arrangements that remained unaltered during evolution and the karyotype rearrangements that originated in the Oleracea lineage after its divergence from Rapa lineage were identified. Genomic rearrangements leading to the gain or loss of one chromosome each between the A-B and A-C lineages were deciphered. Complete homoeology in terms of block organization was found between three linkage groups (LG each for the A-B and A-C genomes. Based on the homoeology shared between the A, B and C genomes, a new nomenclature for the B genome LGs was assigned to establish uniformity in the international Brassica LG nomenclature code. Conclusion IP markers were highly effective in generating comparative relationships between Arabidopsis and various Brassica species. Comparative genomics between the three Brassica lineages established the major rearrangements

  13. Arabidopsis CDS blastp result: AK105724 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK105724 001-201-G07 At1g07110.1 fructose-6-phosphate 2-kinase / fructose-2,6-bisph...osphatase (F2KP) identical to fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (F2KP) [Arabidopsis thaliana] GI:13096098 0.0 ...

  14. Arabidopsis CDS blastp result: AK072243 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK072243 J023003N10 At1g07110.1 fructose-6-phosphate 2-kinase / fructose-2,6-bispho...sphatase (F2KP) identical to fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (F2KP) [Arabidopsis thaliana] GI:13096098 0.0 ...

  15. Molecular Basis of Meiotic Maturation and Apoptosis of Oocytes, Sperm-Oocyte Interactions and Early Cleavage of Embryos in Mice, Role of Phosphatidylinositol 3-Kinase, Mos, Fas-Fas Ligand, Integrinα6 and MAP Kinase

    Directory of Open Access Journals (Sweden)

    Yumi Hoshino

    2005-01-01

    Full Text Available The interaction between molecular biology and embryology made an extensive progress in the research on gametogenesis, fertilization and early embryogenesis in mice. In this article, molecules involving in meiotic maturation and apoptosis of oocytes, sperm-oocyte interactions and early cleavage of fertilized embryos in mice are described including our recent following experiments. 1 Phosphatidylinositol 3-kinase and Akt participate in the follicle stimulating hormone-induced meiotic maturation of mouse oocytes. 2 Mos plays a crucial role in normal spindle and chromosome morphology and the reactivation of maturation promoting factor after first meiosis. 3 Follicular atresia is caused by apoptosis and the apoptosis associated with internucleosomal DNA fragmentation is directly regulated by the Fas-Fas ligand system. 4 Integrin α6β1 is involved in sperm-egg binding leading to fusion via direct association of the integrin α 6 with sperm. 5 MAP kinase cascade is activated at the M-phase and some MAP kinases other than ERKs are activated during early cleavage of fertilized eggs.

  16. Localization of the human stress responsive MAP kinase-like CSAIDs binding protein (CSBP) gene to chromosome 6p21.3/21.2

    Energy Technology Data Exchange (ETDEWEB)

    McDonnell, P.C.; Young, P.R.; DiLella, A.G. [SmithKline Beecham Pharmaceuticals, King of Prussia, PA (United States)] [and others

    1995-09-01

    The proinflammatory cytokines interleukin 1 (IL-1) and tumor necrosis factor (TNF) play a pivotal role in the initiation of inflammatory responses. Soluble protein antagonists of IL-1 and TNF, such as IL-1ra, sTNFR-Fc fusion, and monoclonal antibodies to TNF have proven to be effective at blocking acute and chronic responses in a number of animal models of inflammatory diseases such as rheumatoid arthritis, septic shock, and inflammatory bowel disease. Consequently, there has been considerable interest in discovering compounds that could inhibit the production of these cytokines and might therefore become treatments. Recently, a structurally related series of pyridinyl imidazoles was found to block IL-1 and TNF production from LPS-stimulated human monocytes and to ameliorate inflammatory diseases significantly in vivo, leading to their being named CSAIDs (cytokine suppressive anti-inflammatory drugs). The protein target of these compounds, termed CSBP (CSAID binding protein), was discovered to be a new member of the MAP kinase family of serine-threonine protein kinases whose kinase activity is activated by LPS in human monocytes. Independently, the same kinase, or its rodent homologues, was found to respond also to chemical, thermal, and osmotic stress and IL-1 treatment. Inhibition of this kinase correlated with reduction in inflammatory cytokine production from LPS-activated monocytes. 15 refs., 1 fig.

  17. PRO40 is a scaffold protein of the cell wall integrity pathway, linking the MAP kinase module to the upstream activator protein kinase C.

    Directory of Open Access Journals (Sweden)

    Ines Teichert

    2014-09-01

    Full Text Available Mitogen-activated protein kinase (MAPK pathways are crucial signaling instruments in eukaryotes. Most ascomycetes possess three MAPK modules that are involved in key developmental processes like sexual propagation or pathogenesis. However, the regulation of these modules by adapters or scaffolds is largely unknown. Here, we studied the function of the cell wall integrity (CWI MAPK module in the model fungus Sordaria macrospora. Using a forward genetic approach, we found that sterile mutant pro30 has a mutated mik1 gene that encodes the MAPK kinase kinase (MAPKKK of the proposed CWI pathway. We generated single deletion mutants lacking MAPKKK MIK1, MAPK kinase (MAPKK MEK1, or MAPK MAK1 and found them all to be sterile, cell fusion-deficient and highly impaired in vegetative growth and cell wall stress response. By searching for MEK1 interaction partners via tandem affinity purification and mass spectrometry, we identified previously characterized developmental protein PRO40 as a MEK1 interaction partner. Although fungal PRO40 homologs have been implicated in diverse developmental processes, their molecular function is currently unknown. Extensive affinity purification, mass spectrometry, and yeast two-hybrid experiments showed that PRO40 is able to bind MIK1, MEK1, and the upstream activator protein kinase C (PKC1. We further found that the PRO40 N-terminal disordered region and the central region encompassing a WW interaction domain are sufficient to govern interaction with MEK1. Most importantly, time- and stress-dependent phosphorylation studies showed that PRO40 is required for MAK1 activity. The sum of our results implies that PRO40 is a scaffold protein for the CWI pathway, linking the MAPK module to the upstream activator PKC1. Our data provide important insights into the mechanistic role of a protein that has been implicated in sexual and asexual development, cell fusion, symbiosis, and pathogenicity in different fungal systems.

  18. Perception of the novel MAMP eMax from different Xanthomonas species requires the Arabidopsis receptor-like protein ReMAX and the receptor kinase SOBIR

    OpenAIRE

    Jehle, Anna Kristina; Fürst, Ursula; Lipschis, Martin; Albert, Markus; Felix, Georg

    2013-01-01

    As part of their innate immune system plants carry a number of pattern recognition receptors (PRRs) that can detect a broad range of microbe-associated molecular patterns (MAMPs). In a recently published article1 we described a novel, proteinaceous MAMP termed eMax (enigmatic MAMP of Xanthomonas) that derives from Xanthomonas and gets recognized by the receptor-like protein ReMAX (RECEPTOR OF eMax) of Arabidopsis thaliana. ReMAX has no ortholog in Nicotiana benthamiana and this species does n...

  19. A superoxide anion-scavenger, 1,3-selenazolidin-4-one suppresses serum deprivation-induced apoptosis in PC12 cells by activating MAP kinase

    Energy Technology Data Exchange (ETDEWEB)

    Nishina, Atsuyoshi, E-mail: nishina@yone.ac.jp [Yonezawa Women' s Junior College, 6-15-1 Tohrimachi, Yonezawa, Yamagata 992-0025 (Japan); Kimura, Hirokazu; Kozawa, Kunihisa [Gunma Prefectural Institute of Public Health and Environmental Sciences, 378 Kamioki, Maebashi, Gunma 371-0052 (Japan); Sommen, Geoffroy [Lonza Braine SA, Chaussee de Tubize 297, B-1420 Braine l' Alleud (Belgium); Nakamura, Takao [Department of Biomedical Information Engineering, Graduate School of Medical Science, Yamagata University, Yamagata 990-9585 (Japan); Heimgartner, Heinz [University of Zuerich, Institut of Organic Chemistry, Winterthurerstrasse 190, CH-8057 Zuerich (Switzerland); Koketsu, Mamoru [Department of Materials Science and Technology, Faculty of Engineering, Gifu University, Gifu 501-1193 (Japan); Furukawa, Shoei [Laboratory of Molecular Biology, Gifu Pharmaceutical University, 5-6-1 Mitahora-higashi, Gifu 502-8585 (Japan)

    2011-12-15

    Synthetic organic selenium compounds, such as ebselen, may show glutathione peroxidase-like antioxidant activity and have a neurotrophic effect. We synthesized 1,3-selenazolidin-4-ones, new types of synthetic organic selenium compounds (five-member ring compounds), to study their possible applications as antioxidants or neurotrophic-like molecules. Their superoxide radical scavenging effects were assessed using the quantitative, highly sensitive method of real-time kinetic chemiluminescence. At 166 {mu}M, the O{sub 2}{sup -} scavenging activity of 1,3-selenazolidin-4-ones ranged from 0 to 66.2%. 2-[3-(4-Methoxyphenyl)-4-oxo-1,3-selenazolidin-2-ylidene]malononitrile (compound b) showed the strongest superoxide anion-scavenging activity among the 6 kinds of 2-methylene-1,3-selenazolidin-4-ones examined. Compound b had a 50% inhibitory concentration (IC{sub 50}) at 92.4 {mu}M and acted as an effective and potentially useful O{sub 2}{sup -} scavenger in vitro. The effect of compound b on rat pheochromocytome cell line PC12 cells was compared with that of ebselen or nerve growth factor (NGF) by use of the MTT [3-(4, 5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay. When ebselen was added at 100 {mu}M or more, toxicity toward PC12 cells was evident. On the contrary, compound b suppressed serum deprivation-induced apoptosis in PC12 cells more effectively at a concentration of 100 {mu}M. The activity of compound b to phosphorylate mitogen-activated protein kinase/extracellular signal-regulated protein kinase (ERK) 1/2 (MAP kinase) in PC12 cells was higher than that of ebselen, and the former at 100 {mu}M induced the phosphorylation of MAP kinase to a degree similar to that induced by NGF. From these results, we conclude that this superoxide anion-scavenger, compound b, suppressed serum deprivation-induced apoptosis by promoting the phosphorylation of MAP kinase. -- Highlights: Black-Right-Pointing-Pointer We newly synthesized 1,3-selenazolidin-4-ones to

  20. The Aspergillus fumigatus SchASCH9 kinase modulates SakAHOG1 MAP kinase activity and it is essential for virulence

    Science.gov (United States)

    Alves de Castro, Patrícia; dos Reis, Thaila Fernanda; Dolan, Stephen K.; Manfiolli, Adriana Oliveira; Brown, Neil Andrew; Jones, Gary W.; Doyle, Sean; Riaño-Pachón, Diego M.; Squina, Fábio Márcio; Caldana, Camila; Singh, Ashutosh; Del Poeta, Maurizio; Hagiwara, Daisuke; Silva-Rocha, Rafael; Goldman, Gustavo H.

    2016-01-01

    Summary The serine-threonine kinase TOR, the Target of Rapamycin, is an important regulator of nutrient, energy and stress signaling in eukaryotes. Sch9, a Ser/Thr kinase of AGC family (the cAMP-dependent PKA, cGMP- dependent protein kinase G and phospholipid-dependent protein kinase C family), is a substrate of TOR. Here, we characterized the fungal opportunistic pathogen Aspergillus fumigatus Sch9 homologue (SchA). The schA null mutant was sensitive to rapamycin, high concentrations of calcium, hyperosmotic stress and SchA was involved in iron metabolism. The ΔschA null mutant showed increased phosphorylation of SakA, the A. fumigatus Hog1 homologue. The schA null mutant has increased and decreased trehalose and glycerol accumulation, respectively, suggesting SchA performs different roles for glycerol and trehalose accumulation during osmotic stress. The schA was transcriptionally regulated by osmotic stress and this response was dependent on SakA and MpkC. The double ΔschA ΔsakA and ΔschA ΔmpkC mutants were more sensitive to osmotic stress than the corresponding parental strains. Transcriptomics and proteomics identified direct and indirect targets of SchA post-exposure to hyperosmotic stress. Finally, ΔschA was avirulent in a low dose murine infection model. Our results suggest there is a complex network of interactions amongst the A. fumigatus TOR, SakA and SchA pathways. PMID:27538790

  1. Microglial Signaling in Chronic Pain with a Special Focus on Caspase 6, p38 MAP Kinase, and Sex Dependence.

    Science.gov (United States)

    Berta, T; Qadri, Y J; Chen, G; Ji, R R

    2016-09-01

    Microglia are the resident immune cells in the spinal cord and brain. Mounting evidence suggests that activation of microglia plays an important role in the pathogenesis of chronic pain, including chronic orofacial pain. In particular, microglia contribute to the transition from acute pain to chronic pain, as inhibition of microglial signaling reduces pathologic pain after inflammation, nerve injury, and cancer but not baseline pain. As compared with inflammation, nerve injury induces much more robust morphologic activation of microglia, termed microgliosis, as shown by increased expression of microglial markers, such as CD11b and IBA1. However, microglial signaling inhibitors effectively reduce inflammatory pain and neuropathic pain, arguing against the importance of morphologic activation of microglia in chronic pain sensitization. Importantly, microglia enhance pain states via secretion of proinflammatory and pronociceptive mediators, such as tumor necrosis factor α, interleukins 1β and 18, and brain-derived growth factor. Mechanistically, these mediators have been shown to enhance excitatory synaptic transmission and suppress inhibitory synaptic transmission in the pain circuits. While early studies suggested a predominant role of microglia in the induction of chronic pain, further studies have supported a role of microglia in the maintenance of chronic pain. Intriguingly, recent studies show male-dominant microglial signaling in some neuropathic pain and inflammatory pain states, although both sexes show identical morphologic activation of microglia after nerve injury. In this critical review, we provide evidence to show that caspase 6-a secreted protease that is expressed in primary afferent axonal terminals surrounding microglia-is a robust activator of microglia and induces profound release of tumor necrosis factor α from microglia via activation of p38 MAP kinase. The authors also show that microglial caspase 6/p38 signaling is male dominant in some

  2. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Aniek van der Vaart

    2015-12-01

    Full Text Available Cilia are sensory organelles present on almost all vertebrate cells. Cilium length is constant, but varies between cell types, indicating that cilium length is regulated. How this is achieved is unclear, but protein transport in cilia (intraflagellar transport, IFT plays an important role. Several studies indicate that cilium length and function can be modulated by environmental cues. As a model, we study a C. elegans mutant that carries a dominant active G protein α subunit (gpa-3QL, resulting in altered IFT and short cilia. In a screen for suppressors of the gpa-3QL short cilium phenotype, we identified uev-3, which encodes an E2 ubiquitin-conjugating enzyme variant that acts in a MAP kinase pathway. Mutation of two other components of this pathway, dual leucine zipper-bearing MAPKKK DLK-1 and p38 MAPK PMK-3, also suppress the gpa-3QL short cilium phenotype. However, this suppression seems not to be caused by changes in IFT. The DLK-1/p38 pathway regulates several processes, including microtubule stability and endocytosis. We found that reducing endocytosis by mutating rabx-5 or rme-6, RAB-5 GEFs, or the clathrin heavy chain, suppresses gpa-3QL. In addition, gpa-3QL animals showed reduced levels of two GFP-tagged proteins involved in endocytosis, RAB-5 and DPY-23, whereas pmk-3 mutant animals showed accumulation of GFP-tagged RAB-5. Together our results reveal a new role for the DLK-1/p38 MAPK pathway in control of cilium length by regulating RAB-5 mediated endocytosis.

  3. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.

    Science.gov (United States)

    van der Vaart, Aniek; Rademakers, Suzanne; Jansen, Gert

    2015-12-01

    Cilia are sensory organelles present on almost all vertebrate cells. Cilium length is constant, but varies between cell types, indicating that cilium length is regulated. How this is achieved is unclear, but protein transport in cilia (intraflagellar transport, IFT) plays an important role. Several studies indicate that cilium length and function can be modulated by environmental cues. As a model, we study a C. elegans mutant that carries a dominant active G protein α subunit (gpa-3QL), resulting in altered IFT and short cilia. In a screen for suppressors of the gpa-3QL short cilium phenotype, we identified uev-3, which encodes an E2 ubiquitin-conjugating enzyme variant that acts in a MAP kinase pathway. Mutation of two other components of this pathway, dual leucine zipper-bearing MAPKKK DLK-1 and p38 MAPK PMK-3, also suppress the gpa-3QL short cilium phenotype. However, this suppression seems not to be caused by changes in IFT. The DLK-1/p38 pathway regulates several processes, including microtubule stability and endocytosis. We found that reducing endocytosis by mutating rabx-5 or rme-6, RAB-5 GEFs, or the clathrin heavy chain, suppresses gpa-3QL. In addition, gpa-3QL animals showed reduced levels of two GFP-tagged proteins involved in endocytosis, RAB-5 and DPY-23, whereas pmk-3 mutant animals showed accumulation of GFP-tagged RAB-5. Together our results reveal a new role for the DLK-1/p38 MAPK pathway in control of cilium length by regulating RAB-5 mediated endocytosis.

  4. Rapid CB1 cannabinoid receptor desensitization defines the time course of ERK1/2 MAP kinase signaling.

    Science.gov (United States)

    Daigle, Tanya L; Kearn, Christopher S; Mackie, Ken

    2008-01-01

    Molecular mechanisms regulating the development of physiological and behavioral tolerance to cannabinoids are not well understood. Two cellular correlates implicated in the development and maintenance of tolerance are CB(1) cannabinoid receptor internalization and uncoupling of receptor signal transduction. Both processes have been proposed as mediators of tolerance because of observations that chronic Delta(9)-tetrahydrocannabinol (THC) treatment causes both region-specific decreases in CB(1) receptors and G-protein coupling in the brain. To determine the balance of these two processes in regulating CB(1) receptor signaling during sustained receptor stimulation, we evaluated the parameters affecting ERK1/2 MAP kinase activity in HEK293 cells stably expressing CB(1) receptors. CB(1) receptor stimulation by the potent CB(1) receptor agonist, CP 55,940 transiently activated ERK1/2. To determine if CB(1) receptor desensitization or internalization was responsible for the transient nature of ERK1/2 activation, we evaluated ERK1/2 phosphorylation in HEK293 cells expressing a desensitization-deficient CB(1) receptor (S426A/S430A CB(1)). Here, the duration of S426A/S430A CB(1) receptor-mediated activation of ERK1/2 was markedly prolonged relative to wild-type receptors, and was dynamically reversed by SR141716A. Interestingly, the S426A/S430A CB(1) receptor was still able to recruit betaarrestin-2, a key mediator of receptor desensitization, to the cell surface following agonist activation. In contrast to a central role for desensitization, pharmacological and genetic approaches suggested CB(1) receptor internalization is dispensable in the transient activation of ERK1/2. This study indicates that the duration of ERK1/2 activation by CB(1) receptors is regulated by receptor desensitization and underscores the importance of G-protein uncoupling in the regulation of CB(1) receptor signaling.

  5. Signaling through P2X7 receptor in human T cells involves p56lck, MAP kinases, and transcription factors AP-1 and NF-kappa B.

    Science.gov (United States)

    Budagian, Vadim; Bulanova, Elena; Brovko, Luba; Orinska, Zane; Fayad, Raja; Paus, Ralf; Bulfone-Paus, Silvia

    2003-01-17

    ATP-gated ion channel P2X receptors are expressed on the surface of most immune cells and can trigger multiple cellular responses, such as membrane permeabilization, cytokine production, and cell proliferation or apoptosis. Despite broad distribution and pleiotropic activities, signaling pathways downstream of these ionotropic receptors are still poorly understood. Here, we describe intracellular signaling events in Jurkat cells treated with millimolar concentrations of extracellular ATP. Within minutes, ATP treatment resulted in the phosphorylation and activation of p56(lck) kinase, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase but not p38 kinase. These effects were wholly dependent upon the presence of extracellular Ca(2+) ions in the culture medium. Nevertheless, calmodulin antagonist calmidazolium and CaM kinase inhibitor KN-93 both had no effect on the activation of p56(lck) and ERK, whereas a pretreatment of Jurkat cells with MAP kinase kinase inhibitor P098059 was able to abrogate phosphorylation of ERK. Further, expression of c-Jun and c-Fos proteins and activator protein (AP-1) DNA binding activity were enhanced in a time-dependent manner. In contrast, DNA binding activity of NF-kappa B was reduced. ATP failed to stimulate the phosphorylation of ERK and c-Jun N-terminal kinase and activation of AP-1 in the p56(lck)-deficient isogenic T cell line JCaM1, suggesting a critical role for p56(lck) kinase in downstream signaling. Regarding the biological significance of the ATP-induced signaling events we show that although extracellular ATP was able to stimulate proliferation of both Jurkat and JCaM1 cells, an increase in interleukin-2 transcription was observed only in Jurkat cells. The nucleotide selectivity and pharmacological profile data supported the evidence that the ATP-induced effects in Jurkat cells were mediated through the P2X7 receptor. Taken together, these results demonstrate the ability of extracellular ATP to activate

  6. Identification and functional characterization of the Arabidopsis Snf1-related protein kinase SnRK2.4 phosphatidic acid-binding domain

    NARCIS (Netherlands)

    Julkowska, M.M.; McLoughlin, F.; Galvan-Ampudia, C.S.; Rankenberg, J.M.; Kawa, D.; Klimecka, M.; Haring, M.A.; Munnik, T.; Kooijman, E.E.; Testerink, C.

    2015-01-01

    Phosphatidic acid (PA) is an important signalling lipid involved in various stress-induced signalling cascades. Two SnRK2 protein kinases (SnRK2.4 and SnRK2.10), previously identified as PA-binding proteins, are shown here to prefer binding to PA over other anionic phospholipids and to associate wit

  7. The Arabidopsis thaliana lectin receptor kinase LecRK-I.9 is required for full resistance to Pseudomonas syringae and affects jasmonate signalling

    NARCIS (Netherlands)

    Balagué, Claudine; Gouget, Anne; Bouchez, Olivier; Souriac, Camille; Haget, Nathalie; Boutet-Mercey, Stéphanie; Govers, Francine; Roby, Dominique; Canut, Hervé

    2016-01-01

    On microbial attack, plants can detect invaders and activate plant innate immunity. For the detection of pathogen molecules or cell wall damage, plants employ receptors that trigger the activation of defence responses. Cell surface proteins that belong to large families of lectin receptor kinases

  8. Genome wide association mapping in Arabidopsis thaliana identifies novel genes involved in linking allyl glucosinolate to altered biomass and defense

    Directory of Open Access Journals (Sweden)

    Marta Francisco

    2016-07-01

    Full Text Available A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL, may provide direct feedback regulation, linking defense metabolism outputs to the growth and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 µM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  9. Inducible and targeted deletion of the ERK5 MAP kinase in adult neurogenic regions impairs adult neurogenesis in the olfactory bulb and several forms of olfactory behavior.

    Directory of Open Access Journals (Sweden)

    Yung-Wei Pan

    Full Text Available Although adult-born neurons in the subventricular zone (SVZ and olfactory bulb (OB have been extensively characterized at the cellular level, their functional impact on olfactory behavior is still highly controversial with many conflicting results reported in the literature. Furthermore, signaling mechanisms regulating adult SVZ/OB neurogenesis are not well defined. Here we report that inducible and targeted deletion of erk5, a MAP kinase selectively expressed in the adult neurogenic regions of the adult brain, impairs adult neurogenesis in the SVZ and OB of transgenic mice. Although erk5 deletion had no effect on olfactory discrimination among discrete odorants in the habituation/dishabituation assay, it reduced short-term olfactory memory as well as detection sensitivity to odorants and pheromones including those evoking aggression and fear. Furthermore, these mice show impaired acquisition of odor-cued associative olfactory learning, a novel phenotype that had not been previously linked to adult neurogenesis. These data suggest that ERK5 MAP kinase is a critical kinase signaling pathway regulating adult neurogenesis in the SVZ/OB, and provide strong evidence supporting a functional role for adult neurogenesis in several distinct forms of olfactory behavior.

  10. Mapping the lipoylation site of Arabidopsis thaliana plastidial dihydrolipoamide S-acetyltransferase using mass spectrometry and site-directed mutagenesis.

    Science.gov (United States)

    Casteel, Jill; Miernyk, Ján A; Thelen, Jay J

    2011-11-01

    Catalytic enhancement achieved by the pyruvate dehydrogenase complex (PDC) results from a combination of substrate channeling plus active-site coupling. The mechanism for active-site coupling involves lipoic acid prosthetic groups covalently attached to Lys in the primary sequence of the dihydrolipoyl S-acetyltransferase (E2) component. Arabidopsis thaliana plastidial E2 (AtplE2-1A-His(6)) was expressed in Escherichia coli. Analysis of recombinant protein by SDS-PAGE revealed a Mr 59,000 band. Supplementation of bacterial culture medium with l-lipoic acid (LA) shifted the band to Mr 57,000. Intact mass determinations using matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) revealed the faster migrating E2 species was 189 Da larger than the slower migrating form, exactly the difference that would result from addition of a single lipoamide group. Results from systematic MALDI-TOF analysis of Lys-containing tryptic peptides derived from purified recombinant AtplE2-1A indicate that Lys96 is the site of lipoyl-addition. Analysis of Lys96 site-directed mutant proteins showed that they migrated as single species during SDS-PAGE when expressed in either the absence or presence of supplemental LA. Results from both intact and tryptic peptide mass determinations by MALDI-TOF MS confirmed that the mutant proteins were not lipoylated. The A. thaliana plastidial E2 subunit includes a single lipoyl-prosthetic group covalently attached to Lys96. Despite low primary sequence identity with bacterial E2, the plant E2 protein was recognized and modified by E. coli E2 lipoyl-addition system. Results from meta-genomic analysis suggest a β-turn is more important in defining the site for LA addition than a conserved sequence motif.

  11. p42/p44 MAP kinase activation is localized to caveolae-free membrane domains in airway smooth muscle

    NARCIS (Netherlands)

    Gosens, Reinoud; Dueck, Gordon; Gerthoffer, William T; Unruh, Helmut; Zaagsma, Johan; Meurs, Herman; Halayko, Andrew J

    2007-01-01

    Caveolae are abundant plasma membrane invaginations in airway smooth muscle that may function as preorganized signalosomes by sequestering and regulating proteins that control cell proliferation, including receptor tyrosine kinases (RTKs) and their signaling effectors. We previously demonstrated, ho

  12. Opposite effects of the p52shc/p46shc and p66shc splicing isoforms on the EGF receptor-MAP kinase-fos signalling pathway

    DEFF Research Database (Denmark)

    Migliaccio, E; Mele, S; Salcini, A E;

    1997-01-01

    66shc expression varies from cell type to cell type. p66shc differs from p52shc/p46shc in its inability to transform mouse fibroblasts in vitro. Like p52shc/p46shc, p66shc is tyrosine-phosphorylated upon epidermal growth factor (EGF) stimulation, binds to activated EGF receptors (EGFRs) and forms...... on the EGFR-MAP kinase and other signalling pathways that control fos promoter activity. Regulation of p66shc expression might, therefore, influence the cellular response to growth factors.......Shc proteins are targets of activated tyrosine kinases and are implicated in the transmission of activation signals to Ras. The p46shc and p52shc isoforms share a C-terminal SH2 domain, a proline- and glycine-rich region (collagen homologous region 1; CH1) and a N-terminal PTB domain. We have...

  13. Histamine activates p38 MAP kinase and alters local lamellipodia dynamics, reducing endothelial barrier integrity and eliciting central movement of actin fibers.

    Science.gov (United States)

    Adderley, Shaquria P; Lawrence, Curtis; Madonia, Eyong; Olubadewo, Joseph O; Breslin, Jerome W

    2015-07-01

    The role of the actin cytoskeleton in endothelial barrier function has been debated for nearly four decades. Our previous investigation revealed spontaneous local lamellipodia in confluent endothelial monolayers that appear to increase overlap at intercellular junctions. We tested the hypothesis that the barrier-disrupting agent histamine would reduce local lamellipodia protrusions and investigated the potential involvement of p38 mitogen-activated protein (MAP) kinase activation and actin stress fiber formation. Confluent monolayers of human umbilical vein endothelial cells (HUVEC) expressing green fluorescent protein-actin were studied using time-lapse fluorescence microscopy. The protrusion and withdrawal characteristics of local lamellipodia were assessed before and after addition of histamine. Changes in barrier function were determined using electrical cell-substrate impedance sensing. Histamine initially decreased barrier function, lamellipodia protrusion frequency, and lamellipodia protrusion distance. A longer time for lamellipodia withdrawal and reduced withdrawal distance and velocity accompanied barrier recovery. After barrier recovery, a significant number of cortical fibers migrated centrally, eventually resembling actin stress fibers. The p38 MAP kinase inhibitor SB203580 attenuated the histamine-induced decreases in barrier function and lamellipodia protrusion frequency. SB203580 also inhibited the histamine-induced decreases in withdrawal distance and velocity, and the subsequent actin fiber migration. These data suggest that histamine can reduce local lamellipodia protrusion activity through activation of p38 MAP kinase. The findings also suggest that local lamellipodia have a role in maintaining endothelial barrier integrity. Furthermore, we provide evidence that actin stress fiber formation may be a reaction to, rather than a cause of, reduced endothelial barrier integrity.

  14. Staphylococcus aureus α-toxin-mediated cation entry depolarizes membrane potential and activates p38 MAP kinase in airway epithelial cells.

    Science.gov (United States)

    Eiffler, Ina; Behnke, Jane; Ziesemer, Sabine; Müller, Christian; Hildebrandt, Jan-Peter

    2016-09-01

    Membrane potential (Vm)-, Na(+)-, or Ca(2+)-sensitive fluorescent dyes were used to analyze changes in Vm or intracellular ion concentrations in airway epithelial cells treated with Staphylococcus aureus α-toxin (Hla), a major virulence factor of pathogenic strains of these bacteria. Gramicidin, a channel-forming peptide causing membrane permeability to monovalent cations, a mutated form of Hla, rHla-H35L, which forms oligomers in the plasma membranes of eukaryotic cells but fails to form functional transmembrane pores, or the cyclodextrin-derivative IB201, a blocker of the Hla pore, were used to investigate the permeability of the pore. Na(+) as well as Ca(2+) ions were able to pass the Hla pore and accumulated in the cytosol. The pore-mediated influx of calcium ions was blocked by IB201. Treatment of cells with recombinant Hla resulted in plasma membrane depolarization as well as in increases in the phosphorylation levels of paxillin (signaling pathway mediating disruption of the actin cytoskeleton) and p38 MAP kinase (signaling pathway resulting in defensive actions). p38 MAP kinase phosphorylation, but not paxillin phosphorylation, was elicited by treatment of cells with gramicidin. Although treatment of cells with rHla-H35L resulted in the formation of membrane-associated heptamers, none of these cellular effects were observed in our experiments. This indicates that formation of functional Hla-transmembrane pores is required to induce the cell physiological changes mediated by α-toxin. Specifically, the changes in ion equilibria and plasma membrane potential are important activators of p38 MAP kinase, a signal transduction module involved in host cell defense.

  15. The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

    Science.gov (United States)

    Gruber, Sabine; Zeilinger, Susanne

    2014-01-01

    Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

  16. [INHIBITORS OF MAP-KINASE PATHWAY U0126 AND PD98059 DIFFERENTLY AFFECT ORGANIZATION OF TUBULIN CYTOSKELETON AFTER STIMULATION OF EGF RECEPTOR ENDOCYTOSIS].

    Science.gov (United States)

    Zlobina, M V; Steblyanko, Yu Yu; Shklyaeva, M A; Kharchenko, V V; Salova, A V; Kornilova, E S

    2015-01-01

    To confirm the hypothesis about the involvement of EGF-stimulated MAP-kinase ERK1/2 in the regulation of microtubule (MT) system, the influence of two widely used ERK1/2 inhibitors, U0126 and PD98059, on the organization of tubulin cytoskeleton in interphase HeLa cells during EGF receptor endocytosis has been investigated. We have found that addition of U0126 or PD98059 to not-stimulated with EGF ells for 30 min has no effect on radially organized MT system. However, in the case of U0126 addition before EGF endocytosis stimulation, the number of MT per cell decreased within 15 min after such stimulation and was followed by complete MT depolymerization by 60-90 min. Stimulation of EGF endocytosis in the presence of PD98059 resulted only in insignificant depolymerization of MT and it could be detected mainly from their minus-ends. At the same time, MT regions close to plasma membrane became stabilized, which was proved by increase in tubulin acetylation level. This situation was characteristic for all period of the experiment. It has been also found that the inhibitors affect endocytosis dynamics of EGF-receptor complexes. Quantitative analysis demonstrated that the stimulation of endocytosis in the presence of U0126 generated a greater number of endosomes compared to control cells, and their number did not change significantly during the experiment. All these endosomes were localized peripherally. Effect of PD98059 resulted in the formation of lower number of endosomes that in control, but they demonstrated very slow clusterization despite the presence of some intact MT. Both inhibitors decreased EGFR colocolization with early endosomal marker EEA1, which indicated a delay in endosome fusions and maturation. The inhibitors were also shown to affect differently phospho-ERK 1 and 2 forms: U0126 completely inhibited phospho-ERK1 and 2, white, in the presence of PD98059, the two ERK forms demonstrated sharp transient activation in 15 min after stimulation, but only

  17. Amide-based inhibitors of p38alpha MAP kinase. Part 2: design, synthesis and SAR of potent N-pyrimidyl amides.

    Science.gov (United States)

    Tester, Richland; Tan, Xuefei; Luedtke, Gregory R; Nashashibi, Imad; Schinzel, Kurt; Liang, Weiling; Jung, Joon; Dugar, Sundeep; Liclican, Albert; Tabora, Jocelyn; Levy, Daniel E; Do, Steven

    2010-04-15

    Optimization of a tri-substituted N-pyridyl amide led to the discovery of a new class of potent N-pyrimidyl amide based p38alpha MAP kinase inhibitors. Initial SAR studies led to the identification of 5-dihydrofuran as an optimal hydrophobic group. Additional side chain modifications resulted in the introduction of hydrogen bond interactions. Through extensive SAR studies, analogs bearing free amino groups and alternatives to the parent (S)-alpha-methyl benzyl moiety were identified. These compounds exhibited improved cellular activities and maintained balance between p38alpha and CYP3A4 inhibition.

  18. Mitogen-activated protein kinase pathways are required for melatonin-mediated defense responses in plants.

    Science.gov (United States)

    Lee, Hyoung Yool; Back, Kyoungwhan

    2016-04-01

    Melatonin enhances pathogen resistance by inducing the expression of a number of plant defense-related genes. To examine whether the melatonin-mediated pathogen resistance is associated with mitogen-activated protein kinase (MAPK) cascades, Arabidopsis and tobacco leaves were treated with melatonin and investigated for MAPK activation using an antiphospho-p44/42 MAPK (Erk1/2) monoclonal antibody. Two MAPKs, MPK3 and MPK6, were activated rapidly and transiently by 1 μm melatonin treatment in Arabidopsis. Its tobacco ortholog MAPKs were also activated. The activation of MPK3 and MPK6 by 2-hydroxymelatonin and N-acetylserotonin was also observed, albeit to a lesser degree than that by melatonin. Furthermore, MAPK activation by melatonin was uncoupled from G-protein signaling, because melatonin efficiently activated two MAPKs in a G-protein β knockout mutant (agb1). Suppression of both MPK3 and MPK6 in transgenic Arabidopsis exhibited significant decreases in the induction of defense-related gene expression and pathogen resistance relative to wild-type plants. Using an array of MAP kinase kinase (MKK) knockout mutants, we found that four MKKs, namely MKK4, MKK5, MKK7, and MKK9, are responsible for the activation of MPK3 and MPK6 by melatonin, indicating that melatonin-mediated innate immunity is triggered by MAPK signaling through MKK4/5/7/9-MPK3/6 cascades.

  19. An extracellular subtilase switch for immune priming in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Vicente Ramírez

    Full Text Available In higher eukaryotes, induced resistance associates with acquisition of a priming state of the cells for a more effective activation of innate immunity; however, the nature of the components for mounting this type of immunological memory is not well known. We identified an extracellular subtilase from Arabidopsis, SBT3.3, the overexpression of which enhances innate immune responses while the loss of function compromises them. SBT3.3 expression initiates a durable autoinduction mechanism that promotes chromatin remodeling and activates a salicylic acid(SA-dependent mechanism of priming of defense genes for amplified response. Moreover, SBT3.3 expression-sensitized plants for enhanced expression of the OXI1 kinase gene and activation of MAP kinases following pathogen attack, providing additional clues for the regulation of immune priming by SBT3.3. Conversely, in sbt3.3 mutant plants pathogen-mediated induction of SA-related defense gene expression is drastically reduced and activation of MAP kinases inhibited. Moreover, chromatin remodeling of defense-related genes normally associated with activation of an immune priming response appear inhibited in sbt3.3 plants, further indicating the importance of the extracellular SBT3.3 subtilase in the establishment of immune priming. Our results also point to an epigenetic control in the regulation of plant immunity, since SBT3.3 is up-regulated and priming activated when epigenetic control is impeded. SBT3.3 represents a new regulator of primed immunity.

  20. Synergistic activation of defense responses in Arabidopsis by simultaneous loss of the GSL5 callose synthase and the EDR1 protein kinase.

    Science.gov (United States)

    Wawrzynska, Anna; Rodibaugh, Natalie L; Innes, Roger W

    2010-05-01

    Loss-of-function mutations in the EDR1 gene of Arabidopsis confer enhanced resistance to Golovinomyces cichoracearum (powdery mildew). Disease resistance mediated by the edr1 mutation is dependent on an intact salicylic acid (SA) signaling pathway, but edr1 mutant plants do not constitutively express the SA-inducible gene PR-1 and are not dwarfed. To identify other components of the EDR1 signaling network, we screened for mutations that enhanced the edr1 mutant phenotype. Here, we describe an enhancer of edr1 mutant, eed3, which forms spontaneous lesions in the absence of pathogen infection, constitutively expresses both SA- and methyl jasmonate (JA)-inducible defense genes, and is dwarfed. Positional cloning of eed3 revealed that the mutation causes a premature stop codon in GLUCAN SYNTHASE-LIKE 5 (GSL5, also known as POWDERY MILDEW RESISTANT 4), which encodes a callose synthase required for pathogen-induced callose production. Significantly, gsl5 single mutants do not constitutively express PR-1 or AtERF1 (a JA-inducible gene) and are not dwarfed. Thus, loss of both EDR1 and GSL5 function has a synergistic effect. Our data suggest that EDR1 and GSL5 negatively regulate SA and JA production or signaling by independent mechanisms and that negative regulation of defense signaling by GSL5 may be independent of callose production.

  1. XYLEM INTERMIXED WITH PHLOEM1, a leucine-rich repeat receptor-like kinase required for stem growth and vascular development in Arabidopsis thaliana.

    Science.gov (United States)

    Bryan, Anthony C; Obaidi, Adam; Wierzba, Michael; Tax, Frans E

    2012-01-01

    The regulation of cell specification in plants is particularly important in vascular development. The vascular system is comprised two differentiated tissue types, the xylem and phloem, which form conductive elements for the transport of water, nutrients and signaling molecules. A meristematic layer, the procambium, is located between these two differentiated cell types and divides to initiate vascular growth. We report the identification of a receptor-like kinase (RLK) that is expressed in the vasculature. Histochemical analyses of mutants in this kinase display an aberrant accumulation of highly lignified cells, typical of xylem or fiber cells, within the phloem. In addition, phloem cells are sometimes located adjacent to xylem cells in these mutants. We, therefore, named this RLK XYLEM INTERMIXED WITH PHLOEM 1 (XIP1). Analyses of longitudinal profiles of xip1 mutant stems show malformed cell files, indicating defects in oriented cell divisions or cell morphology. We propose that XIP1 prevents ectopic lignification in phloem cells and is necessary to maintain the organization of cell files or cell morphology in conductive elements.

  2. The Calcineurin B-Like Calcium Sensors CBL1 and CBL9 Together with Their Interacting Protein Kinase CIPK26 Regulate the Arabidopsis NADPH Oxidase RBOHF

    Institute of Scientific and Technical Information of China (English)

    Maria Magdalena Drerup; Kathrin Schlücking; Kenji Hashimoto; Prabha Manishankar; Leonie Steinhorst; Kazuyuki Kuchitsu; J(o)rg Kudla

    2013-01-01

    Stimulus-specific accumulation of second messengers like reactive oxygen species (ROS) and Ca2+ are central to many signaling and regulation processes in plants.However,mechanisms that govern the reciprocal interrelation of Ca2+ and ROS signaling are only beginning to emerge.NADPH oxidases of the respiratory burst oxidase homolog (RBOH) family are critical components contributing to the generation of ROS while Calcineurin B-like (CBL) Ca2+ sensor proteins together with their interacting kinases (CIPKs) have been shown to function in many Ca2+-signaling processes.In this study,we identify direct functional interactions between both signaling systems.We report that the CBL-interacting protein kinase ClPK26 specifically interacts with the N-terminal domain of RBOHF in yeast two-hybrid analyses and with the full-length RBOHF protein in plant cells.In addition,CIPK26 phosphorylates RBOHF in vitro and co-expression of either CBL1 or CBL9 with CIPK26 strongly enhances ROS production by RBOHF in HEK293T cells.Together,these findings identify a direct interconnection between CBL-ClPK-mediated Ca2+ signaling and ROS signaling in plants and provide evidence for a synergistic activation of the NADPH oxidase RBOHF by direct Ca2+-binding to its EF-hands and Ca2+-induced phosphorylation by CBL1/9-ClPK26 complexes.

  3. Targeted deletion of the ERK5 MAP kinase impairs neuronal differentiation, migration, and survival during adult neurogenesis in the olfactory bulb.

    Directory of Open Access Journals (Sweden)

    Tan Li

    Full Text Available Recent studies have led to the exciting idea that adult-born neurons in the olfactory bulb (OB may be critical for complex forms of olfactory behavior in mice. However, signaling mechanisms regulating adult OB neurogenesis are not well defined. We recently reported that extracellular signal-regulated kinase (ERK 5, a MAP kinase, is specifically expressed in neurogenic regions within the adult brain. This pattern of expression suggests a role for ERK5 in the regulation of adult OB neurogenesis. Indeed, we previously reported that conditional deletion of erk5 in adult neurogenic regions impairs several forms of olfactory behavior in mice. Thus, it is important to understand how ERK5 regulates adult neurogenesis in the OB. Here we present evidence that shRNA suppression of ERK5 in adult neural stem/progenitor cells isolated from the subventricular zone (SVZ reduces neurogenesis in culture. By contrast, ectopic activation of endogenous ERK5 signaling via expression of constitutive active MEK5, an upstream activating kinase for ERK5, stimulates neurogenesis. Furthermore, inducible and conditional deletion of erk5 specifically in the neurogenic regions of the adult mouse brain interferes with cell cycle exit of neuroblasts, impairs chain migration along the rostral migratory stream and radial migration into the OB. It also inhibits neuronal differentiation and survival. These data suggest that ERK5 regulates multiple aspects of adult OB neurogenesis and provide new insights concerning signaling mechanisms governing adult neurogenesis in the SVZ-OB axis.

  4. FvBck1, a Component of Cell Wall Integrity MAP Kinase Pathway, is Required for Virulence and Oxidative Stress Response in Sugarcane Pokkah Boeng Pathogen

    Directory of Open Access Journals (Sweden)

    Chengkang eZhang

    2015-10-01

    Full Text Available Fusarium verticillioides (formerly F. moniliforme is suggested as one of the causal agents of Pokkah Boeng, a serious disease of sugarcane worldwide. Currently, detailed molecular and physiological mechanism of pathogenesis is unknown. In this study, we focused on cell wall integrity MAPK pathway as one of the potential signaling mechanisms associated with Pokkah Boeng pathogenesis. We identified FvBCK1 gene that encodes a MAP kinase kinase kinase homolog and determined that it is not only required for growth, micro- and macro-conidia production, and cell wall integrity but also for response to osmotic and oxidative stresses. The deletion of FvBCK1 caused a significant reduction in virulence and FB1 production, a carcinogenic mycotoxin produced by the fungus. Moreover, we found the expression levels of three genes, which are known to be involved in superoxide scavenging, were down regulated in the mutant. We hypothesized that the loss of superoxide scavenging capacity was one of the reasons for reduced virulence, but overexpression of catalase or peroxidase gene failed to restore the virulence defect in the deletion mutant. When we introduced Magnaporthe oryzae MCK1 into the FvBck1 deletion mutant, while certain phenotypes were restored, the complemented strain failed to gain full virulence. In summary, FvBck1 plays a diverse role in F. verticillioides, and detailed investigation of downstream signaling pathways will lead to a better understanding of how this MAPK pathway regulates Pokkah Boeng on sugarcane.

  5. Dual Roles of Quercetin in Platelets: Phosphoinositide-3-Kinase and MAP Kinases Inhibition, and cAMP-Dependent Vasodilator-Stimulated Phosphoprotein Stimulation

    Directory of Open Access Journals (Sweden)

    Won Jun Oh

    2012-01-01

    Full Text Available Background. Progressive diseases including cancer, metabolic, and cardiovascular disorders are marked by platelet activation and chronic inflammation. Studies suggest that dietary flavonoids such as quercetin possess antioxidant, anti-inflammatory, and antiplatelet properties, which could prevent various chronic diseases including atherosclerosis and thrombosis. However, the mechanism and the signaling pathway that links quercetin's antiplatelet activity with its anti-inflammatory property is limited and thus further exploration is required. The aim of this paper was to examine the link between antiplatelet and anti-inflammatory roles of quercetin in agonist-induced platelet activation. Methods. Quercetin effects on agonist-activated platelet-aggregation, granule-secretion, [Ca2+]i, and glycoprotein-IIb/IIIa activation were examined. Its effects on PI3K/Akt, VASP, and MAPK phosphorylations were also studied on collaged-activated platelets. Results. Quercetin dose dependently suppressed collagen, thrombin, or ADP-induced platelet aggregation. It significantly inhibited collagen-induced ATP release, P-selectin expression, [Ca2+]i mobilization, integrin-αIIbβ3 activation, and augmented cAMP and VASP levels. Moreover, quercetin attenuated PI3K, Akt, ERK2, JNK1, and p38 MAPK activations, which were supported by platelet-aggregation inhibition with the respective kinase inhibitors. Conclusion. Quercetin-mediated antiplatelet activity involves PI3K/Akt inactivation, cAMP elevation, and VASP stimulation that, in turn, suppresses MAPK phosphorylations. This result suggests quercetin may have a potential to treat cardiovascular diseases involving aberrant platelet activation and inflammation.

  6. Mechanical stress triggers cardiomyocyte autophagy through angiotensin II type 1 receptor-mediated p38MAP kinase independently of angiotensin II.

    Directory of Open Access Journals (Sweden)

    Li Lin

    Full Text Available Angiotensin II (Ang II type 1 (AT1 receptor is known to mediate a variety of physiological actions of Ang II including autophagy. However, the role of AT1 receptor in cardiomyocyte autophagy triggered by mechanical stress still remains elusive. The aim of this study was therefore to examine whether and how AT1 receptor participates in cardiomyocyte autophagy induced by mechanical stresses. A 48-hour mechanical stretch and a 4-week transverse aorta constriction (TAC were imposed to cultured cardiomyocytes of neonatal rats and adult male C57B/L6 mice, respectively, to induce cardiomyocyte hypertrophy prior to the assessment of cardiomyocyte autophagy using LC3b-II. Losartan, an AT1 receptor blocker, but not PD123319, the AT2 inhibitor, was found to significantly reduce mechanical stretch-induced LC3b-II upregulation. Moreover, inhibition of p38MAP kinase attenuated not only mechanical stretch-induced cardiomyocyte hypertrophy but also autophagy. To the contrary, inhibition of ERK and JNK suppressed cardiac hypertrophy but not autophagy. Intriguingly, mechanical stretch-induced autophagy was significantly inhibited by Losartan in the absence of Ang II. Taken together, our results indicate that mechanical stress triggers cardiomyocyte autophagy through AT1 receptor-mediated activation of p38MAP kinase independently of Ang II.

  7. The inflammatory kinase MAP4K4 promotes reactivation of Kaposi's sarcoma herpesvirus and enhances the invasiveness of infected endothelial cells.

    Directory of Open Access Journals (Sweden)

    Darya A Haas

    Full Text Available Kaposi's sarcoma (KS is a mesenchymal tumour, which is caused by Kaposi's sarcoma herpesvirus (KSHV and develops under inflammatory conditions. KSHV-infected endothelial spindle cells, the neoplastic cells in KS, show increased invasiveness, attributed to the elevated expression of metalloproteinases (MMPs and cyclooxygenase-2 (COX-2. The majority of these spindle cells harbour latent KSHV genomes, while a minority undergoes lytic reactivation with subsequent production of new virions and viral or cellular chemo- and cytokines, which may promote tumour invasion and dissemination. In order to better understand KSHV pathogenesis, we investigated cellular mechanisms underlying the lytic reactivation of KSHV. Using a combination of small molecule library screening and siRNA silencing we found a STE20 kinase family member, MAP4K4, to be involved in KSHV reactivation from latency and to contribute to the invasive phenotype of KSHV-infected endothelial cells by regulating COX-2, MMP-7, and MMP-13 expression. This kinase is also highly expressed in KS spindle cells in vivo. These findings suggest that MAP4K4, a known mediator of inflammation, is involved in KS aetiology by regulating KSHV lytic reactivation, expression of MMPs and COX-2, and, thereby modulating invasiveness of KSHV-infected endothelial cells.

  8. The transcriptional response to the inactivation of the PaMpk1 and PaMpk2 MAP kinase pathways in Podospora anserina.

    Science.gov (United States)

    Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe

    2012-08-01

    Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development.

  9. Specific MAP-kinase blockade protects against renal damage in homozygous TGR(mRen2)27 rats

    NARCIS (Netherlands)

    de Borst, MH; Navis, G; de Boer, RA; Vis, LM; van Gilst, WH; van Goor, H

    2003-01-01

    Angiotensin II (AngII) plays an important role in renal damage by acting on hemodynamics, cell-growth, proliferation, and fibrosis, mainly by effects on the AngII type 1 (AT,) receptor. The AT, receptor activates several intracellular signaling molecules such as mitogen-activated protein kinases ext

  10. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Science.gov (United States)

    Kotzka, Jorg; Knebel, Birgit; Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller-Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  11. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Directory of Open Access Journals (Sweden)

    Jorg Kotzka

    Full Text Available The transcription factor sterol regulatory element binding protein (SREBP-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK. Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  12. In vitro expression and determination of phosphorylation activity of point mutants of the PKS5 kinase in Arabidopsis%拟南芥 PKS5激酶点突变体外表达与磷酸化测试

    Institute of Scientific and Technical Information of China (English)

    赵菲佚; 焦成瑾; 陈荃; 马伟超; 安建平; 呼丽萍

    2015-01-01

    PKS5(protein kinase SOS2-like 5)虽为拟南芥(Arabidopsis thaliana )中介导植物响应外界高 pH的蛋白激酶,但其关键功能结构域尚未被确定.该研究用 PCR 对 PKS5不同位置点突变形式进行克隆,并在原核系统中进行表达,得到 PKS5不同的点突变蛋白;使用激酶通用底物 MBP(myelin basic protein)及 PKS5体内特异底物 AHA2(A .thaliana isoform of the PM H +-ATPase,拟南芥质膜质子泵等位形式之一)对 PKS5点突变蛋白磷酸化活性进行了测试.结果表明:点突变 PKS5-2失去了激酶活性,PKS5-4、PKS5-5、PKS5-9自磷酸化与 MBP 磷酸化活性与 PKS5相比无差异;而与 PKS5相比,点突变 PKS5-6和 PKS5-7自磷酸化及对AHA2的磷酸化活性升高,且 PKS5-7活性高于 PKS5-6.说明 PKS5特定位置点突变改变 PKS5的自磷酸化及底物磷酸化活性水平,不同位置的点突变对其磷酸化活性的影响存在差异.研究结果可为确定 PKS5功能结构域及体内作用机理提供依据.%In Arabidopsis ,PKS5 (protein kinase SOS2-like 5),a serine-threonine kinase,involves in the response to the external high pH stress based on the study of its loss-of-function mutant.Whereas,the fine functions of the do-mains resided in PKS5 are not currently well determined.We report here the dissection of domains of PKS5 in the ac-tivity of phosphorylation against MBP(myelin basic protein)and AHA2(one of the Arabidopsis thaliana isoform of PM H+-ATPases ),which is the specific substrate of PKS5 in vivo ,using the assay of phosphorlation in vitro via expressing the distinct PKS5 mutant versions in bacteria using the PKS5 cloning from plants employing PCR ap-proach.The results showed that the point mutated PKS5-2 lost its activity,PKS5-4,PKS5-5 and PKS5-9 displayed no difference in autophosphorylation and the MBP phosphorylation.Moreover,autophosphorylation and the AHA2 phosphorylation of the point mutated PKS5-6 and PKS5-7 increased compared with PKS5 and the PKS5

  13. Exploiting Natural Variation in Arabidopsis

    NARCIS (Netherlands)

    Molenaar, J.A.; Keurentjes, J.J.B.

    2014-01-01

    Natural variation for many traits is present within the species Arabidopsis thaliana . This chapter describes the use of natural variation to elucidate genes underlying the regulation of quantitative traits. It deals with the development and use of mapping populations, the detection and handling of

  14. Exploiting natural variation in Arabidopsis

    NARCIS (Netherlands)

    J.A. Molenaar; J.J.B. Keurentjes

    2014-01-01

    Natural variation for many traits is present within the species Arabidopsis thaliana. This chapter describes the use of natural variation to elucidate genes underlying the regulation of quantitative traits. It deals with the development and use of mapping populations, the detection and handling of g

  15. Cyanidin-3-glucoside inhibits UVB-induced oxidative damage and inflammation by regulating MAP kinase and NF-κB signaling pathways in SKH-1 hairless mice skin

    Energy Technology Data Exchange (ETDEWEB)

    Pratheeshkumar, Poyil; Son, Young-Ok; Wang, Xin; Divya, Sasidharan Padmaja [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Joseph, Binoy [Spinal Cord and Brain Injury Research Center and Department of Physiology, University of Kentucky, Lexington, KY 40536-0509 (United States); Hitron, John Andrew; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Kim, Donghern [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Yin, Yuanqin [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Cancer Institute, The First Affiliated Hospital, China Medical University, Shenyang (China); Roy, Ram Vinod [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Lu, Jian [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Institute of Life Sciences, Jiangsu University, Zhenjiang, Jiangsu 212013 (China); Zhang, Zhuo [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Wang, Yitao [State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau (China); and others

    2014-10-01

    Skin cancer is one of the most commonly diagnosed cancers in the United States. Exposure to ultraviolet-B (UVB) radiation induces inflammation and photocarcinogenesis in mammalian skin. Cyanidin-3-glucoside (C3G), a member of the anthocyanin family, is present in various vegetables and fruits especially in edible berries, and displays potent antioxidant and anticarcinogenic properties. In this study, we have assessed the in vivo effects of C3G on UVB irradiation induced chronic inflammatory responses in SKH-1 hairless mice, a well-established model for UVB-induced skin carcinogenesis. Here, we show that C3G inhibited UVB-induced skin damage and inflammation in SKH-1 hairless mice. Our results indicate that C3G inhibited glutathione depletion, lipid peroxidation and myeloperoxidation in mouse skin by chronic UVB exposure. C3G significantly decreased the production of UVB-induced pro-inflammatory cytokines, such as IL-6 and TNF-α, associated with cutaneous inflammation. Likewise, UVB-induced inflammatory responses were diminished by C3G as observed by a remarkable reduction in the levels of phosphorylated MAP kinases, Erk1/2, p38, JNK1/2 and MKK4. Furthermore, C3G also decreased UVB-induced cyclooxygenase-2 (COX-2), PGE{sub 2} and iNOS levels, which are well-known key mediators of inflammation and cancer. Treatment with C3G inhibited UVB-induced nuclear translocation of NF-κB and degradation of IκBα in mice skin. Immunofluorescence assay revealed that topical application of C3G inhibited the expression of 8-hydroxy-2′-deoxyguanosine, proliferating cell nuclear antigen, and cyclin D1 in chronic UVB exposed mouse skin. Collectively, these data indicates that C3G can provide substantial protection against the adverse effects of UVB radiation by modulating UVB-induced MAP kinase and NF-κB signaling pathways. - Highlights: • C3G inhibited UVB-induced oxidative damage and inflammation. • C3G inhibited UVB-induced COX-2, iNOS and PGE{sub 2} production. • C3G

  16. Short waves-induced enhancement of proliferation of human chondrocytes: involvement of extracellular signal-regulated map-kinase (erk).

    Science.gov (United States)

    Wang, Jue-Long; Chan, Rai-Chi; Cheng, He-Hsiung; Huang, Chun-Jen; Lu, Yih-Chau; Chen, I-Shu; Liu, Shiuh-Inn; Hsu, Shu-Shong; Chang, Hong-Tai; Huang, Jong-Khing; Chen, Jin-Shyr; Ho, Chin-Man; Jan, Chung-Ren

    2007-07-01

    1. Short-wave diathermy (SWD) is a form of radiofrequency radiation that is used therapeutically by physiotherapists. The cellular mechanisms of SWD are unclear. The present study was performed to explore the effect of different conditions of short-wave exposure on the proliferation of cultured human chondrocytes. 2. Cells exposed to short waves once per day for seven consecutive days exhibited a significant increase in proliferation by 42% compared with the control cells. In cells that were treated with short waves twice per day for seven consecutive days, or only once on Day 1 and then examined for proliferation on Day 7, cell proliferation was greater than the control cells by 40% and 30%, respectively. 3. Given the importance of mitogen-activated protein kinases (MAPK) in the proliferation of different cell types, efforts were extended to explore the role of three major types of MAPK; that is, extracellular signal-regulated kinase (ERK), c-Jun NH(2)-terminal protein kinase (JNK) and p38. 4. It was found that the level of phosphorylated ERK (phospho-ERK 1 and ERK 2) increased significantly within 5-120 min following consecutive exposure to short waves for 7 days. Exposure to short waves failed to alter the intensity of phosphorylated JNK and p38 within 0-240 min. 5. Cells were exposed to short waves once for seven consecutive days in the presence of 0, 10 micromol/L, 20 micromol/L or 50 micromol/L PD98059 (an ERK inhibitor). PD98059 totally inhibited short waves-induced enhancement of proliferation without altering normal control viability. In the presence of short waves and PD98059, the cell viability was lower than the normal control. Together, the data suggest that short waves could increase proliferation in human chondrocytes through activation of the ERK pathway, which is also involved in maintaining normal cell proliferation under physiological conditions.

  17. Convergent evidence identifying MAP/microtubule affinity-regulating kinase 1 (MARK1) as a susceptibility gene for autism.

    Science.gov (United States)

    Maussion, Gilles; Carayol, Jérôme; Lepagnol-Bestel, Aude-Marie; Tores, Frédéric; Loe-Mie, Yann; Milbreta, Ulla; Rousseau, Francis; Fontaine, Karine; Renaud, Julie; Moalic, Jean-Marie; Philippi, Anne; Chedotal, Alain; Gorwood, Philip; Ramoz, Nicolas; Hager, Jörg; Simonneau, Michel

    2008-08-15

    Autism spectrum disorders (ASDs) are common, heritable, but genetically heterogeneous neurodevelopmental conditions. We recently defined a susceptibility locus for ASDs on chromosome 1q41-q42. High-resolution single-nucleotide polymorphisms (126 SNPs) genotyping across the chromosome 1q41-q42 region, followed by a MARK1 (microtubule affinity-regulating kinase 1)-tagged-SNP association study in 276 families with autism from the Autism Genetic Research Exchange, showed that several SNPs within the MARK1 gene were significantly associated with ASDs by transmission disequilibrium tests. Haplotype rs12740310*C-rs3737296*G-rs12410279*A was overtransmitted (P(corrected)= 0.0016), with a relative risk for autism of 1.8 in homozygous carriers. Furthermore, ASD-associated SNP rs12410279 modulates the level of transcription of MARK1. We found that MARK1 was overexpressed in the prefrontal cortex (BA46) but not in cerebellar granule cells, on postmortem brain tissues from patients. MARK1 displayed an accelerated evolution along the lineage leading to humans, suggesting possible involvement of this gene in cognition. MARK1 encodes a kinase-regulating microtubule-dependent transport in axons and dendrites. Both overexpression and silencing of MARK1 resulted in significantly shorter dendrite length in mouse neocortical neurons and modified dendritic transport speed. As expected for a gene encoding a key polarity determinant Par-1 protein kinase, MARK1 is involved in axon-dendrite specification. Thus, MARK1 overexpression in humans may be responsible for subtle changes in dendritic functioning.

  18. Reference: 566 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available utations in the MKK3-MPK6 cascade, which indicates important roles in JA signaling. We provide a model expla...tress - into three different sets of responses in Arabidopsis. The mitogen-activated protein kinase cascade MKK3-MPK6 is an important

  19. Reference: 620 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 620 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u17543866i Nodine Michael...or-like kinases redundantly required for arabidopsis embryonic pattern formation. 6 943-56 17543866 2007 Jun Developmental cell Nodine Michael D|Tax Frans E|Yadegari Ramin

  20. Arabidopsis CDS blastp result: AK241519 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241519 J065170E12 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 3e-23 ...

  1. Arabidopsis CDS blastp result: AK242651 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242651 J090026B08 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 1e-16 ...

  2. Arabidopsis CDS blastp result: AK243050 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243050 J100011E04 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 2e-24 ...

  3. Arabidopsis CDS blastp result: AK242271 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242271 J075187A19 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 4e-17 ...

  4. Arabidopsis CDS blastp result: AK240655 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK240655 J023135E11 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 1e-40 ...

  5. Arabidopsis CDS blastp result: AK242638 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242638 J090023J02 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 1e-29 ...

  6. Arabidopsis CDS blastp result: AK242681 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242681 J090032N04 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 8e-38 ...

  7. Arabidopsis CDS blastp result: AK288923 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK288923 J090081P06 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 1e-59 ...

  8. Arabidopsis CDS blastp result: AK243187 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243187 J100039E11 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 4e-24 ...

  9. Arabidopsis CDS blastp result: AK111785 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK111785 J023089N11 At5g62310.1 incomplete root hair elongation (IRE) / protein kin...ase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 0.0 ...

  10. Arabidopsis CDS blastp result: AK288095 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK288095 J075191E21 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 9e-31 ...

  11. Arabidopsis CDS blastp result: AK242859 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242859 J090073L24 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 2e-21 ...

  12. Arabidopsis CDS blastp result: AK242717 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242717 J090043H19 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 1e-23 ...

  13. Arabidopsis CDS blastp result: AK287631 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK287631 J065073J24 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 2e-35 ...

  14. Arabidopsis CDS blastp result: AK242733 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242733 J090047O22 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 2e-24 ...

  15. Arabidopsis CDS blastp result: AK242758 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK242758 J090051H03 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 1e-59 ...

  16. Arabidopsis CDS blastp result: AK243656 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243656 J100088L22 At5g62310.1 68418.m07822 incomplete root hair elongation (IRE) .../ protein kinase, putative nearly identical to IRE (incomplete root hair elongation) [Arabidopsis thaliana] gi|6729346|dbj|BAA89783 6e-29 ...

  17. Pharmacological profile of AW-814141, a novel, potent, selective and orally active inhibitor of p38 MAP kinase

    DEFF Research Database (Denmark)

    Chopra, Puneet; Kulkarni, Onkar; Gupta, Shashank

    2010-01-01

    -inflammatory activity of a p38 MAPK inhibitor, AW-814141. AW-814141 inhibited enzymatic activity of recombinant p38-alpha and beta isoforms with IC(50) value of 100nM and 158nM, respectively. AW-814141 also inhibited the release of tumor necrosis factor (TNF)-alpha by lipopolysaccharide (LPS) treated human peripheral...... blood mononuclear cells with an IC(50) value of 212nM and demonstrated selectivity against a panel of few kinases. Oral administration of AW-814141 (10mpk) in LPS-injected mice resulted in a significant reduction in TNF-alpha production in the circulation. In a carrageenan-induced rat paw edema model...

  18. 22(R)-hydroxycholesterol induces HuR-dependent MAP kinase phosphatase-1 expression via mGluR5-mediated Ca(2+)/PKCα signaling.

    Science.gov (United States)

    Kim, Hyunmi; Woo, Joo Hong; Lee, Jee Hoon; Joe, Eun-Hye; Jou, Ilo

    2016-08-01

    MAP kinase phosphatase (MKP)-1 plays a pivotal role in controlling MAP kinase (MAPK)-dependent (patho) physiological processes. Although MKP-1 gene expression is tightly regulated at multiple levels, the underlying mechanistic details remain largely unknown. In this study, we demonstrate that MKP-1 expression is regulated at the post-transcriptional level by 22(R)-hydroxycholesterol [22(R)-HC] through a novel mechanism. 22(R)-HC induces Hu antigen R (HuR) phosphorylation, cytoplasmic translocation and binding to MKP-1 mRNA, resulting in stabilization of MKP-1 mRNA. The resulting increase in MKP-1 leads to suppression of JNK-mediated inflammatory responses in brain astrocytes. We further demonstrate that 22(R)-HC-induced phosphorylation of nuclear HuR is mediated by PKCα, which is activated in the cytosol by increases in intracellular Ca(2+) levels mediated by the phospholipase C/inositol 1,4,5-triphosphate receptor (PLC/IP3R) pathway and translocates from cytoplasm to nucleus. In addition, pharmacological interventions reveal that metabotropic glutamate receptor5 (mGluR5) is responsible for the increases in intracellular Ca(2+) that underlie these actions of 22(R)-HC. Collectively, our findings identify a novel anti-inflammatory mechanism of 22(R)-HC, which acts through PKCα-mediated cytoplasmic shuttling of HuR to post-transcriptionally regulate MKP-1 expression. These findings provide an experimental basis for the development of a RNA-targeted therapeutic agent to control MAPK-dependent inflammatory responses.

  19. Interplay between calcineurin and the Slt2 MAP-kinase in mediating cell wall integrity, conidiation and virulence in the insect fungal pathogen Beauveria bassiana.

    Science.gov (United States)

    Huang, Shuaishuai; He, Zhangjiang; Zhang, Shiwei; Keyhani, Nemat O; Song, Yulin; Yang, Zhi; Jiang, Yahui; Zhang, Wenli; Pei, Yan; Zhang, Yongjun

    2015-10-01

    The entomopathogenic fungus, Beauveria bassiana, is of environmental and economic importance as an insect pathogen, currently used for the biological control of a number of pests. Cell wall integrity and conidiation are critical parameters for the ability of the fungus to infect insects and for production of the infectious propagules. The contribution of calcineurin and the Slt2 MAP kinase to cell wall integrity and development in B. bassiana was investigated. Gene knockouts of either the calcineurin CNA1 subunit or the Slt2 MAP kinase resulted in decreased tolerance to calcofluor white and high temperature. In contrast, the Δcna1 strain was more tolerant to Congo red but more sensitive to osmotic stress (NaCl, sorbitol) than the wild type, whereas the Δslt2 strain had the opposite phenotype. Changes in cell wall structure and composition were seen in the Δslt2 and Δcna1 strains during growth under cell wall stress as compared to the wild type. Both Δslt2 and Δcna1 strains showed significant alterations in growth, conidiation, and viability. Elevation of intracellular ROS levels, and decreased conidial hydrophobicity and adhesion to hydrophobic surfaces, were also seen for both mutants, as well as decreased virulence. Under cell wall stress conditions, inactivation of Slt2 significantly repressed CN-mediated phosphatase activity suggesting some level of cross talk between the two pathways. Comparative transcriptome profiling of the Δslt2 and Δcna1 strains revealed alterations in the expression of distinct gene sets, with overlap in transcripts involved in cell wall integrity, stress response, conidiation and virulence. These data illustrate convergent and divergent phenotypes and targets of the calcineurin and Slt2 pathways in B. bassiana.

  20. Analysis of Activated Platelet-Derived Growth Factor β Receptor and Ras-MAP Kinase Pathway in Equine Sarcoid Fibroblasts

    Directory of Open Access Journals (Sweden)

    Gennaro Altamura

    2013-01-01

    Full Text Available Equine sarcoids are skin tumours of fibroblastic origin affecting equids worldwide. Bovine papillomavirus type-1 (BPV-1 and, less commonly, type-2 are recognized as etiological factors of sarcoids. The transforming activity of BPV is related to the functions of its major oncoprotein E5 which binds to the platelet-derived growth factor β receptor (PDGFβR causing its phosphorylation and activation. In this study, we demonstrate, by coimmunoprecipitation and immunoblotting, that in equine sarcoid derived cell lines PDGFβR is phosphorylated and binds downstream molecules related to Ras-mitogen-activated protein kinase-ERK pathway thus resulting in Ras activation. Imatinib mesylate is a tyrosine kinase receptors inhibitor which selectively inhibits the activation of PDGFβR in the treatment of several human and animal cancers. Here we show that imatinib inhibits receptor phosphorylation, and cell viability assays demonstrate that this drug decreases sarcoid fibroblasts viability in a dose-dependent manner. This study contributes to a better understanding of the molecular mechanisms involved in the pathology of sarcoids and paves the way to a new therapeutic approach for the treatment of this common equine skin neoplasm.

  1. Cloning and molecular characterization of a gene encoding MAP kinase from maize and its expression in E. coli

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A new MAPK gene, ZmSIMK1 (Zea mays L. salt-induced mitogen-activated protein kinase 1), is isolated from a maize cDNA library. The full-length ZmSIMK1 gene contains 1636 bp and an open reading frame of 1122 nucleotides capable of encoding 373 amino acid polypeptides with a predicted molecular mass of 42.3 kda and pI of 6.01. The putative ZmSIMK1 protein contains all 11 conserved subdomains that are characteristics of serine/threonine protein kinases and the TEY motif, which is the putative phosphorylation site. Northern blot analysis shows that ZmSIMK1 is ubiquitously expressed in roots, stems, and leaves of maize seedlings and its mRNA accumulation is observed in maize seedlings treated with 30 mmol/L PEG-6000 and 137 mmol/L NaCl, but the expression of ZmSIMK1 is not significantly affected by 4℃ treatment. The expression vector pET-ZmSIMK1 is constructed by inserting the coding region of ZmSIMK1 cDNA into pET-42a(+), and transformed into E. coli strain BL21(DE3). A 77kda fusion protein is induced by the further culture at 37℃ after addition of 1mmol/L IPTG.

  2. Activation of ERK/MAP kinase in the amygdala is required for memory consolidation of pavlovian fear conditioning.

    Science.gov (United States)

    Schafe, G E; Atkins, C M; Swank, M W; Bauer, E P; Sweatt, J D; LeDoux, J E

    2000-11-01

    Although much has been learned about the neurobiological mechanisms underlying Pavlovian fear conditioning at the systems and cellular levels, relatively little is known about the molecular mechanisms underlying fear memory consolidation. The present experiments evaluated the role of the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK) signaling cascade in the amygdala during Pavlovian fear conditioning. We first show that ERK/MAPK is transiently activated-phosphorylated in the amygdala, specifically the lateral nucleus (LA), at 60 min, but not 15, 30, or 180 min, after conditioning, and that this activation is attributable to paired presentations of tone and shock rather than to nonassociative auditory stimulation, foot shock sensitization, or unpaired tone-shock presentations. We next show that infusions of U0126, an inhibitor of ERK/MAPK activation, aimed at the LA, dose-dependently impair long-term memory of Pavlovian fear conditioning but leaves short-term memory intact. Finally, we show that bath application of U0126 impairs long-term potentiation in the LA in vitro. Collectively, these results demonstrate that ERK/MAPK activation is necessary for both memory consolidation of Pavlovian fear conditioning and synaptic plasticity in the amygdala.

  3. Role of stress-activated MAP kinase P38 in cisplatin-and DTT-induced apoptosis of the esophageal carcinoma cell line Eca109

    Institute of Scientific and Technical Information of China (English)

    Qian-Xian Zhang; Ruo Feng; Wei Zhang; Yi Ding; Ji-Yao Yang; Guo-Hong Liu

    2005-01-01

    AIM: To study the role of P38 kinase in esophageal cancer cell apoptosis induced by genotoxin, cisplatin and the unfolded protein response (UPR) inducer, dithiothreitol(DTT).METHODS: Esophageal carcinoma cell line Eca109 was cultured in RPMI 1640 medium to 70% confluency and treated with either cisplatin, DTT, or cisplatin plus DTT in the presence or absence of P38 inhibitor, SB203580. The untreated cells served as the control. The esophageal carcinoma cell apoptosis was detected by agarose gel DNA ladder analysis and quantified by flow cytometry.The P38 phosphorylation was detected by immunohis-tochemistry using antibodies specific to phosphorylated P38 protein.RESULTS: (1) Both cisplatin and DTT induced apoptosis in the esophageal cancer cell line Eca109 as shown by DNA ladder formation; (2) As detected by antibodies specific for the phosphorylated P38 protein (p-P38), both cisplatin and DTT treatments activated the stress-activated enzyme, MAP kinase P38. The number of positive cells was about 50% for the treatment groups, comparing to that of 10% for untreated group. DTT treatment, but not cisplatin treatment, induces nuclear localization of p-P38;(3) As measured by flow cytometry, inhibition of P38 activity by SB203580 blocks DFT- and cisplatin-induced apoptosis.The rates for DTT, cisplatin, and DTT plus cisplatin-induced apoptosis were 16.8%, 17.1%, and 21.4%, respectively.Addition of the SB compound during the incubation reduced the apoptotic rate to about 7.6% for all the treatment groups, suggesting that P38 activation is essential for cisplatin- and DTT-induced apoptosis in Eca109 cells.CONCLUSION: (1) Both DTT and cisplatin were able to induce apoptosis in esophageal cancer cell line Eca109;(2) P38 MAP kinase is essential for DTT- and cisplatin-induced apoptosis in Eca109 cells; (3) P38 activation may be the common signaling component relaying the multiple upstream signaling events to the downstream cell death program.

  4. cAMP-Induced Histones H3 Dephosphorylation Is Independent of PKA and MAP Kinase Activations and Correlates With mTOR Inactivation.

    Science.gov (United States)

    Rodriguez, Pedro; Rojas, Juan

    2016-03-01

    cAMP is a second messenger well documented to be involved in the phosphorylation of PKA, MAP kinase, and histone H3 (H3). Early, we reported that cAMP also induced H3 dephosphorylation in a variety of proliferating cell lines. Herein, it is shown that cAMP elicits a biphasic H3 dephosphorylation independent of PKA activation in cycling cells. H89, a potent inhibitor of PKA catalytic sub-unite, could not abolish this effect. Additionally, H89 induces a rapid and biphasic H3 serine 10 dephosphorylation, while a decline in the basal phosphorylation of CREB/ATF-1 is observed. Rp-cAMPS, an analog of cAMP and specific inhibitor of PKA, is unable to suppress cAMP-mediated H3 dephosphorylation, whereas Rp-cAMPS effectively blocks CREB/ATF-1 hyper-phosphorylation by cAMP and its inducers. Interestingly, cAMP exerts a rapid and profound H3 dephosphorylation at much lower concentration (50-fold lower, 0.125 mM) than the concentration required for maximal CREB/ATF-1 phosphorylation (5 mM). Much higher cAMP concentration is required to fully induce CREB/ATF-1 gain in phosphate (5 mM), which correlates with the inhibition of H3 dephosphorylation. Also, the dephosphorylation of H3 does not overlap at onset of MAP kinase phosphorylation pathways, p38 and ERK. Surprisingly, rapamycin (an mTOR inhibitor), cAMP, and its natural inducer isoproterenol, elicit identical dephosphorylation kinetics on both S6K1 ribosomal kinase (a downstream mTOR target) and H3. Finally, cAMP-induced H3 dephosphorylation is PP1/2-dependent. The results suggest that a pathway, requiring much lower cAMP concentration to that required for CREB/ATF-1 hyper-phosphorylation, is responsible for histone H3 dephosphorylation and may be linked to mTOR down regulation.

  5. Mutagenesis of p38alpha MAP Kinase Establishes Key Roles of Phe169 in Function and Structural Dynamics and Reveals a Novel DFG-OUT State

    Energy Technology Data Exchange (ETDEWEB)

    Bukhtiyarova,M.; Karpusas, M.; Northrup, K.; Namboodiri, H.; Springman, E.

    2007-01-01

    In order to study the role of Phe169 in p38{alpha} MAP kinase structure and function, wild-type p38{alpha} and five p38{alpha} DFG motif mutants were examined in vitro for phosphorylation by MKK6, kinase activity toward ATF2 substrate, thermal stability, and X-ray crystal structure. All six p38{alpha} variants were efficiently phosphorylated by MKK6. However, only one activated p38{alpha} mutant (F169Y) possessed measurable kinase activity (1% compared to wild-type). The loss of kinase activity among the DFG mutants may result from an inability to correctly position Asp168 in the activated form of p38{alpha}. Two mutations significantly increased the thermal stability of p38{alpha} (F169A {Delta}T{sub m} = 1.3 {sup o}C and D168G {Delta}T{sub m} = 3.8 {sup o}C), and two mutations significantly decreased the stability of p38{alpha} (F169R {Delta}T{sub m} = -3.2 {sup o}C and F169G {Delta}T{sub m} = -4.7 {sup o}C). Interestingly, X-ray crystal structures of two thermally destabilized p38{alpha}-F169R and p38{alpha}-F169G mutants revealed a DFG-OUT conformation in the absence of an inhibitor molecule. This DFG-OUT conformation, termed {alpha}-DFG-OUT, is different from the ones previously identified in p38{alpha} crystal structures with bound inhibitors and postulated from high-temperature molecular dynamics simulations. Taken together, these results indicate that Phe169 is optimized for p38{alpha} functional activity and structural dynamics, rather than for structural stability. The {alpha}-DFG-OUT conformation observed for p38{alpha}-F169R and p38{alpha}-F169G may represent a naturally occurring intermediate state of p38{alpha} that provides access for binding of allosteric inhibitors. A model of the local forces driving the DFG IN-OUT transition in p38{alpha} is proposed.

  6. Monocyte intracellular cytokine production during human endotoxaemia with or without a second in vitro LPS challenge : effect of RWJ-67657, a p38 MAP-kinase inhibitor, on LPS-hyporesponsiveness

    NARCIS (Netherlands)

    Faas, MM; Moes, H; Fijen, JW; Kobold, ACM; Tulleken, JE; Zijlstra, JG

    2002-01-01

    In the present study, we investigated the effect of RWJ-67657, a p38 MAP kinase inhibitor, upon in vivo LPS-induced monocyte cytokine production and upon monocyte LPS-hyporesponsiveness. Thirty minutes before a single injection of LPS (4 ng/kg BW), healthy male volunteers received a single oral dose

  7. Essential role of the A'α/Aβ gap in the N-terminal upstream of LOV2 for the blue light signaling from LOV2 to kinase in Arabidopsis photototropin1, a plant blue light receptor.

    Directory of Open Access Journals (Sweden)

    Sachiko Kashojiya

    Full Text Available Phototropin (phot is a blue light (BL receptor in plants and is involved in phototropism, chloroplast movement, stomata opening, etc. A phot molecule has two photo-receptive domains named LOV (Light-Oxygen-Voltage 1 and 2 in its N-terminal region and a serine/threonine kinase (STK in its C-terminal region. STK activity is regulated mainly by LOV2, which has a cyclic photoreaction, including the transient formation of a flavin mononucleotide (FMN-cysteinyl adduct (S390. One of the key events for the propagation of the BL signal from LOV2 to STK is conformational changes in a Jα-helix residing downstream of the LOV2 C-terminus. In contrast, we focused on the role of the A'α-helix, which is located upstream of the LOV2 N-terminus and interacts with the Jα-helix. Using LOV2-STK polypeptides from Arabidopsis thaliana phot1, we found that truncation of the A'α-helix and amino acid substitutions at Glu474 and Lys475 in the gap between the A'α and the Aβ strand of LOV2 (A'α/Aβ gap to Ala impaired the BL-induced activation of the STK, although they did not affect S390 formation. Trypsin digested the LOV2-STK at Lys603 and Lys475 in a light-dependent manner indicating BL-induced structural changes in both the Jα-helix and the gap. The digestion at Lys603 is faster than at Lys475. These BL-induced structural changes were observed with the Glu474Ala and the Lys475Ala substitutes, indicating that the BL signal reached the Jα-helix as well as the A'α/Aβ gap but could not activate STK. The amino acid residues, Glu474 and Lys475, in the gap are conserved among the phots of higher plants and may act as a joint to connect the structural changes in the Jα-helix with the activation of STK.

  8. Reference: 105 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available Hee et al. 2004 Sep. Plant Cell 16(9):2406-17. BRASSINOSTEROID-INSENSITIVE 1 (BRI1) is a Leu-rich-repeat (LRR) re...ceptor kinase that functions as a critical component of a transmembrane brassinosteroid (BR) receptor.... It is believed that BRI1 becomes activated through heterodimerization with BAK1, a similar LRR re...ceptor kinase, in response to BR signal. A yeast two-hybrid screen using the kinase domain ...of BRI1 identified an Arabidopsis thaliana Transthyretin-Like protein (TTL) as a potential BRI1 substrate. T

  9. Reference: 446 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available rk E et al. 2006 Nov. Plant Physiol. 142(3):1004-13. Arabidopsis (Arabidopsis thaliana) QUARTET (QRT) genes are require...d for pollen separation during normal floral development. In qrt mutants, the four products of microsporogenesis re...main fused and pollen grains are released as tetrads. In Arabid...opsis, tetrad analysis in qrt mutants has been used to map all five centromeres, easily distinguish sporophy...tic from gametophytic mutations, and accurately assess crossover interference. Using a combination of forward and re

  10. Quantitative assay for the detection of the V617F variant in the Janus kinase 2 (JAK2 gene using the Luminex xMAP technology

    Directory of Open Access Journals (Sweden)

    Gaudet Daniel

    2010-04-01

    Full Text Available Abstract Background The availability of clinically valid biomarkers contribute to improve the diagnosis and clinical management of diseases. A valine-to-phenylalanine substitution at position 617 (V617F in the Janus kinase 2 (JAK2 gene has been recently associated with key signaling abnormalities in the transduction of haemopoietic growth-factor receptors and is now considered as a useful clinical marker of myeloproliferative neoplasms. Several methods have recently been reported to detect the JAK2 V617F point mutation and show variable sensitivity. Methods Using the Luminex xMAP technology, we developed a quantitative assay to detect the JAK2V617F variant. The method was based on polymerase chain reaction (PCR followed by hybridization to specific probes coupled with internally dyed microspheres. The assay comprises 3 steps: genomic DNA extraction, end point PCR reaction, direct hybridization of PCR fragments and quantification. It has been tested with different sources of nucleic acid. Results Applied to whole blood samples, this quantitative assay showed a limit of detection of 2%. A highly sensitive allele-specific primer extension reaction performed in parallel allowed to validate the results and to identify the specimens with values below 2%. Conclusion Direct hybridization assay using the Luminex xMAP technology allows sensitive quantification of JAK2V617F from blood spots. It is simple and can be easily performed in a clinical setting.

  11. P38 MAP kinase inhibitors as potential therapeutics for the treatment of joint degeneration and pain associated with osteoarthritis

    Directory of Open Access Journals (Sweden)

    Taiwo Yetunde O

    2008-12-01

    Full Text Available Abstract Background Evaluate the potential role of p38 inhibitors for the treatment of osteoarthritis using an animal model of joint degeneration (iodoacetate-induced arthritis and a pain model (Hargraeves assay. Methods P38 kinase activity was evaluated in a kinase assay by measuring the amount of phosphorylated substrate ATF2 using a phosphoATF2 (Thr71 specific primary antibody and an alkaline phosphate coupled secondary antibody and measuring the OD at 405 nm. TNFα and IL-1β secretion from LPS stimulated THP-1 monocytic cells and human peripheral blood mononuclear cells were measured by ELISA. Rats treated with vehicle or p38 inhibitor were injected intra-articularly in one knee with iodoacetate and damage to the tibial plateau was assessed from digitized images captured using an image analyzer. The effect of p38 inhibitors on hyperalgesia was evaluated in rats given an intraplantar injection of carrageenan and 4 h later the paw withdrawal time to a radiant heat source was measured. Results SB-203580 and VX-745 are both potent inhibitors of p38 with IC50s of 136 ± 64 nM and 35 ± 14 nM (mean ± S.D., respectively. Similarly, SB-203580 and VX-745 potently inhibited TNF release from LPS stimulated human THP-1 cells with IC50s of 72 ± 15 nM; and 29 ± 14 nM (mean ± S.D. respectively. TNF release from LPS stimulated human peripheral blood mononuclear cells was inhibited with IC50s 16 ± 6 nM and 14 ± 8 nM, (mean ± S.D. for SB-203580 and VX-745 and IL-1 was inhibited with IC50s of 20 ± 8 nM and 15 ± 4 nM (mean ± S.D., respectively. SB-203580 and VX-745 administered orally at a dose of 50 mg/kg resulted in the significant (p Conclusion SB203580 and VX-745 demonstrated attenuation of both cartilage degeneration and pain in animal models and suggest that p38 inhibitors may be a useful approach for the treatment of osteoarthritis.

  12. Genome-Wide Mapping of Uncapped and Cleaved Transcripts Reveals a Role for the Nuclear mRNA Cap-Binding Complex in Cotranslational RNA Decay in Arabidopsis[OPEN

    Science.gov (United States)

    Willmann, Matthew R.

    2016-01-01

    RNA turnover is necessary for controlling proper mRNA levels posttranscriptionally. In general, RNA degradation is via exoribonucleases that degrade RNA either from the 5′ end to the 3′ end, such as XRN4, or in the opposite direction by the multisubunit exosome complex. Here, we use genome-wide mapping of uncapped and cleaved transcripts to reveal the global landscape of cotranslational mRNA decay in the Arabidopsis thaliana transcriptome. We found that this process leaves a clear three nucleotide periodicity in open reading frames. This pattern of cotranslational degradation is especially evident near the ends of open reading frames, where we observe accumulation of cleavage events focused 16 to 17 nucleotides upstream of the stop codon because of ribosomal pausing during translation termination. Following treatment of Arabidopsis plants with the translation inhibitor cycloheximide, cleavage events accumulate 13 to 14 nucleotides upstream of the start codon where initiating ribosomes have been stalled with these sequences in their P site. Further analysis in xrn4 mutant plants indicates that cotranslational RNA decay is XRN4 dependent. Additionally, studies in plants lacking CAP BINDING PROTEIN80/ABA HYPERSENSITIVE1, the largest subunit of the nuclear mRNA cap binding complex, reveal a role for this protein in cotranslational decay. In total, our results demonstrate the global prevalence and features of cotranslational RNA decay in a plant transcriptome. PMID:27758893

  13. Shock Waves Increase T-cell Proliferation or IL-2 Expression by Activating p38 MAP Kinase

    Institute of Scientific and Technical Information of China (English)

    Tie-Cheng YU; Yi LIU; Yan TAN; Yanfang JIANG; Xueqing ZHENG; Xinxiang XU

    2004-01-01

    Shock waves were elicited by transient pressure disturbances, which could be used to treat musculoskeletal disorders. In present studies, we i. nvestigated whether the low-density shock waves (LDSWs), which are able to damage plasma membrane without impairing the vimentin or other organelles, might augment T-cell proliferation as well as IL-2 expression, and if mitogen activated protein kinase p38 (p38 MAPK)might be an underlying mechanism through which the LDSWs enhanced T-cell function. We found that the LDSWs increased activation of p38 MAPK in Jurkat T cells. The LDSWs alone didn't result in the T-cell proliferation and IL-2 expression. However, in combination with other stimuli, LDSWs could augment the T-cell proliferation and IL-2 expression. Inhibition of p38 MAPK using SB203580 reduced the stimulatory effects of the LDSWs, which indicated that the LDSWs enhanced IL-2 expression through a mechanism that involved p38 MAPK activation. We concluded that the p38 MAPK activation played a key role in the regulation of T cell function by the LDSWs.

  14. Inhibition of the MAP kinase activity suppresses estrogen-induced breast tumor growth both in vitro and in vivo.

    Science.gov (United States)

    Reddy, Kaladhar B; Glaros, Selina

    2007-04-01

    Elevated expression of mitogen-activated protein kinase (Erk/MAPK) has been noted in a significant percentage of primary human breast cancers. To directly assess the importance of Erk/MAPK activation in estrogen (E2)-induced tumor progression, we blocked E2-signaling with MEK-inhibitor CI-1040 and/or tamoxifen (Tam). Our data show that both MEK-inhibitor CI-1040 and Tam blocked E2-induced MAPK phosphorylation and cell proliferation in MCF-7 breast cancer cells in vitro. However, in vivo studies show that anti-tumor efficacy of combining the CI-1040 and Tam was similar to single agent(s). Furthermore, sequential treatment with Tam followed by CI-1040 or CI-1040 followed by Tam did not significantly reduce E2-induced tumor growth. This suggests that the combination of CI-1040 and Tam may not be synergistic in inhibiting E2-induced tumor growth. However, these findings also indicate that MAPK plays a critical role in E2-induced tumor growth, and that this could be a potential therapeutic target to combat hormonally regulated growth in ER-positive tumors.

  15. Oleanolic acid induces migration in Mv1Lu and MDA-MB-231 epithelial cells involving EGF receptor and MAP kinases activation

    Science.gov (United States)

    Ruzafa-Martínez, María; Ramos-Morcillo, Antonio Jesús

    2017-01-01

    During wound healing, skin function is restored by the action of several cell types that undergo differentiation, migration, proliferation and/or apoptosis. These dynamics are tightly regulated by the evolution of the extra cellular matrix (ECM) contents along the process. Pharmacologically active flavonoids have shown to exhibit useful physiological properties interesting in pathological states. Among them, oleanolic acid (OA), a pentacyclic triterpene, shows promising properties over wound healing, as increased cell migration in vitro and improved wound resolution in vivo. In this paper, we pursued to disclose the molecular mechanisms underlying those effects, by using an in vitro scratch assay in two epithelial cell lines of different linage: non-malignant mink lung epithelial cells, Mv1Lu; and human breast cancer cells, MDA-MB-231. In every case, we observed that OA clearly enhanced cell migration for in vitro scratch closure. This correlated with the stimulation of molecular pathways related to mitogen-activated protein (MAP) kinases, as ERK1,2 and Jun N-terminal kinase (JNK) 1,2 activation and c-Jun phosphorylation. Moreover, MDA-MB-231 cells treated with OA displayed an altered gene expression profile affecting transcription factor genes (c-JUN) as well as proteins involved in migration and ECM dynamics (PAI1), in line with the development of an epithelial to mesenchymal transition (EMT) status. Strikingly, upon OA treatment, we observed changes in the epidermal growth factor receptor (EGFR) subcellular localization, while interfering with its signalling completely prevented migration effects. This data provides a physiological framework supporting the notion that lipophilic plant extracts used in traditional medicine, might modulate wound healing processes in vivo through its OA contents. The molecular implications of these observations are discussed. PMID:28231262

  16. A Major Facilitator Superfamily Transporter-Mediated Resistance to Oxidative Stress and Fungicides Requires Yap1, Skn7, and MAP Kinases in the Citrus Fungal Pathogen Alternaria alternata

    Science.gov (United States)

    Chen, Li-Hung; Tsai, Hsieh-Chin; Yu, Pei-Ling

    2017-01-01

    Major Facilitator Superfamily (MFS) transporters play an important role in multidrug resistance in fungi. We report an AaMFS19 gene encoding a MFS transporter required for cellular resistance to oxidative stress and fungicides in the phytopathogenic fungus Alternaria alternata. AaMFS19, containing 12 transmembrane domains, displays activity toward a broad range of substrates. Fungal mutants lacking AaMFS19 display profound hypersensitivities to cumyl hydroperoxide, potassium superoxide, many singlet oxygen-generating compounds (eosin Y, rose Bengal, hematoporphyrin, methylene blue, and cercosporin), and the cell wall biosynthesis inhibitor, Congo red. AaMFS19 mutants also increase sensitivity to copper ions, clotrimazole, fludioxonil, and kocide fungicides, 2-chloro-5-hydroxypyridine (CHP), and 2,3,5-triiodobenzoic acid (TIBA). AaMFS19 mutants induce smaller necrotic lesions on leaves of a susceptible citrus cultivar. All observed phenotypes in the mutant are restored by introducing and expressing a wild-type copy of AaMFS19. The wild-type strain of A. alternata treated with either CHP or TIBA reduces radial growth and formation and germination of conidia, increases hyphal branching, and results in decreased expression of the AaMFS19 gene. The expression of AaMFS19 is regulated by the Yap1 transcription activator, the Hog1 and Fus3 mitogen-activated protein (MAP) kinases, the ‘two component’ histidine kinase, and the Skn7 response regulator. Our results demonstrate that A. alternata confers resistance to different chemicals via a membrane-bound MFS transporter. PMID:28060864

  17. C-type natriuretic peptide regulates endochondral bone growth through p38 MAP kinase-dependent and – independent pathways

    Directory of Open Access Journals (Sweden)

    Serra Rosa

    2007-03-01

    Full Text Available Abstract Background C-type natriuretic peptide (CNP has recently been identified as an important anabolic regulator of endochondral bone growth, but the molecular mechanisms mediating its effects are not completely understood. Results We demonstrate in a tibia organ culture system that pharmacological inhibition of p38 blocks the anabolic effects of CNP. We further show that CNP stimulates endochondral bone growth largely through expansion of the hypertrophic zone of the growth plate, while delaying mineralization. Both effects are reversed by p38 inhibition. We also performed Affymetrix microarray analyses on micro-dissected tibiae to identify CNP target genes. These studies confirmed that hypertrophic chondrocytes are the main targets of CNP signaling in the growth plate, since many more genes were regulated by CNP in this zone than in the others. While CNP receptors are expressed at similar levels in all three zones, cGMP-dependent kinases I and II, important transducers of CNP signaling, are expressed at much higher levels in hypertrophic cells than in other areas of the tibia, providing a potential explanation for the spatial distribution of CNP effects. In addition, our data show that CNP induces the expression of NPR3, a decoy receptor for natriuretic peptides, suggesting the existence of a feedback loop to limit CNP signaling. Finally, detailed analyses of our microarray data showed that CNP regulates numerous genes involved in BMP signaling and cell adhesion. Conclusion Our data identify novel target genes of CNP and demonstrate that the p38 pathway is a novel, essential mediator of CNP effects on endochondral bone growth, with potential implications for understanding and treatment of numerous skeletal diseases.

  18. Reference: 640 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available er Alois et al. 2007 Jul. Plant Cell 19(7):2213-24. Wound signaling pathways in plants are mediated by mitog...en-activated protein kinases (MAPKs) and stress hormones, such as ethylene and jasmonates. In Arabidopsis th...ed investigations; however, the involvement of specific phosphatases in wound signaling is not known. Here, ...we show that AP2C1, an Arabidopsis Ser/Thr phosphatase of type 2C, is a novel stress signal regulator that inactivates the stress-re... significantly higher amounts of jasmonate upon wounding and are more resistant to phytophagous mites (Tetra

  19. Blackberry extract inhibits UVB-induced oxidative damage and inflammation through MAP kinases and NF-κB signaling pathways in SKH-1 mice skin

    Energy Technology Data Exchange (ETDEWEB)

    Divya, Sasidharan Padmaja; Wang, Xin; Pratheeshkumar, Poyil; Son, Young-Ok; Roy, Ram Vinod [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Kim, Donghern; Dai, Jin [Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Hitron, John Andrew; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Asha, Padmaja [National Centre for Aquatic Animal Health, Cochin University of Science and Technology, Cochin (India); Shi, Xianglin [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Zhang, Zhuo, E-mail: zhuo.zhang@uky.edu [Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States)

    2015-04-01

    Extensive exposure of solar ultraviolet-B (UVB) radiation to skin induces oxidative stress and inflammation that play a crucial role in the induction of skin cancer. Photochemoprevention with natural products represents a simple but very effective strategy for the management of cutaneous neoplasia. In this study, we investigated whether blackberry extract (BBE) reduces chronic inflammatory responses induced by UVB irradiation in SKH-1 hairless mice skin. Mice were exposed to UVB radiation (100 mJ/cm{sup 2}) on alternate days for 10 weeks, and BBE (10% and 20%) was applied topically a day before UVB exposure. Our results show that BBE suppressed UVB-induced hyperplasia and reduced infiltration of inflammatory cells in the SKH-1 hairless mice skin. BBE treatment reduced glutathione (GSH) depletion, lipid peroxidation (LPO), and myeloperoxidase (MPO) in mouse skin by chronic UVB exposure. BBE significantly decreased the level of pro-inflammatory cytokines IL-6 and TNF-α in UVB-exposed skin. Likewise, UVB-induced inflammatory responses were diminished by BBE as observed by a remarkable reduction in the levels of phosphorylated MAP Kinases, Erk1/2, p38, JNK1/2 and MKK4. Furthermore, BBE also reduced inflammatory mediators such as cyclooxygenase-2 (COX-2), prostaglandin E{sub 2} (PGE{sub 2}), and inducible nitric oxide synthase (iNOS) levels in UVB-exposed skin. Treatment with BBE inhibited UVB-induced nuclear translocation of NF-κB and degradation of IκBα in mouse skin. Immunohistochemistry analysis revealed that topical application of BBE inhibited the expression of 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), cyclobutane pyrimidine dimers (CPD), proliferating cell nuclear antigen (PCNA), and cyclin D1 in UVB-exposed skin. Collectively, these data indicate that BBE protects from UVB-induced oxidative damage and inflammation by modulating MAP kinase and NF-κB signaling pathways. - Highlights: • Blackberry extract inhibits UVB-induced glutathione depletion.

  20. Comparative analysis of drought resistance genes in Arabidopsis and rice

    NARCIS (Netherlands)

    Trijatmiko, K.R.

    2005-01-01

    Keywords: rice, Arabidopsis, drought, genetic mapping,microarray, transcription factor, AP2/ERF, SHINE, wax, stomata, comparative genetics, activation tagging, Ac/Ds, En/IThis thesis describes the use of genomics information and tools from Arabidopsis and

  1. Immunomodulation by the Pseudomonas syringae HopZ type III effector family in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jennifer D Lewis

    Full Text Available Pseudomonas syringae employs a type III secretion system to inject 20-30 different type III effector (T3SE proteins into plant host cells. A major role of T3SEs is to suppress plant immune responses and promote bacterial infection. The YopJ/HopZ acetyltransferases are a superfamily of T3SEs found in both plant and animal pathogenic bacteria. In P. syringae, this superfamily includes the evolutionarily diverse HopZ1, HopZ2 and HopZ3 alleles. To investigate the roles of the HopZ family in immunomodulation, we generated dexamethasone-inducible T3SE transgenic lines of Arabidopsis for HopZ family members and characterized them for immune suppression phenotypes. We show that all of the HopZ family members can actively suppress various facets of Arabidopsis immunity in a catalytic residue-dependent manner. HopZ family members can differentially suppress the activation of mitogen-activated protein (MAP kinase cascades or the production of reactive oxygen species, whereas all members can promote the growth of non-virulent P. syringae. Localization studies show that four of the HopZ family members containing predicted myristoylation sites are localized to the vicinity of the plasma membrane while HopZ3 which lacks the myristoylation site is at least partially nuclear localized, suggesting diversification of immunosuppressive mechanisms. Overall, we demonstrate that despite significant evolutionary diversification, all HopZ family members can suppress immunity in Arabidopsis.

  2. The role of EGFR/ERK/ELK-1 MAP kinase pathway in the underlying damage to diabetic rat skin

    Directory of Open Access Journals (Sweden)

    Xinhong Ge

    2013-01-01

    Full Text Available Background: Diabetes mellitus (DM is a highly prevalent disease. Atrophy and spontaneous ulcers are the most common cutaneous manifestation of diabetic dermopathy (DD. Before spontaneous ulcers, we believe there is an underlying damage stage although the mechanism is unknown. Aims: To explore the expression of extracellular signal-regulated kinase1/2 (ERK1/2, its correlated upstream protein epidermal growth factor receptor (EGFR and its downstream transcription factor E twenty-six (ETS-like 1(ELK-1in the damage of the diabetic rat skin, and to explore the role of ERK1/2 on the recessive damage to diabetic rat skin. Materials and Methods: Eighty Sprague-Dawley (SD rats weighing 260-300 g were randomly divided into control and streptozotocin (STZ-induced diabetes groups. After 0.5, 2, 4, and 8 weeks, the shaved skin specimens from the back of rats in both groups were collected to observe the histological characteristics of the skin, to measure the thickness of the epidermis and the dermis, and to observe the ultrastructure. Immunohistochemistry (IHC and Western blot techniques were used to detect the expression and activation of ERK1/2, EGFR, ELK-1 in the skin of the rats. Results: There are ultrastructural changes in the DM skin. With the continuance of the diabetes course, the thicknesses of the epidermis and dermis decreased, and the expression of phospho-ERK1/2 (P-ERK1/2, EGFR, and ELK-1 was decreased gradually in the back skin of the diabetes rats. It was significantly lower in 4 and 8 week DM than that of the normal control ( P < 0.05. The expression of P-EGFR and P-ERK1/2 in the back skin of the diabetes rats was positively correlated ( r = 0.572 P < 0.05, and the positive correlation was also obtained between P-ERK1/2 and P-ELK-1 ( r = 0.715, P < 0.05. Conclusion: The phenomenon of recessive damage exists in the skin of diabetes rats, which probably may relate to the weakness of the signal transduction: P-EGFR → ERK1/2 → ELK-1.

  3. Are free energy calculations useful in practice? A comparison with rapid scoring functions for the p38 MAP kinase protein system.

    Science.gov (United States)

    Pearlman, D A; Charifson, P S

    2001-10-11

    Precise thermodynamic integration free energy simulations have been applied to a congeneric series of 16 inhibitors to the p38 MAP kinase protein for which the experimental binding data (IC(50)) is known. The relative free energy of binding for each compound has been determined. For comparison, the same series of compounds have also scored using the best rapid scoring functions used in database screening. From the results of these calculations, we find (1) that precise free energy simulations allow predictions that are reliable and in good agreement with experiment; (2) that predictions of lower reliability, but still in good qualitative agreement with experiment, can be obtained using the OWFEG free energy grid method, at a much lower computational cost; (3) and that other methods, not based on free energy simulations yield results in much poorer agreement with experiment. A new predictive index, which measures the reliability of a prediction method in the context of normal use, is defined and calculated for each scoring method. Predictive indices of 0.84, 0.56, 0.04, -0.05, and 0.25 are calculated for thermodynamic integration, OWFEG, ChemScore, PLPScore, and Dock Energy Score, respectively, where +1.0 is perfect correct prediction, -1.0 is perfect incorrect prediction, and 0.0 is random.

  4. IDC1, a pezizomycotina-specific gene that belongs to the PaMpk1 MAP kinase transduction cascade of the filamentous fungus Podospora anserina.

    Science.gov (United States)

    Jamet-Vierny, Corinne; Debuchy, Robert; Prigent, Magali; Silar, Philippe

    2007-12-01

    Components involved in the activation of the MAPK cascades in filamentous fungi are not well known. Here, we provide evidence that IDC1, a pezizomycotina-specific gene is involved along with the PaNox1 NADPH oxidase in the nuclear localization of the PaMpk1 MAP kinase, a prerequisite for MAPK activity. Mutants of IDC1 display the same phenotypes as mutants in PaNox1 and PaMpk1, i.e., lack of pigment and of aerial hyphae, female sterility, impairment in hyphal interference and inability to develop Crippled Growth cell degeneration. As observed for the PaNox1 mutant, IDC1 mutants are hypostatic to PaMpk1 mutants. IDC1 seems to play a key role in sexual reproduction. Indeed, fertility is diminished in strains with lower level of IDC1. In strains over-expressing IDC1, protoperithecia reach a later stage of development towards perithecia without fertilization; however, upon fertilization maturation of fertile perithecia is diminished and delayed. In addition, heterokaryon construction shows that IDC1 is necessary together with PaNox1 in the perithecial envelope but not in the dikaryon resulting from fertilization.

  5. PNL1 and PNL2 : Arabidopsis homologs of maize PAN1

    OpenAIRE

    Clark, Lauren Gail

    2010-01-01

    PNL1 and PNL2 are the closest Arabidopsis relatives of maize pan1. pan1 and the PNL family of 11 genes encode leucine-rich repeat, receptor-like kinases, however none of these putative kinases is predicted to have actual kinase function, due to one or more amino acid substitutions in residues necessary for kinase function. Because PAN1 plays a role in subsidiary cell formation in maize, it is hypothesized that PNL1 and PNL2 are involved in stomatal formation in Arabidopsis. YFP fusions of the...

  6. 拟南芥蛋白激酶 SnRK2.6的原核表达、纯化及活性分析%Prokaryotic Expression,Purification and Activity Analysis of Protein Kinase SnRK2·6 in Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    杨凤博; 王鲜萍; 李坤

    2014-01-01

    从哥伦比亚生态型拟南芥(Arabidopsis thaliana Columbia 0)中克隆 SnRK2·6[SNF1(su-crose non-fermenting-1)-related protein kinase 2·6]的完整编码序列(coding sequence,CDS),构建该基因的原核表达载体,将其转化 BL21(DE3),经表达纯化得到 SnRK2·6蛋白。激酶活性分析发现,原核表达纯化的 SnRK2·6有自磷酸化和磷酸化 MBP(myelin basin protein)的活性,为后续试验分析 SnRK2·6的功能奠定基础。%The whole coding sequence of SnRK2·6 [SNF1 (sucrose non-fermenting-1 )-related protein kinase 2·6]was cloned from Arabidopsis thaliana ecotype Columbia 0.The prokaryotic expression vector of the gene was constructed and transformed into Escherichia coli strain BL21 (DE3)to obtain SnRK2·6 protein by induction and purification.By activity analysis,the purified SnRK2·6 had both autophosphorylation activity and phosphorylation activity of the myelin basic protein(MBP)substrate.This study lays the foundation for further study of the function of SnRK2·6.

  7. Acquisition of contextual discrimination involves the appearance of a RAS-GRF1/p38 mitogen-activated protein (MAP) kinase-mediated signaling pathway that promotes long term potentiation (LTP).

    Science.gov (United States)

    Jin, Shan-Xue; Arai, Junko; Tian, Xuejun; Kumar-Singh, Rajendra; Feig, Larry A

    2013-07-26

    RAS-GRF1 is a guanine nucleotide exchange factor with the ability to activate RAS and RAC GTPases in response to elevated calcium levels. We previously showed that beginning at 1 month of age, RAS-GRF1 mediates NMDA-type glutamate receptor (NMDAR)-induction of long term depression in the CA1 region of the hippocampus of mice. Here we show that beginning at 2 months of age, when mice first acquire the ability to discriminate between closely related contexts, RAS-GRF1 begins to contribute to the induction of long term potentiation (LTP) in the CA1 hippocampus by mediating the action of calcium-permeable, AMPA-type glutamate receptors (CP-AMPARs). Surprisingly, LTP induction by CP-AMPARs through RAS-GRF1 occurs via activation of p38 MAP kinase rather than ERK MAP kinase, which has more frequently been linked to LTP. Moreover, contextual discrimination is blocked by knockdown of Ras-Grf1 expression specifically in the CA1 hippocampus, infusion of a p38 MAP kinase inhibitor into the CA1 hippocampus, or the injection of an inhibitor of CP-AMPARs. These findings implicate the CA1 hippocampus in the developmentally dependent capacity to distinguish closely related contexts through the appearance of a novel LTP-supporting signaling pathway.

  8. Effects of interleukins 2 and 12 on TBT-induced alterations of MAP kinases p38 and p44/42 in human natural killer cells.

    Science.gov (United States)

    Aluoch, Aloice O; Whalen, Margaret M

    2006-01-01

    NK cells are lymphocytes in the non-adaptive immune system that protect the body against intracellular pathogens and eliminate tumor cells. Tributyltin (TBT) is a toxic chemical that has been detected in human foods as well as in human blood. The role of TBT in immunosuppression has been described, including inhibition of the human NK-cell cytotoxic function. Previous studies indicated that exposure of NK cells to TBT for 1 h induced progressive and irreversible inhibition of cytotoxic function. However, it was found that if NK cells were incubated in TBT-free media with either IL-2 or IL-12, loss of cytotoxic function was prevented/reversed within 24 h. Molecular studies established that loss of cytotoxic function is accompanied by alteration of MAP kinases (MAPKs) p38 and p44/42 phosphorylation. This study examined whether interleukin-mediated recovery of cytotoxicity involved reversal of tributyltin-altered p38 and p44/42 phosphorylation. The results indicated that there was no substantial IL-2 prevention/reversal of the TBT-induced alteration of phosphorylation of either p38 or p44/42 after either a 24 or 48 h recovery period. Additionally, IL-12 caused no substantial prevention/reversal of the TBT-induced alteration of phosphorylation of the MAPKs seen after either 24 or 48 h. These data suggest that IL-2 and/or IL-12-mediated recovery of NK cytotoxic function is not a result of prevention/reversal of TBT-induced phosphorylation of p38 and p44/42 MAPKs at the 24 or 48 h time points.

  9. Inhibition of lipid phosphate phosphatase activity by VPC32183 suppresses the ability of diacylglycerol pyrophosphate to activate ERK(1/2) MAP kinases.

    Science.gov (United States)

    Violet, Pierre-Christian; Billon-Denis, Emmanuelle; Robin, Philippe

    2012-11-01

    The lipidic metabolite, diacylglycerol pyrophosphate (DGPP), in its dioctanoyl form (DGPP 8:0), has been described as an antagonist for mammalian lysophosphatidic acid (LPA) receptors LPA1 and LPA3. In this study we show that DGPP 8:0 does not antagonize LPA dependent activation of ERK(1/2) MAP kinases but strongly stimulated them in various mammalian cell lines. LPA and DGPP 8:0 stimulation of ERK(1/2) occurred through different pathways. The DGPP 8:0 effect appeared to be dependent on PKC, Raf and MEK but was insensitive to pertussis toxin and did not involve G protein activation. Finally we showed that DGPP 8:0 effect on ERK(1/2) was dependent on its dephosphorylation by a phosphatase activity sharing lipid phosphate phosphatase properties. The inhibition of this phosphatase activity by VPC32183, a previously characterized LPA receptor antagonist, blocked the DGPP 8:0 effect on ERK(1/2) activation. Moreover, down-regulation of lipid phosphate phosphatase 1 (LPP1) expression by RNA interference technique also reduced DGPP 8:0-induced ERK(1/2) activation. Consistently, over expression of LPP1 in HEK293 cells increases DGPP 8:0 hydrolysis and this increased activity was inhibited by VPC32183. In conclusion, DGPP 8:0 does not exert its effect by acting on a G protein coupled receptor, but through its dephosphorylation by LPP1, generating dioctanoyl phosphatidic acid which in turn activates PKC. These results suggest that LPP1 could have a positive regulatory function on cellular signaling processes such as ERK(1/2) activation.

  10. Phosphorylation of ERK/MAP Kinase Is Required for Long-Term Potentiation in Anatomically Restricted Regions of the Lateral Amygdala in Vivo

    Science.gov (United States)

    Schafe, Glenn E.; Swank, Michael W.; Rodriguez, Sarina M.; Debiec, Jacek; Doyere, Valerie

    2008-01-01

    We have previously shown that the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/ MAPK) is transiently activated in anatomically restricted regions of the lateral amygdala (LA) following Pavlovian fear conditioning and that blockade of ERK/MAPK activation in the LA impairs both fear memory consolidation and long-term…

  11. Tobacco-specific Carcinogen 4-(Methylnitrosoamino)-1-(3-pyridyl )-1-butanone(NNK) Activating ERK1/2 MAP Kinases and Stimulating Proliferation of Hmnan Mammary Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Cigarette smoking is correlated with the development of various cancers. 4 - (Methylnitrosoamino) -1 - ( 3 -pyridyl) -1-butanone (NNK) is one of the major tobacco-specific carcinogens in the cigarette smoke, which increases the risk of breast cancer. In the present study, it was demonstrated that NNK rapidly activated ERK1 and ERK2 MAP kinases in human normal mammary epithelial cells. It was found that there are two different routes for the activation of ERK1/2with NNK. One is from nicotinic receptor nAchR to MEK1/2, and the other is from tyrosine kinase containing receptor to MEK1/2. The tobacco-specific carcinogen NNK shows a strong proliferative effect on normal human mammary epithelial cells and cancer mammary epithelial cells.

  12. Reference: 600 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available n M et al. 2007 Jun. Plant J. 50(5):810-24. A novel abscisic acid (ABA)-deficient mutant, aba4, was identified in a scre...en for paclobutrazol-resistant germination. Compared with wild-type, the mutant showed reduced e...by map-based cloning, and found to be a unique gene in the Arabidopsis genome. The predicted protein has fou...r putative helical transmembrane domains and shows significant similarity to pred...icted proteins from tomato, rice and cyanobacteria. Constitutive expression of the ABA4 gene in Arabidopsis

  13. Proteomic Responses in Arabidopsis thaliana Seedlings Treated with Ethylene

    Science.gov (United States)

    Ethylene (ET) is a volatile plant growth hormone that most famously modulates fruit ripening, but it also controls plant growth, development and stress responses. In Arabidopsis thaliana, ET is perceived by receptors in the endoplasmic reticulum, and a signal is transduced through a protein kinase,...

  14. Identification of a 115kDa MAP-kinase activated by freezing and anoxic stresses in the marine periwinkle, Littorina littorea.

    Science.gov (United States)

    MacDonald, Justin A; Storey, Kenneth B

    2006-06-15

    The mitogen-activated protein kinase (MAPK) cascade regulates changes in gene transcription by transmitting extracellular stimuli from the plasma membrane to the cell nucleus and has an important role to play in organismal responses to environmental stresses. The activities of MAPKs were investigated in the marine gastropod mollusk, Littorina littorea, a species that tolerates both extracellular freezing and long term oxygen deprivation. In-gel kinase assays revealed the presence of two MAPKs in foot muscle and hepatopancreas, a 42 and a 115kDa protein. Immunoblot analysis showed that both were MAPK proteins and that one was the periwinkle homologue of p42(ERK2). Size exclusion chromatography confirmed the 115kDa size of the novel snail MAPK and its role as the dominant MAPK activity in foot muscle. In-gel kinase assays, immunoblotting with phospho-specific ERK antibody, as well as kinase activity profiles from hydroxyapatite chromatography demonstrated that p115 MAPK kinase activity was increased in foot muscle in response to in vivo freezing or anoxia exposures. The results suggest a role for this novel kinase in environmental stress response.

  15. In vivo Evaluation of Two Thiazolidin-4-one Derivatives in High Sucrose Diet Fed Pre-diabetic Mice and Their Modulatory Effect on AMPK, Akt and p38 MAP Kinase in L6 Cells

    Science.gov (United States)

    Mudgal, Jayesh; Shetty, Priya; Reddy, Neetinkumar D.; Akhila, H. S.; Gourishetti, Karthik; Mathew, Geetha; Nayak, Pawan G.; Kumar, Nitesh; Kishore, Anoop; Kutty, Nampurath G.; Nandakumar, Krishnadas; Shenoy, Rekha R.; Rao, Chamallamudi M.; Joseph, Alex

    2016-01-01

    We had previously demonstrated the anti-diabetic potential and pancreatic protection of two thiazolidin-4-one derivatives containing nicotinamide moiety (NAT-1 and NAT-2) in STZ-induced diabetic mice. However, due to the limitations of the STZ model, we decided to undertake a detailed evaluation of anti-diabetic potential of the molecules on a high sucrose diet (HSD) fed diabetic mouse model. Further, in vitro mechanistic studies on the phosphorylation of AMPK, Akt and p38 MAP kinase in L6 myotubes and anti-inflammatory studies in RAW264.7 mouse monocyte macrophage cells were performed. 15 months of HSD induced fasting hyperglycaemia and impaired glucose tolerance in mice. Treatment with NAT-1 and NAT-2 (100 mg/kg) for 45 days significantly improved the glucose tolerance and lowered fasting blood glucose levels compared to untreated control. An improvement in the elevated triglycerides and total cholesterol levels, and favorable rise in HDL cholesterol were also observed with test drug treatment. Also, no major changes were observed in the liver (albumin, AST and ALT) and kidney (creatinine and urea) parameters. This was further confirmed in their respective histology profiles which revealed no gross morphological changes. In L6 cells, significant phosphorylation of Akt and p38 MAP kinase proteins were observed with 100 μM of NAT-1 and NAT-2 with no significant changes in phosphorylation of AMPK. The molecules failed to exhibit anti-inflammatory activity as observed by their effect on the generation of ROS and nitrite, and nuclear levels of NF-κB in LPS-stimulated RAW264.7 cells. In summary, the molecules activated Akt and p38 MAP kinase which could have partly contributed to their anti-hyperglycaemic and hypolipidemic activities in vivo. PMID:27790148

  16. Differential expression profiles of poplar MAP kinase kinases in response to abiotic stresses and plant hormones, and overexpression of PtMKK4 improves the drought tolerance of poplar.

    Science.gov (United States)

    Wang, Lei; Su, Hongyan; Han, Liya; Wang, Chuanqi; Sun, Yanlin; Liu, Fenghong

    2014-07-15

    Mitogen-activated protein kinase (MAPK) cascades are universal signal transduction modules that play essential roles in plant growth, development and stress response. MAPK kinases (MAPKKs), which link MAPKs and MAPKK kinases (MAPKKKs), are integral in mediating various stress responses in plants. However, to date few data about the roles of poplar MAPKKs in stress signal transduction are available. In this study, we performed a systemic analysis of poplar MAPKK gene family expression profiles in response to several abiotic stresses and stress-associated hormones. Furthermore, Populus trichocarpa MAPKK4 (PtMKK4) was chosen for functional characterization. Transgenic analysis showed that overexpression of the PtMKK4 gene remarkably enhanced drought stress tolerance in the transgenic poplar plants. The PtMKK4-overexpressing plants also exhibited much lower levels of H2O2 and higher antioxidant enzyme activity after exposure to drought stress compared to the wide type lines. Besides, some drought marker genes including PtP5CS, PtSUS3, PtLTP3 and PtDREB8 exhibited higher expression levels in the transgenic lines than in the wide type under drought conditions. This study provided valuable information for understanding the putative functions of poplar MAPKKs involved in important signaling pathways under different stress conditions.

  17. Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L.; Hood, Molly M.; Lord, John W.; Lu, Wei-Ping; Miller, David F.; Patt, William C.; Smith, Bryan D.; Vogeti, Lakshminarayana; Kaufman, Michael D.; Petillo, Peter A.; Wise, Scott C.; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L. (Deciphera); (Emerald); (Cocrystal)

    2012-01-20

    Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase.

  18. Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region.

    Science.gov (United States)

    Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L; Hood, Molly M; Lord, John W; Lu, Wei-Ping; Miller, David F; Patt, William C; Smith, Bryan D; Vogeti, Lakshminarayana; Kaufman, Michael D; Petillo, Peter A; Wise, Scott C; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L

    2010-10-01

    Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase.

  19. Proteomic Analysis of Two Brassica napus Differing in the Oil Contents and Map Alignment between the DEPs with Arabidopsis and B. rapa

    Institute of Scientific and Technical Information of China (English)

    Maoteng Li; Lu Gan; Xiaodong Wang; Dianrong Li; Hao Wang; Chunhua Fu; Longjiang Yu

    2012-01-01

    Rapeseed (Brassica napus) is one of the most important oilseed crops in the world.Improve the oil content is the main object for breeders at present.Oil contents is an important and complex metabolic trait of B.napus,in our previous studies,about 50 materials with oil content over 50% were obtained.Lots of studies revealed that some factors,such as seed coat,embryo,and endosperm that were all correlated with oil conten,but the studies focus on the proteomic studies on seed oil content were few reported.It is generally considered that the protein content is negatively correlated with oil content,which was further verified with QTL analysis for protein and oil content,Total and oil body protein in mature seeds of two B.napus cultivars with the oil content of 36.49% and 55.19% were analsized by using 2-DE technique.154 differentially expressed proteins (DEPs) have been successfully identified by using MALDI-TOF-MS method.The DEPs were mainly involved in Storage protein,Carbohydrate pathway protein,Cell Growth/Division protein,and Defense/Disease protein.Significant difference of cell growth/division protein both detected in total and oil body protein may be correlated to the size of oil body in B.napus with different oil content.The genome alignment analysis showed that among the 378 key genes,24 genes were underlying the N block,36 genes were underlying the U block and 17 genes were belong to the C block,then the 77 genes were used as candidate genes to do in silico mapping in A4 and C3 chromosomes of TN linkage map.For example,compared with the QTL mapping results and candidate genes,6 of the 24 genes underlying N block of A4 chromosome were mapped on the QTL qA4-1 confidence interval,including AT3G56350,AT3G57620,PGL34,AT3G58450,BGLU27 and BGLU30,and 5 genes were mapped on the QTL qOCDA-2 confidence interval,including AT3G52470,ATELP,MDAR1,FBA8 and AT3G53040.

  20. Preventing Phosphorylation of Sterol Regulatory Element-Binding Protein 1a by MAP-Kinases Protects Mice from Fatty Liver and Visceral Obesity

    OpenAIRE

    Jorg Kotzka; Birgit Knebel; Jutta Haas; Lorena Kremer; Sylvia Jacob; Sonja Hartwig; Ulrike Nitzgen; Dirk Muller-Wieland

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress acti...

  1. Arabidopsis hybrid speciation processes.

    Science.gov (United States)

    Schmickl, Roswitha; Koch, Marcus A

    2011-08-23

    The genus Arabidopsis provides a unique opportunity to study fundamental biological questions in plant sciences using the diploid model species Arabidopsis thaliana and Arabidopsis lyrata. However, only a few studies have focused on introgression and hybrid speciation in Arabidopsis, although polyploidy is a common phenomenon within this genus. More recently, there is growing evidence of significant gene flow between the various Arabidopsis species. So far, we know Arabidopsis suecica and Arabidopsis kamchatica as fully stabilized allopolyploid species. Both species evolved during Pleistocene glaciation and deglaciation cycles in Fennoscandinavia and the amphi-Beringian region, respectively. These hybrid studies were conducted either on a phylogeographic scale or reconstructed experimentally in the laboratory. In our study we focus at a regional and population level. Our research area is located in the foothills of the eastern Austrian Alps, where two Arabidopsis species, Arabidopsis arenosa and A. lyrata ssp. petraea, are sympatrically distributed. Our hypothesis of genetic introgression, migration, and adaptation to the changing environment during the Pleistocene has been confirmed: We observed significant, mainly unidirectional gene flow between the two species, which has given rise to the tetraploid A. lyrata. This cytotype was able to escape from the narrow ecological niche occupied by diploid A. lyrata ssp. petraea on limestone outcrops by migrating northward into siliceous areas, leaving behind a trail of genetic differentiation.

  2. GmSARK启动子驱动IPT基因在拟南芥中的表达研究%Heterologous Expression of Isopentenyl Transferase(Ipt) Gene Directed by Senescence Associated Receptor Protein Kinase(SARK) Promoter in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    霍巍巍; 闫璇玲; 孙晓文; 李海燕

    2012-01-01

    [Objective] This study aimed to investigate the expression of IPT gene directed by GmSARK promoter in Arabidopsis. [ Method] IPT gene and GmSARK promoter were respectively cloned to construct plant expression vector and transform Arabidopsis. T, transgenic plant lines were detected by PPT(phosphinothricin) herbicide selection and treated under drought and dark conditions for semi-quantitive RT-PCR analysis. [ Result] GmSARK and IPT fusion gene was successfully cloned and the plant expression vector p3301 -GmSAHK-IPT was constructed. RT-PCR analysis showed that the target gene was expressed in T1 transgenic plant lines at the mRNA level. [ Conclusion] This study laid the foundation for further investigating the roles of IPT gene directed by GmSARK promoter in plant stress resistance.%[目的]对GmSARK启动子驱动IPT基因在拟南芥中的表达进行研究.[方法]分别克隆IPT基因及GmSARK基因启动子,构建它们的植物表达栽体并进行拟南芥的转化,利用PPT(phosphinothricin)除草剂筛选,检测T1代转基因植株;对T1代转基因植株进行黑暗避光和干旱处理后进行半定量RT-PCR分析.[结果]成功克隆得到了IPT基因及GmSARK基因,并构建了它们的p3301 -GmSARK-IPT植物表达载体;对T代转基因植株的RT-PCR表明,目的基因mRNA水平上有所表达.[结论]为进一步研究GmSARK启动子驱动的IPT基因在抗逆中的作用奠定了基础.

  3. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  4. Gene expression studies demonstrate that the K-ras/Erk MAP kinase signal transduction pathway and other novel pathways contribute to the pathogenesis of cumene-induced lung tumors.

    Science.gov (United States)

    Wakamatsu, Nobuko; Collins, Jennifer B; Parker, Joel S; Tessema, Mathewos; Clayton, Natasha P; Ton, Thai-Vu T; Hong, Hue-Hua L; Belinsky, Steven; Devereux, Theodora R; Sills, Robert C; Lahousse, Stephanie A

    2008-07-01

    National Toxicology Program (NTP) inhalation studies demonstrated that cumene significantly increased the incidence of alveolar/bronchiolar adenomas and carcinomas in B6C3F1 mice. Cumene or isopropylbenzene is a component of crude oil used primarily in the production of phenol and acetone. The authors performed global gene expression analysis to distinguish patterns of gene regulation between cumene-induced tumors and normal lung tissue and to look for patterns based on the presence or absence of K-ras and p53 mutations in the tumors. Principal component analysis segregated the carcinomas into groups with and without K-ras mutations, but failed to separate the tumors based on p53 mutation status. Expression of genes associated with the Erk MAP kinase signaling pathway was significantly altered in carcinomas with K-ras mutations compared to tumors without K-ras mutations or normal lung. Gene expression analysis also suggested that cumene-induced carcinomas with K-ras mutations have greater malignant potential than those without mutations. In addition, significance analysis of function and expression (SAFE) demonstrated expression changes of genes regulated by histone modification in carcinomas with K-ras mutations. The gene expression analysis suggested the formation of alveolar/bronchiolar carcinomas in cumene-exposed mice typically involves mutation of K-ras, which results in increased Erk MAP kinase signaling and modification of histones.

  5. Chromosomal mapping and mutational analysis of the coding region of the glycogen synthase kinase-3alpha and beta isoforms in patients with NIDDM

    DEFF Research Database (Denmark)

    Hansen, L; Arden, K C; Rasmussen, S B

    1997-01-01

    Activation of glycogen synthesis in skeletal muscle in response to insulin results from the combined inactivation of glycogen synthase kinase-3 (GSK-3) and activation of the protein phosphatase-1, changing the ratio between the inactive phosphorylated state of the glycogen synthase to the active ...

  6. The NO-cGMP-PKG Signaling Pathway Regulates Synaptic Plasticity and Fear Memory Consolidation in the Lateral Amygdala via Activation of ERK/MAP Kinase

    Science.gov (United States)

    Ota, Kristie T.; Pierre, Vicki J.; Ploski, Jonathan E.; Queen, Kaila; Schafe, Glenn E.

    2008-01-01

    Recent studies have shown that nitric oxide (NO) signaling plays a crucial role in memory consolidation of Pavlovian fear conditioning and in synaptic plasticity in the lateral amygdala (LA). In the present experiments, we examined the role of the cGMP-dependent protein kinase (PKG), a downstream effector of NO, in fear memory consolidation and…

  7. Inhibitory Effects of KP-A159, a Thiazolopyridine Derivative, on Osteoclast Differentiation, Function, and Inflammatory Bone Loss via Suppression of RANKL-Induced MAP Kinase Signaling Pathway.

    Directory of Open Access Journals (Sweden)

    Hye Jung Ihn

    Full Text Available Abnormally elevated formation and activation of osteoclasts are primary causes for a majority of skeletal diseases. In this study, we found that KP-A159, a newly synthesized thiazolopyridine derivative, inhibited osteoclast differentiation and function in vitro, and inflammatory bone loss in vivo. KP-A159 did not cause a cytotoxic response in bone marrow macrophages (BMMs, but significantly inhibited the formation of multinucleated tartrate-resistant acid phosphatase (TRAP-positive osteoclasts induced by macrophage colony-stimulating factor (M-CSF and receptor activator of nuclear factor-κB ligand (RANKL. KP-A159 also dramatically inhibited the expression of marker genes related to osteoclast differentiation, including TRAP (Acp5, cathepsin K (Ctsk, dendritic cell-specific transmembrane protein (Dcstamp, matrix metallopeptidase 9 (Mmp9, and nuclear factor of activated T-cells, cytoplasmic 1 (Nfatc1. Moreover, actin ring and resorption pit formation were inhibited by KP-A159. Analysis of the signaling pathway involved showed that KP-A159 inhibited RANKL-induced activation of extracellular signal-regulated kinase (ERK, c-Jun N-terminal kinase (JNK, and mitogen-activated protein kinase kinase1/2 (MEK1/2. In a mouse inflammatory bone loss model, KP-A159 significantly rescued lipopolysaccharide (LPS-induced bone loss by suppressing osteoclast numbers. Therefore, KP-A159 targets osteoclasts, and may be a potential candidate compound for prevention and/or treatment of inflammatory bone loss.

  8. Pseudomonas aeruginosa pyocyanin activates NRF2-ARE-mediated transcriptional response via the ROS-EGFR-PI3K-AKT/MEK-ERK MAP kinase signaling in pulmonary epithelial cells.

    Science.gov (United States)

    Xu, Ying; Duan, Chaohui; Kuang, Zhizhou; Hao, Yonghua; Jeffries, Jayme L; Lau, Gee W

    2013-01-01

    The redox-active pyocyanin (PCN) secreted by the respiratory pathogen Pseudomonas aeruginosa generates reactive oxygen species (ROS) and causes oxidative stress to pulmonary epithelial cells. Nuclear factor (erythroid-derived 2)-like 2 (NRF2) confers protection against ROS-mediated cell death by inducing the expression of detoxifying enzymes and proteins via its binding to the cis-acting antioxidant response element (ARE). However, a clear relationship between NRF2 and PCN-mediated oxidative stress has not been established experimentally. In this study, we investigated the induction of NRF2-ARE response by PCN in the pulmonary epithelial cells. We analyzed the effect of PCN on NRF2 expression and nuclear translocation in cultured human airway epithelial cells, and in a mouse model of chronic PCN exposure. NRF2-dependent transcription of antioxidative enzymes was also assessed. Furthermore, we used inhibitors to examine the involvement of EGFR and its downstream signaling components that mediate NRF2-ARE-activation in response to PCN. PCN enhances the nuclear NRF2 accumulation and activates the transcription of ARE-mediated antioxidant genes. Furthermore, PCN activates NRF2 by inducing the EGFR-phosphoinositide-3-kinase (PI3K) signaling pathway and its main downstream effectors, AKT and MEK1/2-ERK1/2 MAP kinases. Inhibition of the EGFR-PI3K signaling markedly attenuates PCN-stimulated NRF2 accumulation in the nucleus. We demonstrate for the first time that PCN-mediated oxidative stress activates the EGFR-PI3K-AKT/MEK1/2-ERK1/2 MAP kinase signaling pathway, leading to nuclear NRF2 translocation and ARE responsiveness in pulmonary epithelial cells.

  9. Auxin efflux by PIN-FORMED proteins is activated by two different protein kinases, D6 PROTEIN KINASE and PINOID

    KAUST Repository

    Zourelidou, Melina

    2014-06-19

    The development and morphology of vascular plants is critically determined by synthesis and proper distribution of the phytohormone auxin. The directed cell-to-cell distribution of auxin is achieved through a system of auxin influx and efflux transporters. PIN-FORMED (PIN) proteins are proposed auxin efflux transporters, and auxin fluxes can seemingly be predicted based on the-in many cells-asymmetric plasma membrane distribution of PINs. Here, we show in a heterologous Xenopus oocyte system as well as in Arabidopsis thaliana inflorescence stems that PIN-mediated auxin transport is directly activated by D6 PROTEIN KINASE (D6PK) and PINOID (PID)/WAG kinases of the Arabidopsis AGCVIII kinase family. At the same time, we reveal that D6PKs and PID have differential phosphosite preferences. Our study suggests that PIN activation by protein kinases is a crucial component of auxin transport control that must be taken into account to understand auxin distribution within the plant.

  10. Auxin efflux by PIN-FORMED proteins is activated by two different protein kinases, D6 PROTEIN KINASE and PINOID.

    Science.gov (United States)

    Zourelidou, Melina; Absmanner, Birgit; Weller, Benjamin; Barbosa, Inês C R; Willige, Björn C; Fastner, Astrid; Streit, Verena; Port, Sarah A; Colcombet, Jean; de la Fuente van Bentem, Sergio; Hirt, Heribert; Kuster, Bernhard; Schulze, Waltraud X; Hammes, Ulrich Z; Schwechheimer, Claus

    2014-06-19

    The development and morphology of vascular plants is critically determined by synthesis and proper distribution of the phytohormone auxin. The directed cell-to-cell distribution of auxin is achieved through a system of auxin influx and efflux transporters. PIN-FORMED (PIN) proteins are proposed auxin efflux transporters, and auxin fluxes can seemingly be predicted based on the--in many cells--asymmetric plasma membrane distribution of PINs. Here, we show in a heterologous Xenopus oocyte system as well as in Arabidopsis thaliana inflorescence stems that PIN-mediated auxin transport is directly activated by D6 PROTEIN KINASE (D6PK) and PINOID (PID)/WAG kinases of the Arabidopsis AGCVIII kinase family. At the same time, we reveal that D6PKs and PID have differential phosphosite preferences. Our study suggests that PIN activation by protein kinases is a crucial component of auxin transport control that must be taken into account to understand auxin distribution within the plant.

  11. Sodium nitroprusside-induced mitochondrial apoptotic events in insulin-secreting RINm5F cells are associated with MAP kinases activation.

    Science.gov (United States)

    Bernabé, J C; Tejedo, J R; Rincón, P; Cahuana, G M; Ramírez, R; Sobrino, F; Bedoya, F J

    2001-10-01

    Exposure of insulin-secreting RINm5F cells to the chemical nitric oxide donor sodium nitroprusside (SNP) resulted in apoptotic cell death, as detected by cytochrome c release from mitochondria and caspase 3 activation. SNP exposure also leads to phosphorylation and activation of enzymes involved in cellular response to stress such as signal-regulated kinase 2 (ERK2) and c-Jun NH(2)-terminal kinase 46 (JNK46). Both cytochrome c release and caspase 3 activation were abrogated in cells exposed to MEK and p38 inhibitors. Treatment of cells with the NO donors SNP, DETA-NO, GEA 5024, and SNAP resulted in phosphorylation of the antiapoptotic protein Bcl-2, which was resistant to blockade of MEK, p38, and JNK pathways and sensitive to phosphoinositide 3-kinase (PI3K) inhibition. In addition, transient transfection of cells with the wild-type PI3K gamma gene mimics the increased rate of Bcl-2 phosphorylation detected in NO-treated cells. The generation of phosphoinositides seems to participate in the process since Bcl-2 phosphorylation was not observed in cells overexpressing lipid-kinase-deficient PI3Kgamma. The potential of SNP toxicity directly from NO was supported by our finding that the NO scavenger carboxy-PTIO prevented cell death. We found no evidence to support the contention that oxygen radicals generated during cellular SNP metabolism mediate cell toxicity in RINm5F cells, since neither addition of catalase/superoxide dismutase nor transfection with superoxide dismutase prevented SNP-induced cell death. Thus, we propose that exposure to apoptotic concentrations of NO triggers ERK- and p38-dependent cytochrome c release, caspase 3 activation, and PI3K-dependent Bcl-2 phosphorylation.

  12. The nucleotide receptor P2X7 mediates actin reorganization and membrane blebbing in RAW 264.7 macrophages via p38 MAP kinase and Rho.

    Science.gov (United States)

    Pfeiffer, Zachary A; Aga, Mini; Prabhu, Usha; Watters, Jyoti J; Hall, David J; Bertics, Paul J

    2004-06-01

    Extracellular nucleotides regulate macrophage function via P2X nucleotide receptors that form ligand-gated ion channels. In particular, P2X7 activation is characterized by pore formation, membrane blebbing, and cytokine release. P2X7 is also linked to mitogen-activated protein kinases (MAPK) and Rho-dependent pathways, which are known to affect cytoskeletal structure in other systems. As cytoskeletal function is critical for macrophage behavior, we have tested the importance of these pathways in actin filament reorganization during P2X7 stimulation in RAW 264.7 macrophages. We observed that the P2X7 agonists adenosine 5'-triphosphate (ATP) and 3'-O-(4-benzoylbenzoyl) ATP (BzATP) stimulated actin reorganization and concomitant membrane blebbing within 5 min. Disruption of actin filaments with cytochalasin D attenuated membrane blebbing but not P2X7-dependent pore formation or extracellular-regulated kinase (ERK)1/ERK2 and p38 activation, suggesting that these latter processes do not require intact actin filaments. However, we provide evidence that p38 MAPK and Rho activation but not ERK1/ERK2 activation is important for P2X7-mediated actin reorganization and membrane blebbing. First, activation of p38 and Rho was detected within 5 min of BzATP treatment, which is coincident with membrane blebbing. Second, the p38 inhibitors SB202190 and SB203580 reduced nucleotide-induced blebbing and actin reorganization, whereas the MAPK kinase-1/2 inhibitor U0126, which blocks ERK1/ERK2 activation, had no discernable effect. Third, the Rho-selective inhibitor C3 exoenzyme and the Rho effector kinase, Rho-associated coiled-coil kinase, inhibitor Y-27632, markedly attenuated BzATP-stimulated actin reorganization and membrane blebbing. These data support a model wherein p38- and Rho-dependent pathways are critical for P2X7-dependent actin reorganization and membrane blebbing, thereby facilitating P2X7 involvement in macrophage inflammatory responses.

  13. Distinct signaling mechanisms in multiple developmental pathways by the SCRAMBLED receptor of Arabidopsis.

    Science.gov (United States)

    Kwak, Su-Hwan; Woo, Sooah; Lee, Myeong Min; Schiefelbein, John

    2014-10-01

    SCRAMBLED (SCM), a leucine-rich repeat receptor-like kinase in Arabidopsis (Arabidopsis thaliana), is required for positional signaling in the root epidermis and for tissue/organ development in the shoot. To further understand SCM action, we generated a series of kinase domain variants and analyzed their ability to complement scm mutant defects. We found that the SCM kinase domain, but not kinase activity, is required for its role in root epidermal patterning, supporting the view that SCM is an atypical receptor kinase. We also describe a previously uncharacterized role for SCM in fruit dehiscence, because mature siliques from scm mutants fail to open properly. Interestingly, the kinase domain of SCM appears to be dispensable for this developmental process. Furthermore, we found that most of the SCM kinase domain mutations dramatically inhibit inflorescence development. Because this process is not affected in scm null mutants, it is likely that SCM acts redundantly to regulate inflorescence size. The importance of distinct kinase residues for these three developmental processes provides an explanation for the maintenance of the conserved kinase domain in the SCM protein, and it may generally explain its conservation in other atypical kinases. Furthermore, these results indicate that individual leucine-rich repeat receptor-like kinases may participate in multiple pathways using distinct signaling mechanisms to mediate diverse cellular communication events.

  14. Inhibitory effects of pentosan polysulfate sodium on MAP-kinase pathway and NF-κB nuclear translocation in canine chondrocytes in vitro.

    Science.gov (United States)

    Sunaga, Takafumi; Oh, Namgil; Hosoya, Kenji; Takagi, Satoshi; Okumura, Masahiro

    2012-06-01

    Pentosan polysulfate sodium (PPS) has a heparin-like structure and is purificated from the plant of European beech wood. PPS has been used for the treatment of interstitial cystitis for human patients. Recent years, it was newly recognised that PPS reduce pain and inflammation of OA. The molecular biological mechanism of PPS to express its clinical effects is not fully understood. The purpose of the present study is to investigate a mechanism of action of PPS on inflammatory reaction of chondrocytes in vitro. It was evaluated that effects of PPS on interleukin (IL)-1β-induced phosphorylation of mitogen-actiated protein kinases (MAPKs), such as p38, extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), nuclear translocation of nuclear factor-kappa B (NF-κB), and matrix metalloproteinase (MMP)-3 production in cultured articular chondrocytes. As a result, in the presence of PPS existence, IL-1β-induced phosphorylation of p38 and ERK were certainly inhibited, while JNK phosphorylation was not affected. Nuclear translocation of NF-κB and MMP-3 production were suppressed by PPS pretreatment prior to IL-1β stimulation. In conclusion, it is strongly suggested that PPS treatment prevents inflammatory intracellular responses induced by IL-1 β through inhibition of phosphorylation of certain MAPKs, p38 and ERK and then nuclear translocation of NF-κB in cultured chondrocytes. These PPS properties may contribute to suppressive consequence of catabolic MMP-3 synthesis. These data might translate the clinical efficacy as PPS treatment could inhibit the cartilage catabolism and related clinical symptoms of OA in dogs.

  15. Pioglitazone inhibition of lipopolysaccharide-induced nitric oxide synthase is associated with altered activity of p38 MAP kinase and PI3K/Akt

    Directory of Open Access Journals (Sweden)

    Hunter Randy

    2008-01-01

    Full Text Available Abstract Background Previous studies have suggested that peroxisome proliferator activated receptor-gamma (PPAR-γ-mediated neuroprotection involves inhibition of microglial activation and decreased expression and activity of inducible nitric oxide synthase (iNOS; however, the underlying molecular mechanisms have not yet been well established. In the present study we explored: (1 the effect of the PPAR-γ agonist pioglitazone on lipopolysaccharide (LPS-induced iNOS activity and nitric oxide (NO generation by microglia; (2 the differential role of p38 mitogen-activated protein kinase (p38 MAPK, c-Jun NH(2-terminal kinase (JNK, and phosphoinositide 3-kinase (PI3K on LPS-induced NO generation; and (3 the regulation of p38 MAPK, JNK, and PI3K by pioglitazone. Methods Mesencephalic neuron-microglia mixed cultures, and microglia-enriched cultures were treated with pioglitazone and/or LPS. The protein levels of iNOS, p38 MAPK, JNK, PPAR-γ, PI3K, and protein kinase B (Akt were measured by western blot. Different specific inhibitors of iNOS, p38MAPK, JNK, PI3K, and Akt were used in our experiment, and NO generation was measured using a nitrite oxide assay kit. Tyrosine hydroxylase (TH-positive neurons were counted in mesencephalic neuron-microglia mixed cultures. Results Our results showed that pioglitazone inhibits LPS-induced iNOS expression and NO generation, and inhibition of iNOS is sufficient to protect dopaminergic neurons against LPS insult. In addition, inhibition of p38 MAPK, but not JNK, prevented LPS-induced NO generation. Further, and of interest, pioglitazone inhibited LPS-induced phosphorylation of p38 MAPK. Wortmannin, a specific PI3K inhibitor, enhanced p38 MAPK phosphorylation upon LPS stimulation of microglia. Elevations of phosphorylated PPAR-γ, PI3K, and Akt levels were observed with pioglitazone treatment, and inhibition of PI3K activity enhanced LPS-induced NO production. Furthermore, wortmannin prevented the inhibitory effect of

  16. The Arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens

    DEFF Research Database (Denmark)

    Roux, Milena Edna; Schwessinger, Benjamin; Albrecht, Catherine;

    2011-01-01

    Recognition of pathogen-associated molecular patterns (PAMPs) by surface-localized pattern recognition receptors (PRRs) constitutes an important layer of innate immunity in plants. The leucine-rich repeat (LRR) receptor kinases EF-TU RECEPTOR (EFR) and FLAGELLIN SENSING2 (FLS2) are the PRRs...... and BKK1 cooperate genetically to achieve full signaling capability in response to elf18 and flg22 and to the damage-associated molecular pattern AtPep1. Furthermore, we demonstrated that BAK1 and BKK1 contribute to disease resistance against the hemibiotrophic bacterium Pseudomonas syringae...... and the obligate biotrophic oomycete Hyaloperonospora arabidopsidis. Our work reveals that the establishment of PAMP-triggered immunity (PTI) relies on the rapid ligand-induced recruitment of multiple SERKs within PRR complexes and provides insight into the early PTI signaling events underlying this important...

  17. Discovery of 4-(5-(Cyclopropylcarbamoyl)-2-methylphenylamino)-5-methyl-N-propylpyrrolo[1,2-f][1,2,4]triazine-6-carboxamide (BMS-582949), a Clinical p38[alpha] MAP Kinase Inhibitor for the Treatment of Inflammatory Diseases

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chunjian; Lin, James; Wrobleski, Stephen T.; Lin, Shuqun; Hynes, Jr., John; Wu, Hong; Dyckman, Alaric J.; Li, Tianle; Wityak, John; Gillooly, Kathleen M.; Pitt, Sidney; Shen, Ding Ren; Zhang, Rosemary F.; McIntyre, Kim W.; Salter-Cid, Luisa; Shuster, David J.; Zhang, Hongjian; Marathe, Punit H.; Doweyko, Arthur M.; Sack, John S.; Kiefer, Susan E.; Kish, Kevin F.; Newitt, John A.; McKinnon, Murray; Dodd, John H.; Barrish, Joel C.; Schieven, Gary L.; Leftheris, Katerina (BMS)

    2013-11-20

    The discovery and characterization of 7k (BMS-582949), a highly selective p38{alpha} MAP kinase inhibitor that is currently in phase II clinical trials for the treatment of rheumatoid arthritis, is described. A key to the discovery was the rational substitution of N-cyclopropyl for N-methoxy in 1a, a previously reported clinical candidate p38{alpha} inhibitor. Unlike alkyl and other cycloalkyls, the sp{sup 2} character of the cyclopropyl group can confer improved H-bonding characteristics to the directly substituted amide NH. Inhibitor 7k is slightly less active than 1a in the p38{alpha} enzymatic assay but displays a superior pharmacokinetic profile and, as such, was more effective in both the acute murine model of inflammation and pseudoestablished rat AA model. The binding mode of 7k with p38{alpha} was confirmed by X-ray crystallographic analysis.

  18. TOR-inhibitor insensitive-1 (TRIN1) regulates cotyledons greening in Arabidopsis.

    Science.gov (United States)

    Li, Linxuan; Song, Yun; Wang, Kai; Dong, Pan; Zhang, Xueyan; Li, Fuguang; Li, Zhengguo; Ren, Maozhi

    2015-01-01

    Target of Rapamycin (TOR) is an eukaryotic protein kinase and evolutionally conserved from the last eukaryotic common ancestor (LECA) to humans. The growing evidences have shown that TOR signaling acts as a central controller of cell growth and development. The downstream effectors of TOR have been well-identified in yeast and animals by using the immunosuppression agent rapamycin. However, less is known about TOR in plants. This is largely due to the fact that plants are insensitive to rapamycin. In this study, AZD8055 (AZD), the novel ATP-competitive inhibitor of TOR, was employed to decipher the downstream effectors of TOR in Arabidopsis. One AZD insensitive mutant, T O R - i nhibitor i n sensitive- 1 (trin1), was screened from 10,000 EMS-induced mutation seeds. The cotyledons of trin1 can turn green when its seeds were germinated on ½ MS medium supplemented with 2 μM AZD, whereas the cotyledons greening of wild-type (WT) can be completely blocked at this concentration. Through genetic mapping, TRIN1 was mapped onto the long arm of chromosome 2, between markers SGCSNP26 and MI277. Positional cloning revealed that TRIN1 was an allele of ABI4, which encoded an ABA-regulated AP2 domain transcription factor. Plants containing P35S::TRIN1 or P35S::TRIN1-GUS were hypersensitive to AZD treatment and displayed the opposite phenotype observed in trin1. Importantly, GUS signaling was significantly enhanced in P35S::TRIN1-GUS transgenic plants in response to AZD treatment, indicating that suppression of TOR resulted in the accumulation of TRIN1. These observations revealed that TOR controlled seed-to-seedling transition by negatively regulating the stability of TRIN1 in Arabidopsis. For the first time, TRIN1, the downstream effector of TOR signaling, was identified through a chemical genetics approach.

  19. The Role of Mitogen-Activated Protein (MAP Kinase Signaling Components in the Fungal Development, Stress Response and Virulence of the Fungal Cereal Pathogen Bipolaris sorokiniana.

    Directory of Open Access Journals (Sweden)

    Yueqiang Leng

    Full Text Available Mitogen-activated protein kinases (MAPKs have been demonstrated to be involved in fungal development, sexual reproduction, pathogenicity and/or virulence in many filamentous plant pathogenic fungi, but genes for MAPKs in the fungal cereal pathogen Bipolaris sorokiniana have not been characterized. In this study, orthologues of three MAPK genes (CsSLT2, CsHOG1 and CsFUS3 and one MAPK kinase kinase (MAPKKK gene (CsSTE11 were identified in the whole genome sequence of the B. sorokiniana isolate ND90Pr, and knockout mutants were generated for each of them. The ∆Csfus3 and ∆Csste11 mutants were defective in conidiation and formation of appressoria-like structures, showed hypersensitivity to oxidative stress and lost pathogenicity on non-wounded leaves of barley cv. Bowman. When inoculated on wounded leaves of Bowman, the ∆Csfus3 and ∆Csste11 mutants were reduced in virulence compared to the wild type. No morphological changes were observed in the ∆Cshog1 mutants in comparison with the wild type; however, they were slightly reduced in growth under oxidative stress and were hypersensitive to hyperosmotic stress. The ∆Cshog1 mutants formed normal appressoria-like structures but were reduced in virulence when inoculated on Bowman leaves. The ∆Csslt2 mutants produced more vegetative hyphae, had lighter pigmentation, were more sensitive to cell wall degrading enzymes, and were reduced in virulence on Bowman leaves, although they formed normal appressoria like the wild type. Root infection assays indicated that the ∆Cshog1 and ∆Csslt2 mutants were able to infect barley roots while the ∆Csfus3 and ∆Csste11 failed to cause any symptoms. However, no significant difference in virulence was observed for ∆Cshog1 mutants while ∆Csslt2 mutants showed significantly reduced virulence on barley roots in comparison with the wild type. Our results indicated that all of these MAPK and MAPKKK genes are involved in the regulation of fungal

  20. The Role of Mitogen-Activated Protein (MAP) Kinase Signaling Components in the Fungal Development, Stress Response and Virulence of the Fungal Cereal Pathogen Bipolaris sorokiniana.

    Science.gov (United States)

    Leng, Yueqiang; Zhong, Shaobin

    2015-01-01

    Mitogen-activated protein kinases (MAPKs) have been demonstrated to be involved in fungal development, sexual reproduction, pathogenicity and/or virulence in many filamentous plant pathogenic fungi, but genes for MAPKs in the fungal cereal pathogen Bipolaris sorokiniana have not been characterized. In this study, orthologues of three MAPK genes (CsSLT2, CsHOG1 and CsFUS3) and one MAPK kinase kinase (MAPKKK) gene (CsSTE11) were identified in the whole genome sequence of the B. sorokiniana isolate ND90Pr, and knockout mutants were generated for each of them. The ∆Csfus3 and ∆Csste11 mutants were defective in conidiation and formation of appressoria-like structures, showed hypersensitivity to oxidative stress and lost pathogenicity on non-wounded leaves of barley cv. Bowman. When inoculated on wounded leaves of Bowman, the ∆Csfus3 and ∆Csste11 mutants were reduced in virulence compared to the wild type. No morphological changes were observed in the ∆Cshog1 mutants in comparison with the wild type; however, they were slightly reduced in growth under oxidative stress and were hypersensitive to hyperosmotic stress. The ∆Cshog1 mutants formed normal appressoria-like structures but were reduced in virulence when inoculated on Bowman leaves. The ∆Csslt2 mutants produced more vegetative hyphae, had lighter pigmentation, were more sensitive to cell wall degrading enzymes, and were reduced in virulence on Bowman leaves, although they formed normal appressoria like the wild type. Root infection assays indicated that the ∆Cshog1 and ∆Csslt2 mutants were able to infect barley roots while the ∆Csfus3 and ∆Csste11 failed to cause any symptoms. However, no significant difference in virulence was observed for ∆Cshog1 mutants while ∆Csslt2 mutants showed significantly reduced virulence on barley roots in comparison with the wild type. Our results indicated that all of these MAPK and MAPKKK genes are involved in the regulation of fungal development under

  1. Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K

    2006-10-01

    Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent

  2. Differential regulation of iron chelator-induced IL-8 synthesis via MAP kinase and NF-κB in immortalized and malignant oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Lee Suk-Keun

    2007-09-01

    Full Text Available Abstract Background Interleukin-8 (IL-8 is a cytokine that plays an important role in tumor progression in a variety of cancer types; however, its regulation is not well understood in oral cancer cells. In the present study, we examined the expression and mechanism of IL-8 in which it is involved by treating immortalized (IHOK and malignant human oral keratinocytes (HN12 cells with deferoxamine (DFO. Methods IL-8 production was measured by an enzyme-linked immunoabsorbent assay and reverse transcriptase-polymerase chain reaction (RT-PCR analysis. Electrophoretic mobility shift assays was used to determine NF-κB binding activity. Phosphorylation and degradation of the I-κB were analyized by Western blot. Results IHOK cells incubated with DFO showed increased expression of IL-8 mRNA, as well as higher release of the IL-8 protein. The up-regulation of DFO-induced IL-8 expression was higher in IHOK cells than in HN12 cells and was concentration-dependent. DFO acted additively with IL-1β to strongly up-regulate IL-8 in IHOK cells but not in HN12 cells. Accordingly, selective p38 and ERK1/2 inhibitors for both kinases abolished DFO-induced IL-8 expression in both IHOK and HN12 cells. Furthermore, DFO induced the degradation and phosphorylation of IκB, and activation of NF-κB. The IL-8 inducing effects of DFO were mediated by a nitric oxide donor (S-nitrosoglutathione, and by pyrrolidine dithiocarbamate, an inhibitor of NF-κB, as well as by wortmannin, which inhibits the phosphatidylinositol 3-kinase-dependent activation of NAD(PH oxidase. Conclusion This results demonstrate that DFO-induced IL-8 acts via multiple signaling pathways in immortalized and malignant oral keratinocytes, and that the control of IL-8 may be an important target for immunotheraphy against human oral premalignant lesions.

  3. Isoquercitrin suppresses the expression of histamine and pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-κB in human KU812 cells

    Institute of Scientific and Technical Information of China (English)

    LI Li; ZHANG Xiao-Hui; LIU Guang-Rong; LIU Chang; DONG Yin-Mao

    2016-01-01

    Mast cells and basophils are multifunctional effector cells that contain abundant secretory granules in their cytoplasm.Both cell types are involved in a variety of inflammatory and immune events,producing an array of inflammatory mediators,such as cytokines.The aim of the study was to examine whether isoquercitrin modulates allergic and inflammatory reactions in the human basophilic KU812 cells and to elucidate its influence on the phosphorylation of mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB activation.The KU812 cells were stimulated with phorbol-12-myristate 13-acetate plus the calcium ionophore A23187 (PMACI).The inhibitory effects of isoquercitrin on the productions of histamine and pro-inflammatory cytokines in the stimulated KU812 cells were measured using cytokine-specific enzyme-linked immunosorbent (ELISA) assays.Western blotting analysis was used to assess the effects of isoquercitrin on the MAPKs and NF-κB protein levels.Our results indicated that the isoquercitrin treatment of PMACI-stimulated KU812 cells significantly reduced the production of histamine and the pro-inflammatory cytokines,such as interleukin (IL)-6,IL-8,IL-1β,and tumor necrosis factor (TNF)-α.The treated cells exhibited decreased phosphorylation of extracellular signal-regulated kinase (ERK),revealing the role of ERK MAPK in isoquercitrin-mediated allergy inhibition.Furthermore,isoquercitrin suppressed the PMACI-mediated activation of NF-κB in the human basophil cells.In conclusion,the results from the present study provide insights into the potential therapeutic use of isoquercitrin for the treatment of inflammatory and allergic reactions.

  4. Isoquercitrin suppresses the expression of histamine and pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-κB in human KU812 cells.

    Science.gov (United States)

    Li, Li; Zhang, Xiao-Hui; Liu, Guang-Rong; Liu, Chang; Dong, Yin-Mao

    2016-06-01

    Mast cells and basophils are multifunctional effector cells that contain abundant secretory granules in their cytoplasm. Both cell types are involved in a variety of inflammatory and immune events, producing an array of inflammatory mediators, such as cytokines. The aim of the study was to examine whether isoquercitrin modulates allergic and inflammatory reactions in the human basophilic KU812 cells and to elucidate its influence on the phosphorylation of mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB activation. The KU812 cells were stimulated with phorbol-12-myristate 13-acetate plus the calcium ionophore A23187 (PMACI). The inhibitory effects of isoquercitrin on the productions of histamine and pro-inflammatory cytokines in the stimulated KU812 cells were measured using cytokine-specific enzyme-linked immunosorbent (ELISA) assays. Western blotting analysis was used to assess the effects of isoquercitrin on the MAPKs and NF-κB protein levels. Our results indicated that the isoquercitrin treatment of PMACI-stimulated KU812 cells significantly reduced the production of histamine and the pro-inflammatory cytokines, such as interleukin (IL)-6, IL-8, IL-1β, and tumor necrosis factor (TNF)-α. The treated cells exhibited decreased phosphorylation of extracellular signal-regulated kinase (ERK), revealing the role of ERK MAPK in isoquercitrin-mediated allergy inhibition. Furthermore, isoquercitrin suppressed the PMACI-mediated activation of NF-κB in the human basophil cells. In conclusion, the results from the present study provide insights into the potential therapeutic use of isoquercitrin for the treatment of inflammatory and allergic reactions.

  5. Glycosylation of a Fasciclin-Like Arabinogalactan-Protein (SOS5) Mediates Root Growth and Seed Mucilage Adherence via a Cell Wall Receptor-Like Kinase (FEI1/FEI2) Pathway in Arabidopsis.

    Science.gov (United States)

    Basu, Debarati; Tian, Lu; Debrosse, Tayler; Poirier, Emily; Emch, Kirk; Herock, Hayley; Travers, Andrew; Showalter, Allan M

    2016-01-01

    Fundamental processes that underpin plant growth and development depend crucially on the action and assembly of the cell wall, a dynamic structure that changes in response to both developmental and environmental cues. While much is known about cell wall structure and biosynthesis, much less is known about the functions of the individual wall components, particularly with respect to their potential roles in cellular signaling. Loss-of-function mutants of two arabinogalactan-protein (AGP)-specific galactosyltransferases namely, GALT2 and GALT5, confer pleiotropic growth and development phenotypes indicating the important contributions of carbohydrate moieties towards AGP function. Notably, galt2galt5 double mutants displayed impaired root growth and root tip swelling in response to salt, likely as a result of decreased cellulose synthesis. These mutants phenocopy a salt-overly sensitive mutant called sos5, which lacks a fasciclin-like AGP (SOS5/FLA4) as well as a fei1fei2 double mutant, which lacks two cell wall-associated leucine-rich repeat receptor-like kinases. Additionally, galt2gal5 as well as sos5 and fei2 showed reduced seed mucilage adherence. Quintuple galt2galt5sos5fei1fei2 mutants were produced and provided evidence that these genes act in a single, linear genetic pathway. Further genetic and biochemical analysis of the quintuple mutant demonstrated involvement of these genes with the interplay between cellulose biosynthesis and two plant growth regulators, ethylene and ABA, in modulating root cell wall integrity.

  6. Casein kinases

    DEFF Research Database (Denmark)

    Issinger, O G

    1993-01-01

    subunits are highly conserved during evolution. The relationship between CK-2 alpha from humans and plants is still 73%. Similar relationships are reported for the beta-subunit. Chromosomal assignment of CK-2 alpha shows two gene loci, one of which is a pseudogene. They are located on different chromosomes......, no genetic changes are necessarily involved; the observed changes may be entirely due to a signal transduction pathway where CK-2 could be phosphorylated by another kinase(s). CK-2 cDNAs from various organisms have been isolated and characterized. From the deduced amino acid sequence it turns out that CK-2......-subunit affecting: (i) stability, (ii) enzyme specificity and (iii) enzyme activity. The question where CK-2 and its subunits are located throughout the cell cycle has also been addressed, mainly because of the large discrepancies that still exist between results obtained by different investigators. Tissue...

  7. Basic fibroblast growth factor induces matrix metalloproteinase-13 via ERK MAP kinase-altered phosphorylation and sumoylation of Elk-1 in human adult articular chondrocytes

    Directory of Open Access Journals (Sweden)

    Hee-Jeong Im

    2009-10-01

    Full Text Available Hee-Jeong Im,1–4 Andrew D Sharrocks,5 Xia Lin,6 Dongyao Yan,1 Jaesung Kim,1 Andre J van Wijnen,7 Robert A Hipskind81Departments of Biochemistry, 2Internal Medicine, 3Section of Rheumatology, Orthopedic Surgery, 4Rush University Medical Center, and Department of Bioengineering; University of Illinois at Chicago, IL USA; 5Faculty of Life Sciences, University of Manchester, Oxford Rd, Manchester, UK; 6Michael D DeBakey Department of Surgery, Baylor College of Medicine, Houston, Texas, USA; 7Department of Cell Biology, University of Massachusetts Medical School, Worcester, MA, USA; 8Institute De Genetique Moleculaire de Montpellier, FranceAbstract: Degradation of the extracellular matrix (ECM by matrix metalloproteinases (MMPs and release of basic fibroblast growth factor (bFGF are principal aspects of the pathology of osteoarthritis (OA. ECM disruption leads to bFGF release, which activates the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK pathway and its downstream target the Ets-like transcription factor Elk-1. Previously we demonstrated that the bFGF-ERK-Elk-1 signaling axis is responsible for the potent induction of MMP-13 in human primary articular chondrocytes. Here we report that, in addition to phosphorylation of Elk-1, dynamic posttranslational modification of Elk-1 by small ubiquitin-related modifier (SUMO serves as an important mechanism through which MMP-13 gene expression is regulated. We show that bFGF activates Elk-1 mainly through the ERK pathway and that increased phosphorylation of Elk-1 is accompanied by decreased conjugation of SUMO to Elk-1. Reporter gene assays reveal that phosphorylation renders Elk-1 competent for induction of MMP-13 gene transcription, while sumoylation has the opposite effect. Furthermore, we demonstrate that the SUMO-conjugase Ubc9 acts as a key mediator for Elk-1 sumoylation. Taken together, our results suggest that sumoylation antagonizes the phosphorylation

  8. Genome-wide identification and analysis of expression profiles of maize mitogen-activated protein kinase kinase kinase.

    Science.gov (United States)

    Kong, Xiangpei; Lv, Wei; Zhang, Dan; Jiang, Shanshan; Zhang, Shizhong; Li, Dequan

    2013-01-01

    Mitogen-activated protein kinase (MAPK) cascades are highly conserved signal transduction model in animals, yeast and plants. Plant MAPK cascades have been implicated in development and stress responses. Although MAPKKKs have been investigated in several plant species including Arabidopsis and rice, no systematic analysis has been conducted in maize. In this study, we performed a bioinformatics analysis of the entire maize genome and identified 74 MAPKKK genes. Phylogenetic analyses of MAPKKKs from maize, rice and Arabidopsis have classified them into three subgroups, which included Raf, ZIK and MEKK. Evolutionary relationships within subfamilies were also supported by exon-intron organizations and the conserved protein motifs. Further expression analysis of the MAPKKKs in microarray databases revealed that MAPKKKs were involved in important signaling pathways in maize different organs and developmental stages. Our genomics analysis of maize MAPKKK genes provides important information for evolutionary and functional characterization of this family in maize.

  9. Genome-wide identification and analysis of expression profiles of maize mitogen-activated protein kinase kinase kinase.

    Directory of Open Access Journals (Sweden)

    Xiangpei Kong

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are highly conserved signal transduction model in animals, yeast and plants. Plant MAPK cascades have been implicated in development and stress responses. Although MAPKKKs have been investigated in several plant species including Arabidopsis and rice, no systematic analysis has been conducted in maize. In this study, we performed a bioinformatics analysis of the entire maize genome and identified 74 MAPKKK genes. Phylogenetic analyses of MAPKKKs from maize, rice and Arabidopsis have classified them into three subgroups, which included Raf, ZIK and MEKK. Evolutionary relationships within subfamilies were also supported by exon-intron organizations and the conserved protein motifs. Further expression analysis of the MAPKKKs in microarray databases revealed that MAPKKKs were involved in important signaling pathways in maize different organs and developmental stages. Our genomics analysis of maize MAPKKK genes provides important information for evolutionary and functional characterization of this family in maize.

  10. Biochemical and pharmacological assessment of MAP-kinase signaling along pain pathways in experimental rodent models: a potential tool for the discovery of novel antinociceptive therapeutics.

    Science.gov (United States)

    Edelmayer, Rebecca M; Brederson, Jill-Desiree; Jarvis, Michael F; Bitner, Robert S

    2014-02-01

    Injury to the peripheral or central nervous system can induce changes within the nervous tissues that promote a state of sensitization that may underlie conditions of pathological chronic pain. A key biochemical event in the initiation and maintenance of peripheral and central neuronal sensitization associated with chronic pain is the phosphorylation and subsequent activation of mitogen-activated protein kinases (MAPKs) and immediate early gene transcription factors, in particular cAMP-response element binding protein (CREB). In this commentary we review the preclinical data that describe anatomical and mechanistic aspects of nociceptive-induced signaling along nociceptive pathways including peripheral cutaneous axons, the dorsal root ganglia, spinal cord dorsal horn and cerebral cortex. In addition to the regional manifestation of nociceptive signaling, investigations have attempted to elucidate the cellular origin of biochemical nociceptive processing in which communication, i.e. cross-talk between neurons and glia is viewed as an essential component of pathogenic pain development. Here, we outline a research strategy by which nociceptive-induced cellular signaling in experimental pain models, specifically MAPK and CREB phosphorylation can be utilized to provide mechanistic insight into drug-target interaction along the nociceptive pathways. We describe a series of studies using nociceptive inflammatory and neuropathic pain models to investigate the effects of known pain therapeutics on nociceptive-induced biochemical signaling and present this as a complementary research strategy for assessing antinociceptive activity useful in the preclinical development of novel pain therapeutics.

  11. Endothelin-1 induces proliferation of human lung fibroblasts and IL-11 secretion through an ET(A) receptor-dependent activation of MAP kinases.

    Science.gov (United States)

    Gallelli, Luca; Pelaia, Girolamo; D'Agostino, Bruno; Cuda, Giovanni; Vatrella, Alessandro; Fratto, Donatella; Gioffrè, Vincenza; Galderisi, Umberto; De Nardo, Marilisa; Mastruzzo, Claudio; Salinaro, Elisa Trovato; Maniscalco, Mauro; Sofia, Matteo; Crimi, Nunzio; Rossi, Francesco; Caputi, Mario; Costanzo, Francesco S; Maselli, Rosario; Marsico, Serafino A; Vancheri, Carlo

    2005-11-01

    Endothelin-1 (ET-1) is implicated in the fibrotic responses characterizing interstitial lung diseases, as well as in the airway remodeling process occurring in asthma. Within such a context, the aim of our study was to investigate, in primary cultures of normal human lung fibroblasts (NHLFs), the ET-1 receptor subtypes, and the intracellular signal transduction pathways involved in the proliferative effects of this peptide. Therefore, cells were exposed to ET-1 in the presence or absence of an overnight pre-treatment with either ET(A) or ET(B) selective receptor antagonists. After cell lysis, immunoblotting was performed using monoclonal antibodies against the phosphorylated, active forms of mitogen-activated protein kinases (MAPK). ET-1 induced a significant increase in MAPK phosphorylation pattern, and also stimulated fibroblast proliferation and IL-6/IL-11 release into cell culture supernatants. All these effects were inhibited by the selective ET(A) antagonist BQ-123, but not by the specific ET(B) antagonist BQ-788. The stimulatory influence of ET-1 on IL-11, but not on IL-6 secretion, was prevented by MAPK inhibitors. Therefore, such results suggest that in human lung fibroblasts ET-1 exerts a profibrogenic action via an ET(A) receptor-dependent, MAPK-mediated induction of IL-11 release and cell proliferation.

  12. Deoxycholic acid and selenium metabolite methylselenol exert common and distinct effects on cell cycle, apoptosis, and MAP kinase pathway in HCT116 human colon cancer cells.

    Science.gov (United States)

    Zeng, Huawei; Botnen, James H; Briske-Anderson, Mary

    2010-01-01

    The cell growth inhibition induced by bile acid deoxycholic acid (DCA) may cause compensatory hyperproliferation of colonic epithelial cells and consequently increase colon cancer risk. On the other hand, there is increasing evidence for the efficacy of certain forms of selenium (Se) as anticancer nutrients. Methylselenol has been hypothesized to be a critical Se metabolite for anticancer activity in vivo. In this study, we demonstrated that both DCA (75-300 micromol/l) and submicromolar methylselenol inhibited colon cancer cell proliferation by up to 64% and 63%, respectively. In addition, DCA and methylselenol each increased colon cancer cell apoptosis rate by up to twofold. Cell cycle analyses revealed that DCA induced an increase in only the G1 fraction with a concomitant drop in G2 and S-phase; in contrast, methylselenol led to an increase in the G1 and G2 fractions with a concomitant drop only in the S-phase. Although both DCA and methylselenol significantly promoted apoptosis and inhibited cell growth, examination of mitogen-activated protein kinase (MAPK) pathway activation showed that DCA, but not methylselenol, induced SAPK/JNK1/2, p38 MAPK, ERK1/2 activation. Thus, our data provide, for the first time, the molecular basis for opposite effects of methylselenol and DCA on colon tumorigenesis.

  13. Stress-induced activation of protein kinase CK2 by direct interaction with p38 mitogen-activated protein kinase

    DEFF Research Database (Denmark)

    Sayed, M; Kim, S O; Salh, B S

    2000-01-01

    in the human cervical carcinoma HeLa cells by up to 8-fold, and this could be blocked by the p38 MAP kinase inhibitor SB203580. We show that p38alpha MAP kinase, in a phosphorylation-dependent manner, can directly interact with the alpha and beta subunits of CK2 to activate the holoenzyme through what appears...

  14. In silico analysis reveals 75 members of mitogen-activated protein kinase kinase kinase gene family in rice.

    Science.gov (United States)

    Rao, Kudupudi Prabhakara; Richa, Tambi; Kumar, Kundan; Raghuram, Badmi; Sinha, Alok Krishna

    2010-06-01

    Mitogen-Activated Protein Kinase Kinase Kinases (MAPKKKs) are important components of MAPK cascades, which are universal signal transduction modules and play important role in plant growth and development. In the sequenced Arabidopsis genome 80 MAPKKKs were identified and currently being analysed for its role in different stress. In rice, economically important monocot cereal crop only five MAPKKKs were identified so far. In this study using computational analysis of sequenced rice genome we have identified 75 MAPKKKs. EST hits and full-length cDNA sequences (from KOME or Genbank database) of 75 MAPKKKs supported their existence. Phylogenetic analyses of MAPKKKs from rice and Arabidopsis have classified them into three subgroups, which include Raf, ZIK and MEKK. Conserved motifs in the deduced amino acid sequences of rice MAPKKKs strongly supported their identity as members of Raf, ZIK and MEKK subfamilies. Further expression analysis of the MAPKKKs in MPSS database revealed that their transcripts were differentially regulated in various stress and tissue-specific libraries.

  15. A versatile mass spectrometry-based method to both identify kinase client-relationships and characterize signaling network topology

    Science.gov (United States)

    While more than a thousand protein kinases (PK) have been identified in the Arabidopsis thaliana genome, relatively little progress has been made towards identifying their individual client proteins. Herein we describe use of a mass spectrometry-based in vitro phosphorylation strategy, termed Kinase...

  16. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  17. Mapping the sites of latency and reactivation by bovine herpesvirus 5 (BoHV-5 and a thymidine kinase-deleted BoHV-5 in lambs

    Directory of Open Access Journals (Sweden)

    Gustavo C. Cadore

    2013-12-01

    Full Text Available A thymidine kinase (tk-deleted bovine herpesvirus 5 (BoHV-5tkΔ was previously shown to establish latent infection and reactivate - even poorly - in a sheep model (Cadore et al. 2013. As TK-negative alphaherpesviruses are unlike to reactivate in neural tissue, this study investigated the sites of latency and reactivation by this recombinant in lambs. For this, groups of lambs were inoculated intranasally with the parental BoHV-5 strain (SV-507/99 or with the recombinant BoHV-5tkΔ. During latent infection (40 days post-inoculation, pi, the distribution of recombinant virus DNA in neural and non-neural tissues was similar to that of the parental virus. Parental and recombinant virus DNA was consistently detected by PCR in trigeminal ganglia (TGs; frequently in palatine and pharyngeal tonsils and, less frequently in the retropharyngeal lymph nodes. In addition, latent DNA of both viruses was detected in several areas of the brain. After dexamethasone (Dx administration (day 40pi, the recombinant virus was barely detected in nasal secretions contrasting with marked shedding of the parental virus. In tissues of lambs euthanized at day 3 post-Dx treatment (pDx, reverse-transcription-PCR (RT-PCR for a late viral mRNA (glycoprotein D gene demonstrated reactivation of parental virus in neural (TGs and lymphoid tissues (tonsils, lymph node. In contrast, recombinant virus mRNA was detected only in lymphoid tissues. These results demonstrate that BoHV-5 and the recombinant BoHV-5tkΔ do establish latent infection in neural and non-neural sites. Reactivation of the recombinant BoHV-5tkΔ, however, appeared to occur only in non-neural sites. In anyway, the ability of a tk-deleted strain to reactivate latent infection deserves attention in the context of vaccine safety.

  18. Different muscarinic receptor subtypes modulate proliferation of primary human detrusor smooth muscle cells via Akt/PI3K and map kinases.

    Science.gov (United States)

    Arrighi, Nicola; Bodei, Serena; Zani, Danilo; Michel, Martin C; Simeone, Claudio; Cosciani Cunico, Sergio; Spano, Pierfranco; Sigala, Sandra

    2013-08-01

    While acetylcholine (ACh) and muscarinic receptors in the bladder are mainly known for their role in the regulation of smooth muscle contractility, in other tissues they are involved in tissue remodelling and promote cell growth and proliferation. In the present study we have used primary cultures of human detrusor smooth muscle cells (HDSMCs), in order to investigate the role of muscarinic receptors in HDSMC proliferation. Samples were obtained as discarded tissue from men >65 years undergoing radical cystectomy for bladder cancer and cut in pieces that were either immediately frozen or placed in culture medium for the cell culture establishment. HDSMCs were isolated from samples, propagated and maintained in culture. [(3)H]-QNB radioligand binding on biopsies revealed the presence of muscarinic receptors, with a Kd of 0.10±0.02nM and a Bmax of 72.8±0.1fmol/mg protein. The relative expression of muscarinic receptor subtypes, based on Q-RT-PCR, was similar in biopsies and HDSMC with a rank order of M2≥M3>M1>M4>M5. The cholinergic agonist carbachol (CCh, 1-100μM) concentration-dependently increased [(3)H]-thymidine incorporation (up to 46±4%). This was concentration-dependently inhibited by the general muscarinic receptor antagonist atropine and by subtype-preferring antagonists with an order of potency of darifenacin >4-DAMP>AF-DX 116. The CCh-induced cell proliferation was blocked by selective PI-3 kinase and ERK activation inhibitors, strongly suggesting that these intracellular pathways mediate, at least in part, the muscarinic receptor-mediated cell proliferation. This work shows that M2 and M3 receptors can mediate not only HDSM contraction but also proliferation; they may also contribute bladder remodelling including detrusor hypertrophy.

  19. Effects of TGF-beta and glucocorticoids on map kinase phosphorylation, IL-6/IL-11 secretion and cell proliferation in primary cultures of human lung fibroblasts.

    Science.gov (United States)

    Pelaia, Girolamo; Gallelli, Luca; D'Agostino, Bruno; Vatrella, Alessandro; Cuda, Giovanni; Fratto, Donatella; Renda, Teresa; Galderisi, Umberto; Piegari, Elena; Crimi, Nunzio; Rossi, Francesco; Caputi, Mario; Costanzo, Francesco S; Vancheri, Carlo; Maselli, Rosario; Marsico, Serafino A

    2007-02-01

    Transforming growth factor-beta1 (TGF-beta1) is crucially involved in the fibrotic events characterizing interstitial lung diseases (ILDs), as well as in the airway remodeling process typical of asthma. Within such a context, the aim of our study was to investigate, in primary cultures of normal and fibrotic human lung fibroblasts (HLFs), the effects of TGF-beta1 on mitogen-activated protein kinase (MAPK) phosphorylation, cell proliferation, and production of interleukins 6 (IL-6) and 11 (IL-11), in the presence or absence of a pretreatment with budesonide (BUD). MAPK phosphorylation was detected by Western blotting, cell viability and proliferation were evaluated using Trypan blue staining and [(3)H]-thymidine incorporation assay, respectively, and the release of IL-6 and IL-11 into cell culture supernatants was assessed by ELISA. TGF-beta1 (10 ng/ml) significantly stimulated MAPK phosphorylation (P < 0.01), and also enhanced cell proliferation as well as the secretion of both IL-6 and IL-11, which reached the highest increases at the 72nd h of cell exposure to this growth factor. All such effects were prevented by BUD (10(-8) M) and, with the exception of IL-6 release, also by a mixture of MAPK inhibitors. Therefore, our findings suggest that the fibrotic action exerted by TGF-beta1 in the lung is mediated at least in part by MAPK activation and by an increased synthesis of the profibrogenic cytokines IL-6 and IL-11; all these effects appear to be prevented by corticosteroids via inhibition of MAPK phosphorylation.

  20. Central SDF-1/CXCL12 expression and its cardiovascular and sympathetic effects: the role of angiotensin II, TNF-α, and MAP kinase signaling.

    Science.gov (United States)

    Wei, Shun-Guang; Zhang, Zhi-Hua; Yu, Yang; Felder, Robert B

    2014-12-01

    The chemokine stromal cell-derived factor-1 (SDF-1/CXCL12) and its receptors are expressed by neurons and glial cells in cardiovascular autonomic regions of the brain, including the hypothalamic paraventricular nucleus (PVN), and contribute to neurohumoral excitation in rats with ischemia-induced heart failure. The present study examined factors regulating the expression of SDF-1 in the PVN and mechanisms mediating its sympatho-excitatory effects. In urethane anesthetized rats, a 4-h intracerebroventricular (ICV) infusion of angiotensin II (ANG II) or tumor necrosis factor-α (TNF-α) in doses that increase mean blood pressure (MBP) and sympathetic drive increased the expression of SDF-1 in PVN. ICV administration of SDF-1 increased the phosphorylation of p44/42 mitogen-activated protein kinase (MAPK), JNK, and p38 MAPK in PVN, along with MBP, heart rate (HR), and renal sympathetic nerve activity (RSNA), but did not affect total p44/42 MAPK, JNK, and p38 MAPK levels. ICV pretreatment with the selective p44/42 MAPK inhibitor PD98059 prevented the SDF-1-induced increases in MBP, HR, and RSNA; ICV pretreatment with the selective JNK and p38 MAPK inhibitors attenuated but did not block these SDF-1-induced excitatory responses. ICV PD98059 also prevented the sympatho-excitatory response to bilateral PVN microinjections of SDF-1. ICV pretreatment with SDF-1 short-hairpin RNA significantly reduced ANG II- and TNF-α-induced phosphorylation of p44/42 MAPK in PVN. These findings identify TNF-α and ANG II as drivers of SDF-1 expression in PVN and suggest that the full expression of their cardiovascular and sympathetic effects depends upon SDF-1-mediated activation of p44/42 MAPK signaling.

  1. Expression of Pseudomonas syringae type III effectors in yeast under stress conditions reveals that HopX1 attenuates activation of the high osmolarity glycerol MAP kinase pathway.

    Science.gov (United States)

    Salomon, Dor; Bosis, Eran; Dar, Daniel; Nachman, Iftach; Sessa, Guido

    2012-11-01

    The Gram-negative bacterium Pseudomonas syringae pv. tomato (Pst) is the causal agent of speck disease in tomato. Pst pathogenicity depends on a type III secretion system that delivers effector proteins into host cells, where they promote disease by manipulating processes to the advantage of the pathogen. Previous studies identified seven Pst effectors that inhibit growth when expressed in yeast under normal growth conditions, suggesting that they interfere with cellular processes conserved in yeast and plants. We hypothesized that effectors also target conserved cellular processes that are required for yeast growth only under stress conditions. We therefore examined phenotypes induced by expression of Pst effectors in yeast grown in the presence of various stressors. Out of 29 effectors tested, five (HopX1, HopG1, HopT1-1, HopH1 and AvrPtoB) displayed growth inhibition phenotypes only in combination with stress conditions. Viability assays revealed that the HopX1 effector caused loss of cell viability under prolonged osmotic stress. Using transcription reporters, we found that HopX1 attenuated the activation of the high osmolarity glycerol (HOG) mitogen-activated protein kinase (MAPK) pathway, which is responsible for yeast survival under osmotic stress, while other MAPK pathways were mildly affected by HopX1. Interestingly, HopX1-mediated phenotypes in yeast were dependent on the putative transglutaminase catalytic triad of the effector. This study enlarges the pool of phenotypes available for the functional analysis of Pst type III effectors in yeast, and exemplifies how analysis of phenotypes detected in yeast under stress conditions can lead to the identification of eukaryotic cellular processes affected by bacterial effectors.

  2. Mangiferin, a natural xanthone, protects murine liver in Pb(II induced hepatic damage and cell death via MAP kinase, NF-κB and mitochondria dependent pathways.

    Directory of Open Access Journals (Sweden)

    Pabitra Bikash Pal

    Full Text Available One of the most well-known naturally occurring environmental heavy metals, lead (Pb has been reported to cause liver injury and cellular apoptosis by disturbing the prooxidant-antioxidant balance via oxidative stress. Several studies, on the other hand, reported that mangiferin, a naturally occurring xanthone, has been used for a broad range of therapeutic purposes. In the present study, we, therefore, investigated the molecular mechanisms of the protective action of mangiferin against lead-induced hepatic pathophysiology. Lead [Pb(II] in the form of Pb(NO32 (at a dose of 5 mg/kg body weight, 6 days, orally induced oxidative stress, hepatic dysfunction and cell death in murine liver. Post treatment of mangiferin at a dose of 100 mg/kg body weight (6 days, orally, on the other hand, diminished the formation of reactive oxygen species (ROS and reduced the levels of serum marker enzymes [alanine aminotranferase (ALT and alkaline phosphatase (ALP]. Mangiferin also reduced Pb(II induced alterations in antioxidant machineries, restored the mitochondrial membrane potential as well as mutual regulation of Bcl-2/Bax. Furthermore, mangiferin inhibited Pb(II-induced activation of mitogen-activated protein kinases (MAPKs (phospho-ERK 1/2, phosphor-JNK phospho- p38, nuclear translocation of NF-κB and apoptotic cell death as was evidenced by DNA fragmentation, FACS analysis and histological assessment. In vitro studies using hepatocytes as the working model also showed the protective effect of mangiferin in Pb(II induced cytotoxicity. All these beneficial effects of mangiferin contributes to the considerable reduction of apoptotic hepatic cell death induced by Pb(II. Overall results demonstrate that mangiferin exhibit both antioxidative and antiapoptotic properties and protects the organ in Pb(II induced hepatic dysfunction.

  3. Mangiferin, a Natural Xanthone, Protects Murine Liver in Pb(II) Induced Hepatic Damage and Cell Death via MAP Kinase, NF-κB and Mitochondria Dependent Pathways

    Science.gov (United States)

    Pal, Pabitra Bikash; Sinha, Krishnendu; Sil, Parames C.

    2013-01-01

    One of the most well-known naturally occurring environmental heavy metals, lead (Pb) has been reported to cause liver injury and cellular apoptosis by disturbing the prooxidant-antioxidant balance via oxidative stress. Several studies, on the other hand, reported that mangiferin, a naturally occurring xanthone, has been used for a broad range of therapeutic purposes. In the present study, we, therefore, investigated the molecular mechanisms of the protective action of mangiferin against lead-induced hepatic pathophysiology. Lead [Pb(II)] in the form of Pb(NO3)2 (at a dose of 5 mg/kg body weight, 6 days, orally) induced oxidative stress, hepatic dysfunction and cell death in murine liver. Post treatment of mangiferin at a dose of 100 mg/kg body weight (6 days, orally), on the other hand, diminished the formation of reactive oxygen species (ROS) and reduced the levels of serum marker enzymes [alanine aminotranferase (ALT) and alkaline phosphatase (ALP)]. Mangiferin also reduced Pb(II) induced alterations in antioxidant machineries, restored the mitochondrial membrane potential as well as mutual regulation of Bcl-2/Bax. Furthermore, mangiferin inhibited Pb(II)-induced activation of mitogen-activated protein kinases (MAPKs) (phospho-ERK 1/2, phosphor-JNK phospho- p38), nuclear translocation of NF-κB and apoptotic cell death as was evidenced by DNA fragmentation, FACS analysis and histological assessment. In vitro studies using hepatocytes as the working model also showed the protective effect of mangiferin in Pb(II) induced cytotoxicity. All these beneficial effects of mangiferin contributes to the considerable reduction of apoptotic hepatic cell death induced by Pb(II). Overall results demonstrate that mangiferin exhibit both antioxidative and antiapoptotic properties and protects the organ in Pb(II) induced hepatic dysfunction. PMID:23451106

  4. Human p38{delta} MAP kinase mediates UV irradiation induced up-regulation of the gene expression of chemokine BRAK/CXCL14

    Energy Technology Data Exchange (ETDEWEB)

    Ozawa, Shigeyuki [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan); Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580 (Japan); Ito, Shin; Kato, Yasumasa [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan); Kubota, Eiro [Department of Biochemistry and Molecular Biology (Japan); Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580 (Japan); Hata, Ryu-Ichiro, E-mail: ryuhata@gmail.com [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan)

    2010-06-11

    The mitogen-activated protein kinase (MAPK) family comprises ERK, JNK, p38 and ERK5 (big-MAPK, BMK1). UV irradiation of squamous cell carcinoma cells induced up-regulation of gene expression of chemokine BRAK/CXCL14, stimulated p38 phosphorylation, and down-regulated the phosphorylation of ERK. Human p38 MAPKs exist in 4 isoforms: p38{alpha}, {beta}, {gamma} and {delta}. The UV stimulation of p38 phosphorylation was not inhibited by the presence of SB203580 or PD169316, inhibitors of p38{alpha} and {beta}, suggesting p38 phosphorylation was not dependent on these 2 isoforms and that p38{gamma} and/or {delta} was responsible for the phosphorylation. In fact, inhibition of each of these 4 p38 isoforms by the introduction of short hairpin (sh) RNAs for respective isoforms revealed that only shRNA for p38{delta} attenuated the UV-induced up-regulation of BRAK/CXCL14 gene expression. In addition, over-expression of p38 isoforms in the cells showed the association of p38{delta} with ERK1 and 2, concomitant with down-regulation of ERK phosphorylation. The usage of p38{delta} isoform by UV irradiation is not merely due to the abundance of this p38 isoform in the cells. Because serum deprivation of the cells also induced an increase in BRAK/CXCL14 gene expression, and in this case p38{alpha} and/or {beta} isoform is responsible for up-regulation of BRAK/CXCL14 gene expression. Taken together, the data indicate that the respective stress-dependent action of p38 isoforms is responsible for the up-regulation of the gene expression of the chemokine BRAK/CXCL14.

  5. Role of the HaHOG1 MAP kinase in response of the conifer root and butt rot pathogen (heterobasidion annosum to osmotic and oxidative stress [corrected].

    Directory of Open Access Journals (Sweden)

    Tommaso Raffaello

    Full Text Available The basidiomycete Heterobasidion annosum (Fr. Bref. s.l. is a filamentous white rot fungus, considered to be the most economically important pathogen of conifer trees. Despite the severity of the tree infection, very little is known about the molecular and biochemical aspects related to adaptation to abiotic stresses. In this study, the osmotic and oxidative tolerance as well as the role of the HaHOG1 Mitogen Activated Protein Kinase (MAPK gene were investigated. The transcript levels of the yeast orthologues GPD1, HSP78, STL1, GRE2 and the ATPase pumps ENA1, PMR1, PMC1 known to have an important role in osmotolerance were also quantified under salt osmotic conditions. The HaHOG1 gene was used for a heterologous expression and functional study in the Saccharomyces cerevisiae Δhog1 strain. Moreover, the phosphorylation level of HaHog1p was studied under salt osmotic and oxidative stress. The result showed that H. annosum displayed a decreased growth when exposed to an increased concentration of osmotic and oxidative stressors. GPD1, HSP78, STL1 and GRE2 showed an induction already at 10 min after exposure to salt stress. Among the ATPase pumps studied, PMC1 was highly induced when the fungus was exposed to 0.2 M CaCl₂ for 60 min. The heterologous expression of the HaHOG1 sequence in yeast confirmed that the gene is able to restore the osmotolerance and oxidative tolerance in the S. cerevisiae hog1Δ mutant strain. The HaHog1p was strongly phosphorylated in the presence of NaCl, KCl, H₂O₂ but not in the presence of CaCl₂ and MgCl₂. The GFP-HaHog1p fusion protein accumulated in the nuclei of the S. cerevisiae hog1Δ cells when exposed to high osmotic conditions but not under oxidative stress. These results provide the first insights about the response of H. annosum to osmotic and oxidative stress and elucidate the role of the HaHOG1 gene in such conditions.

  6. Multi-walled carbon nanotubes induce COX-2 and iNOS expression via MAP Kinase-dependent and -independent mechanisms in mouse RAW264.7 macrophages

    Directory of Open Access Journals (Sweden)

    Lee Jong

    2012-05-01

    Full Text Available Abstract Background Carbon nanotubes (CNTs are engineered graphene cylinders with numerous applications in engineering, electronics and medicine. However, CNTs cause inflammation and fibrosis in the rodent lung, suggesting a potential human health risk. We hypothesized that multi-walled CNTs (MWCNTs induce two key inflammatory enzymes in macrophages, cyclooxygenase-2 (COX-2 and inducible nitric oxide synthase (iNOS, through activation of extracellular signal-regulated kinases (ERK1,2. Methods RAW264.7 macrophages were exposed to MWCNTs or carbon black nanoparticles (CBNPs over a range of doses and time course. Uptake and subcellular localization of MWCNTs was visualized by transmission electron microscopy (TEM. Protein levels of COX-2, iNOS, and ERK1,2 (total ERK and phosphorylated ERK were measured by Western blot analysis. Prostaglandin-E2 (PGE2 and nitric oxide (NO levels in cell supernatants were measured by ELISA and Greiss assay, respectively. Results MWCNTs, but not CBNPs, induced COX-2 and iNOS in a time- and dose-dependent manner. COX-2 and iNOS induction by MWCNTs correlated with increased PGE2 and NO production, respectively. MWCNTs caused ERK1,2 activation and inhibition of ERK1,2 (U0126 blocked MWCNT induction of COX-2 and PGE2 production, but did not reduce the induction of iNOS. Inhibition of iNOS (L-NAME did not affect ERK1,2 activation, nor did L-NAME significantly decrease COX-2 induction by MWCNT. Nickel nanoparticles (NiNPs, which are present in MWCNTs as a residual catalyst, also induced COX-2 via ERK-1,2. However, a comparison of COX-2 induction by MWCNTs containing 4.5 and 1.8% Ni did not show a significant difference in ability to induce COX-2, indicating that characteristics of MWCNTs in addition to Ni content contribute to COX-2 induction. Conclusion This study identifies COX-2 and subsequent PGE2 production, along with iNOS induction and NO production, as inflammatory mediators involved in the macrophage response to

  7. Skepinone-L, a Novel Potent and Highly Selective Inhibitor of p38 MAP Kinase, Effectively Impairs Platelet Activation and Thrombus Formation

    Directory of Open Access Journals (Sweden)

    Oliver Borst

    2013-06-01

    Full Text Available Background/Aims: Platelets are critically important for primary haemostasis and the major players in thrombotic vascular occlusion. Platelets are activated by agonists, such as thrombin and collagen-related peptide as well as second-wave mediators including thromboxane A2 via different intracellular signaling pathways resulting in degranulation, aggregation and thrombus formation. Platelet activation is paralleled by phosphorylation and activation of p38 MAPK. The limited specificity of hitherto known p38 MAPK inhibitors precluded safe conclusions on the precise role of p38 MAPK in the regulation of platelet function. The present study examined the impact of Skepinone-L, a novel and highly selective inhibitor of p38 mitogen-activated protein kinase (p38 MAPK, on platelet activation and thrombus formation. Methods: Experiments were performed in freshly isolated human platelets. Protein phosphorylation was quantified by Western blotting, thromboxane B2 synthesis by enzyme immunoassay, ATP release by ChronoLume luciferin assay, cytosolic Ca2+ concentration by Fura-2 fluorescence-measurements, platelet aggregation by a light transmissions measurement and in vitro thrombus formation by a flow chamber. Results: Skepinone-L (1 μM virtually abrogated the phosphorylation of platelet p38 MAPK substrate Hsp27 following stimulation with CRP (1 μg/ml, thrombin (5 mU/ml or thromboxane A2 analogue U-46619 (1 μM. Furthermore, Skepinone-L significantly blunted activation-dependent platelet secretion and aggregation following threshold concentrations of CRP, thrombin and thromboxane A2 analogue U-46619. Skepinone-L did not impair platelet Ca2+ signaling but prevented agonist-induced thromboxane A2 synthesis through abrogation of p38 MAPK-dependent phosphorylation of platelet cytosolic phospholipase A2 (cPLA2. Skepinone-L further markedly blunted thrombus formation under low (500-s and high (1700-s arterial shear rates. Conclusions: The present study discloses

  8. Reference: 517 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available d isolated aleurone layers of Arabidopsis (Arabidopsis thaliana) were used in experiments designed to iden...tify components of the Arabidopsis seed that contribute to seed dormancy and to lea

  9. G-Protein Inwardly Rectifying Potassium Channel 1 (GIRK1 Knockdown Decreases Beta-Adrenergic, MAP Kinase and Akt Signaling in the MDA-MB-453 Breast Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Michael W. Hance

    2008-01-01

    Full Text Available Previous data from our laboratory have indicated that there is a functional link between the beta-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in breast cancer cell lines and that these pathways are involved in growth regulation of these cells. To determine functionality, MDA-MB-453 breast cancer cells were stimulated with ethanol, known to open GIRK channels. Decreased GIRK1 protein levels were seen after treatment with 0.12% ethanol. In addition, serum-free media completely inhibited GIRK1 protein expression. This data indicates that there are functional GIRK channels in breast cancer cells and that these channels are involved in cellular signaling. In the present research, to further define the signaling pathways involved, we performed RNA interference (siRNA studies. Three stealth siRNA constructs were made starting at bases 1104, 1315, and 1490 of the GIRK1 sequence. These constructs were transfected into MDA-MB-453 cells, and both RNA and protein were isolated. GIRK1, β2-adrenergic and 18S control levels were determined using real-time PCR 24 hours after transfection. All three constructs decreased GIRK1 mRNA levels. However, β2 mRNA levels were unchanged by the GIRK1 knockdown. GIRK1 protein levels were also reduced by the knockdown, and this knockdown led to decreases in beta-adrenergic, MAP kinase and Akt signaling.

  10. Rac-1 and Raf-1 kinases, components of distinct signaling pathways, activate myotonic dystrophy protein kinase

    Science.gov (United States)

    Shimizu, M.; Wang, W.; Walch, E. T.; Dunne, P. W.; Epstein, H. F.

    2000-01-01

    Myotonic dystrophy protein kinase (DMPK) is a serine-threonine protein kinase encoded by the myotonic dystrophy (DM) locus on human chromosome 19q13.3. It is a close relative of other kinases that interact with members of the Rho family of small GTPases. We show here that the actin cytoskeleton-linked GTPase Rac-1 binds to DMPK, and coexpression of Rac-1 and DMPK activates its transphosphorylation activity in a GTP-sensitive manner. DMPK can also bind Raf-1 kinase, the Ras-activated molecule of the MAP kinase pathway. Purified Raf-1 kinase phosphorylates and activates DMPK. The interaction of DMPK with these distinct signals suggests that it may play a role as a nexus for cross-talk between their respective pathways and may partially explain the remarkable pleiotropy of DM.

  11. PERK–KIPK–KCBP signalling negatively regulates root growth in Arabidopsis thaliana

    Science.gov (United States)

    Humphrey, Tania V.; Haasen, Katrina E.; Aldea-Brydges, May Grace; Sun, He; Zayed, Yara; Indriolo, Emily; Goring, Daphne R.

    2015-01-01

    The Arabidopsis proline-rich, extensin-like receptor-like kinases (PERKs) are a small group of receptor-like kinases that are thought to act as sensors at the cell wall through their predicted proline-rich extracellular domains. In this study, we focused on the characterization of a subclade of three Arabidopsis predicted PERK genes, PERK8, -9, and -10, for which no functions were known. Yeast two-hybrid interaction studies were conducted with the PERK8,- 9, and -10 cytosolic kinase domains, and two members of the Arabidopsis AGC VIII kinase family were identified as interacting proteins: AGC1-9 and the closely related kinesin-like calmodulin-binding protein (KCBP)-interacting protein kinase (KIPK). As KIPK has been identified previously as an interactor of KCBP, these interactions were also examined further and confirmed in this study. Finally, T-DNA mutants for each gene were screened for altered phenotypes under different conditions, and from these screens, a role for the PERK, KIPK, and KCBP genes in negatively regulating root growth was uncovered. PMID:25262228

  12. Arabidopsis MAPKKK18 positively regulates drought stress resistance via downstream MAPKK3.

    Science.gov (United States)

    Li, Yuanyuan; Cai, Huixian; Liu, Pu; Wang, Chunyan; Gao, Huiyang; Wu, Changai; Yan, Kang; Zhang, Shizhong; Huang, Jinguang; Zheng, Chengchao

    2017-03-04

    Mitogen-activated protein kinase (MAPK) cascades are conserved and vital signaling components in the responses to various ambient stresses. Here, we report the identification of MAPKKK18, a drought resistance associated MAPK kinase kinase in Arabidopsis. The mapkkk18 knockout mutants displayed hypersensitivity to drought stress, whereas overaccumulation of MAPKKK18 in transgenic Arabidopsis plants significantly enhanced the resistance to drought. Expression pattern analysis revealed that the inducible expression of MAPKKK18 by osmotic stress was ABA and the canonical ABA signaling pathway dependent. Furthermore, MAPKKK18 mainly exerted its regulatory roles via downstream MAPKK3. These findings uncovered important roles for MAPKKK18 in drought resistance and expanded our understanding of the MAPK pathways in modulating abiotic stress responses.

  13. Plant and animal pathogen recognition receptors signal through non-RD kinases.

    Directory of Open Access Journals (Sweden)

    Christopher Dardick

    2006-01-01

    Full Text Available Plants and animals mediate early steps of the innate immune response through pathogen recognition receptors (PRRs. PRRs commonly associate with or contain members of a monophyletic group of kinases called the interleukin-1 receptor-associated kinase (IRAK family that include Drosophila Pelle, human IRAKs, rice XA21 and Arabidopsis FLS2. In mammals, PRRs can also associate with members of the receptor-interacting protein (RIP kinase family, distant relatives to the IRAK family. Some IRAK and RIP family kinases fall into a small functional class of kinases termed non-RD, many of which do not autophosphorylate the activation loop. We surveyed the yeast, fly, worm, human, Arabidopsis, and rice kinomes (3,723 kinases and found that despite the small number of non-RD kinases in these genomes (9%-29%, 12 of 15 kinases known or predicted to function in PRR signaling fall into the non-RD class. These data indicate that kinases associated with PRRs can largely be predicted by the lack of a single conserved residue and reveal new potential plant PRR subfamilies.

  14. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  15. Cytokine-induced activation of Mixed Lineage Kinase 3 requires TRAF2 and TRAF6

    OpenAIRE

    Korchnak, Amanda C.; Zhan, Yu; Aguilar, Michael T.; Chadee, Deborah N.

    2009-01-01

    Mixed Lineage Kinase 3 (MLK3) is a mitogen-activated protein kinase kinase kinase (MAP3K) that activates multiple mitogen activated protein kinase (MAPK) pathways in response to growth factors, stresses and the pro-inflammatory cytokine, tumor necrosis factor (TNF). MLK3 is required for optimal activation of stress activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) signaling by TNF, however, the mechanism by which MLK3 is recruited and activated by the TNF receptor remains poorly und...

  16. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  17. The Crystal Structure of Cancer Osaka Thyroid Kinase Reveals an Unexpected Kinase Domain Fold*

    Science.gov (United States)

    Gutmann, Sascha; Hinniger, Alexandra; Fendrich, Gabriele; Drückes, Peter; Antz, Sylvie; Mattes, Henri; Möbitz, Henrik; Ofner, Silvio; Schmiedeberg, Niko; Stojanovic, Aleksandar; Rieffel, Sebastien; Strauss, André; Troxler, Thomas; Glatthar, Ralf; Sparrer, Helmut

    2015-01-01

    Macrophages are important cellular effectors in innate immune responses and play a major role in autoimmune diseases such as rheumatoid arthritis. Cancer Osaka thyroid (COT) kinase, also known as mitogen-activated protein kinase kinase kinase 8 (MAP3K8) and tumor progression locus 2 (Tpl-2), is a serine-threonine (ST) kinase and is a key regulator in the production of pro-inflammatory cytokines in macrophages. Due to its pivotal role in immune biology, COT kinase has been identified as an attractive target for pharmaceutical research that is directed at the discovery of orally available, selective, and potent inhibitors for the treatment of autoimmune disorders and cancer. The production of monomeric, recombinant COT kinase has proven to be very difficult, and issues with solubility and stability of the enzyme have hampered the discovery and optimization of potent and selective inhibitors. We developed a protocol for the production of recombinant human COT kinase that yields pure and highly active enzyme in sufficient yields for biochemical and structural studies. The quality of the enzyme allowed us to establish a robust in vitro phosphorylation assay for the efficient biochemical characterization of COT kinase inhibitors and to determine the x-ray co-crystal structures of the COT kinase domain in complex with two ATP-binding site inhibitors. The structures presented in this study reveal two distinct ligand binding modes and a unique kinase domain architecture that has not been observed previously. The structurally versatile active site significantly impacts the design of potent, low molecular weight COT kinase inhibitors. PMID:25918157

  18. The Arabidopsis SERK1 protein interacts with the AAA-ATPase AtCDC48, the 14-3-3 protein GF14lambda and the PP2C phosphatase KAPP

    NARCIS (Netherlands)

    Rienties, I.M.; Vink, J.; Borst, J.W.; Russinova, E.T.; Vries, de S.C.

    2005-01-01

    Leucine-rich repeat (LRR)-containing transmembrane receptor-like kinases (RLKs) are important components of plant signal transduction. The Arabidopsis thaliana somatic embryogenesis receptor-like kinase 1 (AtSERK1) is an LRR-RLK proposed to participate in a signal transduction cascade involved in em

  19. Expression of a gibberellin-induced leucine-rich repeat receptor-like protein kinase in deepwater rice and its interaction with kinase-associated protein phosphatase

    Energy Technology Data Exchange (ETDEWEB)

    Knaap, E. van der; Sauter, M.; Kende, H. (Michigan State Univ., East Lansing, MI (United States). DOE Plant Research Lab.); Song, W.Y.; Ruan, D.L.; Ronald, P.C. (Univ. of California, Davis, CA (United States). Dept. of Plant Pathology)

    1999-06-01

    The authors identified in deepwater rice (Oryza sativa L.) a gene encoding a leucine-rich repeat receptor-like transmembrane protein kinase, OsTMK (O. sativa transmembrane kinase). The transcript levels of OsTMK increased in the rice internode in response to gibberellin. Expression of OsTMK was especially high in regions undergoing cell division and elongation. The kinase domain of OsTMK was enzymatically active autophosphorylating on serine and threonine residues. A cDNA encoding a rice ortholog of a kinase-associated type 2C protein phosphatase (OsKAPP) was cloned. KAPPs are putative downstream components in kinase-mediated signal transduction pathways. The kinase interaction domain of OsKAPP was phosphorylated in vitro by the kinase domain of OsTMK. RNA gel-blot analysis indicated that the expression of OsTMK and OsKAPP was similar in different tissues of the rice plant. In protein-binding assays, OsKAPP interacted with a receptor-like protein kinase, RLK5 of Arabidopsis, but not with the protein kinase domains of the rice and maize receptor-like protein kinases Xa21 and ZmPK1, respectively.

  20. The quantitative basis of the Arabidopsis innate immune system to endemic pathogens depends on pathogen genetics

    DEFF Research Database (Denmark)

    Corwin, Jason A; Copeland, Daniel; Feusier, Julie

    2016-01-01

    the Arabidopsis-Botrytis pathosystem to explore the quantitative genetic architecture underlying host innate immune system in a population of Arabidopsis thaliana. By infecting a diverse panel of Arabidopsis accessions with four phenotypically and genotypically distinct isolates of the fungal necrotroph B...... of pathogen genetic variation in analyzing host quantitative resistance. While known resistance genes, such as receptor-like kinases (RLKs) and nucleotide-binding site leucine-rich repeat proteins (NLRs), were found to be enriched among associated genes, they only account for a small fraction of the total......, including defense hormone signaling and ROS production, as well as novel processes, such as leaf development. Validation of single gene T-DNA knockouts in a Col-0 background demonstrate a high success rate (60%) when accounting for differences in environmental and Botrytis genetic variation. This study...

  1. Staphylococcal PknB as the First Prokaryotic Representative of the Proline-Directed Kinases

    NARCIS (Netherlands)

    Miller, Malgorzata; Donat, Stefanie; Rakette, Sonja; Stehle, Thilo; Kouwen, Thijs R. H. M.; Diks, Sander H.; Dreisbach, Annette; Reilman, Ewoud; Gronau, Katrin; Becher, Doerte; Peppelenbosch, Maikel P.; van Dijl, Jan Maarten; Ohlsen, Knut

    2010-01-01

    In eukaryotic cell types, virtually all cellular processes are under control of proline-directed kinases and especially MAP kinases. Serine/threonine kinases in general were originally considered as a eukaryote-specific enzyme family. However, recent studies have revealed that orthologues of eukaryo

  2. Identification of Target Ligands of CORYNE in Arabidopsis by Phage Display Library

    Institute of Scientific and Technical Information of China (English)

    Heng Zhao; Shuzhen Li; Jiping Sheng; Lin Shen; Yuhui Yang; Bin Yao

    2011-01-01

    CORYNE (CRN) plays important roles in stem cell division and differentiation of shoot apical meristem (SAM) in Arabidopsis thaliana. The cytoplasmic kinase domain of CRN has been cloned and expressed in Escherichia coil, and further purified by two consecutive steps of affinity chromatography. By using this purified CRN as a ligand, a 12-mer random-peptide library was used to determine the specific amino acid sequences binding with the recombinant CRN molecule. After four rounds of biopanning, positive phage clones were isolated and sequenced, and further tested by enzyme linked immunosorbent assay for their binding ability and specificity. Two positive clones that specifically bind to the intracellular protein kinase domain of CRN have been identified. Alignment of these peptides and the kinase-associated protein phosphatase (KAPP) shows high similarity, indicating that KAPP might interact with the cytoplasmic kinase domain of CRN and negatively regulate the CLV signal. Our current study would be helpful to better understand the CLV3 signal pathway.

  3. Post-transcriptional regulation of ethylene perception and signaling in Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Schaller, George Eric

    2014-03-19

    The simple gas ethylene functions as an endogenous regulator of plant growth and development, and modulates such energy relevant processes as photosynthesis and biomass accumulation. Ethylene is perceived in the plant Arabidopsis by a five-member family of receptors related to bacterial histidine kinases. Our data support a general model in which the receptors exist as parts of larger protein complexes. Our goals have been to (1) characterize physical interactions among members of the signaling complex; (2) the role of histidine-kinase transphosphorylation in signaling by the complex; and (3) the role of a novel family of proteins that regulate signal output by the receptors.

  4. Mixed Lineage Kinase-c-Jun N-Terminal Kinase Axis: A Potential Therapeutic Target in Cancer.

    Science.gov (United States)

    Rana, Ajay; Rana, Basabi; Mishra, Rajakishore; Sondarva, Gautam; Rangasamy, Velusamy; Das, Subhasis; Viswakarma, Navin; Kanthasamy, Anumantha

    2013-09-01

    Mixed lineage kinases (MLKs) are members of the mitogen-activated protein kinase kinase kinase (MAP3K) family and are reported to activate MAP kinase pathways. There have been at least 9 members of the MLK family identified to date, although the physiological functions of all the family members are yet unknown. However, MLKs in general have been implicated in neurodegenerative diseases, including Parkinson and Alzheimer diseases. Recent reports suggest that some of the MLK members could play a role in cancer via modulating cell migration, invasion, cell cycle, and apoptosis. This review article will first describe the biology of MLK members and then discuss the current progress that relates to their functions in cancer.

  5. Reference: 774 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available an essential gene, the disruption of which causes embryonic lethality. Plants carrying a hypomorphic smg7 mu...e progression from anaphase to telophase in the second meiotic division in Arabidopsis. Arabidopsis SMG7 is

  6. Reference: 398 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available plays attenuated chloroplast movements under intermediate and high light intensitie...hese movements. In this work, we describe plastid movement impaired 2 (pmi2), a mutant in Arabidopsis (Arabidopsis thaliana) that dis

  7. Reference: 173 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available mical approaches to elucidate the action mechanisms of sirtinol in Arabidopsis. A...tic and chemical analyses of the action mechanisms of sirtinol in Arabidopsis. 8 3129-34 15710899 2005 Feb P

  8. Reference: 718 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available displayed a moderate but significant decrease in germination in the presence of D...NA damage. This report links Ubc13-Uev with functions in DNA damage response in Arabidopsis. Arabidopsis UEV

  9. Arabidopsis CDS blastp result: AK068856 [KOME

    Lifescience Database Archive (English)

    Full Text Available eme oxygenase (HY1) [Arabidopsis thaliana] GI:4877362, heme oxygenase 1 [Arabidopsis thaliana] GI:4530591 GB:AF132475; annotation upd...ated per Seth J. Davis at University of Wisconsin-Madison 3e-90 ...

  10. Arabidopsis CDS blastp result: AK104955 [KOME

    Lifescience Database Archive (English)

    Full Text Available B:AF132475; annotation updated per Seth J. Davis at University of Wisconsin-Madison 3e-90 ... ...heme oxygenase (HY1) [Arabidopsis thaliana] GI:4877362, heme oxygenase 1 [Arabidopsis thaliana] GI:4530591 G

  11. Reference: 110 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available on process. Our study shows that an Arabidopsis SNM protein, although structurally closer to the SNM1/PSO2 members, shares some prope...rties with ARTEMIS but also has novel characteristics. Arabidopsis plants defective

  12. Arabidopsis Kinesins HINKEL and TETRASPORE Act Redundantly to Control Cell Plate Expansion during Cytokinesis in the Male Garnetophyte

    Institute of Scientific and Technical Information of China (English)

    Sung-Aeong Oh; Valérie Bourdon; Madhumita Das'Pal; Hugh Dickinson; David Twell

    2008-01-01

    Asymmetric cell division at pollen mitosis I(PMI)is required to specify the differentiaI fate of the daughter vegetative and generative cells.Cytokinesis at PMI displays specialized features,and it has been suggested that there might be distinct molecular pathways underpinning different modes of cytokinesis in plants.Activation of the NACKPQR MAP kinase signaling pathway,which is essentiaI for somatic cell cytokinesis in tobacco,depends upon the NACK1and NACK2 kinesin-related proteins.Their Arabidopsis orthologs.HINKEL(HIK)and TETRAsPORE(TES).were reported to be essential for cytokinesis in somatic cells and in microsporoctes.respectively.More recently,HIK and TES were shown to have a functionally redundant role in female gametophytic cvtokinesis.We report here that HIK and TES are co-expressed in microspores and developing pollen,and,through analysis of microspore and pollen development in double heterozygote mutants.the occurrence of cell plate expansion defects during cytokinesis at PMI.The data demonstrate a functionally redundant role for HIK and TES in cell plate expansion during male gametophytic cytokinesis.extending the concept that different modes of cytokinesis are executed by a common signaling pathway,but reinforcing the individuality of gametophytic cytokinesis in its requirement for either TES or HIK.

  13. Thymidine kinases in archaea

    DEFF Research Database (Denmark)

    Clausen, A.R.; Matakos, A.; Sandrini, Michael;

    2006-01-01

    Twenty-six fully sequenced archaeal genomes were searched for genes coding for putative deoxyribonucleoside kinases (dNKs). We identified only 5 human-like thymidine kinase 1 genes (TK1s) and none for non-TK1 kinases. Four TK1s were identified in the Euryarchaea and one was found in the Crenarchaea...... that a functional deoxyribonucleoside salvage pathway is not crucial for the archaeal cell....

  14. Arabidopsis thaliana peroxidase N

    DEFF Research Database (Denmark)

    Mirza, Osman Asghar; Henriksen, A; Ostergaard, L

    2000-01-01

    The structure of the neutral peroxidase from Arabidopsis thaliana (ATP N) has been determined to a resolution of 1.9 A and a free R value of 20.5%. ATP N has the expected characteristic fold of the class III peroxidases, with a C(alpha) r.m.s.d. of 0.82 A when compared with horseradish peroxidase C...... (HRP C). HRP C is 54% identical to ATP N in sequence. When the structures of four class III plant peroxidases are superimposed, the regions with structural differences are non-randomly distributed; all are located in one half of the molecule. The architecture of the haem pocket of ATP N is very similar...... to that of HRP C, in agreement with the low small-molecule substrate specificity of all class III peroxidases. The structure of ATP N suggests that the pH dependence of the substrate turnover will differ from that of HRP C owing to differences in polarity of the residues in the substrate-access channel. Since...

  15. Attenuation of pattern recognition receptor signaling is mediated by a MAP kinase kinase kinase

    NARCIS (Netherlands)

    Mithoe, S.C.; Ludwig, C.; Pel, M.J.C.; Cucinotta, M.; Casartelli, A.; Mbengue, M.; Sklenar, J.; Derbyshire, P.; Robatzek, S.; Pieterse, C.M.J.; Aebersold, R.; Menke, F.L.H.

    2016-01-01

    Pattern recognition receptors (PRRs) play a key role in plant and animal innate immunity. PRR binding of their cognate ligand triggers a signaling network and activates an immune response. Activation of PRR signaling must be controlled prior to ligand binding to prevent spurious signaling and immune

  16. Chromosomal proteins of Arabidopsis thaliana.

    Science.gov (United States)

    Moehs, C P; McElwain, E F; Spiker, S

    1988-07-01

    In plants with large genomes, each of the classes of the histones (H1, H2A, H2B, H3 and H4) are not unique polypeptides, but rather families of closely related proteins that are called histone variants. The small genome and preponderance of single-copy DNA in Arabidopsis thaliana has led us to ask if this plant has such families of histone variants. We have thus isolated histones from Arabidopsis and analyzed them on four polyacrylamide gel electrophoretic systems: an SDS system; an acetic acid-urea system; a Triton transverse gradient system; and a two-dimensional system combining SDS and Triton-acetic acid-urea systems. This approach has allowed us to identify all four of the nucleosomal core histones in Arabidopsis and to establish the existence of a set of H2A and H2B variants. Arabidopsis has at least four H2A variants and three H2B variants of distinct molecular weights as assessed by electrophoretic mobility on SDS-polyacrylamide gels. Thus, Arabidopsis displays a diversity in these histones similar to the diversity displayed by plants with larger genomes such as wheat.The high mobility group (HMG) non-histone chromatin proteins have attracted considerable attention because of the evidence implicating them as structural proteins of transcriptionally active chromatin. We have isolated a group of non-histone chromatin proteins from Arabidopsis that meet the operational criteria to be classed as HMG proteins and that cross-react with antisera to HMG proteins of wheat.

  17. MYB75 phosphorylation by MPK4 is required for light-induced anthocyanin accumulation in arabidopsis

    DEFF Research Database (Denmark)

    Li, Shengnan; Wang, Wenyi; Gao, Jinlan

    2016-01-01

    anthocyanin pigments is light dependent, and the R2R3 MYB transcription factor MYB75/PAP1 regulates anthocyanin accumulation. Here, we report that MYB75 interacts with and is phosphorylated by MAP KINASE4 (MPK4). Their interaction is dependent on MPK4 kinase activity and is required for full function of MYB75...

  18. BAC-HAPPY mapping (BAP mapping): a new and efficient protocol for physical mapping.

    Science.gov (United States)

    Vu, Giang T H; Dear, Paul H; Caligari, Peter D S; Wilkinson, Mike J

    2010-02-08

    Physical and linkage mapping underpin efforts to sequence and characterize the genomes of eukaryotic organisms by providing a skeleton framework for whole genome assembly. Hitherto, linkage and physical "contig" maps were generated independently prior to merging. Here, we develop a new and easy method, BAC HAPPY MAPPING (BAP mapping), that utilizes BAC library pools as a HAPPY mapping panel together with an Mbp-sized DNA panel to integrate the linkage and physical mapping efforts into one pipeline. Using Arabidopsis thaliana as an exemplar, a set of 40 Sequence Tagged Site (STS) markers spanning approximately 10% of chromosome 4 were simultaneously assembled onto a BAP map compiled using both a series of BAC pools each comprising 0.7x genome coverage and dilute (0.7x genome) samples of sheared genomic DNA. The resultant BAP map overcomes the need for polymorphic loci to separate genetic loci by recombination and allows physical mapping in segments of suppressed recombination that are difficult to analyze using traditional mapping techniques. Even virtual "BAC-HAPPY-mapping" to convert BAC landing data into BAC linkage contigs is possible.

  19. Muscle phosphorylase kinase deficiency

    DEFF Research Database (Denmark)

    Preisler, N; Orngreen, M C; Echaniz-Laguna, A;

    2012-01-01

    To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD).......To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD)....

  20. Mixed - Lineage Protein kinases (MLKs) in inflammation, metabolism, and other disease states.

    Science.gov (United States)

    Craige, Siobhan M; Reif, Michaella M; Kant, Shashi

    2016-09-01

    Mixed lineage kinases, or MLKs, are members of the MAP kinase kinase kinase (MAP3K) family, which were originally identified among the activators of the major stress-dependent mitogen activated protein kinases (MAPKs), JNK and p38. During stress, the activation of JNK and p38 kinases targets several essential downstream substrates that react in a specific manner to the unique stressor and thus determine the fate of the cell in response to a particular challenge. Recently, the MLK family was identified as a specific modulator of JNK and p38 signaling in metabolic syndrome. Moreover, the MLK family of kinases appears to be involved in a very wide spectrum of disorders. This review discusses the newly identified functions of MLKs in multiple diseases including metabolic disorders, inflammation, cancer, and neurological diseases.

  1. Modification of tomato growth by expression of truncated ERECTA protein from Arabidopsis thaliana.

    Science.gov (United States)

    Villagarcia, Hector; Morin, Anne-Claire; Shpak, Elena D; Khodakovskaya, Mariya V

    2012-11-01

    ERECTA family genes encode leucine-rich repeat receptor-like kinases that control multiple aspects of plant development such as elongation of aboveground organs, leaf initiation, development of flowers, and epidermis differentiation. These receptors have also been implicated in responses to biotic and abiotic stress, probably as a consequence of their involvement in regulation of plant architecture. Here, ERECTA signalling in tomatoes (Solanum lycopersicum) was manipulated by expressing truncated ERECTA protein (AtΔKinase) from Arabidopsis using two different promoters. In Arabidopsis, this protein functions in a dominant-negative manner, disrupting signalling of the whole ERECTA gene family. Expression of AtΔKinase under a constitutive 35S promoter dramatically reduced vegetative growth and led to the formation of fruits with a reduced seed set. Similarly, expression of AtΔKinase under its own promoter resulted in transgenic tomato plants with diminished growth, a reduced number of leaves, changed flowering time, and slightly increased stomata density. The transgenic plants also exhibited increased tolerance to water deficit stress, at least partially due to their diminished surface area. These phenotypes of the transgenic plants were the result of ERECTA signalling disruption at the protein level, as the expression of two endogenous tomato ERECTA family genes was not suppressed. These results demonstrate the significance of ERECTA family genes for development and stress responses in tomato and suggest that truncated ERECTA can be used to manipulate the growth of crop species.

  2. Comparative transcriptomics of early meiosis in Arabidopsis and maize.

    Science.gov (United States)

    Dukowic-Schulze, Stefanie; Harris, Anthony; Li, Junhua; Sundararajan, Anitha; Mudge, Joann; Retzel, Ernest F; Pawlowski, Wojciech P; Chen, Changbin

    2014-03-20

    Though sexually reproductive plants share the same principle and most processes in meiosis, there are distinct features detectable. To address the similarities and differences of early meiosis transcriptomes from the dicot model system Arabidopsis and monocot model system maize, we performed comparative analyses of RNA-seq data of isolated meiocytes, anthers and seedlings from both species separately and via orthologous genes. Overall gene expression showed similarities, such as an increased number of reads mapping to unannotated features, and differences, such as the amount of differentially expressed genes. We detected major similarities and differences in functional annotations of genes up-regulated in meiocytes, which point to conserved features as well as unique features. Transcriptional regulation seems to be quite similar in Arabidopsis and maize, and we could reveal known and novel transcription factors and cis-regulatory elements acting in early meiosis. Taken together, meiosis between Arabidopsis and maize is conserved in many ways, but displays key distinctions that lie in the patterns of gene expression.

  3. Comparative Proteomic Analysis of Arabidopsis Mature Pollen and Germinated Pollen

    Institute of Scientific and Technical Information of China (English)

    Junjie Zou; Lianfen Song; Wenzheng Zhang; Yi Wang; Songlin Ruan; Wei-Hua Wu

    2009-01-01

    Proteomic analysis was applied to generating the map of Arabidopsis mature pollen proteins and analyzing the differentially expressed proteins that are potentially involved in the regulation of Arabidopsis pollen germination. By applying 2-D electrophoresis and silver staining, we resolved 499 and 494 protein spots from protein samples extracted from pollen grains and pollen tubes, respectively. Using the matrix-assisted laser desorption ionization time-of-flight mass spectrometry method, we identified 189 distinct proteins from 213 protein spots expressed in mature pollen or pollen tubes, and 75 new identified proteins that had not been reported before in research into the Arabidopsis pollen proteome. Comparative analysis revealed that 40 protein spots exhibit reproducible significant changes between mature pollen and pollen tubes. And 21 proteins from 17 downregulated and six upregulated protein spots were identified. Functional category analysis indicated that these differentially expressed proteins mainly involved in signaling, cellular structure, transport, defense/stress responses, transcription, metabolism, and energy production. The patterns of changes at protein level suggested the important roles for energy metabolism-related proteins in pollen tube growth, accompanied by the activation of the stress response pathway and modifications to the cell wall.

  4. The salty tale of Arabidopsis.

    Science.gov (United States)

    Sanders, D

    2000-06-29

    High concentrations of sodium chloride are toxic to most plant species. New insights into the mechanisms by which plants tolerate salt have emerged from the identification of genes in Arabidopsis thaliana that play a critical part in physiological resistance to salt.

  5. Regulation of mitogen-activated protein kinase pathways by the plasma membrane Na+/H+ exchanger, NHE1

    DEFF Research Database (Denmark)

    Pedersen, Stine Helene Falsig; Darborg, Barbara Vasek; Rentsch, Maria Louise;

    2006-01-01

    The mitogen-activated protein kinases (MAPKs), including extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38 MAPK, play a major role in the regulation of pivotal cellular processes such as cell death/survival balance, cell cycle progression, and cell migration. MAP...

  6. Mapping of p140Cap phosphorylation sites: the EPLYA and EGLYA motifs have a key role in tyrosine phosphorylation and Csk binding, and are substrates of the Abl kinase.

    Directory of Open Access Journals (Sweden)

    Daniele Repetto

    Full Text Available Protein phosphorylation tightly regulates specific binding of effector proteins that control many diverse biological functions of cells (e. g. signaling, migration and proliferation. p140Cap is an adaptor protein, specifically expressed in brain, testis and epithelial cells, that undergoes phosphorylation and tunes its interactions with other regulatory molecules via post-translation modification. In this work, using mass spectrometry, we found that p140Cap is in vivo phosphorylated on tyrosine (Y within the peptide GEGLpYADPYGLLHEGR (from now on referred to as EGLYA as well as on three serine residues. Consistently, EGLYA has the highest score of in silico prediction of p140Cap phosphorylation. To further investigate the p140Cap function, we performed site specific mutagenesis on tyrosines inserted in EGLYA and EPLYA, a second sequence with the same highest score of phosphorylation. The mutant protein, in which both EPLYA/EGLYA tyrosines were converted to phenylalanine, was no longer tyrosine phosphorylated, despite the presence of other tyrosine residues in p140Cap sequence. Moreover, this mutant lost its ability to bind the C-terminal Src kinase (Csk, previously shown to interact with p140Cap by Far Western analysis. In addition, we found that in vitro and in HEK-293 cells, the Abelson kinase is the major kinase involved in p140Cap tyrosine phosphorylation on the EPLYA and EGLYA sequences. Overall, these data represent an original attempt to in vivo characterise phosphorylated residues of p140Cap. Elucidating the function of p140Cap will provide novel insights into its biological activity not only in normal cells, but also in tumors.

  7. Mapping of p140Cap phosphorylation sites: the EPLYA and EGLYA motifs have a key role in tyrosine phosphorylation and Csk binding, and are substrates of the Abl kinase.

    Science.gov (United States)

    Repetto, Daniele; Aramu, Simona; Boeri Erba, Elisabetta; Sharma, Nanaocha; Grasso, Silvia; Russo, Isabella; Jensen, Ole N; Cabodi, Sara; Turco, Emilia; Di Stefano, Paola; Defilippi, Paola

    2013-01-01

    Protein phosphorylation tightly regulates specific binding of effector proteins that control many diverse biological functions of cells (e. g. signaling, migration and proliferation). p140Cap is an adaptor protein, specifically expressed in brain, testis and epithelial cells, that undergoes phosphorylation and tunes its interactions with other regulatory molecules via post-translation modification. In this work, using mass spectrometry, we found that p140Cap is in vivo phosphorylated on tyrosine (Y) within the peptide GEGLpYADPYGLLHEGR (from now on referred to as EGLYA) as well as on three serine residues. Consistently, EGLYA has the highest score of in silico prediction of p140Cap phosphorylation. To further investigate the p140Cap function, we performed site specific mutagenesis on tyrosines inserted in EGLYA and EPLYA, a second sequence with the same highest score of phosphorylation. The mutant protein, in which both EPLYA/EGLYA tyrosines were converted to phenylalanine, was no longer tyrosine phosphorylated, despite the presence of other tyrosine residues in p140Cap sequence. Moreover, this mutant lost its ability to bind the C-terminal Src kinase (Csk), previously shown to interact with p140Cap by Far Western analysis. In addition, we found that in vitro and in HEK-293 cells, the Abelson kinase is the major kinase involved in p140Cap tyrosine phosphorylation on the EPLYA and EGLYA sequences. Overall, these data represent an original attempt to in vivo characterise phosphorylated residues of p140Cap. Elucidating the function of p140Cap will provide novel insights into its biological activity not only in normal cells, but also in tumors.

  8. Mapping of the receptor protein-tyrosine kinase 10 to human chromosome 1q21-q23 and mouse chromosome 1H1-5 by fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Edelhoff, S.; Disteche, C.M. [Univ. of Washington School of Medicine, Seattle, WA (United States); Lai, C. [Scripps Research Inst., LaJolla, CA (United States)

    1995-01-01

    Receptor protein-tyrosine kinases (PTKs) play a critical role in the transduction of signals important to cell growth, differentiation, and survival. Mutations affecting the expression of receptor PTK genes have been associated with a number of vertebrate and invertebrate developmental abnormalities, and the aberrant regulation of tyrosine phosphorylation is implicated in a variety of neoplasias. One estimate suggests that approximately 100 receptor PTK genes exist in the mammalian genome, about half of which have been identified. The tyro-10 receptor protein-tyrosine kinase, first identified in a PCR-based survey for novel tyrosine kinases in the rat nervous system, defines a new subfamily of PTKs. It exhibits a catalytic domain most closely related to those found in the trk PTK receptor subfamily, which transduces signals for nerve growth factor and the related molecules brain-derived neurotrophic factor (BDNF), neurotrophin-3, and neurotrophin-4 (NT-3 and NT-4). Trk and the related PTK receptors trkB and trkC play a critical role in the neurotrophin-dependent survival of subsets of sensory and motor neurons. The predicted tyro-10 extracellular region is, however, distinct from that of the trk subfamily and is unique except for a domain shared with the blood coagulation factors V and VIII, thought to be involved in phospholipid binding. Although tyro-10 RNA is most abundant in heart and skeletal muscle in the adult rat, it is expressed in a wide variety of tissues, including the developing and mature brain. Tyro-10 appears identical to the murine TKT sequence reported by Karn et al. and exhibits a high degree of similarity with the CaK, DDR, and Nep PTKs. A ligand for tyro-10 has not yet been identified. 10 refs., 1 fig.

  9. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Kyuha Choi

    2016-07-01

    Full Text Available Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr effectors by resistance (R genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1 R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  10. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes

    Science.gov (United States)

    Serra, Heïdi; Ziolkowski, Piotr A.; Yelina, Nataliya E.; Jackson, Matthew; Mézard, Christine; McVean, Gil; Henderson, Ian R.

    2016-01-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity. PMID:27415776

  11. Consensus maps of cloned plant cuticle genes

    Institute of Scientific and Technical Information of China (English)

    Eviatar; Nevo

    2010-01-01

    Plant cuticle,which covers the plant surface,consists of waxes and cutins,and is associated with plant drought,cold,and salt resistance.Hitherto,at least 47 genes participating in the formation of plant cuticle have been cloned from Arabidopsis thaliana,Oryza sativa,Zea mays,Ricinus communis,Brassica napus,and Medicago truncatula;and about 85% of them encode proteins sharing above 50% identities with their rice homologous sequences.These cloned cuticle genes were mapped in silico on different chromosomes of rice and Arabidopsis,respectively.The mapping results revealed that plant cuticle genes were not evenly distributed in both genomes.About 40% of the mapped cuticle genes were located on chromosome 1 in Arabidopsis,while 20% of the mapped cuticle genes were located on chromosome 2 but none on chromosome 12 in rice.Some cloned plant cuticle genes have several rice homologous sequences,which might be produced by chromosomal segment duplication.The consensus map of cloned plant cuticle genes will provide important clues for the selection of candidate genes in a positional cloning of an unknown cuticle gene in plants.

  12. SRC protein tyrosine kinase, c-Jun N-terminal kinase (JNK), and NF-kappaBp65 signaling in commercial and wild-type turkey leukocytes

    Science.gov (United States)

    Studies comparing signaling in wild-type turkey (WT) leukocytes and commercial turkey (CT) leukocytes found that the activity of protein tyrosine kinases (PTK) and MAP kinases, ERK 1/2 and p38, were significantly higher in WT leukocytes compared to CT lines upon exposure to both SE and OPSE on days...

  13. Studying Kinetochore Kinases

    NARCIS (Netherlands)

    Saurin, Adrian T; Kops, Geert J P L

    2016-01-01

    Mitotic kinetochores are signaling network hubs that regulate chromosome movements, attachment error-correction, and the spindle assembly checkpoint. Key switches in these networks are kinases and phosphatases that enable rapid responses to changing conditions. Describing the mechanisms and dynamics

  14. Chemical genetic approach identifies microtubule affinity-regulating kinase 1 as a leucine-rich repeat kinase 2 substrate.

    Science.gov (United States)

    Krumova, Petranka; Reyniers, Lauran; Meyer, Marc; Lobbestael, Evy; Stauffer, Daniela; Gerrits, Bertran; Muller, Lionel; Hoving, Sjouke; Kaupmann, Klemens; Voshol, Johannes; Fabbro, Doriano; Bauer, Andreas; Rovelli, Giorgio; Taymans, Jean-Marc; Bouwmeester, Tewis; Baekelandt, Veerle

    2015-07-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of autosomal-dominant forms of Parkinson's disease. LRRK2 is a modular, multidomain protein containing 2 enzymatic domains, including a kinase domain, as well as several protein-protein interaction domains, pointing to a role in cellular signaling. Although enormous efforts have been made, the exact pathophysiologic mechanisms of LRRK2 are still not completely known. In this study, we used a chemical genetics approach to identify LRRK2 substrates from mouse brain. This approach allows the identification of substrates of 1 particular kinase in a complex cellular environment. Several of the identified peptides are involved in the regulation of microtubule (MT) dynamics, including microtubule-associating protein (MAP)/microtubule affinity-regulating kinase 1 (MARK1). MARK1 is a serine/threonine kinase known to phosphorylate MT-binding proteins such as Tau, MAP2, and MAP4 at KXGS motifs leading to MT destabilization. In vitro kinase assays and metabolic-labeling experiments in living cells confirmed MARK1 as an LRRK2 substrate. Moreover, we also showed that LRRK2 and MARK1 are interacting in eukaryotic cells. Our findings contribute to the identification of physiologic LRRK2 substrates and point to a potential mechanism explaining the reported effects of LRRK2 on neurite morphology.

  15. The Receptor-Like Cytoplasmic Kinase(OsRL CK) Gene Family in Rice:Organization,Phylogenetic Relationship,and Expressionduring Development and Stress

    Institute of Scientific and Technical Information of China (English)

    Shubha Vij; Jitender Giri; Prasant Kumar Dansana; Sanjay Kapoor; Akhilesh K.Tyagi

    2008-01-01

    Receptor-like cytoplasmic kinases(RLCKs)in plants belong to the super family of receptor-like kinases(RLKs).These proteins show homology to RLKs in kinase domain but Iack the transmembrane domain.Some of the functionally characterized RLCKs from plants have been shown to play roles jn development and stress responses.Previously,149 and 187 RLCK encoding genes were identified from Arabidopsis and rice,respectively.By using HMM-based domain structure and phylogenetic relationships,we have identified 379 OsRLCKs from rice.OsRLCKs are distributed on all 12 chromosomes of rice and some members are located on duplicated chromosomal segments.Several OsRLCKs probably also undergo alternative splicing,some having evidence only in the form of gene models.To understand their possible functions,expression patterns during Iandmark stages of vegetative and reproductive development as welI as abiotic and biotic stress using microarray and MPSS-based data were analyzed.Real-time PCR-based expression profiling for a selected few genes confirmed the outcome of microarray analysis.Differential expression patterns observed for majority of OsRLCKs during development and stress suggest their involvement in diverse functions in rice.Majority of the stress-responsive OsRLCKs were also found to be localized within mapped regions of abiotic stress QTLs.Outcome of this study would help in selecting organ/development stage specific OsRLCK genes/targets for functionaI validation studies.

  16. Powdery Mildew Resistance Conferred by Loss of the ENHANCED DISEASE RESISTANCE1 Protein Kinase Is Suppressed by a Missense Mutation in KEEP ON GOING, a Regulator of Abscisic Acid Signaling1[W][OA

    Science.gov (United States)

    Wawrzynska, Anna; Christiansen, Katy M.; Lan, Yinan; Rodibaugh, Natalie L.; Innes, Roger W.

    2008-01-01

    Loss-of-function mutations in the Arabidopsis (Arabidopsis thaliana) ENHANCED DISEASE RESISTANCE1 (EDR1) gene confer enhanced resistance to infection by powdery mildew (Golovinomyces cichoracearum). EDR1 encodes a protein kinase, but its substrates and the pathways regulated by EDR1 are unknown. To identify components of the EDR1 signal transduction pathway(s), we conducted a forward genetic screen for mutations that suppressed edr1-mediated disease resistance. Genetic mapping and cloning of one of these suppressor mutations revealed a recessive missense mutation in the KEEP ON GOING gene (KEG; At5g13530), which we designated keg-4. KEG encodes a multidomain protein that includes a RING E3 ligase domain, a kinase domain, ankyrin repeats, and HERC2-like repeats. The KEG protein has previously been shown to have ubiquitin ligase activity and to negatively regulate protein levels of the transcription factor ABCISIC ACID INSENSITIVE5. KEG mRNA levels were found to be 3-fold higher in edr1 mutant plants compared to wild type. Loss-of-function mutations in KEG are seedling lethal and are hypersensitive to glucose and abscisic acid (ABA). The keg-4 mutation, in contrast, conferred resistance to 6% glucose and suppressed edr1-mediated hypersensitivity to ABA, suggesting that the keg-4 mutation suppresses ABA signaling by altering KEG function. Several ABA-responsive genes were found to be further up-regulated in the edr1 mutant following ABA treatment, and this up-regulation was suppressed by the keg-4 mutation. We conclude that edr1-mediated resistance to powdery mildew is mediated, in part, by enhanced ABA signaling. PMID:18815384

  17. Powdery mildew resistance conferred by loss of the ENHANCED DISEASE RESISTANCE1 protein kinase is suppressed by a missense mutation in KEEP ON GOING, a regulator of abscisic acid signaling.

    Science.gov (United States)

    Wawrzynska, Anna; Christiansen, Katy M; Lan, Yinan; Rodibaugh, Natalie L; Innes, Roger W

    2008-11-01

    Loss-of-function mutations in the Arabidopsis (Arabidopsis thaliana) ENHANCED DISEASE RESISTANCE1 (EDR1) gene confer enhanced resistance to infection by powdery mildew (Golovinomyces cichoracearum). EDR1 encodes a protein kinase, but its substrates and the pathways regulated by EDR1 are unknown. To identify components of the EDR1 signal transduction pathway(s), we conducted a forward genetic screen for mutations that suppressed edr1-mediated disease resistance. Genetic mapping and cloning of one of these suppressor mutations revealed a recessive missense mutation in the KEEP ON GOING gene (KEG; At5g13530), which we designated keg-4. KEG encodes a multidomain protein that includes a RING E3 ligase domain, a kinase domain, ankyrin repeats, and HERC2-like repeats. The KEG protein has previously been shown to have ubiquitin ligase activity and to negatively regulate protein levels of the transcription factor ABCISIC ACID INSENSITIVE5. KEG mRNA levels were found to be 3-fold higher in edr1 mutant plants compared to wild type. Loss-of-function mutations in KEG are seedling lethal and are hypersensitive to glucose and abscisic acid (ABA). The keg-4 mutation, in contrast, conferred resistance to 6% glucose and suppressed edr1-mediated hypersensitivity to ABA, suggesting that the keg-4 mutation suppresses ABA signaling by altering KEG function. Several ABA-responsive genes were found to be further up-regulated in the edr1 mutant following ABA treatment, and this up-regulation was suppressed by the keg-4 mutation. We conclude that edr1-mediated resistance to powdery mildew is mediated, in part, by enhanced ABA signaling.

  18. Reference: 710 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available n factor family in Arabidopsis (Arabidopsis thaliana). Treatment with abscisic acid (ABA) induced AtMYB44 tr...anscript accumulation within 30 min. The gene was also activated under various abiotic stre...sses, such as dehydration, low temperature, and salinity. In transgenic Arabidopsis carrying an At...MYB44 promoter-driven beta-glucuronidase (GUS) construct, strong GUS activity was observed in the vasculature... and leaf epidermal guard cells. Transgenic Arabidopsis overexpressing AtMYB44 is more

  19. Functional analysis of related CrRLK1L receptor-like kinases in pollen tube reception.

    Science.gov (United States)

    Kessler, Sharon A; Lindner, Heike; Jones, Daniel S; Grossniklaus, Ueli

    2015-01-01

    The Catharanthus roseus Receptor-Like Kinase 1-like (CrRLK1L) family of 17 receptor-like kinases (RLKs) has been implicated in a variety of signaling pathways in Arabidopsis, ranging from pollen tube (PT) reception and tip growth to hormonal responses. The extracellular domains of these RLKs have malectin-like domains predicted to bind carbohydrate moieties. Domain swap analysis showed that the extracellular domains of the three members analyzed (FER, ANX1, HERK1) are not interchangeable, suggesting distinct upstream components, such as ligands and/or co-factors. In contrast, their intercellular domains are functionally equivalent for PT reception, indicating that they have common downstream targets in their signaling pathways. The kinase domain is necessary for FER function, but kinase activity itself is not, indicating that other kinases may be involved in signal transduction during PT reception.

  20. The role of MAP kinase cascades in cell signaling,neural plasticity and pain facilitation%MAP激酶在细胞内信号传递,神经可塑性及痛觉易化中的作用

    Institute of Scientific and Technical Information of China (English)

    Ru-Rong Ji; Yu-Qiu Zhang

    2005-01-01

    病理性疼痛通常指由组织损伤引起的炎性痛和神经损伤引起的神经病理性痛.损伤和强烈的伤害刺激能导致痛过敏.痛过敏现象的产生是由外周敏化(初级伤害感受器的敏感性增加)和中枢敏化(脊髓背角以及其他中枢神经元敏感性增加)引起的.有些蛋白激酶通过翻译后的调节如关键膜受体和通道蛋白磷酸化而参与外周和中枢敏化的形成.特别的是多种信号通路可汇聚而激活MAPK(mitogen-activated protein kinase).伤害性刺激、生长因子以及炎性介质均能在初级和二级痛感受神经元中激活MAPK家族成员ERK和P38.ERK和P38的激活不仅能够引起转录后过程发生改变,而且还能够通过对转录和非转录水平的调节增加多种基因的表达,从而导致损伤后痛过敏的形成和维持.%Pathological pain, normally referring to tissue injury-induced inflammatory pain and nerve injury-induced neuropathic pain, is an expression of neural plasticity. Injuries and intense noxious stimuli result in pain hypersensitivity,which is contributed by peripheral sensitization (increased sensitivity of primary sensory nociceptors) and central sensitization (increased sensitivity of spinal dorsal horn and other CNS neurons). Activation of several protein kinases causes both forms of sensitization via posttranslational regulation, such as phosphorylation of key membrane receptors and channels. In particular, activation of multiple signal cascades converge on the activation of MAPK (mitogen-activated protein kinase).Activation of MAPK family members of ERK and p38 by nociceptive activity, growth factors, and inflammatory mediators in primary sensory and secondary order neurons, not only results in posttranslational modification, but also increases the expression of numerous genes via transcriptional and non-transcriptional regulation. Eventually this activation contributes to the development and maintenance of heightened pain

  1. 14-3-3 proteins interact with specific MEK kinases.

    Science.gov (United States)

    Fanger, G R; Widmann, C; Porter, A C; Sather, S; Johnson, G L; Vaillancourt, R R

    1998-02-06

    MEK (mitogen-activated protein kinase/extracellular signal-regulated kinase kinase) kinases (MEKKs) regulate c-Jun N-terminal kinase and extracellular response kinase pathways. The 14-3-3zeta and 14-3-3epsilon isoforms were isolated in a two-hybrid screen for proteins interacting with the N-terminal regulatory domain of MEKK3. 14-3-3 proteins bound both the N-terminal regulatory and C-terminal kinase domains of MEKK3. The binding affinity of 14-3-3 for the MEKK3 N terminus was 90 nM, demonstrating a high affinity interaction. 14-3-3 proteins also interacted with MEKK1 and MEKK2, but not MEKK4. Endogenous 14-3-3 protein and MEKK1 and MEKK2 were similarly distributed in the cell, consistent with their in vitro interactions. MEKK1 and 14-3-3 proteins colocalized using two-color digital confocal immunofluorescence. Binding of 14-3-3 proteins mapped to the N-terminal 393 residues of 196-kDa MEKK1. Unlike MEKK2 and MEKK3, the C-terminal kinase domain of MEKK1 demonstrated little or no ability to interact with 14-3-3 proteins. MEKK1, but not MEKK2, -3 or -4, is a caspase-3 substrate that when cleaved releases the kinase domain from the N-terminal regulatory domain. Functionally, caspase-3 cleavage of MEKK1 releases the kinase domain from the N-terminal 14-3-3-binding region, demonstrating that caspases can selectively alter protein kinase interactions with regulatory proteins. With regard to MEKK1, -2 and -3, 14-3-3 proteins do not appear to directly influence activity, but rather function as "scaffolds" for protein-protein interactions.

  2. Identification of novel PAMP-triggered phosphorylation and dephosphorylation events in arabidopsis thaliana by quantitative phosphoproteomic analysis

    KAUST Repository

    Rayapuram, Naganand

    2014-04-04

    Signaling cascades rely strongly on protein kinase-mediated substrate phosphorylation. Currently a major challenge in signal transduction research is to obtain high confidence substrate phosphorylation sites and assign them to specific kinases. In response to bacterial flagellin, a pathogen-associated molecular pattern (PAMP), we searched for rapidly phosphorylated proteins in Arabidopsis thaliana by combining multistage activation (MSA) and electron transfer dissociation (ETD) fragmentation modes, which generate complementary spectra and identify phosphopeptide sites with increased reliability. Of a total of 825 phosphopeptides, we identified 58 to be differentially phosphorylated. These peptides harbor kinase motifs of mitogen-activated protein kinases (MAPKs) and calcium-dependent protein kinases (CDPKs), as well as yet unknown protein kinases. Importantly, 12 of the phosphopeptides show reduced phosphorylation upon flagellin treatment. Since protein abundance levels did not change, these results indicate that flagellin induces not only various protein kinases but also protein phosphatases, even though a scenario of inhibited kinase activity may also be possible. © 2014 American Chemical Society.

  3. Induction of Systemic Resistance against Aphids by Endophytic Bacillus velezensis YC7010 via Expressing PHYTOALEXIN DEFICIENT4 in Arabidopsis

    Science.gov (United States)

    Rashid, Md. Harun-Or-; Khan, Ajmal; Hossain, Mohammad T.; Chung, Young R.

    2017-01-01

    Aphids are the most destructive insect pests. They suck the sap and transmit plant viruses, causing widespread yield loss of many crops. A multifunctional endophytic bacterial strain Bacillus velezensis YC7010 has been found to induce systemic resistance against bacterial and fungal pathogens of rice. However, its activity against insects attack and underlying cellular and molecular defense mechanisms are not elucidated yet. Here, we show that root drenching of Arabidopsis seedlings with B. velezensis YC7010 can induce systemic resistance against green peach aphid (GPA), Myzus persicae. Treatment of bacterial suspension of B. velezensis YC7010 at 2 × 107 CFU/ml to Arabidopsis rhizosphere induced higher accumulation of hydrogen peroxide, cell death, and callose deposition in leaves compared to untreated plants at 6 days after infestation of GPA. Salicylic acid, jasmonic acid, ethylene, and abscisic acid were not required to confer defense against GPA in Arabidopsis plants treated by B. velezensis YC7010. Bacterial treatment with B. velezensis YC7010 significantly reduced settling, feeding and reproduction of GPA on Arabidopsis leaves via strongly expressing senescence-promoting gene PHYTOALEXIN DEFICIENT4 (PAD4) while suppressing BOTRYTIS-INDUCED KINASE1 (BIK1). These results indicate that B. velezensis YC7010-induced systemic resistance to the GPA is a hypersensitive response mainly dependent on higher expression of PAD4 with suppression of BIK1, resulting in more accumulation of hydrogen peroxide, cell death, and callose deposition in Arabidopsis. PMID:28261260

  4. Induction of Systemic Resistance against Aphids by Endophytic Bacillus velezensis YC7010 via Expressing PHYTOALEXIN DEFICIENT4 in Arabidopsis.

    Science.gov (United States)

    Rashid, Md Harun-Or-; Khan, Ajmal; Hossain, Mohammad T; Chung, Young R

    2017-01-01

    Aphids are the most destructive insect pests. They suck the sap and transmit plant viruses, causing widespread yield loss of many crops. A multifunctional endophytic bacterial strain Bacillus velezensis YC7010 has been found to induce systemic resistance against bacterial and fungal pathogens of rice. However, its activity against insects attack and underlying cellular and molecular defense mechanisms are not elucidated yet. Here, we show that root drenching of Arabidopsis seedlings with B. velezensis YC7010 can induce systemic resistance against green peach aphid (GPA), Myzus persicae. Treatment of bacterial suspension of B. velezensis YC7010 at 2 × 10(7) CFU/ml to Arabidopsis rhizosphere induced higher accumulation of hydrogen peroxide, cell death, and callose deposition in leaves compared to untreated plants at 6 days after infestation of GPA. Salicylic acid, jasmonic acid, ethylene, and abscisic acid were not required to confer defense against GPA in Arabidopsis plants treated by B. velezensis YC7010. Bacterial treatment with B. velezensis YC7010 significantly reduced settling, feeding and reproduction of GPA on Arabidopsis leaves via strongly expressing senescence-promoting gene PHYTOALEXIN DEFICIENT4 (PAD4) while suppressing BOTRYTIS-INDUCED KINASE1 (BIK1). These results indicate that B. velezensis YC7010-induced systemic resistance to the GPA is a hypersensitive response mainly dependent on higher expression of PAD4 with suppression of BIK1, resulting in more accumulation of hydrogen peroxide, cell death, and callose deposition in Arabidopsis.

  5. Orexin-stimulated MAP kinase cascades are activated through multiple G-protein signalling pathways in human H295R adrenocortical cells: diverse roles for orexins A and B.

    Science.gov (United States)

    Ramanjaneya, Manjunath; Conner, Alex C; Chen, Jing; Kumar, Prashanth; Brown, James E P; Jöhren, Olaf; Lehnert, Hendrik; Stanfield, Peter R; Randeva, Harpal S

    2009-08-01

    Orexins A and B (ORA and ORB) are neuropeptide hormones found throughout the central nervous system and periphery. They are required for a host of physiological processes including mitogen-activated protein kinase (MAPK) regulation, steroidogenesis, appetite control and energy regulation. While some signalling mechanisms have been proposed for individual recombinant orexin receptors in generic mammalian cell types, it is clear that the peripheral effects of orexin are spatially and temporally complex. This study dissects the different G-protein signalling and MAPK pathways activated in a pluripotent human adrenal H295R cell line capable of all the physiological steps involved in steroidogenesis. Both extracellular receptor kinase 1/2 (ERK1/2) and p38 were phosphorylated rapidly with a subsequent decline, in a time- and dose-dependent manner, in response to both ORA and ORB. Conversely, there was little or no direct activation of the ERK5 or JNK pathway. Analysis using signalling and MAPK inhibitors as well as receptor-specific antagonists determined the precise mediators of the orexin response in these cells. Both ERK1/2 and p38 activation were predominantly G(q)- and to a lesser extent G(s)-mediated; p38 activation even had a small G(i)-component. Effects were broadly comparable for both orexin sub-types ORA and ORB and although most of the effects were transmitted through the orexin receptor-1 subtype, we did observe a role for orexin receptor-2-mediated activation of both ERK1/2 and p38. Cortisol secretion also differed in response to ORA and ORB. These data suggest multiple roles for orexin-mediated MAPK activation in an adrenal cell-line, this complexity may help to explain the diverse biological actions of orexins with wide-ranging consequences for our understanding of the mechanisms initiated by these steroidogenic molecules.

  6. Interaction of Medicago truncatula Lysin Motif Receptor-Like Kinases, NFP and LYK3, Produced in Nicotiana benthamiana Induces Defence-Like Responses

    NARCIS (Netherlands)

    Pietraszewska-Bogiel, A.; Lefebvre, B.; Koini, A.M.; Klaus-Heisen, D.; Takken, F.L.W.; Geurts, R.; Cullimore, J.V.; Gadella, Th.W.J.

    2013-01-01

    Receptor(-like) kinases with Lysin Motif (LysM) domains in their extracellular region play crucial roles during plant interactions with microorganisms; e.g. Arabidopsis thaliana CERK1 activates innate immunity upon perception of fungal chitin/chitooligosaccharides, whereas Medicago truncatula NFP an

  7. Epistatic natural allelic variation reveals a function of AGAMOUS-LIKE6 in axillary bud formation in Arabidopsis

    NARCIS (Netherlands)

    Huang, X.; Effgen, S.; Meyer, R.C.; Theres, K.; Koornneef, M.

    2012-01-01

    In the Arabidopsis Multiparent Recombinant Inbred Line mapping population, a limited number of plants were detected that lacked axillary buds in most of the axils of the cauline (stem) leaves, but formed such buds in almost all rosette axils. Genetic analysis showed that polymorphisms in at least th

  8. An International Bioinformatics Infrastructure to Underpin the Arabidopsis Community

    Science.gov (United States)

    The future bioinformatics needs of the Arabidopsis community as well as those of other scientific communities that depend on Arabidopsis resources were discussed at a pair of recent meetings held by the Multinational Arabidopsis Steering Committee (MASC) and the North American Arabidopsis Steering C...

  9. Arabidopsis CDS blastp result: AK240652 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK240652 J023098G11 At5g63090.2 68418.m07919 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 1e-13 ...

  10. Arabidopsis CDS blastp result: AK241761 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241761 J065205C18 At5g63090.1 68418.m07918 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 5e-32 ...

  11. Arabidopsis CDS blastp result: AK240652 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK240652 J023098G11 At5g63090.1 68418.m07918 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 1e-13 ...

  12. Arabidopsis CDS blastp result: AK240652 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK240652 J023098G11 At5g63090.4 68418.m07921 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 1e-13 ...

  13. Arabidopsis CDS blastp result: AK241761 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241761 J065205C18 At5g63090.3 68418.m07920 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 5e-32 ...

  14. Arabidopsis CDS blastp result: AK241761 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241761 J065205C18 At5g63090.2 68418.m07919 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 5e-32 ...

  15. Arabidopsis CDS blastp result: AK241761 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241761 J065205C18 At5g63090.4 68418.m07921 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 5e-32 ...

  16. Arabidopsis CDS blastp result: AK240652 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK240652 J023098G11 At5g63090.3 68418.m07920 LOB domain protein / lateral organ boundaries... protein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 1e-13 ...

  17. Arabidopsis CDS blastp result: AK105527 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK105527 001-127-G05 At5g63090.4 LOB domain protein / lateral organ boundaries prot...ein (LOB) identical to LOBa [Arabidopsis thaliana] GI:17484100, SP|Q9FML4 LATERAL ORGAN BOUNDARIES protein {Arabidopsis thaliana} 3e-52 ...

  18. Arabidopsis CDS blastp result: AK240730 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK240730 J043030K09 At2g32440.1 68415.m03963 ent-kaurenoic acid hydroxylase, putati...ve / cytochrome P450, putative identical to ent-kaurenoic acid hydroxylase / cytochrome P450 CYP88A (GI:1302...1856) [Arabidopsis thaliana]; similar to ent-kaurenoic acid hydroxylase [Arabidopsis thaliana] GI:13021853 2e-11 ...

  19. Arabidopsis CDS blastp result: AK288052 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK288052 J075151I09 At2g32440.1 68415.m03963 ent-kaurenoic acid hydroxylase, putati...ve / cytochrome P450, putative identical to ent-kaurenoic acid hydroxylase / cytochrome P450 CYP88A (GI:1302...1856) [Arabidopsis thaliana]; similar to ent-kaurenoic acid hydroxylase [Arabidopsis thaliana] GI:13021853 6e-14 ...

  20. Arabidopsis CDS blastp result: AK240911 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK240911 J065037E05 At2g32440.1 68415.m03963 ent-kaurenoic acid hydroxylase, putati...ve / cytochrome P450, putative identical to ent-kaurenoic acid hydroxylase / cytochrome P450 CYP88A (GI:1302...1856) [Arabidopsis thaliana]; similar to ent-kaurenoic acid hydroxylase [Arabidopsis thaliana] GI:13021853 4e-22 ...

  1. Arabidopsis CDS blastp result: AK241119 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241119 J065094C22 At2g32440.1 68415.m03963 ent-kaurenoic acid hydroxylase, putati...ve / cytochrome P450, putative identical to ent-kaurenoic acid hydroxylase / cytochrome P450 CYP88A (GI:1302...1856) [Arabidopsis thaliana]; similar to ent-kaurenoic acid hydroxylase [Arabidopsis thaliana] GI:13021853 2e-13 ...

  2. Arabidopsis CDS blastp result: AK243149 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK243149 J100032I21 At2g32440.1 68415.m03963 ent-kaurenoic acid hydroxylase, putati...ve / cytochrome P450, putative identical to ent-kaurenoic acid hydroxylase / cytochrome P450 CYP88A (GI:1302...1856) [Arabidopsis thaliana]; similar to ent-kaurenoic acid hydroxylase [Arabidopsis thaliana] GI:13021853 7e-12 ...

  3. Arabidopsis CDS blastp result: AK241581 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241581 J065181K09 At2g32440.1 68415.m03963 ent-kaurenoic acid hydroxylase, putati...ve / cytochrome P450, putative identical to ent-kaurenoic acid hydroxylase / cytochrome P450 CYP88A (GI:1302...1856) [Arabidopsis thaliana]; similar to ent-kaurenoic acid hydroxylase [Arabidopsis thaliana] GI:13021853 4e-15 ...

  4. Arabidopsis CDS blastp result: AK287479 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK287479 J043023O14 At2g32440.1 68415.m03963 ent-kaurenoic acid hydroxylase, putati...ve / cytochrome P450, putative identical to ent-kaurenoic acid hydroxylase / cytochrome P450 CYP88A (GI:1302...1856) [Arabidopsis thaliana]; similar to ent-kaurenoic acid hydroxylase [Arabidopsis thaliana] GI:13021853 1e-17 ...

  5. Reference: 631 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ggest that atRZ-1a has a negative impact on seed germination and seedling growth of Arabidopsis under salt o...binding protein, atRZ-1a, has a negative impact on seed germination and seedling growth of Arabidopsis thali

  6. Enterococcus faecalis phosphomevalonate kinase.

    Science.gov (United States)

    Doun, Stephanie S; Burgner, John W; Briggs, Scott D; Rodwell, Victor W

    2005-05-01

    The six enzymes of the mevalonate pathway of isopentenyl diphosphate biosynthesis represent potential for addressing a pressing human health concern, the development of antibiotics against resistant strains of the Gram-positive streptococci. We previously characterized the first four of the mevalonate pathway enzymes of Enterococcus faecalis, and here characterize the fifth, phosphomevalonate kinase (E.C. 2.7.4.2). E. faecalis genomic DNA and the polymerase chain reaction were used to clone DNA thought to encode phosphomevalonate kinase into pET28b(+). Double-stranded DNA sequencing verified the sequence of the recombinant gene. The encoded N-terminal hexahistidine-tagged protein was expressed in Escherichia coli with induction by isopropylthiogalactoside and purified by Ni(++) affinity chromatography, yield 20 mg protein per liter. Analysis of the purified protein by MALDI-TOF mass spectrometry established it as E. faecalis phosphomevalonate kinase. Analytical ultracentrifugation revealed that the kinase exists in solution primarily as a dimer. Assay for phosphomevalonate kinase activity used pyruvate kinase and lactate dehydrogenase to couple the formation of ADP to the oxidation of NADH. Optimal activity occurred at pH 8.0 and at 37 degrees C. The activation energy was approximately 5.6 kcal/mol. Activity with Mn(++), the preferred cation, was optimal at about 4 mM. Relative rates using different phosphoryl donors were 100 (ATP), 3.6 (GTP), 1.6 (TTP), and 0.4 (CTP). K(m) values were 0.17 mM for ATP and 0.19 mM for (R,S)-5-phosphomevalonate. The specific activity of the purified enzyme was 3.9 micromol substrate converted per minute per milligram protein. Applications to an immobilized enzyme bioreactor and to drug screening and design are discussed.

  7. Cellular reprogramming through mitogen-activated protein kinases

    Directory of Open Access Journals (Sweden)

    Justin eLee

    2015-10-01

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are conserved eukaryote signaling modules where MAPKs, as the final kinases in the cascade, phosphorylate protein substrates to regulate cellular processes. While some progress in the identification of MAPK substrates has been made in plants, the knowledge on the spectrum of substrates and their mechanistic action is still fragmentary. In this focused review, we discuss the biological implications of the data in our original paper (Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana; Frontiers in Plant Science 5: 554 in the context of related research. In our work, we mimicked in vivo activation of two stress-activated MAPKs, MPK3 and MPK6, through transgenic manipulation of Arabidopsis thaliana and used phosphoproteomics analysis to identify potential novel MAPK substrates. Here, we plotted the identified putative MAPK substrates (and downstream phosphoproteins as a global protein clustering network. Based on a highly stringent selection confidence level, the core networks highlighted a MAPK-induced cellular reprogramming at multiple levels of gene and protein expression – including transcriptional, post-transcriptional, translational, post-translational (such as protein modification, folding and degradation steps, and also protein re-compartmentalization. Additionally, the increase in putative substrates/phosphoproteins of energy metabolism and various secondary metabolite biosynthesis pathways coincides with the observed accumulation of defense antimicrobial substances as detected by metabolome analysis. Furthermore, detection of protein networks in phospholipid or redox elements suggests activation of downstream signaling events. Taken in context with other studies, MAPKs are key regulators that reprogram cellular events to orchestrate defense signaling in eukaryotes.

  8. A membrane protein / signaling protein interaction network for Arabidopsis version AMPv2

    Directory of Open Access Journals (Sweden)

    Sylvie Lalonde

    2010-09-01

    Full Text Available Interactions between membrane proteins and the soluble fraction are essential for signal transduction and for regulating nutrient transport. To gain insights into the membrane-based interactome, 3,852 open reading frames (ORFs out of a target list of 8,383 representing membrane and signaling proteins from Arabidopsis thaliana were cloned into a Gateway compatible vector. The mating-based split-ubiquitin system was used to screen for potential protein-protein interactions (pPPIs among 490 Arabidopsis ORFs. A binary robotic screen between 142 receptor-like kinases, 72 transporters, 57 soluble protein kinases and phosphatases, 40 glycosyltransferases, 95 proteins of various functions and 89 proteins with unknown function detected 387 out of 90,370 possible PPIs. A secondary screen confirmed 343 (of 387 pPPIs between 179 proteins, yielding a scale-free network (r2=0.863. Eighty of 142 transmembrane receptor-like kinases (RLK tested positive, identifying three homomers, 63 heteromers and 80 pPPIs with other proteins. Thirty-one out of 142 RLK interactors (including RLKs had previously been found to be phosphorylated; thus interactors may be substrates for respective RLKs. None of the pPPIs described here had been reported in the major interactome databases, including potential interactors of G protein-coupled receptors, phospholipase C, and AMT ammonium transporters. Two RLKs found as putative interactors of AMT1;1 were independently confirmed using a split luciferase assay in Arabidopsis protoplasts. These RLKs may be involved in ammonium-dependent phosphorylation of the C-terminus and regulation of ammonium uptake activity. The robotic screening method established here will enable a systematic analysis of membrane protein interactions in fungi, plants and metazoa.

  9. MEK kinases are regulated by EGF and selectively interact with Rac/Cdc42.

    Science.gov (United States)

    Fanger, G R; Johnson, N L; Johnson, G L

    1997-08-15

    MEK kinases (MEKKs) 1, 2, 3 and 4 are members of sequential kinase pathways that regulate MAP kinases including c-Jun NH2-terminal kinases (JNKs) and extracellular regulated kinases (ERKs). Confocal immunofluorescence microscopy of COS cells demonstrated differential MEKK subcellular localization: MEKK1 was nuclear and in post-Golgi vesicular-like structures; MEKK2 and 4 were localized to distinct Golgi-associated vesicles that were dispersed by brefeldin A. MEKK1 and 2 were activated by EGF, and kinase-inactive mutants of each MEKK partially inhibited EGF-stimulated JNK activity. Kinase-inactive MEKK1, but not MEKK2, 3 or 4, strongly inhibited EGF-stimulated ERK activity. In contrast to MEKK2 and 3, MEKK1 and 4 specifically associated with Rac and Cdc42 and kinase-inactive mutants blocked Rac/Cdc42 stimulation of JNK activity. Inhibitory mutants of MEKK1-4 did not affect p21-activated kinase (PAK) activation of JNK, indicating that the PAK-regulated JNK pathway is independent of MEKKs. Thus, in different cellular locations, specific MEKKs are required for the regulation of MAPK family members, and MEKK1 and 4 are involved in the regulation of JNK activation by Rac/Cdc42 independent of PAK. Differential MEKK subcellular distribution and interaction with small GTP-binding proteins provides a mechanism to regulate MAP kinase responses in localized regions of the cell and to different upstream stimuli.

  10. Natural genetic variation in Arabidopsis for responsiveness to plant growth-promoting rhizobacteria.

    Science.gov (United States)

    Wintermans, Paul C A; Bakker, Peter A H M; Pieterse, Corné M J

    2016-04-01

    The plant growth-promoting rhizobacterium (PGPR) Pseudomonas simiae WCS417r stimulates lateral root formation and increases shoot growth in Arabidopsis thaliana (Arabidopsis). These plant growth-stimulating effects are partly caused by volatile organic compounds (VOCs) produced by the bacterium. Here, we performed a genome-wide association (GWA) study on natural genetic variation in Arabidopsis for the ability to profit from rhizobacteria-mediated plant growth-promotion. To this end, 302 Arabidopsis accessions were tested for root architecture characteristics and shoot fresh weight in response to exposure to WCS417r. Although virtually all Arabidopsis accessions tested responded positively to WCS417r, there was a large variation between accessions in the increase in shoot fresh weight, the extra number of lateral roots formed, and the effect on primary root length. Correlation analyses revealed that the bacterially-mediated increase in shoot fresh weight is related to alterations in root architecture. GWA mapping for WCS417r-stimulated changes in root and shoot growth characteristics revealed 10 genetic loci highly associated with the responsiveness of Arabidopsis to the plant growth-promoting activity of WCS417r. Several of the underlying candidate genes have been implicated in important plant growth-related processes. These results demonstrate that plants possess natural genetic variation for the capacity to profit from the plant growth-promoting function of a beneficial rhizobacterium in their rhizosphere. This knowledge is a promising starting point for sustainable breeding strategies for future crops that are better able to maximize profitable functions from their root microbiome.

  11. Arabidopsis MKS1 is involved in basal immunity and requires an intact N-terminal domain for proper function

    DEFF Research Database (Denmark)

    Petersen, Klaus; Qiu, Jin-Long; Lütje, Juri

    2010-01-01

    Innate immune signaling pathways in animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. MAP kinase 4 (MPK4) functions downstream of innate immune receptors via a nuclear substrate MKS1 to regulate the activity of the WRKY33 transcription factor, which in turn...

  12. Rho-kinase limits FGF-2-stimulated VEGF release in osteoblasts.

    Science.gov (United States)

    Natsume, Hideo; Tokuda, Haruhiko; Adachi, Seiji; Takai, Shinji; Matsushima-Nishiwaki, Rie; Kato, Kenji; Minamitani, Chiho; Niida, Shunpei; Mizutani, Jun; Kozawa, Osamu; Otsuka, Takanobu

    2010-04-01

    We previously reported that basic fibroblast growth factor (FGF-2) stimulates the release of vascular endothelial growth factor (VEGF) via p44/p42 mitogen-activated protein (MAP) kinase and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) in osteoblast-like MC3T3-E1 cells and that FGF-2-activated p38 MAP kinase negatively regulates the VEGF release in osteoblast-like MC3T3-E1 cells. In the present study, we investigated whether Rho-kinase is involved in FGF-2-stimulated VEGF release in MC3T3-E1 cells. FGF-2 induced the phosphorylation of myosin phosphatase targeting subunit (MYPT-1), a substrate of Rho-kinase. Y27632, a specific inhibitor of Rho-kinase, which attenuated the MYPT-1 phosphorylation, significantly enhanced the FGF-2-stimulated VEGF release. Fasudil, another Rho-kinase inhibitor, also amplified the VEGF release. FGF-2 significantly stimulated VEGF accumulation and fasudil enhanced FGF-2-stimulated VEGF accumulation also in whole cell lysates. Neither Y27632 nor fasudil affected the phosphorylation levels of p44/p42 MAP kinase or p38 MAP kinase. Y27632 and fasudil markedly strengthened the FGF-2-induced phosphorylation of SAPK/JNK. Y27632 as well as fasudil enhanced FGF-2-stimulated VEGF release and Y27632 enhanced the FGF-2-induced phosphorylation levels of SAPK/JNK also in human osteoblasts. These results strongly suggest that Rho-kinase negatively regulates FGF-2-stimulated VEGF release in osteoblasts.

  13. Triptolide down-regulates COX-2 expression and PGE2 release by suppressing the activity of NF-κB and MAP kinases in lipopolysaccharide-treated PC12 cells.

    Science.gov (United States)

    Geng, Yu; Fang, Marong; Wang, Jing; Yu, Haiyan; Hu, Zhiying; Yew, David T; Chen, Wei

    2012-03-01

    As an active compound extracted from the Chinese herb Tripterygium wilfordii, triptolide (TP) was demonstrated to have potent antiinflammatory and immunosuppressive properties in previous studies. Recently, it has been shown that TP prevented the loss of dopaminergic neurons in the substantia nigra of rats in a model of Parkinson's disease, but little is known about the precise neuroprotective mechanism of TP. This study was designed to elucidate whether the neuroprotective effect of TP is partially based on its direct inhibition of inflammatory molecules by investigating the effects of TP on the expression of cyclooxygenase (COX)-2 and prostaglandin E2 (PGE2) related to the nuclear factor (NF)-κB pathway in lipopolysaccharide (LPS)-stimulated PC12 cells. The activation of related upstream molecules such as NF-κB, P38, extracellular signal-regulated kinase (ERK)1/2, and beta-alanyl-alpha-ketoglutarate transaminase (AKT), in PC12 cells were investigated by real time polymerase chain reaction (PCR), western blotting and enzyme-linked immunosorbent assay (ELISA). Our results showed that TP directly inhibited the expression of both mRNA and protein of COX-2 (p < 0.01), decreased PGE2 production (p < 0.01) in a dose-dependent manner, down-regulated NF-κB activity (p < 0.01), and significantly inhibited the phosphorylation of p38, ERK1/2 (p42/p44) and AKT in PC12 cells after LPS challenge. This suggests that the neuroprotective effects of TP may be partially mediated by direct inhibition of the expression of COX-2, activation of NF-κB, and phosphorylation of p38, ERK1/2 (p42/p44) and AKT proteins of neuronal cells.

  14. Comparative genomics of Gossypium and Arabidopsis: Unraveling the consequences of both ancient and recent polyploidy

    Science.gov (United States)

    Rong, Junkang; Bowers, John E.; Schulze, Stefan R.; Waghmare, Vijay N.; Rogers, Carl J.; Pierce, Gary J.; Zhang, Hua; Estill, James C.; Paterson, Andrew H.

    2005-01-01

    Both ancient and recent polyploidy, together with post-polyploidization loss of many duplicated gene copies, complicates angiosperm comparative genomics. To explore an approach by which these challenges might be mitigated, genetic maps of extant diploid and tetraploid cottons (Gossypium spp.) were used to infer the approximate order of 3016 loci along the chromosomes of their hypothetical common ancestor. The inferred Gossypium gene order corresponded more closely than the original maps did to a similarly inferred ancestral gene order predating an independent paleopolyploidization (α) in Arabidopsis. At least 59% of the cotton map and 53% of the Arabidopsis transcriptome showed correspondence in multilocus gene arrangements based on one or both of two software packages (CrimeStatII, FISH). Genomic regions in which chromosome structural rearrangement has been rapid (obscuring gene order correspondence) have also been subject to greater divergence of individual gene sequences. About 26%-44% of corresponding regions involved multiple Arabidopsis or cotton chromosomes, in some cases consistent with known, more ancient, duplications. The genomic distributions of multiple-locus probes provided early insight into the consequences for chromosome structure of an ancient large-scale duplication in cotton. Inferences that mitigate the consequences of ancient duplications improve leveraging of genomic information for model organisms in the study of more complex genomes. PMID:16109973

  15. IL-1β activates p44/42 and p38 mitogen-activated protein kinases via different pathways in cat esophageal smooth muscle cells

    Institute of Scientific and Technical Information of China (English)

    Tai Sang Lee; Hyun Ju Song; Ji Hoon Jeong; Young Sil Min; Chang Yell Shin; Uy Dong Sohn

    2006-01-01

    AIM: To examine the pathway related to the IL-1β-induced activation of mitogen-activated protein (MAP)kinases in cat esophageal smooth muscle cells.METHODS: Culture of the esophageal smooth muscle cells from cat was prepared. Specific inhibitors were treated before applying the IL-1β. Western blot analysis was performed to detect the expressions of COX, iNOS and MAP kinases.RESULTS: In the primary cultured cells, although IL-1βfailed to upregulate the COX and iNOS levels, the levels of the phosphorylated forms of p44/42 MAP kinase and p38 MAP klnase increased in both concentration- and time-dependent manner, of which the level of activation reached a maximum within 3 and 18 h, respectively.The pertussis toxin reduced the level of p44/42 MAP kinase phosphorylation. Tyrphostin 51 and genistein also inhibited this activation. Neomycin decreased the density of the p44/42 MAP kinase band to the basal level.Phosphokinase C (PKC) was found to play a mediating role in the IL-1β-induced p44/42 MAP kinase activity.In contrast, the activation of p38 MAP kinase was inhibited only by a pretreatment with forskolin, and was unaffected by the other compounds.CONCLUSION: Based on these results, IL-1β-Induced p44/42 MAP kinase activation is mediated by the Gi protein, tyrosine kinase, phospholipase C (PLC) and PKC. The pathway for p38 MAP kinase phosphorylation is different from that of p44/42 MAP kinase, suggesting that it plays a different role in the cellular response to IL-1β.

  16. Jasmonate Signal Pathway in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Xiao-Yi Shan; Zhi-Long Wang; Daoxin Xie

    2007-01-01

    Jasmonates (JAs), which include jasmonic acid and its cyclopentane derivatives are synthesized from the octadecanoid pathway and widely distributed throughout the plant kingdom. JAs modulate the expression of numerous genes and mediate responses to stress, wounding, insect attack, pathogen infection, and UV damage. They also affect a variety of processes in many plant developmental processes. The JA signal pathway involves two important events: the biosynthesis of JA and the transduction of JA signal. Several important Arabidopsis mutants in jasmonate signal pathway were described in this review.

  17. AtPIN: Arabidopsis thaliana Protein Interaction Network

    Directory of Open Access Journals (Sweden)

    Silva-Filho Marcio C

    2009-12-01

    Full Text Available Abstract Background Protein-protein interactions (PPIs constitute one of the most crucial conditions to sustain life in living organisms. To study PPI in Arabidopsis thaliana we have developed AtPIN, a database and web interface for searching and building interaction networks based on publicly available protein-protein interaction datasets. Description All interactions were divided into experimentally demonstrated or predicted. The PPIs in the AtPIN database present a cellular compartment classification (C3 which divides the PPI into 4 classes according to its interaction evidence and subcellular localization. It has been shown in the literature that a pair of genuine interacting proteins are generally expected to have a common cellular role and proteins that have common interaction partners have a high chance of sharing a common function. In AtPIN, due to its integrative profile, the reliability index for a reported PPI can be postulated in terms of the proportion of interaction partners that two proteins have in common. For this, we implement the Functional Similarity Weight (FSW calculation for all first level interactions present in AtPIN database. In order to identify target proteins of cytosolic glutamyl-tRNA synthetase (Cyt-gluRS (AT5G26710 we combined two approaches, AtPIN search and yeast two-hybrid screening. Interestingly, the proteins glutamine synthetase (AT5G35630, a disease resistance protein (AT3G50950 and a zinc finger protein (AT5G24930, which has been predicted as target proteins for Cyt-gluRS by AtPIN, were also detected in the experimental screening. Conclusions AtPIN is a friendly and easy-to-use tool that aggregates information on Arabidopsis thaliana PPIs, ontology, and sub-cellular localization, and might be a useful and reliable strategy to map protein-protein interactions in Arabidopsis. AtPIN can be accessed at http://bioinfo.esalq.usp.br/atpin.

  18. SNF1-related protein kinases type 2 are involved in plant responses to cadmium stress.

    Science.gov (United States)

    Kulik, Anna; Anielska-Mazur, Anna; Bucholc, Maria; Koen, Emmanuel; Szymanska, Katarzyna; Zmienko, Agnieszka; Krzywinska, Ewa; Wawer, Izabela; McLoughlin, Fionn; Ruszkowski, Dariusz; Figlerowicz, Marek; Testerink, Christa; Sklodowska, Aleksandra; Wendehenne, David; Dobrowolska, Grazyna

    2012-10-01

    Cadmium ions are notorious environmental pollutants. To adapt to cadmium-induced deleterious effects plants have developed sophisticated defense mechanisms. However, the signaling pathways underlying the plant response to cadmium are still elusive. Our data demonstrate that SnRK2s (for SNF1-related protein kinase2) are transiently activated during cadmium exposure and are involved in the regulation of plant response to this stress. Analysis of tobacco (Nicotiana tabacum) Osmotic Stress-Activated Protein Kinase activity in tobacco Bright Yellow 2 cells indicates that reactive oxygen species (ROS) and nitric oxide, produced mainly via an l-arginine-dependent process, contribute to the kinase activation in response to cadmium. SnRK2.4 is the closest homolog of tobacco Osmotic Stress-Activated Protein Kinase in Arabidopsis (Arabidopsis thaliana). Comparative analysis of seedling growth of snrk2.4 knockout mutants versus wild-type Arabidopsis suggests that SnRK2.4 is involved in the inhibition of root growth triggered by cadmium; the mutants were more tolerant to the stress. Measurements of the level of three major species of phytochelatins (PCs) in roots of plants exposed to Cd(2+) showed a similar (PC2, PC4) or lower (PC3) concentration in snrk2.4 mutants in comparison to wild-type plants. These results indicate that the enhanced tolerance of the mutants does not result from a difference in the PCs level. Additionally, we have analyzed ROS accumulation in roots subjected to Cd(2+) treatment. Our data show significantly lower Cd(2+)-induced ROS accumulation in the mutants' roots. Concluding, the obtained results indicate that SnRK2s play a role in the regulation of plant tolerance to cadmium, most probably by controlling ROS accumulation triggered by cadmium ions.

  19. Mixed Lineage Kinase 3 negatively regulates IKK activity and enhances etoposide-induced cell death

    OpenAIRE

    Cole, Eric T.; Zhan, Yu; Abi Saab, Widian F.; Korchnak, Amanda C.; Ashburner, Brian P.; Chadee, Deborah N.

    2009-01-01

    Mixed Lineage Kinase 3 (MLK3) is a mitogen activated protein kinase kinase kinase (MAP3K) that activates multiple MAPK signaling pathways. Nuclear factor kappa B (NF-κB) is a transcription factor that has important functions in inflammation, immunity and cell survival. We found that silencing mlk3 expression with RNA interference (RNAi) in SKOV3 human ovarian cancer epithelial cells and NIH-3T3 murine fibroblasts led to a reduction in the level of the inhibitor of kappa B alpha (IκBα) protein...

  20. Evolutionary dynamics of leucine-rich repeat receptor-like kinases and related genes in plants:A phylogenomic approach

    Institute of Scientific and Technical Information of China (English)

    Tao Shi; Hongwen Huang; Michael J.Sanderson; Frans E.Tax

    2014-01-01

    Leucine-rich repeat (LRR) receptor-like kinases (RLKs), evolutionarily related LRR receptor-like proteins (RLPs) and receptor-like cytoplasmic kinases (RLCKs) have important roles in plant signaling, and their gene subfamilies are large with a complicated history of gene duplication and loss. In three pairs of closely related lineages, including Arabidopsis thaliana and A. lyrata (Arabidopsis), Lotus japonicus, and Medicago truncatula (Legumes), Oryza sativa ssp. japonica, and O. sativa ssp. indica (Rice), we find that LRR RLKs comprise the largest group of these LRR-related subfamilies, while the related RLCKs represent the smal est group. In addition, comparison of orthologs indicates a high frequency of reciprocal gene loss of the LRR RLK/LRR RLP/RLCK subfamilies. Furthermore, pairwise comparisons show that reciprocal gene loss is often associated with lineage-specific duplication(s) in the alternative lineage. Last, analysis of genes in A. thaliana involved in development revealed that most are highly conserved orthologs without species-specific duplication in the two Arabidopsis species and originated from older Arabidopsis-specific or rosid-specific duplications. We discuss potential pitfal s related to functional prediction for genes that have undergone frequent turnover (duplications, losses, and domain architecture changes), and conclude that prediction based on phylogenetic relationships wil likely outperform that based on sequence similarity alone.

  1. Reference: 572 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available et al. 2007 May. Plant J. 50(3):439-51. Although glycine-rich RNA-binding protein 2 (GRP2) has been implicated in plant re...sponses to environmental stresses, the function and importance of GRP2 in stress responses are largely unknown. Here...haliana under high-salinity, cold or osmotic stress. GRP2 affects seed germination of Arabidopsis plants under salt stre...ss, but does not influence seed germination and seedling growth of Arabidopsis plants under osmotic stre...ss. GRP2 accelerates seed germination and seedling growth in Arabidopsis plants under cold stre

  2. Glucose, other secretagogues, and nerve growth factor stimulate mitogen-activated protein kinase in the insulin-secreting beta-cell line, INS-1

    DEFF Research Database (Denmark)

    Frödin, M; Sekine, N; Roche, E;

    1995-01-01

    converge to activate 44-kDa mitogen-activated protein (MAP) kinase. Thus, glucose-induced insulin secretion was found to be associated with a small stimulatory effect on 44-kDa MAP kinase, which was synergistically enhanced by increased levels of intracellular cAMP and by the hormonal secretagogues...... glucagon-like peptide-1 and pituitary adenylate cyclase-activating polypeptide. Activation of 44-kDa MAP kinase by glucose was dependent on Ca2+ influx and may in part be mediated by MEK-1, a MAP kinase kinase. Stimulation of Ca2+ influx by KCl was in itself sufficient to activate 44-kDa MAP kinase and MEK......-1. Phorbol ester, an activator of protein kinase C, stimulated 44-kDa MAP kinase by both Ca(2+)-dependent and -independent pathways. Nerve growth factor, independently of changes in cytosolic Ca2+, efficiently stimulated 44-kDa MAP kinase without causing insulin release, indicating that activation...

  3. Tyrosine kinases in rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Kobayashi Akiko

    2011-08-01

    Full Text Available Abstract Rheumatoid arthritis (RA is an inflammatory, polyarticular joint disease. A number of cellular responses are involved in the pathogenesis of rheumatoid arthritis, including activation of inflammatory cells and cytokine expression. The cellular responses involved in each of these processes depends on the specific signaling pathways that are activated; many of which include protein tyrosine kinases. These pathways include the mitogen-activated protein kinase pathway, Janus kinases/signal transducers and activators transcription pathway, spleen tyrosine kinase signaling, and the nuclear factor κ-light-chain-enhancer of activated B cells pathway. Many drugs are in development to target tyrosine kinases for the treatment of RA. Based on the number of recently published studies, this manuscript reviews the role of tyrosine kinases in the pathogenesis of RA and the potential role of kinase inhibitors as new therapeutic strategies of RA.

  4. Re-Evaluation of Reportedly Metal Tolerant Arabidopsis thaliana Accessions

    Science.gov (United States)

    Silva-Guzman, Macarena; Addo-Quaye, Charles; Dilkes, Brian P.

    2016-01-01

    Santa Clara, Limeport, and Berkeley are Arabidopsis thaliana accessions previously identified as diversely metal resistant. Yet these same accessions were determined to be genetically indistinguishable from the metal sensitive Col-0. We robustly tested tolerance for Zn, Ni and Cu, and genetic relatedness by growing these accessions under a range of Ni, Zn and Cu concentrations for three durations in multiple replicates. Neither metal resistance nor variance in growth were detected between them and Col-0. We re-sequenced the genomes of these accessions and all stocks available for each accession. In all cases they were nearly indistinguishable from the standard laboratory accession Col-0. As Santa Clara was allegedly collected from the Jasper Ridge serpentine outcrop in California, USA we investigated the possibility of extant A. thaliana populations adapted to serpentine soils. Botanically vouchered Arabidopsis accessions in the Jepson database were overlaid with soil maps of California. This provided no evidence of A. thaliana collections from serpentine sites in California. Thus, our work demonstrates that the Santa Clara, Berkeley and Limeport accessions are not metal tolerant, not genetically distinct from Col-0, and that there are no known serpentine adapted populations or accessions of A. thaliana. PMID:27467746

  5. Enterococcus faecalis phosphomevalonate kinase

    OpenAIRE

    Doun, Stephanie S.; Burgner, John W.; Briggs, Scott D.; Rodwell, Victor W.

    2005-01-01

    The six enzymes of the mevalonate pathway of isopentenyl diphosphate biosynthesis represent potential for addressing a pressing human health concern, the development of antibiotics against resistant strains of the Gram-positive streptococci. We previously characterized the first four of the mevalonate pathway enzymes of Enterococcus faecalis, and here characterize the fifth, phosphomevalonate kinase (E.C. 2.7.4.2). E. faecalis genomic DNA and the polymerase chain reaction were used to clone D...

  6. Oncoprotein protein kinase

    Energy Technology Data Exchange (ETDEWEB)

    Karin, Michael (San Diego, CA); Hibi, Masahiko (San Diego, CA); Lin, Anning (La Jolla, CA); Davis, Roger (Princeton, MA); Derijard, Benoit (Shrewsbury, MA)

    2003-02-04

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  7. The Medicago truncatula lysin [corrected] motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes.

    Science.gov (United States)

    Arrighi, Jean-François; Barre, Annick; Ben Amor, Besma; Bersoult, Anne; Soriano, Lidia Campos; Mirabella, Rossana; de Carvalho-Niebel, Fernanda; Journet, Etienne-Pascal; Ghérardi, Michèle; Huguet, Thierry; Geurts, René; Dénarié, Jean; Rougé, Pierre; Gough, Clare

    2006-09-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide further evidence for this by showing that NFP is a lysin [corrected] motif (LysM)-receptor-like kinase (RLK). NFP was shown both to be expressed in association with infection thread development and to be involved in the infection process. Consistent with deviations from conserved kinase domain sequences, NFP did not show autophosphorylation activity, suggesting that NFP needs to associate with an active kinase or has unusual functional characteristics different from classical kinases. Identification of nine new M. truncatula LysM-RLK genes revealed a larger family than in the nonlegumes Arabidopsis (Arabidopsis thaliana) or rice (Oryza sativa) of at least 17 members that can be divided into three subfamilies. Three LysM domains could be structurally predicted for all M. truncatula LysM-RLK proteins, whereas one subfamily, which includes NFP, was characterized by deviations from conserved kinase sequences. Most of the newly identified genes were found to be expressed in roots and nodules, suggesting this class of receptors may be more extensively involved in nodulation than was previously known.

  8. Function and interaction of maturation-promoting factor and mitogen-activated protein kinase during meiotic maturation and fertilization of oocyte

    Institute of Scientific and Technical Information of China (English)

    HUO Lijun; FAN Hengyu; CHEN Dayuan; SUN Qingyuan

    2004-01-01

    Mitogen-activated protein kinase (MAP kinase) cascade and maturation-promoting factor (MPF) play very important roles during meiotic maturation and fertilization of oocyte. Interaction between MAP kinase and MPF influences meiotic maturation and fertilization of oocyte throughout the animal kingdom, including stimulation of germinal vesicle breakdown (GVBD), suppression of DNA replication, control of meiotic chromosome segregation, maintenance of metaphase II arrest, and resumption and completion of second meiosis. This review focuses on the function and interaction of MAP kinase and MPF during meiotic maturation and fertilization of oocyte.

  9. W55a Encodes a Novel Protein Kinase That Is Involved in Multiple Stress Responses

    Institute of Scientific and Technical Information of China (English)

    Zhao-Shi Xu; Li Liu; Zhi-Yong Ni; Pei Liu; Ming Chen; Lian-Cheng Li; Yao-Feng Chen; You-Zhi Ma

    2009-01-01

    Protein kinases play crucial roles In response to external environment stress signals. A putative protein kinase, W55a, belonging to SNF1-related protein kinase 2 (SnRK2) subfamily, was isolated from a cDNA library of drought-treated wheat seedlings. The entire length of W55a was obtained using rapid amplification of 5' cDNA ends (5'-RACE) and reverse transcription-polymerase chain reaction(RT-PCR). It contains a 1029-bp open reading frame (ORF) encoding 342 amino acids. The deduced amino acid sequence of W55a had eleven conserved catalytic subdomains and one Ser/Thr protein kinase active-site that characterize Ser/Thr protein kinases. Phylogenetic analysis showed that W55a was 90.38% homologous with rice SAPK1, a member of the SnRK2 family. Using nullisomic-tetrasomic and ditelocentric lines of Chinese Spring, W55a was located on chromosome 2BS. Expression pattern analysis revealed that W55a was upregulated by drought and salt, exogenous abscisic acid, salicylic acid, ethylene and methyl jasmonata, but was not responsive to cold stress. In addition, W55a transcripts were abundant in leaves, but not in roots or stems, under environmental stresses. Transgenic Arabidopsis plants overexprassing W55a exhibited higher tolerance to drought. Based on these findings, W55a encodes a novel dehydration-responsive protein kinase that is involved in multiple stress signal transductions.

  10. TORNADO1 regulates root epidermal patterning through the WEREWOLF pathway in Arabidopsis thaliana.

    Science.gov (United States)

    Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

    2015-01-01

    Cell fate in the root epidermis of Arabidopsis thaliana is determined in a position-dependent manner. SCRAMBLED (SCM), an atypical leucine-rich repeat receptor-like kinase, mediates this positional regulation via its effect on WEREWOLF (WER) expression, and subsequently, its downstream transcription factor, GLABRA2 (GL2), which are required for nonhair cell development. Previously, TORNADO1 (TRN1), a plant-specific protein with a leucine-rich repeat ribonuclease inhibitor-like domain, was shown to be required for proper epidermal patterning in Arabidopsis roots. In this work, we analyzed the possible involvement of TRN1 in the known root epidermal gene network. We discovered that the trn1 mutant caused the ectopic expression of WER and the randomized expression of GL2 and EGL3. This suggests that TRN1 regulates the position-dependent cell fate determination by affecting WER expression in Arabidopsis root epidermis. Additionally, the distinct phenotypes of the aerial parts of the trn1-t and scm-2 mutant suggest that TRN1 and SCM might have different functions in the development of aerial parts.

  11. Arabidopsis CDS blastp result: AK065259 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK065259 J013002J18 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...

  12. Arabidopsis CDS blastp result: AK102134 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK102134 J033085F12 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...

  13. Arabidopsis CDS blastp result: AK066835 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066835 J013087I16 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 1e-171 ...

  14. Arabidopsis CDS blastp result: AK100523 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK100523 J023100P04 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...

  15. Arabidopsis CDS blastp result: AK102695 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK102695 J033103F21 At5g16910.1 cellulose synthase family protein similar to gi:2827143 cellulose... synthase catalytic subunit, Arabidopsis thaliana, gi:9622886 cellulose synthase-7 from Zea mays 0.0 ...

  16. Reference: 488 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available Inactivation of ATAB2 strongly affects Arabidopsis development and thylakoid mem...n center subunits is decreased and the association of their mRNAs with polysomes is affected. ATAB2 is a chl

  17. Reference: 212 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available identified in pea (Pisum sativum) using biochemical approaches. The Arabidopsis (...C75-IV, which we studied using a range of molecular, genetic, and biochemical techniques. Expression of atTO

  18. Reference: 480 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available activity was analyzed. Compared to all other Suc transporters, AtSUC9 had an ult...abidopsis (Arabidopsis thaliana) L. Heynh., was expressed in Xenopus (Xenopus laevis) oocytes, and transport

  19. Reference: 507 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available een them. However, little is known about the mechanisms that regulate the two pathways and the metabolic cro...ss-talk. To identify such regulatory mechanisms, we isolated and characterized the Arabidopsis T-DNA inserti

  20. Reference: 278 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available functional ERA1 gene, which encodes the beta-subunit of protein farnesyltransferase (PFT), exhibit pleiotropic effects...gnaling and meristem development. Here, we report the effects of T-DNA insertion mutations in the Arabidopsi