Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian
2016-07-01
Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Vendramin Giovanni G
2010-06-01
Full Text Available Abstract Background Tropical trees undergo severe stress through seasonal drought and flooding, and the ability of these species to respond may be a major factor in their survival in tropical ecosystems, particularly in relation to global climate change. Aquaporins are involved in the regulation of water flow and have been shown to be involved in drought response; they may therefore play a major adaptive role in these species. We describe genetic diversity in the PIP sub-family of the widespread gene family of Aquaporins in five Neotropical tree species covering four botanical families. Results PIP Aquaporin subfamily genes were isolated, and their DNA sequence polymorphisms characterised in natural populations. Sequence data were analysed with statistical tests of standard neutral equilibrium and demographic scenarios simulated to compare with the observed results. Chloroplast SSRs were also used to test demographic transitions. Most gene fragments are highly polymorphic and display signatures of balancing selection or bottlenecks; chloroplast SSR markers have significant statistics that do not conform to expectations for population bottlenecks. Although not incompatible with a purely demographic scenario, the combination of all tests tends to favour a selective interpretation of extant gene diversity. Conclusions Tropical tree PIP genes may generally undergo balancing selection, which may maintain high levels of genetic diversity at these loci. Genetic variation at PIP genes may represent a response to variable environmental conditions.
Shivaraj, S M; Deshmukh, Rupesh K; Rai, Rhitu; Bélanger, Richard; Agrawal, Pawan K; Dash, Prasanta K
2017-04-27
Membrane intrinsic proteins (MIPs) form transmembrane channels and facilitate transport of myriad substrates across the cell membrane in many organisms. Majority of plant MIPs have water transporting ability and are commonly referred as aquaporins (AQPs). In the present study, we identified aquaporin coding genes in flax by genome-wide analysis, their structure, function and expression pattern by pan-genome exploration. Cross-genera phylogenetic analysis with known aquaporins from rice, arabidopsis, and poplar showed five subgroups of flax aquaporins representing 16 plasma membrane intrinsic proteins (PIPs), 17 tonoplast intrinsic proteins (TIPs), 13 NOD26-like intrinsic proteins (NIPs), 2 small basic intrinsic proteins (SIPs), and 3 uncharacterized intrinsic proteins (XIPs). Amongst aquaporins, PIPs contained hydrophilic aromatic arginine (ar/R) selective filter but TIP, NIP, SIP and XIP subfamilies mostly contained hydrophobic ar/R selective filter. Analysis of RNA-seq and microarray data revealed high expression of PIPs in multiple tissues, low expression of NIPs, and seed specific expression of TIP3 in flax. Exploration of aquaporin homologs in three closely related Linum species bienne, grandiflorum and leonii revealed presence of 49, 39 and 19 AQPs, respectively. The genome-wide identification of aquaporins, first in flax, provides insight to elucidate their physiological and developmental roles in flax.
Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).
Deokar, Amit A; Tar'an, Bunyamin
2016-01-01
Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness
Directory of Open Access Journals (Sweden)
Giovannetti Marco
2012-10-01
Full Text Available Abstract Background Arbuscular mycorrhizas (AM are widespread symbioses that provide great advantages to the plant, improving its nutritional status and allowing the fungus to complete its life cycle. Nevertheless, molecular mechanisms that lead to the development of AM symbiosis are not yet fully deciphered. Here, we have focused on two putative aquaporin genes, LjNIP1 and LjXIP1, which resulted to be upregulated in a transcriptomic analysis performed on mycorrhizal roots of Lotus japonicus. Results A phylogenetic analysis has shown that the two putative aquaporins belong to different functional families: NIPs and XIPs. Transcriptomic experiments have shown the independence of their expression from their nutritional status but also a close correlation with mycorrhizal and rhizobial interaction. Further transcript quantification has revealed a good correlation between the expression of one of them, LjNIP1, and LjPT4, the phosphate transporter which is considered a marker gene for mycorrhizal functionality. By using laser microdissection, we have demonstrated that one of the two genes, LjNIP1, is expressed exclusively in arbuscule-containing cells. LjNIP1, in agreement with its putative role as an aquaporin, is capable of transferring water when expressed in yeast protoplasts. Confocal analysis have demonstrated that eGFP-LjNIP1, under its endogenous promoter, accumulates in the inner membrane system of arbusculated cells. Conclusions Overall, the results have shown different functionality and expression specificity of two mycorrhiza-inducible aquaporins in L. japonicus. One of them, LjNIP1 can be considered a novel molecular marker of mycorrhizal status at different developmental stages of the arbuscule. At the same time, LjXIP1 results to be the first XIP family aquaporin to be transcriptionally regulated during symbiosis.
Directory of Open Access Journals (Sweden)
Zhi Zou
Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.
The Aquaporin Gene Family of the Yellow Fever Mosquito, Aedes aegypti
Drake, Lisa L.; Boudko, Dmitri Y.; Marinotti, Osvaldo; Carpenter, Victoria K.; Dawe, Angus L.; Hansen, Immo A.
2010-01-01
Background The mosquito, Aedes aegypti, is the principal vector of the Dengue and yellow fever viruses. During feeding, an adult female can take up more than its own body weight in vertebrate blood. After a blood meal females excrete large amounts of urine through their excretion system, the Malpighian tubules (MT). Diuresis starts within seconds after the mosquito starts feeding. Aquaporins (AQPs) are a family of membrane transporters that regulate the flow of water, glycerol and other small...
Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène
2013-01-01
Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy
Directory of Open Access Journals (Sweden)
David Cohen
Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of
Parreira, Kleber S; Debaix, Huguette; Cnops, Yvette; Geffers, Lars; Devuyst, Olivier
2009-08-01
High-throughput analyses have shown that aquaporins (AQPs) belong to a cluster of genes that are differentially expressed during kidney organogenesis. However, the spatiotemporal expression patterns of the AQP gene family during tubular maturation and the potential influence of genetic variation on these patterns and on water handling remain unknown. We investigated the expression patterns of all AQP isoforms in fetal (E13.5 to E18.5), postnatal (P1 to P28), and adult (9 weeks) kidneys of inbred (C57BL/6J) and outbred (CD-1) mice. Using quantitative polymerase chain reaction (PCR), we evidenced two mRNA patterns during tubular maturation in C57 mice. The AQPs 1-7-11 showed an early (from E14.5) and progressive increase to adult levels, similar to the mRNA pattern observed for proximal tubule markers (Megalin, NaPi-IIa, OAT1) and reflecting the continuous increase in renal cortical structures during development. By contrast, AQPs 2-3-4 showed a later (E15.5) and more abrupt increase, with transient postnatal overexpression. Most AQP genes were expressed earlier and/or stronger in maturing CD-1 kidneys. Furthermore, adult CD-1 kidneys expressed more AQP2 in the collecting ducts, which was reflected by a significant delay in excreting a water load. The expression patterns of proximal vs. distal AQPs and the earlier expression in the CD-1 strain were confirmed by immunoblotting and immunostaining. These data (1) substantiate the clustering of important genes during tubular maturation and (2) demonstrate that genetic variability influences the regulation of the AQP gene family during tubular maturation and water handling by the mature kidney.
Genome-wide identification and expression analysis of aquaporins in tomato.
Reuscher, Stefan; Akiyama, Masahito; Mori, Chiharu; Aoki, Koh; Shibata, Daisuke; Shiratake, Katsuhiro
2013-01-01
The family of aquaporins, also called water channels or major intrinsic proteins, is characterized by six transmembrane domains that together facilitate the transport of water and a variety of low molecular weight solutes. They are found in all domains of life, but show their highest diversity in plants. Numerous studies identified aquaporins as important targets for improving plant performance under drought stress. The phylogeny of aquaporins is well established based on model species like Arabidopsis thaliana, which can be used as a template to investigate aquaporins in other species. In this study we comprehensively identified aquaporin encoding genes in tomato (Solanum lycopersicum), which is an important vegetable crop and also serves as a model for fleshy fruit development. We found 47 aquaporin genes in the tomato genome and analyzed their structural features. Based on a phylogenetic analysis of the deduced amino acid sequences the aquaporin genes were assigned to five subfamilies (PIPs, TIPs, NIPs, SIPs and XIPs) and their substrate specificity was assessed on the basis of key amino acid residues. As ESTs were available for 32 genes, expression of these genes was analyzed in 13 different tissues and developmental stages of tomato. We detected tissue-specific and development-specific expression of tomato aquaporin genes, which is a first step towards revealing the contribution of aquaporins to water and solute transport in leaves and during fruit development.
Genome-wide identification and expression analysis of aquaporins in tomato.
Directory of Open Access Journals (Sweden)
Stefan Reuscher
Full Text Available The family of aquaporins, also called water channels or major intrinsic proteins, is characterized by six transmembrane domains that together facilitate the transport of water and a variety of low molecular weight solutes. They are found in all domains of life, but show their highest diversity in plants. Numerous studies identified aquaporins as important targets for improving plant performance under drought stress. The phylogeny of aquaporins is well established based on model species like Arabidopsis thaliana, which can be used as a template to investigate aquaporins in other species. In this study we comprehensively identified aquaporin encoding genes in tomato (Solanum lycopersicum, which is an important vegetable crop and also serves as a model for fleshy fruit development. We found 47 aquaporin genes in the tomato genome and analyzed their structural features. Based on a phylogenetic analysis of the deduced amino acid sequences the aquaporin genes were assigned to five subfamilies (PIPs, TIPs, NIPs, SIPs and XIPs and their substrate specificity was assessed on the basis of key amino acid residues. As ESTs were available for 32 genes, expression of these genes was analyzed in 13 different tissues and developmental stages of tomato. We detected tissue-specific and development-specific expression of tomato aquaporin genes, which is a first step towards revealing the contribution of aquaporins to water and solute transport in leaves and during fruit development.
Hu, Wei; Hou, Xiaowan; Huang, Chao; Yan, Yan; Tie, Weiwei; Ding, Zehong; Wei, Yunxie; Liu, Juhua; Miao, Hongxia; Lu, Zhiwei; Li, Meiying; Xu, Biyu; Jin, Zhiqiang
2015-01-01
Aquaporins (AQPs) function to selectively control the flow of water and other small molecules through biological membranes, playing crucial roles in various biological processes. However, little information is available on the AQP gene family in bananas. In this study, we identified 47 banana AQP genes based on the banana genome sequence. Evolutionary analysis of AQPs from banana, Arabidopsis, poplar, and rice indicated that banana AQPs (MaAQPs) were clustered into four subfamilies. Conserved motif analysis showed that all banana AQPs contained the typical AQP-like or major intrinsic protein (MIP) domain. Gene structure analysis suggested the majority of MaAQPs had two to four introns with a highly specific number and length for each subfamily. Expression analysis of MaAQP genes during fruit development and postharvest ripening showed that some MaAQP genes exhibited high expression levels during these stages, indicating the involvement of MaAQP genes in banana fruit development and ripening. Additionally, some MaAQP genes showed strong induction after stress treatment and therefore, may represent potential candidates for improving banana resistance to abiotic stress. Taken together, this study identified some excellent tissue-specific, fruit development- and ripening-dependent, and abiotic stress-responsive candidate MaAQP genes, which could lay a solid foundation for genetic improvement of banana cultivars. PMID:26307965
Characterization of V71M mutation in the aquaporin-2 gene causing ...
Indian Academy of Sciences (India)
Introduction. The aquaporin-2 (AQP2) water channel plays an important ... X-ray structure of lens aquaporin-0 open form (Lens Mip) as template (pdb. Keywords. AQP2 gene; nephrogenic diabetes insipidus; mutation; structural modelling.
The Aquaporin gene family of the yellow fever mosquito, Aedes aegypti.
Directory of Open Access Journals (Sweden)
Lisa L Drake
2010-12-01
Full Text Available The mosquito, Aedes aegypti, is the principal vector of the Dengue and yellow fever viruses. During feeding, an adult female can take up more than its own body weight in vertebrate blood. After a blood meal females excrete large amounts of urine through their excretion system, the Malpighian tubules (MT. Diuresis starts within seconds after the mosquito starts feeding. Aquaporins (AQPs are a family of membrane transporters that regulate the flow of water, glycerol and other small molecules across cellular membranes in both prokaryotic and eukaryotic cells. Our aim was to identify aquaporins that function as water channels, mediating transcellular water transport in MTs of adult female Ae. aegypti.Using a bioinformatics approach we screened genome databases and identified six putative AQPs in the genome of Ae. aegypti. Phylogenetic analysis showed that five of the six Ae. aegypti AQPs have high similarity to classical water-transporting AQPs of vertebrates. Using microarray, reverse transcription and real time PCR analysis we found that all six AQPs are expressed in distinct patterns in mosquito tissues/body parts. AaAQP1, 4, and 5 are strongly expressed in the adult female MT. RNAi-mediated knockdown of the MT-expressed mosquito AQPs resulted in significantly reduced diuresis.Our results support the notion that AQP1, 4, and 5 function as water transporters in the MTs of adult female Ae. aegypti mosquitoes. Our results demonstrate the importance of these AQPs for mosquito diuresis after blood ingestion and highlight their potential as targets for the development of novel vector control strategies.
The Aquaporin gene family of the yellow fever mosquito, Aedes aegypti.
Drake, Lisa L; Boudko, Dmitri Y; Marinotti, Osvaldo; Carpenter, Victoria K; Dawe, Angus L; Hansen, Immo A
2010-12-29
The mosquito, Aedes aegypti, is the principal vector of the Dengue and yellow fever viruses. During feeding, an adult female can take up more than its own body weight in vertebrate blood. After a blood meal females excrete large amounts of urine through their excretion system, the Malpighian tubules (MT). Diuresis starts within seconds after the mosquito starts feeding. Aquaporins (AQPs) are a family of membrane transporters that regulate the flow of water, glycerol and other small molecules across cellular membranes in both prokaryotic and eukaryotic cells. Our aim was to identify aquaporins that function as water channels, mediating transcellular water transport in MTs of adult female Ae. aegypti. Using a bioinformatics approach we screened genome databases and identified six putative AQPs in the genome of Ae. aegypti. Phylogenetic analysis showed that five of the six Ae. aegypti AQPs have high similarity to classical water-transporting AQPs of vertebrates. Using microarray, reverse transcription and real time PCR analysis we found that all six AQPs are expressed in distinct patterns in mosquito tissues/body parts. AaAQP1, 4, and 5 are strongly expressed in the adult female MT. RNAi-mediated knockdown of the MT-expressed mosquito AQPs resulted in significantly reduced diuresis. Our results support the notion that AQP1, 4, and 5 function as water transporters in the MTs of adult female Ae. aegypti mosquitoes. Our results demonstrate the importance of these AQPs for mosquito diuresis after blood ingestion and highlight their potential as targets for the development of novel vector control strategies.
Directory of Open Access Journals (Sweden)
Zhi eZou
2016-03-01
Full Text Available Aquaporins (AQPs are channel-forming integral membrane proteins that transport water and other small solutes across biological membranes. Despite the vital role of AQPs, to date, little is known in physic nut (Jatropha curcas L., Euphorbiaceae, an important non-edible oilseed crop with great potential for the production of biodiesel. In this study, 32 AQP genes were identified from the physic nut genome and the family number is relatively small in comparison to 51 in another Euphorbiaceae plant, rubber tree (Hevea brasiliensis Muell. Arg.. Based on the phylogenetic analysis, the JcAQPs were assigned to five subfamilies, i.e., 9 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 2 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs. Like rubber tree and other plant species, functional prediction based on the aromatic/arginine selectivity filter, Froger’s positions and specificity-determining positions showed a remarkable difference in substrate specificity among subfamilies of JcAQPs. Genome-wide comparative analysis revealed the specific expansion of PIP and TIP subfamilies in rubber tree and the specific gene loss of the XIP subfamily in physic nut. Furthermore, by analyzing deep transcriptome sequencing data, the expression evolution especially the expression divergence of duplicated HbAQP genes was also investigated and discussed. Results obtained from this study not only provide valuable information for future functional analysis and utilization of Jc/HbAQP genes, but also provide a useful reference to survey the gene family expansion and evolution in Euphorbiaceae plants and other plant species.
Directory of Open Access Journals (Sweden)
Chuanju Dong
Full Text Available Aquaporins (Aqps are integral membrane proteins that facilitate the transport of water and small solutes across cell membranes. Among vertebrate species, Aqps are highly conserved in both gene structure and amino acid sequence. These proteins are vital for maintaining water homeostasis in living organisms, especially for aquatic animals such as teleost fish. Studies on teleost Aqps are mainly limited to several model species with diploid genomes. Common carp, which has a tetraploidized genome, is one of the most common aquaculture species being adapted to a wide range of aquatic environments. The complete common carp genome has recently been released, providing us the possibility for gene evolution of aqp gene family after whole genome duplication.In this study, we identified a total of 37 aqp genes from common carp genome. Phylogenetic analysis revealed that most of aqps are highly conserved. Comparative analysis was performed across five typical vertebrate genomes. We found that almost all of the aqp genes in common carp were duplicated in the evolution of the gene family. We postulated that the expansion of the aqp gene family in common carp was the result of an additional whole genome duplication event and that the aqp gene family in other teleosts has been lost in their evolution history with the reason that the functions of genes are redundant and conservation. Expression patterns were assessed in various tissues, including brain, heart, spleen, liver, intestine, gill, muscle, and skin, which demonstrated the comprehensive expression profiles of aqp genes in the tetraploidized genome. Significant gene expression divergences have been observed, revealing substantial expression divergences or functional divergences in those duplicated aqp genes post the latest WGD event.To some extent, the gene families are also considered as a unique source for evolutionary studies. Moreover, the whole set of common carp aqp gene family provides an
Directory of Open Access Journals (Sweden)
Simone Lima São Pedro
Full Text Available Marine mammals are well adapted to their hyperosmotic environment. Several morphological and physiological adaptations for water conservation and salt excretion are known to be present in cetaceans, being responsible for regulating salt balance. However, most previous studies have focused on the unique renal physiology of marine mammals, but the molecular bases of these mechanisms remain poorly explored. Many genes have been identified to be involved in osmotic regulation, including the aquaporins. Considering that aquaporin genes were potentially subject to strong selective pressure, the aim of this study was to analyze the molecular evolution of seven aquaporin genes (AQP1, AQP2, AQP3, AQP4, AQP6, AQP7, and AQP9 comparing the lineages of cetaceans and terrestrial mammals.Our results demonstrated strong positive selection in cetacean-specific lineages acting only in the gene for AQP2 (amino acids 23, 83, 107,179, 180, 181, 182, whereas no selection was observed in terrestrial mammalian lineages. We also analyzed the changes in the 3D structure of the aquaporin 2 protein. Signs of strong positive selection in AQP2 sites 179, 180, 181, and 182 were unexpectedly identified only in the baiji lineage, which was the only river dolphin examined in this study. Positive selection in aquaporins AQP1 (45, AQP4 (74, AQP7 (342, 343, 356 was detected in cetaceans and artiodactyls, suggesting that these events are not related to maintaining water and electrolyte homeostasis in seawater.Our results suggest that the AQP2 gene might reflect different selective pressures in maintaining water balance in cetaceans, contributing to the passage from the terrestrial environment to the aquatic. Further studies are necessary, especially those including other freshwater dolphins, who exhibit osmoregulatory mechanisms different from those of marine cetaceans for the same essential task of maintaining serum electrolyte balance.
Carbon dioxide and water transport through plant aquaporins.
Groszmann, Michael; Osborn, Hannah L; Evans, John R
2017-06-01
Aquaporins are channel proteins that function to increase the permeability of biological membranes. In plants, aquaporins are encoded by multigene families that have undergone substantial diversification in land plants. The plasma membrane intrinsic proteins (PIPs) subfamily of aquaporins is of particular interest given their potential to improve plant water relations and photosynthesis. Flowering plants have between 7 and 28 PIP genes. Their expression varies with tissue and cell type, through development and in response to a variety of factors, contributing to the dynamic and tissue specific control of permeability. There are a growing number of PIPs shown to act as water channels, but those altering membrane permeability to CO 2 are more limited. The structural basis for selective substrate specificities has not yet been resolved, although a few key amino acid positions have been identified. Several regions important for dimerization, gating and trafficking are also known. PIP aquaporins assemble as tetramers and their properties depend on the monomeric composition. PIPs control water flux into and out of veins and stomatal guard cells and also increase membrane permeability to CO 2 in mesophyll and stomatal guard cells. The latter increases the effectiveness of Rubisco and can potentially influence transpiration efficiency. © 2016 John Wiley & Sons Ltd.
Boccalandro, C.; Mattia, F.P. de; Guo, D.C.; Xue, L.; Orlander, P.; King, T.M.; Gupta, P.; Deen, P.M.T.; Lavis, V.R.; Milewicz, D.M.
2004-01-01
A Mexican family with partial congenital nephrogenic diabetes insipidus (NDI) that resulted from a mutation in the aquaporin-2 water channel (AQP2) was characterized, and the source of this rare mutation was traced to the family's town of origin in Mexico. Affected individuals with profound polyuria
Renal aquaporins and sodium transporters with special focus on urinary tract obstruction
DEFF Research Database (Denmark)
Frøkiaer, Jørgen; Li, Chunling; Shi, Yimin
2003-01-01
seven aquaporins are expressed at distinct sites in the kidney and 4 members of this family (AQP1-4) have been demonstrated to play pivotal roles in the physiology and pathophysiology for renal regulation of body water balance. Osmotic equilibration via renal aquaporins is maintained by active transport......The discovery of aquaporin-1 (AQP1) by Agre and colleagues explained the long-standing biophysical question of how water specifically crosses biological membranes. These studies led to the discovery and identification of a whole new family of membrane proteins, the aquaporins. At present, at least...
New challenges in plant aquaporin biotechnology.
Martinez-Ballesta, Maria del Carmen; Carvajal, Micaela
2014-03-01
Recent advances concerning genetic manipulation provide new perspectives regarding the improvement of the physiological responses in herbaceous and woody plants to abiotic stresses. The beneficial or negative effects of these manipulations on plant physiology are discussed, underlining the role of aquaporin isoforms as representative markers of water uptake and whole plant water status. Increasing water use efficiency and the promotion of plant water retention seem to be critical goals in the improvement of plant tolerance to abiotic stress. However, newly uncovered mechanisms, such as aquaporin functions and regulation, may be essential for the beneficial effects seen in plants overexpressing aquaporin genes. Under distinct stress conditions, differences in the phenotype of transgenic plants where aquaporins were manipulated need to be analyzed. In the development of nano-technologies for agricultural practices, multiple-walled carbon nanotubes promoted plant germination and cell growth. Their effects on aquaporins need further investigation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong
2012-07-25
To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.
Christensen, Nathan; D'Souza, Mary; Zhu, Xiaoxia; Frisina, Robert D.
2009-01-01
Presbycusis – age-related hearing loss, is the number one communication disorder, and one of the top three chronic medical conditions of our aged population. Aquaporins, particularly aquaporin 4 (Aqp4), are membrane proteins with important roles in water and ion flux across cell membranes, including cells of the inner ear and pathways of the brain used for hearing. To more fully understand the biological bases of presbycusis, 39 CBA mice, a well-studied animal model of presbycusis, underwent non-invasive hearing testing as a function of sound frequency (auditory brainstem response – ABR thresholds, and distortion-product otoacoustic emission – DPOAE magnitudes), and were clustered into four groups based on age and hearing ability. Aqp4 gene expression, as determined by genechip microarray analysis and quantitative real-time PCR, was compared to the young adult control group in the three older groups: middle aged with good hearing, old age with mild presbycusis, and old age with severe presbycusis. Linear regression and ANOVA showed statistically significant changes in Aqp4 gene expression and ABR and DPOAE hearing status in the cochlea and auditory midbrain – inferior colliculus. Down-regulation in the cochlea was seen, and an initial down-, then up-regulation was discovered for the inferior colliculus Aqp4 expression. It is theorized that these changes in Aqp4 gene expression represent an age-related disruption of ion flux in the fluids of the cochlea that are responsible for ionic gradients underlying sound transduction in cochlear hair cells necessary for hearing. In regard to central auditory processing at the level of the auditory midbrain, aquaporin gene expression changes may affect neurotransmitter cycling involving supporting cells, thus impairing complex sound neural processing with age. PMID:19070604
Directory of Open Access Journals (Sweden)
Takashi Negishi
Full Text Available Hydrangea (Hydrangea macrophylla is tolerant of acidic soils in which toxicity generally arises from the presence of the soluble aluminum (Al ion. When hydrangea is cultivated in acidic soil, its resulting blue sepal color is caused by the Al complex formation of anthocyanin. The concentration of vacuolar Al in blue sepal cells can reach levels in excess of approximately 15 mM, suggesting the existence of an Al-transport and/or storage system. However, until now, no Al transporter has been identified in Al hyperaccumulating plants, animals or microorganisms. To identify the transporter being responsible for Al hyperaccumulation, we prepared a cDNA library from blue sepals according to the sepal maturation stage, and then selected candidate genes using a microarray analysis and an in silico study. Here, we identified the vacuolar and plasma membrane-localized Al transporters genes vacuolar Al transporter (VALT and plasma membrane Al transporter 1 (PALT1, respectively, which are both members of the aquaporin family. The localization of each protein was confirmed by the transient co-expression of the genes. Reverse transcription-PCR and immunoblotting results indicated that VALT and PALT1 are highly expressed in sepal tissue. The overexpression of VALT and PALT1 in Arabidopsis thaliana conferred Al-tolerance and Al-sensitivity, respectively.
Aquaporin-11: A channel protein lacking apparent transport function expressed in brain
Directory of Open Access Journals (Sweden)
Tsunenari Takashi
2006-05-01
Full Text Available Abstract Background The aquaporins are a family of integral membrane proteins composed of two subfamilies: the orthodox aquaporins, which transport only water, and the aquaglyceroporins, which transport glycerol, urea, or other small solutes. Two recently described aquaporins, numbers 11 and 12, appear to be more distantly related to the other mammalian aquaporins and aquaglyceroporins. Results We report on the characterization of Aquaporin-11 (AQP11. AQP11 RNA and protein is found in multiple rat tissues, including kidney, liver, testes and brain. AQP11 has a unique distribution in brain, appearing in Purkinje cell dendrites, hippocampal neurons of CA1 and CA2, and cerebral cortical neurons. Immunofluorescent staining of Purkinje cells indicates that AQP11 is intracellular. Unlike other aquaporins, Xenopus oocytes expressing AQP11 in the plasma membrane failed to transport water, glycerol, urea, or ions. Conclusion AQP11 is functionally distinct from other proteins of the aquaporin superfamily and could represent a new aquaporin subfamily. Further studies are necessary to elucidate the role of AQP11 in the brain.
Directory of Open Access Journals (Sweden)
Jessica L Will
2010-04-01
Full Text Available A major goal in evolutionary biology is to understand how adaptive evolution has influenced natural variation, but identifying loci subject to positive selection has been a challenge. Here we present the adaptive loss of a pair of paralogous genes in specific Saccharomyces cerevisiae subpopulations. We mapped natural variation in freeze-thaw tolerance to two water transporters, AQY1 and AQY2, previously implicated in freeze-thaw survival. However, whereas freeze-thaw-tolerant strains harbor functional aquaporin genes, the set of sensitive strains lost aquaporin function at least 6 independent times. Several genomic signatures at AQY1 and/or AQY2 reveal low variation surrounding these loci within strains of the same haplotype, but high variation between strain groups. This is consistent with recent adaptive loss of aquaporins in subgroups of strains, leading to incipient balancing selection. We show that, although aquaporins are critical for surviving freeze-thaw stress, loss of both genes provides a major fitness advantage on high-sugar substrates common to many strains' natural niche. Strikingly, strains with non-functional alleles have also lost the ancestral requirement for aquaporins during spore formation. Thus, the antagonistic effect of aquaporin function-providing an advantage in freeze-thaw tolerance but a fitness defect for growth in high-sugar environments-contributes to the maintenance of both functional and nonfunctional alleles in S. cerevisiae. This work also shows that gene loss through multiple missense and nonsense mutations, hallmarks of pseudogenization presumed to emerge after loss of constraint, can arise through positive selection.
Will, Jessica L; Kim, Hyun Seok; Clarke, Jessica; Painter, John C; Fay, Justin C; Gasch, Audrey P
2010-04-01
A major goal in evolutionary biology is to understand how adaptive evolution has influenced natural variation, but identifying loci subject to positive selection has been a challenge. Here we present the adaptive loss of a pair of paralogous genes in specific Saccharomyces cerevisiae subpopulations. We mapped natural variation in freeze-thaw tolerance to two water transporters, AQY1 and AQY2, previously implicated in freeze-thaw survival. However, whereas freeze-thaw-tolerant strains harbor functional aquaporin genes, the set of sensitive strains lost aquaporin function at least 6 independent times. Several genomic signatures at AQY1 and/or AQY2 reveal low variation surrounding these loci within strains of the same haplotype, but high variation between strain groups. This is consistent with recent adaptive loss of aquaporins in subgroups of strains, leading to incipient balancing selection. We show that, although aquaporins are critical for surviving freeze-thaw stress, loss of both genes provides a major fitness advantage on high-sugar substrates common to many strains' natural niche. Strikingly, strains with non-functional alleles have also lost the ancestral requirement for aquaporins during spore formation. Thus, the antagonistic effect of aquaporin function-providing an advantage in freeze-thaw tolerance but a fitness defect for growth in high-sugar environments-contributes to the maintenance of both functional and nonfunctional alleles in S. cerevisiae. This work also shows that gene loss through multiple missense and nonsense mutations, hallmarks of pseudogenization presumed to emerge after loss of constraint, can arise through positive selection.
Directory of Open Access Journals (Sweden)
Francesca Secchi
2016-04-01
Full Text Available The aquaporin specific control on water versus carbon pathways in leaves is pivotal in controlling gas exchange and leaf hydraulics. We investigated whether Nicotiana tabacum aquaporin 1 (NtAQP1 and Nicotiana tabacum plasma membrane intrinsic protein 2;1 (NtPIP2;1 gene expression varies in tobacco leaves subjected to treatments with different CO2 concentrations (ranging from 0 to 800 ppm, inducing changes in photosynthesis, stomatal regulation and water evaporation from the leaf. Changes in air CO2 concentration ([CO2] affected net photosynthesis (Pn and leaf substomatal [CO2] (Ci. Pn was slightly negative at 0 ppm air CO2; it was one-third that of ambient controls at 200 ppm, and not different from controls at 800 ppm. Leaves fed with 800 ppm [CO2] showed one-third reduced stomatal conductance (gs and transpiration (E, and their gs was in turn slightly lower than in 200 ppm– and in 0 ppm–treated leaves. The 800 ppm air [CO2] strongly impaired both NtAQP1 and NtPIP2;1 gene expression, whereas 0 ppm air [CO2], a concentration below any in vivo possible conditions and specifically chosen to maximize the gene expression alteration, increased only the NtAQP1 transcript level. We propose that NtAQP1 expression, an aquaporin devoted to CO2 transport, positively responds to CO2 scarcity in the air in the whole range 0–800 ppm. On the contrary, expression of NtPIP2;1, an aquaporin not devoted to CO2 transport, is related to water balance in the leaf, and changes in parallel with gs. These observations fit in a model where upregulation of leaf aquaporins is activated at low Ci, while downregulation occurs when high Ci saturates photosynthesis and causes stomatal closure.
Forrest, Kerrie L; Bhave, Mrinal
2007-10-01
The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.
Aquaporin Protein-Protein Interactions
Directory of Open Access Journals (Sweden)
Jennifer Virginia Roche
2017-10-01
Full Text Available Aquaporins are tetrameric membrane-bound channels that facilitate transport of water and other small solutes across cell membranes. In eukaryotes, they are frequently regulated by gating or trafficking, allowing for the cell to control membrane permeability in a specific manner. Protein–protein interactions play crucial roles in both regulatory processes and also mediate alternative functions such as cell adhesion. In this review, we summarize recent knowledge about aquaporin protein–protein interactions; dividing the interactions into three types: (1 interactions between aquaporin tetramers; (2 interactions between aquaporin monomers within a tetramer (hetero-tetramerization; and (3 transient interactions with regulatory proteins. We particularly focus on the structural aspects of the interactions, discussing the small differences within a conserved overall fold that allow for aquaporins to be differentially regulated in an organism-, tissue- and trigger-specific manner. A deep knowledge about these differences is needed to fully understand aquaporin function and regulation in many physiological processes, and may enable design of compounds targeting specific aquaporins for treatment of human disease.
Song, Shun; Xu, Yi; Huang, Dongmei; Miao, Hongxia; Liu, Juhua; Jia, Caihong; Hu, Wei; Valarezo, Ana Valeria; Xu, Biyu; Jin, Zhiqiang
2018-07-01
Drought and salt stresses often affect plant growth and crop yields. Identification of promoters involved in drought and salt stress responses is of great significance for genetic improvement of crop resistance. Our previous studies showed that aquaporin can respond to drought and salt stresses, but its promoter has not yet been reported in plants. In the present study, cis-acting elements of MaAQP family member promoters were systematically analyzed in banana. Expression of MaTIP1; 2 was induced by drought and salt stresses but not sensitive to cold stress, waterlogging stress, or mechanical damage, and its promoter contained five stress-related cis-acting elements. The MaTIP1; 2 promoter (841 bp upstream of translation initiation site) from banana (Musa acuminata L. AAA group cv. Brazilian) was isolated through genome walking polymerase chain reaction, and found to contain a TATA Box, CAAT box, ABRE element, CCGTCC box, CGTCA motif, and TCA element. Transformation of the MaTIP1; 2 promoter into Arabidopsis to assess its function indicated that it responds to both drought and salt stress treatments. These results suggest that MaTIP1; 2 utilization may improve drought and salt stresses resistance of the transgenic plants by promoting banana aquaporin expression. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Navarro-Ródenas, Alfonso; Ruíz-Lozano, Juan Manuel; Kaldenhoff, Ralf; Morte, Asunción
2012-02-01
Terfezia claveryi is a hypogeous mycorrhizal fungus belonging to the so-called "desert truffles," with a good record as an edible fungus and of considerable economic importance. T. claveryi improves the tolerance to water stress of the host plant Helianthemum almeriense, for which, in field conditions, symbiosis with T. claveryi is valuable for its survival. We have characterized cDNAs from T. claveryi and identified a sequence related to the aquaporin gene family. The full-length sequence was obtained by rapid amplification of cDNA ends and was named TcAQP1. This aquaporin gene encoded a functional water-channel protein, as demonstrated by heterologous expression assays in Saccharomyces cerevisiae. The mycorrhizal fungal aquaporin increased both water and CO(2) conductivity in the heterologous expression system. The expression patterns of the TcAQP1 gene in mycelium, under different water potentials, and in mycorrhizal plants are discussed. The high levels of water conductivity of TcAQP1 could be related to the adaptation of this mycorrhizal fungus to semiarid areas. The CO(2) permeability of TcAQP1 could be involved in the regulation of T. claveryi growth during presymbiotic phases, making it a good candidate to be considered a novel molecular signaling channel in mycorrhizal fungi.
Detection of anti-aquaporin-4 autoantibodies in the sera of Chinese neuromyelitis optica patients
Institute of Scientific and Technical Information of China (English)
Miao Li; Weiheng Su; Jie Wang; Francesco Pisani; Antonio Frigeri; Tonghui Ma
2013-01-01
In this study, we recruited 10 neuromyelitis optica patients, two multiple sclerosis patients and two myelitis patients. Chinese hamster lung fibroblast (V79) cells transfected with a human aquaporin-4-mCherry fusion protein gene were used to detect anti-aquaporin-4 antibody in neuromyelitis optica patient sera by immunofluorescence. Anti-aquaporin-4 autoantibody was stably detected by immunofluorescence in neuromyelitis optica patient sera exclusively. The sensitivity of the assay for neuromyelitis optica was 90% and the specificity for neuromyelitis optica was 100%. The anti-aquaporin-4 antibody titers in sera were tested with serial dilutions until the signal disappeared. A positive correlation was detected between Expanded Disability Status Scale scores and serum anti-aquaporin-4 antibody titers. The anti-aquaporin-4 antibody assay is highly sensitive and specific in the sera of Chinese neuromyelitis optica patients. Detection of aquaporin-4 autoantibody is important for the diagnosis and treatment of neuromyelitis optica.
Detection of anti-aquaporin-4 autoantibodies in the sera of Chinese neuromyelitis optica patients.
Li, Miao; Su, Weiheng; Wang, Jie; Pisani, Francesco; Frigeri, Antonio; Ma, Tonghui
2013-03-15
In this study, we recruited 10 neuromyelitis optica patients, two multiple sclerosis patients and two myelitis patients. Chinese hamster lung fibroblast (V79) cells transfected with a human aquaporin-4-mCherry fusion protein gene were used to detect anti-aquaporin-4 antibody in neuromyelitis optica patient sera by immunofluorescence. Anti-aquaporin-4 autoantibody was stably detected by immunofluorescence in neuromyelitis optica patient sera exclusively. The sensitivity of the assay for neuromyelitis optica was 90% and the specificity for neuromyelitis optica was 100%. The anti-aquaporin-4 antibody titers in sera were tested with serial dilutions until the signal disappeared. A positive correlation was detected between Expanded Disability Status Scale scores and serum anti-aquaporin-4 antibody titers. The anti-aquaporin-4 antibody assay is highly sensitive and specific in the sera of Chinese neuromyelitis optica patients. Detection of aquaporin-4 autoantibody is important for the diagnosis and treatment of neuromyelitis optica.
Detection of anti-aquaporin-4 autoantibodies in the sera of Chinese neuromyelitis optica patients★
Li, Miao; Su, Weiheng; Wang, Jie; Pisani, Francesco; Frigeri, Antonio; Ma, Tonghui
2013-01-01
In this study, we recruited 10 neuromyelitis optica patients, two multiple sclerosis patients and two myelitis patients. Chinese hamster lung fibroblast (V79) cells transfected with a human aquaporin-4-mCherry fusion protein gene were used to detect anti-aquaporin-4 antibody in neuromyelitis optica patient sera by immunofluorescence. Anti-aquaporin-4 autoantibody was stably detected by immunofluorescence in neuromyelitis optica patient sera exclusively. The sensitivity of the assay for neuromyelitis optica was 90% and the specificity for neuromyelitis optica was 100%. The anti-aquaporin-4 antibody titers in sera were tested with serial dilutions until the signal disappeared. A positive correlation was detected between Expanded Disability Status Scale scores and serum anti-aquaporin-4 antibody titers. The anti-aquaporin-4 antibody assay is highly sensitive and specific in the sera of Chinese neuromyelitis optica patients. Detection of aquaporin-4 autoantibody is important for the diagnosis and treatment of neuromyelitis optica. PMID:25206717
Renal aquaporins and water balance disorders
DEFF Research Database (Denmark)
Kortenoeven, Marleen; Fenton, Robert A.
2013-01-01
BACKGROUND: Aquaporins (AQPs) are a family of proteins that can act as water channels. Regulation of AQPs is critical to osmoregulation and the maintenance of body water homeostasis. Eight AQPs are expressed in the kidney of which five have been shown to play a role in body water balance; AQP1, A......-solute diet and diuretics. GENERAL SIGNIFICANCE: In recent years, our understanding of the underlying mechanisms of water balance disorders has increased enormously, which has opened up several possible new treatment strategies.......BACKGROUND: Aquaporins (AQPs) are a family of proteins that can act as water channels. Regulation of AQPs is critical to osmoregulation and the maintenance of body water homeostasis. Eight AQPs are expressed in the kidney of which five have been shown to play a role in body water balance; AQP1, AQP......2, AQP3, AQP4 and AQP7. AQP2 in particular is regulated by vasopressin. SCOPE OF REVIEW: This review summarizes our current knowledge of the underlying mechanisms of various water balance disorders and their treatment strategies. MAJOR CONCLUSIONS: Dysfunctions of AQPs are involved in disorders...
Increased expression of aquaporin-4 in human traumatic brain injury and brain tumors
Institute of Scientific and Technical Information of China (English)
HuaHu; Wei-PingZhang; LeiZhang; ZhongChen; Er-QingWei
2004-01-01
Aquaporin-4 (AQP4) is one of the aquaporins (AQPs), a water channel family. In the brain, AQP4 is expressed in astroeyte foot processes, and plays an important role in water homeostasis and in the formation of brain edema. In our study, AQP4 expression in human brain specimens from patients with traumatic brain injury or different brain tumors was detected
Plant aquaporins: roles in plant physiology.
Li, Guowei; Santoni, Véronique; Maurel, Christophe
2014-05-01
Aquaporins are membrane channels that facilitate the transport of water and small neutral molecules across biological membranes of most living organisms. Here, we present comprehensive insights made on plant aquaporins in recent years, pointing to their molecular and physiological specificities with respect to animal or microbial counterparts. In plants, aquaporins occur as multiple isoforms reflecting a high diversity of cellular localizations and various physiological substrates in addition to water. Of particular relevance for plants is the transport by aquaporins of dissolved gases such as carbon dioxide or metalloids such as boric or silicic acid. The mechanisms that determine the gating and subcellular localization of plant aquaporins are extensively studied. They allow aquaporin regulation in response to multiple environmental and hormonal stimuli. Thus, aquaporins play key roles in hydraulic regulation and nutrient transport in roots and leaves. They contribute to several plant growth and developmental processes such as seed germination or emergence of lateral roots. Plants with genetically altered aquaporin functions are now tested for their ability to improve plant resistance to stresses. This article is part of a Special Issue entitled Aquaporins. Copyright © 2013 Elsevier B.V. All rights reserved.
Unexpected complexity of the Aquaporin gene family in the moss Physcomitrella patens
Directory of Open Access Journals (Sweden)
Johanson Urban
2008-04-01
Full Text Available Abstract Background Aquaporins, also called major intrinsic proteins (MIPs, constitute an ancient superfamily of channel proteins that facilitate the transport of water and small solutes across cell membranes. MIPs are found in almost all living organisms and are particularly abundant in plants where they form a divergent group of proteins able to transport a wide selection of substrates. Results Analyses of the whole genome of Physcomitrella patens resulted in the identification of 23 MIPs, belonging to seven different subfamilies, of which only five have been previously described. Of the newly discovered subfamilies one was only identified in P. patens (Hybrid Intrinsic Protein, HIP whereas the other was found to be present in a wide variety of dicotyledonous plants and forms a major previously unrecognized MIP subfamily (X Intrinsic Proteins, XIPs. Surprisingly also some specific groups within subfamilies present in Arabidopsis thaliana and Zea mays could be identified in P. patens. Conclusion Our results suggest an early diversification of MIPs resulting in a large number of subfamilies already in primitive terrestrial plants. During the evolution of higher plants some of these subfamilies were subsequently lost while the remaining subfamilies expanded and in some cases diversified, resulting in the formation of more specialized groups within these subfamilies.
Directory of Open Access Journals (Sweden)
Chunhui Xu
Full Text Available Aquaporins are channel proteins which transport water across cell membranes. We show that the bread wheat aquaporin gene TaTIP2;2 maps to the long arm of chromosome 7b and that its product localizes to the endomembrane system. The gene is expressed constitutively in both the root and the leaf, and is down-regulated by salinity and drought stress. Salinity stress induced an increased level of C-methylation within the CNG trinucleotides in the TaTIP2;2 promoter region. The heterologous expression of TaTIP2;2 in Arabidopsis thaliana compromised its drought and salinity tolerance, suggesting that TaTIP2;2 may be a negative regulator of abiotic stress. The proline content of transgenic A. thaliana plants fell, consistent with the down-regulation of P5CS1, while the expression of SOS1, SOS2, SOS3, CBF3 and DREB2A, which are all stress tolerance-related genes acting in an ABA-independent fashion, was also down-regulated. The supply of exogenous ABA had little effect either on TaTIP2;2 expression in wheat or on the phenotype of transgenic A. thaliana. The expression level of the ABA signalling genes ABI1, ABI2 and ABF3 remained unaltered in the transgenic A. thaliana plants. Thus TaTIP2;2 probably regulates the response to stress via an ABA-independent pathway(s.
Ammonia and urea permeability of mammalian aquaporins
DEFF Research Database (Denmark)
Litman, Thomas; Søgaard, Rikke; Zeuthen, Thomas
2009-01-01
significant at alkaline pH. It is debated whether the H(+) ion passes via the aquaporin or by some external route; the investigation of this problem requires the aquaporin-expressing cell to be voltage-clamped. The ammonia-permeable aquaporins differ from other aquaporins by having a less restrictive aromatic...... groups differ in the amino acid composition of their aromatic/arginine regions. The location of the ammonia-permeable aquaporins in the body parallels that of the Rh proteins. This applies to erythrocytes and to cells associated with nitrogen homeostasis and high rates of anabolism. In the liver, AQPs 8...
Aquaporins of the PIP2 class are required for efficient anther dehiscence in tobacco.
Bots, Marc; Vergeldt, Frank; Wolters-Arts, Mieke; Weterings, Koen; van As, Henk; Mariani, Celestina
2005-03-01
Several processes during sexual reproduction in higher plants involve the movement of water between cells or tissues. Before flower anthesis, anther and pollen dehydration takes place before the release of mature pollen at dehiscence. Aquaporins represent a class of proteins that mediates the movement of water over cellular membranes. Aquaporins of the plasmamembrane PIP2 family are expressed in tobacco (Nicotiana tabacum) anthers and may therefore be involved in the movement of water in this organ. To gain more insight into the role these proteins may play in this process, we have analyzed their localization using immunolocalizations and generated plants displaying RNA interference of PIP2 aquaporins. Our results indicate that PIP2 protein expression is modulated during anther development. Furthermore, in tobacco PIP2 RNA interference plants, anther dehydration was slower, and dehiscence occurred later when compared with control plants. Together, our results suggest that aquaporins of the PIP2 class are required for efficient anther dehydration prior to dehiscence.
Diehn, Till A.; Pommerrenig, Benjamin; Bernhardt, Nadine; Hartmann, Anja; Bienert, Gerd P.
2015-01-01
Aquaporins (AQPs) are essential channel proteins that regulate plant water homeostasis and the uptake and distribution of uncharged solutes such as metalloids, urea, ammonia, and carbon dioxide. Despite their importance as crop plants, little is known about AQP gene and protein function in cabbage (Brassica oleracea) and other Brassica species. The recent releases of the genome sequences of B. oleracea and Brassica rapa allow comparative genomic studies in these species to investigate the evolution and features of Brassica genes and proteins. In this study, we identified all AQP genes in B. oleracea by a genome-wide survey. In total, 67 genes of four plant AQP subfamilies were identified. Their full-length gene sequences and locations on chromosomes and scaffolds were manually curated. The identification of six additional full-length AQP sequences in the B. rapa genome added to the recently published AQP protein family of this species. A phylogenetic analysis of AQPs of Arabidopsis thaliana, B. oleracea, B. rapa allowed us to follow AQP evolution in closely related species and to systematically classify and (re-) name these isoforms. Thirty-three groups of AQP-orthologous genes were identified between B. oleracea and Arabidopsis and their expression was analyzed in different organs. The two selectivity filters, gene structure and coding sequences were highly conserved within each AQP subfamily while sequence variations in some introns and untranslated regions were frequent. These data suggest a similar substrate selectivity and function of Brassica AQPs compared to Arabidopsis orthologs. The comparative analyses of all AQP subfamilies in three Brassicaceae species give initial insights into AQP evolution in these taxa. Based on the genome-wide AQP identification in B. oleracea and the sequence analysis and reprocessing of Brassica AQP information, our dataset provides a sequence resource for further investigations of the physiological and molecular functions of
Aquaporins in Digestive System.
Zhu, Shuai; Ran, Jianhua; Yang, Baoxue; Mei, Zhechuan
2017-01-01
In this chapter, we mainly discuss the expression and function of aquaporins (AQPs ) expressed in digestive system . AQPs in gastrointestinal tract include four members of aquaporin subfamily: AQP1, AQP4, AQP5 and AQP8, and a member of aquaglyceroporin subfamily: AQP3. In the digestive glands, especially the liver, we discuss three members of aquaporin subfamily: AQP1, AQP5 and AQP8, a member of aquaglyceroporin subfamily: AQP9. AQP3 is involved in the diarrhea and inflammatory bowel disease; AQP5 is relevant to gastric carcinoma cell proliferation and migration; AQP9 plays considerable role in glycerol metabolism , urea transport and hepatocellular carcinoma. Further investigation is necessary for specific locations and functions of AQPs in digestive system.
Osmotic water transport in aquaporins
DEFF Research Database (Denmark)
Zeuthen, Thomas; Alsterfjord, Magnus; Beitz, Eric
2013-01-01
Abstract We test a novel, stochastic model of osmotic water transport in aquaporins. A solute molecule present at the pore mouth can either be reflected or permeate the pore. We assume that only reflected solute molecules induce osmotic transport of water through the pore, while permeating solute...... molecules give rise to no water transport. Accordingly, the rate of water transport is proportional to the reflection coefficient σ, while the solute permeability, P(S), is proportional to 1 - σ. The model was tested in aquaporins heterologously expressed in Xenopus oocytes. A variety of aquaporin channel...... sizes and geometries were obtained with the two aquaporins AQP1 and AQP9 and mutant versions of these. Osmotic water transport was generated by adding 20 mM of a range of different-sized osmolytes to the outer solution. The osmotic water permeability and the reflection coefficient were measured...
Rodrigues, Marcela I; Bravo, Juliana P; Sassaki, Flávio T; Severino, Fábio E; Maia, Ivan G
2013-12-01
Aquaporins have important roles in various physiological processes in plants, including growth, development and adaptation to stress. In this study, a gene encoding a root-specific tonoplast intrinsic aquaporin (TIP) from Eucalyptus grandis (named EgTIP2) was investigated. The root-specific expression of EgTIP2 was validated over a panel of five eucalyptus organ/tissues. In eucalyptus roots, EgTIP2 expression was significantly induced by osmotic stress imposed by PEG treatment. Histochemical analysis of transgenic tobacco lines (Nicotiana tabacum SR1) harboring an EgTIP2 promoter:GUS reporter cassette revealed major GUS staining in the vasculature and in root tips. Consistent with its osmotic-stress inducible expression in eucalyptus, EgTIP2 promoter activity was up-regulated by mannitol treatment, but was down-regulated by abscisic acid. Taken together, these results suggest that EgTIP2 might be involved in eucalyptus response to drought. Additional searches in the eucalyptus genome revealed the presence of four additional putative TIP coding genes, which could be individually assigned to the classical TIP1-5 groups. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Novel Commercial Aquaporin Flat-Sheet Membrane for Forward Osmosis
DEFF Research Database (Denmark)
Xia, Lingling; Andersen, Mads Friis; Hélix-Nielsen, Claus
2017-01-01
Aquaporin proteins are of great interest to the membrane science community because of their unique characteristics of high water permeability and perfect molecular selectivity. Although these characteristics make aquaporins particularly valuable for desalination applications, none of these aquapo...... was found to exhibit water and reverse solute flux performances similar to those of other commercially available varieties, although this membrane represents one of the few TFC membranes that is available to the academic community for FO testing at the time of this writing.......Aquaporin proteins are of great interest to the membrane science community because of their unique characteristics of high water permeability and perfect molecular selectivity. Although these characteristics make aquaporins particularly valuable for desalination applications, none...... of these aquaporin-based membrane designs has been produced at a large scale. In this work, we report on the recently designed and commercially available Aquaporin Inside flat-sheet membrane designed for forward osmosis (FO) by Aquaporin A/S, Lyngby, Denmark. The Aquaporin Inside flat-sheet membrane is the first...
Aquaporin-3 and aquaporin-4 are sorted differently and separately in the trans-Golgi network
DEFF Research Database (Denmark)
Christensen, Eva Arnspang; Sundbye, S.; Nelson, W. J.
2013-01-01
Aquaporin-3 (AQP3) and aquaporin-4 (AQP4) are homologous proteins expressed in the basolateral plasma membrane of kidney collecting duct principal cells, where they mediate the exit pathway for apically reabsorbed water. Although both proteins are localized to the same plasma membrane domain, it ...
Pancreatic Aquaporin-7: A Novel Target for Anti-diabetic Drugs?
Méndez-Giménez, Leire; Ezquerro, Silvia; da Silva, Inês V; Soveral, Graça; Frühbeck, Gema; Rodríguez, Amaia
2018-01-01
Aquaporins comprise a family of 13 members of water channels (AQP0-12) that facilitate a rapid transport of water across cell membranes. In some cases, these pores are also permeated by small solutes, particularly glycerol, urea or nitric oxide, among other solutes. Several aquaporins have been identified in the pancreas, an exocrine and endocrine organ that plays an essential role in the onset of insulin resistance and type 2 diabetes. The exocrine pancreas, which accounts for 90% of the total pancreas, secretes daily large volumes of a near-isotonic fluid containing digestive enzymes into the duodenum. AQP1, AQP5, and AQP8 contribute to fluid secretion especially from ductal cells, whereas AQP12 allows the proper maturation and exocytosis of secretory granules in acinar cells of the exocrine pancreas. The endocrine pancreas (10% of the total pancreatic cells) is composed by the islets of Langerhans, which are distributed in α, β, δ, ε, and pancreatic polypeptide (PP) cells that secrete glucagon, insulin, somatostatin, ghrelin and PP, respectively. AQP7, an aquaglyceroporin permeated by water and glycerol, is expressed in pancreatic β-cells and murine studies have confirmed its participation in insulin secretion, triacylglycerol synthesis and proliferation of these endocrine cells. In this regard, transgenic AQP7-knockout mice develop adult-onset obesity, hyperinsulinemia, increased intracellular triacylglycerol content and reduced β-cell mass in Langerhans islets. Moreover, we have recently reported that AQP7 upregulation in β-cells after bariatric surgery, an effective weight loss surgical procedure, contributes, in part, to the improvement of pancreatic steatosis and insulin secretion through the increase of intracytoplasmic glycerol in obese rats. Human studies remain scarce and controversial, with some rare cases of loss-of function mutations of the AQP7 gene being associated with the onset of type 2 diabetes. The present Review is focused on the role
Pancreatic aquaporin-7: a novel target for anti-diabetic drugs?
Méndez-Giménez, Leire; Ezquerro, Silvia; da Silva, Inês V.; Soveral, Graça; Frühbeck, Gema; Rodríguez, Amaia
2018-04-01
Aquaporins comprise a family of 13 members of water channels (AQP0-12) that facilitate a rapid transport of water across cell membranes. In some cases, these pores are also permeated by small solutes, particularly glycerol, urea or nitric oxide, among other solutes. Several aquaporins have been identified in the pancreas, an exocrine and endocrine organ that plays an essential role in the onset of insulin resistance and type 2 diabetes. The exocrine pancreas, which accounts for 90% of the total pancreas, secretes daily large volumes of a near-isotonic fluid containing digestive enzymes into the duodenum. AQP1, AQP5 and AQP8 contribute to fluid secretion especially from ductal cells, whereas AQP12 allows the proper maturation and exocytosis of secretory granules in acinar cells of the exocrine pancreas. The endocrine pancreas (10% of the total pancreatic cells) is composed by the islets of Langerhans, which are distributed in ,, , and pancreatic polypeptide (PP) cells that secrete glucagon, insulin, somatostatin, ghrelin and PP, respectively. AQP7, an aquaglyceroporin permeated by water and glycerol, is expressed in pancreatic -cells and murine studies have confirmed its participation in insulin secretion, triacylglycerol synthesis and proliferation of these endocrine cells. In this regard, transgenic AQP7-knockout mice develop adult-onset obesity, hyperinsulinemia, increased intracellular triacylglycerol content and reduced -cell mass in Langerhans islets. Moreover, we have recently reported that AQP7 upregulation in β-cells after bariatric surgery, an effective weight loss surgical procedure, contributes, in part, to the improvement of pancreatic steatosis and insulin secretion by increasing intracellular glycerol in obese rats. Human studies remain scarce and controversial, with some rare cases of loss-of function variants of the AQP7 gene being associated with the onset of type 2 diabetes. The present Review is focused on the role of
Pancreatic Aquaporin-7: A Novel Target for Anti-diabetic Drugs?
Directory of Open Access Journals (Sweden)
Leire Méndez-Giménez
2018-04-01
Full Text Available Aquaporins comprise a family of 13 members of water channels (AQP0-12 that facilitate a rapid transport of water across cell membranes. In some cases, these pores are also permeated by small solutes, particularly glycerol, urea or nitric oxide, among other solutes. Several aquaporins have been identified in the pancreas, an exocrine and endocrine organ that plays an essential role in the onset of insulin resistance and type 2 diabetes. The exocrine pancreas, which accounts for 90% of the total pancreas, secretes daily large volumes of a near-isotonic fluid containing digestive enzymes into the duodenum. AQP1, AQP5, and AQP8 contribute to fluid secretion especially from ductal cells, whereas AQP12 allows the proper maturation and exocytosis of secretory granules in acinar cells of the exocrine pancreas. The endocrine pancreas (10% of the total pancreatic cells is composed by the islets of Langerhans, which are distributed in α, β, δ, ε, and pancreatic polypeptide (PP cells that secrete glucagon, insulin, somatostatin, ghrelin and PP, respectively. AQP7, an aquaglyceroporin permeated by water and glycerol, is expressed in pancreatic β-cells and murine studies have confirmed its participation in insulin secretion, triacylglycerol synthesis and proliferation of these endocrine cells. In this regard, transgenic AQP7-knockout mice develop adult-onset obesity, hyperinsulinemia, increased intracellular triacylglycerol content and reduced β-cell mass in Langerhans islets. Moreover, we have recently reported that AQP7 upregulation in β-cells after bariatric surgery, an effective weight loss surgical procedure, contributes, in part, to the improvement of pancreatic steatosis and insulin secretion through the increase of intracytoplasmic glycerol in obese rats. Human studies remain scarce and controversial, with some rare cases of loss-of function mutations of the AQP7 gene being associated with the onset of type 2 diabetes. The present Review is
DEFF Research Database (Denmark)
Zhao, Yang; Vararattanavech, Ardcharaporn; Li, Xuesong
2013-01-01
Escherichia coli cells, and their separation properties were characterized by stopped-flow measurements. The current study systematically investigated the effect of proteoliposome composition (lipid type, protein-to-lipid ratio (PLR), and the addition of cholesterol) on water permeability and NaCl retention......Aquaporins are a large family of water transport proteins in cell membranes. Their high water permeability and solute rejection make them potential building blocks for high-performance biomimetic membranes for desalination. In the current study, proteoliposomes were prepared using AquaporinZ from...
Directory of Open Access Journals (Sweden)
Mohamed Ragab Abdel Gawwad
2013-09-01
Full Text Available Aquaporins are channel proteins found in plasma membranes and intercellular membranes of different cellular compartments, facilitate the water flux, solutes and gases across the cellular plasma membranes. The present study highlights the sub-family plasma membrane intrinsic protein (PIP predicting the 3-D structure and analyzing the functional interactome of it homologs. PIP1 homologs integrate with many proteins with different plant physiological roles in Arabidopsis thaliana including; PIP1A and PIP1B: facilitate the transport of water, diffusion of amino acids and/or peptides from the vacuolar compartment to the cytoplasm, play a role in the control of cell turgor and cell expansion and involved in root water uptake respectively. In addition we found that PIP1B plays a defensive role against Pseudomonas syringae infection through the interaction with the plasma membrane Rps2 protein. Another substantial function of PIP1C via the interaction with PIP2E is the response to nematode infection. Generally, PIP1 sub-family interactome controlling many physiological processes in plant cell like; osmoregulation in plants under high osmotic stress such as under a high salt, response to nematode, facilitate the transport of water across cell membrane and regulation of floral initiation in Arabidopsis thaliana.
Directory of Open Access Journals (Sweden)
Ulrika Lind
Full Text Available Barnacles are sessile macro-invertebrates, found along rocky shores in coastal areas worldwide. The euryhaline bay barnacle Balanus improvisus (Darwin, 1854 (= Amphibalanus improvisus can tolerate a wide range of salinities, but the molecular mechanisms underlying the osmoregulatory capacity of this truly brackish species are not well understood. Aquaporins are pore-forming integral membrane proteins that facilitate transport of water, small solutes and ions through cellular membranes, and that have been shown to be important for osmoregulation in many organisms. The knowledge of the function of aquaporins in crustaceans is, however, limited and nothing is known about them in barnacles. We here present the repertoire of aquaporins from a thecostracan crustacean, the barnacle B. improvisus, based on genome and transcriptome sequencing. Our analyses reveal that B. improvisus contains eight genes for aquaporins. Phylogenetic analysis showed that they represented members of the classical water aquaporins (Aqp1, Aqp2, the aquaglyceroporins (Glp1, Glp2, the unorthodox aquaporin (Aqp12 and the arthropod-specific big brain aquaporin (Bib. Interestingly, we also found two big brain-like proteins (BibL1 and BibL2 constituting a new group of aquaporins not yet described in arthropods. In addition, we found that the two water-specific aquaporins were expressed as C-terminal splice variants. Heterologous expression of some of the aquaporins followed by functional characterization showed that Aqp1 transported water and Glp2 water and glycerol, agreeing with the predictions of substrate specificity based on 3D modeling and phylogeny. To investigate a possible role for the B. improvisus aquaporins in osmoregulation, mRNA expression changes in adult barnacles were analysed after long-term acclimation to different salinities. The most pronounced expression difference was seen for AQP1 with a substantial (>100-fold decrease in the mantle tissue in low salinity (3
Desalination by biomimetic aquaporin membranes: Review of status and prospects
DEFF Research Database (Denmark)
Tang, C.Y.; Zhao, Y.; Wang, R.
2013-01-01
Based on their unique combination of offering high water permeability and high solute rejection aquaporin proteins have attracted considerable interest over the last years as functional building blocks of biomimetic membranes for water desalination and reuse. The purpose of this review is to prov......Based on their unique combination of offering high water permeability and high solute rejection aquaporin proteins have attracted considerable interest over the last years as functional building blocks of biomimetic membranes for water desalination and reuse. The purpose of this review...... is to provide an overview of the properties of aquaporins, their preparation and characterization. We discuss the challenges in exploiting the remarkable properties of aquaporin proteins for membrane separation processes and we present various attempts to construct aquaporin in membranes for desalination......; including an overview of our own recent developments in aquaporin-based membranes. Finally we outline future prospects of aquaporin based biomimetic membrane for desalination and water reuse....
Silicon-mediated Improvement in Plant Salinity Tolerance: The Role of Aquaporins
Directory of Open Access Journals (Sweden)
Juan J. Rios
2017-06-01
Full Text Available Silicon (Si is an abundant and differentially distributed element in soils that is believed to have important biological functions. However, the benefits of Si and its essentiality in plants are controversial due to differences among species in their ability to take up this element. Despite this, there is a consensus that the application of Si improves the water status of plants under abiotic stress conditions. Hence, plants treated with Si are able to maintain a high stomatal conductance and transpiration rate under salt stress, suggesting that a reduction in Na+ uptake occurs due to deposition of Si in the root. In addition, root hydraulic conductivity increases when Si is applied. As a result, a Si-mediated upregulation of aquaporin (PIP gene expression is observed in relation to increased root hydraulic conductivity and water uptake. Aquaporins of the subclass nodulin 26-like intrinsic proteins are further involved in allowing Si entry into the cell. Therefore, on the basis of available published results and recent developments, we propose a model to explain how Si absorption alleviates stress in plants grown under saline conditions through the conjugated action of different aquaporins.
Plasma membrane aquaporins mediates vesicle stability in broccoli.
Directory of Open Access Journals (Sweden)
Maria Del Carmen Martínez-Ballesta
Full Text Available The use of in vitro membrane vesicles is attractive because of possible applications in therapies. Here we aimed to compare the stability and functionality of plasma membrane vesicles extracted from control and salt-treated broccoli. The impact of the amount of aquaporins was related to plasma membrane osmotic water permeability and the stability of protein secondary structure. Here, we describe for first time an increase in plant aquaporins acetylation under high salinity. Higher osmotic water permeability in NaCl vesicles has been related to higher acetylation, upregulation of aquaporins, and a more stable environment to thermal denaturation. Based on our findings, we propose that aquaporins play an important role in vesicle stability.
Gene cluster statistics with gene families.
Raghupathy, Narayanan; Durand, Dannie
2009-05-01
Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data
Robust High Performance Aquaporin based Biomimetic Membranes
DEFF Research Database (Denmark)
Helix Nielsen, Claus; Zhao, Yichun; Qiu, C.
2013-01-01
on top of a support membrane. Control membranes, either without aquaporins or with the inactive AqpZ R189A mutant aquaporin served as controls. The separation performance of the membranes was evaluated by cross-flow forward osmosis (FO) and reverse osmosis (RO) tests. In RO the ABM achieved a water......Aquaporins are water channel proteins with high water permeability and solute rejection, which makes them promising for preparing high-performance biomimetic membranes. Despite the growing interest in aquaporin-based biomimetic membranes (ABMs), it is challenging to produce robust and defect...... permeability of ~ 4 L/(m2 h bar) with a NaCl rejection > 97% at an applied hydraulic pressure of 5 bar. The water permeability was ~40% higher compared to a commercial brackish water RO membrane (BW30) and an order of magnitude higher compared to a seawater RO membrane (SW30HR). In FO, the ABMs had > 90...
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
Genome-Wide Comparative Gene Family Classification
Frech, Christian; Chen, Nansheng
2010-01-01
Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221
Li, Yadong; Jin, Qian; Yang, Desong; Cui, Jianghu
2018-04-25
Molybdenum sulfide (MoS 2 ) has been applied widely in industrial and environmental application, leading to increasing release into environment. So far, no studies have been investigated with regard to the potential effect of MoS 2 on plants. Herein, we studied the impact of MoS 2 on the growth, chlorophyll content, lipid peroxidation, antioxidase system, and aquaporins of rice for the first time. Results showed that MoS 2 did not significantly affect the germination of rice seeds, malonaldehyde (MDA) content, and the antioxidant enzyme activity. While the length and biomass of rice root and shoot, chlorophyll content index (CCI), and expression of aquaporin genes were significantly increased. Based on these results, we concluded that MoS 2 promoted rice growth through (i) the promotion of nitrogen source assimilation, (ii) the enhancement of photosynthesis, enzymatic-related biochemical reactions, and metabolic processes, subsequently, (iii) the acceleration of cell division and expansion, furthermore (iv) no abiotic stress and favorable condition of antioxidant enzyme system. These results provided an important insight into the further application of MoS 2 on agriculture and environment.
Bichet, Daniel G; Bockenhauer, Detlef
2016-03-01
Nephrogenic diabetes insipidus (NDI), which can be inherited or acquired, is characterized by an inability to concentrate urine despite normal or elevated plasma concentrations of the antidiuretic hormone, arginine vasopressin (AVP). Polyuria with hyposthenuria and polydipsia are the cardinal clinical manifestations of the disease. About 90% of patients with congenital NDI are males with X-linked NDI who have mutations in the vasopressin V2 receptor (AVPR2) gene encoding the vasopressin V2 receptor. In less than 10% of the families studied, congenital NDI has an autosomal recessive or autosomal dominant mode of inheritance with mutations in the aquaporin-2 (AQP2) gene. When studied in vitro, most AVPR2 and AQP2 mutations lead to proteins trapped in the endoplasmic reticulum and are unable to reach the plasma membrane. Prior knowledge of AVPR2 or AQP2 mutations in NDI families and perinatal mutation testing is of direct clinical value and can avert the physical and mental retardation associated with repeated episodes of dehydration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Regulation of Aquaporin Z osmotic permeability in ABA tri-block copolymer
Directory of Open Access Journals (Sweden)
Wenyuan Xie
2015-08-01
Full Text Available Aquaporins are transmembrane water channel proteins present in biological plasma membranes that aid in biological water filtration processes by transporting water molecules through at high speeds, while selectively blocking out other kinds of solutes. Aquaporin Z incorporated biomimetic membranes are envisaged to overcome the problem of high pressure needed, and holds great potential for use in water purification processes, giving high flux while keeping energy consumption low. The functionality of aquaporin Z in terms of osmotic permeability might be regulated by factors such as pH, temperature, crosslinking and hydrophobic thickness of the reconstituted bilayers. Hence, we reconstituted aquaporin Z into vesicles that are made from a series of amphiphilic block copolymers PMOXA-PDMS-PMOXAs with various hydrophobic molecular weights. The osmotic permeability of aquaporin Z in these vesicles was determined through a stopped-flow spectroscopy. In addition, the temperature and pH value of the vesicle solutions were adjusted within wide ranges to investigate the regulation of osmotic permeability of aquaporin Z through external conditions. Our results show that aquaporin Z permeability was enhanced by hydrophobic mismatch. In addition, the water filtration mechanism of aquaporin Z is significantly affected by the concentration of H+ and OH- ions.
Oliva, Romina; Calamita, Giuseppe; Thornton, Janet M.; Pellegrini-Calace, Marialuisa
2010-01-01
Aquaporins are homotetrameric channel proteins, which allow the diffusion of water and small solutes across biological membranes. According to their transport function, aquaporins can be divided into “orthodox aquaporins”, which allow the flux of water molecules only, and “aquaglyceroporins”, which facilitate the diffusion of glycerol and other small solutes in addition to water. The contribution of individual residues in the pore to the selectivity of orthodox aquaporins and aquaglyceroporins is not yet fully understood. To gain insights into aquaporin selectivity, we focused on the sequence variation and electrostatics of their channels. The continuum Poisson-Boltzmann electrostatic potential along the channel was calculated and compared for ten three-dimensional-structures which are representatives of different aquaporin subfamilies, and a panel of functionally characterized mutants, for which high-accuracy three-dimensional-models could be derived. Interestingly, specific electrostatic profiles associated with the main selectivity to water or glycerol could be identified. In particular: (i) orthodox aquaporins showed a distinctive electrostatic potential maximum at the periplasmic side of the channel around the aromatic/Arg (ar/R) constriction site; (ii) aquaporin-0 (AQP0), a mammalian aquaporin with considerably low water permeability, had an additional deep minimum at the cytoplasmic side; (iii) aquaglyceroporins showed a rather flat potential all along the channel; and (iv) the bifunctional protozoan PfAQP had an unusual all negative profile. Evaluation of electrostatics of the mutants, along with a thorough sequence analysis of the aquaporin pore-lining residues, illuminated the contribution of specific residues to the electrostatics of the channels and possibly to their selectivity. PMID:20147624
[Relationship between efficacy exertion of diuretic traditional Chinese medicines and aquaporin].
Wang, Peng-cheng; Zhao, Shan; Wang, Qiu-hong; Kuang, Hai-xue
2015-06-01
In recent years, the discovery and studies on aquaporin have made us have a more in-depth understanding about the physiological and pathological processes of water metabolism. Over years, however, there has been no quantitative study on the target sites of diuretic traditional Chinese medicines at the molecular level. In that case, aquaporin was found to been a new target molecule to explain the efficacy exertion of diuretic traditional Chinese medicines. By studying aquaporin, researchers can understand the implicit meaning of the diuretic effect of traditional Chinese medicines and conduct quantitative studies on the diuretic effect. So far, many scholars have conducted a series of studies in the traditional Chinese medicine field by using the findings on aquaporin and made certain advances. This article provides a summary about the efficacy exertion of diuretic traditional Chinese medicines through target molecule aquaporin.
Non-invasive imaging using reporter genes altering cellular water permeability
Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.
2016-12-01
Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.
Wang, Lin; Li, Qing-Tian; Lei, Qiong; Feng, Chao; Zheng, Xiaodong; Zhou, Fangfang; Li, Lingzi; Liu, Xuan; Wang, Zhi; Kong, Jin
2017-12-19
Water deficit severely reduces apple growth and production, is detrimental to fruit quality and size. This problem is exacerbated as global warming is implicated in producing more severe drought stress. Thus water-efficiency has becomes the major target for apple breeding. A desired apple tree can absorb and transport water efficiently, which not only confers improved drought tolerance, but also guarantees fruit size for higher income returns. Aquaporins, as water channels, control water transportation across membranes and can regulate water flow by changing their amount and activity. The exploration of molecular mechanism of water efficiency and the gene wealth will pave a way for molecular breeding of drought tolerant apple tree. In the current study, we screened out a drought inducible aquaporin gene MdPIP1;3, which specifically enhanced its expression during fruit expansion in 'Fuji' apple (Malus domestica Borkh. cv. Red Fuji). It localized on plasma membranes and belonged to PIP1 subfamily. The tolerance to drought stress enhanced in transgenic tomato plants ectopically expressing MdPIP1;3, showing that the rate of losing water in isolated transgenic leaves was slower than wild type, and stomata of transgenic plants closed sensitively to respond to drought compared with wild type. Besides, length and diameter of transgenic tomato fruits increased faster than wild type, and in final, fruit sizes and fresh weights of transgenic tomatoes were bigger than wild type. Specially, in cell levels, fruit cell size from transgenic tomatoes was larger than wild type, showing that cell number per mm 2 in transgenic fruits was less than wild type. Altogether, ectopically expressing MdPIP1;3 enhanced drought tolerance of transgenic tomatoes partially via reduced water loss controlled by stomata closure in leaves. In addition, the transgenic tomato fruits are larger and heavier with larger cells via more efficient water transportation across membranes. Our research will
The Role of Aquaporins in pH-Dependent Germination of Rhizopus delemar Spores.
Directory of Open Access Journals (Sweden)
Tidhar Turgeman
Full Text Available Rhizopus delemar and associated species attack a wide range of fruit and vegetables after harvest. Host nutrients and acidic pH are required for optimal germination of R. delemar, and we studied how this process is triggered. Glucose induced spore swelling in an acidic environment, expressed by an up to 3-fold increase in spore diameter, whereas spore diameter was smaller in a neutral environment. When suspended in an acidic environment, the spores started to float, indicating a change in their density. Treatment of the spores with HgCl2, an aquaporin blocker, prevented floating and inhibited spore swelling and germ-tube emergence, indicating the importance of water uptake at the early stages of germination. Two putative candidate aquaporin-encoding genes-RdAQP1 and RdAQP2-were identified in the R. delemar genome. Both presented the conserved NPA motif and six-transmembrane domain topology. Expressing RdAQP1 and RdAQP2 in Arabidopsis protoplasts increased the cells' osmotic water permeability coefficient (Pf compared to controls, indicating their role as water channels. A decrease in R. delemar aquaporin activity with increasing external pH suggested pH regulation of these proteins. Substitution of two histidine (His residues, positioned on two loops facing the outer side of the cell, with alanine eliminated the pH sensing resulting in similar Pf values under acidic and basic conditions. Since hydration is critical for spore switching from the resting to activate state, we suggest that pH regulation of the aquaporins can regulate the initial phase of R. delemar spore germination, followed by germ-tube elongation and host-tissue infection.
Aquaporin-2 regulation in health and disease
DEFF Research Database (Denmark)
Radin, M J; Yu, Ming-Jiun; Stødkilde-Jørgensen, Lene
2012-01-01
Aquaporin-2 (AQP2), the vasopressin-regulated water channel of the renal collecting duct, is dysregulated in numerous disorders of water balance in people and animals, including those associated with polyuria (urinary tract obstruction, hypokalemia, inflammation, and lithium toxicity) and with di......Aquaporin-2 (AQP2), the vasopressin-regulated water channel of the renal collecting duct, is dysregulated in numerous disorders of water balance in people and animals, including those associated with polyuria (urinary tract obstruction, hypokalemia, inflammation, and lithium toxicity...
DEFF Research Database (Denmark)
Li, Zhenyu; Linares, Rodrigo Valladares; Bucs, Szilard
2017-01-01
Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused, by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquaporin...
To, Janet; Torres, Jaume
2015-08-10
In recent years, the use of biomimetic membranes that incorporate membrane proteins, i.e., biomimetic-hybrid membranes, has increased almost exponentially. Key membrane proteins in these systems have been aquaporins, which selectively permeabilize cellular membranes to water. Aquaporins may be incorporated into synthetic lipid bilayers or to more stable structures made of block copolymers or solid-state nanopores. However, translocation of aquaporins to these alien environments has adverse consequences in terms of performance and stability. Aquaporins incorporated in biomimetic membranes for use in water purification and desalination should also withstand the harsh environment that may prevail in these conditions, such as high pressure, and presence of salt or other chemicals. In this respect, modified aquaporins that can be adapted to these new environments should be developed. Another challenge is that biomimetic membranes that incorporate high densities of aquaporin should be defect-free, and this can only be efficiently ascertained with the availability of completely inactive mutants that behave otherwise like the wild type aquaporin, or with effective non-toxic water channel inhibitors that are so far inexistent. In this review, we describe approaches that can potentially be used to overcome these challenges.
Directory of Open Access Journals (Sweden)
Janet To
2015-08-01
Full Text Available In recent years, the use of biomimetic membranes that incorporate membrane proteins, i.e., biomimetic-hybrid membranes, has increased almost exponentially. Key membrane proteins in these systems have been aquaporins, which selectively permeabilize cellular membranes to water. Aquaporins may be incorporated into synthetic lipid bilayers or to more stable structures made of block copolymers or solid-state nanopores. However, translocation of aquaporins to these alien environments has adverse consequences in terms of performance and stability. Aquaporins incorporated in biomimetic membranes for use in water purification and desalination should also withstand the harsh environment that may prevail in these conditions, such as high pressure, and presence of salt or other chemicals. In this respect, modified aquaporins that can be adapted to these new environments should be developed. Another challenge is that biomimetic membranes that incorporate high densities of aquaporin should be defect-free, and this can only be efficiently ascertained with the availability of completely inactive mutants that behave otherwise like the wild type aquaporin, or with effective non-toxic water channel inhibitors that are so far inexistent. In this review, we describe approaches that can potentially be used to overcome these challenges.
Directory of Open Access Journals (Sweden)
Julie Bomholt
Full Text Available In the present paper we explored the capacity of yeast Saccharomyces cerevisiae as host for heterologous expression of human Aquaporin-1. Aquaporin-1 cDNA was expressed from a galactose inducible promoter situated on a plasmid with an adjustable copy number. Human Aquaporin-1 was C-terminally tagged with yeast enhanced GFP for quantification of functional expression, determination of sub-cellular localization, estimation of in vivo folding efficiency and establishment of a purification protocol. Aquaporin-1 was found to constitute 8.5 percent of total membrane protein content after expression at 15°C in a yeast host over-producing the Gal4p transcriptional activator and growth in amino acid supplemented minimal medium. In-gel fluorescence combined with western blotting showed that low accumulation of correctly folded recombinant Aquaporin-1 at 30°C was due to in vivo mal-folding. Reduction of the expression temperature to 15°C almost completely prevented Aquaporin-1 mal-folding. Bioimaging of live yeast cells revealed that recombinant Aquaporin-1 accumulated in the yeast plasma membrane. A detergent screen for solubilization revealed that CYMAL-5 was superior in solubilizing recombinant Aquaporin-1 and generated a monodisperse protein preparation. A single Ni-affinity chromatography step was used to obtain almost pure Aquaporin-1. Recombinant Aquaporin-1 produced in S. cerevisiae was not N-glycosylated in contrast to the protein found in human erythrocytes.
Aquaporin-2 membrane targeting
DEFF Research Database (Denmark)
Olesen, Emma T B; Fenton, Robert A
2017-01-01
The targeting of the water channel aquaporin-2 (AQP2) to the apical plasma membrane of kidney collecting duct principal cells is regulated mainly by the antidiuretic peptide hormone arginine vasopressin (AVP). This process is of crucial importance for the maintenance of body water homeostasis...... of aquaporin-2 (AQP2) to the apical plasma membrane of collecting duct (CD) principal cells (10, 20). This process is mainly regulated by the actions of AVP on the type 2 AVP receptor (V2R), although the V1a receptor may also play a minor role (26). The V2R is classified within the group of 7-transmembrane....... For example, 1) stimulation with the nonspecific AC activator forskolin increases AQP2 membrane accumulation in a mouse cortical collecting duct cell line [e.g., Norregaard et al. (16)]; 2) cAMP increases CD water permeability (15); 3) the cAMP-activated protein kinase A (PKA) can phosphorylate AQP2 on its...
Stabilization and immobilization of aquaporin reconstituted lipid vesicles for water purification.
Sun, Guofei; Chung, Tai-Shung; Jeyaseelan, Kandiah; Armugam, Arunmozhiarasi
2013-02-01
Aquaporins are water channel proteins in biological membranes that have extraordinary water permeability and selectivity. In this work, we have demonstrated that one of their family members, AquaporinZ (AqpZ), can be possibly applied in a pressure-driven water purification process. A nanofiltration membrane was designed and fabricated by immobilization of AqpZ-reconstituted liposomes on a polydopamine (PDA) coated microporous membrane. Amine-functionalized proteoliposomes were first deposited via gentle vacuum suction and subsequently conjugated on the PDA layer via an amine-catechol adduct formation. Due to the existence of a polymer network within the lipid bilayers, the membrane could sustain hydraulic pressure of 5 bar as well as the strong surface agitation in nanofiltration tests, indicating a relatively stable membrane structure. In comparison with membrane without AqpZ incorporation, the membrane with AqpZ-to-lipid weight ratio of 1:100 increased the water flux by 65% with enhanced NaCl and MgCl(2) rejections of 66.2% and 88.1%, respectively. With AqpZ incorporation, the vesicle immobilized membrane exhibits a promising strategy for high productivity water purification. Copyright © 2012 Elsevier B.V. All rights reserved.
Expression of aquaporin8 in human astrocytomas: Correlation with pathologic grade
International Nuclear Information System (INIS)
Zhu, Shu-juan; Wang, Ke-jian; Gan, Sheng-wei; Xu, Jin; Xu, Shi-ye; Sun, Shan-quan
2013-01-01
Highlights: •AQP8 is mainly distributed in the cytoplasm of human astrocytoma cells. •AQP8 over-expressed in human astrocytomas, especially glioblastoma. •The up-regulation of AQP8 is related to the pathological grade of human astrocytomas. •AQP8 may contribute to the growth and proliferation of astrocytomas. -- Abstract: Aquaporin8 (AQP8), a member of the aquaporin (AQP) protein family, is weakly distributed in mammalian brains. Previous studies on AQP8 have focused mainly on the digestive and the reproductive systems. AQP8 has a pivotal role in keeping the fluid and electrolyte balance. In this study, we investigated the expression changes of AQP8 in 75 cases of human brain astrocytic tumors using immunohistochemistry, Western blotting, and reverse transcription polymerase chain reaction. The results demonstrated that AQP8 was mainly distributed in the cytoplasm of astrocytoma cells. The expression levels and immunoreactive score of AQP8 protein and mRNA increased in low-grade astrocytomas, and further increased in high-grade astrocytomas, especially in glioblastoma. Therefore, AQP8 may contribute to the proliferation of astrocytomas, and may be a biomarker and candidate therapy target for patients with astrocytomas
Expression of aquaporin8 in human astrocytomas: Correlation with pathologic grade
Energy Technology Data Exchange (ETDEWEB)
Zhu, Shu-juan; Wang, Ke-jian; Gan, Sheng-wei; Xu, Jin; Xu, Shi-ye; Sun, Shan-quan, E-mail: sunsq2151@cqmu.edu.cn
2013-10-11
Highlights: •AQP8 is mainly distributed in the cytoplasm of human astrocytoma cells. •AQP8 over-expressed in human astrocytomas, especially glioblastoma. •The up-regulation of AQP8 is related to the pathological grade of human astrocytomas. •AQP8 may contribute to the growth and proliferation of astrocytomas. -- Abstract: Aquaporin8 (AQP8), a member of the aquaporin (AQP) protein family, is weakly distributed in mammalian brains. Previous studies on AQP8 have focused mainly on the digestive and the reproductive systems. AQP8 has a pivotal role in keeping the fluid and electrolyte balance. In this study, we investigated the expression changes of AQP8 in 75 cases of human brain astrocytic tumors using immunohistochemistry, Western blotting, and reverse transcription polymerase chain reaction. The results demonstrated that AQP8 was mainly distributed in the cytoplasm of astrocytoma cells. The expression levels and immunoreactive score of AQP8 protein and mRNA increased in low-grade astrocytomas, and further increased in high-grade astrocytomas, especially in glioblastoma. Therefore, AQP8 may contribute to the proliferation of astrocytomas, and may be a biomarker and candidate therapy target for patients with astrocytomas.
Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A; Tyerman, Stephen D; Langridge, Peter; Sutton, Tim
2010-08-01
Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley.
Altered aquaporins in the brains of mice submitted to intermittent hypoxia model of sleep apnea.
Baronio, Diego; Martinez, Denis; Fiori, Cintia Zappe; Bambini-Junior, Victorio; Forgiarini, Luiz Felipe; Pase da Rosa, Darlan; Kim, Lenise Jihe; Cerski, Marcelle Reesink
2013-01-15
Rostral fluid displacement has been proposed as a pathophysiologic mechanism of both central and obstructive sleep apnea. Aquaporins are membrane proteins that regulate water transport across the cell membrane and are involved in brain edema formation and resolution. The present study investigated the effect of intermittent hypoxia (IH), a model of sleep apnea, on brain aquaporins. Mice were exposed to intermittent hypoxia to a nadir of 7% oxygen fraction. Brain water content, Aquaporin-1 and Aquaporin-3 were measured in the cerebellum and hippocampus. Hematoxylin-eosin and immunohistochemistry stainings were performed to evaluate cell damage. Compared to the sham group, the hypoxia group presented higher brain water content, lower levels of Aquaporin-1 and similar levels of Aquaporin-3. Immunoreactivity to GFAP and S100B was stronger in the hypoxia group in areas of extensive gliosis, compatible with cytotoxic edema. These findings, although preliminary, indicate an effect of IH on aquaporins levels. Further investigation about the relevance of these data on the pathophysiology of OSA is warranted. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Maria V. Fernández
2018-04-01
Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.
Directory of Open Access Journals (Sweden)
Xun Yue
2012-01-01
Full Text Available Aquaporins are multifunctional membrane channels that facilitate the transmembrane transport of water and solutes. When transmembrane mineral nutrient transporters exhibit the same expression patterns as aquaporins under diverse temporal and physiological conditions, there is a greater probability that they interact. In this study, genome-wide temporal profiling of transcripts analysis and coexpression network-based approaches are used to examine the significant specificity correlation of aquaporins and transmembrane solute transporters in developing maize leaf. The results indicate that specific maize aquaporins are related to specific transmembrane solute transporters. The analysis demonstrates a systems-level correlation between aquaporins, nutrient transporters, and the homeostasis of mineral nutrients in developing maize leaf. Our results provide a resource for further studies into the physiological function of these aquaporins.
DEFF Research Database (Denmark)
Bomholt, Julie; Helix Nielsen, Claus; Scharff-Poulsen, Peter
2014-01-01
prevented Aquaporin1 mal-folding. Bioimaging of live yeast cells revealed that recombinant Aquaporin-1 accumulated in the yeast plasma membrane. A detergent screen for solubilization revealed that CYMAL-5 was superior in solubilizing recombinant Aquaporin-1 and generated a monodisperse protein preparation...
Directory of Open Access Journals (Sweden)
Lei Kai
Full Text Available The continuous progress in the structural and functional characterization of aquaporins increasingly attracts attention to study their roles in certain mammalian diseases. Although several structures of aquaporins have already been solved by crystallization, the challenge of producing sufficient amounts of functional proteins still remains. CF (cell free expression has emerged in recent times as a promising alternative option in order to synthesize large quantities of membrane proteins, and the focus of this report was to evaluate the potential of this technique for the production of eukaryotic aquaporins. We have selected the mouse aquaporin 4 as a representative of mammalian aquaporins. The protein was synthesized in an E. coli extract based cell-free system with two different expression modes, and the efficiencies of two modes were compared. In both, the P-CF (cell-free membrane protein expression as precipitate mode generating initial aquaporin precipitates as well as in the D-CF (cell-free membrane protein expression in presence of detergent mode, generating directly detergent solubilized samples, we were able to obtain mg amounts of protein per ml of cell-free reaction. Purified aquaporin samples solubilized in different detergents were reconstituted into liposomes, and analyzed for the water channel activity. The calculated P(f value of proteoliposome samples isolated from the D-CF mode was 133 µm/s at 10°C, which was 5 times higher as that of the control. A reversible inhibitory effect of mercury chloride was observed, which is consistent with previous observations of in vitro reconstituted aquaporin 4. In this study, a fast and convenient protocol was established for functional expression of aquaporins, which could serve as basis for further applications such as water filtration.
PIP1 and PIP2 aquaporins are differentially expressed during tobacco anther and stigma development.
Bots, Marc; Feron, Richard; Uehlein, Norbert; Weterings, Koen; Kaldenhoff, Ralf; Mariani, Titti
2005-01-01
Several processes during sexual reproduction in higher plants involve the movement of water between cells or tissues, such as occurs during dehiscence of the anther and hydration of the pollen grain after it is deposited on a stigma. To get more insight in these processes, a set of putative aquaporins was cloned and it was found that at least 15 are expressed in reproductive organs, which indicates that the control of water flow is important for reproduction. Functional studies in Xenopus laevis oocytes using two of the cDNAs showed that NtPIP2;1 is an efficient aquaporin, whereas NtPIP1;1 is not. Expression studies on RNA and protein levels showed that PIP1 and PIP2 genes are differently expressed in reproductive organs: PIP1 RNA accumulates in the stigma, and PIP1 and PIP2 RNA can be detected in most tissues of the anther.
DEFF Research Database (Denmark)
Bomholt, Julie; Helix Nielsen, Claus; Scharff-Poulsen, Peter
2013-01-01
of the expression temperature to 15°C almost completely prevented Aquaporin-1 mal-folding. Bioimaging of live yeast cells revealed that recombinant Aquaporin-1 accumulated in the yeast plasma membrane. A detergent screen for solubilization revealed that CYMAL-5 was superior in solubilizing recombinant Aquaporin-1...
Regulation of the Water Channel Aquaporin-2 via 14-3-3θ and -ζ
DEFF Research Database (Denmark)
Moeller, Hanne B; Slengerik-Hansen, Joachim; Aroankins, Takwa
2016-01-01
The 14-3-3 family of proteins are multifunctional proteins that interact with many of their cellular targets in a phosphorylation-dependent manner. Here, we determined that 14-3-3 proteins interact with phosphorylated forms of the water channel aquaporin-2 (AQP2) and modulate its function. With t...... levels. In conclusion, this study demonstrates phosphorylation-dependent interactions of AQP2 with 14-3-3 θ and ζ. These interactions play divergent roles in modulating AQP2 trafficking, phosphorylation, ubiquitylation and degradation....
NH3 and NH4+ permeability in aquaporin-expressing Xenopus oocytes
DEFF Research Database (Denmark)
Holm, Lars M.; Jahn, Thomas Paul; Møller, Anders Laurell Blom
2005-01-01
We have shown recently, in a yeast expression system, that some aquaporins are permeable to ammonia. In the present study, we expressed the mammalian aquaporins AQP8, AQQP9, AQP3, AQP1 and a plant aquaporin TIP2;1 in Xenopus oocytes to study the transport of ammonia (NH3) and ammonium (NH4+) under...... inwards currents carried by NH4+. This conductivity increased as a sigmoid function of external [NH3]: for AQP8 at a bath pH (pH(e)) of 6.5, the conductance was abolished, at pH(e) 7.4 it was half maximal and at pH(e) 7.8 it saturated. NY4+ influx was associated with oocyte swelling. In comparison, native...... oocytes as well as AQP1 and tip2;1-expressing oocytes showed small currents that were associated with small and even negative volume changes. We conclude that AQP8, AQP9, AQP3, and TIP2;1, apart from being water channels, also support significant fluxes of NH3. These aquaporins could support NH4...
Perez-Martin, Alfonso; Michelazzo, Chiara; Torres-Ruiz, Jose M; Flexas, Jaume; Fernández, José E; Sebastiani, Luca; Diaz-Espejo, Antonio
2014-07-01
The hypothesis that aquaporins and carbonic anhydrase (CA) are involved in the regulation of stomatal (g s) and mesophyll (g m) conductance to CO2 was tested in a short-term water-stress and recovery experiment in 5-year-old olive plants (Olea europaea) growing outdoors. The evolution of leaf gas exchange, chlorophyll fluorescence, and plant water status, and a quantitative analysis of photosynthesis limitations, were followed during water stress and recovery. These variables were correlated with gene expression of the aquaporins OePIP1.1 and OePIP2.1, and stromal CA. At mild stress and at the beginning of the recovery period, stomatal limitations prevailed, while the decline in g m accounted for up to 60% of photosynthesis limitations under severe water stress. However, g m was restored to control values shortly after rewatering, facilitating the recovery of the photosynthetic rate. CA was downregulated during water stress and upregulated after recovery. The use of structural equation modelling allowed us to conclude that both OePIP1.1 and OePIP2.1 expression could explain most of the variations observed for g s and g m. CA expression also had a small but significant effect on g m in olive under water-stress conditions. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Cerebrospinal fluid aquaporin-4-immunoglobulin G disrupts blood brain barrier
DEFF Research Database (Denmark)
Asgari, Nasrin; Berg, Carsten Tue; Mørch, Marlene Thorsen
2015-01-01
associated with blood-borne horseradish peroxidase leakage indicating blood-brain barrier breakdown. The cerebrospinal fluid aquaporin-4-immunoglobulin G therefore distributes widely in brain to initiate astrocytopathy and blood-brain barrier breakdown....... was evaluated. A distinct distribution pattern of aquaporin-4-immunoglobulin G deposition was observed in the subarachnoid and subpial spaces where vessels penetrate the brain parenchyma, via a paravascular route with intraparenchymal perivascular deposition. Perivascular astrocyte-destructive lesions were...
Aquaporin-6 Expression in the Cochlear Sensory Epithelium Is Downregulated by Salicylates
Directory of Open Access Journals (Sweden)
Paola Perin
2010-01-01
Full Text Available We characterize the expression pattern of aquaporin-6 in the mouse inner ear by RT-PCR and immunohistochemistry. Our data show that in the inner ear aquaporin-6 is expressed, in both vestibular and acoustic sensory epithelia, by the supporting cells directly contacting hair cells. In particular, in the Organ of Corti, expression was strongest in Deiters' cells, which provide both a mechanical link between outer hair cells (OHCs and the Organ of Corti, and an entry point for ion recycle pathways. Since aquaporin-6 is permeable to both water and anions, these results suggest its possible involvement in regulating OHC motility, directly through modulation of water and chloride flow or by changing mechanical compliance in Deiters' cells. In further support of this role, treating mice with salicylates, which impair OHC electromotility, dramatically reduced aquaporin-6 expression in the inner ear epithelia but not in control tissues, suggesting a role for this protein in modulating OHCs' responses.
Aquaporin-6 expression in the cochlear sensory epithelium is downregulated by salicylates.
Perin, Paola; Tritto, Simona; Botta, Laura; Fontana, Jacopo Maria; Gastaldi, Giulia; Masetto, Sergio; Tosco, Marisa; Laforenza, Umberto
2010-01-01
We characterize the expression pattern of aquaporin-6 in the mouse inner ear by RT-PCR and immunohistochemistry. Our data show that in the inner ear aquaporin-6 is expressed, in both vestibular and acoustic sensory epithelia, by the supporting cells directly contacting hair cells. In particular, in the Organ of Corti, expression was strongest in Deiters' cells, which provide both a mechanical link between outer hair cells (OHCs) and the Organ of Corti, and an entry point for ion recycle pathways. Since aquaporin-6 is permeable to both water and anions, these results suggest its possible involvement in regulating OHC motility, directly through modulation of water and chloride flow or by changing mechanical compliance in Deiters' cells. In further support of this role, treating mice with salicylates, which impair OHC electromotility, dramatically reduced aquaporin-6 expression in the inner ear epithelia but not in control tissues, suggesting a role for this protein in modulating OHCs' responses.
Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A.; Tyerman, Stephen D.; Langridge, Peter; Sutton, Tim
2010-01-01
Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley. PMID:20581256
Changes in plasma membrane aquaporin gene expression under osmotic stress and blue light in tomato
Czech Academy of Sciences Publication Activity Database
Balarynová, Jana; Danihlík, J.; Fellner, Martin
2018-01-01
Roč. 40, č. 2 (2018), č. článku 27. ISSN 0137-5881 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : male-sterile mutant * arabidopsis-thaliana * seed-germination * abscisic-acid * solanum-lycopersicon * nitric-oxide * 7b-1 * protein * hypocotyl * responses * Tomato * Seed * Aquaporins * Blue light * 7B-1 mutant * Mannitol * PIPs Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.364, year: 2016
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Yeast aquaporin regulation by 4-hydroxynonenal is implicated in oxidative stress response.
Rodrigues, Claudia; Tartaro Bujak, Ivana; Mihaljević, Branka; Soveral, Graça; Cipak Gasparovic, Ana
2017-05-01
Reactive oxygen species, especially hydrogen peroxide (H 2 O 2 ), contribute to functional molecular impairment and cellular damage, but also are necessary in normal cellular metabolism, and in low doses play stimulatory role in cell proliferation and stress resistance. In parallel, reactive aldehydes such as 4-hydroxynonenal (HNE), are lipid peroxidation breakdown products which also contribute to regulation of numerous cellular processes. Recently, channeling of H 2 O 2 by some mammalian aquaporin isoforms has been reported and suggested to contribute to aquaporin involvement in cancer malignancies, although the mechanism by which these membrane water channels are implicated in oxidative stress is not clear. In this study, two yeast models with increased levels of membrane polyunsaturated fatty acids (PUFAs) and aquaporin AQY1 overexpression, respectively, were used to evaluate their interplay in cell's oxidative status. In particular, the aim of the study was to investigate if HNE accumulation could affect aquaporin function with an outcome in oxidative stress response. The data showed that induction of aquaporin expression by PUFAs results in increased water permeability in yeast membranes and that AQY1 activity is impaired by HNE. Moreover, AQY1 expression increases cellular sensitivity to oxidative stress by facilitating H 2 O 2 influx. On the other hand, AQY1 expression has no influence on the cellular antioxidant GSH levels and catalase activity. These results strongly suggest that aquaporins are important players in oxidative stress response and could contribute to regulation of cellular processes by regulation of H 2 O 2 influx. © 2017 IUBMB Life, 69(5):355-362, 2017. © 2017 International Union of Biochemistry and Molecular Biology.
Lopes, Karen de Carvalho; Sartorato, Edi Lúcia; da Silva-Costa, Sueli M; de Macedo Adamov, Nadya Soares; Ganança, Fernando Freitas
2016-09-01
Ménière's disease (MD) is a complex disease of unknown etiology characterized by a symptomatic tetrad of vertigo, hearing loss, tinnitus, and aural fullness. In addition to factors related to homeostasis of the inner ear, genetic factors have been implicated in its pathophysiology, including genes related to the transport of water and ionic composition maintenance of the endolymph, such as the aquaporin genes AQP2 and AQP3, and the potassium channel gene KCNE1. The aim of this study was to identify polymorphisms of these genes and determine their association with clinical characteristics of patients with MD. A case-control genetic association study was carried out, including 30 patients with definite Ménière's disease and 30 healthy controls. The coding regions of the target genes were amplified from blood samples by polymerase chain reaction (PCR), followed by direct sequencing. The associations of polymorphisms with clinical characteristics were analyzed with logistic regression. Five polymorphisms were identified: rs426496 in AQP2; rs591810 in AQP3; and rs1805127, rs1805128, and rs17173510 in KCNE1. After adjustment, rs426496 was significantly associated with tinnitus during the initial crisis and with altered electronystagmography, and rs1805127 was significantly associated with nephropathy. The genetic variant rs426496 in AQP2; rs591810 in AQP3 and rs1805127, rs1805128, and rs17173510, in KCNE1 were found in patients with Ménière's disease. The polymorphism rs426496, in AQP2, is associated with tinnitus at the onset of Ménière's disease and altered electronystagmography. In addition, rs1805127, in KCNE1, is associated with the presence of nephropathy.
Directory of Open Access Journals (Sweden)
Kasim Khan
Full Text Available Drought and high salinity are environmental conditions that cause adverse effects on the growth and productivity of crops. Aquaporins are small integral membrane proteins that belong to the family of the major intrinsic proteins (MIPs, with members in animals, plants and microbes, where they facilitate the transport of water and/or small neutral solutes thereby affecting water balance. In this study we characterized two aquaporin genes namely, plasma membrane intrinsic protein (PIP2;7 and tonoplast intrinsic protein TIP1;3 from Jatropha curcas that are localised to the plasma membrane and vacuole respectively. Transgenic Arabidopsis thaliana lines over-expressing JcPIP2;7 and JcTIP1;3 under a constitutive promoter show improved germination under high salt and mannitol compared to control seeds. These transgenic plants also show increased root length under abiotic stress conditions compared to wild type Col-0 plants. Transgenic lines exposed to drought conditions by withholding water for 20 days, were able to withstand water stress and attained normal growth after re-watering unlike control plants which could not survive. Transgenic lines also had better seed yield than control under salt stress. Importantly, seed viability of transgenic plants grown under high salt concentration was 35%-45% compared to less than 5% for control seeds obtained from plants growing under salt stress. The effect of JcPIP2;7 and JcTIP1;3 on improving germination and seed viability in drought and salinity make these important candidates for genetic manipulation of plants for growth in saline soils.
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
Polyphenols as Modulators of Aquaporin Family in Health and Disease
Directory of Open Access Journals (Sweden)
Diana Fiorentini
2015-01-01
Full Text Available Polyphenols are bioactive molecules widely distributed in fruits, vegetables, cereals, and beverages. Polyphenols in food sources are extensively studied for their role in the maintenance of human health and in the protection against development of chronic/degenerative diseases. Polyphenols act mainly as antioxidant molecules, protecting cell constituents against oxidative damage. The enormous number of polyphenolic compounds leads to huge different mechanisms of action not fully understood. Recently, some evidence is emerging about the role of polyphenols, such as curcumin, pinocembrin, resveratrol, and quercetin, in modulating the activity of some aquaporin (AQP isoforms. AQPs are integral, small hydrophobic water channel proteins, extensively expressed in many organs and tissues, whose major function is to facilitate the transport of water or glycerol over cell plasma membranes. Here we summarize AQP physiological functions and report emerging evidence on the implication of these proteins in a number of pathophysiological processes. In particular, this review offers an overview about the role of AQPs in brain, eye, skin diseases, and metabolic syndrome, focusing on the ability of polyphenols to modulate AQP expression. This original analysis can contribute to elucidating some peculiar effects exerted by polyphenols and can lead to the development of an innovative potential preventive/therapeutic strategy.
Polyphenols as Modulators of Aquaporin Family in Health and Disease.
Fiorentini, Diana; Zambonin, Laura; Dalla Sega, Francesco Vieceli; Hrelia, Silvana
2015-01-01
Polyphenols are bioactive molecules widely distributed in fruits, vegetables, cereals, and beverages. Polyphenols in food sources are extensively studied for their role in the maintenance of human health and in the protection against development of chronic/degenerative diseases. Polyphenols act mainly as antioxidant molecules, protecting cell constituents against oxidative damage. The enormous number of polyphenolic compounds leads to huge different mechanisms of action not fully understood. Recently, some evidence is emerging about the role of polyphenols, such as curcumin, pinocembrin, resveratrol, and quercetin, in modulating the activity of some aquaporin (AQP) isoforms. AQPs are integral, small hydrophobic water channel proteins, extensively expressed in many organs and tissues, whose major function is to facilitate the transport of water or glycerol over cell plasma membranes. Here we summarize AQP physiological functions and report emerging evidence on the implication of these proteins in a number of pathophysiological processes. In particular, this review offers an overview about the role of AQPs in brain, eye, skin diseases, and metabolic syndrome, focusing on the ability of polyphenols to modulate AQP expression. This original analysis can contribute to elucidating some peculiar effects exerted by polyphenols and can lead to the development of an innovative potential preventive/therapeutic strategy.
Perrone, Irene; Gambino, Giorgio; Chitarra, Walter; Vitali, Marco; Pagliarani, Chiara; Riccomagno, Nadia; Balestrini, Raffaella; Kaldenhoff, Ralf; Uehlein, Norbert; Gribaudo, Ivana; Schubert, Andrea; Lovisolo, Claudio
2012-10-01
We functionally characterized the grape (Vitis vinifera) VvPIP2;4N (for Plasma membrane Intrinsic Protein) aquaporin gene. Expression of VvPIP2;4N in Xenopus laevis oocytes increased their swelling rate 54-fold. Northern blot and quantitative reverse transcription-polymerase chain reaction analyses showed that VvPIP2;4N is the most expressed PIP2 gene in root. In situ hybridization confirmed root localization in the cortical parenchyma and close to the endodermis. We then constitutively overexpressed VvPIP2;4N in grape 'Brachetto', and in the resulting transgenic plants we analyzed (1) the expression of endogenous and transgenic VvPIP2;4N and of four other aquaporins, (2) whole-plant, root, and leaf ecophysiological parameters, and (3) leaf abscisic acid content. Expression of transgenic VvPIP2;4N inhibited neither the expression of the endogenous gene nor that of other PIP aquaporins in both root and leaf. Under well-watered conditions, transgenic plants showed higher stomatal conductance, gas exchange, and shoot growth. The expression level of VvPIP2;4N (endogenous + transgene) was inversely correlated to root hydraulic resistance. The leaf component of total plant hydraulic resistance was low and unaffected by overexpression of VvPIP2;4N. Upon water stress, the overexpression of VvPIP2;4N induced a surge in leaf abscisic acid content and a decrease in stomatal conductance and leaf gas exchange. Our results show that aquaporin-mediated modifications of root hydraulics play a substantial role in the regulation of water flow in well-watered grapevine plants, while they have a minor role upon drought, probably because other signals, such as abscisic acid, take over the control of water flow.
DEFF Research Database (Denmark)
Li, Zhenyu; Linares, Rodrigo Valladares; Bucs, Szilard
2017-01-01
Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused, by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquapor...
Targeting Aquaporin Function : Potent Inhibition of Aquaglyceroporin-3 by a Gold-Based Compound
Martins, Ana Paula; Marrone, Alessandro; Ciancetta, Antonella; Galan Cobo, Ana; Echevarria, Miriam; Moura, Teresa F.; Re, Nazzareno; Casini, Angela; Soveral, Graca
2012-01-01
Aquaporins (AQPs) are membrane channels that conduct water and small solutes such as glycerol and are involved in many physiological functions. Aquaporin-based modulator drugs are predicted to be of broad potential utility in the treatment of several diseases. Until today few AQP inhibitors have
Li, Zhenyu
2017-07-27
Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquaporin based biomimetic membrane in simulated membrane cleaning processes. The effects of cleaning agents on water flux and salt rejection were evaluated. The membrane showed a good resistance to the chemical agents. The water flux after chemical cleaning showed significant increases, particularly after cleaning with NaOCl and Alconox. Changes in the membrane structure and increased hydrophilicity in the surrounding areas of the aquaporin may be accountable for the increase in water permeability. The membrane shows stable salt rejection up to 99% after all cleaning agents were tested. A 15-day experiment with secondary wastewater effluent as the feed solution and seawater as the draw solution showed a stable flux and high salt rejection. The average rejection of the dissolved organic carbon from wastewater after the 15-day test was 90%. The results demonstrated that the aquaporin based biomimetic FO membrane exhibits chemical resistance for most agents used in membrane cleaning procedures, maintaining a stable flux and high salt rejection.
Li, Zhenyu; Valladares Linares, Rodrigo; Bucs, Szilard; Fortunato, Luca; Hé lix-Nielsen, Claus; Vrouwenvelder, Johannes S.; Ghaffour, NorEddine; Leiknes, TorOve; Amy, Gary
2017-01-01
Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquaporin based biomimetic membrane in simulated membrane cleaning processes. The effects of cleaning agents on water flux and salt rejection were evaluated. The membrane showed a good resistance to the chemical agents. The water flux after chemical cleaning showed significant increases, particularly after cleaning with NaOCl and Alconox. Changes in the membrane structure and increased hydrophilicity in the surrounding areas of the aquaporin may be accountable for the increase in water permeability. The membrane shows stable salt rejection up to 99% after all cleaning agents were tested. A 15-day experiment with secondary wastewater effluent as the feed solution and seawater as the draw solution showed a stable flux and high salt rejection. The average rejection of the dissolved organic carbon from wastewater after the 15-day test was 90%. The results demonstrated that the aquaporin based biomimetic FO membrane exhibits chemical resistance for most agents used in membrane cleaning procedures, maintaining a stable flux and high salt rejection.
In vitro physiological and pathophysiological models: dynamic expression of aquaporins.
Avola, Rosanna
2017-01-01
Water is the main component of biological fluids and a prerequisite of all organisms living. In 1987, Agre isolated a new integral membrane protein acting as a channel that mediates the water flux and uncharged solutes across biological membranes. This protein was called aquaporin1 and ever since its discovery, more than 300 homologues have been identified in animal, bacteria and plant. In human have been discovered 13 aquaporins (AQPs) isoform (AQP0-AQP12) widely distributed in various epith...
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Ma, Xiaohong; Shatil-Cohen, Arava; Ben-Dor, Shifra; Wigoda, Noa; Perera, Imara Y; Im, Yang Ju; Diminshtein, Sofia; Yu, Ling; Boss, Wendy F; Moshelion, Menachem; Moran, Nava
2015-03-01
Enhancing the membrane content of PtdInsP 2 , the already-recognized protein-regulating lipid, increased the osmotic water permeability of tobacco protoplasts, apparently by increasing the abundance of active aquaporins in their membranes. While phosphoinositides are implicated in cell volume changes and are known to regulate some ion channels, their modulation of aquaporins activity has not yet been reported for any organism. To examine this, we compared the osmotic water permeability (P f) of protoplasts isolated from tobacco (Nicotiana tabacum) cultured cells (NT1) with different (genetically lowered or elevated relative to controls) levels of inositol trisphosphate (InsP3) and phosphatidyl inositol [4,5] bisphosphate (PtdInsP2). To achieve this, the cells were transformed with, respectively, the human InsP3 5-phosphatase ('Ptase cells') or human phosphatidylinositol (4) phosphate 5-kinase ('PIPK cells'). The mean P f of the PIPK cells was several-fold higher relative to that of controls and Ptase cells. Three results favor aquaporins over the membrane matrix as underlying this excessive P f: (1) transient expression of the maize aquaporin ZmPIP2;4 in the PIPK cells increased P f by 12-30 μm s(-1), while in the controls only by 3-4 μm s(-1). (2) Cytosol acidification-known to inhibit aquaporins-lowered the P f in the PIPK cells down to control levels. (3) The transcript of at least one aquaporin was elevated in the PIPK cells. Together, the three results demonstrate the differences between the PIPK cells and their controls, and suggest a hitherto unobserved regulation of aquaporins by phosphoinositides, which could occur through direct interaction or indirect phosphoinositides-dependent cellular effects.
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
Directory of Open Access Journals (Sweden)
Shiyi Zhou
Full Text Available Aquaporin (AQP proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG, abscisic acid (ABA and H(2O(2. Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA and H(2O(2, and less ion leakage (IL, but higher relative water content (RWC and superoxide dismutase (SOD and catalase (CAT activities when compared with the wild type (WT under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants.
Electrostatic tuning of permeation and selectivity in aquaporin water channels
DEFF Research Database (Denmark)
Jensen, Mogens O Stibius; Tajkhorshid, E.; Schulten, K.
2003-01-01
Water permeation and electrostatic interactions between water and channel are investigated in the Escherichia coli glycerol uptake facilitator GlpF, a member of the aquaporin water channel family, by molecular dynamics simulations. A tetrameric model of the channel embedded in a 16:0/ 18:1c9...... with the protein electrostatic fields enforce a bipolar water configuration inside the channel with dipole inversion at the NPA motifs. At the NPA motifs water-protein electrostatic interactions facilitate this inversion. Furthermore, water-water electrostatic interactions are in all regions inside the channel...... stronger than water-protein interactions, except near a conserved, positively charged Arg residue. We find that variations of the protein electrostatic field through the channel, owing to preserved structural features, completely explain the bipolar orientation of water. This orientation persists despite...
Martínez-Ballesta, Maria Del Carmen; Pérez-Sánchez, Horacio; Moreno, Diego A; Carvajal, Micaela
2016-07-01
Their biodegradable nature and ability to target cells make biological vesicles potential nanocarriers for bioactives delivery. In this work, the interaction between proteoliposomes enriched in aquaporins derived from broccoli plants and the glucosinolates was evaluated. The vesicles were stored at different temperatures and their integrity was studied. Determination of glucosinolates, showed that indolic glucosinolates were more sensitive to degradation in aqueous solution than aliphatic glucosinolates. Glucoraphanin was stabilized by leaf and root proteoliposomes at 25°C through their interaction with aquaporins. An extensive hydrogen bond network, including different aquaporin residues, and hydrophobic interactions, as a consequence of the interaction between the linear alkane chain of glucoraphanin and Glu31 and Leu34 protein residues, were established as the main stabilizing elements. Combined our results showed that plasma membrane vesicles from leaf and root tissues of broccoli plants may be considered as suitable carriers for glucosinolate which stabilization can be potentially attributed to aquaporins. Copyright © 2016 Elsevier B.V. All rights reserved.
Ohrui, T; Nobira, H; Sakata, Y; Taji, T; Yamamoto, C; Nishida, K; Yamakawa, T; Sasuga, Y; Yaguchi, Y; Takenaga, H; Tanaka, Shigeo
2007-12-01
The atmospheric epiphyte Tillandsia ionantha is capable of surviving drought stress for 6 months or more without any exogenous water supply via an as of yet to be determined mechanism. When plants were soaked in water for 3 h, leaves absorbed a remarkably large amount of water (30-40% on the basis of fresh weight), exhibiting a bimodal absorption pattern. Radiolabeled water was taken up by the leaves by capillary action of the epidermal trichomes within 1 min (phase 1) and then transported intracellularly to leaf tissues over 3 h (phase 2). The removal of epidermal trichome wings from leaves as well as rinsing leaves with water significantly lowered the extracellular accumulation of water on leaf surfaces. The intracellular transport of water was inhibited by mercuric chloride, implicating the involvement of a water channel aquaporin in second-phase water absorption. Four cDNA clones (TiPIP1a, TiPIP1b, TiPIP1c, and TiPIP2a) homologous to PIP family aquaporins were isolated from the leaves, and RT-PCR showed that soaking plants in water stimulated the expression of TiPIP2a mRNA, suggesting the reinforcement in ability to rapidly absorb a large amount of water. The expression of TiPIP2a complementary RNA in Xenopus oocytes enhanced permeability, and treatment with inhibitors suggested that the water channel activity of TiPIP2a protein was regulated by phosphorylation. Thus, the high water uptake capability of T. ionantha leaves surviving drought is attributable to a bimodal trichome- and aquaporin-aided water uptake system based on rapid physical collection of water and subsequent, sustained chemical absorption.
DEFF Research Database (Denmark)
Engelund, Morten Buch; Madsen, Steffen S
2015-01-01
Most vertebrate nephrons possess an inherited ability to secrete fluid in normal or pathophysiological states. We hypothesized that renal aquaporin expression and localization are functionally regulated in response to seawater and during smoltification in Atlantic salmon and thus reflect a shift...... in renal function from filtration towards secretion. We localized aquaporins (Aqp) in Atlantic salmon renal tubular segments by immunohistochemistry and monitored their expressional dynamics using RT-PCR and immunoblotting. Three aquaporins: Aqpa1aa, Aqp1ab and Aqp8b and two aquaglyceroporins Aqp3a and Aqp......10b were localized in the kidney of salmon. The staining for all aquaporins was most abundant in the proximal kidney tubules and there was no clear effect of salinity or developmental stage on localization pattern. Aqp1aa and Aqp3a were abundant apically but extended throughout the epithelial cells...
Meng, Juan-hong; Ma, Xu-chen; Li, Zhi-min; Wu, Deng-cheng
2007-12-20
Over 70% of the total tissue weight in the cartilage matrix consists of water, and the early-stage osteoarthritic cartilage is characterized by swelling. Water transport in the cartilage matrix and across the membranes of chondrocytes may be important in normal and pathological conditions of cartilage. The purpose of this study was to identify aquaporin-1 (AQP1) and aquaporin-3 (AQP3) expressions in the mandibular condylar cartilage after experimentally induced osteoarthritis (OA) in rats. An experimental temporomandibular joint OA was induced by partial discectomy in rats. The pathological characteristics of the normal, early-stage, and late-stage osteoarthritic TMJ cartilages were verified by histological techniques. The AQP1 and AQP3 gene expressions in the normal and osteoarthritic cartilages were measured using quantitative real-time reverse-transcription PCR analysis. The cartilage sections were incubated in primary polyclonal antibodies to AQP3; immunofluorescent microscopy was used to examine the AQP3 expression shown by its protein level. The mRNA expression levels of AQP1 and AQP3, analyzed using quantitative PCR, revealed that AQP3 mRNA was highly up-regulated in the OA cartilage, which was considered significant. There was no notable difference in the expression of AQP1 mRNA between OA and normal controls. With the progressing of the OA, the localization of the AQP3 protein was quite different from that of the normal cartilage. Compared to the normal cartilage, the expressions of AQP3 protein were observed mainly in the proliferative zone and the upper mid-zone chondrocytes at the early-stage of OA, and were observed to appear frequently throughout the mid- and deep zone during the late-stage of OA. The high expression of AQP3 mRNA in the OA cartilage and the different localization of the AQP3 protein suggest that it may play a particular role in OA pathogenesis. Further study of AQP3 function may provide new insight into the understanding of the
DEFF Research Database (Denmark)
Tran, Thuy Linh; Hamann, Steffen; Heegaard, Steffen
2017-01-01
The major part of the eye consists of water . Continuous movement of water and ions between the ocular compartments and to the systemic circulation is pivotal for many physiological functions in the eye. The movement of water facilitates removal of the many metabolic products of corneal-, ciliary...... pressure. In the retina, water is transported into the vitreous body and across the retinal pigment epithelium to regulate the extracellular environment and the hydration of the retina. Aquaporins (AQPs ) take part in the water transport throughout the eye....
Water transport and functional dynamics of aquaporins in osmoregulatory organs of fishes
DEFF Research Database (Denmark)
Madsen, Steffen S; Engelund, Morten B; Cutler, Christopher P
2015-01-01
salty desert lakes, the challenge to obtain consensus as well as specific knowledge about aquaporin physiology in these vertebrate clades is overwhelming. Because the integumental surfaces of these animals are in intimate contact with the surrounding milieu, passive water loss and uptake represent two......Aquaporins play distinct roles for water transport in fishes as they do in mammals-both at the cellular, organ, and organismal levels. However, with over 32,000 known species of fishes inhabiting almost every aquatic environment, from tidal pools, small mountain streams, to the oceans and extreme...... of the major osmoregulatory challenges that need compensation. However, neither obligatory nor regulatory water transport nor their mechanisms have been elucidated to the same degree as, for example, ion transport in fishes. Currently fewer than 60 papers address fish aquaporins. Most of these papers identify...
DEFF Research Database (Denmark)
Skjolding, Anders Daehli; Holst, Anders Vedel; Broholm, Helle
2013-01-01
findings to human pathophysiology. This study compares expression of aquaporin-4 in hydrocephalic human brain with human controls and hydrocephalic rat brain. Methods: Cortical biopsies from patients with chronic hydrocephalus (n=29) were sampled secondary to planned surgical intervention. Aquaporin-4...
Novel regulation of aquaporins during osmotic stress.
Vera-Estrella, Rosario; Barkla, Bronwyn J; Bohnert, Hans J; Pantoja, Omar
2004-08-01
Aquaporin protein regulation and redistribution in response to osmotic stress was investigated. Ice plant (Mesembryanthemum crystallinum) McTIP1;2 (McMIPF) mediated water flux when expressed in Xenopus leavis oocytes. Mannitol-induced water imbalance resulted in increased protein amounts in tonoplast fractions and a shift in protein distribution to other membrane fractions, suggesting aquaporin relocalization. Indirect immunofluorescence labeling also supports a change in membrane distribution for McTIP1;2 and the appearance of a unique compartment where McTIP1;2 is expressed. Mannitol-induced redistribution of McTIP1;2 was arrested by pretreatment with brefeldin A, wortmannin, and cytochalasin D, inhibitors of vesicle trafficking-related processes. Evidence suggests a role for glycosylation and involvement of a cAMP-dependent signaling pathway in McTIP1;2 redistribution. McTIP1;2 redistribution to endosomal compartments may be part of a homeostatic process to restore and maintain cellular osmolarity under osmotic-stress conditions.
Control of the selectivity of the aquaporin water channel family by global orientational tuning
DEFF Research Database (Denmark)
Jensen, Morten Østergaard; Tajkhorshid, E.; Nollert, P.
2002-01-01
and orientation of a single file of seven to nine water molecules inside the channel. Two conserved asparagines force a central water molecule to serve strictly as a hydrogen bond donor to its neighboring water molecules. Assisted by the electrostatic potential generated by two half-membrane spanning loops......Aquaporins are transmembrane channels found in cell membranes of all life forms. We examine their apparently paradoxical property, facilitation of efficient permeation of water while excluding protons, which is of critical importance to preserving the electrochemical potential across the cell...... membrane. We have determined the structure of the Escherichia coli aquaglyceroporin GlpF with bound water, in native (2.7 angstroms) and in W48F/F200T mutant (2.1 angstroms) forms, and carried out 12-nanosecond molecular dynamics simulations that define the spatial and temporal probability distribution...
Interferon induced IFIT family genes in host antiviral defense.
Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua
2013-01-01
Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.
DEFF Research Database (Denmark)
Zhao, Yang; Qiu, Changquan; Li, Xuesong
2012-01-01
-free ABMs that can be easily scaled up. In the current study, a thin film composite (TFC) ABM was prepared by the interfacial polymerization method, where AquaporinZ-containing proteoliposomes were added to the m-phenylene-diamine aqueous solution. Control membranes, either without aquaporins......Aquaporins are water channel proteins with excellent water permeability and solute rejection, which makes them promising for preparing high-performance biomimetic membranes. Despite the growing interest in aquaporin-based biomimetic membranes (ABMs), it is challenging to produce robust and defect...... or with inactive (mutant) aquaporins, were also similarly prepared. The separation performance of these membranes was evaluated by cross-flow reverse osmosis (RO) tests. Compared to the controls, the active ABM achieved significantly higher water permeability (∼4L/m2hbar) with comparable NaCl rejection (∼97...
Diabetes Insipidus in Mice with a Mutation in Aquaporin-2.
Directory of Open Access Journals (Sweden)
2005-08-01
Full Text Available Congenital nephrogenic diabetes insipidus (NDI is a disease characterized by failure of the kidney to concentrate urine in response to vasopressin. Human kindreds with nephrogenic diabetes insipidus have been found to harbor mutations in the vasopressin receptor 2 (Avpr2 gene or the vasopressin-sensitive water channel aquaporin-2 (Aqp2 gene. Development of a treatment is rendered difficult due to the lack of a viable animal model. Through forward genetic screening of ethylnitrosourea-mutagenized mice, we report the identification and characterization of a mouse model of NDI, with an F204V mutation in the Aqp2 gene. Unlike previously attempted murine models of NDI, our mice survive to adulthood and more exactly recapitulate the human disorder. Previous in vitro experiments using renal cell lines suggest recessive Aqp2 mutations result in improper trafficking of the mutant water pore. Using these animals, we have directly proven this hypothesis of improper AQP2 translocation as the molecular defect in nephrogenic diabetes insipidus in the intact organism. Additionally, using a renal cell line we show that the mutated protein, AQP2-F204V, is retained in the endoplasmic reticulum and that this abnormal localization can be rescued by wild-type protein. This novel mouse model allows for further mechanistic studies as well as testing of pharmacological and gene therapies for NDI.
The Caenorhabditis chemoreceptor gene families
Robertson Hugh M; Thomas James H
2008-01-01
Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...
Alguacil, Maria Del Mar; Kohler, Josef; Caravaca, Fuensanta; Roldán, Antonio
2009-11-01
Arbuscular mycorrhizal (AM) symbiosis and plant-growth-promoting rhizobacterium (PGPR) can alleviate the effects of water stress in plants, but it is unknown whether these benefits can be maintained at elevated CO2. Therefore, we carried out a study where seedlings of Lactuca sativa were inoculated with the AM fungus (AMF) Glomus intraradices N.C. Schenk & G.S. Sm. or the PGPR Pseudomonas mendocina Palleroni and subjected to two levels of watering and two levels of atmospheric CO2 to ascertain their effects on plant physiological parameters and gene expression of one PIP aquaporin in roots. The inoculation with PGPR produced the greatest growth in lettuce plants under all assayed treatments as well as the highest foliar potassium concentration and leaf relative water content under elevated [CO2] and drought. However, under such conditions, the PIP2 gene expression remained almost unchanged. G. intraradices increased significantly the AMF colonization, foliar phosphorus concentration and leaf relative water content in plants grown under drought and elevated [CO2]. Under drought and elevated [CO2], the plants inoculated with G. intraradices showed enhanced expression of the PIP2 gene as compared to P. mendocina or control plants. Our results suggest that both microbial inoculation treatments could help to alleviate drought at elevated [CO2]. However, the PIP2 gene expression was increased only by the AMF but not by the PGPR under these conditions.
Directory of Open Access Journals (Sweden)
Lin Wang
Full Text Available Plants are unavoidably subjected to various abiotic stressors, including high salinity, drought and low temperature, which results in water deficit and even death. Water uptake and transportation play a critical role in response to these stresses. Many aquaporin proteins, localized at different tissues, function in various transmembrane water movements. We targeted at the key aquaporin in charge of both water uptake in roots and radial water transportation from vascular tissues through the whole plant.The MzPIP2;1 gene encoding a plasma membrane intrinsic protein was cloned from salt-tolerant apple rootstock Malus zumi Mats. The GUS gene was driven by MzPIP2;1 promoter in transgenic Arabidopsis. It indicated that MzPIP2;1 might function in the epidermal and vascular cells of roots, parenchyma cells around vessels through the stems and vascular tissues of leaves. The ectopically expressed MzPIP2;1 conferred the transgenic Arabidopsis plants enhanced tolerance to slight salt and drought stresses, but sensitive to moderate salt stress, which was indicated by root length, lateral root number, fresh weight and K+/Na+ ratio. In addition, the possible key cis-elements in response to salt, drought and cold stresses were isolated by the promoter deletion experiment.The MzPIP2;1 protein, as a PIP2 aquaporins subgroup member, involved in radial water movement, controls water absorption and usage efficiency and alters transgenic plants drought and salt tolerance.
Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family
Directory of Open Access Journals (Sweden)
Wang Bo
2015-01-01
Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Recurrent APC gene mutations in Polish FAP families
Directory of Open Access Journals (Sweden)
Pławski Andrzej
2007-12-01
Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
Aquaporin-Based Biomimetic Polymeric Membranes: Approaches and Challenges
DEFF Research Database (Denmark)
Habel, Joachim Erich Otto; Hansen, Michael; Kynde, Søren
2015-01-01
In recent years, aquaporin biomimetic membranes (ABMs) for water separation have gained considerable interest. Although the first ABMs are commercially available, there are still many challenges associated with further ABM development. Here, we discuss the interplay of the main components of ABMs...... thin film interfacial polymerization techniques. Finally, we describe some new developments in interfacial polymerization using polyhedral oligomeric silsesquioxane cages for increasing the physical and chemical durability of thin film composite membranes.......In recent years, aquaporin biomimetic membranes (ABMs) for water separation have gained considerable interest. Although the first ABMs are commercially available, there are still many challenges associated with further ABM development. Here, we discuss the interplay of the main components of ABMs...... for investigating AQP incorporation including freeze-fracture transmission electron microscopy, fluorescence correlation spectroscopy, stopped-flow light scattering, and small-angle X-ray scattering. Third, we focus on recent efforts in embedding reconstituted AQPs in membrane designs that are based on conventional...
Aquaporin-Based Biomimetic Polymeric Membranes: Approaches and Challenges
Habel, Joachim; Hansen, Michael; Kynde, Søren; Larsen, Nanna; Midtgaard, Søren Roi; Jensen, Grethe Vestergaard; Bomholt, Julie; Ogbonna, Anayo; Almdal, Kristoffer; Schulz, Alexander; Hélix-Nielsen, Claus
2015-01-01
In recent years, aquaporin biomimetic membranes (ABMs) for water separation have gained considerable interest. Although the first ABMs are commercially available, there are still many challenges associated with further ABM development. Here, we discuss the interplay of the main components of ABMs: aquaporin proteins (AQPs), block copolymers for AQP reconstitution, and polymer-based supporting structures. First, we briefly cover challenges and review recent developments in understanding the interplay between AQP and block copolymers. Second, we review some experimental characterization methods for investigating AQP incorporation including freeze-fracture transmission electron microscopy, fluorescence correlation spectroscopy, stopped-flow light scattering, and small-angle X-ray scattering. Third, we focus on recent efforts in embedding reconstituted AQPs in membrane designs that are based on conventional thin film interfacial polymerization techniques. Finally, we describe some new developments in interfacial polymerization using polyhedral oligomeric silsesquioxane cages for increasing the physical and chemical durability of thin film composite membranes. PMID:26264033
Novel Regulation of Aquaporins during Osmotic Stress1
Vera-Estrella, Rosario; Barkla, Bronwyn J.; Bohnert, Hans J.; Pantoja, Omar
2004-01-01
Aquaporin protein regulation and redistribution in response to osmotic stress was investigated. Ice plant (Mesembryanthemum crystallinum) McTIP1;2 (McMIPF) mediated water flux when expressed in Xenopus leavis oocytes. Mannitol-induced water imbalance resulted in increased protein amounts in tonoplast fractions and a shift in protein distribution to other membrane fractions, suggesting aquaporin relocalization. Indirect immunofluorescence labeling also supports a change in membrane distribution for McTIP1;2 and the appearance of a unique compartment where McTIP1;2 is expressed. Mannitol-induced redistribution of McTIP1;2 was arrested by pretreatment with brefeldin A, wortmannin, and cytochalasin D, inhibitors of vesicle trafficking-related processes. Evidence suggests a role for glycosylation and involvement of a cAMP-dependent signaling pathway in McTIP1;2 redistribution. McTIP1;2 redistribution to endosomal compartments may be part of a homeostatic process to restore and maintain cellular osmolarity under osmotic-stress conditions. PMID:15299122
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Liu, Peng; Yin, Lina; Deng, Xiping; Wang, Shiwen; Tanaka, Kiyoshi; Zhang, Suiqi
2014-09-01
The fact that silicon application alleviates water deficit stress has been widely reported, but the underlying mechanism remains unclear. Here the effects of silicon on water uptake and transport of sorghum seedlings (Sorghum bicolor L.) growing under polyethylene glycol-simulated osmotic stress in hydroponic culture and water deficit stress in sand culture were investigated. Osmotic stress dramatically decreased dry weight, photosynthetic rate, transpiration rate, stomatal conductance, and leaf water content, but silicon application reduced these stress-induced decreases. Although silicon application had no effect on stem water transport capacity, whole-plant hydraulic conductance (Kplant) and root hydraulic conductance (Lp) were higher in silicon-treated seedlings than in those without silicon treatment under osmotic stress. Furthermore, the extent of changes in transpiration rate was similar to the changes in Kplant and Lp. The contribution of aquaporin to Lp was characterized using the aquaporin inhibitor mercury. Under osmotic stress, the exogenous application of HgCl2 decreased the transpiration rates of seedlings with and without silicon to the same level; after recovery induced by dithiothreitol (DTT), however, the transpiration rate was higher in silicon-treated seedlings than in untreated seedlings. In addition, transcription levels of several root aquaporin genes were increased by silicon application under osmotic stress. These results indicate that the silicon-induced up-regulation of aquaporin, which was thought to increase Lp, was involved in improving root water uptake under osmotic stress. This study also suggests that silicon plays a modulating role in improving plant resistance to osmotic stress in addition to its role as a mere physical barrier. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?
Directory of Open Access Journals (Sweden)
Philipp H. Schiffer
2016-08-01
Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.
Aquaporin-4-autoimmunity in patients with systemic lupus erythematosus
DEFF Research Database (Denmark)
Asgari, Nasrin; Jarius, Sven; Laustrup, Helle
2018-01-01
BACKGROUND: Serum immunoglobulin G targeting the astrocyte water channel aquaporin-4 (AQP4) in the central nervous system (CNS) is a biomarker for neuromyelitis optica spectrum disease (NMOSD). Co-existence of NMOSD with systemic lupus erythematosus (SLE) putatively suggests susceptibility...
Frequency and prognostic impact of antibodies to aquaporin-4 in patients with optic neuritis
DEFF Research Database (Denmark)
Jarius, Sven; Frederiksen, Jette Lautrup Battistini; Waters, Patrick
2010-01-01
Antibodies to aquaporin-4 (AQP4-Ab) are found in 60-80% of patients with neuromyelitis optica (NMO), a severely disabling inflammatory CNS disorder of putative autoimmune aetiology, which predominantly affects the optic nerves and spinal cord.......Antibodies to aquaporin-4 (AQP4-Ab) are found in 60-80% of patients with neuromyelitis optica (NMO), a severely disabling inflammatory CNS disorder of putative autoimmune aetiology, which predominantly affects the optic nerves and spinal cord....
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Repeat-associated plasticity in the Helicobacter pylori RD gene family.
Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J
2009-11-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.
International Nuclear Information System (INIS)
Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.
1987-01-01
The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged
The SPINK gene family and celiac disease susceptibility
Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.
2007-01-01
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
The SPINK gene family and celiac disease susceptibility
Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
Song, Juanjuan; Ye, Guoliang; Qian, Zhengjiang; Ye, Qing
2016-12-01
Aquaporins (AQPs) are known to facilitate water transport across cell membranes, but the role of a single AQP in regulating plant water transport, particularly in plants other than Arabidopsis remains largely unexplored. In the present study, a virus-induced gene silencing (VIGS) technique was employed to suppress the expression of a specific plasma membrane aquaporin PsPIP2;1 of Pea plants (Pisum sativum), and subsequent effects of the gene suppression on root hydraulic conductivity (Lp r ), leaf hydraulic conductivity (K leaf ), root cell hydraulic conductivity (Lp rc ), and leaf cell hydraulic conductivity (Lp lc ) were investigated, using hydroponically grown Pea plants. Compared with control plants, VIGS-PsPIP2;1 plants displayed a significant suppression of PsPIP2;1 in both roots and leaves, while the expression of other four PIP isoforms (PsPIP1;1, PsPIP1;2, PsPIP2;2, and PsPIP2;3) that were simultaneously monitored were not altered. As a consequence, significant declines in water transport of VIGS-PsPIP2;1 plants were observed at both organ and cell levels, i.e., as compared to control plants, Lp r and K leaf were reduced by 29 %, and Lp rc and Lp lc were reduced by 20 and 29 %, respectively. Our results demonstrate that PsPIP2;1 alone contributes substantially to root and leaf water transport in Pea plants, and highlight VIGS a useful tool for investigating the role of a single AQP in regulating plant water transport.
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
The Role of Aquaporins in Ocular Lens Homeostasis
Schey, Kevin L.; Petrova, Rosica S.; Gletten, Romell B.; Donaldson, Paul J.
2017-01-01
Aquaporins (AQPs), by playing essential roles in the maintenance of ocular lens homeostasis, contribute to the establishment and maintenance of the overall optical properties of the lens over many decades of life. Three aquaporins, AQP0, AQP1 and AQP5, each with distinctly different functional properties, are abundantly and differentially expressed in the different regions of the ocular lens. Furthermore, the diversity of AQP functionality is increased in the absence of protein turnover by age-related modifications to lens AQPs that are proposed to alter AQP function in the different regions of the lens. These regional differences in AQP functionality are proposed to contribute to the generation and directionality of the lens internal microcirculation; a system of circulating ionic and fluid fluxes that delivers nutrients to and removes wastes from the lens faster than could be achieved by passive diffusion alone. In this review, we present how regional differences in lens AQP isoforms potentially contribute to this microcirculation system by highlighting current areas of investigation and emphasizing areas where future work is required. PMID:29231874
Yaba, A; Sozen, B; Suzen, B; Demir, N
2017-03-01
Tanycytes are special ependymal cells located in the ventrolateral wall and floor of the third ventricle having processes extending nuclei that regulate reproductive functions and around of vessels in median eminance. The aquaporins (AQPs) are a family of transmembrane proteins that transport water and glycerol. AQP-7 and -9 are permeable to other small molecules as glycerol and therefore called aquaglyceroporins. In this study, we aimed to show localization of AQP-7 and -9 in epithelial cells of choroid plexus and tanycytes during female mouse estrus cycle. AQP-7 and -9 proteins were detected in α2 and β1 tanycytes in prœstrus stage. Interestingly, there is no staining in estrus stage in any type of tanycytes. We observed weak immunoreactivity in α1, α2 and β1 tanycyte cells in metestrus stage for AQP-7 and α1 for AQP-9 protein. AQP-7 and -9 showed intense immunoreactivity in α2, β1 and β2 tanycyte cells during diestrus stage. Consequently, AQP-7 and -9 showed differential staining pattern in different stages of mouse estrus cycle. In the light of our findings and other recent publications, we suggest that AQP-7 and -9-mediated glycerol transport in tanycyte cells might be under hormonal control to use glycerol as a potential energy substrate during mouse estrus cycle. Copyright © 2016. Published by Elsevier Masson SAS.
Aquaporin-2 excretion in hospitalized patients with cirrhosis
DEFF Research Database (Denmark)
Busk, Troels M; Møller, Søren; Pedersen, Erling B.
2017-01-01
Background and Aim: Urinary aquaporin-2 (AQP2) is a parameter of water transport in the principal cells in the distal part of the nephron and involved in water retention in cirrhosis and may be a marker of renal function. The aim of the study was to evaluate AQP2 as a predictor of renal insuffici...
Molecular evolution of the major chemosensory gene families in insects.
Sánchez-Gracia, A; Vieira, F G; Rozas, J
2009-09-01
Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.
DEFF Research Database (Denmark)
Hansen, Jesper Søndergaard
). This constitutes a new methodology to correctly and functionally reconstitute membrane proteins in controllable amounts into giant vesicles. The method for formation of giant protein vesicles subsequently led to the first functional prototype of an aquaporin-membrane water filtration device.......Aquaporins represent a class of membrane protein channels found in all living organisms that selectively transport water molecules across biological membranes. The work presented in this thesis was motivated by the conceptual idea of incorporating aquaporin water channels into biomimetic membranes...... to develop novel water separation technologies. To accomplish this, it is necessary to construct an efficient platform to handle biomimetic membranes. Moreover, general methods are required to reliable and controllable reconstitute membrane proteins into artificially made model membranes...
The nitrate transporter (NRT gene family in poplar.
Directory of Open Access Journals (Sweden)
Hua Bai
Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.
Su, Shengan; Lu, Yunbi; Zhang, Weiping
2013-05-01
To investigate the effects of aquaporin-4 (AQP4) gene knockout on the behavior changes and cerebral morphology during aging in mice,and to compare that of young and aged mice between AQP4 knockout mice (AQP4(-/-)) and wild type mice (AQP4(+/+)). Fifty-eight CD-1 mice were divided into four groups: young (2-3 months old) AQP4(-/-), aged (17-19 months old) AQP4(-/-), young AQP4(+/+) and aged AQP4(+/+). The activity levels and exploring behavior of mice were tested in open field. The neurons were stained with toluidine blue and NeuN, the astrocytes and microglia were stained with GFAP and Iba-1, respectively. The morphological changes of neuron, astrocyte and microglia were then analyzed. Compared with young mice, the total walking distance in open field of aged AQP4(+/+) mice and aged AQP4(-/-) mice decreased 41.2% and 44.1%, respectively (Ptime in the central area of open field. The density of neuron in cortex of aged AQP4(+/+) mice and aged AQP4(-/-) mice decreased 19.6% and 15.8%, respectively (P<0.05), while there was no difference in the thickness of neuron cell body in hippocampus CA1 region. The density of astrocyte in hippocampus CA3 region of aged AQP4(+/+) mice and aged AQP4(-/-) mice increased 57.7% and 64.3%, respectively (P<0.001), while there was no difference in the area of astrocyte. The area of microglia in hippocampus CA3 region of aged AQP4(+/+) mice and aged AQP4(-/-) mice increased 46.9% and 52.0%, respectively (P<0.01), while there was no difference in the density of microglia. Compared with AQP4(+/+) mice, the young and aged AQP4(-/-) mice showed smaller area of astrocyte in hippocampus CA3 region, reduced 18.0% in young mice and 23.6% in aged mice. There was no difference between AQP4(+/+) mice and AQP4(-/-) mice for other observed indexes. AQP4 may be involved in change of astrocyte and astrocyte-related behaviors during aging. AQP4 gene knockout may have limited effects on the change of neuron, microglia and most neuronal behaviors in aging
Directory of Open Access Journals (Sweden)
Parker Nadeene
2004-01-01
Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.
Directory of Open Access Journals (Sweden)
Vanessa Rodrigues Paixão-Côrtes
Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
Vacuolar biogenesis and aquaporin expression at early germination of broad bean seeds.
Novikova, Galina V; Tournaire-Roux, Colette; Sinkevich, Irina A; Lityagina, Snejana V; Maurel, Christophe; Obroucheva, Natalie
2014-09-01
A key event in seed germination is water uptake-mediated growth initiation in embryonic axes. Vicia faba var. minor (broad bean) seeds were used for studying cell growth, vacuolar biogenesis, expression and function of tonoplast water channel proteins (aquaporins) in embryonic axes during seed imbibition, radicle emergence and growth. Hypocotyl and radicle basal cells showed vacuole restoration from protein storage vacuoles, whereas de novo vacuole formation from provacuoles was observed in cells newly produced by root meristem. cDNA fragments of seven novel aquaporin isoforms including five Tonoplast Intrinsic Proteins (TIP) from three sub-types were amplified by PCR. The expression was probed using q-RT-PCR and when possible with isoform-specific antibodies. Decreased expression of TIP3s was associated to the transformation of protein storage vacuoles to vacuoles, whereas enhanced expression of a TIP2 homologue was closely linked to the fast cell elongation. Water channel functioning checked by inhibitory test with mercuric chloride showed closed water channels prior to growth initiation and active water transport into elongating cells. The data point to a crucial role of tonoplast aquaporins during germination, especially during growth of embryonic axes, due to accelerated water uptake and vacuole enlargement resulting in rapid cell elongation. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Early evolution of the LIM homeobox gene family
Energy Technology Data Exchange (ETDEWEB)
Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S
2010-01-01
LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural
Early evolution of the LIM homeobox gene family
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2010-01-01
Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In
The gating mechanism of the human aquaporin 5 revealed by molecular dynamics simulations.
Directory of Open Access Journals (Sweden)
Lorant Janosi
Full Text Available Aquaporins are protein channels located across the cell membrane with the role of conducting water or other small sugar alcohol molecules (aquaglyceroporins. The high-resolution X-ray structure of the human aquaporin 5 (HsAQP5 shows that HsAQP5, as all the other known aquaporins, exhibits tetrameric structure. By means of molecular dynamics simulations we analyzed the role of spontaneous fluctuations on the structural behavior of the human AQP5. We found that different conformations within the tetramer lead to a distribution of monomeric channel structures, which can be characterized as open or closed. The switch between the two states of a channel is a tap-like mechanism at the cytoplasmic end which regulates the water passage through the pore. The channel is closed by a translation of the His67 residue inside the pore. Moreover, water permeation rate calculations revealed that the selectivity filter, located at the other end of the channel, regulates the flow rate of water molecules when the channel is open, by locally modifying the orientation of His173. Furthermore, the calculated permeation rates of a fully open channel are in good agreement with the reported experimental value.
Chevalier, Adrien S; Chaumont, François
2015-05-01
Aquaporins are small channel proteins which facilitate the diffusion of water and small neutral molecules across biological membranes. Compared with animals, plant genomes encode numerous aquaporins, which display a large variety of subcellular localization patterns. More specifically, plant aquaporins of the plasma membrane intrinsic protein (PIP) subfamily were first described as plasma membrane (PM)-resident proteins, but recent research has demonstrated that the trafficking and subcellular localization of these proteins are complex and highly regulated. In the past few years, PIPs emerged as new model proteins to study subcellular sorting and membrane dynamics in plant cells. At least two distinct sorting motifs (one cytosolic, the other buried in the membrane) are required to direct PIPs to the PM. Hetero-oligomerization and interaction with SNAREs (soluble N-ethylmaleimide-sensitive factor protein attachment protein receptors) also influence the subcellular trafficking of PIPs. In addition to these constitutive processes, both the progression of PIPs through the secretory pathway and their dynamics at the PM are responsive to changing environmental conditions. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
TreeFam: a curated database of phylogenetic trees of animal gene families
DEFF Research Database (Denmark)
Li, Heng; Coghlan, Avril; Ruan, Jue
2006-01-01
TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...
Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.
Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson
2011-02-01
This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families. A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included. A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta. Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.
Shelden, Megan C; Vandeleur, Rebecca; Kaiser, Brent N; Tyerman, Stephen D
2017-01-01
We report physiological, anatomical and molecular differences in two economically important grapevine ( Vitis vinifera L.) cultivars cv. Grenache (near-isohydric) and Chardonnay (anisohydric) in their response to water-stress induced cavitation. The aim of the study was to compare organ vulnerability (petiole and stem) to cavitation by measuring ultrasonic acoustic emissions (UAE) and percent loss of conductance of potted grapevines subject to the onset of water-stress. Leaf (ψ L ) and stem water potential (ψ S ), stomatal conductance ( g s ), transpiration ( E ), petiole hydraulics ( K Pet ), and xylem diameter were also measured. Chardonnay displayed hydraulic segmentation based on UAE, with cavitation occurring at a less negative ψ L in the petiole than in the stem. Vulnerability segmentation was not observed in Grenache, with both petioles and stems equally vulnerable to cavitation. Leaf water potential that induced 50% of maximum UAE was significantly different between petioles and stems in Chardonnay (ψ 50Petiole = -1.14 and ψ 50Stem = -2.24 MPa) but not in Grenache (ψ 50Petiole = -0.73 and ψ 50Stem = -0.78 MPa). Grenache stems appeared more susceptible to water-stress induced cavitation than Chardonnay stems. Grenache displayed (on average) a higher K Pet likely due to the presence of larger xylem vessels. A close relationship between petiole hydraulic properties and vine water status was observed in Chardonnay but not in Grenache. Transcriptional analysis of aquaporins in the petioles and leaves ( VvPIP1;1, VvPIP2;1, VvPIP2;2 VvPIP2;3, VvTIP1;1 , and VvTIP2;1 ) showed differential regulation diurnally and in response to water-stress. VvPIP2;1 showed strong diurnal regulation in the petioles and leaves of both cultivars with expression highest predawn. Expression of VvPIP2;1 and VvPIP2;2 responded to ψ L and ψ S in both cultivars indicating the expression of these two genes are closely linked to vine water status. Expression of several aquaporin
Water transport between CNS compartments: contributions of aquaporins and cotransporters
DEFF Research Database (Denmark)
MacAulay, N; Zeuthen, T
2010-01-01
or hydrocephalus. The molecular pathways by which water molecules cross the cell membranes of the brain are not well-understood, although the discovery of aquaporin 4 (AQP4) in the brain improved our understanding of some of these transport processes, particularly under pathological conditions. In the present...
Aquaporin-5: from structure to function and dysfunction in cancer.
Direito, Inês; Madeira, Ana; Brito, Maria Alexandra; Soveral, Graça
2016-04-01
Aquaporins, a highly conserved group of membrane proteins, are involved in the bidirectional transfer of water and small solutes across cell membranes taking part in many biological functions all over the human body. In view of the wide range of cancer malignancies in which aquaporin-5 (AQP5) has been detected, an increasing interest in its implication in carcinogenesis has emerged. Recent publications suggest that this isoform may enhance cancer cell proliferation, migration and survival in a variety of malignancies, with strong evidences pointing to AQP5 as a promising drug target and as a novel biomarker for cancer aggressiveness with high translational potential for therapeutics and diagnostics. This review addresses the structural and functional features of AQP5, detailing its tissue distribution and functions in human body, its expression pattern in a variety of tumors, and highlighting the underlying mechanisms involved in carcinogenesis. Finally, the actual progress of AQP5 research, implications in cancer biology and potential for cancer detection and prognosis are discussed.
Sreedharan, Shareena; Shekhawat, Upendra K Singh; Ganapathi, Thumballi R
2015-05-01
High soil salinity constitutes a major abiotic stress and an important limiting factor in cultivation of crop plants worldwide. Here, we report the identification and characterization of a aquaporin gene, MusaPIP2;6 which is involved in salt stress signaling in banana. MusaPIP2;6 was firstly identified based on comparative analysis of stressed and non-stressed banana tissue derived EST data sets and later overexpression in transgenic banana plants was performed to study its tangible functions in banana plants. The overexpression of MusaPIP2;6 in transgenic banana plants using constitutive or inducible promoter led to higher salt tolerance as compared to equivalent untransformed control plants. Cellular localization assay performed using transiently transformed onion peel cells indicated that MusaPIP2;6 protein tagged with green fluorescent protein was translocated to the plasma membrane. MusaPIP2;6-overexpressing banana plants displayed better photosynthetic efficiency and lower membrane damage under salt stress conditions. Our results suggest that MusaPIP2;6 is involved in salt stress signaling and tolerance in banana.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families
Directory of Open Access Journals (Sweden)
Besic Nikola
2008-09-01
Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of
Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families
Energy Technology Data Exchange (ETDEWEB)
Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others
1994-09-01
Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.
The human protein disulfide isomerase gene family
Directory of Open Access Journals (Sweden)
Galligan James J
2012-07-01
Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.
Role of aquaporins in oral cancer
Directory of Open Access Journals (Sweden)
Mamatha G. S. Reddy
2017-01-01
Full Text Available Aquaporins (AQP are the membrane proteins involved in the transport of water and some neutral solutes. Thirteen types of AQP are identified in various human tissues. The expression of AQP's has been studied in various tumors among one is oral cancer. These molecules are involved in cell proliferation, migration, and metastasis. AQP target inhibitors act directly or indirectly through focal adhesion kinase-mitogen-activated protein kinase signaling pathway and shown promising results along with anti-cancer drugs. However, further researches were required to verify the efficiency and safety of these AQPs-target inhibitors in clinical therapy.
Directory of Open Access Journals (Sweden)
Lei Ding
2018-01-01
Full Text Available The photosynthetic rate increases under high-N supply, resulting in a large CO2 transport conductance in mesophyll cells. It is less known that water movement is affected by nitrogen supply in leaves. This study investigated whether the expression of aquaporin and water transport were affected by low-N (0.7 mM and high-N (7 mM concentrations in the hydroponic culture of four rice varieties: (1 Shanyou 63 (SY63, a hybrid variant of the indica species; (2 Yangdao 6 (YD6, a variant of indica species; (3 Zhendao 11 (ZD11, a hybrid variant of japonica species; and (4 Jiuyou 418 (JY418, another hybrid of the japonica species. Both the photosynthetic and transpiration rate were increased by the high-N supply in the four varieties. The expressions of aquaporins, plasma membrane intrinsic proteins (PIPs, and tonoplast membrane intrinsic protein (TIP were higher in high-N than low-N leaves, except in SY63. Leaf hydraulic conductance (Kleaf was lower in high-N than low-N leaves in SY63, while Kleaf increased under high-N supply in the YD6 variant. Negative correlations were observed between the expression of aquaporin and the transpiration rate in different varieties. Moreover, there was a significant negative correlation between transpiration rate and intercellular air space. In conclusion, the change in expression of aquaporins could affect Kleaf and transpiration. A feedback effect of transpiration would regulate aquaporin expression. The present results imply a coordination of gas exchange with leaf hydraulic conductance.
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Dichotomy in the NRT gene families of dicots and grass species.
Directory of Open Access Journals (Sweden)
Darren Plett
Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.
Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin
Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192
Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.
Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S
2016-10-01
Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Marlar, Saw; Jensen, Helene H; Login, Frédéric H; Nejsum, Lene N
2017-10-07
Increasing evidence suggests that the water/glycerol channel aquaporin-3 (AQP3) plays a pivotal role in cancer metastasis. AQP3 knockout mice were resistant to skin tumor formation and overexpression correlated with metastasis and poor prognosis in patients with breast or gastric cancer. In cultured cancer cells, increased AQP3 expression stimulated several intracellular signaling pathways and resulted in increased cell proliferation, migration, and invasion as well as aggravation of epithelial-to-mesenchymal transition. Besides AQP facilitated water transport at the leading edge of migrating cells, AQP3 signaling mechanisms are beginning to be unraveled. Here, we give a thorough review of current knowledge regarding AQP3 expression in cancer and how AQP3 contributes to cancer progression via signaling that modulates cellular mechanisms. This review article will expand our understanding of the known pathophysiological findings regarding AQP3 in cancer.
Aquaporins and Gland Secretion.
Delporte, Christine
2017-01-01
Aquaporins (AQPs ) are expressed in most exocrine and endocrine secretory glands. Consequently, summarizing the expression and functions of AQPs in secretory glands represents a daunting task considering the important number of glands present in the body, as well as the number of mammalian AQPs - thirteen. The roles played by AQPs in secretory processes have been investigated in many secretory glands. However, despite considerable research, additional studies are clearly needed to pursue our understanding of the role played by AQPs in secretory processes. This book chapter will focus on summarizing the current knowledge on AQPs expression and function in the gastrointestinal tract , including salivary glands, gastric glands, Duodenal Brunner's gland, liver and gallbladder, intestinal goblets cells, exocrine and endocrine pancreas, as well as few other secretory glands including airway submucosal glands, lacrimal glands, mammary glands and eccrine sweat glands.
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression
Directory of Open Access Journals (Sweden)
Li Guo
2014-01-01
Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.
Novel genetic variants in miR-191 gene and familial ovarian cancer
International Nuclear Information System (INIS)
Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua
2010-01-01
Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer
Molecular analysis of the NDP gene in two families with Norrie disease.
Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto
2005-04-01
To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
Polymorphism in the interferon-{alpha} gene family
Energy Technology Data Exchange (ETDEWEB)
Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)
1996-09-01
A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.
Compartmentalization of Aquaporins in the Human Intestine
Directory of Open Access Journals (Sweden)
Rajendram V. Rajnarayanan
2008-06-01
Full Text Available Improper localization of water channel proteins called aquaporins (AQP induce mucosal injury which is implicated in Crohn’s disease and ulcerative colitis. The amino acid sequences of AQP3 and AQP10 are 79% similar and belong to the mammalian aquaglyceroporin subfamily. AQP10 is localized on the apical compartment of the intestinal epithelium called the glycocalyx while AQP3 is selectively targeted to the basolateral membrane. Despite the high sequence similarity and evolutionary relatedness, the molecular mechanism involved in the polarity, selective targeting and function of AQP3 and AQP10 in the intestine is largely unknown. Our hypothesis is that the differential polarity and selective targeting of AQP3 and AQP10 in the intestinal epithelial cells is influenced by amino acid signal motifs. We performed sequence and structural alignments to determine differences in signals for localization and posttranslational glycosylation. The basolateral sorting motif “YRLL†is present in AQP3 but absent in AQP10; while Nglycosylation signals are present in AQP10 but absent in AQP3. Furthermore, the C-terminal region of AQP3 is longer compared to AQP10. The sequence and structural differences between AQP3 and AQP10 provide insights into the differential compartmentalization and function of these two aquaporins commonly expressed in human intestines.
msh/Msx gene family in neural development.
Ramos, Casto; Robert, Benoît
2005-11-01
The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.
Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape
Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping
2012-01-01
Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514
Song, Yuanlin; Jayaraman, Sujatha; Yang, Baoxue; Matthay, Michael A.; Verkman, A.S.
2001-01-01
Several aquaporin-type water channels are expressed in mammalian airways and lung: AQP1 in microvascular endothelia, AQP3 in upper airway epithelia, AQP4 in upper and lower airway epithelia, and AQP5 in alveolar epithelia. Novel quantitative methods were developed to compare airway fluid transport–related functions in wild-type mice and knockout mice deficient in these aquaporins. Lower airway humidification, measured from the moisture content of expired air during mechanical ventilation with dry air through a tracheotomy, was 54–56% efficient in wild-type mice, and reduced by only 3–4% in AQP1/AQP5 or AQP3/AQP4 double knockout mice. Upper airway humidification, measured from the moisture gained by dry air passed through the upper airways in mice breathing through a tracheotomy, decreased from 91 to 50% with increasing ventilation from 20 to 220 ml/min, and reduced by 3–5% in AQP3/AQP4 knockout mice. The depth and salt concentration of the airway surface liquid in trachea was measured in vivo using fluorescent probes and confocal and ratio imaging microscopy. Airway surface liquid depth was 45 ± 5 μm and [Na+] was 115 ± 4 mM in wild-type mice, and not significantly different in AQP3/AQP4 knockout mice. Osmotic water permeability in upper airways, measured by an in vivo instillation/sample method, was reduced by ∼40% by AQP3/AQP4 deletion. In doing these measurements, we discovered a novel amiloride-sensitive isosmolar fluid absorption process in upper airways (13% in 5 min) that was not affected by aquaporin deletion. These results establish the fluid transporting properties of mouse airways, and indicate that aquaporins play at most a minor role in airway humidification, ASL hydration, and isosmolar fluid absorption. PMID:11382807
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Bietz, Sven; Montilla, Irine; Külzer, Simone; Przyborski, Jude M; Lingelbach, Klaus
2009-09-01
The molecular mechanisms underlying the formation of the parasitophorous vacuolar membrane in Plasmodium falciparum infected erythrocytes are incompletely understood, and the protein composition of this membrane is still enigmatic. Although the differentiated mammalian erythrocyte lacks the machinery required for endocytosis, some reports have described a localisation of host cell membrane proteins at the parasitophorous vacuolar membrane. Aquaporin 3 is an abundant plasma membrane protein of various cells, including mammalian erythrocytes where it is found in distinct oligomeric states. Here we show that human aquaporin 3 is internalized into infected erythrocytes, presumably during or soon after invasion. It is integrated into the PVM where it is organized in novel oligomeric states which are not found in non-infected cells.
Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion
DEFF Research Database (Denmark)
Wree, Dorothea; Wu, Binghua; Zeuthen, Thomas
2011-01-01
Two highly conserved NPA motifs are a hallmark of the aquaporin (AQP) family. The NPA triplets form N-terminal helix capping structures with the Asn side chains located in the centre of the water or solute-conducting channel, and are considered to play an important role in AQP selectivity. Although...... interchangeable at both NPA sites without affecting protein expression or water, glycerol and methylamine permeability. However, other mutations in the NPA region led to reduced permeability (S186C and S186D), to nonfunctional channels (N64D), or even to lack of protein expression (S186A and S186T). Using...... electrophysiology, we found that an analogous mammalian AQP1 N76S mutant excluded protons and potassium ions, but leaked sodium ions, providing an argument for the overwhelming prevalence of Asn over other amino acids. We conclude that, at the first position in the NPA motifs, only Asn provides efficient helix cap...
The role of aquaporins in polycystic ovary syndrome - A way towards a novel drug target in PCOS.
Wawrzkiewicz-Jałowiecka, Agata; Kowalczyk, Karolina; Pluta, Dagmara; Blukacz, Łukasz; Madej, Paweł
2017-05-01
Aquaporins (AQPs) are transmembrane proteins, able to transport water (and in some cases also small solutes, e. g. glycerol) through the cell membrane. There are twelve types of aquaporins (AQP1-AQP12) expressed in mammalian reproductive systems. According to literature, many diseases of the reproductive organs are correlated with changes of AQPs expression and their malfunction. That is the case in the polycystic ovary syndrome (PCOS), where dysfunctions of AQPs 7-9 and alterations in its levels occur. In this work, we postulate how AQPs are involved in PCOS-related disorders, in order to emphasize their potential therapeutic meaning as a drug target. Our research allows for a surprising inference, that genetic mutation causing malfunction and/or decreased expression of aquaporins, may be incorporated in the popular insulin-dependent hypothesis of PCOS pathogenesis. What is more, changes in AQP's expression may affect the folliculogenesis and follicular atresia in PCOS. Copyright © 2017 Elsevier Ltd. All rights reserved.
Aquaporin 3 (AQP3) participates in the cytotoxic response to nucleoside-derived drugs
International Nuclear Information System (INIS)
Pérez-Torras, Sandra; Casado, F Javier; Pastor-Anglada, Marçal
2012-01-01
Nucleoside analogs used in the chemotherapy of solid tumors, such as the capecitabine catabolite 5 ′ -deoxy-5-fluorouridine (5 ′ -DFUR) trigger a transcriptomic response that involves the aquaglyceroporin aquaporin 3 along with other p53-dependent genes. Here, we examined whether up-regulation of aquaporin 3 (AQP3) mRNA in cancer cells treated with 5 ′ -DFUR represents a collateral transcriptomic effect of the drug, or conversely, AQP3 participates in the activity of genotoxic agents. The role of AQP3 in cell volume increase, cytotoxicity and cell cycle arrest was analyzed using loss-of-function approaches. 5 ′ -DFUR and gemcitabine, but not cisplatin, stimulated AQP3 expression and cell volume, which was partially and significantly blocked by knockdown of AQP3. Moreover, AQP3 siRNA significantly blocked other effects of nucleoside analogs, including G 1 /S cell cycle arrest, p21 and FAS up-regulation, and cell growth inhibition. Short incubations with 5-fluorouracil (5-FU) also induced AQP3 expression and increased cell volume, and the inhibition of AQP3 expression significantly blocked growth inhibition triggered by this drug. To further establish whether AQP3 induction is related to cell cycle arrest and apoptosis, cells were exposed to long incubations with escalating doses of 5-FU. AQP3 was highly up-regulated at doses associated with cell cycle arrest, whereas at doses promoting apoptosis induction of AQP3 mRNA expression was reduced. Based on the results, we propose that the aquaglyceroporin AQP3 is required for cytotoxic activity of 5’-DFUR and gemcitabine in the breast cancer cell line MCF7 and the colon adenocarcinoma cell line HT29, and is implicated in cell volume increase and cell cycle arrest
Phosphorylation of rat aquaporin-4 at Ser(111) is not required for channel gating
DEFF Research Database (Denmark)
Assentoft, Mette; Kaptan, Shreyas; Fenton, Robert A.
2013-01-01
Aquaporin 4 (AQP4) is the predominant water channel in the mammalian brain and is mainly expressed in the perivascular glial endfeet at the brain-blood interface. AQP4 has been described as an important entry and exit site for water during formation of brain edema and regulation of AQP4 is theref......Aquaporin 4 (AQP4) is the predominant water channel in the mammalian brain and is mainly expressed in the perivascular glial endfeet at the brain-blood interface. AQP4 has been described as an important entry and exit site for water during formation of brain edema and regulation of AQP4...... is therefore of therapeutic interest. Phosphorylation of some aquaporins has been proposed to regulate their water permeability via gating of the channel itself. Protein kinase (PK)-dependent phosphorylation of Ser(111) has been reported to increase the water permeability of AQP4 expressed in an astrocytic...... of activators and inhibitors of PKG and PKA. Mutation of Ser(111) to alanine or aspartate (to prevent or mimic phosphorylation) did not change the water permeability of AQP4. PKG activation had no effect on the water permeability of AQP4 in primary cultures of rat astrocytes. Molecular dynamics simulations...
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Identification and characterization of NF-YB family genes in tung tree.
Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun
2015-12-01
The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
Oxygen-dependent regulation of aquaporin-3 expression
Directory of Open Access Journals (Sweden)
Hoogewijs D
2016-04-01
Full Text Available David Hoogewijs,1,2 Melanie Vogler,3 Eveline Zwenger,3 Sabine Krull,3 Anke Zieseniss3 1Institute of Physiology, University of Duisburg-Essen, Essen, Germany; 2Institute of Physiology, University of Zürich, Zürich, Switzerland; 3Institute of Cardiovascular Physiology, University Medical Center Göttingen, University of Göttingen, Göttingen, GermanyAbstract: The purpose of this study was to investigate whether aquaporin-3 (AQP3 expression is altered in hypoxia and whether hypoxia-inducible transcription factor (HIF-1 regulates the hypoxic expression. AQP3 mRNA expression was studied in L929 fibrosarcoma cells and in several tissues derived from mice that were subjected to hypoxia. Computational analysis of the AQP3 promoter revealed conserved HIF binding sites within close proximity to the translational start site, and chromatin immunoprecipitation assays confirmed binding of HIF-1 to the endogenous hypoxia response elements. Furthermore, hypoxia resulted in increased expression of AQP3 mRNA in L929 fibrosarcoma cells. Consistently, shRNA-mediated knockdown of HIF-1 greatly reduced the hypoxic induction of AQP3. In addition, mRNA analysis of organs from mice exposed to inspiratory hypoxia demonstrated pronounced hypoxia-inducible expression of AQP3 in the kidney. Overall, our findings suggest that AQP3 expression can be regulated at the transcriptional level and that AQP3 represents a novel HIF-1 target gene. Keywords: transcriptional regulation, oxygen, hypoxia-inducible factor, hypoxia response element
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
DEFF Research Database (Denmark)
Hadrup, Niels; Petersen, Jørgen S; Windfeld, Søren
2007-01-01
) of the vasopressin type-2 receptor antagonist 5-dimethylamine-1-[4-(2-methylbenzoylamino)benzoyl]-2,3,4,5-tetrahydro-1H-benzapine (OPC31260) (32 nmol/kg/min). ZP120 decreased the aquaporin-2 protein level in the rat cortex/outer stripe of outer medulla and decreased apical plasma membrane localization of aquaporin-2......We previously showed that aquaresis induced by the peripherally acting nociceptin/orphanin FQ receptor agonist ZP120 is associated with a decreased protein level of aquaporin-2 (AQP2) in whole-kidney homogenates. We now examined the effects of Ac-RYYRWKKKKKKK-NH(2) (ZP120) (1 nmol/kg/min i.v. for 4...... h) on renal regional expression (cortex/outer stripe of outer medulla, inner stripe of outer medulla, and inner medulla) and subcellular localization of aquaporin-2. Responses to ZP120 were compared to the effects of an equi-aquaretic dose ( approximately 40% inhibition of distal water reabsorption...
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.
Rawal, H C; Singh, N K; Sharma, T R
2013-01-01
Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants
Directory of Open Access Journals (Sweden)
H. C. Rawal
2013-01-01
Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Structure and Stability of the Spinach Aquaporin SoPIP2;1 in Detergent Micelles and Lipid Membranes
DEFF Research Database (Denmark)
Plasencia, Ines; Survery, Sabeen; Ibragimova, Sania
2011-01-01
Background: SoPIP2;1 constitutes one of the major integral proteins in spinach leaf plasma membranes and belongs to the aquaporin family. SoPIP2;1 is a highly permeable and selective water channel that has been successfully overexpressed and purified with high yields. In order to optimize...... reconstitution of the purified protein into biomimetic systems, we have here for the first time characterized the structural stability of SoPIP2;1. Methodology/Principal Finding: We have characterized the protein structural stability after purification and after reconstitution into detergent micelles...... and proteoliposomes using circular dichroism and fluorescence spectroscopy techniques. The structure of SoPIP2;1 was analyzed either with the protein solubilized with octyl-beta-D-glucopyranoside (OG) or reconstituted into lipid membranes formed by E. coli lipids, diphytanoylphosphatidylcholine (DPh...
Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro
2018-02-16
For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.
Genomewide analysis of MATE-type gene family in maize reveals ...
Indian Academy of Sciences (India)
Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.
Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.
Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning
2016-01-01
WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
DEFF Research Database (Denmark)
Christiansen, Michael W; Gregersen, Per L.
2014-01-01
-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...
Directory of Open Access Journals (Sweden)
Behzad Davarniya
Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914
The ACBP gene family in Rhodnius prolixus
DEFF Research Database (Denmark)
Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C
2016-01-01
The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...
Identification of the 14-3-3 gene family in Rafflesia cantleyi
Rosli, Khadijah; Wan, Kiew-Lian
2018-04-01
Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.
Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu
2017-10-01
The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.
APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis
Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.
1997-01-01
Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven
Xu, Hao; Kemppainen, Minna; El Kayal, Walid; Lee, Seong Hee; Pardo, Alejandro G; Cooke, Janice E K; Zwiazek, Janusz J
2015-01-01
The contribution of hyphae to water transport in ectomycorrhizal (ECM) white spruce (Picea glauca) seedlings was examined by altering expression of a major water-transporting aquaporin in Laccaria bicolor. Picea glauca was inoculated with wild-type (WT), mock transgenic or L. bicolor aquaporin JQ585595-overexpressing (OE) strains and exposed to root temperatures ranging from 5 to 20°C to examine the root water transport properties, physiological responses and plasma membrane intrinsic protein (PIP) expression in colonized plants. Mycorrhization increased shoot water potential, transpiration, net photosynthetic rates, root hydraulic conductivity and root cortical cell hydraulic conductivity in seedlings. At 20°C, OE plants had higher root hydraulic conductivity compared with WT plants and the increases were accompanied by higher expression of P. glauca PIP GQ03401_M18.1 in roots. In contrast to WT L. bicolor, the effects of OE fungi on root and root cortical cell hydraulic conductivities were abolished at 10 and 5°C in the absence of major changes in the examined transcript levels of P. glauca root PIPs. The results provide evidence for the importance of fungal aquaporins in root water transport of mycorrhizal plants. They also demonstrate links between hyphal water transport, root aquaporin expression and root water transport in ECM plants. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori
Directory of Open Access Journals (Sweden)
Yi Yong-Zhu
2006-08-01
Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.
Reversed polarized delivery of an aquaporin-2 mutant causes dominant nephrogenic diabetes insipidus.
Kamsteeg, E.J.; Bichet, D.G.; Konings, I.B.M.; Nivet, H.; Lonergan, M.; Arthus, M.F.; Os, C.H. van; Deen, P.M.T.
2003-01-01
Vasopressin regulates body water conservation by redistributing aquaporin-2 (AQP2) water channels from intracellular vesicles to the apical surface of renal collecting ducts, resulting in water reabsorption from urine. Mutations in AQP2 cause autosomal nephrogenic diabetes insipidus (NDI), a disease
Regional expression of aquaporins 1, 4, and 9 in the brain during pregnancy
Wiegman, Marchien J.; Bullinger, Lisa V.; Kohlmeyer, Meghan M.; Hunter, Timothy C.; Cipolla, Marilyn J.
Pregnancy is a state of physiologic adaptation, with significant changes in cardiovascular, renal, and hemodynamic systems. Aquaporins (AQPs) may play a role in facilitating these changes. Mile AQP expression has been assessed in several organs during pregnancy, little is known about its expression
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Search for intracranial aneurysm susceptibility gene(s using Finnish families
Directory of Open Access Journals (Sweden)
Ryynänen Markku
2002-08-01
Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.
Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family
Institute of Scientific and Technical Information of China (English)
Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang
2007-01-01
The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.
Increased expression of aquaporin-4 in human traumatic brain injury and brain tumors
Institute of Scientific and Technical Information of China (English)
HU Hua; YAO Hong-tian; ZHANG Wei-ping; ZHANG LEI; DING Wei; ZHANG Shi-hong; CHEN Zhong; WEI Er-qing
2005-01-01
Objective: To characterize the expression of aquaporin-4 (AQP4), one of the aquaporins (AQPs), in human brain specimens from patients with traumatic brain injury or brain tumors. Methods: Nineteen human brain specimens were obtained from the patients with traumatic brain injury, brain tumors, benign meningioma or early stage hemorrhagic stroke. MRI or CT imaging was used to assess brain edema. Hematoxylin and eosin staining were used to evaluate cell damage. Immunohistochemistry was used to detect the AQP4 expression. Results: AQP4 expression was increased from 15h to at least 8 d after injury. AQP4immunoreactivity was strong around astrocytomas, ganglioglioma and metastatic adenocarcinoma. However, AQP4 immunoreactivity was only found in the centers of astrocytomas and ganglioglioma, but not in metastatic adenocarcinoma derived from lung.Conclusion: AQP4 expression increases in human brains after traumatic brain injury, within brain-derived tumors, and around brain tumors.
A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.
Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P
2005-10-01
We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.
Natural killer cell receptor genes in the family Equidae: not only Ly49.
Directory of Open Access Journals (Sweden)
Jan Futas
Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for
Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49
Futas, Jan; Horin, Petr
2013-01-01
Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of
DEFF Research Database (Denmark)
Hinrichs, Gitte R; Hansen, Louise H; Nielsen, Maria R
2016-01-01
Mutations in the vasopressin V2 receptor gene AVPR2 may cause X-linked nephrogenic diabetes insipidus by defective apical insertion of aquaporin-2 in the renal collecting duct principal cell. Substitution mutations with exchange of arginine at codon 137 can cause nephrogenic syndrome...... of inappropriate antidiuresis or congenital X-linked nephrogenic diabetes insipidus. We present a novel mutation in codon 137 within AVPR2 with substitution of glycine for arginine in male dizygotic twins. Nephrogenic diabetes insipidus was demonstrated by water deprivation test and resistance to vasopressin...
Aquaporin-11 (AQP11 Expression in the Mouse Brain
Directory of Open Access Journals (Sweden)
Shin Koike
2016-06-01
Full Text Available Aquaporin-11 (AQP11 is an intracellular aquaporin expressed in various tissues, including brain tissues in mammals. While AQP11-deficient mice have developed fatal polycystic kidneys at one month old, the role of AQP11 in the brain was not well appreciated. In this study, we examined the AQP11 expression in the mouse brain and the brain phenotype of AQP11-deficient mice. AQP11 messenger ribonucleic acid (mRNA and protein were expressed in the brain, but much less than in the thymus and kidney. Immunostaining showed that AQP11 was localized at the epithelium of the choroid plexus and at the endothelium of the brain capillary, suggesting that AQP11 may be involved in water transport at the choroid plexus and blood-brain barrier (BBB in the brain. The expression of AQP4, another brain AQP expressed at the BBB, was decreased by half in AQP11-deficient mice, thereby suggesting the presence of the interaction between AQP11 and AQP4. The brain of AQP11-deficient mice, however, did not show any morphological abnormalities and the function of the BBB was intact. Our findings provide a novel insight into a water transport mechanism mediated by AQPs in the brain, which may lead to a new therapy for brain edema.
[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].
Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe
2014-01-01
Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.
NDP gene mutations in 14 French families with Norrie disease.
Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul
2003-12-01
Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.
Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan
2017-01-25
Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.
Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene
International Nuclear Information System (INIS)
Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.
2000-01-01
Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)
Evolution of the MAGUK protein gene family in premetazoan lineages
Directory of Open Access Journals (Sweden)
Ruiz-Trillo Iñaki
2010-04-01
Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Frequency and prognostic impact of antibodies to aquaporin-4 in patients with optic neuritis
DEFF Research Database (Denmark)
Jarius, Sven; Frederiksen, Jette Lautrup Battistini; Waters, Patrick
2010-01-01
Antibodies to aquaporin-4 (AQP4-Ab) are found in 60-80% of patients with neuromyelitis optica (NMO), a severely disabling inflammatory CNS disorder of putative autoimmune aetiology, which predominantly affects the optic nerves and spinal cord....
Genome organization and expression of the rat ACBP gene family
DEFF Research Database (Denmark)
Mandrup, S; Andreasen, P H; Knudsen, J
1993-01-01
pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Cholesterol can modulate mitochondrial aquaporin-8 expression in human hepatic cells.
Danielli, Mauro; Capiglioni, Alejo M; Marrone, Julieta; Calamita, Giuseppe; Marinelli, Raúl A
2017-05-01
Hepatocyte mitochondrial aquaporin-8 (mtAQP8) works as a multifunctional membrane channel protein that facilitates the uptake of ammonia for its detoxification to urea as well as the mitochondrial release of hydrogen peroxide. Since early oligonucleotide microarray studies in liver of cholesterol-fed mice showed an AQP8 downregulation, we tested whether alterations of cholesterol content per se modulate mtAQP8 expression in human hepatocyte-derived Huh-7 cells. Cholesterol loading with methyl-β-cyclodextrin (mβCD):cholesterol complexes downregulated the proteolytic activation of cholesterol-responsive sterol regulatory element-binding protein (SREBP) transcriptions factors 1 and 2, and the expression of the target gene 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR). Under such conditions, mtAQP8 mRNA and protein expressions were significantly reduced. In contrast, cholesterol depletion using mβCD alone increased SREBP-1 and 2 activation and upregulated HMGCR and mtAQP8 mRNA and protein expressions. The results suggest that cholesterol can regulate transcriptionally human hepatocyte mtAQP8 expression likely via SREBPs. The functional implications of our findings are discussed. © 2017 IUBMB Life, 69(5):341-346, 2017. © 2017 International Union of Biochemistry and Molecular Biology.
Aquaporin 4 and neuromyelitis optica
Papadopoulos, Marios C; Verkman, A S
2013-01-01
Neuromyelitis optica is an inflammatory demyelinating disorder of the CNS. The discovery of circulating IgG1 antibodies against the astrocyte water channel protein aquaporin 4 (AQP4) and the evidence that AQP4-IgG is involved in the development of neuromyelitis optica revolutionised our understanding of the disease. However, important unanswered questions remain—for example, we do not know the cause of AQP4-IgG-negative disease, how astrocyte damage causes demyelination, the role of T cells, why peripheral AQP4-expressing organs are undamaged, and how circulating AQP4-IgG enters neuromyelitis optica lesions. New drug candidates have emerged, such as aquaporumab (non-pathogenic antibody blocker of AQP4-IgG binding), sivelestat (neutrophil elastase inhibitor), and eculizumab (complement inhibitor). Despite rapid progress, randomised clinical trials to test new drugs will be challenging because of the small number of individuals with the disorder. PMID:22608667
[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].
Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun
2017-08-10
To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.
Ye, Qing; Wiera, Boguslaw; Steudle, Ernst
2004-02-01
Isolated internodes of Chara corallina have been used to study the gating of aquaporins (water channels) in the presence of high concentrations of osmotic solutes of different size (molecular weight). Osmolytes were acetone and three glycol ethers: ethylene glycol monomethyl ether (EGMME), diethylene glycol monomethyl ether (DEGMME), and triethylene glycol monoethyl ether (TEGMEE). The 'osmotic efficiency' of osmolytes was quite different. Their reflection coefficients ranged between 0.15 (acetone), 0.59 (EGMME), 0.78 (DEGMME), and 0.80 (TEGMEE). Bulk water permeability (Lp) and diffusive permeabilities (Ps) of heavy water (HDO), hydrogen peroxide (H2O2), acetone, and glycol ethers (EGMME, DEGMME, and TEGMEE) were measured using a cell pressure probe. Cells were treated with different concentrations of osmotic solutes of up to 800 mM ( approximately 2.0 MPa of osmotic pressure). Inhibition of aquaporin activity increased with both increasing concentration and size of solutes (reflection coefficients). As cell Lp decreased, Ps increased, indicating that water and solutes used different passages across the plasma membrane. Similar to earlier findings of an osmotic gating of ion channels, a cohesion/tension model of the gating of water channels in Chara internodes by high concentration is proposed. According to the model, tensions (negative pressures) within water channels affected the open/closed state by changing the free energy between states and favoured a distorted/collapsed rather than the open state. They should have differed depending on the concentration and size of solutes that are more or less excluded from aquaporins. The bigger the solute, the lower was the concentration required to induce a reversible closure of aquaporins, as predicted by the model.
A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.
Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E
2016-03-01
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.
Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T
1995-05-20
Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Demeclocycline Attenuates Hyponatremia by Reducing Aquaporin-2 Expression in the Renal Inner Medulla
DEFF Research Database (Denmark)
Kortenoeven, Marleen L. A.; Sinke, Anne P.; Hadrup, Niels
2013-01-01
Binding of vasopressin to its type-2 receptor in renal collecting ducts induces cAMP signaling, transcription and translocation of aquaporin-2 (AQP2) water channels to the plasma membrane and water reabsorption from the pro-urine. Demeclocycline is currently used to treat hyponatremia in patients...
Common mutations identified in the MLH1 gene in familial Lynch syndrome
Directory of Open Access Journals (Sweden)
Jisha Elias
2017-12-01
In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.
The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.
Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki
2018-05-01
Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Directory of Open Access Journals (Sweden)
Naoki Takata
Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Directory of Open Access Journals (Sweden)
Yan Liangzhen
2012-11-01
Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a
Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J
2018-02-01
WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M
2013-12-01
Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.
Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P
2007-01-31
Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.
Olaetxea, Maite; Mora, Verónica; Bacaicoa, Eva; Garnica, María; Fuentes, Marta; Casanova, Esther; Zamarreño, Angel M; Iriarte, Juan C; Etayo, David; Ederra, Iñigo; Gonzalo, Ramón; Baigorri, Roberto; García-Mina, Jose M
2015-12-01
The physiological and metabolic mechanisms behind the humic acid-mediated plant growth enhancement are discussed in detail. Experiments using cucumber (Cucumis sativus) plants show that the shoot growth enhancement caused by a structurally well-characterized humic acid with sedimentary origin is functionally associated with significant increases in abscisic acid (ABA) root concentration and root hydraulic conductivity. Complementary experiments involving a blocking agent of cell wall pores and water root transport (polyethylenglycol) show that increases in root hydraulic conductivity are essential in the shoot growth-promoting action of the model humic acid. Further experiments involving an inhibitor of ABA biosynthesis in root and shoot (fluridone) show that the humic acid-mediated enhancement of both root hydraulic conductivity and shoot growth depended on ABA signaling pathways. These experiments also show that a significant increase in the gene expression of the main root plasma membrane aquaporins is associated with the increase of root hydraulic conductivity caused by the model humic acid. Finally, experimental data suggest that all of these actions of model humic acid on root functionality, which are linked to its beneficial action on plant shoot growth, are likely related to the conformational structure of humic acid in solution and its interaction with the cell wall at the root surface. © 2015 American Society of Plant Biologists. All Rights Reserved.
Wang, Fen; Ye, Bin
2016-09-01
Cyst echinococcosis caused by the matacestodal larvae of Echinococcus granulosus (Eg), is a chronic, worldwide, and severe zoonotic parasitosis. The treatment of cyst echinococcosis is still difficult since surgery cannot fit the needs of all patients, and drugs can lead to serious adverse events as well as resistance. The screen of target proteins interacted with new anti-hydatidosis drugs is urgently needed to meet the prevailing challenges. Here, we analyzed the sequences and structure properties, and constructed a phylogenetic tree by bioinformatics methods. The MIP family signature and Protein kinase C phosphorylation sites were predicted in all nine EgAQPs. α-helix and random coil were the main secondary structures of EgAQPs. The numbers of transmembrane regions were three to six, which indicated that EgAQPs contained multiple hydrophobic regions. A neighbor-joining tree indicated that EgAQPs were divided into two branches, seven EgAQPs formed a clade with AQP1 from human, a "strict" aquaporins, other two EgAQPs formed a clade with AQP9 from human, an aquaglyceroporins. Unfortunately, homology modeling of EgAQPs was aborted. These results provide a foundation for understanding and researches of the biological function of E. granulosus.
Ketelslegers, I.A.; Modderman, P.W.; Vennegoor, A.; Killestein, J.; Hamann, D.; Hintzen, R.Q.
2011-01-01
The detection of antibodies against aquaporin-4 (AQP4) has improved the diagnosis of neuromyelitis optica (NMO). We evaluated a recently established cell-based anti-AQP4 assay in 273 patients with inflammatory CNS demyelination. The assay had a specificity of 99% and a sensitivity of 56% to detect
Massive expansion of the calpain gene family in unicellular eukaryotes
Directory of Open Access Journals (Sweden)
Zhao Sen
2012-09-01
Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Massive expansion of the calpain gene family in unicellular eukaryotes.
Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran
2012-09-29
Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Molecular Characterization of LRB7 Gene and a Water Channel Protein TIP2 in Chorispora bungeana
Directory of Open Access Journals (Sweden)
Ming Li
2016-01-01
Full Text Available Background. Water channel proteins, also called aquaporins, are integral membrane proteins from major intrinsic protein (MIP family and involved in several pathways including not only water transport but also cell signaling, reproduction, and photosynthesis. The full cDNA and protein sequences of aquaporin in Chorispora bungeana Fisch. & C.A. Mey (C. bungeana are still unknown. Results. In this study, PCR and rapid amplification of cDNA ends approaches were used to clone the full cDNA of LRB7 (GenBank accession number: EU636988 of C. bungeana. Sequence analysis indicated that it was 1235 bp, which had two introns and encoded a protein of 250 amino acids. Structure analysis revealed that the protein had two conserved NPA motifs, one of which is MIP signature sequence (SGxHxNPAVT, six membrane helix regions, and additional membrane-embedded domains. Phylogenetic analysis suggested that the protein was from TIP2 subgroup. Surprisingly, semiquantitative RT-PCR experiment and western blot analysis showed that LRB7 and TIP2 were only detectable in roots, unlike Arabidopsis and Raphanus. Connecting with our previous studies, LRB7 was supported to associate with chilling-tolerance in C. bungeana. Conclusion. This is the first time to characterize the full sequences of LRB7 gene and water channel protein in C. bungeana. Our findings contribute to understanding the water transports in plants under low temperatures.
DEFF Research Database (Denmark)
Tinning, Anne Robdrup; Jensen, Boye L; Schweda, Frank
2014-01-01
Processing and release of secretory granules involve water movement across granule membranes. It was hypothesized that the water channel aquaporin-1 (AQP-1) contributes directly to recruitment of renin-positive cells in the afferent arteriole. AQP1(-/-) and (+/+) mice were fed a low NaCl diet (LS...... to baseline with no difference between genotypes. Plasma nitrite/nitrate concentration was unaffected by genotype and LS-ACEI. In AQP1(-/-) mice, the number of afferent arterioles with recruitment was significantly lower compared to (+/+) after LS-ACEI. It is concluded that aquaporin-1 is not necessary...... for acutely stimulated renin secretion in vivo and from isolated perfused kidney, whereas recruitment of renin-positive cells in response to chronic stimulation is attenuated or delayed in AQP1(-/-) mice....
The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns
Directory of Open Access Journals (Sweden)
kun feng
2016-08-01
Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.
Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula
Directory of Open Access Journals (Sweden)
Wei Li
2016-04-01
Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.
Jiang, Yong; Wang, Hui-Yan; Zheng, Sheng; Mu, Shang-Qiang; Ma, Meng-Ni; Xie, Xin; Zhang, Yang-Yang; Zhang, Chun-Xue; Cai, Jian-Hui
2015-01-01
Hypertension is the most common risk factor for various cardiovascular and cerebrovascular diseases that affects approximately 61 million, or 25% of the population in United States. The dietary salt intake is one of the most important but modifiable factors for hypertension. In the current study, we aim to elucidate the role of aquaporin 1 in high-salt-induced hypertension and cardiac injuries and whether angiotensin II receptor blocker valsartan could ameliorate the effect of high salt on blood pressure. Mice were fed with normal diet, high-salt diet in the presence or absence of valsartan for 4 weeks. The body weight gain, feeding behavior, blood pressure, and cardiac pathology changes were monitored after 4 weeks. The expression of aquaporin 1, vascular endothelial growth factor, transforming growth factor β1, and basic fibroblast growth factor were analyzed using quantitative real-time polymerase chain reaction, Western blot, and immunohistochemical staining. Valsartan partially reversed the effects of high-salt diet on hypertension, cardiac injuries such as fibrosis and inflammatory cell infiltration, and inhibition of aquaporin 1 and angiogenic factors; valsartan alone did not exert such effects. The current data demonstrated that the reduction of cardiac aquaporin 1 and angiogenic factor expression level might be associated with high-salt-induced hypertension and cardiac injuries in mice, which could be ameliorated by angiotensin II receptor blocker treatment. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
New Perspectives on the Potential Role of Aquaporins (AQPs in the Physiology of Inflammation
Directory of Open Access Journals (Sweden)
Rosaria Meli
2018-02-01
Full Text Available Aquaporins (AQPs are emerging, in the last few decades, as critical proteins regulating water fluid homeostasis in cells involved in inflammation. AQPs represent a family of ubiquitous membrane channels that regulate osmotically water flux in various tissues and sometimes the transport of small solutes, including glycerol. Extensive data indicate that AQPs, working as water channel proteins, regulate not only cell migration, but also common events essential for inflammatory response. The involvement of AQPs in several inflammatory processes, as demonstrated by their dysregulation both in human and animal diseases, identifies their new role in protection and response to different noxious stimuli, including bacterial infection. This contribution could represent a new key to clarify the dilemma of host-pathogen communications, and opens up new scenarios regarding the investigation of the modulation of specific AQPs, as target for new pharmacological therapies. This review provides updated information on the underlying mechanisms of AQPs in the regulation of inflammatory responses in mammals and discusses the broad spectrum of options that can be tailored for different diseases and their pharmacological treatment.
Kelly, Gilor; Sade, Nir; Attia, Ziv; Secchi, Francesca; Zwieniecki, Maciej; Holbrook, N. Michele; Levi, Asher; Alchanatis, Victor; Moshelion, Menachem; Granot, David
2014-01-01
Increased expression of the aquaporin NtAQP1, which is known to function as a plasmalemma channel for CO2 and water, increases the rate of both photosynthesis and transpiration. In contrast, increased expression of Arabidopsis hexokinase1 (AtHXK1), a dual-function enzyme that mediates sugar sensing, decreases the expression of photosynthetic genes and the rate of transpiration and inhibits growth. Here, we show that AtHXK1 also decreases root and stem hydraulic conductivity and leaf mesophyll CO2 conductance (g m). Due to their opposite effects on plant development and physiology, we examined the relationship between NtAQP1 and AtHXK1 at the whole-plant level using transgenic tomato plants expressing both genes simultaneously. NtAQP1 significantly improved growth and increased the transpiration rates of AtHXK1-expressing plants. Reciprocal grafting experiments indicated that this complementation occurs when both genes are expressed simultaneously in the shoot. Yet, NtAQP1 had only a marginal effect on the hydraulic conductivity of the double-transgenic plants, suggesting that the complementary effect of NtAQP1 is unrelated to shoot water transport. Rather, NtAQP1 significantly increased leaf mesophyll CO2 conductance and enhanced the rate of photosynthesis, suggesting that NtAQP1 facilitated the growth of the double-transgenic plants by enhancing mesophyll conductance of CO2. PMID:24498392
Directory of Open Access Journals (Sweden)
Gilor Kelly
Full Text Available Increased expression of the aquaporin NtAQP1, which is known to function as a plasmalemma channel for CO₂ and water, increases the rate of both photosynthesis and transpiration. In contrast, increased expression of Arabidopsis hexokinase1 (AtHXK1, a dual-function enzyme that mediates sugar sensing, decreases the expression of photosynthetic genes and the rate of transpiration and inhibits growth. Here, we show that AtHXK1 also decreases root and stem hydraulic conductivity and leaf mesophyll CO₂ conductance (g(m. Due to their opposite effects on plant development and physiology, we examined the relationship between NtAQP1 and AtHXK1 at the whole-plant level using transgenic tomato plants expressing both genes simultaneously. NtAQP1 significantly improved growth and increased the transpiration rates of AtHXK1-expressing plants. Reciprocal grafting experiments indicated that this complementation occurs when both genes are expressed simultaneously in the shoot. Yet, NtAQP1 had only a marginal effect on the hydraulic conductivity of the double-transgenic plants, suggesting that the complementary effect of NtAQP1 is unrelated to shoot water transport. Rather, NtAQP1 significantly increased leaf mesophyll CO₂ conductance and enhanced the rate of photosynthesis, suggesting that NtAQP1 facilitated the growth of the double-transgenic plants by enhancing mesophyll conductance of CO₂.
[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].
Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang
2011-12-01
To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.
Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline
2017-06-09
Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.
International Nuclear Information System (INIS)
Susa, Taketo; Sawai, Nobuhiko; Aoki, Takeo; Iizuka-Kogo, Akiko; Kogo, Hiroshi; Negishi, Akihide; Yokoo, Satoshi; Takata, Kuniaki; Matsuzaki, Toshiyuki
2013-01-01
Aquaporins are water channel proteins which enable rapid water movement across the plasma membrane. Aquaporin-5 (AQP5) is the major aquaporin and is expressed on the apical membrane of salivary gland acinar cells. We examined the effects of repeated administration of pilocarpine, a clinically useful stimulant for salivary fluid secretion, and isoproterenol (IPR), a stimulant for salivary protein secretion, on the abundance of AQP5 protein in rat salivary glands by immunofluorescence microscopy and semi-quantitative immunoblotting. Unexpectedly AQP5 was decreased in pilocarpine-administered salivary glands, in which fluid secretion must be highly stimulated, implying that AQP5 might not be required for fluid secretion at least in pilocarpine-administered state. The abundance of AQP5, on the other hand, was found to be significantly increased in IPR-administered submandibular and parotid glands. To address the possible mechanism of the elevation of AQP5 abundance in IPR-administered animals, changes of AQP5 level in fasting animals, in which the exocytotic events are reduced, were examined. AQP5 was found to be decreased in fasting animals as expected. These results suggested that the elevation of cAMP and/or frequent exocytotic events could increase AQP5 protein. AQP5 expression seems to be easily changed by salivary stimulants, although these changes do not always reflect the ability in salivary fluid secretion
Expression of AQP3 gene in chronic atrophic and chronic superficial gastritis patients
Directory of Open Access Journals (Sweden)
Shijun Zhang
2007-12-01
Full Text Available BACKGROUND: Most studies about aquaporin 3 (AQP3 in the gastrointestinal tract were carried out on both in vivo and in vitro. The role of AQP3-mediated water transport in human gastrointestinal tract is still unclear. Our aim in this study was to explore the expression of AQP3 gene in chronic atrophic gastritis (CAG and chronic superficial gastritis (CSG atients and to determine its possible function in the development of gastritis.
METHODS: Twenty-two outpatients diagnosed as CSG and 12 outpatients diagnosed as CAG were selected randomly. Ten cases of healthy individuals were selected as normal control group. In all cases, AQP3 gene expression of gastric mucosa was detected by fluorescence quantitative polymerase chain reaction (FQ-PCR.
RESULTS: The AQP3 gene expression was significantly higher in gastric mucosa of CSG and healthy individuals than that in CAG (P<0.01. However, there was no significant difference in the AQP3 gene expression between helicobacter pylori positive patients and helicobacter pylori negative patients (P>0.05.
CONCLUSIONS: AQP3 expression might play certain role in the occurrence and development of gastritis.
KEY WORDS: Aquaporin 3, chronic superficial gastritis, chronic atrophic gastritis.
Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro
2018-04-01
In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.
Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.
Juranić, Martina; Dresselhaus, Thomas
2014-01-01
MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.
DEFF Research Database (Denmark)
Davis, Margaret R.; Andersson, Robin; Severin, Jessica
2014-01-01
in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...
Genome-wide analysis of the GRAS gene family in Prunus mume.
Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang
2015-02-01
Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.
[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].
Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan
2016-08-01
To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Huang, Qin; Wang, Meiping; Xia, Zongliang
2018-01-01
Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a
Insights into plant plasma membrane aquaporin trafficking.
Hachez, Charles; Besserer, Arnaud; Chevalier, Adrien S; Chaumont, François
2013-06-01
Plasma membrane intrinsic proteins (PIPs) are plant aquaporins that facilitate the diffusion of water and small uncharged solutes through the cell membrane. Deciphering the network of interacting proteins that modulate PIP trafficking to and activity in the plasma membrane is essential to improve our knowledge about PIP regulation and function. This review highlights the most recent advances related to PIP subcellular routing and dynamic redistribution, identifies some key molecular interacting proteins, and indicates exciting directions for future research in this field. A better understanding of the mechanisms by which plants optimize water movement might help in identifying new molecular players of agronomical relevance involved in the control of cellular water uptake and drought tolerance. Copyright © 2012 Elsevier Ltd. All rights reserved.
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.
Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine
2011-11-01
The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.
Directory of Open Access Journals (Sweden)
Juergen H Nett
Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.
Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping
2018-02-21
Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
2014-12-09
Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.
Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B
2015-12-01
Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.
Directory of Open Access Journals (Sweden)
Glen Peter
2009-12-01
Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig
Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther
2013-04-01
Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.
Evaluation of the norrie disease gene in a family with incontinentia pigmenti.
Shastry, B S; Trese, M T
2000-01-01
Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel
Procino, G.; Mastrofrancesco, L.; Mira, A.; Tamma, G.; Carmosino, M.; Emma, F.; Svelto, M.; Valenti, G.
2008-01-01
The kidney plays a critical role in regulating water homeostasis through specific proteins highly expressed in the kidney, called aquaporins, allowing water permeation at a high rate. This brief review focuses on some nephropathies associated with impaired urinary concentrating ability and in
Water fluxes through aquaporin-9 prime epithelial cells for rapid wound healing
DEFF Research Database (Denmark)
Karlsson, T.; Lagerholm, B. C.; Vikstrom, E.
2013-01-01
Cells move along surfaces both as single cells and multi-cellular units. Recent research points toward pivotal roles for water flux through aquaporins (AQPs) in single cell migration. Their expression is known to facilitate this process by promoting rapid shape changes. However, little is known...... wound healing based on AQP-induced swelling and expansion of the monolayer. (C) 2012 Elsevier Inc. All rights reserved....
The claudin gene family: expression in normal and neoplastic tissues
International Nuclear Information System (INIS)
Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J
2006-01-01
The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4
Genome-wide identification and expression analysis of the WRKY gene family in cassava
Directory of Open Access Journals (Sweden)
Yunxie eWei
2016-02-01
Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.
Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian
2016-01-01
The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Directory of Open Access Journals (Sweden)
LISTYA UTAMI KARMAWAN
2009-03-01
Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...
Diverse roles of ERECTA family genes in plant development.
Shpak, Elena D
2013-12-01
Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Altered aquaporin expression in glaucoma eyes
DEFF Research Database (Denmark)
Tran, Thuy Linh; Bek, Toke; Cour, Morten la
2014-01-01
Aquaporins (AQP) are channels in the cell membrane that mainly facilitate a passive transport of water. In the eye, AQPs are expressed in the ciliary body and retina and may contribute to the pathogenesis of glaucoma and optic neuropathy. We investigated the expression of AQP1, AQP3, AQP4, AQP5......, AQP7 and AQP9 in human glaucoma eyes compared with normal eyes. Nine glaucoma eyes were examined. Of these, three eyes were diagnosed with primary open angle glaucoma; three eyes had neovascular glaucoma; and three eyes had chronic angle-closure glaucoma. Six eyes with normal intraocular pressure...... and without glaucoma were used as control. Immunohistochemistry was performed using antibodies against AQP1, AQP3, AQP4, AQP5, AQP7 and AQP9. For each specimen, optical densities of immunoprecipitates were measured using Photoshop and the staining intensities were calculated. Immunostaining showed labelling...
Tonoplast aquaporins facilitate lateral root emergence
DEFF Research Database (Denmark)
Reinhardt, Hagen; Hachez, Charles; Bienert, Manuela Désirée
2016-01-01
Aquaporins (AQPs) are water channels allowing fast and passive diffusion of water across cell membranes. It was hypothesized that AQPs contribute to cell elongation processes by allowing water influx across the plasma membrane and the tonoplast to maintain adequate turgor pressure. Here, we report...... mutants showed no or minor reduction in growth of the main root. This phenotype was due to the retardation of LRP emergence. Live cell imaging revealed that tight spatiotemporal control of TIP abundance in the tonoplast of the different LRP cells is pivotal to mediating this developmental process. While...... lateral root emergence is correlated to a reduction of AtTIP1;1 and AtTIP1;2 protein levels in LRPs, expression of AtTIP2;1 is specifically needed in a restricted cell population at the base, then later at the flanks, of developing LRPs. Interestingly, the LRP emergence phenotype of the triple tip mutants...
This study evaluated a recombinant aquaporin 1 protein of Rhipicephalus (Boophilus) microplus (RmAQP1) as antigen in a vaccine against R. sanguineus. Five dogs were immunized with RmAQP1 (10 µg) + adjuvant (Montanide) (G1), and five were inoculated with adjuvant only (G2), three times. Twenty-one da...
Directory of Open Access Journals (Sweden)
Atanassova Rossitza
2010-11-01
Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and
Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill
2013-02-01
Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.
Zhao, Manchun; Tan, Hwei-Ting; Scharwies, Johannes; Levin, Kara; Evans, John R; Tyerman, Stephen D
2017-06-01
The role of some aquaporins as CO 2 permeable channels has been controversial. Low CO 2 permeability of plant membranes has been criticized because of unstirred layers and other limitations. Here we measured both water and CO 2 permeability (P os , P CO2 ) using stopped flow on plasma membrane vesicles (pmv) isolated from Pisum sativum (pea) and Arabidopsis thaliana leaves. We excluded the chemical limitation of carbonic anhydrase (CA) in the vesicle acidification technique for P CO2 using different temperatures and CA concentrations. Unstirred layers were excluded based on small vesicle size and the positive correlation between vesicle diameter and P CO2 . We observed high aquaporin activity (P os 0.06 to 0.22 cm s -1 ) for pea pmv based on all the criteria for their function using inhibitors and temperature dependence. Inhibitors of P os did not alter P CO2 . P CO2 ranged from 0.001 to 0.012 cm s -1 (mean 0.0079 + 0.0007 cm s -1 ) with activation energy of 30.2 kJ mol -1 . Intrinsic variation between pmv batches from normally grown or stressed plants revealed a weak (R 2 = 0.27) positive linear correlation between P os and P CO2 . Despite the low P CO2 , aquaporins may facilitate CO 2 transport across plasma membranes, but probably via a different pathway than for water. © 2016 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Directory of Open Access Journals (Sweden)
Orsolya Galamb
2008-01-01
Full Text Available Gene expression analysis of colon biopsies using high-density oligonucleotide microarrays can contribute to the understanding of local pathophysiological alterations and to functional classification of adenoma (15 samples, colorectal carcinomas (CRC (15 and inflammatory bowel diseases (IBD (14. Total RNA was extracted, amplified and biotinylated from frozen colonic biopsies. Genome-wide gene expression profile was evaluated by HGU133plus2 microarrays and verified by RT-PCR. We applied two independent methods for data normalization and used PAM for feature selection. Leave one-out stepwise discriminant analysis was performed. Top validated genes included collagenIVα1, lipocalin-2, calumenin, aquaporin-8 genes in CRC; CD44, met proto-oncogene, chemokine ligand-12, ADAM-like decysin-1 and ATP-binding casette-A8 genes in adenoma; and lipocalin-2, ubiquitin D and IFITM2 genes in IBD. Best differentiating markers between Ulcerative colitis and Crohn's disease were cyclin-G2; tripartite motif-containing-31; TNFR shedding aminopeptidase regulator-1 and AMICA. The discriminant analysis was able to classify the samples in overall 96.2% using 7 discriminatory genes (indoleamine-pyrrole-2,3-dioxygenase, ectodermal-neural cortex, TIMP3, fucosyltransferase-8, collectin sub-family member 12, carboxypeptidase D, and transglutaminase-2. Using routine biopsy samples we successfully performed whole genomic microarray analysis to identify discriminative signatures. Our results provide further insight into the pathophysiological background of colonic diseases. The results set up data warehouse which can be mined further.
Molecular study of the perforin gene in familial hematological malignancies
Directory of Open Access Journals (Sweden)
El Abed Rim
2011-09-01
Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.
Evolution of the defensin-like gene family in grass genomes
Indian Academy of Sciences (India)
that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing
2014-06-01
Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
A comprehensive family-based replication study of schizophrenia genes
DEFF Research Database (Denmark)
Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef
2013-01-01
768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X
DEFF Research Database (Denmark)
Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas
2013-01-01
Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....
Small Mutations of the DMD Gene in Taiwanese Families
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2008-06-01
Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana
Czech Academy of Sciences Publication Activity Database
Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav
2007-01-01
Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007
Kasimanickam, R K; Kasimanickam, V R; Arangasamy, A; Kastelic, J P
2017-02-01
Mammalian sperm are exposed to a natural hypoosmotic environment during male-to-female reproductive tract transition; although this activates sperm motility in vivo, excessive swelling can harm sperm structure and function. Aquaporins (AQPs) is a family of membrane-channel proteins implicated in sperm osmoregulation. The objective was to determine associations among relative sperm volume shift, hypoosmotic swelling test (HOST), sperm aquaporin (AQP) 7 mRNA abundances, and sire conception rate (SCR; fertility estimate) in Holstein bulls at a commercial artificial insemination center. Three or four sires for each full point SCR score from -4 to +4 were included. Each SCR estimate for study bulls (N = 30) was based on > 500 services (mean ± SEM) of 725 ± 13 services/sire). Sperm from a single collection day (two ejaculates) from these commercial Holstein bulls were used. Relative mRNA expression of AQP7 in sperm was determined by polymerase chain reaction. Mean relative sperm volume shift and percentage of sperm reacted in a HOST (% HOST) were determined (400 sperm per bull) after incubating in isoosmotic (300 mOsm/kg) and hypoosmotic (100 mOsm/kg) solutions for 30 min. There was no correlation between %HOST and SCR (r = 0.28 P > 0.1). However, there was a positive correlation between relative sperm volume shift and SCR (r = 0.65, P 2) fertility sire groups. In conclusion, bulls with higher SCR had significantly greater AQP7 mRNA abundance in frozen-thawed sperm. This plausibly contributed to greater regulation of sperm volume shift, which apparently conferred protection from detrimental swelling and impaired functions. Copyright © 2016 Elsevier Inc. All rights reserved.
GDNF gene is associated with tourette syndrome in a family study.
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo
2015-07-01
Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.
GDNF Gene Is Associated With Tourette Syndrome in a Family Study
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo
2016-01-01
Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985
Directory of Open Access Journals (Sweden)
S. Pamela K. Shiao
2018-02-01
Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.
[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].
Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi
2014-12-01
To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Gene screening in a Chinese family with Marfan syndrome
Directory of Open Access Journals (Sweden)
Wen-Jiao Xia
2016-05-01
Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.
Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.
Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin
2018-03-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.
He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun
2017-08-23
The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.
Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B
2016-12-07
Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.
Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan
2018-04-01
Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
Bienert, Gerd P; Heinen, Robert B; Berny, Marie C; Chaumont, François
2014-01-01
Plant aquaporins play important roles in transmembrane water transport processes, but some also facilitate the diffusion of other small uncharged solutes ranging from gases to metalloids. Recent evidence suggests that the transmembrane movement of hydrogen peroxide, an intra- and intercellular multifunctional signaling and defense compound, can be regulated by aquaporins. We addressed the question whether maize aquaporins belonging to the plasma membrane intrinsic protein (PIP) subfamily facilitate hydrogen peroxide diffusion using heterologous expression in the yeast Saccharomyces cerevisiae. We showed that ZmPIP proteins belonging to the PIP1 and PIP2 groups were significantly expressed in yeast cells only after codon optimization of their cDNA. In accordance with previous localization studies in oocytes and plants, ZmPIP1;2 was mainly retained in intracellular membranes, while ZmPIP2;5 was localized to the plasma membrane. However, upon co-expression with ZmPIP2;5, ZmPIP1;2 was re-localized to the plasma membrane. Using a non-functional plasma membrane-localized ZmPIP2;5 mutant to deliver ZmPIP1;2 to the plasma membrane, we demonstrated that, in contrast to wild type ZmPIP2;5, ZmPIP1;2 was not permeable to hydrogen peroxide. Our study further highlighted the fact that, when using the yeast system, which is widely employed to study substrates for plant aquaporins and other transporters, although positive transport assay results allow direct conclusions to be drawn regarding solute permeability, negative results require additional control experiments to show that the protein is expressed and localized correctly before concluding on the lack of transport activity. © 2013.
[Roles of Aquaporins in Brain Disorders].
Yasui, Masato
2015-06-01
Aquaporin (AQP) is a water channel protein that is expressed in the cell membranes. AQPs are related to several kinds of human diseases such as cataract. In the mammalian central nervous system (CNS), AQP4 is specifically expressed in the astrocyte membranes lining the perivascular and periventricular structures. AQP4 plays a role in the development of brain edema associated with certain brain disorders. Neuromyelitis optica (NMO) is a demyelinating disorder, and patients with NMO develop autoimmune antibodies against AQP4 in their serum. Therefore, AQP4 is involved in NMO pathogenesis. A new concept referred to as "glymphatic pathway" has been recently proposed to explain the lymphatic system in the CNS. Dysfunction of the "glymphatic pathway" may cause several neurodegenerative diseases and mood disorders. Importantly, AQP4 may play a role in the "glymphatic pathway". Further investigation of AQP4 in CNS disorders is necessary, and a new drug against AQP4 is expected.
Downregulation of aquaporin-1 in alveolar microvessels in lungs adapted to chronic heart failure
DEFF Research Database (Denmark)
Müllertz, Katrine M; Strøm, Claes; Trautner, Simon
2011-01-01
The threshold pressure for lung edema formation is increased in severe chronic heart failure (CHF) due to reduced microvascular permeability. The water channel aquaporin-1 (AQP1) is present in the pulmonary microvascular endothelium, and a number of studies suggest the importance of AQP1 as a mol......The threshold pressure for lung edema formation is increased in severe chronic heart failure (CHF) due to reduced microvascular permeability. The water channel aquaporin-1 (AQP1) is present in the pulmonary microvascular endothelium, and a number of studies suggest the importance of AQP1...... as a molecular determinant of pulmonary microvascular water transport. The present study examined the abundance and localization of AQP1 in lungs from rats with CHF. We used two different models of CHF: ligation of the left anterior descending coronary artery (LAD ligation) and aorta-banding (AB). Sham......-operated rats served as controls. Echocardiographic verification of left ventricular dysfunction, enhanced left ventricular end-diastolic pressure, and right ventricular hypertrophy confirmed the presence of CHF. Western blotting of whole-lung homogenates revealed significant downregulation of AQP1 in LAD...
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
Differential expression of aquaporin-3 and aquaporin-5 in pancreatic ductal adenocarcinoma.
Direito, Inês; Paulino, Jorge; Vigia, Emanuel; Brito, Maria Alexandra; Soveral, Graça
2017-06-01
Aquaporin-5 (AQP5) and -3 (AQP3) are protein channels that showed to be up-regulated in a variety of tumors. Our goal was to investigate the expression pattern of AQP5 and AQP3 in pancreatic ductal adenocarcinomas (PDA) and correlate with cell proliferation, tumor stage and progression, and clinical significance. 35 PDA samples in different stages of differentiation and locations were analyzed by immunohistochemistry for expression of AQP5, AQP3 and several markers of cell proliferation and tumorigenesis. In PDA samples AQP5 was overexpressed in the apical membrane of intercalated and intralobular ductal cells while AQP3 was expressed at the plasma membrane of ductal cells. AQP5 was also found in infiltrative cancer cells in duodenum. Simultaneous overexpression of EGFR, Ki-67, and CK7, with decreased E-cad and increased Vim that characterize epithelial mesenchymal transition, tumor formation and invasion, strongly suggest AQP3 and AQP5 involvement in cell proliferation and transformation. AQP3 overexpression is reinforced in late and more aggressive PDA stages whereas AQP5 is related with tumor differentiation, suggesting it may represent a novel marker for PDA aggressiveness and intestinal infiltration. These findings suggest AQP3 and AQP5 involvement in PDA development and the usefulness of AQP5 in early PDA diagnosis. © 2017 Wiley Periodicals, Inc.
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families
International Nuclear Information System (INIS)
Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen
2007-01-01
Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
DEFF Research Database (Denmark)
Madsen, Steffen S; Olesen, Jesper H; Bedal, Konstanze
2011-01-01
Intestinal water absorption is greatly enhanced in salmonids upon acclimation from freshwater (FW) to seawater (SW); however, the molecular mechanism for water transport is unknown. We conducted a pharmacological characterization of water absorption in the rainbow trout intestine along......%), 0.1 ouabain (72%), and 0.1 bumetanide (82%) suggesting that active transport, Na(+), K(+)-ATPase and Na(+), K(+), 2Cl(-)-co-transport are involved in establishing the driving gradient for water transport. J(v) was also inhibited by 1 mmol L(-1) HgCl(2), serosally (23% in M and 44% in P), mucosally...... (27% in M), or both (61% in M and 58% in P), suggesting involvement of both apical and basolateral aquaporins in water transport. The inhibition was antagonized by 5 mmol L(-1) mercaptoethanol. By comparison, 10 mmol L(-1) mucosal tetraethylammonium, an inhibitor of certain aquaporins, inhibited J...
Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E
2015-05-01
Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family
Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li
2015-11-24
Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.
Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T
2015-11-27
Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
Smith, Alex J; Yao, Xiaoming; Dix, James A; Jin, Byung-Ju; Verkman, Alan S
2017-08-21
Transport of solutes through brain involves diffusion and convection. The importance of convective flow in the subarachnoid and paravascular spaces has long been recognized; a recently proposed 'glymphatic' clearance mechanism additionally suggests that aquaporin-4 (AQP4) water channels facilitate convective transport through brain parenchyma. Here, the major experimental underpinnings of the glymphatic mechanism were re-examined by measurements of solute movement in mouse brain following intracisternal or intraparenchymal solute injection. We found that: (i) transport of fluorescent dextrans in brain parenchyma depended on dextran size in a manner consistent with diffusive rather than convective transport; (ii) transport of dextrans in the parenchymal extracellular space, measured by 2-photon fluorescence recovery after photobleaching, was not affected just after cardiorespiratory arrest; and (iii) Aqp4 gene deletion did not impair transport of fluorescent solutes from sub-arachnoid space to brain in mice or rats. Our results do not support the proposed glymphatic mechanism of convective solute transport in brain parenchyma.
International Nuclear Information System (INIS)
Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.
2015-01-01
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Energy Technology Data Exchange (ETDEWEB)
Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)
2015-11-27
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Aquaporins 6-12 in the human eye
DEFF Research Database (Denmark)
Tran, Thuy Linh; Bek, Toke; Holm, Lars
2012-01-01
Purpose: Aquaporins (AQPs) are widely expressed and have diverse distribution patterns in the eye. AQPs 0-5 have been localized at the cellular level in human eyes. We investigated the presence of the more recently discovered AQPs 6-12 in the human eye. Methods: RT-PCR was performed on fresh tissue...... from two human eyes divided into the cornea, corneal limbus, ciliary body and iris, lens, choroid, optic nerve, retina and sclera. Each structure was examined to detect the mRNA of AQPs 6-12. Twenty-one human eyes were examined using immunohistochemical and immunofluorescence techniques to determine...... was detected in the corneal epithelium, corneal endothelium, trabecular meshwork endothelium, ciliary epithelia, lens epithelium, the inner and outer limiting membrane of the retina, the retinal pigment epithelium and the capillary endothelium of all parts of the eye. AQP9 immunolabelling was detected...
Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...
Energy Technology Data Exchange (ETDEWEB)
Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)
2012-07-13
Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
International Nuclear Information System (INIS)
Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin
2012-01-01
Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.
Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo
2015-01-01
To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.
Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin
2015-11-01
The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
Bilska-Kos, Anna; Szczepanik, Jarosław; Sowiński, Paweł
2016-10-20
Chilling stress is known to affect the water balance in plants, which often manifests itself in the decrease of the water potential in different organs. Relationships between chilling, assimilate transport and water balance are far from being understood. Although aquaporins play a key role in regulating water balance in plants, especially under stress conditions, the role of individual aquaporins in stress response remains unclear. In this report we show the specific localization within plasma membranes of one of the aquaporins (PIP2;3) in the leaves of two maize inbred lines differing in their chilling-sensitivity. This form of aquaporin has been also observed in thick-walled sieve elements - an additional type of sieve tubes of unclear function found only in monocotyledons. Moderate chilling (about 15°C) caused significant reduction of labelling in these cells accompanied by a steep decrease in the water potential in leaves of chilling-sensitive maize line. Our results suggest that both PIP2;3 and thick-walled sieve tubes may be an unknown element of the mechanism of the response of maize to cold stress. Copyright © 2016 Elsevier GmbH. All rights reserved.
DEFF Research Database (Denmark)
Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen
2004-01-01
Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...
Identification of the trehalose-6-phosphate synthase gene family in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.
Phylogenetic analysis of the MS4A and TMEM176 gene families.
Directory of Open Access Journals (Sweden)
Jonathan Zuccolo
2010-02-01
Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.
Expression of REG family genes in human inflammatory bowel diseases and its regulation
Directory of Open Access Journals (Sweden)
Chikatsugu Tsuchida
2017-12-01
Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.
Plant aquaporins: new perspectives on water and nutrient uptake in saline environment.
del Martínez-Ballesta, M C; Silva, C; López-Berenguer, C; Cabañero, F J; Carvajal, M
2006-09-01
The mechanisms of salt stress and tolerance have been targets for genetic engineering, focusing on ion transport and compartmentation, synthesis of compatible solutes (osmolytes and osmoprotectants) and oxidative protection. In this review, we consider the integrated response to salinity with respect to water uptake, involving aquaporin functionality. Therefore, we have concentrated on how salinity can be alleviated, in part, if a perfect knowledge of water uptake and transport for each particular crop and set of conditions is available.
Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon
Directory of Open Access Journals (Sweden)
Qing XU
2018-01-01
Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
Genome-wide identification and characterization of the SBP-box gene family in Petunia.
Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng
2018-03-12
SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative
Dlx homeobox gene family expression in osteoclasts.
Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A
2010-06-01
Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia
2014-10-01
MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.
Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.
Directory of Open Access Journals (Sweden)
Rocio Toro
Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.
International Nuclear Information System (INIS)
Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.
2010-01-01
Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels
Energy Technology Data Exchange (ETDEWEB)
Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)
2010-10-01
Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten
Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W
1993-10-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.
Directory of Open Access Journals (Sweden)
Sierra M Li
Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.
[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].
Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian
2015-05-01
The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Maddala, Rupalatha; Nagendran, Tharkika; de Ridder, Gustaaf G; Schey, Kevin L; Rao, Ponugoti Vasantha
2013-01-01
Homeostasis of intracellular calcium is crucial for lens cytoarchitecture and transparency, however, the identity of specific channel proteins regulating calcium influx within the lens is not completely understood. Here we examined the expression and distribution profiles of L-type calcium channels (LTCCs) and explored their role in morphological integrity and transparency of the mouse lens, using cDNA microarray, RT-PCR, immunoblot, pharmacological inhibitors and immunofluorescence analyses. The results revealed that Ca (V) 1.2 and 1.3 channels are expressed and distributed in both the epithelium and cortical fiber cells in mouse lens. Inhibition of LTCCs with felodipine or nifedipine induces progressive cortical cataract formation with time, in association with decreased lens weight in ex-vivo mouse lenses. Histological analyses of felodipine treated lenses revealed extensive disorganization and swelling of cortical fiber cells resembling the phenotype reported for altered aquaporin-0 activity without detectable cytotoxic effects. Analysis of both soluble and membrane rich fractions from felodipine treated lenses by SDS-PAGE in conjunction with mass spectrometry and immunoblot analyses revealed decreases in β-B1-crystallin, Hsp-90, spectrin and filensin. Significantly, loss of transparency in the felodipine treated lenses was preceded by an increase in aquaporin-0 serine-235 phosphorylation and levels of connexin-50, together with decreases in myosin light chain phosphorylation and the levels of 14-3-3ε, a phosphoprotein-binding regulatory protein. Felodipine treatment led to a significant increase in gene expression of connexin-50 and 46 in the mouse lens. Additionally, felodipine inhibition of LTCCs in primary cultures of mouse lens epithelial cells resulted in decreased intracellular calcium, and decreased actin stress fibers and myosin light chain phosphorylation, without detectable cytotoxic response. Taken together, these observations reveal a crucial
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates
Directory of Open Access Journals (Sweden)
Eliane Evanovich
2016-01-01
Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.
Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).
Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2013-07-25
The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.
Complexity of rice Hsp100 gene family: lessons from rice genome ...
Indian Academy of Sciences (India)
Madhu Sudhan
2007-03-29
Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...
Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri
2011-03-28
A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Neurexin gene family variants as risk factors for autism spectrum disorder.
Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran
2018-01-01
Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.
Genetic diversity of bitter taste receptor gene family in Sichuan
Indian Academy of Sciences (India)
Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
DEFF Research Database (Denmark)
Hu, H; Haas, S A; Chelly, J
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...
Azad, Abul Kalam; Sawa, Yoshihiro; Ishikawa, Takahiro; Shibata, Hitoshi
2009-01-01
Water channels formed by aquaporins (AQPs) play an important role in the control of water homeostasis in individual cells and in multicellular organisms. Plasma membrane intrinsic proteins (PIPs) constitute a subclass of plant AQPs. TgPIP2;1 and TgPIP2;2 from tulip petals are members of the PIP family. In this study, we overexpressed TgPIP2;1 and TgPIP2;2 in Pichia pastoris and monitored their water channel activity (WCA) either by an in vivo spheroplast-bursting assay performed after hypo-osmotic shock or by growth assay. Osmolarity, pH, and inhibitors of AQPs, protein kinases (PKs), and protein phosphatases (PPs) affect the WCA of heterologous AQPs in this expression system. The WCA of TgPIP2;2-expressing spheroplasts was affected by inhibitors of PKs and PPs, which indicates that the water channel of this homologue is regulated by phosphorylation in P. pastoris. From the results reported herein, we suggest that P. pastoris can be employed as a heterologous expression system to assay the WCA of PIPs and to monitor the AQP-mediated channel gating mechanism, and it can be developed to screen inhibitors/effectors of PIPs. PMID:19251885
Azad, Abul Kalam; Sawa, Yoshihiro; Ishikawa, Takahiro; Shibata, Hitoshi
2009-05-01
Water channels formed by aquaporins (AQPs) play an important role in the control of water homeostasis in individual cells and in multicellular organisms. Plasma membrane intrinsic proteins (PIPs) constitute a subclass of plant AQPs. TgPIP2;1 and TgPIP2;2 from tulip petals are members of the PIP family. In this study, we overexpressed TgPIP2;1 and TgPIP2;2 in Pichia pastoris and monitored their water channel activity (WCA) either by an in vivo spheroplast-bursting assay performed after hypo-osmotic shock or by growth assay. Osmolarity, pH, and inhibitors of AQPs, protein kinases (PKs), and protein phosphatases (PPs) affect the WCA of heterologous AQPs in this expression system. The WCA of TgPIP2;2-expressing spheroplasts was affected by inhibitors of PKs and PPs, which indicates that the water channel of this homologue is regulated by phosphorylation in P. pastoris. From the results reported herein, we suggest that P. pastoris can be employed as a heterologous expression system to assay the WCA of PIPs and to monitor the AQP-mediated channel gating mechanism, and it can be developed to screen inhibitors/effectors of PIPs.
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Directory of Open Access Journals (Sweden)
Carolina eRípodas
2015-01-01
Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.
Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.
Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng
2014-04-18
The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ashutosh ePandey
2016-02-01
Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.
Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming
2013-02-01
Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.
[Genome-wide identification and expression analysis of the WRKY gene family in peach].
Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long
2016-03-01
The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.
Genome-wide identification and expression analysis of the CIPK gene family in cassava
Directory of Open Access Journals (Sweden)
Wei eHu
2015-10-01
Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.
Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth
2012-06-06
As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.
Chromosomal evolution of the PKD1 gene family in primates
Directory of Open Access Journals (Sweden)
Krawczak Michael
2008-09-01
Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative
Convergence spasm due to aquaporin-positive neuromyelitis optica spectrum disorder
Directory of Open Access Journals (Sweden)
Pınar Özçelik
2017-06-01
Full Text Available A female 27 presented with nausea and diplopia for 1 week. On examination she had normal vertical gaze but would develop convergence with miosis whenever she made horizontal saccades. Pupils were 6 mm and unreactive to light. MRI showed extensive hyperintensity in the dorsal midbrain and thalamus. Spinal MRI and CSF were both normal. Serum aquaporin-4-antibody was positive. She was treated with steroids and plasmapheresis and after 3 months convergence spasm resolved but pupils remained unreactive. Neuromyelitis optica often presents with brainstem signs, rarely a dorsal midbrain syndrome. Convergence spasm is occasionally of organic neurologic origin.
Directory of Open Access Journals (Sweden)
Serbielle Céline
2012-12-01
Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in
Directory of Open Access Journals (Sweden)
Saleha S
2016-06-01
Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.
Ajmal, M; Zafar, S; Hameed, A
2016-01-01
ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411
Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.
Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge
2016-01-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.
Directory of Open Access Journals (Sweden)
Tianyu Zhou
2015-01-01
Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
DEFF Research Database (Denmark)
Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.
2011-01-01
challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...
Phylogenetic Analysis of the MS4A and TMEM176 Gene Families
Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.
2010-01-01
Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress
Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na
2017-07-15
Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.
Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.
1993-01-01
The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes
Directory of Open Access Journals (Sweden)
Libia Sanz
2016-07-01
Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.
Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan
2015-09-08
WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D
2017-11-07
The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.
Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong
2017-12-01
SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.
Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.
Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A
2016-12-01
Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Directory of Open Access Journals (Sweden)
Ogunjumo Oluwasanmi
2004-06-01
Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A
2004-01-01
Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903
Hobson, Neil; Deyholos, Michael K
2013-05-23
Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require
The plasma membrane intrinsic proteins (PIP) are one of the five aquaporin protein subfamilies. Aquaporin proteins are known to facilitate water transport through biological membranes. In order to identify NIP aquaporin gene candidates in cotton (Gossypium hirsutum L.), in silico and molecular clon...
Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi
2007-03-01
To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
Aquaporin expression in the fetal porcine urinary tract changes during gestation
DEFF Research Database (Denmark)
Jakobsen, L K; Trelborg, K; Kingo, P S
2018-01-01
The expression of aquaporins (AQPs) in the fetal porcine urinary tract and its relation to gestational age has not been established. Tissue samples from the renal pelvis, ureter, bladder and urethra were obtained from porcine fetuses. Samples were examined by RT-PCR (AQPs 1-11), QPCR (AQPs positive....... Immunohistochemistry showed AQP1 staining in sub-urothelial vessels at all locations. Western blotting analysis confirmed increased AQP1 protein levels in bladder samples during gestation. Expression levels of AQP1, 3, 5, 9 and 11 in the urinary tract change during gestation, and further studies are needed to provide...
Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H
2016-01-01
The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.
Directory of Open Access Journals (Sweden)
Ridhi eGoel
2016-03-01
Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.
The Role of the S40 Gene Family in Leaf Senescence
Directory of Open Access Journals (Sweden)
Muhammad Jehanzeb
2017-10-01
Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.
Aquaporins Contribute to ABA-Triggered Stomatal Closure through OST1-Mediated Phosphorylation
Grondin, Alexandre; Rodrigues, Olivier; Verdoucq, Lionel; Merlot, Sylvain; Leonhardt, Nathalie; Maurel, Christophe
2015-01-01
Stomatal movements in response to environmental stimuli critically control the plant water status. Although these movements are governed by osmotically driven changes in guard cell volume, the role of membrane water channels (aquaporins) has remained hypothetical. Assays in epidermal peels showed that knockout Arabidopsis thaliana plants lacking the Plasma membrane Intrinsic Protein 2;1 (PIP2;1) aquaporin have a defect in stomatal closure, specifically in response to abscisic acid (ABA). ABA induced a 2-fold increase in osmotic water permeability (Pf) of guard cell protoplasts and an accumulation of reactive oxygen species in guard cells, which were both abrogated in pip2;1 plants. Open stomata 1 (OST1)/Snf1-related protein kinase 2.6 (SnRK2.6), a protein kinase involved in guard cell ABA signaling, was able to phosphorylate a cytosolic PIP2;1 peptide at Ser-121. OST1 enhanced PIP2;1 water transport activity when coexpressed in Xenopus laevis oocytes. Upon expression in pip2;1 plants, a phosphomimetic form (Ser121Asp) but not a phosphodeficient form (Ser121Ala) of PIP2;1 constitutively enhanced the Pf of guard cell protoplasts while suppressing its ABA-dependent activation and was able to restore ABA-dependent stomatal closure in pip2;1. This work supports a model whereby ABA-triggered stomatal closure requires an increase in guard cell permeability to water and possibly hydrogen peroxide, through OST1-dependent phosphorylation of PIP2;1 at Ser-121. PMID:26163575
Function of the Membrane Water Channel Aquaporin-5 in the Salivary Gland
International Nuclear Information System (INIS)
Matsuzaki, Toshiyuki; Susa, Taketo; Shimizu, Kinue; Sawai, Nobuhiko; Suzuki, Takeshi; Aoki, Takeo; Yokoo, Satoshi; Takata, Kuniaki
2012-01-01
The process of saliva production in the salivary glands requires transepithelial water transfer from the interstitium to the acinar lumen. There are two transepithelial pathways: the transcellular and paracellular. In the transcellular pathway, the aquaporin water channels induce passive water diffusion across the membrane lipid bilayer. It is well known that aquaporin-5 (AQP5) is expressed in the salivary glands, in which it is mainly localized at the apical membrane of the acinar cells. This suggests the physiological importance of AQP5 in transcellular water transfer. Reduced saliva secretion under pilocarpine stimulation in AQP5-null mice compared with normal mice further indicates the importance of AQP5 in this process, at least in stimulated saliva secretion. Questions remain therefore regarding the role and importance of AQP5 in basal saliva secretion. It has been speculated that there would be some short-term regulation of AQP5 such as a trafficking mechanism to regulate saliva secretion. However, no histochemical evidence of AQP5-trafficking has been found, although some of biochemical analyses suggested that it may occur. There are no reports of human disease caused by AQP5 mutations, but some studies have revealed an abnormal subcellular distribution of AQP5 in patients or animals with xerostomia caused by Sjögren’s syndrome and X-irradiation. These findings suggest the possible pathophysiological importance of AQP5 in the salivary glands
[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].
Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen
2015-08-01
To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands
Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.
2006-01-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the
Institute of Scientific and Technical Information of China (English)
Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU
2007-01-01
Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.
Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J
2018-05-01
Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.
Directory of Open Access Journals (Sweden)
Wentao Wu
2017-10-01
Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli
2017-10-08
The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Leiomodins: larger members of the tropomodulin (Tmod) gene family
Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.
2001-01-01
The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.
Yusupov, Maksudbek; Yan, Dayun; Cordeiro, Rodrigo M.; Bogaerts, Annemie
2018-03-01
Experiments have demonstrated the potential selective anticancer capacity of cold atmospheric plasmas (CAPs), but the underlying mechanisms remain unclear. Using computer simulations, we try to shed light on the mechanism of selectivity, based on aquaporins (AQPs), i.e. transmembrane protein channels transferring external H2O2 and other reactive oxygen species, created e.g. by CAPs, to the cell interior. Specifically, we perform molecular dynamics simulations for the permeation of H2O2 through AQP1 (one of the members of the AQP family) and the palmitoyl-oleoyl-phosphatidylcholine (POPC) phospholipid bilayer (PLB). The free energy barrier of H2O2 across AQP1 is lower than for the POPC PLB, while the permeability coefficient, calculated using the free energy and diffusion rate profiles, is two orders of magnitude higher. This indicates that the delivery of H2O2 into the cell interior should be through AQP. Our study gives a better insight into the role of AQPs in the selectivity of CAPs for treating cancer cells.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Role of Aquaporin 0 in lens biomechanics.
Sindhu Kumari, S; Gupta, Neha; Shiels, Alan; FitzGerald, Paul G; Menon, Anil G; Mathias, Richard T; Varadaraj, Kulandaiappan
2015-07-10
Maintenance of proper biomechanics of the eye lens is important for its structural integrity and for the process of accommodation to focus near and far objects. Several studies have shown that specialized cytoskeletal systems such as the beaded filament (BF) and spectrin-actin networks contribute to mammalian lens biomechanics; mutations or deletion in these proteins alters lens biomechanics. Aquaporin 0 (AQP0), which constitutes ∼45% of the total membrane proteins of lens fiber cells, has been shown to function as a water channel and a structural cell-to-cell adhesion (CTCA) protein. Our recent ex vivo study on AQP0 knockout (AQP0 KO) mouse lenses showed the CTCA function of AQP0 could be crucial for establishing the refractive index gradient. However, biomechanical studies on the role of AQP0 are lacking. The present investigation used wild type (WT), AQP5 KO (AQP5(-/-)), AQP0 KO (heterozygous KO: AQP0(+/-); homozygous KO: AQP0(-/-); all in C57BL/6J) and WT-FVB/N mouse lenses to learn more about the role of fiber cell AQPs in lens biomechanics. Electron microscopic images exhibited decreases in lens fiber cell compaction and increases in extracellular space due to deletion of even one allele of AQP0. Biomechanical assay revealed that loss of one or both alleles of AQP0 caused a significant reduction in the compressive load-bearing capacity of the lenses compared to WT lenses. Conversely, loss of AQP5 did not alter the lens load-bearing ability. Compressive load-bearing at the suture area of AQP0(+/-) lenses showed easy separation while WT lens suture remained intact. These data from KO mouse lenses in conjunction with previous studies on lens-specific BF proteins (CP49 and filensin) suggest that AQP0 and BF proteins could act co-operatively in establishing normal lens biomechanics. We hypothesize that AQP0, with its prolific expression at the fiber cell membrane, could provide anchorage for cytoskeletal structures like BFs and together they help to confer
Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping
2013-09-01
SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Myo-Jing Kim
2014-12-01
Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.
Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria
Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.
2003-01-01
The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.
Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A
2017-02-01
There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.
Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan
2017-01-01
Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.
da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando
2016-01-01
The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.
Directory of Open Access Journals (Sweden)
Sandra Gutiérrez
2012-01-01
Full Text Available In this study, we analyzed the phenotype, clinical characteristics and presence of mutations in the enamelin gene ENAM in five Colombian families with autosomal dominant amelogenesis imperfecta (ADAI. 22 individuals (15 affected and seven unaffected belonging to five Colombian families with ADAI and eight individuals (three affected and five unaffected belonging to three Colombian families with autosomal recessive amelogenesis imperfecta (ARAI that served as controls for molecular alterations and inheritance patterns were studied. Clinical, radiographic and genetic evaluations were done in all individuals. Eight exons and three intron-exon boundaries were sequenced for mutation analysis. Two of the five families with ADAI had the hypoplasic phenotype, two had the hypocalcified phenotype and one had the hypomaturative phenotype. Anterior open bite and mandibular retrognathism were the most frequent skeletal abnormalities in the families with ADAI. No mutations were found. These findings suggest that ADAI in these Colombian families was unrelated to previously described mutations in the ENAM gene. These results also indicate that other regions not included in this investigation, such as the promoter region, introns and other genes should be considered as potential ADAI candidates.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.
Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B
2006-09-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.
Gene-expression patterns in peripheral blood classify familial breast cancer susceptibility.
Piccolo, Stephen R; Andrulis, Irene L; Cohen, Adam L; Conner, Thomas; Moos, Philip J; Spira, Avrum E; Buys, Saundra S; Johnson, W Evan; Bild, Andrea H
2015-11-04
Women with a family history of breast cancer face considerable uncertainty about whether to pursue standard screening, intensive screening, or prophylactic surgery. Accurate and individualized risk-estimation approaches may help these women make more informed decisions. Although highly penetrant genetic variants have been associated with familial breast cancer (FBC) risk, many individuals do not carry these variants, and many carriers never develop breast cancer. Common risk variants have a relatively modest effect on risk and show limited potential for predicting FBC development. As an alternative, we hypothesized that additional genomic data types, such as gene-expression levels, which can reflect genetic and epigenetic variation, could contribute to classifying a person's risk status. Specifically, we aimed to identify common patterns in gene-expression levels across individuals who develop FBC. We profiled peripheral blood mononuclear cells from women with a family history of breast cancer (with or without a germline BRCA1/2 variant) and from controls. We used the support vector machines algorithm to differentiate between patients who developed FBC and those who did not. Our study used two independent datasets, a training set of 124 women from Utah (USA) and an external validation (test) set from Ontario (Canada) of 73 women (197 total). We controlled for expression variation associated with clinical, demographic, and treatment variables as well as lymphocyte markers. Our multigene biomarker provided accurate, individual-level estimates of FBC occurrence for the Utah cohort (AUC = 0.76 [0.67-84]) . Even at their lower confidence bounds, these accuracy estimates meet or exceed estimates from alternative approaches. Our Ontario cohort resulted in similarly high levels of accuracy (AUC = 0.73 [0.59-0.86]), thus providing external validation of our findings. Individuals deemed to have "high" risk by our model would have an estimated 2.4 times greater odds of
Dong, Chun-Juan; Shang, Qing-Mao
2013-07-01
Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.
Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes
Directory of Open Access Journals (Sweden)
Yoshinori Sugiyama
2014-01-01
Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.
Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.
Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi
2008-07-01
Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.
International Nuclear Information System (INIS)
Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K.; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming
2012-01-01
Highlights: ► We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. ► Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. ► The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. ► GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.
Directory of Open Access Journals (Sweden)
Hua Guo
Full Text Available Aquaporin 1 (AQP1 is a member of the transmembrane water channel family of proteins with special structural features, and two AQP1 paralogous genes (aqp1aa and aqp1ab are reported in teleosts. In the present study, the aqp1aa gene of half-smooth tongue sole (Cynoglossus semilaevis was cloned and characterized. The full-length cDNA of aqp1aa is 1411 bp with a 786 bp open reading frame encoding a 261-amino acid putative protein with a characteristic structure consisting of 6 membrane-spanning α-helical domains and two highly conserved asparagine-proline-alanine motifs. Real-time quantitative PCR revealed that aqp1aa mRNA is expressed predominantly in the testis of males and pseudo-males, while its expression is low in the ovary and lowest in doublesex and mab-3-related transcription factor 1(DMRT1 knock out fish and triploid males. In situ hybridization indicated that aqp1aa mRNA is expressed mainly in the germ cells of males and pseudo-males, especially in spermatozoa and spermatids. These results suggest that the aqp1aa may play a role in spermatogenesis of C. semilaevis.
Sexy gene conversions: locating gene conversions on the X-chromosome.
Lawson, Mark J; Zhang, Liqing
2009-08-01
Gene conversion can have a profound impact on both the short- and long-term evolution of genes and genomes. Here, we examined the gene families that are located on the X-chromosomes of human (Homo sapiens), chimpanzee (Pan troglodytes), mouse (Mus musculus) and rat (Rattus norvegicus) for evidence of gene conversion. We identified seven gene families (WD repeat protein family, Ferritin Heavy Chain family, RAS-related Protein RAB-40 family, Diphosphoinositol polyphosphate phosphohydrolase family, Transcription Elongation Factor A family, LDOC1-related family, Zinc Finger Protein ZIC, and GLI family) that show evidence of gene conversion. Through phylogenetic analyses and synteny evidence, we show that gene conversion has played an important role in the evolution of these gene families and that gene conversion has occurred independently in both primates and rodents. Comparing the results with those of two gene conversion prediction programs (GENECONV and Partimatrix), we found that both GENECONV and Partimatrix have very high false negative rates (i.e. failed to predict gene conversions), which leads to many undetected gene conversions. The combination of phylogenetic analyses with physical synteny evidence exhibits high resolution in the detection of gene conversions.
Directory of Open Access Journals (Sweden)
Dandan eLi
2015-12-01
Full Text Available The heavy metal ATPase (HMA family plays an important role in transition metal transport in plants. However, this gene family has not been extensively studied in Populus trichocarpa. We identified 17 HMA genes in P. trichocarpa (PtHMAs, of which PtHMA1–PtHMA4 belonged to the zinc (Zn/cobalt (Co/cadmium (Cd/lead (Pb subgroup, and PtHMA5–PtHMA8 were members of the copper (Cu/silver (Ag subgroup. Most of the genes were localized to chromosomes I and III. Gene structure, gene chromosomal location, and synteny analyses of PtHMAs indicated that tandem and segmental duplications likely contributed to the expansion and evolution of the PtHMAs. Most of the HMA genes contained abiotic stress-related cis-elements. Tissue-specific expression of PtHMA genes showed that PtHMA1 and PtHMA4 had relatively high expression levels in the leaves, whereas Cu/Ag subgroup (PtHMA5.1- PtHMA8 genes were upregulated in the roots. High concentrations of Cu, Ag, Zn, Cd, Co, Pb and Mn differentially regulated the expression of PtHMAs in various tissues. The preliminary results of the present study generated basic information on the HMA family of Populus that may serve as foundation for future functional studies.
Goubau, Christophe; Jaeken, Jaak; Levtchenko, Elena N; Thys, Chantal; Di Michele, Michela; Martens, Geert A; Gerlo, Erik; De Vos, Rita; Buyse, Gunnar M; Goemans, Nathalie; Van Geet, Chris; Freson, Kathleen
2013-01-01
Aquaporin 7 (AQP7) belongs to the aquaglyceroporin family, which transports glycerol and water. AQP7-deficient mice develop obesity, insulin resistance, and hyperglyceroluria. However, AQP7's pathophysiologic role in humans is not yet known. Three children with psychomotor retardation and hyperglyceroluria were screened for AQP7 mutations. The children were from unrelated families. Urine and plasma glycerol levels were measured using a three-step enzymatic approach. Platelet morphology and function were studied using electron microscopy, aggregations, and adenosine triphosphate (ATP) secretion tests. The index patients were homozygous for AQP7 G264V, which has previously been shown to inhibit transport of glycerol in Xenopus oocytes. We also detected a subclinical platelet secretion defect with reduced ATP secretion, and the absence of a secondary aggregation wave after epinephrine stimulation. Electron microscopy revealed round platelets with centrally located granules. Immunostaining showed AQP7 colocalization, with dense granules that seemed to be released after strong platelet activation. Healthy relatives of these patients, who were homozygous (not heterozygous) for G264V, also had hyperglyceroluria and platelet granule abnormalities. The discovery of an association between urine glycerol loss and a platelet secretion defect is a novel one, and our findings imply the involvement of AQPs in platelet secretion. Additional studies are needed to define whether AQP7 G264V is also a risk factor for mental disability.
Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L
2014-04-08
In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.
NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.
Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran
2017-09-01
To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Genomic sequence and organization of two members of a human lectin gene family
International Nuclear Information System (INIS)
Gitt, M.A.; Barondes, S.H.
1991-01-01
The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family
International Nuclear Information System (INIS)
Pylkäs, Katri; Erkko, Hannele; Nikkilä, Jenni; Sólyom, Szilvia; Winqvist, Robert
2008-01-01
BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA) method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13) in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility
Directory of Open Access Journals (Sweden)
Sherri Sandy
2014-08-01
Full Text Available Epidemiological studies of neuromyelitis optica (NMO in Jamaica are lacking. Here we reviewed the clinical records of 700 patients undergoing neurological evaluation at the Kingston Public Hospital, the largest tertiary institution in Jamaica over a 4 month period. We investigated the diagnostic utility of Aquaporin-4 ImmuneglobulinG (AQP4-IgG testing in 36 consecutive patients with a diagnosis of an inflammatory demyelinating disorder (IDD of the central nervous system (CNS. Patients were classified into 3 categories: i NMO, n=10; ii multiple sclerosis (MS, n=14 and iii unclassified IDD (n=12. All sera were tested for AQP-IgG status by cell binding assay (Euroimmun. No MS cases were positive. Ninety per cent of NMO cases were positive. Four of 12 patients with unclassified IDD tested positive for AQP4-IgG. AQP4-IgG seropositivity was associated with a lower socioeconomic status, higher EDSS (P=0.04 and lower pulmonary function than the seronegative cases (P=0.007. Aquaporin-4 autoimmunity may account for a significant proportion of Jamaican CNS IDDs.
Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.
Directory of Open Access Journals (Sweden)
Yoshikazu Furuta
Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.
Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).
Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W
2015-12-29
GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.
Directory of Open Access Journals (Sweden)
Fang Hu
2014-10-01
Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.
Aquaporins regulate water transport through the highly hydrophobic lipid bilayer of cell membranes. As ticks ingest large volumes of host blood in relation to their size, they are required to concentrate blood components and have efficient water transport mechanisms. This study aimed to evaluate the...
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
Genome-wide analysis of WRKY gene family in Cucumis sativus.
Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan
2011-09-28
WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.
Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza
2017-09-27
Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.
Differential roles of TGIF family genes in mammalian reproduction
Directory of Open Access Journals (Sweden)
Renfree Marilyn B
2011-09-01
Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by
Kelly, Gilor; Sade, Nir; Doron-Faigenboim, Adi; Lerner, Stephen; Shatil-Cohen, Arava; Yeselson, Yelena; Egbaria, Aiman; Kottapalli, Jayaram; Schaffer, Arthur A; Moshelion, Menachem; Granot, David
2017-07-01
Sugars affect central aspects of plant physiology, including photosynthesis, stomatal behavior and the loss of water through the stomata. Yet, the potential effects of sugars on plant aquaporins (AQPs) and water conductance have not been examined. We used database and transcriptional analyses, as well as cellular and whole-plant functional techniques to examine the link between sugar-related genes and AQPs. Database analyses revealed a high level of correlation between the expression of AQPs and that of sugar-related genes, including the Arabidopsis hexokinases 1 (AtHXK1). Increased expression of AtHXK1, as well as the addition of its primary substrate, glucose (Glc), repressed the expression of 10 AQPs from the plasma membrane-intrinsic proteins (PIP) subfamily (PIP-AQPs) and induced the expression of two stress-related PIP-AQPs. The osmotic water permeability of mesophyll protoplasts of AtHXK1-expressing plants and the leaf hydraulic conductance of those plants were significantly reduced, in line with the decreased expression of PIP-AQPs. Conversely, hxk1 mutants demonstrated a higher level of hydraulic conductance, with increased water potential in their leaves. In addition, the presence of Glc reduced leaf water potential, as compared with an osmotic control, indicating that Glc reduces the movement of water from the xylem into the mesophyll. The production of sugars entails a significant loss of water and these results suggest that sugars and AtHXK1 affect the expression of AQP genes and reduce leaf water conductance, to coordinate sugar levels with the loss of water through transpiration. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Burfeind, Kevin G; Murchison, Charles F; Westaway, Shawn K; Simon, Matthew J; Erten-Lyons, Deniz; Kaye, Jeffrey A; Quinn, Joseph F; Iliff, Jeffrey J
2017-09-01
The glymphatic system is a brain-wide perivascular network that facilitates clearance of proteins, including amyloid β, from the brain interstitium through the perivascular exchange of cerebrospinal fluid and interstitial fluid. The astrocytic water channel aquaporin-4 (AQP4) is required for glymphatic system function, and impairment of glymphatic function in the aging brain is associated with altered AQP4 expression and localization. In human cortical tissue, alterations in AQP4 expression and localization are associated with Alzheimer's disease (AD) status and pathology. Although this suggests a potential role for AQP4 in the development or progression of AD, the relationship between of naturally occurring variants in the human AQP4 gene and cognitive function has not yet been evaluated. Using data from several longitudinal aging cohorts, we investigated the association between five AQP4 single-nucleotide polymorphisms (SNPs) and the rate of cognitive decline in participants with a diagnosis of AD. None of the five SNPs were associated with different rates of AD diagnosis, age of dementia onset in trial subjects. No association between AQP4 SNPs with histological measures of AD pathology, including Braak stage or neuritic plaque density was observed. However, AQP4 SNPs were associated with altered rates of cognitive decline after AD diagnosis, with two SNPS (rs9951307 and rs3875089) associated with slower cognitive decline and two (rs3763040 and rs3763043) associated with more rapid cognitive decline after AD diagnosis. These results provide the first evidence that variations in the AQP4 gene, whose gene product AQP4 is vital for glymphatic pathway function, may modulate the progression of cognitive decline in AD.
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.
LENUS (Irish Health Repository)
Fernandez, Desiree M
2012-02-03
OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.
Pittock, Sean J.; Lucchinetti, Claudia F.
2015-01-01
The discovery of AQP4-IgG (a pathogenic antibody that targets the astrocytic water channel aquaporin-4) as the first sensitive and specific biomarker for any inflammatory central nervous system demyelinating disease, has shifted emphasis from the oligodendrocyte and myelin to the astrocyte as a central immunopathogenic player. Neuromyelitis optica (NMO) spectrum disorders (SD) represent an evolving spectrum of IDDs extending beyond the optic nerves and spinal cord to include the brain (especially in children) and, rarely, muscle. NMOSD typical brain lesions are located in areas that highly express the target antigen, AQP4, including the circumventricular organs (accounting for intractable nausea and vomiting) and the diencephalon (accounting for sleep disorders, endocrinopathies, and syndrome of inappropriate antidiuresis). Magnetic resonance imaging (MRI) brain abnormalities fulfill Barkoff criteria for multiple sclerosis in up to 10% of patients. As the spectrum broadens, the importance of highly specific assays that detect pathogenic AQP4-IgG targeting extracellular epitopes of AQP4 cannot be overemphasized. The rapid evolution of our understanding of the immunobiology of AQP4 autoimmunity necessitates continuing revision of NMOSD diagnostic criteria. Here, we describe scientific advances that have occurred since the discovery of NMO-IgG in 2004 and review novel targeted immunotherapies. We also suggest that NMOSDs should now be considered under the umbrella term autoimmune aquaporin-4 channelopathy. PMID:26096370
Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou
2016-02-23
The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.
Directory of Open Access Journals (Sweden)
Ling Wei
2016-02-01
Full Text Available The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus, and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.
Repair of DNA damage in the human metallothionein gene family
International Nuclear Information System (INIS)
Leadon, S.A.; Snowden, M.M.
1987-01-01
In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab
International Nuclear Information System (INIS)
Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi
2016-01-01
NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.
Peng, Yanhui; Lin, Wuling; Cai, Weiming; Arora, Rajeev
2007-08-01
Water movement across cellular membranes is regulated largely by a family of water channel proteins called aquaporins (AQPs). Since several abiotic stresses such as, drought, salinity and freezing, manifest themselves via altering water status of plant cells and are linked by the fact that they all result in cellular dehydration, we overexpressed an AQP (tonoplast intrinsic protein) from Panax ginseng, PgTIP1, in transgenic Arabidopsis thaliana plants to test its role in plant's response to drought, salinity and cold acclimation (induced freezing tolerance). Under favorable conditions, PgTIP1 overexpression significantly increased plant growth as determined by the biomass production, and leaf and root morphology. PgTIP1 overexpression had beneficial effect on salt-stress tolerance as indicated by superior growth status and seed germination of transgenic plants under salt stress; shoots of salt-stressed transgenic plants also accumulated greater amounts of Na(+) compared to wild-type plants. Whereas PgTIP1 overexpression diminished the water-deficit tolerance of plants grown in shallow (10 cm deep) pots, the transgenic plants were significantly more tolerant to water stress when grown in 45 cm deep pots. The rationale for this contrasting response, apparently, comes from the differences in the root morphology and leaf water channel activity (speed of dehydration/rehydration) between the transgenic and wild-type plants. Plants overexpressed with PgTIP1 exhibited lower (relative to wild-type control) cold acclimation ability; however, this response was independent of cold-regulated gene expression. Our results demonstrate a significant function of PgTIP1 in growth and development of plant cells, and suggest that the water movement across tonoplast (via AQP) represents a rate-limiting factor for plant vigor under favorable growth conditions and also significantly affect responses of plant to drought, salt and cold stresses.
The nuclear IκB family of proteins controls gene regulation and immune homeostasis.
MaruYama, Takashi
2015-10-01
The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.
Deville, Sarah
2012-01-01
Traumatic brain injury (TBI) is often complicated by the development of brain edema. Despite its clinical importance, the underlying pathological mechanisms are poorly understood. Nevertheless, a central role for aquaporin-4 (AQP4) has been suggested. AQP4 is the predominant water channel of the central nervous system, where it forms supramolecular structures named orthogonal arrays of particles (OAP). This organization is essential for channel opening. OAP formation is regulated by the diffe...