WorldWideScience

Sample records for apoptotic enzymes escape

  1. Expression of Apoptotic and Antioxidant Enzyme Genes in Sheep Oocytes and In Vitro Produced Embryos.

    Science.gov (United States)

    Mishra, Ashish; Reddy, Ippala Janardhan; Gupta, Paluru Subramanyam Parameswara; Mondal, Sukanta

    2017-01-02

    The present study was to find out the expression pattern and relative expression level of apoptotic (Bcl2, Bax, Casp3, and PCNA) and antioxidant enzyme [(GPx, Cu/Zn-SOD (SOD1) and Mn-SOD (SOD2)] genes in sheep oocytes and developing embryos produced in vitro by conventional RT-PCR and real time qPCR, respectively. Different developmental stages of embryos were produced in vitro from oocytes collected from local slaughter house ovaries. RT-PCR amplicons showed expression of Bcl2 and PCNA in all stages except at morula. In contrast Bax and Casp3 were expressed in all stages. GPx and SOD1 were expressed in all stages but SOD2 was not expressed in 8-16 cells, although expressed in the remaining stages. The qPCR analysis reflected that Bcl2 expression was significantly (P sheep embryos produced in vitro are highly sensitive to culture condition, which alters the expression level of apoptotic and antioxidant enzyme genes.

  2. Echinacoside induces apoptotic cancer cell death by inhibiting the nucleotide pool sanitizing enzyme MTH1

    Directory of Open Access Journals (Sweden)

    Dong L

    2015-12-01

    Full Text Available Liwei Dong,1 Hongge Wang,1 Jiajing Niu,1 Mingwei Zou,2 Nuoting Wu,1 Debin Yu,1 Ye Wang,1 Zhihua Zou11Key Laboratory for Molecular Enzymology and Engineering of the Ministry of Education, National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, Jilin Province, People’s Republic of China; 2Department of Psychology, College of Liberal Arts and Social Sciences, University of Houston, Houston, TX, USA Abstract: Inhibition of the nucleotide pool sanitizing enzyme MTH1 causes extensive oxidative DNA damages and apoptosis in cancer cells and hence may be used as an anticancer strategy. As natural products have been a rich source of medicinal chemicals, in the present study, we used the MTH1-catalyzed enzymatic reaction as a high-throughput in vitro screening assay to search for natural compounds capable of inhibiting MTH1. Echinacoside, a compound derived from the medicinal plants Cistanche and Echinacea, effectively inhibited the catalytic activity of MTH1 in an in vitro assay. Treatment of various human cancer cell lines with Echinacoside resulted in a significant increase in the cellular level of oxidized guanine (8-oxoguanine, while cellular reactive oxygen species level remained unchanged, indicating that Echinacoside also inhibited the activity of cellular MTH1. Consequently, Echinacoside treatment induced an immediate and dramatic increase in DNA damage markers and upregulation of the G1/S-CDK inhibitor p21, which were followed by marked apoptotic cell death and cell cycle arrest in cancer but not in noncancer cells. Taken together, these studies identified a natural compound as an MTH1 inhibitor and suggest that natural products can be an important source of anticancer agents. Keywords: Echinacoside, MTH1, 8-oxoG, DNA damage, apoptosis, cell cycle arrest

  3. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  4. Enzyme

    Science.gov (United States)

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  5. Restricting wolves risks escape

    Science.gov (United States)

    Mech, L. David; Ballard, Warren; Bangs, Ed; Ream, Bob

    2010-01-01

    Implementing the proposal set forth by Licht and colleagues (BioScience 60: 147–153) requires restricting wolves to tiny "islands," areas that are magnitudes smaller than the ranges of most wolf populations. Wolves naturally have large ranges; restricting their spatial needs increases the risk of wolves escaping, exacerbating public relations and political and legal problems.

  6. Writing E/scapes

    Directory of Open Access Journals (Sweden)

    Jasmine Ulmer

    2017-12-01

    Full Text Available scape. 1 a brief ‘escape or means of escape’ 2 ‘a scenic view, whether of sea, land, or sky’ 3 ‘in its various senses’ 4 ‘a long flower-stalk rising directly from the root or rhizome’ 5 a theoretical approach to writing

  7. Escape From Cultural Isolation

    Science.gov (United States)

    Umesao, Tadao

    1975-01-01

    On the premise that the fundamental character of international interchange lies in a cruel and merciless collision of mutually suspicious and distrustful cultures, the historical resistance of the Japanese to cultural interchange is examined, the consequences of international trade without interchange noted, and the means of escape outlined. (JT)

  8. Escape from planetary neighbourhoods

    NARCIS (Netherlands)

    Waalkens, H.; Burbanks, A.; Wiggins, S.

    2005-01-01

    In this paper we use recently developed phase-space transport theory coupled with a so-called classical spectral theorem to develop a dynamically exact and computationally efficient procedure for studying escape from a planetary neighbourhood. The ‘planetary neighbourhood’ is a bounded region of

  9. Determination of forage escape protein value with in situ and ...

    African Journals Online (AJOL)

    This study was carried out to compare in situ and in vitro enzyme techniques for determining estimates of forage escape proteins. Eight forages (vetch hay, wheat silage, corn silage, wheat hay, grass hay, lentil straw, triticale hay and alfalfa hay) were used as feed materials. During 70 h, incubation with enzyme method had ...

  10. Escape from the Alternative

    Directory of Open Access Journals (Sweden)

    Marin Dinu

    2006-12-01

    Full Text Available This paper sets out to elaborate on Romania’s specific agenda regarding the approach to the integration process in the EU as a project of modernization. The focus is on the functional aspects, the type of strategic solutions destined to consolidate the specific transformations belonging to post-communist transition seen as an internal transition, on the one hand and on the other hand to push convergence as the essence of integration, marked by the vision of EU integration as a continuation of change, which is the stage of external transition. Identifying the prominent factors and the pragmatic priorities of the escape from the peripheries of development by engaging in evolution by way of the second modernization constitutes as well a target for analysis. One particularity of the method of analysis is the review if the value-set of the bobsled effect of path dependency – the path of the peripheries – as well as of the set of values of the escape from the peripheries.

  11. Reconstructing the Alcatraz escape

    Science.gov (United States)

    Baart, F.; Hoes, O.; Hut, R.; Donchyts, G.; van Leeuwen, E.

    2014-12-01

    In the night of June 12, 1962 three inmates used a raft made of raincoatsto escaped the ultimate maximum security prison island Alcatraz in SanFrancisco, United States. History is unclear about what happened tothe escapees. At what time did they step into the water, did theysurvive, if so, where did they reach land? The fate of the escapees has been the subject of much debate: did theymake landfall on Angel Island, or did the current sweep them out ofthe bay and into the cold pacific ocean? In this presentation, we try to shed light on this historic case using avisualization of a high-resolution hydrodynamic simulation of the San Francisco Bay, combined with historical tidal records. By reconstructing the hydrodynamic conditions and using a particle based simulation of the escapees we show possible scenarios. The interactive model is visualized using both a 3D photorealistic and web based visualization. The "Escape from Alcatraz" scenario demonstrates the capabilities of the 3Di platform. This platform is normally used for overland flooding (1D/2D). The model engine uses a quad tree structure, resulting in an order of magnitude speedup. The subgrid approach takes detailed bathymetry information into account. The inter-model variability is tested by comparing the results with the DFlow Flexible Mesh (DFlowFM) San Francisco Bay model. Interactivity is implemented by converting the models from static programs to interactive libraries, adhering to the Basic ModelInterface (BMI). Interactive models are more suitable for answeringexploratory research questions such as this reconstruction effort. Although these hydrodynamic simulations only provide circumstantialevidence for solving the mystery of what happened during the foggy darknight of June 12, 1962, it can be used as a guidance and provides aninteresting testcase to apply interactive modelling.

  12. Immunosuppressive effects of apoptotic cells

    Science.gov (United States)

    Voll, Reinhard E.; Herrmann, Martin; Roth, Edith A.; Stach, Christian; Kalden, Joachim R.; Girkontaite, Irute

    1997-11-01

    Apoptotic cell death is important in the development and homeostasis of multicellular organisms and is a highly controlled means of eliminating dangerous, damaged or unnecessary cells without causing an inflammatory response or tissue damage,. We now show that the presence of apoptotic cells during monocyte activation increases their secretion of the anti-inflammatory and immunoregulatory cytokine interleukin 10 (IL-10) and decreases secretion of the proinflammatory cytokines tumour necrosis factor-α (TNF-α), IL-1 and IL-12. This may inhibit inflammation and contribute to impaired cell-mediated immunity in conditions associated with increased apoptosis, such as viral infections, pregnancy, cancer and exposure to radiation.

  13. Creating Engaging Escape Rooms for the Classroom

    Science.gov (United States)

    Nicholson, Scott

    2018-01-01

    Escape rooms are "live-action team-based games where players discover clues, solve puzzles, and accomplish tasks in one or more rooms in order to accomplish a specific goal (usually escaping from the room) in a limited amount of time." Escape Rooms are one type of Escape Game, which are narrative-based challenges that use puzzles, tasks,…

  14. Automated Escape Guidance Algorithms for An Escape Vehicle

    Science.gov (United States)

    Flanary, Ronald; Hammen, David; Ito, Daigoro; Rabalais, Bruce; Rishikof, Brian; Siebold, Karl

    2002-01-01

    An escape vehicle was designed to provide an emergency evacuation for crew members living on a space station. For maximum escape capability, the escape vehicle needs to have the ability to safely evacuate a station in a contingency scenario such as an uncontrolled (e.g., tumbling) station. This emergency escape sequence will typically be divided into three events: The fust separation event (SEP1), the navigation reconstruction event, and the second separation event (SEP2). SEP1 is responsible for taking the spacecraft from its docking port to a distance greater than the maximum radius of the rotating station. The navigation reconstruction event takes place prior to the SEP2 event and establishes the orbital state to within the tolerance limits necessary for SEP2. The SEP2 event calculates and performs an avoidance burn to prevent station recontact during the next several orbits. This paper presents the tools and results for the whole separation sequence with an emphasis on the two separation events. The fust challenge includes collision avoidance during the escape sequence while the station is in an uncontrolled rotational state, with rotation rates of up to 2 degrees per second. The task of avoiding a collision may require the use of the Vehicle's de-orbit propulsion system for maximum thrust and minimum dwell time within the vicinity of the station vicinity. The thrust of the propulsion system is in a single direction, and can be controlled only by the attitude of the spacecraft. Escape algorithms based on a look-up table or analytical guidance can be implemented since the rotation rate and the angular momentum vector can be sensed onboard and a-priori knowledge of the position and relative orientation are available. In addition, crew intervention has been provided for in the event of unforeseen obstacles in the escape path. The purpose of the SEP2 burn is to avoid re-contact with the station over an extended period of time. Performing this maneuver properly

  15. Lise Meitner's escape from Germany

    Science.gov (United States)

    Sime, Ruth Lewin

    1990-03-01

    Lise Meitner (1878-1968) achieved prominence as a nuclear physicist in Germany; although of Jewish origin, her Austrian citizenship exempted her from Nazi racial laws until the annexation of Austria in 1938 precipitated her dismissal. Forbidden to emigrate, she narrowly escaped to the Netherlands with the help of concerned friends in the international physics community.

  16. Escaping carbon lock-in

    International Nuclear Information System (INIS)

    Unruh, G.C.

    2002-01-01

    This article explores the climate policy implications of the arguments made in ''Understanding carbon lock-in'' (Unruh, 2000), which posited that industrial countries have become locked-into fossil fuel-based energy systems through path dependent processes driven by increasing returns to scale. Carbon lock-in arises through technological, organizational, social and institutional co-evolution, ''culminating'' in what was termed as techno-institutional complex (TIC). In order to resolve the climate problem, an escape from the lock-in condition is required. However, due to the self-referential nature of TIC, escape conditions are unlikely to be generated internally and it is argued here that erogenous forces are probably required. (author)

  17. The escape gated proportional counter

    International Nuclear Information System (INIS)

    Bibbo, G.; Sanford, P.W.

    1981-01-01

    Proportional counters, designed to detect hard X-rays, are generally filled with Xe or Kr or a mixture of Xe and Kr. In a large multichamber proportional counter the K-fluorescent radiation of these gases, which escapes the cell of origin, but is absorbed in other cells of the counter, provides an additional signal. A coincidence technique, which makes use of this signal to reduce the charged particle background and to correct the energy spectrum for the escape peak, has been evaluated. The detector has an improved energy resolution over that of the conventional proportional counter and preliminary results indicate that a reduction in the background by a factor of about 1000 can be obtained. Its combined properties of very efficient background reduction and improved energy resolution make this type of instrument most suitable for spectroscopic studies of astronomical X-ray sources in the energy range of 15-100 keV. (orig.)

  18. EscapED: A Framework for Creating Educational Escape Rooms and Interactive Games to For Higher/Further Education.

    Directory of Open Access Journals (Sweden)

    Samantha Jane Clarke

    2017-09-01

    Full Text Available Game-based learning (GBL is often found to be technologically driven and more often than not, serious games for instance, are conceptualised and designed solely for digital platforms and state of the art technologies. To encourage a greater discussion on the potential benefits and challenges of a more holistic approach to developing GBL that promote human centered interactions and play for learning, the authors present the escapED programme. The escapED programme was conceived following the recent entertainment trend of escape rooms and is used for developing non-digital GBL approaches within education. escapED aids the design and creation of educational Escape Rooms and Interactive Gaming Experiences for staff and students in further/higher education settings. The paper first presents a pilot study that was used to assess the feasibility and acceptance of University teaching staff of embedding interactive GBL into a higher education environment. The authors then present the escapED theoretical framework that was used to create the prototype game for the pilot study as a tool to aid future design and development of on-site interactive experiences. The paper also presents an external developer report of using the escapED framework to develop a prototype game for teaching research methods to Southampton University students. Finally, the authors present a discussion on the use of the escapED framework so far and plans for future work and evaluation in order to provide engaging alternatives for learning and soft skills development amongst higher education staff andstudents.

  19. Malaria parasites: the great escape

    Directory of Open Access Journals (Sweden)

    Laurent Rénia

    2016-11-01

    Full Text Available Parasites of the genus Plasmodium have a complex life cycle. They alternate between their final mosquito host and their intermediate hosts. The parasite can be either extra- or intracellular, depending on the stage of development. By modifying their shape, motility, and metabolic requirements, the parasite adapts to the different environments in their different hosts. The parasite has evolved to escape the multiple immune mechanisms in the host that try to block parasite development at the different stages of their development. In this article, we describe the mechanisms reported thus far that allow the Plasmodium parasite to evade innate and adaptive immune responses.

  20. Apoptotic engulfment pathway and schizophrenia.

    LENUS (Irish Health Repository)

    Chen, Xiangning

    2009-01-01

    BACKGROUND: Apoptosis has been speculated to be involved in schizophrenia. In a previously study, we reported the association of the MEGF10 gene with the disease. In this study, we followed the apoptotic engulfment pathway involving the MEGF10, GULP1, ABCA1 and ABCA7 genes and tested their association with the disease. METHODOLOGY\\/PRINCIPAL FINDINGS: Ten, eleven and five SNPs were genotyped in the GULP1, ABCA1 and ABCA7 genes respectively for the ISHDSF and ICCSS samples. In all 3 genes, we observed nominally significant associations. Rs2004888 at GULP1 was significant in both ISHDSF and ICCSS samples (p = 0.0083 and 0.0437 respectively). We sought replication in independent samples for this marker and found highly significant association (p = 0.0003) in 3 Caucasian replication samples. But it was not significant in the 2 Chinese replication samples. In addition, we found a significant 2-marker (rs2242436 * rs3858075) interaction between the ABCA1 and ABCA7 genes in the ISHDSF sample (p = 0.0022) and a 3-marker interaction (rs246896 * rs4522565 * rs3858075) amongst the MEGF10, GULP1 and ABCA1 genes in the ICCSS sample (p = 0.0120). Rs3858075 in the ABCA1 gene was involved in both 2- and 3-marker interactions in the two samples. CONCLUSIONS\\/SIGNIFICANCE: From these data, we concluded that the GULP1 gene and the apoptotic engulfment pathway are involved in schizophrenia in subjects of European ancestry and multiple genes in the pathway may interactively increase the risks to the disease.

  1. Submarine 'safe to escape' studies in man.

    Science.gov (United States)

    Jurd, K M; Seddon, F M; Thacker, J C; Blogg, S L; Stansfield, M R D; White, M G; Loveman, G A M

    2014-01-01

    The Royal Navy requires reliable advice on the safe limits of escape from a distressed submarine (DISSUB). Flooding in a DISSUB may cause a rise in ambient pressure, increasing the risk of decompression sickness (DCS) and decreasing the maximum depth from which it is safe to escape. The aim of this study was to investigate the pressure/depth limits to escape following saturation at raised ambient pressure. Exposure to saturation pressures up to 1.6 bar (a) (160 kPa) (n = 38); escapes from depths down to 120 meters of sea water (msw) (n = 254) and a combination of saturation followed by escape (n = 90) was carried out in the QinetiQ Submarine Escape Simulator, Alverstoke, United Kingdom. Doppler ultrasound monitoring was used to judge the severity of decompression stress. The trials confirmed the previously untested advice, in the Guardbook, that if a DISSUB was lying at a depth of 90 msw, then it was safe to escape when the pressure in the DISSUB was 1.5 bar (a), but also indicated that this advice may be overly conservative. This study demonstrated that the upper DISSUB saturation pressure limit to safe escape from 90 msw was 1.6 bar (a), resulting in two cases of DCS.

  2. Escape of atmospheric gases from the Moon

    Indian Academy of Sciences (India)

    The escape rate of atmospheric molecules on the Moon is calculated.Based on the assumption that the rates of emission and escape of gases attain equilibrium, the ratio of molecular number densities during day and night, 0/0, can be explained. The plausible emission rate of helium and radioactive elements present ...

  3. Escape of atmospheric gases from the Moon

    Indian Academy of Sciences (India)

    its weak gravity, the atmospheric molecules gradu- ally escaped, resulting in the very thin atmosphere existing now. To see if a thick atmosphere could be retained or not, we assume that the air hav- ing pressure of 1atmosphere (as exists on Earth now) existed on the Moon initially and calculate the escape life times for ...

  4. Two examples of escaping harmonic maps

    International Nuclear Information System (INIS)

    Pereira do Valle, A.; Verjovsky, A.

    1988-12-01

    This paper is part of a study on the existence of special harmonic maps on complete non-compact Riemannian manifolds. We generalize the notion of escaping geodesic and prove some results on the existence of escaping harmonic maps. 11 refs, 6 figs

  5. Escaping Homelessness: Anticipated and Perceived Facilitators

    Science.gov (United States)

    Patterson, Allisha; Tweed, Roger

    2009-01-01

    One study with two distinct sections was conducted to identify factors facilitating escape from homelessness. In Section 1, 58 homeless individuals rated possible facilitators of escape (factors they believed would help them become more independent and self-sufficient). In Section 2, 80 participants who had already exited homelessness rated the…

  6. Learning from escaped prescribed fire reviews [Abstract

    Science.gov (United States)

    Anne Black; Dave Thomas; James Saveland

    2011-01-01

    Over the past decade, the wildland fire community has developed a number of innovative methods for conducting a review following escape of a prescribed fire. The stated purpose been to identify methods that not only meet policy requirements, but to reduce future escapes. Implicit is the assumption that a review leads to learning. Yet, as organizational learning expert...

  7. Apoptotic Bodies: Selective Detection in Extracellular Vesicles.

    Science.gov (United States)

    Hauser, Paul; Wang, Sha; Didenko, Vladimir V

    2017-01-01

    Normal and dying cells release various types of membrane-bound vesicles including microvesicles, exosomes, and apoptotic bodies. These vesicles play important roles in intercellular communication and signal transduction. However, their diverse forms and subtypes fluctuate in size and other properties. In result current purification approaches do not fully discriminate between different categories of extracellular vesicles. Here, we present a fluorescence technique that specifically identifies apoptotic bodies in preparations of microvesicles, exosomes, and other extracellular vesicles.The approach exclusively labels the vesicles that contain DNA with 5'PO 4 blunt-ended DNA breaks, such as those produced by the apoptotic CAD nuclease during apoptotic DNA degradation. The technique can be useful in studies of apoptosis involving microvesicles and exosomes.

  8. Rumen escape protein in concentrate ingredients determined with the nylon bag and enzymatic techniques

    NARCIS (Netherlands)

    Cone, J.W.; Kamman, A.A.; Gelder, A.H. van; Hindle, V.A.

    2002-01-01

    Rumen escape protein (REP) was determined for 26 concentrate feed ingredients using the nylon bag technique and in vitro using a proteolytic enzyme preparation of Streptomyces griseus. In vitro, the samples were incubated for 0, 1, 6 and 24 h. The highest correlation was observed between percentage

  9. Physics escape room as an educational tool

    Science.gov (United States)

    Vörös, Alpár István Vita; Sárközi, Zsuzsa

    2017-12-01

    Escape rooms have flourished in the last decade. These are adventure games in which players work together to solve puzzles using hints, clues and a strategy to escape from a locked room. In many cases they use different phenomena related to physics. Hence the idea of using escape rooms in science centers or even in classroom activities. Escape rooms are designed for one single team of players, the method is more suitable for activities in a science centre. In our paper, we show that escape rooms' puzzle solving methods could be used in physics classroom activities as well, taking into account that several teams have to work together in the same room/place. We have developed an educational escape game for physics of fluids, as this topic is left out from the Romanian high-school curriculum. We have tried out our game during the project week called "Şcoala altfel" ("school in a different way") and in a physics camp for gifted students. We present the designed physics escape game and the results.

  10. A Model for SEP Escape

    Science.gov (United States)

    Antiochos, S. K.; Masson, S.; DeVore, C. R.

    2012-01-01

    Magnetic reconnection in the solar atmosphere is believed to be the driver of most solar explosive phenomena. Therefore, the topology of the coronal magnetic field is central to understanding the solar drivers of space weather. Of particular importance to space weather are the impulsive Solar Energetic particles that are associated with some CME/eruptive flare events. Observationally, the magnetic configuration of active regions where solar eruptions originate appears to agree with the standard eruptive flare model. According to this model, particles accelerated at the flare reconnection site should remain trapped in the corona and the ejected plasmoid. However, flare-accelerated particles frequently reach the Earth long before the CME does. We present a model that may account for the injection of energetic particles onto open magnetic flux tubes connecting to the Earth. Our model is based on the well-known 2.5D breakout topology, which has a coronal null point (null line) and a four-flux system. A key new addition, however, is that we include an isothermal solar wind with open-flux regions. Depending on the location of the open flux with respect to the null point, we find that the flare reconnection can consist of two distinct phases. At first, the flare reconnection involves only closed field, but if the eruption occurs close to the open field, we find a second phase involving interchange reconnection between open and closed. We argue that this second reconnection episode is responsible for the injection of flare-accelerated particles into the interplanetary medium. We will report on our recent work toward understanding how flare particles escape to the heliosphere. This work uses high-resolution 2.5D MHD numerical simulations performed with the Adaptively Refined MHD Solver (ARMS).

  11. Exploitation of Apoptotic Regulation in Cancer

    Directory of Open Access Journals (Sweden)

    David S. Ucker

    2018-02-01

    Full Text Available Within an organism, environmental stresses can trigger cell death, particularly apoptotic cell death. Apoptotic cells, themselves, are potent regulators of their cellular environment, involved primarily in effecting homeostatic control. Tumors, especially, exist in a dynamic balance of cell proliferation and cell death. This special feature of the tumorous microenvironment—namely, the prominence and persistence of cell death—necessarily entails a magnification of the extrinsic, postmortem effects of dead cells. In both normal and malignant tissues, apoptotic regulation is exerted through immune as well as non-immune mechanisms. Apoptotic cells suppress the repertoire of immune reactivities, both by attenuating innate (especially inflammatory responses and by abrogating adaptive responses. In addition, apoptotic cells modulate multiple vital cell activities, including survival, proliferation (cell number, and growth (cell size. While the microenvironment of the tumor may contribute to apoptosis, the postmortem effects of apoptotic cells feature prominently in the reciprocal acclimatization between the tumor and its environment. In much the same way that pathogens evade the host’s defenses through exploitation of key aspects of innate and adaptive immunity, cancer cells subvert several normal homeostatic processes, in particular wound healing and organ regeneration, to transform and overtake their environment. In understanding this subversion, it is crucial to view a tumor not simply as a clone of malignant cells, but rather as a complex and highly organized structure in which there exists a multidirectional flow of information between the cancer cells themselves and the multiple other cell types and extracellular matrix components of which the tumor is comprised. Apoptotic cells, therefore, have the unfortunate consequence of facilitating tumorigenesis and tumor survival.

  12. Escape dynamics: a continuous-time approximation

    Czech Academy of Sciences Publication Activity Database

    Kolyuzhnov, D.; Bogomolova, A.; Slobodyan, Sergey

    2014-01-01

    Roč. 38, January (2014), s. 161-183 ISSN 0165-1889 Institutional support: RVO:67985998 Keywords : constant gain adaptive learning * escape dynamics * recursive least squares Subject RIV: AH - Economics Impact factor: 1.018, year: 2014

  13. St.Petersburg Escape Experience Tour

    OpenAIRE

    Palagina, Mariia; Zhak, Svetlana

    2017-01-01

    The growing popularity of Russia as a tourist destination and the high interest towards escape rooms and quests opens new business opportunities and market niches. The aim of this thesis is to develop a tourist product based on the new escape room tourism concept combining the historical, cultural and game experiences. The choice of the theme and destination was determined by the authors’ personal backgrounds and the destination proximity to Finland. The theoretical research was implement...

  14. The escape problem for mortal walkers

    OpenAIRE

    Grebenkov, D. S.; Rupprecht, J. -F.

    2016-01-01

    We introduce and investigate the escape problem for random walkers that may eventually die, decay, bleach, or lose activity during their diffusion towards an escape or reactive region on the boundary of a confining domain. In the case of a first-order kinetics (i.e., exponentially distributed lifetimes), we study the effect of the associated death rate onto the survival probability, the exit probability, and the mean first passage time. We derive the upper and lower bounds and some approximat...

  15. Submarine tower escape decompression sickness risk estimation.

    Science.gov (United States)

    Loveman, G A M; Seddon, E M; Thacker, J C; Stansfield, M R; Jurd, K M

    2014-01-01

    Actions to enhance survival in a distressed submarine (DISSUB) scenario may be guided in part by knowledge of the likely risk of decompression sickness (DCS) should the crew attempt tower escape. A mathematical model for DCS risk estimation has been calibrated against DCS outcome data from 3,738 exposures of either men or goats to raised pressure. Body mass was used to scale DCS risk. The calibration data included more than 1,000 actual or simulated submarine escape exposures and no exposures with substantial staged decompression. Cases of pulmonary barotrauma were removed from the calibration data. The calibrated model was used to estimate the likelihood of DCS occurrence following submarine escape from the United Kingdom Royal Navy tower escape system. Where internal DISSUB pressure remains at - 0.1 MPa, escape from DISSUB depths 60% DCS risk predicted for a 200-meter escape from saturation at 0.21 MPa. Using the calibrated model to predict DCS for direct ascent from saturation gives similar risk estimates to other published models.

  16. Polymer escape from a confining potential

    International Nuclear Information System (INIS)

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-01-01

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer

  17. Radon escape from New Zealand speleothems

    International Nuclear Information System (INIS)

    Lyons, R.G.; Crossley, P.C.; Ditchburn, R.G.; McCabe, W.J.; Whitehead, N.

    1989-01-01

    When calculating the environment radiation absorbed dose rate in ESR or TL dating, it is usual to allow for the possibility of disequilibrium in the uranium-series decay chain, due to the escape of radon from the sample. A number of speleothems from a temperate climate, varying in age have been analysed for thorium and polonium isotopes. A comparison of thorium and polonium activities with the expected values, derived from the age of the sample and the initial concentrations, gives an estimate of the radon escape. The recovery rates of uranium and thorium were monitored by spiking but the recovery rate of polonium must be regarded as a minimum; estimates of radon escape are therefore likely to be overestimates. Of 19 speleothems studied, only two gave results inconsistent with values predicted on the basis of no radon loss one, a relatively young sample, showed evidence of radium coprecipitation with uranium, and one, a dog-tooth spar with an open crystal structure and a high porosity showed evidence for radon escape. A third sample, also a flowstone/spar with a higher porosity than normal, was marginally significant. As the degree of radon escape will vary from sample to sample, the environment dose rate must be regarded as having a high level of uncertainty for samples of this type, unless radon escape is determined experimentally. The remaining samples (12 stalagmites, 3 stalactites and 1 flowstone), of a more massive structure, showed no significant radon escape and therefore the environment dose rate for such samples should be calculated on the basis of radon retention. (author)

  18. Radon escape from New Zealand speleothems

    Energy Technology Data Exchange (ETDEWEB)

    Lyons, R.G.; Crossley, P.C. (Auckland Univ. (New Zealand). Dept. of Geography); Ditchburn, R.G.; McCabe, W.J.; Whitehead, N. (Department of Scientific and Industrial Research, Lower Hutt (New Zealand). Inst. of Nuclear Sciences)

    1989-01-01

    When calculating the environment radiation absorbed dose rate in ESR or TL dating, it is usual to allow for the possibility of disequilibrium in the uranium-series decay chain, due to the escape of radon from the sample. A number of speleothems from a temperate climate, varying in age have been analysed for thorium and polonium isotopes. A comparison of thorium and polonium activities with the expected values, derived from the age of the sample and the initial concentrations, gives an estimate of the radon escape. The recovery rates of uranium and thorium were monitored by spiking but the recovery rate of polonium must be regarded as a minimum; estimates of radon escape are therefore likely to be overestimates. Of 19 speleothems studied, only two gave results inconsistent with values predicted on the basis of no radon loss one, a relatively young sample, showed evidence of radium coprecipitation with uranium, and one, a dog-tooth spar with an open crystal structure and a high porosity showed evidence for radon escape. A third sample, also a flowstone/spar with a higher porosity than normal, was marginally significant. As the degree of radon escape will vary from sample to sample, the environment dose rate must be regarded as having a high level of uncertainty for samples of this type, unless radon escape is determined experimentally. The remaining samples (12 stalagmites, 3 stalactites and 1 flowstone), of a more massive structure, showed no significant radon escape and therefore the environment dose rate for such samples should be calculated on the basis of radon retention. (author).

  19. Activation of Pro-apoptotic Caspases in Non-apoptotic Cells During Odontogenesis and Related Osteogenesis

    Directory of Open Access Journals (Sweden)

    Eva Svandova

    2018-03-01

    Full Text Available Caspases are well known proteases in the context of inflammation and apoptosis. Recently, novel roles of pro-apoptotic caspases have been reported, including findings related to the development of hard tissues. To further investigate these emerging functions of pro-apoptotic caspases, the in vivo localisation of key pro-apoptotic caspases (-3,-6,-7,-8, and -9 was assessed, concentrating on the development of two neighbouring hard tissues, cells participating in odontogenesis (represented by the first mouse molar and intramembranous osteogenesis (mandibular/alveolar bone. The expression of the different caspases within the developing tissues was correlated with the apoptotic status of the cells, to produce a picture of whether different caspases have potentially distinct, or overlapping non-apoptotic functions. The in vivo investigation was additionally supported by examination of caspases in an osteoblast-like cell line in vitro. Caspases-3,-7, and -9 were activated in apoptotic cells of the primary enamel knot of the first molar; however, caspase-7 and -8 activation was also associated with the non-apoptotic enamel epithelium at the same stage and later with differentiating/differentiated odontoblasts and ameloblasts. In the adjacent bone, active caspases-7 and -8 were present abundantly in the prenatal period, while the appearance of caspases-3,-6, and -9 was marginal. Perinatally, caspases-3 and -7 were evident in some osteoclasts and osteoblastic cells, and caspase-8 was abundant mostly in osteoclasts. In addition, postnatal activation of caspases-7 and -8 was retained in osteocytes. The results provide a comprehensive temporo-spatial pattern of pro-apoptotic caspase activation, and demonstrate both unique and overlapping activation in non-apoptotic cells during development of the molar tooth and mandibular/alveolar bone. The importance of caspases in osteogenic pathways is highlighted by caspase inhibition in osteoblast-like cells, which

  20. Detection of apoptotic cells using immunohistochemistry

    NARCIS (Netherlands)

    Newbold, Andrea; Martin, Ben P.; Cullinane, Carleen; Bots, Michael

    2014-01-01

    Immunohistochemistry is commonly used to show the presence of apoptotic cells in situ. In this protocol, B-cell lymphoma cells are injected into recipient mice and, on tumor formation, the mice are treated with the apoptosis inducer vorinostat (a histone deacetylase inhibitor). Tumor samples are

  1. Comparative Antioxidant, Antiproliferative and Apoptotic Effects of ...

    African Journals Online (AJOL)

    Purpose: To determine and compare the antioxidant, antiproliferative and apoptotic effects of leaf infusions of Ilex laurina and Ilex paraguariensis in colon cancer cells. Methods: Antioxidant activity was determined by ORAC (Oxygen Radical Absorbance Capacity) and FRAP (Ferric Reducing Antioxidant Power). Cytotoxic ...

  2. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  3. Thermal escape from extrasolar giant planets.

    Science.gov (United States)

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres.

  4. Non-apoptotic function of apoptotic proteins in the development of ...

    Indian Academy of Sciences (India)

    apoptotic roles such as immune function. (Stoven et al. 2003; Tanji and Ip 2005), cell proliferation. (Chun et al. 2002; Salmena and Hakem 2005), cell differentiation (Kang et al. 2004; Lamkanfi et al. 2006) spermatid individualization (Arama et al.

  5. Martian Atmospheric and Ionospheric plasma Escape

    Science.gov (United States)

    Lundin, Rickard

    2016-04-01

    Solar forcing is responsible for the heating, ionization, photochemistry, and erosion processes in the upper atmosphere throughout the lifetime of the terrestrial planets. Of the four terrestrial planets, the Earth is the only one with a fully developed biosphere, while our kin Venus and Mars have evolved into arid inhabitable planets. As for Mars, there are ample evidences for an early Noachian, water rich period on Mars. The question is, what made Mars evolve so differently compared to the Earth? Various hydrosphere and atmospheric evolution scenarios for Mars have been forwarded based on surface morphology, chemical composition, simulations, semi-empiric (in-situ data) models, and the long-term evolution of the Sun. Progress has been made, but the case is still open regarding the changes that led to the present arid surface and tenuous atmosphere at Mars. This presentation addresses the long-term variability of the Sun, the solar forcing impact on the Martian atmosphere, and its interaction with the space environment - an electromagnetic wave and particle interaction with the upper atmosphere that has implications for its photochemistry, composition, and energization that governs thermal and non-thermal escape. Non-thermal escape implies an electromagnetic upward energization of planetary ions and molecules to velocities above escape velocity, a process governed by a combination of solar EUV radiation (ionization), and energy and momentum transfer by the solar wind. The ion escape issue dates back to the early Soviet and US-missions to Mars, but the first more accurate estimates of escape rates came with the Phobos-2 mission in 1989. Better-quality ion composition measurement results of atmospheric/ionospheric ion escape from Mars, obtained from ESA Mars Express (MEX) instruments, have improved our understanding of the ion escape mechanism. With the NASA MAVEN spacecraft orbiting Mars since Sept. 2014, dual in-situ measurement with plasma instruments are now

  6. Stabilization Of Apoptotic Cells: Generation Of Zombie Cells

    Directory of Open Access Journals (Sweden)

    José A. Sánchez Alcázar

    2015-08-01

    Stabilization of apoptotic cells can be used for reliable detection and quantification of apoptosis in cultured cells and may allow a safer administration of apoptotic cells in clinical applications. Furthermore, it opens new avenues in the functional reconstruction of apoptotic cells for longer preservation.

  7. Nociception and escape behavior in planarians

    Science.gov (United States)

    Schoetz Collins, Eva-Maria

    2015-03-01

    Planarians are famous and widely studied for their regenerative capabilities. When a moving planarian is cut through the middle, the resulting head and tail pieces instantaneously retract and exhibit a characteristic escape response that differs from normal locomotion. In asexual animals, a similar reaction is observed when the planarian undergoes fission, suggesting that reproduction through self-tearing is a rather traumatic event for the animal. Using a multiscale approach, we unravel the dynamics, mechanics, and functional aspects of the planarian escape response. This musculature-driven gait was found to be a dominating response that supersedes the urge to feed or reproduce and quantitatively differs from other modes of planarian locomotion (gliding, peristalsis). We show that this escape gait constitutes the animal's pain response mediated by TRP like receptors and the neurotransmitter histamine, and that it can be induced through adverse thermal, mechanical, electrical or chemical stimuli. Ultimately, we will examine the neuronal subpopulations involved in mediating escape reflexes in planarians and how they are functionally restored during regeneration, thereby gaining mechanistic insight into the neuronal circuits required for specific behaviors. Supported by BWF CASI and Sloan Foundation.

  8. Pade approximant calculations for neutron escape probability

    International Nuclear Information System (INIS)

    El Wakil, S.A.; Saad, E.A.; Hendi, A.A.

    1984-07-01

    The neutron escape probability from a non-multiplying slab containing internal source is defined in terms of a functional relation for the scattering function for the diffuse reflection problem. The Pade approximant technique is used to get numerical results which compare with exact results. (author)

  9. How do biological systems escape 'chaotic' state?

    Indian Academy of Sciences (India)

    B J Rao

    2018-02-13

    Feb 13, 2018 ... triggering 'escape from homeostasis' (Nijhout et al. 2014) where phenotypes begin to become less stable and eventually turn into fully unstable state, the start of 'chaos' in a system. Therefore, the key to biological designs is to stay close to or within the 'homeostatic plateau' and resist drifting into 'chaos'.

  10. Escape dynamics: a continuous-time approximation

    Czech Academy of Sciences Publication Activity Database

    Kolyuzhnov, Dmitri; Bogomolova, Anna; Slobodyan, S.

    2014-01-01

    Roč. 38, January (2014), s. 161-183 ISSN 0165-1889 R&D Projects: GA ČR(CZ) GBP402/12/G097 Institutional support: PRVOUK-P23 Keywords : constant gain adaptive learning * escape dynamics * recursive least squares Subject RIV: AH - Economics Impact factor: 1.018, year: 2014

  11. Net escapement of Antartic krill in trawls

    DEFF Research Database (Denmark)

    Krafft, B.A.; Krag, Ludvig Ahm; Herrmann, Bent

    This document describes the aims and methodology of a three year project (commenced in 2012) entitled Net Escapement of Antarctic krill in Trawls (NEAT). The study will include a morphology based mathematical modeling (FISHSELECT) of different sex and maturity groups of Antarctic krill (Euphausia...

  12. Escape dynamics: a continuous-time approximation

    Czech Academy of Sciences Publication Activity Database

    Kolyuzhnov, Dmitri; Bogomolova, Anna; Slobodyan, Sergey

    -, č. 285 (2006), s. 1-42 ISSN 1211-3298 Institutional research plan: CEZ:AV0Z70850503 Keywords : escape dynamics * constant gain adaptive learning * large deviations theory Subject RIV: AH - Economics http://www.cerge-ei.cz/pdf/wp/Wp285.pdf

  13. Centrifugally Stimulated Exospheric Ion Escape at Mercury

    Science.gov (United States)

    Delcourt, Dominique; Seki, K.; Terada, N.; Moore, Thomas E.

    2012-01-01

    We investigate the transport of ions in the low-altitude magnetosphere magnetosphere of Mercury. We show that, because of small spatial scales, the centrifugal effect due to curvature of the E B drift paths can lead to significant particle energization in the parallel direction. We demonstrate that because of this effect, ions with initial speed smaller than the escape speed such as those produced via thermal desorption can overcome gravity and escape into the magnetosphere. The escape route of this low-energy exosphere originating material is largely controlled by the magnetospheric convection rate. This escape route spreads over a narrower range of altitudes when the convection rate increases. Bulk transport of low-energy planetary material thus occurs within a limited region of space once moderate magnetospheric convection is established. These results suggest that, via release of material otherwise gravitationally trapped, the E B related centrifugal acceleration is an important mechanism for the net supply of plasma to the magnetosphere of Mercury.

  14. Learning from escaped prescribed fire reviews

    Science.gov (United States)

    Anne E. Black; Dave Thomas; James Saveland; Jennifer D. Ziegler

    2011-01-01

    The U.S. wildland fire community has developed a number of innovative methods for conducting a review following escape of a prescribed fire (expanding on the typical regional or local reviews, to include more of a learning focus - expanded After Action Reviews, reviews that incorporate High Reliability Organizing, Facilitated Learning Analyses, etc). The stated purpose...

  15. Escape driven by α -stable white noises

    Science.gov (United States)

    Dybiec, B.; Gudowska-Nowak, E.; Hänggi, P.

    2007-02-01

    We explore the archetype problem of an escape dynamics occurring in a symmetric double well potential when the Brownian particle is driven by white Lévy noise in a dynamical regime where inertial effects can safely be neglected. The behavior of escaping trajectories from one well to another is investigated by pointing to the special character that underpins the noise-induced discontinuity which is caused by the generalized Brownian paths that jump beyond the barrier location without actually hitting it. This fact implies that the boundary conditions for the mean first passage time (MFPT) are no longer determined by the well-known local boundary conditions that characterize the case with normal diffusion. By numerically implementing properly the set up boundary conditions, we investigate the survival probability and the average escape time as a function of the corresponding Lévy white noise parameters. Depending on the value of the skewness β of the Lévy noise, the escape can either become enhanced or suppressed: a negative asymmetry parameter β typically yields a decrease for the escape rate while the rate itself depicts a non-monotonic behavior as a function of the stability index α that characterizes the jump length distribution of Lévy noise, exhibiting a marked discontinuity at α=1 . We find that the typical factor of 2 that characterizes for normal diffusion the ratio between the MFPT for well-bottom-to-well-bottom and well-bottom-to-barrier-top no longer holds true. For sufficiently high barriers the survival probabilities assume an exponential behavior versus time. Distinct non-exponential deviations occur, however, for low barrier heights.

  16. Life events and escape in conversion disorder.

    Science.gov (United States)

    Nicholson, T R; Aybek, S; Craig, T; Harris, T; Wojcik, W; David, A S; Kanaan, R A

    2016-09-01

    Psychological models of conversion disorder (CD) traditionally assume that psychosocial stressors are identifiable around symptom onset. In the face of limited supportive evidence such models are being challenged. Forty-three motor CD patients, 28 depression patients and 28 healthy controls were assessed using the Life Events and Difficulties Schedule in the year before symptom onset. A novel 'escape' rating for events was developed to test the Freudian theory that physical symptoms of CD could provide escape from stressors, a form of 'secondary gain'. CD patients had significantly more severe life events and 'escape' events than controls. In the month before symptom onset at least one severe event was identified in 56% of CD patients - significantly more than 21% of depression patients [odds ratio (OR) 4.63, 95% confidence interval (CI) 1.56-13.70] and healthy controls (OR 5.81, 95% CI 1.86-18.2). In the same time period 53% of CD patients had at least one 'high escape' event - again significantly higher than 14% in depression patients (OR 6.90, 95% CI 2.05-23.6) and 0% in healthy controls. Previous sexual abuse was more commonly reported in CD than controls, and in one third of female patients was contextually relevant to life events at symptom onset. The majority (88%) of life events of potential aetiological relevance were not identified by routine clinical assessments. Nine per cent of CD patients had no identifiable severe life events. Evidence was found supporting the psychological model of CD, the Freudian notion of escape and the potential aetiological relevance of childhood traumas in some patients. Uncovering stressors of potential aetiological relevance requires thorough psychosocial evaluation.

  17. Plasticity of Escape Responses: Prior Predator Experience Enhances Escape Performance in a Coral Reef Fish.

    Directory of Open Access Journals (Sweden)

    Ryan A Ramasamy

    Full Text Available Teleost and amphibian prey undertake fast-start escape responses during a predatory attack in an attempt to avoid being captured. Although previously viewed as a reflex reaction controlled by the autonomic nervous system, the escape responses of individuals when repeatedly startled are highly variable in their characteristics, suggesting some behavioural mediation of the response. Previous studies have shown that fishes are able to learn from past experiences, but few studies have assessed how past experience with predators affect the fast-start response. Here we determined whether prior experience with the smell or sight of a predator (the Dottyback, Pseudochromis fuscus affected the escape response of juveniles of the Spiny Chromis (Acanthochromis polyacanthus. Results show that individuals exposed to any of the predator cues prior to being startled exhibited a stronger escape response (i.e., reduced latency, increased escape distance, mean response speed, maximum response speed and maximum acceleration when compared with controls. This study demonstrates the plasticity of escape responses and highlights the potential for naïve reef fish to take into account both visual and olfactory threat cues simultaneously to optimise the amplitude of their kinematic responses to perceived risk.

  18. Asymmetric Effects on Escape Rates of Bistable System

    International Nuclear Information System (INIS)

    Wang Canjun; Mei Dongcheng; Dai Zucheng

    2011-01-01

    The asymmetric effects on the escape rates from the stable states x ± in the bistable system are analyzed. The results indicate that the multiplicative noise and the additive noise always enhance the particle escape from stable states x ± of bistable. However, the asymmetric parameter r enhances the particle escape from stable state x + , and holds back the particle escape from stable state x - . (general)

  19. Measurement of the resonance escape probability

    International Nuclear Information System (INIS)

    Anthony, J.P.; Bacher, P.; Lheureux, L.; Moreau, J.; Schmitt, A.P.

    1957-01-01

    The average cadmium ratio in natural uranium rods has been measured, using equal diameter natural uranium disks. These values correlated with independent measurements of the lattice buckling, enabled us to calculate values of the resonance escape probability for the G1 reactor with one or the other of two definitions. Measurements were performed on 26 mm and 32 mm rods, giving the following values for the resonance escape probability p: 0.8976 ± 0.005 and 0.912 ± 0.006 (d. 26 mm), 0.8627 ± 0.009 and 0.884 ± 0.01 (d. 32 mm). The influence of either definition on the lattice parameters is discussed, leading to values of the effective integral. Similar experiments have been performed with thorium rods. (author) [fr

  20. How does ionizing radiation escape from galaxies?

    Science.gov (United States)

    Orlitova, Ivana

    2016-10-01

    Search for sources that reionized the Universe from z 15 to z 6 is one of the main drivers of present-day astronomy. Low-mass star-forming galaxies are the most favoured sources of ionizing photons, but the searches of escaping Lyman continuum (LyC) have not been extremely successful. Our team has recently detected prominent LyC escape from five Green Pea galaxies at redshift 0.3, using the HST/COS spectrograph, which represents a significant breakthrough. We propose here to study the LyC escape of the strongest among these leakers, J1152, with spatial resolution. From the comparison of the ionizing and non-ionizing radiation maps, and surface brightness profiles, we will infer the major mode in which LyC is escaping: from the strongest starburst, from the galaxy edge, through a hole along our line-of-sight, through clumpy medium, or directly from all the production sites due to highly ionized medium in the entire galaxy. In parallel, we will test the predictive power of two highly debated indirect indicators of LyC leakage: the [OIII]5007/[OII]3727 ratio, and Lyman-alpha. We predict that their spatial distribution should closely follow that of the ionizing continuum if column densities of the neutral gas are low. This combined study, which relies on the HST unique capabilities, will bring crucial information on the structure of the leaking galaxies, provide constraints for hydrodynamic simulations, and will lead to efficient future searches for LyC leakers across a large range of redshifts.

  1. Scrunching: a novel escape gait in planarians

    Science.gov (United States)

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J.; Collins, Eva-Maria S.

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, ‘scrunching’, which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration.

  2. Escape probabilities for fluorescent x-rays

    International Nuclear Information System (INIS)

    Dance, D.R.; Day, G.J.

    1985-01-01

    Computation of the energy absorption efficiency of an x-ray photon detector involves consideration of the histories of the secondary particles produced in any initial or secondary interaction which may occur within the detector. In particular, the K or higher shell fluorescent x-rays which may be emitted following a photoelectric interaction can carry away a large fraction of the energy of the incident photon, especially if this energy is just above an absorption edge. The effects of such photons cannot be ignored and a correction term, depending upon the probability that the fluorescent x-rays will escape from the detector, must be applied to the energy absorption efficiency. For detectors such as x-ray intensifying screens, it has been usual to calculate this probability by numerical integration. In this note analytic expressions are derived for the escape probability of fluorescent photons from planar detectors in terms of exponential integral functions. Rational approximations for these functions are readily available and these analytic expressions therefore facilitate the computation of photon absorption efficiencies. A table is presented which should obviate the need for calculating the escape probability for most cases of interest. (author)

  3. Non-apoptotic function of apoptotic proteins in the development of ...

    Indian Academy of Sciences (India)

    Here we show that in the Malpighian tubules expression of apoptotic proteins commences right from embryonic development and continues throughout the larval stages. Overexpression of these proteins in the Malpighian tubules causes larval lethality resulting in malformed tubules. The number and regular organization of.

  4. Non-apoptotic function of apoptotic proteins in the development of ...

    Indian Academy of Sciences (India)

    2011-07-08

    Jul 8, 2011 ... Here we show that in the Malpighian tubules expression of apoptotic proteins commences right from embryonic development and continues throughout the larval stages. Overexpression of these proteins in the Malpighian tubules causes larval lethality resulting in malformed tubules. The number and ...

  5. Galectin-1 and Galectin-3 induce mitochondrial apoptotic pathway in Jurkat cells

    Science.gov (United States)

    Vasil'eva, O. A.; Isaeva, A. V.; Prokhorenko, T. S.; Zima, A. P.; Novitsky, V. V.

    2016-08-01

    Cellular malignant transformation is often accompanied by increased gene expression of low-molecular proteins of lectins family-galectins. But it is unknown how galectins promote tumor growth and malignization. Galectins-1 and galectin-3 are thought to be possible immunoregulators exerting their effects by regulating the balance of CD4+ lymphocytes. In addition it is known that tumor cells overexpressing galectins are capable of escaping immunological control, causing apoptosis of lymphocytes. The aim of the study is to investigate the role of galectin-1 and galectin-3 in the implementation of mitochondrial apoptotic pathway in Jurkat cells. Methods: Jurkat cells were used as a model for the study of T-lymphocytes. Jurkat cells were activated with antibodies to CD3 and CD28 and cultured with recombinant galectin-1 and -3. Apoptosis of Jurkat cells and depolarization of the mitochondrial membrane were assessed by flow cytometry. It was found that galectin-1 and galectin-3 have a dose-dependent pro-apoptotic effect on Jurkat cells in vitro and enlarge the number of cells with decreased mitochondrial membrane potential compared with intact cells.

  6. The Post-Apoptotic Fate of RNAs Identified Through High-Throughput Sequencing of Human Hair

    Science.gov (United States)

    Lefkowitz, Gloria K.; Mukhopadhyay, Anandaroop; Cowing-Zitron, Christopher; Yu, Benjamin D.

    2011-01-01

    The hair of all mammals consists of terminally differentiated cells that undergo a specialized form of apoptosis called cornification. While DNA is destroyed during cornification, the extent to which RNA is lost is unknown. Here we find that multiple types of RNA are incompletely degraded after hair shaft formation in both mouse and human. Notably, mRNAs and short regulatory microRNAs (miRNAs) are stable in the hair as far as 10 cm from the scalp. To better characterize the post-apoptotic RNAs that escape degradation in the hair, we performed sequencing (RNA-seq) on RNA isolated from hair shafts pooled from several individuals. This hair shaft RNA library, which encompasses different hair types, genders, and populations, revealed 7,193 mRNAs, 449 miRNAs and thousands of unannotated transcripts that remain in the post-apoptotic hair. A comparison of the hair shaft RNA library to that of viable keratinocytes revealed surprisingly similar patterns of gene coverage and indicates that degradation of RNA is highly inefficient during apoptosis of hair lineages. The generation of a hair shaft RNA library could be used as months of accumulated transcriptional history useful for retrospective detection of disease, drug response and environmental exposure. PMID:22110684

  7. The cost of the sword: escape performance in male swordtails.

    Directory of Open Access Journals (Sweden)

    Alex Baumgartner

    2011-01-01

    Full Text Available The handicap theory of sexual selection posits that male display traits that are favored in mate choice come at a significant cost to performance. We tested one facet of this hypothesis in the green swordtail (Xiphophorus helleri. In this species, the lower ray of male caudal fin is extended into a 'sword', which serves to attract potential mates. However, bearing a long sword may increase drag and thus compromise a male's ability to swim effectively. We tested escape performance in this species by eliciting C-start escape responses, an instinctive escape behavior, in males with various sword lengths. We then removed males' swords and retested escape performance. We found no relationship between escape performance and sword length and no effect of sword removal on escape performance. While having a large sword may attract a predator's attention, our results suggest that sword size does not compromise a male's escape performance.

  8. Enzyme Informatics

    Science.gov (United States)

    Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika

    2012-01-01

    Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471

  9. Strange culinary encounters::stranger fetichism in "Jamie's Italian escape" and "Gordon's great escape"

    OpenAIRE

    Leer, Jonatan; Kjær, Katrine Meldgaard

    2015-01-01

    In this article, we examine the ways in which the encountering of 'other' food cultures is played out in the two travelogue cooking shows Gordon's Great Escape and Jamie's Italian Escape. We investigate how the two protagonist chefs Jamie Oliver and Gordon Ramsay imagine, meet and evaluate the ‘other’ food cultures in these programs, paying special attention to how the encounter with the local Indian and Italian is imagined to be a gateway to an authentic and/or primitive experience. Our main...

  10. Room escape at class: Escape games activities to facilitate the motivation and learning in computer science

    Directory of Open Access Journals (Sweden)

    Carlos Borrego

    2017-06-01

    Full Text Available Real-life room-escape games are ludic activities in which participants enter a room in order to get out of it only after solving some riddles. In this paper, we explain a Room Escape teaching experience developed in the Engineering School at Universitat Autònoma de Barcelona. The goal of this activity is to increase student’s motivation and to improve their learning on two courses of the second year in the Computer Engineering degree: Computer Networksand Information and Security.

  11. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    Directory of Open Access Journals (Sweden)

    Nakamura Shinichiro

    2011-01-01

    Full Text Available Abstract Background Runt-related transcription factor 3 (RUNX3 is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC. Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91% and tissues (90%. RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis.

  12. Arduino adventures escape from Gemini station

    CERN Document Server

    Kelly, James Floyd

    2013-01-01

    Arduino Adventures: Escape from Gemini Station provides a fun introduction to the Arduino microcontroller by putting you (the reader) into the action of a science fiction adventure story.  You'll find yourself following along as Cade and Elle explore Gemini Station-an orbiting museum dedicated to preserving and sharing technology throughout the centuries. Trouble ensues. The station is evacuated, including Cade and Elle's class that was visiting the station on a field trip. Cade and Elle don't make it aboard their shuttle and are trapped on the station along with a friendly artificial intellig

  13. Suicide as escape from psychotic panic.

    Science.gov (United States)

    Goldblatt, Mark J; Ronningstam, Elsa; Schechter, Mark; Herbstman, Benjamin; Maltsberger, John T

    2016-01-01

    Suicides of patients in states of acute persecutory panic may be provoked by a subjective experience of helpless terror threatening imminent annihilation or dismemberment. These patients are literally scared to death and try to run away. They imagine suicide is survivable and desperately attempt to escape from imaginary enemies. These states of terror occur in a wide range of psychotic illnesses and are often associated with command hallucinations and delusions. In this article, the authors consider the subjective experience of persecutory panic and the suicide response as an attempt to flee from danger.

  14. The regulation of apoptotic cell death

    Directory of Open Access Journals (Sweden)

    Amarante-Mendes G.P.

    1999-01-01

    Full Text Available Apoptosis is a fundamental biological phenomenon in which the death of a cell is genetically and biochemically regulated. Different molecules are involved in the regulation of the apoptotic process. Death receptors, coupled to distinct members of the caspases as well as other adapter molecules, are involved in the initiation of the stress signals (The Indictment. Members of the Bcl-2 family control at the mitochondrial level the decision between life and death (The Judgement. The effector caspases are responsible for all morphological and biochemical changes related to apoptosis including the "eat-me" signals perceived by phagocytes and neighboring cells (The Execution. Finally, apoptosis would have little biological significance without the recognition and removal of the dying cells (The Burial.

  15. The regulation of apoptotic cell death

    Directory of Open Access Journals (Sweden)

    G.P. Amarante-Mendes

    1999-09-01

    Full Text Available Apoptosis is a fundamental biological phenomenon in which the death of a cell is genetically and biochemically regulated. Different molecules are involved in the regulation of the apoptotic process. Death receptors, coupled to distinct members of the caspases as well as other adapter molecules, are involved in the initiation of the stress signals (The Indictment. Members of the Bcl-2 family control at the mitochondrial level the decision between life and death (The Judgement. The effector caspases are responsible for all morphological and biochemical changes related to apoptosis including the "eat-me" signals perceived by phagocytes and neighboring cells (The Execution. Finally, apoptosis would have little biological significance without the recognition and removal of the dying cells (The Burial.

  16. Molecular Dications in Planetary Atmospheric Escape

    Directory of Open Access Journals (Sweden)

    Stefano Falcinelli

    2016-08-01

    Full Text Available Fundamental properties of multiply charged molecular ions, such as energetics, structure, stability, lifetime and fragmentation dynamics, are relevant to understand and model the behavior of gaseous plasmas as well as ionosphere and astrophysical environments. Experimental determinations of the Kinetic Energy Released (KER for ions originating from dissociations reactions, induced by Coulomb explosion of doubly charged molecular ions (molecular dications produced by double photoionization of CO2, N2O and C2H2 molecules of interest in planetary atmospheres, are reported. The KER measurement as a function of the ultraviolet (UV photon energy in the range of 28–65 eV was extracted from the electron-ion-ion coincidence spectra obtained by using tunable synchrotron radiation coupled with ion imaging techniques at the ELETTRA Synchrotron Light Laboratory Trieste, Italy. These experiments, coupled with a computational analysis based on a Monte Carlo trajectory simulation, allow assessing the probability of escape for simple ionic species in the upper atmosphere of Mars, Venus and Titan. The measured KER in the case of H+, C+, CH+, CH2+, N+, O+, CO+, N2+ and NO+ fragment ions range between 1.0 and 5.5 eV, being large enough to allow these ionic species to participate in the atmospheric escape from such planets into space. In the case of Mars, we suggest a possible explanation for the observed behavior of the O+ and CO22+ ion density profiles.

  17. The escape problem for mortal walkers

    Science.gov (United States)

    Grebenkov, D. S.; Rupprecht, J.-F.

    2017-02-01

    We introduce and investigate the escape problem for random walkers that may eventually die, decay, bleach, or lose activity during their diffusion towards an escape or reactive region on the boundary of a confining domain. In the case of a first-order kinetics (i.e., exponentially distributed lifetimes), we study the effect of the associated death rate onto the survival probability, the exit probability, and the mean first passage time. We derive the upper and lower bounds and some approximations for these quantities. We reveal three asymptotic regimes of small, intermediate, and large death rates. General estimates and asymptotics are compared to several explicit solutions for simple domains and to numerical simulations. These results allow one to account for stochastic photobleaching of fluorescent tracers in bio-imaging, degradation of mRNA molecules in genetic translation mechanisms, or high mortality rates of spermatozoa in the fertilization process. Our findings provide a mathematical ground for optimizing storage containers and materials to reduce the risk of leakage of dangerous chemicals or nuclear wastes.

  18. Pavlovian Control of Escape and Avoidance.

    Science.gov (United States)

    Millner, Alexander J; Gershman, Samuel J; Nock, Matthew K; den Ouden, Hanneke E M

    2017-12-15

    To survive in complex environments, animals need to have mechanisms to select effective actions quickly, with minimal computational costs. As perhaps the computationally most parsimonious of these systems, Pavlovian control accomplishes this by hardwiring specific stereotyped responses to certain classes of stimuli. It is well documented that appetitive cues initiate a Pavlovian bias toward vigorous approach; however, Pavlovian responses to aversive stimuli are less well understood. Gaining a deeper understanding of aversive Pavlovian responses, such as active avoidance, is important given the critical role these behaviors play in several psychiatric conditions. The goal of the current study was to establish a behavioral and computational framework to examine aversive Pavlovian responses (activation vs. inhibition) depending on the proximity of an aversive state (escape vs. avoidance). We introduce a novel task in which participants are exposed to primary aversive (noise) stimuli and characterized behavior using a novel generative computational model. This model combines reinforcement learning and drift-diffusion models so as to capture effects of invigoration/inhibition in both explicit choice behavior as well as changes in RT. Choice and RT results both suggest that escape is associated with a bias for vigorous action, whereas avoidance is associated with behavioral inhibition. These results lay a foundation for future work seeking insights into typical and atypical aversive Pavlovian responses involved in psychiatric disorders, allowing us to quantify both implicit and explicit indices of vigorous choice behavior in the context of aversion.

  19. UNESCO TO BLAME: Reality or Easy Escape?

    Directory of Open Access Journals (Sweden)

    Anna Pereira Roders

    2015-03-01

    Full Text Available “UNESCO to blame” is a trend often observed in scholarly works. In those studies UNESCO is accused to privilege Eurocentric standards on heritage conservation. Is this reality or an easy escape? Can this trend be noted in other UNESCO reference texts? This article seeks to answer this question by studying the two main inscription-based conventions and their contribution to heritage management, while performing a data analysis on the countries behind these conventions, and their roles over time. The 1972 World Heritage Convention and the 2003 Convention for the Safeguarding of the Intangible Cultural Heritage are, therefore, taken as case studies. Based on the results, this paper elaborates on a critical analysis, distinguishing what UNESCO, as well as, Europe can eventually be blamed for and what may be used by the countries as an easy escape. This paper ends setting a research agenda to raise awareness and generate factual knowledge on the role of supranational governance in setting standards in global ethics, in particular, to guideline heritage conservation.

  20. Factors affecting escape distance in birds

    Directory of Open Access Journals (Sweden)

    Augusto J. Piratelli

    2015-12-01

    Full Text Available ABSTRACT The flight initiation distance has been used either to understand the cost-benefit trade-offs related to the risk of predation or as an important tool for wildlife managers. Although this variable is well-discussed for temperate regions, it is still poorly known in the Neotropics. Here we analyze the escape behavior of birds from southeastern Brazil, comparing an urban to a non-urban area. We tested for the influence of sites (urban vs. non-urban area, approaching (by one vs. two people, daytime (morning vs. afternoon, seasons (breeding vs. non-breeding and body mass on the determination of the initial (FID and final (FFD flight distances across different bird species. We predict that FID will be greater in rural areas and under a greater threat (higher number of predators approaching in the afternoon and in the non-breeding season. We also expect a direct relationship between body mass and FID and between FID and FFD. We sampled 11 species after measuring 331 escape behaviors, and we confirmed our predictions for sites (five species, daytime (one species and rejected our premise about seasons for one species. Mean FID was strongly affected by body mass, and directly affected FFD. Adjustments in FID are, most likely, an important adaptive trait in urban habitats and may partially explain the predominance of species with higher ecological plasticity in cities.

  1. Escape from viscosity : the kinematics and hydrodynamics of copepod foraging and escape swimming

    NARCIS (Netherlands)

    van Duren, LA; Videler, JJ

    Feeding and escape swimming in adult females of the calanoid copepod. Temora lopgicornis Muller were investigated and compared. Swimming velocities were calculated using a 3-D filming setup., Foraging velocities ranged between 2 and 6 min s(-1), while maximum velocities of up to 80 mm s(-1) were

  2. Enzyme assays.

    Science.gov (United States)

    Brodelius, P E

    1991-02-01

    The past year or so has seen the development of new enzyme assays, as well as the improvement of existing ones. Assays are becoming more rapid and sensitive as a result of modifications such as amplification of the enzyme product(s). Recombinant DNA technology is now being recognized as a particularly useful tool in the search for improved assay systems.

  3. Some Possible Cases of Escape Mimicry in Neotropical Butterflies.

    Science.gov (United States)

    Pinheiro, C E G; Freitas, A V L

    2014-10-01

    The possibility that escape or evasive mimicry evolved in butterflies and other prey insects in a similar fashion to classical Batesian and Müllerian mimicry has long been advanced in the literature. However, there is a general disagreement among lepidopterists and evolutionary biologists on whether or not escape mimicry exists, as well as in which mimicry rings this form of mimicry has evolved. Here, we review some purported cases of escape mimicry in Neotropical butterflies and suggest new mimicry rings involving several species of Archaeoprepona, Prepona, and Doxocopa (the "bright blue bands" ring) and species of Colobura and Hypna (the "creamy bands" ring) where the palatability of butterflies, their ability to escape predator attacks, geographic distribution, relative abundance, and co-occurrence in the same habitats strongly suggest that escape mimicry is involved. In addition, we also indicate other butterfly taxa whose similarities of coloration patterns could be due to escape mimicry and would constitute important case studies for future investigation.

  4. Effect of Orbital Distance on the Atmospheric Escape of Exoplanets

    Science.gov (United States)

    Mo, Yang; Jian-heng, Guo

    2018-01-01

    Atmospheric escape is an important sector in the evolution of planetary atmosphere, and its energy is mainly originated from the radiation of the host star at the high energy band. The radiation flux drops dramatically with the increase of orbital distance, there is a large difference of planetary atmospheric escape in different orbits, so it is necessary to study the impact of orbital distance on the atmospheric escape of an exoplanet. We consider the radiation transfer and the photochemical reactions of multiple kinds of particles to study the variation of planetary atmospheric escape with the orbital distance by using a 1-D hydrodynamic model. Due to the large differences of the spectra of host stars in different evolution stages, the Astrophysical Plasma Emission Code (APEC) in the X-Ray Spectral Fitting Package (XSPEC) is used to obtain the spectra of solar-type stars with different ages as the input spectra of the model. The results indicate that the escape rates of the exoplanets in different orbits are different significantly, and the escape mechanism is converted from the drastic hydrodynamic escape into the moderate Jeans escape as the orbital distance increases, the smaller the planetary gravitational potential, the younger the star-planet system, the larger the distance of this conversion. The correlation between the escape rate and the radiation flux decreases for the short-period exoplanets in a younger star-planet system. It is shown that the classical energy-limited escape theory is not suitable for this kind of exoplanets. These results have enriched the studies on the atmospheric escape of exoplanets, especially, extended the studies on the escape mechanism and energy conversion under different orbital distances and stellar ages.

  5. Escape response of planktonic protists to fluid mechanical signals

    DEFF Research Database (Denmark)

    Jakobsen, Hans Henrik

    2001-01-01

    The escape response to fluid mechanical signals was examined in 6 protists, 4 ciliates and 2 dinoflagellates. When exposed to a siphon flow. 3 species of ciliates, Balanion comatum, Strobilidium sp., and Mesodinium pulex, responded with escape jumps. The threshold deformation rates required...... to elicit an escape ranged between 1.8 and 3 s(-1). Escape speeds varied between 100 to 150 body length s(-1). Jump directions were non- random in all jumping species and had a negative geotactic component. In a grazing experiment with copepods, the predation mortality of a jumping ciliate was about 15...

  6. Escape of Black Holes from the Brane

    International Nuclear Information System (INIS)

    Flachi, Antonino; Tanaka, Takahiro

    2005-01-01

    TeV-scale gravity theories allow the possibility of producing small black holes at energies that soon will be explored at the CERN LHC or at the Auger observatory. One of the expected signatures is the detection of Hawking radiation that might eventually terminate if the black hole, once perturbed, leaves the brane. Here, we study how the 'black hole plus brane' system evolves once the black hole is given an initial velocity that mimics, for instance, the recoil due to the emission of a graviton. The results of our dynamical analysis show that the brane bends around the black hole, suggesting that the black hole eventually escapes into the extra dimensions once two portions of the brane come in contact and reconnect. This gives a dynamical mechanism for the creation of baby branes

  7. The fastest saccadic responses escape visual masking

    DEFF Research Database (Denmark)

    Crouzet, Sébastien M.; Overgaard, Morten; Busch, Niko A.

    2014-01-01

    visual processing while the initial feedforward processing is thought to be left intact. We tested a prediction derived from this hypothesis: the fastest responses, being triggered before the beginning of reentrant processing, should escape the OSM interference. In a saccadic choice reaction time task......, which gives access to very early stages of visual processing, target visibility was reduced either by OSM, conventional backward masking, or low stimulus contrast. A general reduction of performance was observed in all three conditions. However, the fastest saccades did not show any sign of interference...... under either OSM or backward masking, as they did under the low-contrast condition. This finding supports the hypothesis that masking interferes mostly with reentrant processing at later stages, while leaving early feedforward processing largely intact....

  8. Targeting multiple pro-apoptotic signaling pathways with curcumin in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Mariela Rivera

    Full Text Available Curcumin, an extract from the turmeric rhizome (Curcuma longa, is known to exhibit anti-inflammatory, antioxidant, chemopreventive and antitumoral activities against aggressive and recurrent cancers. Accumulative data indicate that curcumin may induce cancer cell death. However, the detailed mechanism underlying its pro-apoptotic and anti-cancer effects remains to be elucidated. In the present study, we examined the signaling pathways triggered by curcumin, specifically, the exact molecular mechanisms of curcumin-induced apoptosis in highly metastatic human prostate cancer cells. The effect of curcumin was evaluated using for the first time in prostate cancer, a gel-free shotgun quantitative proteomic analysis coupled with Tandem Mass Tag isobaric labeling-based-signaling networks. Results were confirmed at the gene expression level by qRT-PCR and at the protein expression level by western blot and flow cytometry. Our findings revealed that curcumin induced an Endoplasmic Reticulum stress-mediated apoptosis in PC3. The mechanisms by which curcumin promoted cell death in these cells were associated with cell cycle arrest, increased reactive oxygen species, autophagy and the Unfolded Protein Response. Furthermore, the upregulation of ER stress was measured using key indicators of ER stress: Glucose-Regulated Protein 78, Inositol-Requiring Enzyme 1 alpha, Protein Disulfide isomerase and Calreticulin. Chronic ER stress induction was concomitant with the upregulation of pro-apoptotic markers (caspases 3,9,12 and Poly (ADP-ribose polymerase. The downregulated proteins include anti-apoptotic and anti-tumor markers, supporting their curcumin-induced pro-apoptotic role in prostate cancer cells. Taken together, these data suggest that curcumin may serve as a promising anticancer agent by inducing a chronic ER stress mediated cell death and activation of cell cycle arrest, UPR, autophagy and oxidative stress responses.

  9. Targeting multiple pro-apoptotic signaling pathways with curcumin in prostate cancer cells

    Science.gov (United States)

    Rivera, Mariela; Ramos, Yanilda; Rodríguez-Valentín, Madeline; López-Acevedo, Sheila; Cubano, Luis A.; Zou, Jin; Zhang, Qiang; Wang, Guangdi

    2017-01-01

    Curcumin, an extract from the turmeric rhizome (Curcuma longa), is known to exhibit anti-inflammatory, antioxidant, chemopreventive and antitumoral activities against aggressive and recurrent cancers. Accumulative data indicate that curcumin may induce cancer cell death. However, the detailed mechanism underlying its pro-apoptotic and anti-cancer effects remains to be elucidated. In the present study, we examined the signaling pathways triggered by curcumin, specifically, the exact molecular mechanisms of curcumin-induced apoptosis in highly metastatic human prostate cancer cells. The effect of curcumin was evaluated using for the first time in prostate cancer, a gel-free shotgun quantitative proteomic analysis coupled with Tandem Mass Tag isobaric labeling-based-signaling networks. Results were confirmed at the gene expression level by qRT-PCR and at the protein expression level by western blot and flow cytometry. Our findings revealed that curcumin induced an Endoplasmic Reticulum stress-mediated apoptosis in PC3. The mechanisms by which curcumin promoted cell death in these cells were associated with cell cycle arrest, increased reactive oxygen species, autophagy and the Unfolded Protein Response. Furthermore, the upregulation of ER stress was measured using key indicators of ER stress: Glucose-Regulated Protein 78, Inositol-Requiring Enzyme 1 alpha, Protein Disulfide isomerase and Calreticulin. Chronic ER stress induction was concomitant with the upregulation of pro-apoptotic markers (caspases 3,9,12) and Poly (ADP-ribose) polymerase. The downregulated proteins include anti-apoptotic and anti-tumor markers, supporting their curcumin-induced pro-apoptotic role in prostate cancer cells. Taken together, these data suggest that curcumin may serve as a promising anticancer agent by inducing a chronic ER stress mediated cell death and activation of cell cycle arrest, UPR, autophagy and oxidative stress responses. PMID:28628644

  10. Escape Burrowing of Modern Freshwater Bivalves as a Paradigm for Escape Behavior in the Devonian Bivalve Archanodon catskillensis

    Directory of Open Access Journals (Sweden)

    Katja Knoll

    2017-10-01

    Full Text Available Many freshwater bivalves restore themselves to the sediment water interface after burial by upward escape burrowing. We studied the escape burrowing capacity of two modern unionoids, Elliptio complanata and Pyganodon cataracta and the invasive freshwater venerid Corbicula fluminea, in a controlled laboratory setting varying sediment grain size and burial depth. We found that the relatively streamlined E. complanata is a better escape burrower than the more obese P. cataracta. E. complanata is more likely to escape burial in both fine and coarse sand, and at faster rates than P. cataracta. However, successful escape from 10 cm burial, especially in fine sand, is unlikely for both unionoids. The comparatively small and obese C. fluminea outperforms both unionoids in terms of escape probability and escape time, especially when body size is taken into consideration. C. fluminea can escape burial depths many times its own size, while the two unionoids rarely escape from burial equivalent to the length of their shells. E. complanata, and particularly P. cataracta, are morphological paradigms for the extinct Devonian unionoid bivalve Archanodon catskillensis, common in riverine facies of the Devonian Catskill Delta Complex of the eastern United States. Our observations suggest that the escape burrowing capability of A. catskillensis was no better than that of P. cataracta. Archanodon catskillensis was likely unable to escape burial of more than a few centimeters of anastrophically deposited sediment. The long (up to 1 meter, vertical burrows that are associated with A. catskillensis, and interpreted to be its escape burrows, represent a response to episodic, small-scale sedimentation events due to patterns of repetitive hydrologic or weather-related phenomena. They are not a response to a single anastrophic event involving the influx of massive volumes of sediment.

  11. Managing Pacific salmon escapements: The gaps between theory and reality

    Science.gov (United States)

    Knudsen, E. Eric; Knudsen, E. Eric; Steward, Cleveland R.; MacDonald, Donald D.; Williams, Jack E.; Reiser, Dudley W.

    1999-01-01

    There are myriad challenges to estimating intrinsic production capacity for Pacific salmon populations that are heavily exploited and/or suffering from habitat alteration. Likewise, it is difficult to determine whether perceived decreases in production are due to harvest, habitat, or hatchery influences, natural variation, or some combination of all four. There are dramatic gaps between the true nature of the salmon spawner/recruit relationship and the theoretical basis for describing and understanding the relationship. Importantly, there are also extensive practical difficulties associated with gathering and interpreting accurate escapement and run-size information and applying it to population management. Paradoxically, certain aspects of salmon management may well be contributing to losses in abundance and biodiversity, including harvesting salmon in mixed population fisheries, grouping populations into management units subject to a common harvest rate, and fully exploiting all available hatchery fish at the expense of wild fish escapements. Information on U.S. Pacific salmon escapement goal-setting methods, escapement data collection methods and estimation types, and the degree to which stocks are subjected to mixed stock fisheries was summarized and categorized for 1,025 known management units consisting of 9,430 known populations. Using criteria developed in this study, only 1% of U.S. escapement goals are by methods rated as excellent. Escapement goals for 16% of management units were rated as good. Over 60% of escapement goals have been set by methods rated as either fair or poor and 22% of management units have no escapement goals at all. Of the 9,430 populations for which any information was available, 6,614 (70%) had sufficient information to categorize the method by which escapement data are collected. Of those, data collection methods were rated as excellent for 1%, good for 1%, fair for 2%, and poor for 52%. Escapement estimates are not made for 44

  12. Thiamine deficiency activates hypoxia inducible factor-1α to facilitate pro-apoptotic responses in mouse primary astrocytes.

    Directory of Open Access Journals (Sweden)

    Kristy Zera

    Full Text Available Thiamine is an essential enzyme cofactor required for proper metabolic function and maintenance of metabolism and energy production in the brain. In developed countries, thiamine deficiency (TD is most often manifested following chronic alcohol consumption leading to impaired mitochondrial function, oxidative stress, inflammation and excitotoxicity. These biochemical lesions result in apoptotic cell death in both neurons and astrocytes. Comparable histological injuries in patients with hypoxia/ischemia and TD have been described in the thalamus and mammillary bodies, suggesting a congruency between the cellular responses to these stresses. Consistent with hypoxia/ischemia, TD stabilizes and activates Hypoxia Inducible Factor-1α (HIF-1α under physiological oxygen levels. However, the role of TD-induced HIF-1α in neurological injury is currently unknown. Using Western blot analysis and RT-PCR, we have demonstrated that TD induces HIF-1α expression and activity in primary mouse astrocytes. We observed a time-dependent increase in mRNA and protein expression of the pro-apoptotic and pro-inflammatory HIF-1α target genes MCP1, BNIP3, Nix and Noxa during TD. We also observed apoptotic cell death in TD as demonstrated by PI/Annexin V staining, TUNEL assay, and Cell Death ELISA. Pharmacological inhibition of HIF-1α activity using YC1 and thiamine repletion both reduced expression of pro-apoptotic HIF-1α target genes and apoptotic cell death in TD. These results demonstrate that induction of HIF-1α mediated transcriptional up-regulation of pro-apoptotic/inflammatory signaling contributes to astrocyte cell death during thiamine deficiency.

  13. Buying to blunt negative feelings : Materialistic escape from the self

    NARCIS (Netherlands)

    Donnelly, Grant E.; Ksendzova, Masha; Howell, Ryan T.; Vohs, Kathleen D.; Baumeister, Roy F.

    2016-01-01

    We propose that escape theory, which describes how individuals seek to free themselves from aversive states of self-awareness, helps explain key patterns of materialistic people's behavior. As predicted by escape theory, materialistic individuals may feel dissatisfied with their standard of living,

  14. Escape of protists in predator-generated feeding currents

    DEFF Research Database (Denmark)

    Jakobsen, Hans Henrik

    2002-01-01

    The ciliate Strobilidium sp. and 2 flagellates, Chrysochromulina simplex and Gymnodinium sp., were exposed to predator-generated feeding currents, and their escape responses were quantified using 2- and 3-dimensional video techniques. All 3 studied organisms responded by escaping at a defined...

  15. 30 CFR 75.382 - Mechanical escape facilities.

    Science.gov (United States)

    2010-07-01

    ... with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape facilities, including automatic elevators, shall be examined weekly. The weekly examination of this equipment... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities consistent...

  16. Escape rate scaling in infinite measure preserving systems

    International Nuclear Information System (INIS)

    Munday, Sara; Knight, Georgie

    2016-01-01

    We investigate the scaling of the escape rate from piecewise linear dynamical systems displaying intermittency due to the presence of an indifferent fixed point. Strong intermittent behaviour in the dynamics can result in the system preserving an infinite measure. We define a neighbourhood of the indifferent fixed point to be a hole through which points escape and investigate the scaling of the rate of this escape as the length of the hole decreases, both in the finite measure preserving case and infinite measure preserving case. In the infinite measure preserving systems we observe logarithmic corrections to and polynomial scaling of the escape rate with hole length. Finally we conjecture a relationship between the wandering rate and the observed scaling of the escape rate. (paper)

  17. Entrapment and escape of liquid lubricant in metal forming

    DEFF Research Database (Denmark)

    Bech, Jakob Ilsted; Bay, Niels; Eriksen, Morten

    1999-01-01

    Using a transparent tool entrapment, compression and eventual escape of liquid lubricant in surface pockets is observed in plane strip drawing. The two mechanisms of lubricant escape. Micro Plasto HydroDynamic and Hydrostatic Lubrication (MPHDL and MPHSL), are observed and quantified experimentally...... with Varying viscosity, speed, reduction, workpiece material, back tension and friction. The mechanisms are influenced by all these parameters in an explicable way. Theoretical models of the escape mechanisms are established combining continuum mechanic analyses of the die pressure distribution with a fluid...... mechanic analysis of the lubricant escape. Oscillations in the drawing force are caused by the local escape of lubricant. (C) 1999 Elsevier Science S.A. All rights reserved....

  18. Escape route simulator utilizing augmented reality

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Karen Salazar Ribeiro de; Mó, Antônio Carlos de A.; Santo, André Cotelli do E.; Silva, Marcio Henrique, E-mail: karensalazar.1190@gmail.com [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Centro Universitário Carioca (UniCarioca), Rio de Janeiro, RJ (Brazil)

    2017-07-01

    Due to increasing demand and interest in the interaction of technology platforms and integration of different types of systems and technologies, some tools are already providing practical ways to develop integrated applications. The tools explored by this article are Unity, a platform for game development, and Vuforia, an SDK, software development kit, for augmented reality creation. The coalition proposal of these resources is to create an intuitive escape route that can be used for the evacuation of buildings or open spaces in view of imminent danger, such as radiation leakage, and that can be accessed from a target available at the institution. It has also the intention of simulating situations that involve training of personnel in order to obtain methods that allow to save financial resources, and even to avoid that those who are involved are exposed to risks unnecessarily. The simulator is expected to help design, test, and improve ways to maintain the physical integrity of the facility and provide end users with a better sense of immersion and attractiveness. (author)

  19. Immune escape strategies of malaria parasites

    Directory of Open Access Journals (Sweden)

    Pollyanna Stephanie Gomes

    2016-10-01

    Full Text Available Malaria is one of the most life-threatening infectious diseases worldwide. Immunity to malaria is slow and short-lived despite the repeated parasite exposure in endemic areas. Malaria parasites have evolved refined machinery to evade the immune system based on a range of genetic changes that include allelic variation, biomolecular exposure of proteins and intracellular replication. All of these features increase the probability of survival in both mosquitoes and the vertebrate host. Plasmodium species escape from the first immunological trap in its invertebrate vector host, the Anopheles mosquitoes. The parasites have to pass through various immunological barriers within the mosquito such as anti-microbial molecules and the mosquito microbiota in order to achieve successful transmission to the vertebrate host. Within these hosts, Plasmodium species employ various immune evasion strategies during different life cycle stages. Parasite persistence against the vertebrate immune response depends on the balance among virulence factors, pathology, metabolic cost of the host immune response, and the parasites ability to evade the immune response. In this review we discuss the strategies that Plasmodium parasites use to avoid the vertebrate host immune system and how they promote successful infection and transmission.

  20. Escaping the resource curse in China.

    Science.gov (United States)

    Cao, Shixiong; Li, Shurong; Ma, Hua; Sun, Yutong

    2015-02-01

    Many societies face an income gap between rich regions with access to advanced technology and regions that are rich in natural resources but poorer in technology. This "resource curse" can lead to a Kuznets trap, in which economic inequalities between the rich and the poor increase during the process of socioeconomic development. This can also lead to depletion of natural resources, environmental degradation, social instability, and declining socioeconomic development. These problems will jeopardize China's achievements if the current path continues to be pursued without intervention by the government to solve the problems. To mitigate the socioeconomic development gap between western and eastern China, the government implemented its Western Development Program in 2000. However, recent data suggest that this program has instead worsened the resource curse. Because each region has its own unique strengths and weaknesses, China must escape the resource curse by accounting for this difference; in western China, this can be done by improving education, promoting high-tech industry, adjusting its economic strategy to balance regional development, and seeking more sustainable approaches to socioeconomic development.

  1. Escape route simulator utilizing augmented reality

    International Nuclear Information System (INIS)

    Mattos, Karen Salazar Ribeiro de; Mó, Antônio Carlos de A.; Santo, André Cotelli do E.; Silva, Marcio Henrique

    2017-01-01

    Due to increasing demand and interest in the interaction of technology platforms and integration of different types of systems and technologies, some tools are already providing practical ways to develop integrated applications. The tools explored by this article are Unity, a platform for game development, and Vuforia, an SDK, software development kit, for augmented reality creation. The coalition proposal of these resources is to create an intuitive escape route that can be used for the evacuation of buildings or open spaces in view of imminent danger, such as radiation leakage, and that can be accessed from a target available at the institution. It has also the intention of simulating situations that involve training of personnel in order to obtain methods that allow to save financial resources, and even to avoid that those who are involved are exposed to risks unnecessarily. The simulator is expected to help design, test, and improve ways to maintain the physical integrity of the facility and provide end users with a better sense of immersion and attractiveness. (author)

  2. Cytostatic and apoptotic effects of paclitaxel in human ovarian tumors.

    Science.gov (United States)

    Millenbaugh, N J; Gan, Y; Au, J L

    1998-01-01

    The present study evaluated the cytostatic and apoptotic effects of a 24-hr paclitaxel treatment in ovarian tumors. Three-dimensional histocultures of surgical specimens from patients (n = 17) were used. The cytostatic effect was measured by inhibition of 96-hr cumulative DNA precursor incorporation and induction of apoptosis was determined by morphological changes. Paclitaxel produced partial inhibition of DNA precursor incorporation in about 40% of tumors (maximum inhibition of approximately 30%) and induced apoptosis in about 90% of tumors (maximum apoptotic index of approximately 15%). In responsive tumors, maximum cytostatic and apoptotic effects were achieved at < or = 1 microM with no further enhancement by increasing the drug concentration to 10 microM. In individual tumors, the apoptotic effect inversely correlated with cytostatic effect (r2 = 0.27, p = 0.031), and the maximal apoptotic index correlated with the LI for the untreated controls (r2 = 0.38, p < 0.01). More than 95% of apoptotic cells after paclitaxel treatment were labeled with DNA precursor. The incomplete cytostatic and apoptotic effects of paclitaxel and the link between DNA synthesis and apoptosis in ovarian tumors are similar to our previous findings in other human solid tumors. These findings suggest that (a) apoptosis is the major paclitaxel effect in advanced ovarian tumors, (b) tumor sensitivity to drug-induced cytostatic effect is opposite to sensitivity to apoptotic effect, (c) paclitaxel-induced apoptosis increases with increased cell proliferation and is completed after DNA synthesis, and (d) further increasing the dose to elevate plasma concentration beyond 1 microM may not improve treatment outcome.

  3. Enzyme immunoassay

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, B; Dinesen, B; Deckert, M

    1985-01-01

    An enzyme linked immunoadsorbent assay for urinary albumin using commercially available reagents is described. The assay range is 2.5-120 micrograms/l. When samples are analysed in two standard dilutions, the assayable albumin concentration range is 2.5-240 mg/l, covering the clinical range from...

  4. Harnessing Apoptotic Cell Clearance to Treat Autoimmune Arthritis

    Directory of Open Access Journals (Sweden)

    Philippe Saas

    2017-10-01

    Full Text Available Early-stage apoptotic cells possess immunomodulatory properties. Proper apoptotic cell clearance during homeostasis has been shown to limit subsequent immune responses. Based on these observations, early-stage apoptotic cell infusion has been used to prevent unwanted inflammatory responses in different experimental models of autoimmune diseases or transplantation. Moreover, this approach has been shown to be feasible without any toxicity in patients undergoing allogeneic hematopoietic cell transplantation to prevent graft-versus-host disease. However, whether early-stage apoptotic cell infusion can be used to treat ongoing inflammatory disorders has not been reported extensively. Recently, we have provided evidence that early-stage apoptotic cell infusion is able to control, at least transiently, ongoing collagen-induced arthritis. This beneficial therapeutic effect is associated with the modulation of antigen-presenting cell functions mainly of macrophages and plasmacytoid dendritic cells, as well as the induction of collagen-specific regulatory CD4+ T cells (Treg. Furthermore, the efficacy of this approach is not altered by the association with two standard treatments of rheumatoid arthritis (RA, methotrexate and tumor necrosis factor (TNF inhibition. Here, in the light of these observations and recent data of the literature, we discuss the mechanisms of early-stage apoptotic cell infusion and how this therapeutic approach can be transposed to patients with RA.

  5. Modelling the evolution and spread of HIV immune escape mutants.

    Directory of Open Access Journals (Sweden)

    Helen R Fryer

    2010-11-01

    Full Text Available During infection with human immunodeficiency virus (HIV, immune pressure from cytotoxic T-lymphocytes (CTLs selects for viral mutants that confer escape from CTL recognition. These escape variants can be transmitted between individuals where, depending upon their cost to viral fitness and the CTL responses made by the recipient, they may revert. The rates of within-host evolution and their concordant impact upon the rate of spread of escape mutants at the population level are uncertain. Here we present a mathematical model of within-host evolution of escape mutants, transmission of these variants between hosts and subsequent reversion in new hosts. The model is an extension of the well-known SI model of disease transmission and includes three further parameters that describe host immunogenetic heterogeneity and rates of within host viral evolution. We use the model to explain why some escape mutants appear to have stable prevalence whilst others are spreading through the population. Further, we use it to compare diverse datasets on CTL escape, highlighting where different sources agree or disagree on within-host evolutionary rates. The several dozen CTL epitopes we survey from HIV-1 gag, RT and nef reveal a relatively sedate rate of evolution with average rates of escape measured in years and reversion in decades. For many epitopes in HIV, occasional rapid within-host evolution is not reflected in fast evolution at the population level.

  6. Apoptotic response of malignant rhabdoid tumor cells

    Directory of Open Access Journals (Sweden)

    Nocentini Silvano

    2003-07-01

    Full Text Available Abstract Background Malignant rhabdoid tumors (MRTs are extremely aggressive and resist current radio- and chemotherapic treatments. To gain insight into the dysfunctions of MRT cells, the apoptotic response of a model cell line, MON, was analyzed after exposure to several genotoxic and non-genotoxic agents employed separately or in association. Results Fluorescence microscopy of chromatin morphology and electrophoretic analysis of internucleosomal DNA fragmentation revealed that MON cells were, comparatively to HeLa cells, resistant to apoptosis after treatment with etoposide, cisplatin (CisPt or X-rays, but underwent some degree of apoptosis after ultraviolet (UV C irradiation. Concomitant treatment of MON cells with X-rays or vinblastine and the phosphatidylinositol 3-kinase (PI3-K inhibitor wortmannin resulted in synergistic induction of apoptosis. Western blot analysis showed that the p53 protein was upregulated in MON cells after exposure to all the different agents tested, singly or in combination. In treated cells, the p53 downstream effectors p21WAF1/CIP1, Mdm2 and Bax were induced with some inconsistency with regard to the accumulation of p53. Poly ADP-ribose polymerase (PARP cleavage, indicative of ongoing apoptosis, occurred in UVC-irradiated cells and, especially, in cells treated with combinations of X-rays or vinblastine with wortmannin. However, there was moderate or no PARP cleavage in cells treated with CisPt, X-rays, vinblastine or wortmannin singly or with the combinations X-rays plus CisPt or vinblastine and CisPt plus vinblastine or wortmannin. The synergistic effect on the induction of apoptosis exerted by some agent combinations corresponded with synergy in respect of MON cell growth inhibition. Conclusion These results suggest abnormalities in the p53 pathway and apoptosis control in MRT cells. The Ras/PI3-K/AKT signaling pathway might also be deregulated in these cells by generating an excess of survival factors. These

  7. The synergistic apoptotic effects of thiophenfurin, an inosine monophosphate dehydrogenase inhibitor, in combination with retinoids in HL60 cells.

    Science.gov (United States)

    Meli, Maria; Tolomeo, Manlio; Grifantini, Mario; Franchetti, Palmarisa; Cappellacci, Loredana; Simoni, Daniele; Invidiata, Francesco P; Aiello, Stefania; Dusonchet, Luisa

    2007-01-01

    New effective cytotoxic agents and combinations are urgently needed in cancer treatment. The enzyme inosine monophosphate dehydrogenase is a potentially useful target for drug development, since its activity has been shown to be amplified in malignant cells. Thiophenfurin, an inhibitor of the enzyme synthesized by us, is endowed with a significant apoptotic activity in promyelocytic leukaemia HL60 cells. Since retinoids were successfully employed in the treatment of patients with leukaemia, demonstrating significant differentiation-inducing and apoptotic effects, we carried out this study to evaluate the effects of the combination of thiophenfurin and several retinoid molecules, acting in different phases of the cell cycle in vitro. The results show that thiophenfurin is capable of eliciting significant S phase-specific antiproliferative effects in different sensitive and resistant cell lines with the IC50s ranging from 6.7 to 26 microM. When HL60 cells were treated with thiophenfurin in combination with retinoids, the effects on cell growth were additive or synergistic, depending on the kind of retinoid used and the sequence of treatment. In particular, we observed additive effects when the cells were exposed to thiophenfurin and all-transretinoic acid either simultaneously or sequentially. Instead, when the new heterocyclic retinoid isoxazole benzoic acid was used, synergism was obtained in the cells treated sequentially. The combination of thiophenfurin and isoxazole benzoic acid determined synergistic apoptotic effects through a mitochondrion-dependent mechanism, suggesting the possible usefulness of this combination in the treatment of leukaemia.

  8. Escape to infinity under the action of a potential and a constant electromagnetic field

    CERN Document Server

    Gascon, F G

    2003-01-01

    Escape to infinity is proved for a great variety of potentials, including the potential created by an infinite number of sources. Relativistic escape is studied. Escape in the presence of a constant electromagnetic field and a potential is also considered.

  9. Escape of Cosmic Rays from their Acceleration Sites

    Science.gov (United States)

    Malkov, Mikhail; Sagdeev, Roald; Diamond, Patrick

    2012-07-01

    The escape of cosmic rays (CR) from sites of their acceleration, such as supernova remnants (SNR), is calculated self-consistently with the CR transport suppression by self-excited Alfvén waves. The treatment uniformly applies both to the accelerator's nearby zone where intense CRs drive strong turbulence efficiently reducing their escape, and far zone where the CRs rapidly diffuse as test particles. To demonstrate the inseparability of the two zones in calculating the escape flux, an exact solution is obtained for the nonlinear spreading of a sharply localized CR cloud.

  10. Spirulina ameliorates methotrexate hepatotoxicity via antioxidant, immune stimulation, and proinflammatory cytokines and apoptotic proteins modulation.

    Science.gov (United States)

    Khafaga, Asmaa F; El-Sayed, Yasser S

    2018-03-01

    Methotrexate (MTX) is an efficient cytotoxic drug used against various carcinogenic, inflammatory and autoimmune diseases; however, the hepatotoxicity of MTX limits its use. Therefore, the present study aimed to evaluate the potential hepatoprotective and immune-stimulant effect of Spirulina platensis (SP) against MTX acute toxicity. Thirty-two male Wistar rats were randomly allocated into the following four groups (n = 8): control, SP (500 mg/kg bwt, oral gavage daily for 21 days), MTX (20 mg/kg bwt, single ip injection), and MTX+SP. Hepatic and splenic histoarchitecture, leukocyte counts and serum immunoglobulins were evaluated. Hepatic oxidant/antioxidant status, proinflammatory cytokines (tumor necrosis factor-α, and interleukin 6), and pro-apoptotic proteins (caspase 3 and Bax) immunoexpression were assessed. MTX induced extensive hepatic necrosis and vacuolation, and sever lymphoid depletion in splenic white pulp with increased levels of serum transaminases, lactate dehydrogenase, and hepatic malondialdehyde, tumor necrosis factor-α and interleukin 6; and number of caspase 3- and Bax-positive hepatocytes. A significant decrease in leukocyte counts, serum immunoglobulins (IgA, IgM and IgG) level, and hepatic antioxidant enzymes (GSH, GPx, SOD, and CAT) was also detected. Pretreatment with SP resulted in significant improvements in hepatic and splenic histologic architecture, as well as restoring liver enzymes and reduction of lipid peroxidation product, proinflammatory cytokines, and caspase 3 and Bax immunoexpression. Additionally, a significant increase in antioxidant enzymes, serum immunoglobulins, and total leukocyte counts was demonstrated. SP possesses promising antioxidant, anti-inflammatory, anti-apoptotic and immune stimulatory properties against MTX-induced hepatotoxicity and immunosuppression. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Surface code—biophysical signals for apoptotic cell clearance

    International Nuclear Information System (INIS)

    Biermann, Mona; Maueröder, Christian; Brauner, Jan M; Chaurio, Ricardo; Herrmann, Martin; Muñoz, Luis E; Janko, Christina

    2013-01-01

    Apoptotic cell death and the clearance of dying cells play an important and physiological role in embryonic development and normal tissue turnover. In contrast to necrosis, apoptosis proceeds in an anti-inflammatory manner. It is orchestrated by the timed release and/or exposure of so-called ‘find-me’, ‘eat me’ and ‘tolerate me’ signals. Mononuclear phagocytes are attracted by various ‘find-me’ signals, including proteins, nucleotides, and phospholipids released by the dying cell, whereas the involvement of granulocytes is prevented via ‘stay away’ signals. The exposure of anionic phospholipids like phosphatidylserine (PS) by apoptotic cells on the outer leaflet of the plasma membrane is one of the main ‘eat me’ signals. PS is recognized by a number of innate receptors as well as by soluble bridging molecules on the surface of phagocytes. Importantly, phagocytes are able to discriminate between viable and apoptotic cells both exposing PS. Due to cytoskeleton remodeling PS has a higher lateral mobility on the surfaces of apoptotic cells thereby promoting receptor clustering on the phagocyte. PS not only plays an important role in the engulfment process, but also acts as ‘tolerate me’ signal inducing the release of anti-inflammatory cytokines by phagocytes. An efficient and fast clearance of apoptotic cells is required to prevent secondary necrosis and leakage of intracellular danger signals into the surrounding tissue. Failure or prolongation of the clearance process leads to the release of intracellular antigens into the periphery provoking inflammation and development of systemic inflammatory autoimmune disease like systemic lupus erythematosus. Here we review the current findings concerning apoptosis-inducing pathways, important players of apoptotic cell recognition and clearance as well as the role of membrane remodeling in the engulfment of apoptotic cells by phagocytes. (paper)

  12. Autologous HIV-1 neutralizing antibodies: emergence of neutralization-resistant escape virus and subsequent development of escape virus neutralizing antibodies

    DEFF Research Database (Denmark)

    Arendrup, M; Nielsen, C; Hansen, J E

    1992-01-01

    The capacity of consecutive human sera to neutralize sequentially obtained autologous virus isolates was studied. HIV-1 was isolated three times over a 48-164-week period from three individuals immediately after seroconversion and from two individuals in later stages of infection. Development...... escape virus may be part of the explanation of the apparent failure of the immune system to control HIV infection....... of neutralizing antibodies to the primary virus isolates was detected 13-45 weeks after seroconversion. Emergence of escape virus with reduced sensitivity to neutralization by autologous sera was demonstrated. The patients subsequently developed neutralizing antibodies against the escape virus but after a delay...

  13. GREEN PEA GALAXIES REVEAL SECRETS OF Lyα ESCAPE

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Huan; Wang, Junxian [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China (China); Malhotra, Sangeeta; Rhoads, James E. [Arizona State University, School of Earth and Space Exploration (United States); Gronke, Max; Dijkstra, Mark [Institute of Theoretical Astrophysics, University of Oslo (Norway); Jaskot, Anne [Smith College, Northampton, MA (United States); Zheng, Zhenya, E-mail: yanghuan@mail.ustc.edu.cn, E-mail: huan.y@asu.edu, E-mail: Sangeeta.Malhotra@asu.edu, E-mail: James.Rhoads@asu.edu [Pontificia Universidad Católica de Chile, Santiago (Chile)

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  14. A Novel Non-Apoptotic Role of Procaspase-3 in the Regulation of Mitochondrial Biogenesis Activators.

    Science.gov (United States)

    Kim, Ji-Soo; Ha, Ji-Young; Yang, Sol-Ji; Son, Jin H

    2018-01-01

    The executioner caspase-3 has been proposed as a pharmacological intervention target to preserve degenerating dopaminergic (DA) neurons because apoptotic mechanisms involving caspase-3 contribute, at least in part, to the loss of DA neurons in patients and experimental models of Parkinson's disease (PD). Here, we determined that genetic intervention of caspase-3 was sufficient to prevent cell death against oxidative stress (OS), accompanied by unexpected severe mitochondrial dysfunction. Specifically, as we expected, caspase-3-deficient DA neuronal cells were very significantly resistant to OS-induced cell death, while the activation of the initiator caspase-9 by OS was preserved. Moreover, detailed phenotypic characterization of caspase-3-deficient DA cells revealed severe mitochondrial dysfunction, including an accumulation of damaged mitochondria with a characteristic swollen structure and broken cristae, reduced membrane potential, increased levels of reactive oxygen species (ROS), and deficits in mitochondrial oxidative phosphorylation (OXPHOS) enzymes. Of great interest, we found that mitochondrial biogenesis was dramatically decreased in caspase-3-deficient DA cells, whereas their capability of mitophagy was normal. In accordance with this observation, caspase-3 gene knock down (KD) resulted in dramatically decreased expression of the key transcriptional activators of mitochondrial biogenesis, such as Tfam and Nrf-1, implicating a non-apoptotic role of procaspase-3 in mitochondrial biogenesis. Therefore, a prolonged anti-apoptotic intervention targeting caspase-3 should be considered with caution due to the potential adverse effects in mitochondria dynamics resulting from a novel potential functional role of procaspase-3 in mitochondrial biogenesis via regulating the expression of mitochondrial biogenesis activators. J. Cell. Biochem. 119: 347-357, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. The influence of panic on the efficiency of escape

    Science.gov (United States)

    Shen, Jia-Quan; Wang, Xu-Wen; Jiang, Luo-Luo

    2018-02-01

    Whenever we (such as pedestrians) perceive a high density or imminent danger in a confined space, we tend to be panic, which can lead to severe injuries even in the absence of real dangers. Although it is difficult to measure panics in real conditions, we introduced a simple model to study the collective behaviors in condition of fire with dense smoke. Owing to blocking the sight with dense smoke, pedestrians in this condition have two strategies to escape: random-walking or walking along the wall. When the pedestrians are in moderate panic that mean the two types of behaviors are mixed(random-walking and walking along the wall). Our simulation results show that moderate panic, meaning that two escape strategies are mixed, reduces the escape time. In addition, the results indicate that moderate panic can improve the efficiency of escape, this theory also can be useful in a real escape situation. We hope that our research provides the theoretical understanding of underlying mechanisms of panic escape in the condition of poor sight.

  16. Dynamics of immune escape during HIV/SIV infection.

    Directory of Open Access Journals (Sweden)

    Christian L Althaus

    Full Text Available Several studies have shown that cytotoxic T lymphocytes (CTLs play an important role in controlling HIV/SIV infection. Notably, the observation of escape mutants suggests a selective pressure induced by the CTL response. However, it remains difficult to assess the definite role of the cellular immune response. We devise a computational model of HIV/SIV infection having a broad cellular immune response targeting different viral epitopes. The CTL clones are stimulated by viral antigen and interact with the virus population through cytotoxic killing of infected cells. Consequently, the virus population reacts through the acquisition of CTL escape mutations. Our model provides realistic virus dynamics and describes several experimental observations. We postulate that inter-clonal competition and immunodominance may be critical factors determining the sequential emergence of escapes. We show that even though the total killing induced by the CTL response can be high, escape rates against a single CTL clone are often slow and difficult to estimate from infrequent sequence measurements. Finally, our simulations show that a higher degree of immunodominance leads to more frequent escape with a reduced control of viral replication but a substantially impaired replicative capacity of the virus. This result suggests two strategies for vaccine design: Vaccines inducing a broad CTL response should decrease the viral load, whereas vaccines stimulating a narrow but dominant CTL response are likely to induce escape but may dramatically reduce the replicative capacity of the virus.

  17. Rho kinase regulates fragmentation and phagocytosis of apoptotic cells

    International Nuclear Information System (INIS)

    Orlando, Kelly A.; Stone, Nicole L.; Pittman, Randall N.

    2006-01-01

    During the execution phase of apoptosis, a cell undergoes cytoplasmic and nuclear changes that prepare it for death and phagocytosis. The end-point of the execution phase is condensation into a single apoptotic body or fragmentation into multiple apoptotic bodies. Fragmentation is thought to facilitate phagocytosis; however, mechanisms regulating fragmentation are unknown. An isoform of Rho kinase, ROCK-I, drives membrane blebbing through its activation of actin-myosin contraction; this raises the possibility that ROCK-I may regulate other execution phase events, such as cellular fragmentation. Here, we show that COS-7 cells fragment into a number of small apoptotic bodies during apoptosis; treating with ROCK inhibitors (Y-27632 or H-1152) prevents fragmentation. Latrunculin B and blebbistatin, drugs that interfere with actin-myosin contraction, also inhibit fragmentation. During apoptosis, ROCK-I is cleaved and activated by caspases, while ROCK-II is not activated, but rather translocates to a cytoskeletal fraction. siRNA knock-down of ROCK-I but not ROCK-II inhibits fragmentation of dying cells, consistent with ROCK-I being required for apoptotic fragmentation. Finally, cells dying in the presence of the ROCK inhibitor Y-27632 are not efficiently phagocytized. These data show that ROCK plays an essential role in fragmentation and phagocytosis of apoptotic cells

  18. ESCAPE to Reality, Post-Trial Outcomes in an ESCAPE Centre: A Retrospective Case-Control Study.

    Science.gov (United States)

    Nixon, Amy M; Jamison, Michael; Rennie, Ian M; Flynn, Peter A; Smyth, Graham; Wiggam, Ivan; Kerr, Enda; Fulton, Ailsa; Hunter, Annemarie; Burns, Paul A

    2018-01-01

    The Royal Victoria Hospital, Belfast provides the regional neuroendovascular service for Northern Ireland and was an enrolling centre for the ESCAPE endovascular stroke trial. Our aim was to assess outcomes for patients presenting with acute stroke following discontinuation of trial enrolment at our centre. We collected data on all patients presenting with acute stoke between Nov-1st-2014 and Oct-31st-2015 who received endovascular treatment or received IV thrombolysis (IV-tPA) alone. ESCAPE eligibility of each patient was assessed. Primary outcome was modified Rankin Score (mRS) at 3 months. 129 patients presented with acute stoke symptoms during the time period; 56/129 (43.4%) patients in the intervention group and 73/129 (56.5%) patients in the control group. In the interventional group, 42/56 (75%) were considered ESCAPE eligible and 14/56 (25%) were considered ESCAPE ineligible. 30/42 (71.4%) ESCAPE eligible patients had a positive functional outcome at 3 months compared to 9/14 (64.2%) ESCAPE ineligible patients. In the control group, 37 (50.7%) had identifiable thrombotic occlusion and 13/37 (35.1%) were considered eligible for intervention. 4/13 (30.8%) achieved functional independence (mRS<3) at 3 months.There was a statistically significant difference in functional independence in those who underwent endovascular therapy compared to the control group (p= 0.04). ESCAPE eligible patients in our centre had favourable outcome rates superior to the published trial data. ESCAPE ineligible patients tended to do slightly less well, but still better than the favourable outcome rates achieved with IVtPA alone. There is potentially a wide discordance between the threshold for futility and trial eligibility criteria when considering endovascular treatment for acute ischaemic stroke.

  19. Anti-apoptotic effects of tamarind leaves against ethanol-induced rat liver injury.

    Science.gov (United States)

    Ghoneim, Asser I; Eldahshan, Omayma A

    2012-03-01

    The leaf decoctions of Tamarindus indica (TI) have long been traditionally used in liver ailments. The aim of this study was to investigate the anti-apoptotic activity of TI leaf extract against acute ethanol (EtOH)-induced liver injury. The major constituents of the extract were also examined for standardization purposes. Rats (n = 5-7) were orally pretreated with TI leaf extract (25, 50 and 100 mg/kg) for seven days. Silymarin was used as a positive control. Liver tissue biochemical assays included key markers of apoptosis and its redox signalling. Serum enzyme levels were also determined. All graded doses of TI leaf extract mitigated the EtOH-induced liver caspase-3 activation (42, 57 and 64%) as well as DNA fragmentation (32, 47 and 50%), respectively. The highest dose of the extract demonstrated membrane-stabilizing (38%) in addition to glutathione-replenishing (88%) effects. Also, the leaves improved the liver histopathological alterations. Moreover, major plant bioactive polyphenolics, that might be responsible for the extract's observed effects, were isolated and identified. TI leaf extract demonstrated promising anti-apoptotic hepatoprotective effects in rats. The use of TI leaves in different liver diseases, having apoptosis as the underlying pathology, hence warrants further clinical investigation. © 2011 The Authors. JPP © 2011 Royal Pharmaceutical Society.

  20. Glycine tomentella Hayata inhibits IL-1β and IL-6 production, inhibits MMP-9 activity, and enhances RAW264.7 macrophage clearance of apoptotic cells

    Directory of Open Access Journals (Sweden)

    Sun Yu-Shu

    2010-11-01

    Full Text Available Abstract Background To assess the effects of Glycine tomentella Hayata (GTH, a traditional herbal medicine for treatment of rheumatic diseases on the expression of the proinflammatory cytokines and on the clearance of apoptotic cells by macrophages. Methods RAW264.7 cells were cultured with lipopolysaccharide (LPS in the presence or absence of ethanol extract of GTH. The expression of proinflammatory cytokines IL-1β, IL-6, and TNF-α, and inducible nitric oxide synthase (iNOS and transglutaminase 2 (TG2 were assayed by reverse transcriptase-polymerase chain reaction (RT-PCR and enzyme-linked immunosorbent assay (ELISA. Matrix metalloproteinase (MMP-2 and MMP-9 were assayed by gelatin zymography. For detecting uptake of apoptotic cells, RAW264.7 cells were cultured with carboxyfluorescein diacetate (CFDA-stained apoptotic cells and assayed by flow cytometry. Results The major components of GTH analyzed by high-performance liquid chromatography (HPLC chromatogram were daidzein (42.5%, epicatechin (28.8%, and naringin (9.4%. GTH treatment inhibited the expression of proinflammatory cytokines IL-1β, IL-6 and MMP-9 but did not affect the expression of TNF-α and iNOS. GTH significantly enhanced the expression of TG2 and the clearance of apoptotic cells by RAW264.7 macrophages. Conclusions GTH inhibits proinflammatory cytokine secretion and MMP-9 activity, enhances apoptotic cell uptake and up-regulates TG2 expression. Our data show that GTH might have beneficial effects on rheumatic diseases.

  1. Opium induces apoptosis in Jurkat cells via promotion of pro-apoptotic and inhibition of anti-apoptotic molecules.

    Science.gov (United States)

    Arababadi, Mohammad Kazemi; Asadikaram, Gholamreza

    2016-02-01

    The aim of this study was to determine the important molecules involved in apoptosis induction by opium in Jurkat cell line. Jurkat cells were incubated 48 hrs with 2.86×10(-5) g/ml concentration of opium and apoptosis as well as expression levels of related molecules were measured. Our results demonstrated that 50.3±0.2 percent of opium treated Jurkat cells were revealed apoptotic features. The levels of mRNA of several pro-apoptotic and anti-apoptotic molecules were increased and decreased, respectively, in the opium treated cells. The results also demonstrated that expression levels of BCL2, DFFA and NOL3 as anti-apoptotic molecules were increased in the opium treated cells. It seems that opium induces apoptosis in Jurkat cells via both intrinsic and extrinsic pathways. Although opium induces apoptosis in the cells but increased expression of some anti-apoptotic molecules may be a normal resistance of the cell for death.

  2. Lipid Bodies as Sites of Prostaglandin E2 Synthesis During Chagas Disease: Impact in the Parasite Escape Mechanism

    Directory of Open Access Journals (Sweden)

    Patrícia E. de Almeida

    2018-03-01

    Full Text Available During Chagas disease, the Trypanosoma cruzi can induce some changes in the host cells in order to escape or manipulate the host immune response. The modulation of the lipid metabolism in the host phagocytes or in the parasite itself is one feature that has been observed. The goal of this mini review is to discuss the mechanisms that regulate intracellular lipid body (LB biogenesis in the course of this parasite infection and their meaning to the pathophysiology of the disease. The interaction host–parasite induces LB (or lipid droplet formation in a Toll-like receptor 2-dependent mechanism in macrophages and is enhanced by apoptotic cell uptake. Simultaneously, there is a lipid accumulation in the parasite due to the incorporation of host fatty acids. The increase in the LB accumulation during infection is correlated with an increase in the synthesis of PGE2 within the host cells and the parasite LBs. Moreover, the treatment with fatty acid synthase inhibitor C75 or non-steroidal anti-inflammatory drugs such as NS-398 and aspirin inhibited the LB biogenesis and also induced the down modulation of the eicosanoid production and the parasite replication. These findings show that LBs are organelles up modulated during the course of infection. Furthermore, the biogenesis of the LB is involved in the lipid mediator generation by both the macrophages and the parasite triggering escape mechanisms.

  3. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects.

    Science.gov (United States)

    Hamed, Sherifa S; Al-Yhya, Nouf A; El-Khadragy, Manal F; Al-Olayan, Ebtesam M; Alajmi, Reem A; Hassan, Zeinab K; Hassan, Salwa B; Abdel Moneim, Ahmed E

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds.

  4. The apoptotic effect and the plausible mechanism of microwave radiation on rat myocardial cells.

    Science.gov (United States)

    Zhu, Wenhe; Cui, Yan; Feng, Xianmin; Li, Yan; Zhang, Wei; Xu, Junjie; Wang, Huiyan; Lv, Shijie

    2016-08-01

    Microwaves may exert adverse biological effects on the cardiovascular system at the integrated system and cellular levels. However, the mechanism underlying such effects remains poorly understood. Here, we report a previously uncharacterized mechanism through which microwaves damage myocardial cells. Rats were treated with 2450 MHz microwave radiation at 50, 100, 150, or 200 mW/cm(2) for 6 min. Microwave treatment significantly enhanced the levels of various enzymes in serum. In addition, it increased the malondialdehyde content while decreasing the levels of antioxidative stress enzymes, activities of enzyme complexes I-IV, and ATP in myocardial tissues. Notably, irradiated myocardial cells exhibited structural damage and underwent apoptosis. Furthermore, Western blot analysis revealed significant changes in expression levels of proteins involved in oxidative stress regulation and apoptotic signaling pathways, indicating that microwave irradiation could induce myocardial cell apoptosis by interfering with oxidative stress and cardiac energy metabolism. Our findings provide useful insights into the mechanism of microwave-induced damage to the cardiovascular system.

  5. To run or hide?: escape behaviour in a cryptic African snake | Maritz ...

    African Journals Online (AJOL)

    Optimal escape theory predicts that escape behaviour of an organism is best understood in terms of costs and benefits of escaping relative to risk of predation. However, risk of predation facing an organism is dependent on various biotic and abiotic factors. In order to better understand escape behaviour of an African snake, ...

  6. ESCAPE DYNAMICS AS A WAY TO DESCRIBE ECONOMIC PHENOMENA

    Directory of Open Access Journals (Sweden)

    Bogomolova A. S.

    2017-06-01

    Full Text Available This paper presents the review of issues and approaches to the analysis of escape dynamics in economic models with constant gain adaptive learning which is used to model and describe the behavior of various (macroeconomic as well as microeconomic variables in diverse economic phenomena such as currency crises, inflation episodes, endogenous collusion in oligopoly, and cycles of economic activity. This review considers and contrasts two currently existing approaches to the analysis of escape dynamics: the discrete-time approach employed, for example, by Cho, Williams and Sargent (2002, and the continuous-time approach proposed by Kasa (2004 and extended recently by Kolyuzhnov, Bogomolova and Slobodyan (2014, stressing the advantages of the latter. The continuous-time approach is based on the application of the results of the continuous-time version of the large deviations theory to the diffusion approximation of the original discrete-time dynamics under learning. Escape dynamics is characterized by analytically deriving the most probable escape point and mean escape time. The paper provides an example of the continuous-time approach applied to the Phelps problem of a government controlling inflation while adaptively learning the approximate Phillips curve.

  7. History of oxygen and carbon escape from the Martian atmosphere

    Science.gov (United States)

    Luhmann, J. G.; Zhang, M. H. G.; Johnson, R. E.; Bougher, S. W.; Nagy, A. F.

    1992-01-01

    A fraction of the oxygen in the Martian atmosphere continually escapes to space because dissociative recombination of the O2(+) ions in the ionosphere can impart sufficient energy to the product O atoms. In addition, ionization of the extended atomic oxygen corona resulting from the above process adds to escape since the solar wind can carry away O(+) ions born above a few hundred km altitude. A further by-product of this ion-pickup by the solar wind is an additional population of escaping oxygen atoms that are sputtered from the atmosphere near the exobase by pickup ions that are on reentry rather than escaping trajectories. This sputtering process can also remove carbon in the form of intact or dissociated CO2 since all atoms and molecules in the 'target' gas are subject to the collisional energy transfer that characterizes sputtering. We have estimated the present rates of escape of oxygen and carbon due to these mechanisms, as well as the rates at several epochs in the history of the solar system.

  8. The adaptive significance of drought escape in Avena barbata, an annual grass.

    Science.gov (United States)

    Sherrard, Mark E; Maherali, Hafiz

    2006-12-01

    Drought strongly influences plant productivity, suggesting that water limitation has shaped the evolution of many plant physiological traits. One functional strategy that plants employ to cope with decreasing water availability is drought escape. For drought-escaping species, high metabolic activity (gas exchange) and rapid growth are hypothesized to confer a fitness advantage, because this enables a plant to complete its life cycle before the most intense period of drought. By growing an annual grass species (Avena barbata) under well-watered or water-limited conditions in a greenhouse, we directly tested whether high photosynthesis, increased stomatal opening, and early flowering are adaptive under drought. We measured phenotypic selection on instantaneous gas exchange and flowering time as well as the underlying biochemical traits that regulate photosynthesis. We found strong selection for earlier flowering in the dry environment, but no evidence that increased photosynthesis was adaptive under drought. Photosynthetic rate (A) and stomatal conductance (gs) were both adaptively neutral in the dry environment. Increased photosynthetic capacity (Amax) was maladaptive in the dry environment, perhaps because of the respiratory cost associated with maintaining excess enzyme and substrate capacity. There was no correlational selection on the combination of physiology and flowering time in the dry environment, suggesting that accelerated development and high gas exchange may not need to be tightly linked to promote drought escape. In contrast, there was selection for both high photosynthetic function (Amax and A) and early flowering in the well-watered environment. These combinations of traits may have been favored because they maximize both energy and time available for reproduction. Our results suggest that the benefit of increased photosynthesis for plant fitness may be strongest in the absence of drought stress.

  9. Different apoptotic responses to Plasmodium chabaudi malaria in ...

    African Journals Online (AJOL)

    hope&shola

    2010-11-08

    Nov 8, 2010 ... The purpose of this study is to determine whether the apoptotic responses to Plasmodium chabaudi malaria in spleen and liver via mRNA expression of three genes involved in apoptosis (Bax, Bcl-2 and. Caspase-3) are similar or not and to detect if these genes could be a good marker for apoptosis due to.

  10. In vitro Anti-proliferative and Apoptotic Activities of Eurycoma ...

    African Journals Online (AJOL)

    Purpose: To investigate the anti-proliferative, apoptotic and differentiating activities of Eurycoma longifolia root extracts on HL-60 leukemic cells. Methods: HL-60 cells were treated with different partially purified sub-fractions (F1 – F3) derived from the resin chromatography of the crude methanol root extract of E. longifolia ...

  11. Growth inhibitory, apoptotic and anti-inflammatory activities ...

    Indian Academy of Sciences (India)

    mice. Collectively, these results suggest that CEMB is a very potent anti-tumour compound. [Ravanan P, Singh SK, Subba Rao GSR and Kondaiah P 2011 Growth inhibitory, apoptotic and anti-inflammatory activities displayed by a novel modified triterpenoid, cyano enone of methyl boswellates. J. Biosci. 36 297–307] DOI ...

  12. Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Zodwa Dlamini

    2015-11-01

    Full Text Available Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets.

  13. Cytotoxicity and Apoptotic Activity of Ficus pseudopalma Blanco ...

    African Journals Online (AJOL)

    The presence of terpenoid lupeol and flavonoid quercetin was determined through high performance liquid chromatography (HPLC). The cytotoxic and apoptotic effects of different concentrations of FP extracts on PRST2 cells and on non-cancerous human foreskin surface epithelial (hFSE) cells were determined by 3-[4, ...

  14. Antiproliferative and apoptotic activities of Cola lepidota against ...

    African Journals Online (AJOL)

    The stem bark, seed, roots and leaves of Cola lepidota have been used for various health conditions in Nigeria folk medicine including treatment of cancer related ailments. The study evaluated the antiproliferative and apoptotic effects of extracts of the leaves and stem bark on breast cancer (MCF-7) cell line. Powdered ...

  15. Detection of apoptotic cells using propidium iodide staining

    NARCIS (Netherlands)

    Newbold, Andrea; Martin, Ben P.; Cullinane, Carleen; Bots, Michael

    2014-01-01

    Flow cytometry assays are often used to detect apoptotic cells in in vitro cultures. Depending on the experimental model, these assays can also be useful in evaluating apoptosis in vivo. In this protocol, we describe a propidium iodide (PI) flow cytometry assay to evaluate B-cell lymphomas that have

  16. Elimination of apoptotic boar spermatozoa using magnetic activated cell sorting

    Directory of Open Access Journals (Sweden)

    Janko Mrkun

    2014-01-01

    Full Text Available One of the features of apoptosis is the externalization of phosphatidylserine which could be used to remove apoptotic cells from semen preparations. Magnetic-activated cell sorting using annexin V-conjugated microbeads which bind to phosphatidylserine could be used to enhance semen quality. Twelve boar semen samples after 3 days of liquid storage at 16­­–17 °C were subjected to magnetic-activated cell sorting. Bound and unbound fractions and control samples were subjected to flow cytometry following the staining of spermatozoa with Annexin V conjugated with Alexa Fluor 488 and propidium iodide. Four subpopulations were obtained: live, early apoptotic live, late apoptotic, early necrotic dead and late necrotic dead. The frequency of early apoptotic and late necrotic spermatozoa was significantly higher (P P P P < 0.05 lower proportion of morphologically normal spermatozoa was observed in both fractions compared to control (67.2 ± 17.0%. Boar spermatozoa were separated by the above method for the first time, however, the results showed this method to be inappropriate for boar semen separation under the tested conditions.

  17. Passive Facebook use, Facebook addiction, and associations with escapism: an experimental vignette study

    OpenAIRE

    Young, LN; Kuss, DJ; Griffiths, MD; Howard, CJ

    2017-01-01

    There is relatively little research considering motivations of passive Facebook use. However, research regarding motivations of general Facebook use indicates that people use Facebook to escape – and that escapism may motivate passive Facebook use. Research also suggests that using Facebook to escape is associated with Facebook addiction. Using an experimental vignette design, the present research investigated whether passive Facebook use is motivated by escapism and whether this escape motiv...

  18. Antiproliferative and Pro-apoptotic Activities of a Novel Resveratrol Prodrug Against Jurkat CD4+ T-Cells.

    Science.gov (United States)

    Goldhahn, Katrin; Handler, Norbert; Loebsch, Silvia; Schmetterer, Klaus; Steiner, Guenter; Kloesch, Burkhard; Erker, Thomas

    2016-02-01

    Resveratrol, a natural polyphenol, possesses many beneficial health properties but its therapeutic application is limited due to its low water solubility and instability against oxidative processes. To improve the stability and lipophilicity of the natural compound, we synthesized a resveratrol prodrug, termed FEHH4-1. In the present study, we compared the antiproliferative and pro-apoptotic effects of resveratrol with FEHH4-1 on Jurkat T-cells. Cell proliferation and viability were monitored by 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide assay, annexin-V/7-amino-actinomycin D staining and western blot. To induce interleukin-2 (IL2) expression, cells were stimulated with phorbol 12-myristate 13-acetate/phytohemagglutinin. IL2 production was quantified by enzyme-linked immunosorbent assay. IL2 promoter activity was studied by a Jurkat T-cell line containing an IL2 promoter luciferase reporter construct. Both polyphenols inhibited proliferation, induced apoptotic cell death and blocked IL2 synthesis in Jurkat T-cells. Most importantly, FEHH4-1 was three-to four-times more potent than resveratrol. FEHH4-1 had improved antiproliferative and pro-apoptotic potential against Jurkat T-cells compared to resveratrol. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Neuroprotective effects of Activin A on endoplasmic reticulum stress-mediated apoptotic and autophagic PC12 cell death

    Directory of Open Access Journals (Sweden)

    Long-xing Xue

    2017-01-01

    Full Text Available Activin A, a member of the transforming growth factor-beta superfamily, plays a neuroprotective role in multiple neurological diseases. Endoplasmic reticulum (ER stress-mediated apoptotic and autophagic cell death is implicated in a wide range of diseases, including cerebral ischemia and neurodegenerative diseases. Thapsigargin was used to induce PC12 cell death, and Activin A was used for intervention. Our results showed that Activin A significantly inhibited morphological changes in thapsigargin-induced apoptotic cells, and the expression of apoptosis-associated proteins [cleaved-caspase-12, C/EBP homologous protein (CHOP and cleaved-caspase-3] and biomarkers of autophagy (Beclin-1 and light chain 3, and downregulated the expression of thapsigargin-induced ER stress-associated proteins [inositol requiring enzyme-1 (IRE1, tumor necrosis factor receptor-associated factor 2 (TRAF2, apoptosis signal-regulating kinase 1 (ASK1, c-Jun N-terminal kinase (JNK and p38]. The inhibition of thapsigargin-induced cell death was concentration-dependent. These findings suggest that administration of Activin A protects PC12 cells against ER stress-mediated apoptotic and autophagic cell death by inhibiting the activation of the IRE1-TRAF2-ASK1-JNK/p38 cascade.

  20. Behavior of Ants Escaping from a Single-Exit Room.

    Directory of Open Access Journals (Sweden)

    Shujie Wang

    Full Text Available To study the rules of ant behavior and group-formation phenomena, we examined the behaviors of Camponotus japonicus, a species of large ant, in a range of situations. For these experiments, ants were placed inside a rectangular chamber with a single exit that also contained a filter paper soaked in citronella oil, a powerful repellent. The ants formed several groups as they moved toward the exit to escape. We measured the time intervals between individual escapes in six versions of the experiment, each containing an exit of a different width, to quantify the movement of the groups. As the ants exited the chamber, the time intervals between individual escapes changed and the frequency distribution of the time intervals exhibited exponential decay. We also investigated the relationship between the number of ants in a group and the group flow rate.

  1. Escaping and Falling into Poverty in India Today.

    Science.gov (United States)

    Thorat, Amit; Vanneman, Reeve; Desai, Sonalde; Dubey, Amaresh

    2017-05-01

    The study examines the dynamic nature of movements into and out of poverty over a period when poverty has fallen substantially in India. The analysis identifies people who escaped poverty and those who fell into it over the period 2005 to 2012. The analysis identifies people who escaped poverty and those who fell into it over the period 2005 to 2012. Using panel data from the India Human Development Survey for 2005 and 2012, we find that the risks of marginalized communities such as Dalits and Adivasis of falling into or remaining in poverty were higher than those for more privileged groups. Some, but not all of these higher risks are explained by educational, financial, and social disadvantages of these groups in 2005. Results from a logistic regression show that some factors that help people escape poverty differ from those that push people into it and that the strength of their effects varies.

  2. Escape panels in trawls – a consistent management tool?

    DEFF Research Database (Denmark)

    Krag, Ludvig Ahm; Herrmann, Bent; Feekings, Jordan P.

    2016-01-01

    gears are often developed in collaboration between scientists and fishers. Part of the development is a controlled scientific test documenting the selectivity effect. In this study, we compared two versions of a mandatory escape panel that were introduced into the mixed species fishery in the Skagerrak...... vertical distance between the upper panel (escape panel) and the bottom panel compared to the pre-version. Both designs are legal and considered identical. The results of this study showed significantly higher catches (lower selectivity) for the post-version for all five species examined; cod (Gadus morhua......), saithe (Pollachius virens), haddock (Melanogrammus aeglefinus), plaice (Pleuronectes platessa) and Norway lobster (Nephrops norvegicus). Thus the modification by fishers of certain gear properties not specified in the legislation can significantly influence the efficiency of an escape panel. We discuss...

  3. Feature Integration Drives Probabilistic Behavior in the Drosophila Escape Response.

    Science.gov (United States)

    von Reyn, Catherine R; Nern, Aljoscha; Williamson, W Ryan; Breads, Patrick; Wu, Ming; Namiki, Shigehiro; Card, Gwyneth M

    2017-06-21

    Animals rely on dedicated sensory circuits to extract and encode environmental features. How individual neurons integrate and translate these features into behavioral responses remains a major question. Here, we identify a visual projection neuron type that conveys predator approach information to the Drosophila giant fiber (GF) escape circuit. Genetic removal of this input during looming stimuli reveals that it encodes angular expansion velocity, whereas other input cell type(s) encode angular size. Motor program selection and timing emerge from linear integration of these two features within the GF. Linear integration improves size detection invariance over prior models and appropriately biases motor selection to rapid, GF-mediated escapes during fast looms. Our findings suggest feature integration, and motor control may occur as simultaneous operations within the same neuron and establish the Drosophila escape circuit as a model system in which these computations may be further dissected at the circuit level. VIDEO ABSTRACT. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. SOYUZ escape trajectory analysis from Space Station Freedom

    Science.gov (United States)

    Heck, Michael L.

    1993-01-01

    It has been proposed to utilize the Russian built SOYUZ as an assured crew return vehicle (ACRV) for Space Station Freedom. Three departure directions (nadir, zenith, minus velocity) are evaluated to determine escape path clearances. In addition, the effects of the following parameters were also evaluated: delta-V magnitude, configuration dependent ballistic coefficients, atmospheric density, Freedom attitude control, and canted docking adaptors. The primary factor influencing the escape trajectory was station contingency attitude rate. The nadir and zenith departures were preferable to minus velocity. The impact of atmospheric density and relative ballistic coefficients was minimal.

  5. Case of escape in cassava, Manihot esculenta Crantz.

    Science.gov (United States)

    Nassar, N M A; Mendonza, M

    2017-02-08

    Two cassava escapes where collected from cultivated fields near natural habitat in Bolivia. They are described morphologically and analyzed cytogenetically in this study. It is suggested that they are the product of backcrosses of cassava interspecific hybrids with the cultigen itself, and that selective conditions have developed in which certain forms of cassava segregates have adapted to grow wildly in natural habitats near cassava fields. These segregates may hybridize with cultivated cassava upon coming in contact with such varieties. Because these escapes have incorporated useful genes from the wild into their genetic structure, they could be used for cassava improvement since their genetic barriers with other forms of cassava are very weak.

  6. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery

    Science.gov (United States)

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-06-01

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds’ escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds’ cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier.

  7. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery.

    Science.gov (United States)

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-06-30

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds' escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds' cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier.

  8. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis

    DEFF Research Database (Denmark)

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia

    2015-01-01

    conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore...

  9. Chronic MDMA induces neurochemical changes in the hippocampus of adolescent and young adult rats: Down-regulation of apoptotic markers.

    Science.gov (United States)

    García-Cabrerizo, Rubén; García-Fuster, M Julia

    2015-07-01

    While hippocampus is a brain region particularly susceptible to the effects of MDMA, the cellular and molecular changes induced by MDMA are still to be fully elucidated, being the dosage regimen, the species and the developmental stage under study great variables. This study compared the effects of one and four days of MDMA administration following a binge paradigm (3×5 mg/kg, i.p., every 2 h) on inducing hippocampal neurochemical changes in adolescent (PND 37) and young adult (PND 58) rats. The results showed that chronic MDMA caused hippocampal protein deficits in adolescent and young adult rats at different levels: (1) impaired serotonergic (5-HT2A and 5-HT2C post-synaptic receptors) and GABAergic (GAD2 enzyme) signaling, and (2) decreased structural cytoskeletal neurofilament proteins (NF-H, NF-M and NF-L). Interestingly, these effects were not accompanied by an increase in apoptotic markers. In fact, chronic MDMA inhibited proteins of the apoptotic pathway (i.e., pro-apoptotic FADD, Bax and cytochrome c) leading to an inhibition of cell death markers (i.e., p-JNK1/2, cleavage of PARP-1) and suggesting regulatory mechanisms in response to the neurochemical changes caused by the drug. The data, together with the observed lack of GFAP activation, support the view that chronic MDMA effects, regardless of the rat developmental age, extends beyond neurotransmitter systems to impair other hippocampal structural cell markers. Interestingly, inhibitory changes in proteins from the apoptotic pathway might be taking place to overcome the protein deficits caused by MDMA. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Autologous HIV-1 neutralizing antibodies: emergence of neutralization-resistant escape virus and subsequent development of escape virus neutralizing antibodies

    DEFF Research Database (Denmark)

    Arendrup, M; Nielsen, C; Hansen, J E

    1992-01-01

    The capacity of consecutive human sera to neutralize sequentially obtained autologous virus isolates was studied. HIV-1 was isolated three times over a 48-164-week period from three individuals immediately after seroconversion and from two individuals in later stages of infection. Development of ...... escape virus may be part of the explanation of the apparent failure of the immune system to control HIV infection.......The capacity of consecutive human sera to neutralize sequentially obtained autologous virus isolates was studied. HIV-1 was isolated three times over a 48-164-week period from three individuals immediately after seroconversion and from two individuals in later stages of infection. Development...... of neutralizing antibodies to the primary virus isolates was detected 13-45 weeks after seroconversion. Emergence of escape virus with reduced sensitivity to neutralization by autologous sera was demonstrated. The patients subsequently developed neutralizing antibodies against the escape virus but after a delay...

  11. A functional yeast survival screen of tumor-derived cDNA libraries designed to identify anti-apoptotic mammalian oncogenes.

    Science.gov (United States)

    Eißmann, Moritz; Schwamb, Bettina; Melzer, Inga Maria; Moser, Julia; Siele, Dagmar; Köhl, Ulrike; Rieker, Ralf Joachim; Wachter, David Lukas; Agaimy, Abbas; Herpel, Esther; Baumgarten, Peter; Mittelbronn, Michel; Rakel, Stefanie; Kögel, Donat; Böhm, Stefanie; Gutschner, Tony; Diederichs, Sven; Zörnig, Martin

    2013-01-01

    Yeast cells can be killed upon expression of pro-apoptotic mammalian proteins. We have established a functional yeast survival screen that was used to isolate novel human anti-apoptotic genes overexpressed in treatment-resistant tumors. The screening of three different cDNA libraries prepared from metastatic melanoma, glioblastomas and leukemic blasts allowed for the identification of many yeast cell death-repressing cDNAs, including 28% of genes that are already known to inhibit apoptosis, 35% of genes upregulated in at least one tumor entity and 16% of genes described as both anti-apoptotic in function and upregulated in tumors. These results confirm the great potential of this screening tool to identify novel anti-apoptotic and tumor-relevant molecules. Three of the isolated candidate genes were further analyzed regarding their anti-apoptotic function in cell culture and their potential as a therapeutic target for molecular therapy. PAICS, an enzyme required for de novo purine biosynthesis, the long non-coding RNA MALAT1 and the MAST2 kinase are overexpressed in certain tumor entities and capable of suppressing apoptosis in human cells. Using a subcutaneous xenograft mouse model, we also demonstrated that glioblastoma tumor growth requires MAST2 expression. An additional advantage of the yeast survival screen is its universal applicability. By using various inducible pro-apoptotic killer proteins and screening the appropriate cDNA library prepared from normal or pathologic tissue of interest, the survival screen can be used to identify apoptosis inhibitors in many different systems.

  12. Predator escape tactics in birds : linking ecology and aerodynamics

    NARCIS (Netherlands)

    van den Hout, Piet J.; Mathot, Kimberley J.; Maas, Leo R. M.; Piersma, Theunis

    2010-01-01

    In most birds, flight is the most important means of escape from predators. Impaired flight abilities due to increased wing loading may increase vulnerability to predation. To compensate for an increase in wing loading, birds are able to independently decrease body mass (BM) or increase pectoral

  13. Escape angles in bulk chi((2)) soliton interactions

    DEFF Research Database (Denmark)

    Johansen, Steffen Kjær; Bang, Ole; Sørensen, Mads Peter

    2002-01-01

    We develop a theory for nonplanar interaction between two identical type I spatial solitons propagating at opposite, but arbitrary transverse angles in quadratic nonlinear (or so-called chi((2))) bulk, media. We predict quantitatively the outwards escape angle, below which the solitons turn around...

  14. Molecular strategies to design an escape-proof antiviral therapy

    NARCIS (Netherlands)

    Berkhout, Ben; Sanders, Rogier W.

    2011-01-01

    Two antiviral approaches against the human immunodeficiency virus type 1 (HIV-1) were presented at the Antivirals Congress in Amsterdam. The common theme among these two separate therapeutic research lines is the wish to develop a durable therapy that prevents viral escape. We will present a brief

  15. Escaping Embarrassment: Face-Work in the Rap Cipher

    Science.gov (United States)

    Lee, Jooyoung

    2009-01-01

    How do individuals escape embarrassing moments in interaction? Drawing from ethnographic fieldwork, in-depth interviews, and video recordings of weekly street corner ciphers (impromptu rap sessions), this paper expands Goffman's theory of defensive and protective face-work. The findings reveal formulaic and indirect dimensions of face-work. First,…

  16. 46 CFR 169.313 - Means of escape.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Construction... apart, uniform for the length of the ladder; (3) At least 3 inches from the nearest permanent object in...

  17. A Structural Soundness Proof for Shivers's Escape Technique

    DEFF Research Database (Denmark)

    Midtgaard, Jan; Adams, Michael D.; Matthew, Might

    2012-01-01

    Shivers’s escape technique enables one to analyse the control flow of higher-order program fragments. It is widely used, but its soundness has never been proven. In this paper, we present the first soundness proof for the technique. Our proof is structured as a composition of Galois connections...

  18. 46 CFR 108.445 - Alarm and means of escape.

    Science.gov (United States)

    2010-10-01

    ... AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.445 Alarm and means of escape. (a) Each CO2 system that has a supply of more than 136 kilograms (300 pounds) of CO2, except a system that protects a tank, must have an alarm that sounds for at least 20 seconds...

  19. The great escape - AIDS viruses and immune control.

    Science.gov (United States)

    Goulder, P J; Walker, B D

    1999-11-01

    Many studies have been designed to address the role of CTL immune escape in HIV-1 infection, but have not given conclusive answers. Now, an elegant longitudinal analysis clearly demonstrates that progression to disease in SIV-infected macaques is associated with evasion of the CTL response (pages 1270-1276).

  20. Danger detection and escape behaviour in wood crickets.

    Science.gov (United States)

    Dupuy, Fabienne; Casas, Jérôme; Body, Mélanie; Lazzari, Claudio R

    2011-07-01

    The wind-sensitive cercal system of Orthopteroid insects that mediates the detection of the approach of a predator is a very sensitive sensory system. It has been intensively analysed from a behavioural and neurobiological point of view, and constitutes a classical model system in neuroethology. The escape behaviour is triggered in orthopteroids by the detection of air-currents produced by approaching objects, allowing these insects to keep away from potential dangers. Nevertheless, escape behaviour has not been studied in terms of success. Moreover, an attacking predator is more than "air movement", it is also a visible moving entity. The sensory basis of predator detection is thus probably more complex than the perception of air movement by the cerci. We have used a piston mimicking an attacking running predator for a quantitative evaluation of the escape behaviour of wood crickets Nemobius sylvestris. The movement of the piston not only generates air movement, but it can be seen by the insect and can touch it as a natural predator. This procedure allowed us to study the escape behaviour in terms of detection and also in terms of success. Our results showed that 5-52% of crickets that detected the piston thrust were indeed touched. Crickets escaped to stimulation from behind better than to a stimulation from the front, even though they detected the approaching object similarly in both cases. After cerci ablation, 48% crickets were still able to detect a piston approaching from behind (compared with 79% of detection in intact insects) and 24% crickets escaped successfully (compared with 62% in the case of intact insects). So, cerci play a major role in the detection of an approaching object but other mechanoreceptors or sensory modalities are implicated in this detection. It is not possible to assure that other sensory modalities participate (in the case of intact animals) in the behaviour; rather, than in the absence of cerci other sensory modalities can

  1. The influence of Mars' magnetic topology on atmospheric escape

    Science.gov (United States)

    Curry, S.; Luhmann, J. G.; DiBraccio, G. A.; Dong, C.; Xu, S.; Mitchell, D.; Gruesbeck, J.; Espley, J. R.; Connerney, J. E. P.; McFadden, J. P.; Ma, Y. J.; Brain, D.

    2017-12-01

    At weakly magnetized planets such as Mars and Venus, the solar wind directly interacts with the upper atmosphere where ions can be picked up and swept away by the background convection electric field. These pick-up ions have a gyroradius on the planetary scale that is largely dominated by the interplanetary magnetic field (IMF). But at Mars, their trajectory is also influenced by the existence of remanent crustal magnetic fields, which are thought to create a shielding effect for escaping planetary ions when they are on the dayside. Consequently, the magnetic topology changes at Mars as magnetic reconnection occurs between the draped (IMF) and the crustal magnetic fields (closed). The resulting topology includes open field lines in the solar wind with one footprint attached to the planet. Using magnetohydrodynamic (MHD) and test particle simulations, we will explore the influence of the magnetic topology on ion escape. We will present escape rates for planetary ions for different crustal field positions during different IMF configurations, with +/-BY and +/-BZ components in the Mars Sun Orbit (MSO) coordinate system. We will also compare global maps of ion outflow and escape with open / closed magnetic field line maps and compare our results with ion fluxes and magnetic field data from the Mars Atmospheric and Volatile EvolutioN (MAVEN) mission. Our results relating the dynamic magnetic field topology at Mars and planetary ion escape are an important aspect of magnetospheric physics and planetary evolution, both of which have applications to our own solar system and the increasing number of exoplanets discovered every year.

  2. Ultrastructural apoptotic lesions induced in rat thymocytes after borax ingestion.

    Science.gov (United States)

    Sylvain, I C; Berry, J P; Galle, P

    1998-01-01

    Apoptosis has gained increasing attention in recent years. Several chemical compounds induce apoptotic lesions in the thymus. Male Wistar rats received 2000 ppm of borax (Na2B4O7.10H2O) in their food for 16 days. The rats were sacrificed 2, 5, 9, 12, 19, 21, 26 and 28 days after the beginning of treatment. Thymus samples of all rats were taken. A Philips EM 300 electron microscopy was used to study the ultrastructural morphology. Serious nuclear and cytoplasmic lesions were observed. Moreover, numerous macrophages containing apoptotic cells were present in the thymus. The alterations were observed from the 2nd to the 28th day. The extent of damage was much more important in the rats sacrificed 21, 26 and 28 days after borax ingestion.

  3. Macrophage Clearance of Apoptotic Cells: A Critical Assessment

    Directory of Open Access Journals (Sweden)

    Siamon Gordon

    2018-01-01

    Full Text Available As the body continues to grow and age, it becomes essential to maintain a balance between living and dying cells. Macrophages and dendritic cells play a central role in discriminating among viable, apoptotic, and necrotic cells, as selective and efficient phagocytes, without inducing inappropriate inflammation or immune responses. A great deal has been learnt concerning clearance receptors for modified and non-self-ligands on potential targets, mediating their eventual uptake, disposal, and replacement. In this essay, we assess current understanding of the phagocytic recognition of apoptotic cells within their tissue environment; we conclude that efferocytosis constitutes a more complex process than simply removal of corpses, with regulatory interactions between the target and effector cells, which determine the outcome of this homeostatic process.

  4. Enzyme detection by microfluidics

    DEFF Research Database (Denmark)

    2013-01-01

    Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...... by that enzyme...

  5. PDT-treated apoptotic cells induce macrophage synthesis NO

    Science.gov (United States)

    Song, S.; Xing, D.; Zhou, F. F.; Chen, W. R.

    2009-11-01

    Nitric oxide (NO) is a biologically active molecule which has multi-functional in different species. As a second messenger and neurotransmitter, NO is not only an important regulatory factor between cells' information transmission, but also an important messenger in cell-mediated immunity and cytotoxicity. On the other side, NO is involving in some diseases' pathological process. In pathological conditions, the macrophages are activated to produce a large quantity of nitric oxide synthase (iNOS), which can use L-arginine to produce an excessive amount of NO, thereby killing bacteria, viruses, parasites, fungi, tumor cells, as well as in other series of the immune process. In this paper, photofrin-based photodynamic therapy (PDT) was used to treat EMT6 mammary tumors in vitro to induce apoptotic cells, and then co-incubation both apoptotic cells and macrophages, which could activate macrophage to induce a series of cytotoxic factors, especially NO. This, in turn, utilizes macrophages to activate a cytotoxic response towards neighboring tumor cells. These results provided a new idea for us to further study the immunological mechanism involved in damaging effects of PDT, also revealed the important function of the immune effect of apoptotic cells in PDT.

  6. An Empirical Investigation of Time-Out with and without Escape Extinction to Treat Escape-Maintained Noncompliance

    Science.gov (United States)

    Everett, Gregory E.; Olmi, D. Joe; Edwards, Ron P.; Tingstrom, Daniel H.; Sterling-Turner, Heather E.; Christ, Theodore J.

    2007-01-01

    The present study evaluates the effectiveness of two time-out (TO) procedures in reducing escape-maintained noncompliance of 4 children. Noncompliant behavioral function was established via a functional assessment (FA), including indirect and direct descriptive procedures and brief confirmatory experimental analyses. Following FA, parents were…

  7. Caspase-2 mediated apoptotic and necrotic murine macrophage cell death induced by rough Brucella abortus.

    Directory of Open Access Journals (Sweden)

    Fang Chen

    Full Text Available Brucella species are Gram-negative, facultative intracellular bacteria that cause zoonotic brucellosis. Survival and replication inside macrophages is critical for establishment of chronic Brucella infection. Virulent smooth B. abortus strain 2308 inhibits programmed macrophage cell death and replicates inside macrophages. Cattle B. abortus vaccine strain RB51 is an attenuated rough, lipopolysaccharide O antigen-deficient mutant derived from smooth strain 2308. B. abortus rough mutant RA1 contains a single wboA gene mutation in strain 2308. Our studies demonstrated that live RB51 and RA1, but not strain 2308 or heat-killed Brucella, induced both apoptotic and necrotic cell death in murine RAW264.7 macrophages and bone marrow derived macrophages. The same phenomenon was also observed in primary mouse peritoneal macrophages from mice immunized intraperitoneally with vaccine strain RB51 using the same dose as regularly performed in protection studies. Programmed macrophage cell death induced by RB51 and RA1 was inhibited by a caspase-2 inhibitor (Z-VDVAD-FMK. Caspase-2 enzyme activation and cleavage were observed at the early infection stage in macrophages infected with RB51 and RA1 but not strain 2308. The inhibition of macrophage cell death promoted the survival of rough Brucella cells inside macrophages. The critical role of caspase-2 in mediating rough B. abortus induced macrophage cell death was confirmed using caspase-2 specific shRNA. The mitochondrial apoptosis pathway was activated in macrophages infected with rough B. abortus as demonstrated by increase in mitochondrial membrane permeability and the release of cytochrome c to cytoplasm in macrophages infected with rough Brucella. These results demonstrate that rough B. abortus strains RB51 and RA1 induce apoptotic and necrotic murine macrophage cell death that is mediated by caspase-2. The biological relevance of Brucella O antigen and caspase-2-mediated macrophage cell death in Brucella

  8. Caspase-2 mediated apoptotic and necrotic murine macrophage cell death induced by rough Brucella abortus.

    Science.gov (United States)

    Chen, Fang; He, Yongqun

    2009-08-28

    Brucella species are Gram-negative, facultative intracellular bacteria that cause zoonotic brucellosis. Survival and replication inside macrophages is critical for establishment of chronic Brucella infection. Virulent smooth B. abortus strain 2308 inhibits programmed macrophage cell death and replicates inside macrophages. Cattle B. abortus vaccine strain RB51 is an attenuated rough, lipopolysaccharide O antigen-deficient mutant derived from smooth strain 2308. B. abortus rough mutant RA1 contains a single wboA gene mutation in strain 2308. Our studies demonstrated that live RB51 and RA1, but not strain 2308 or heat-killed Brucella, induced both apoptotic and necrotic cell death in murine RAW264.7 macrophages and bone marrow derived macrophages. The same phenomenon was also observed in primary mouse peritoneal macrophages from mice immunized intraperitoneally with vaccine strain RB51 using the same dose as regularly performed in protection studies. Programmed macrophage cell death induced by RB51 and RA1 was inhibited by a caspase-2 inhibitor (Z-VDVAD-FMK). Caspase-2 enzyme activation and cleavage were observed at the early infection stage in macrophages infected with RB51 and RA1 but not strain 2308. The inhibition of macrophage cell death promoted the survival of rough Brucella cells inside macrophages. The critical role of caspase-2 in mediating rough B. abortus induced macrophage cell death was confirmed using caspase-2 specific shRNA. The mitochondrial apoptosis pathway was activated in macrophages infected with rough B. abortus as demonstrated by increase in mitochondrial membrane permeability and the release of cytochrome c to cytoplasm in macrophages infected with rough Brucella. These results demonstrate that rough B. abortus strains RB51 and RA1 induce apoptotic and necrotic murine macrophage cell death that is mediated by caspase-2. The biological relevance of Brucella O antigen and caspase-2-mediated macrophage cell death in Brucella pathogenesis and

  9. Elevated Liver Enzymes

    Science.gov (United States)

    Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...

  10. ESCAP holds training workshop to improve monitoring of reproductive health.

    Science.gov (United States)

    1998-01-01

    While governments in the ESCAP region have made significant efforts toward meeting the 1994 International Conference on Population and Development (ICPD) Program of Action recommendations to reorient and broaden reproductive health programs, obstacles related to the limited capacity of statistical systems for monitoring and evaluating progress in meeting ICPD goals have been problematic. With the goal of strengthening national capacities to monitor and evaluate comprehensive reproductive health programs, the Training Workshop on Improving the National Capacity for Monitoring Reproductive Health Programs was organized by ESCAP, with the financial support of the Netherlands. The workshop was held in Bangkok from November 23 to December 4, 1998, and attended by 15 participants from Cambodia, Laos, Mongolia, Myanmar, Nepal, Pakistan, and Vietnam. Participants were drawn from countries' ministries of health and national statistical agencies. Workshop participants valued the experience and look forward to receiving additional training in the field.

  11. Behavioral analysis of the escape response in larval zebrafish

    Science.gov (United States)

    Feng, Ruopei; Girdhar, Kiran; Chemla, Yann; Gruebele, Martin

    The behavior of larval zebrafish is of great interest because the limited number of locomotor neurons in larval zebrafish couples with its rich repertoire of movements as a vertebrate animal. Current research uses a priori-selected parameters to describe their swimming behavior while our lab has built a parameter-free model based on singular value decomposition analysis to characterize it. Our previous work has analyzed the free swimming of larval zebrafish and presented a different picture from the current classification of larval zebrafish locomotion. Now we are extending this work to the studies of their escape response to acoustic stimulus. Analysis has shown intrinsic difference in the locomotion between escape response and free swimming.

  12. Quantum and thermal phase escape in extended Josephson systems

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, A.

    2006-07-12

    In this work I examine phase escape in long annular Josephson tunnel junctions. The sine-Gordon equation governs the dynamics of the phase variable along the junction. This equation supports topological soliton solutions, which correspond to quanta of magnetic flux trapped in the junction barrier. For such Josephson vortices an effective potential is formed by an external magnetic field, while a bias current acts as a driving force. Both together form a metastable potential well, which the vortex is trapped in. When the driving force exceeds the pinning force of the potential, the vortex escapes and the junction switches to the voltage state. At a finite temperature the driving force fluctuates. If the junction's energy scale is small, the phase variable can undergo a macroscopic quantum tunneling (MQT) process at temperatures below the crossover temperature. Without a vortex trapped, the metastable state is not a potential minimum in space, but a potential minimum at zero phase difference. (orig.)

  13. Fixation and escape times in stochastic game learning

    International Nuclear Information System (INIS)

    Realpe-Gomez, John; Szczesny, Bartosz; Galla, Tobias; Dall’Asta, Luca

    2012-01-01

    Evolutionary dynamics in finite populations is known to fixate eventually in the absence of mutation. We here show that a similar phenomenon can be found in stochastic game dynamical batch learning, and investigate fixation in learning processes in a simple 2×2 game, for two-player games with cyclic interaction, and in the context of the best-shot network game. The analogues of finite populations in evolution are here finite batches of observations between strategy updates. We study when and how such fixation can occur, and present results on the average time-to-fixation from numerical simulations. Simple cases are also amenable to analytical approaches and we provide estimates of the behaviour of so-called escape times as a function of the batch size. The differences and similarities with escape and fixation in evolutionary dynamics are discussed. (paper)

  14. Fractionation of noble gases by thermal escape from accreting planetesimals

    International Nuclear Information System (INIS)

    Donahue, T.M.

    1986-01-01

    Assuming solar initial elemental and isotopic ratios and a determination of the degree of fractionation occurring by competition between gravitational binding and escape, a model is developed for selective noble gas loss through escape during the growth of planetesimals to form the terrestrial planets. Of the two classes of planetesimals that can form on a time scale that is consistent with modern accretion models, one is depleted in neon while the other is neon-rich. The mechanism is noted to be capable of accounting for all known properties of the noble gas volatiles on the terrestrial planets, with only one exception, namely the Ar-36/Ar-38 ratios for Mars and the earth, which are much lower than observed. 11 references

  15. Library Lockdown: An escape room by kids for the community

    Directory of Open Access Journals (Sweden)

    Jennifer Thoegersen

    2016-11-01

    Full Text Available In Brief Hoping to bring the unexpected to Nebraska City, the Morton-James Public Library applied for an ALA Association for Library Service to Children Curiosity Creates grant to undertake an ambitious project: build an escape room. In a library storage room. With children. The hope was  by trying something completely different, we could increase interest in the library throughout the community and build a sense of ownership in the participants, while encouraging creativity and having a lot of fun. Library Lockdown was a four-month program that brought several dozen kids together—age 8 to 13—to build a fully-functioning escape room. Their creation, the Lab of Dr. Morton McBrains, is now open for business.

  16. Escape of Mars atmospheric carbon through time by photochemical means

    Science.gov (United States)

    Luhmann, J. G.; Kim, J.; Nagy, A. F.

    1993-01-01

    Luhmann et al. recently suggested that sputtering of the Martian atmosphere by re-entering O(+) pickup ions could have provided a significant route of escape for CO2 and its products throughout Mars' history. They estimated that the equivalent of C in an approximately 140-mbar CO2 atmosphere should have been lost this way if the Sun and solar wind evolved according to available models. Another source of escaping C (and O) that is potentially important is the dissociative recombination of ionospheric CO(+) near the exobase. We have evaluated the loss rates due to this process for 'ancient' solar EUV radiation fluxes of 1, 3, and 6 times the present flux in order to calculate the possible cumulative loss over the last 3.5 Gyr.

  17. State may be liable for HIV exposure from inmate's escape.

    Science.gov (United States)

    1999-09-03

    The Louisiana Court of Appeal is reviewing a case on whether the Louisiana prison system is liable to a private citizen who was exposed to HIV as a consequence of an inmate escape. The case questions whether the Department of Public Safety and Corrections had a duty to inform the local prison, where the inmate was transferred to, about his HIV infection and propensity to escape. The department requested a summary judgment stating that no such duty existed. This motion was rejected by the trial court. Affidavits were presented that questioned the facts and circumstances of the case. The department's duty to the prisoner and jail are in dispute and the trial court's denial has been deemed proper.

  18. The Endocannabinoid System Differentially Regulates Escape Behavior in Mice

    Directory of Open Access Journals (Sweden)

    Andreas J. Genewsky

    2017-10-01

    Full Text Available Among the hardwired behaviors, fear or survival responses certainly belong to the most evolutionary conserved ones. However, higher animals possess the ability to adapt to certain environments (e.g., novel foraging grounds, and, therefore, those responses need to be plastic. Previous studies revealed a cell-type specific role of the endocannabinoid system in novelty fear, conditioned fear and active vs. passive avoidance in a shuttle box paradigm. In this study we aim to investigate, whether knocking-out the cannabinoid receptor type-1 (CB1 on cortical glutamatergic (Glu-CB1−/− or GABAergic (GABA-CB1−/− neurons differentially affects the level of behavioral inhibition, which could ultimately lead to differences in escape behavior. In this context, we developed a novel behavioral paradigm, the Moving Wall Box (MWB. Using the MWB task we could show that Glu-CB1−/− mice have higher levels of behavioral inhibition over the course of repeated testing. GABA-CB1−/− mice, in contrast, showed significantly lower levels of behavioral inhibition compared to wild-type controls and more escape behavior. These changes in behavioral inhibition and escape behavior cannot be explained by altered levels of arousal, as repeated startle measurements revealed general habituation irrespective of the line and genotype of the animals. Taken together, we could show that CB1 on cortical glutamatergic terminals is important for the acquisition of active avoidance, as the absence of CB1 on these neurons creates a bias toward inhibitory avoidance. This is the case in situations without punishment such as electric footshocks. On the contrary CB1 receptors on GABAergic neurons mediate the acquisition of passive avoidance, as the absence of CB1 on those neurons establishes a strong bias toward escape behavior.

  19. UNESCO to blame:Reality or easy escape?

    OpenAIRE

    Pereira Roders, A Ana; Grigolon, AB Anna

    2015-01-01

    “UNESCO to blame” is a trend often observed in scholarly works. In those studies UNESCO is accused to privilege Eurocentric standards on heritage conservation. Is this reality or an easy escape? Can this trend be noted in other UNESCO reference texts? This article seeks to answer this question by studying the two main inscription-based conventions and their contribution to heritage management, while performing a data analysis on the countries behind these conventions, and their roles over tim...

  20. The escape of natural satellites from Mercury and Venus

    International Nuclear Information System (INIS)

    Kumar, S.S.

    1977-01-01

    It is suggested that the slow rotations of Mercury and Venus may be connected with the absence of natural satellites around them. If Mercury or Venus possessed a satellite at the time of formation, the tidal evolution would have caused the satellite to recede. At a sufficiently large distance from the planet, the Sun's gravitational influence makes the satellite orbit unstable. The natural satellites of Mercury and Venus might have escaped as a consequence of this instability. (Auth.)

  1. Oxygen and carbogen breathing following simulated submarine escape.

    Science.gov (United States)

    Gennser, Mikael; Loveman, Geoff; Seddon, Fiona; Thacker, Julian; Blogg, S Lesley

    2014-01-01

    Escape from a disabled submarine exposes escapers to a high risk of decompression sickness (DCS). The initial bubble load is thought to emanate from the fast tissues; it is this load that should be lowered to reduce risk of serious neurological DCS. The breathing of oxygen or carbogen (5% CO2, 95% O2) post-surfacing was investigated with regard to its ability to reduce the initial bubble load in comparison to air breathing. Thirty-two goats were subject to a dry simulated submarine escape profile to and from 240 meters (2.5 MPa). On surfacing, they breathed air (control), oxygen or carbogen for 30 minutes. Regular Doppler audio bubble grading was carried out, using the Kisman Masurel (KM) scale. One suspected case of DCS was noted. No oxygen toxicity or arterial gas embolism occurred. No significant difference was found between the groups in terms of the median peak KM grade or the period before the KM grade dropped below III. Time to disappearance of bubbles was significantly different between groups; oxygen showed faster bubble resolution than carbogen and air. This reduction in time to bubble resolution may be beneficial in reducing decompression stress, but probably does not affect the risk of fast-tissue DCS.

  2. Effective climate-energy solutions, escape routes and peak oil

    International Nuclear Information System (INIS)

    Bergh, Jeroen C.J.M. van den

    2012-01-01

    Many well-intended climate-energy strategies are ineffective in the absence of serious environmental regulation. This holds, among others, for direct support of clean energy, voluntary energy conservation, technical standards on a limited set of products, unilateral stringent carbon pricing, and awaiting peak oil as a climate strategy. All of these suffer from “escape routes” that indirectly increase CO 2 emissions and thus make the original strategy ineffective. On the other hand, environmental regulation alone may lead to a myopia-bias, stimulating early dominance of cost-effective technologies and a focus on incremental innovations associated with such technologies rather than on radical innovations. Although adopting a partial viewpoint keeps the analysis simple, we urgently need a more inclusive systems perspective on climate solutions. This will allow the formulation of an effective climate policy package that addresses the various escape routes. - Highlights: ► Many well-intended climate-energy strategies are ineffective because of escape routes. ► In this context the relationship between peak oil and climate policy receives attention. ► Environmental regulation alone creates myopia-bias, the resolution of which requires technology-specific policies. ► To formulate an effective climate policy package an inclusive systems perspective is needed.

  3. Transitions between three swimming gaits in Paramecium escape.

    Science.gov (United States)

    Hamel, Amandine; Fisch, Cathy; Combettes, Laurent; Dupuis-Williams, Pascale; Baroud, Charles N

    2011-05-03

    Paramecium and other protists are able to swim at velocities reaching several times their body size per second by beating their cilia in an organized fashion. The cilia beat in an asymmetric stroke, which breaks the time reversal symmetry of small scale flows. Here we show that Paramecium uses three different swimming gaits to escape from an aggression, applied in the form of a focused laser heating. For a weak aggression, normal swimming is sufficient and produces a steady swimming velocity. As the heating amplitude is increased, a higher acceleration and faster swimming are achieved through synchronized beating of the cilia, which begin by producing oscillating swimming velocities and later give way to the usual gait. Finally, escape from a life-threatening aggression is achieved by a "jumping" gait, which does not rely on the cilia but is achieved through the explosive release of a group of trichocysts in the direction of the hot spot. Measurements through high-speed video explain the role of trichocysts in defending against aggressions while showing unexpected transitions in the swimming of microorganisms. These measurements also demonstrate that Paramecium optimizes its escape pattern by taking advantage of its inertia.

  4. Biocatalytic Single Enzyme Nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Grate, Jay W.; Kim, Jungbae

    2004-03-31

    As an innovative way of enzyme stabilization, we recently developed a new enzyme composite of nano-meter scale that we call "single-enzyme nanoparticles (SENs)" (9). Each enzyme molecule is surrounded with a porous composite organic/inorganic network of less than a few nanometers think. This approach represents a new type of enzyme-containing nanostructure. In experiments with perotease (chymotrypsin, CT), the activity of single enzyme nanoparticle form of the enzyme was greatly stabilized compared to the free form, without imposing a serious mass transfer limitation of substrates. In this chapter we will describe the synthesis, characterization and catalytic activity of the new SENs.

  5. Diversity of the Lyman continuum escape fractions of high-z galaxies and its origins

    Science.gov (United States)

    Sumida, Takumi; Kashino, Daichi; Hasegawa, Kenji

    2018-04-01

    The Lyman continuum (LyC) escape fraction is a key quantity to determine the contribution of galaxies to cosmic reionization. It has been known that the escape fractions estimated by observations and numerical simulations show a large diversity. However, the origins of the diversity are still uncertain. In this work, to understand what quantities of galaxies are responsible for controlling the escape fraction, we numerically evaluate the escape fraction by performing ray-tracing calculation with simplified disc galaxy models. With a smooth disc model, we explore the dependence of the escape fraction on the disposition of ionizing sources and find that the escape fraction varies up to ˜3 orders of magnitude. It is also found that the halo mass dependence of disc scale height determines whether the escape fraction increases or decreases with halo mass. With a clumpy disc model, it turns out that the escape fraction increases as the clump mass fraction increases because the density in the inter-clump region decreases. In addition, we find that clumpiness regulates the escape fraction via two ways when the total clump mass dominates the total gas mass; the escape fraction is controlled by the covering factor of clumps if the clumps are dense sufficient to block LyC photons, otherwise the clumpiness works to reduce the escape fraction by increasing the total number of recombination events in a galaxy.

  6. Synergistic effect of aluminum and ionizing radiation upon ultrastructure, oxidative stress and apoptotic alterations in Paneth cells of rat intestine.

    Science.gov (United States)

    Eltahawy, N A; Elsonbaty, S M; Abunour, S; Zahran, W E

    2017-03-01

    Environmental and occupational exposure to aluminum along with ionizing radiation results in serious health problems. This study was planned to investigate the impact of oxidative stress provoked by exposure to ionizing radiation with aluminum administration upon cellular ultra structure and apoptotic changes in Paneth cells of rat small intestine . Animals received daily aluminum chloride by gastric gavage at a dose 0.5 mg/Kg BW for 4 weeks. Whole body gamma irradiation was applied at a dose 2 Gy/week up to 8 Gy. Ileum malondialdehyde, advanced oxidative protein products, protein carbonyl and tumor necrosis factor-alpha were assessed as biomarkers of lipid peroxidation, protein oxidation and inflammation respectively along with superoxide dismutase, catalase, and glutathione peroxidase activities as enzymatic antioxidants. Moreover, analyses of cell cycle division and apoptotic changes were evaluated by flow cytometry. Intestinal cellular ultra structure was investigated using transmission electron microscope.Oxidative and inflammatory stresses assessment in the ileum of rats revealed that aluminum and ionizing radiation exposures exhibited a significant effect upon the increase in oxidative stress biomarkers along with the inflammatory marker tumor necrosis factor-α accompanied by a significant decreases in the antioxidant enzyme activities. Flow cytometric analyses showed significant alterations in the percentage of cells during cell cycle division phases along with significant increase in apoptotic cells. Ultra structurally, intestinal cellular alterations with marked injury in Paneth cells at the sites of bacterial translocation in the crypt of lumens were recorded. The results of this study have clearly showed that aluminum and ionizing radiation exposures induced apoptosis with oxidative and inflammatory disturbance in the Paneth cells of rat intestine, which appeared to play a major role in the pathogenesis of cellular damage. Furthermore, the

  7. Histone deacetylase inhibitor upregulates peroxisomal fatty acid oxidation and inhibits apoptotic cell death in abcd1-deficient glial cells.

    Science.gov (United States)

    Singh, Jaspreet; Khan, Mushfiquddin; Pujol, Aurora; Baarine, Mauhamad; Singh, Inderjit

    2013-01-01

    In X-ALD, mutation/deletion of ALD gene (ABCD1) and the resultant very long chain fatty acid (VLCFA) derangement has dramatically opposing effects in astrocytes and oligodendrocytes. While loss of Abcd1 in astrocytes produces a robust inflammatory response, the oligodendrocytes undergo cell death leading to demyelination in X-linked adrenoleukodystrophy (X-ALD). The mechanisms of these distinct pathways in the two cell types are not well understood. Here, we investigated the effects of Abcd1-knockdown and the subsequent alteration in VLCFA metabolism in human U87 astrocytes and rat B12 oligodendrocytes. Loss of Abcd1 inhibited peroxisomal β-oxidation activity and increased expression of VLCFA synthesizing enzymes, elongase of very long chain fatty acids (ELOVLs) (1 and 3) in both cell types. However, higher induction of ELOVL's in Abcd1-deficient B12 oligodendrocytes than astrocytes suggests that ELOVL pathway may play a prominent role in oligodendrocytes in X-ALD. While astrocytes are able to maintain the cellular homeostasis of anti-apoptotic proteins, Abcd1-deletion in B12 oligodendrocytes downregulated the anti-apototic (Bcl-2 and Bcl-xL) and cell survival (phospho-Erk1/2) proteins, and upregulated the pro-apoptotic proteins (Bad, Bim, Bax and Bid) leading to cell loss. These observations provide insights into different cellular signaling mechanisms in response to Abcd1-deletion in two different cell types of CNS. The apoptotic responses were accompanied by activation of caspase-3 and caspase-9 suggesting the involvement of mitochondrial-caspase-9-dependent mechanism in Abcd1-deficient oligodendrocytes. Treatment with histone deacetylase (HDAC) inhibitor suberoylanilide hydroxamic acid (SAHA) corrected the VLCFA derangement both in vitro and in vivo, and inhibited the oligodendrocytes loss. These observations provide a proof-of principle that HDAC inhibitor SAHA may have a therapeutic potential for X-ALD.

  8. Histone deacetylase inhibitor upregulates peroxisomal fatty acid oxidation and inhibits apoptotic cell death in abcd1-deficient glial cells.

    Directory of Open Access Journals (Sweden)

    Jaspreet Singh

    Full Text Available In X-ALD, mutation/deletion of ALD gene (ABCD1 and the resultant very long chain fatty acid (VLCFA derangement has dramatically opposing effects in astrocytes and oligodendrocytes. While loss of Abcd1 in astrocytes produces a robust inflammatory response, the oligodendrocytes undergo cell death leading to demyelination in X-linked adrenoleukodystrophy (X-ALD. The mechanisms of these distinct pathways in the two cell types are not well understood. Here, we investigated the effects of Abcd1-knockdown and the subsequent alteration in VLCFA metabolism in human U87 astrocytes and rat B12 oligodendrocytes. Loss of Abcd1 inhibited peroxisomal β-oxidation activity and increased expression of VLCFA synthesizing enzymes, elongase of very long chain fatty acids (ELOVLs (1 and 3 in both cell types. However, higher induction of ELOVL's in Abcd1-deficient B12 oligodendrocytes than astrocytes suggests that ELOVL pathway may play a prominent role in oligodendrocytes in X-ALD. While astrocytes are able to maintain the cellular homeostasis of anti-apoptotic proteins, Abcd1-deletion in B12 oligodendrocytes downregulated the anti-apototic (Bcl-2 and Bcl-xL and cell survival (phospho-Erk1/2 proteins, and upregulated the pro-apoptotic proteins (Bad, Bim, Bax and Bid leading to cell loss. These observations provide insights into different cellular signaling mechanisms in response to Abcd1-deletion in two different cell types of CNS. The apoptotic responses were accompanied by activation of caspase-3 and caspase-9 suggesting the involvement of mitochondrial-caspase-9-dependent mechanism in Abcd1-deficient oligodendrocytes. Treatment with histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA corrected the VLCFA derangement both in vitro and in vivo, and inhibited the oligodendrocytes loss. These observations provide a proof-of principle that HDAC inhibitor SAHA may have a therapeutic potential for X-ALD.

  9. Antiproliferative and apoptotic effects of xanthohumol in cholangiocarcinoma.

    Science.gov (United States)

    Walden, Daniel; Kunnimalaiyaan, Selvi; Sokolowski, Kevin; Clark, T Gamblin; Kunnimalaiyaan, Muthusamy

    2017-10-20

    Cholangiocarcinoma remains the second most prevalent hepatic neoplasm in the United States with a 5-year survival rate of less than 10%. Currently, no systemic therapy has demonstrated efficacy. Therefore, an urgent need for the identification of molecularly targeted compound(s) remains. The Notch signaling pathway has been shown to be dysregulated in cholangiocarcinoma, exhibiting hyperactivity while also possibly mediating chemotherapeutic resistance. We analyzed the effects of xanthohumol, a prenylated chalcone, on cholangiocarcinoma proliferation utilizing human cholangiocarcinoma cell lines CCLP1, SG-231 and CC-SW-1 while gaining insight into the associated mechanism. Xanthohumol potently reduced cellular proliferation, colony formation, and cell confluency in all three cell lines. Xanthohumol induced cell cycle arrest as well as apoptosis through the reduction of cell cycle regulatory proteins as well as an increase in pro-apoptotic markers (cleaved poly ADP ribose polymerase, cleaved caspase-3) and a decrease in anti-apoptotic markers (X-linked inhibitor of apoptosis and survivin). At the molecular level, xanthohumol reduced Notch1 and AKT expression in a step-wise and time-dependent fashion, with Notch1 reductions preceding AKT. Additionally, xanthohumol reduced cholangiocarcinoma growth in both CCLP-1 and SG-231 derived mice xenografts. In summary, we show that xanthohumol significantly reduced cholangiocarcinoma growth through the Notch1/AKT signaling axis. Furthermore, known pharmacokinetics and bioavailability of XN supports continued development of treatment for cholangiocarcinoma.

  10. A stapled BIM peptide overcomes apoptotic resistance in hematologic cancers

    Science.gov (United States)

    LaBelle, James L.; Katz, Samuel G.; Bird, Gregory H.; Gavathiotis, Evripidis; Stewart, Michelle L.; Lawrence, Chelsea; Fisher, Jill K.; Godes, Marina; Pitter, Kenneth; Kung, Andrew L.; Walensky, Loren D.

    2012-01-01

    Cancer cells subvert the natural balance between cellular life and death, achieving immortality through pathologic enforcement of survival pathways and blockade of cell death mechanisms. Pro-apoptotic BCL-2 family proteins are frequently disarmed in relapsed and refractory cancer through genetic deletion or interaction-based neutralization by overexpressed antiapoptotic proteins, resulting in resistance to chemotherapy and radiation treatments. New pharmacologic strategies are urgently needed to overcome these formidable apoptotic blockades. We harnessed the natural killing activity of BCL-2–interacting mediator of cell death (BIM), which contains one of the most potent BH3 death domains of the BCL-2 protein family, to restore BH3-dependent cell death in resistant hematologic cancers. A hydrocarbon-stapled peptide modeled after the BIM BH3 helix broadly targeted BCL-2 family proteins with high affinity, blocked inhibitory antiapoptotic interactions, directly triggered proapoptotic activity, and induced dose-responsive and BH3 sequence–specific cell death of hematologic cancer cells. The therapeutic potential of stapled BIM BH3 was highlighted by the selective activation of cell death in the aberrant lymphoid infiltrates of mice reconstituted with BIM-deficient bone marrow and in a human AML xenograft model. Thus, we found that broad and multimodal targeting of the BCL-2 family pathway can overcome pathologic barriers to cell death. PMID:22622039

  11. Apoptotic-like programmed cell death in plants.

    Science.gov (United States)

    Reape, Theresa J; McCabe, Paul F

    2008-01-01

    Programmed cell death (PCD) is now accepted as a fundamental cellular process in plants. It is involved in defence, development and response to stress, and our understanding of these processes would be greatly improved through a greater knowledge of the regulation of plant PCD. However, there may be several types of PCD that operate in plants, and PCD research findings can be confusing if they are not assigned to a specific type of PCD. The various cell-death mechanisms need therefore to be carefully described and defined. This review describes one of these plant cell death processes, namely the apoptotic-like PCD (AL-PCD). We begin by examining the hallmark 'apoptotic-like' features (protoplast condensation, DNA degradation) of the cell's destruction that are characteristic of AL-PCD, and include examples of AL-PCD during the plant life cycle. The review explores the possible cellular 'executioners' (caspase-like molecules; mitochondria; de novo protein synthesis) that are responsible for the hallmark features of the cellular destruction. Finally, senescence is used as a case study to show that a rigorous definition of cell-death processes in plant cells can help to resolve arguments that occur in the scientific literature regarding the timing and control of plant cell death.

  12. Apoptotic potential and cell sensitivity to fractionated radiotherapy

    International Nuclear Information System (INIS)

    Rupnow, Brent A.; Murtha, Albert D.; Alarcon, Rodolfo M.; Giaccia, Amato J.; Knox, Susan J.

    1997-01-01

    Purpose/Objective: At present, the relationship between sensitivity to radiation-induced apoptosis and overall cellular radiosensitivity remains unclear. In particular, the relationship of apoptotic sensitivity to the survival of cells following fractionated irradiation has not been well studied. The purpose of the present study was to determine if increasing cell sensitivity to radiation-induced apoptosis would result in decreased clonogenic survival following single dose and fractionated irradiation in vitro. Materials and Methods: To address this, we chose a cell line (Rat-1MycER) in which the sensitivity to radiation-induced apoptosis could be altered by switching on or off the activity of a conditional c-Myc allele (c-MycER). The c-MycER construct expresses a full length c-Myc protein fused to a modified hormone binding domain of the estrogen receptor. Only in the presence of the estrogen analog 4-hydroxytamoxifen (4HT), does the conditional c-MycER become active. Apoptosis following irradiation in these cells (with and without c-MycER activation) was analyzed by flow cytometry to determine the percentage of cells undergoing apoptosis following various radiation doses and at different times after irradiation. Additionally, clonogenic survival analysis was performed following single radiation doses from 0 to 10 Gy and following five fractions of 2 or 4 Gy each. Survival of cells with and without c-MycER activation was compared. Furthermore, the effect of overexpressing the anti-apoptotic Bcl-2 gene on apoptosis induction and clonogenic survival of these cells was examined. Results: Rat-1MycER cells were strongly sensitized to radiation-induced apoptosis in a dose and time dependent manner when MycER was activated relative to cells treated without c-MycER activation. This c-Myc-mediated sensitivity to radiation-induced apoptosis was suppressed by overexpression of the anti-apoptotic protein Bcl-2. In addition to increasing apoptosis, activating c-MycER prior to

  13. Propofol inhibits burn injury-induced hyperpermeability through an apoptotic signal pathway in microvascular endothelial cells

    OpenAIRE

    K.Y. Tian; X.J. Liu; J.D. Xu; L.J. Deng; G. Wang

    2015-01-01

    Recent studies have revealed that an intrinsic apoptotic signaling cascade is involved in vascular hyperpermeability and endothelial barrier dysfunction. Propofol (2,6-diisopropylphenol) has also been reported to inhibit apoptotic signaling by regulating mitochondrial permeability transition pore (mPTP) opening and caspase-3 activation. Here, we investigated whether propofol could alleviate burn serum-induced endothelial hyperpermeability through the inhibition of the intrinsic apoptotic sign...

  14. The ENZYME data bank.

    Science.gov (United States)

    Bairoch, A

    1994-09-01

    The ENZYME data bank is a repository of information relative to the nomenclature of enzymes. It is primarily based on the recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (IUBMB) and it contains the following data for each type of characterized enzyme for which an EC (Enzyme Commission) number has been provided: EC number Recommended name Alternative names (if any) Catalytic activity Cofactors (if any) Pointers to the SWISS-PROT protein sequence entrie(s) that correspond to the enzyme (if any) Pointers to human disease(s) associated with a deficiency of the enzyme (if any).

  15. Escaping the Self: Identity, Group Identification and Violence

    Directory of Open Access Journals (Sweden)

    James Hardie-Bick

    2016-12-01

    Full Text Available This article draws on the early work of Erich Fromm. In Escape from Freedom Fromm (1969 [1941] directly addressed the psychological mechanisms of escape modern individuals employ to protect themselves from feelings of ontological insecurity and existential estrangement. The article builds on Fromm’s analysis by discussing the significance of his escape mechanisms for understanding the dynamic psychological attractions of identifying with entitative groups. Fromm’s work will be discussed in relation to Hogg’s recent work on uncertainty-identity theory. The aim of the article is to examine the advantages of combining Fromm’s psychoanalytic analysis with Hogg’s uncertainty-identity theory and to highlight the potential this approach has for understanding why groups engage in violent and destructive behaviour. Este artículo se inspira en las primeras obras de Erich Fromm. En El miedo a la libertad, Fromm (1969 [1941] abordó directamente los mecanismos psicológicos de evasión que los individuos modernos emplean para protegerse de los sentimientos de inseguridad ontológica y distanciamiento existencial. Este artículo se basa en el análisis de Fromm exponiendo el significado de sus mecanismos de evasión para entender las atracciones psicológicas dinámicas de identificación con grupos entitativos. Se analizará la obra de Fromm en relación con la obra reciente de Hogg sobre la teoría de incertidumbre identitaria. El objetivo del artículo es examinar las ventajas de combinar el análisis psicoanalítico de Fromm con la teoría de incertidumbre identitaria de Hogg, y destacar el potencial que tiene esta aproximación para comprender por qué los grupos adoptan un comportamiento violento y destructivo. DOWNLOAD THIS PAPER FROM SSRN: https://ssrn.com/abstract=2875737

  16. A domain in human EXOG converts apoptotic endonuclease to DNA-repair exonuclease

    Energy Technology Data Exchange (ETDEWEB)

    Szymanski, Michal R.; Yu, Wangsheng; Gmyrek, Aleksandra M.; White, Mark A.; Molineux, Ian J.; Lee, J. Ching; Yin, Y. Whitney

    2017-05-03

    Human EXOG (hEXOG) is a 5'-exonuclease that is crucial for mitochondrial DNA repair; the enzyme belongs to a nonspecific nuclease family that includes the apoptotic endonuclease EndoG. Here we report biochemical and structural studies of hEXOG, including structures in its apo form and in a complex with DNA at 1.81 and 1.85 Å resolution, respectively. A Wing domain, absent in other ββα-Me members, suppresses endonuclease activity, but confers on hEXOG a strong 5'-dsDNA exonuclease activity that precisely excises a dinucleotide using an intrinsic ‘tape-measure’. The symmetrical apo hEXOG homodimer becomes asymmetrical upon binding to DNA, providing a structural basis for how substrate DNA bound to one active site allosterically regulates the activity of the other. These properties of hEXOG suggest a pathway for mitochondrial BER that provides an optimal substrate for subsequent gap-filling synthesis by DNA polymerase γ.

  17. Effects of cinnamon (Cinnamomum zeylanicum) bark oil on testicular antioxidant values, apoptotic germ cell and sperm quality.

    Science.gov (United States)

    Yüce, A; Türk, G; Çeribaşi, S; Sönmez, M; Çiftçi, M; Güvenç, M

    2013-08-01

    Cinnamon and its contents have multifactorial properties such as antioxidant, anti-inflammatory and antidiabetic. Male infertility is one of the major health problems in life. The aim of this study was to investigate the effects of long-term cinnamon bark oil (CBO) ingestion on testicular antioxidant values, apoptotic germ cell and sperm quality of adult rats. Twelve male healthy Wistar rats were divided into two groups, each group containing six rats. While olive oil was given to control group, 100 mg kg(-1)  CBO was administered to the other group by gavage daily for 10 weeks. Body and reproductive organ weights, sperm characteristics, testicular lipid peroxidation and antioxidant enzyme activities, and testicular apoptosis via terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL) method were examined. A significant decrease in malondialdehyde level and marked increases in reduced glutathione level, glutathione peroxidase and catalase activities were observed in rats treated with CBO compared with the control group. CBO consumption provided a significant increase in weights of testes and epididymides, epididymal sperm concentration, sperm motility and diameter of seminiferous tubules when compared with the control group. However, CBO consumption tended to decrease the abnormal sperm rate and apoptotic germ cell count, but it did not reach statistical significance. It is concluded that CBO has improvement effect on testicular oxidant-antioxidant balance and sperm quality, and its consumption may be useful for asthenozoospermic men. © 2012 Blackwell Verlag GmbH.

  18. Enhanced Antiproliferative and Pro-apoptotic Activities of a Novel Curcumin-related Compound in Jurkat Leukemia T-Cells.

    Science.gov (United States)

    Goldhahn, Katrin; Hintersteininger, Michael; Steiner, Guenter; Erker, Thomas; Kloesch, Burkhard

    2015-05-01

    Inhibition of arachidonic acid metabolism by curcumin has been suggested to be a key mechanism for its anti-carcinogenic action. Recently, we reported on the synthesis of curcumin analogues and their evaluation as selective COX1 inhibitors. Two compounds (HP109/HP102) were selected for evaluation of their anti-proliferative and pro-apoptotic potential in Jurkat T-cells. Jurkat T-cells were stimulated with phorbol 12-myristate 13-acetate/phytohemagglutinin (PMA/PHA) in the absence and presence of different concentrations of curcumin or HP109/HP102. Interleukin 2 (IL2) production and IL2 promoter activity were analyzed by enzyme-linked immunosorbent assay and a luciferase reporter assay, respectively. Proliferation and cell viability were monitored by 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide assay, annexin -V/7-amino-actinomycin D staining and western blotting. HP102 was about 10-times more effective in blocking IL2 synthesis compared to curcumin. Enhanced effects of HP102 were also observed in reducing the proliferation rate and cell viability. In contrast to HP102, HP109 did not exhibit enhanced effects compared to curcumin. The curcumin analog HP102 had strongly improved the anti-proliferative and pro-apoptotic potential in Jurkat T-cells compared to curcumin. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Macrophage-Derived Protein S Facilitates Apoptotic Polymorphonuclear Cell Clearance by Resolution Phase Macrophages and Supports Their Reprogramming.

    Science.gov (United States)

    Lumbroso, Delphine; Soboh, Soaad; Maimon, Avi; Schif-Zuck, Sagie; Ariel, Amiram; Burstyn-Cohen, Tal

    2018-01-01

    The complete resolution of inflammation requires the uptake of apoptotic polymorphonuclear cells (PMN) by local macrophages (efferocytosis) and the consequent reprogramming of the engulfing phagocytes to reparative and pro-resolving phenotypes. The tyrosine kinase receptors TYRO3, AXL, and MERTK (collectively named TAM) are fundamental mediators in regulating inflammatory responses and efferocytosis. Protein S (PROS1) is a ligand for all TAM receptors that mediates various aspects of their activity. However, the involvement of PROS1 in the resolution of inflammation is incompletely understood. Here, we report the upregulation of Pros1 in macrophages during the resolution of inflammation. Selective knockout of Pros1 in the myeloid lineage significantly downregulated macrophage pro-resolving properties. Hence, Pros1 -deficient macrophages engulfed fewer apoptotic PMN remnants in vivo , and exogenous PROS1 rescued impaired efferocytosis ex vivo . Moreover, Pros1 -deficient peritoneal macrophages secreted higher levels of the pro-inflammatory mediators TNFα and CCL3, while they secreted lower levels of the reparative/anti-inflammatory IL-10 following exposure to lipopolysaccharide in comparison to their WT counterparts. Moreover, Pros1 -deficient macrophages expressed less of the anti-inflammatory/pro-resolving enzymes arginase-1 and 12/15-lipoxygenase and produced less of the specialized pro-resolving mediator resolvin D1. Altogether, our results suggest that macrophage-derived PROS1 is an important effector molecule in regulating the efferocytosis, maturation, and reprogramming of resolution phase macrophages, and imply that PROS1 could provide a new therapeutic target for inflammatory and fibrotic disorders.

  20. PKC{eta} confers protection against apoptosis by inhibiting the pro-apoptotic JNK activity in MCF-7 cells

    Energy Technology Data Exchange (ETDEWEB)

    Rotem-Dai, Noa; Oberkovitz, Galia; Abu-Ghanem, Sara [The Schraga Segal Department of Microbiology and Immunology, Faculty of Health Sciences and the Cancer Research Center, Ben - Gurion University, Beer Sheva 84105 (Israel); Livneh, Etta, E-mail: etta@bgumail.bgu.ac.il [The Schraga Segal Department of Microbiology and Immunology, Faculty of Health Sciences and the Cancer Research Center, Ben - Gurion University, Beer Sheva 84105 (Israel)

    2009-09-10

    Apoptosis is frequently regulated by different protein kinases including protein kinase C family enzymes. Both inhibitory and stimulatory effects were demonstrated for several of the different PKC isoforms. Here we show that the novel PKC isoform, PKC{eta}, confers protection against apoptosis induced by the DNA damaging agents, UVC irradiation and the anti-cancer drug - Camptothecin, of the breast epithelial adenocarcinoma MCF-7 cells. The induced expression of PKC{eta} in MCF-7 cells, under the control of the tetracycline-responsive promoter, resulted in increased cell survival and inhibition of cleavage of the apoptotic marker PARP-1. Activation of caspase-7 and 9 and the release of cytochrome c were also inhibited by the inducible expression of PKC{eta}. Furthermore, JNK activity, required for apoptosis in MCF-7, as indicated by the inhibition of both caspase-7 cleavage and cytochrome c release from the mitochondria in the presence of the JNK inhibitor SP600125, was also suppressed by PKC{eta} expression. Hence, in contrast to most PKC isoforms enhancing JNK activation, our studies show that PKC{eta} is an anti-apoptotic protein, acting as a negative regulator of JNK activity. Thus, PKC{eta} could represent a target for intervention aimed to reduce resistance to anti-cancer treatments.

  1. An isoelectrically trapped enzyme reactor operating in an electric field.

    Science.gov (United States)

    Righetti, P G; Bossi, A

    1998-06-01

    Membrane enzyme reactors constitute an attempt at integrating catalytic conversion, product separation and/or concentration and catalyst recovery into a single operation. Whereas conventional membrane reactors confine an enzyme, in a free form, to one side of a membrane by size exclusion, electrostatic repulsion, or physical or chemical immobilization onto an intermediate support (gel, liposome), the membrane reactor here described is shown to operate under an entirely new principle: enzyme confinement into an isoelectric trap located in a multicompartment electrolyzer operating in an electric field. Two isoelectric membranes, having pI values encompassing both the enzyme pI and the pH of its optimum of activity, act by continuously titrating the enzyme trapped inside, thus preventing it from escaping the reaction chamber. Charged products generated by the enzyme catalysis are continuously electrophoretically transported away from the reaction chamber and collected into other chambers stacked either towards the cathodic or anodic sides. In a urease reactor, ammonia is continuously harvested towards the cathode, thus allowing >95% substrate consumption with maintenance of enzyme integrity over much longer time periods than in a batch reactor. In a trypsin reactor, casein is digested and biologically active peptides are continuously harvested in a pure form into appropriate isoelectric traps. In a third example, pure D-phenylglycine is produced from a racemate mixture, via an acylation reaction onto a cosubstrate (the ester methyl-4-hydroxyphenyl acetate), brought about by the enzyme penicillin G acylase.

  2. Reduced DICER1 Expression Bestows Rheumatoid Arthritis Synoviocytes Proinflammatory Properties and Resistance to Apoptotic Stimuli.

    Science.gov (United States)

    Alsaleh, Ghada; Nehmar, Ramzi; Blüml, Stephan; Schleiss, Cédric; Ostermann, Eleonore; Dillenseger, Jean-Philippe; Sayeh, Amira; Choquet, Philippe; Dembele, Doulaye; Francois, Antoine; Salmon, Jean-Hugues; Paul, Nicodème; Schabbauer, Gernot; Bierry, Guillaume; Meyer, Alain; Gottenberg, Jacques-Eric; Haas, Gabrielle; Pfeffer, Sebastien; Vallat, Laurent; Sibilia, Jean; Bahram, Seiamak; Georgel, Philippe

    2016-08-01

    While the regulatory role of individual microRNAs (miRNAs) in rheumatoid arthritis (RA) is well established, the role of DICER1 in the pathogenesis of the disease has not yet been investigated. The purpose of this study was to analyze the expression of factors involved in miRNA biogenesis in fibroblast-like synoviocytes (FLS) from RA patients and to monitor the arthritis triggered by K/BxN serum transfer in mice deficient in the Dicer gene (Dicer(d/d) ). The expression of genes and precursor miRNAs was quantified by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). MicroRNA macroarray profiling was monitored by qRT-PCR. Cytokines were quantified by enzyme-linked immunosorbent assay. Experimental arthritis in mice was achieved by the transfer of serum from K/BxN donors. Apoptosis was quantified using an enzyme-linked immunosorbent assay. We found decreased DICER1 and mature miRNA expression in synovial fibroblasts from RA patients. These cells were hyperresponsive to lipopolysaccharide, as evidenced by their increased interleukin-6 secretion upon stimulation. Experimental serum-transfer arthritis in Dicer(d/d) mice confirmed that an unbalanced biogenesis of miRNAs correlated with an enhanced inflammatory response. Synoviocytes from both RA patients and Dicer(d/d) mice exhibited increased resistance to apoptotic stimuli. The findings of this study further substantiate the important role of DICER1 in the maintenance of homeostasis and the regulation of inflammatory responses. © 2016, American College of Rheumatology.

  3. Chases and escapes the mathematics of pursuit and evasion

    CERN Document Server

    Nahin, Paul J

    2012-01-01

    We all played tag when we were kids. What most of us don't realize is that this simple chase game is in fact an application of pursuit theory, and that the same principles of games like tag, dodgeball, and hide-and-seek are also at play in military strategy, high-seas chases by the Coast Guard, and even romantic pursuits. In Chases and Escapes, Paul Nahin gives us the first complete history of this fascinating area of mathematics, from its classical analytical beginnings to the present day. Drawing on game theory, geometry, linear algebra, target-tracking algorithms, and much

  4. Mechanisms of Pulmonary Escape and Dissemination by Cryptococcus neoformans

    Directory of Open Access Journals (Sweden)

    Steven T. Denham

    2018-02-01

    Full Text Available Cryptococcus neoformans is a common environmental saprophyte and human fungal pathogen that primarily causes disease in immunocompromised individuals. Similar to many environmentally acquired human fungal pathogens, C. neoformans initiates infection in the lungs. However, the main driver of mortality is invasive cryptococcosis leading to fungal meningitis. After C. neoformans gains a foothold in the lungs, a critical early step in invasion is transversal of the respiratory epithelium. In this review, we summarize current knowledge relating to pulmonary escape. We focus on fungal factors that allow C. neoformans to disseminate from the lungs via intracellular and extracellular routes.

  5. Diffusion escape through a cluster of small absorbing windows

    Energy Technology Data Exchange (ETDEWEB)

    Holcman, D [Department of Mathematics, Weizmann Institute of Science, Rehovot 76100 (Israel); Schuss, Z [Department of Mathematics, Tel-Aviv University, Tel-Aviv 69978 (Israel)

    2008-04-18

    We study the first eigenvalue of the Laplace equation in a bounded domain in R{sup d} (d=2,3) with mixed Neumann-Dirichlet (Zaremba) boundary conditions. The Neumann condition is imposed on most of the boundary and the Dirichlet boundary consists of a cluster of small windows. When the windows are well separated the first eigenvalue is asymptotically the sum of eigenvalues of mixed problems with a single Dirichlet window. However, when two or more Dirichlet windows cluster tightly together they interact nonlinearly. We compare our asymptotic approximation of the eigenvalue to the escape rate of simulated Brownian particles through the small windows.

  6. Dynamics of Periodic Impulsive Collision in Escapement Mechanism

    Directory of Open Access Journals (Sweden)

    Jian Mao

    2013-01-01

    Full Text Available Among various non-smooth dynamic systems, the periodically forced oscillation system with impact is perhaps the most common in engineering applications. The dynamical study becomes complicated due to the impact. This paper presents a systematic study on the periodically forced oscillation system with impact. A simplified model of the escapement mechanism is introduced. Impulsive differential equation and Poincare map are applied to describe the model and study the stability of the system. Numerical examples are given and the results show that the model is highly accurate in describing/predicting their dynamics.

  7. The mirror of the escaped God – Alejandra Pizarnik

    Directory of Open Access Journals (Sweden)

    Mariano Carou

    2015-04-01

    Full Text Available Alejandra Pizarnik (1936-1972 shows many different stands regarding to “God’s escape” in her poetry and his diaries: from the psalmist’s request to the more combative atheism. There is, however, a constant development of a symbolic constellation to speak about God’s mistery, and the certitude –inherited from German romanticism– that the poet has always something to say about God’s escape, searching for a new hope in which is maybe a new form of mysticism.

  8. The mirror of the escaped God – Alejandra Pizarnik

    OpenAIRE

    Carou, Mariano

    2015-01-01

    Alejandra Pizarnik (1936-1972) shows many different stands regarding to “God’s escape” in her poetry and his diaries: from the psalmist’s request to the more combative atheism. There is, however, a constant development of a symbolic constellation to speak about God’s mistery, and the certitude –inherited from German romanticism– that the poet has always something to say about God’s escape, searching for a new hope in which is maybe a new form of mysticism. Alejandra Pizarnik (1936-1972) mu...

  9. The mirror of the escaped God – Alejandra Pizarnik

    OpenAIRE

    Mariano Carou

    2015-01-01

    Alejandra Pizarnik (1936-1972) shows many different stands regarding to “God’s escape” in her poetry and his diaries: from the psalmist’s request to the more combative atheism. There is, however, a constant development of a symbolic constellation to speak about God’s mistery, and the certitude –inherited from German romanticism– that the poet has always something to say about God’s escape, searching for a new hope in which is maybe a new form of mysticism.

  10. Test of time: what if little Albert had escaped?

    Science.gov (United States)

    Field, Andy P; Nightingale, Zoë C

    2009-04-01

    Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him.

  11. International Environmental Agreements: Emissions Trade, Safety Valves and Escape Clauses

    International Nuclear Information System (INIS)

    Karp, Larry; Zhao, Jinhua

    2010-01-01

    We explain how the structure of multi-national or multi-regional environmental agreements affect their chance of success. Trade in emissions permits has ambiguous and in some cases surprising effects on both the equilibrium level of abatement, and on the ability to persuade nations or regions to participate in environmental agreements. An escape clause policy and a safety valve policy have essentially the same properties when membership in environmental agreement is pre-determined, but they create markedly different effects on the incentives to join such an agreement. The two policies lead to a qualitative difference in the leverage that a potential member of the agreement exercises on other members

  12. Polyphenol supplementation alters intramuscular apoptotic signaling following acute resistance exercise.

    Science.gov (United States)

    Townsend, Jeremy R; Stout, Jeffrey R; Jajtner, Adam R; Church, David D; Beyer, Kyle S; Riffe, Joshua J; Muddle, Tyler W D; Herrlinger, Kelli L; Fukuda, David H; Hoffman, Jay R

    2018-01-01

    The purpose of this study was to examine the effects of 28-days of supplementation with an aqueous proprietary polyphenol blend (PPB) sourced from Camellia sinensis on intramuscular apoptotic signaling following an acute lower-body resistance exercise protocol and subsequent recovery. Untrained males (n = 38, 21.8 ± 2.7 years, 173.4 ± 7.9 cm, 77.6 ± 14.6 kg) were randomized to PPB (n = 14), placebo (PL; n = 14) or control (CON; n = 10). Participants completed a lower-body resistance exercise protocol comprised of the squat, leg press, and leg extension exercises. Skeletal muscle microbiopsies were obtained from the vastus lateralis preexercise (PRE), 1-h (1HR), 5-h (5HR), and 48-h (48HR) post-resistance exercise. Apoptotic signaling pathways were quantified using multiplex signaling assay kits to quantify total proteins (Caspase 3, 8, 9) and markers of phosphorylation status (JNK, FADD, p53, BAD, Bcl-2). Changes in markers of muscle damage and intramuscular signaling were analyzed via separate repeated measures analysis of variance (ANOVA). Change in Bcl-2 phosphorylation at 1H was significantly greater in PL compared to CON (P = 0.001). BAD phosphorylation was significantly elevated at 5H in PL compared to PPB (P = 0.015) and CON (P = 0.006). The change in JNK phosphorylation was significantly greater in PPB (P = 0.009), and PL (P = 0.017) compared to CON at 1H, while the change for PL was elevated compared to CON at 5H (P = 0.002). A main effect was observed (P < 0.05) at 1H, 5H, and 48H for p53 and Caspase 8, with Caspase 3 and Caspase 9 elevated at 48H. These data indicate that chronic supplementation with PPB alters apoptotic signaling in skeletal muscle following acute muscle-damaging resistance exercise. © 2018 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  13. PEGylated apoptotic protein-loaded PLGA microspheres for cancer therapy

    Directory of Open Access Journals (Sweden)

    Byeon HJ

    2015-01-01

    Full Text Available Hyeong Jun Byeon,1 Insoo Kim,1 Ji Su Choi,1 Eun Seong Lee,2 Beom Soo Shin,3 Yu Seok Youn11Department of Pharmaceutical Sciences, School of Pharmacy, Sungkyunkwan University, Suwon, Republic of Korea; 2Division of Biotechnology, The Catholic University of Korea, Bucheon-si, Republic of Korea; 3Department of Pharmacy, College of Pharmacy, Catholic University of Daegu, Gyeongsan-si, Republic of KoreaAbstract: The aim of the current study was to investigate the antitumor potential of poly(D,L-lactic-co-glycolic acid microspheres (PLGA MSs containing polyethylene glycol (PEG-conjugated (PEGylated tumor necrosis factor–related apoptosis-inducing ligand (PEG-TRAIL. PEG-TRAIL PLGA MSs were prepared by using a water-in-oil-in-water double-emulsion method, and the apoptotic activities of supernatants released from the PLGA MSs at days 1, 3, and 7 were examined. The antitumor effect caused by PEG-TRAIL PLGA MSs was evaluated in pancreatic Mia Paca-2 cell-xenografted mice. PEG-TRAIL PLGA MS was found to be spherical and 14.4±1.06 µm in size, and its encapsulation efficiency was significantly greater than that of TRAIL MS (85.7%±4.1% vs 43.3%±10.9%, respectively. The PLGA MS gradually released PEG-TRAIL for 14 days, and the released PEG-TRAIL was shown to have clear apoptotic activity in Mia Paca-2 cells, whereas TRAIL released after 1 day had a negligible activity. Finally, PEG-TRAIL PLGA MS displayed remarkably greater antitumor efficacy than blank or TRAIL PLGA MS in Mia Paca-2 cell-xenografted mice in terms of tumor volume and weight, apparently due to increased stability and well-retained apoptotic activity of PEG-TRAIL in PLGA MS. We believe that this PLGA MS system, combined with PEG-TRAIL, should be considered a promising candidate for treating pancreatic cancer.Keywords: Poly(D,L-lactic-co-glycolic acid, controlled release, PEGylation, TRAIL, pancreatic cancer

  14. Involvement of caspase-12-dependent apoptotic pathway in ionic radiocontrast urografin-induced renal tubular cell injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Cheng Tien [Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Weng, Te I. [Department of Forensic Medicine, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Chen, Li Ping [Department of Dentistry, Chang Gang Memorial Hospital, Chang Gang University, Taoyuan, Taiwan (China); Chiang, Chih Kang [Department of Integrated Diagnostics and Therapeutics, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan (China); Department of Internal Medicine, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan (China); Liu, Shing Hwa, E-mail: shinghwaliu@ntu.edu.tw [Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Department of Urology, National Taiwan University Hospital, Taipei, Taiwan (China)

    2013-01-01

    Contrast medium (CM) induces a direct toxic effect on renal tubular cells. This toxic effect subjects in the disorder of CM-induced nephropathy. Our previous work has demonstrated that CM shows to activate the endoplasmic reticulum (ER)-related adaptive unfolding protein response (UPR) activators. Glucose-regulated protein 78 (GRP78)/eukaryotic initiation factor 2α (eIF2α)-related pathways play a protective role during the urografin (an ionic CM)-induced renal tubular injury. However, the involvement of ER stress-related apoptotic signals in the urografin-induced renal tubular cell injury remains unclear. Here, we examined by the in vivo and in vitro experiments to explore whether ER stress-regulated pro-apoptotic activators participate in urografin-induced renal injury. Urografin induced renal tubular dilation, tubular cells detachment, and necrosis in the kidneys of rats. The tubular apoptosis, ER stress-related pro-apoptotic transcriptional factors, and kidney injury marker-1 (kim-1) were also conspicuously up-regulated in urografin-treated rats. Furthermore, treatment of normal rat kidney (NRK)-52E tubular cells with urografin augmented the expressions of activating transcription factor-6 (ATF-6), C/EBP homologous protein (CHOP), Bax, caspase-12, JNK, and inositol-requiring enzyme (IRE) 1 signals. Urografin-induced renal tubular cell apoptosis was not reversed by the inhibitors of ATF-6, JNK signals or CHOP siRNA transfection, but it could be partially reversed by the inhibitor of caspase-12. Taken together, the present results and our previous findings suggest that exposure of CM/urografin activates the ER stress-regulated survival- and apoptosis-related signaling pathways in renal tubular cells. Caspase-12-dependent apoptotic pathway may be partially involved in the urografin-induced nephropathy. -- Highlights: ► Ionic contrast medium-urografin induces renal tubular cell apoptosis. ► Urografin induces the ER stress-regulated survival and apoptosis

  15. Enzyme inhibition by iminosugars

    DEFF Research Database (Denmark)

    López, Óscar; Qing, Feng-Ling; Pedersen, Christian Marcus

    2013-01-01

    Imino- and azasugar glycosidase inhibitors display pH dependant inhibition reflecting that both the inhibitor and the enzyme active site have groups that change protonation state with pH. With the enzyme having two acidic groups and the inhibitor one basic group, enzyme-inhibitor complexes...

  16. Quantification of Nociceptive Escape Response in C.elegans

    Science.gov (United States)

    Leung, Kawai; Mohammadi, Aylia; Ryu, William; Nemenman, Ilya

    2013-03-01

    Animals cannot rank and communicate their pain consciously. Thus in pain studies on animal models, one must infer the pain level from high precision experimental characterization of behavior. This is not trivial since behaviors are very complex and multidimensional. Here we explore the feasibility of C.elegans as a model for pain transduction. The nematode has a robust neurally mediated noxious escape response, which we show to be partially decoupled from other sensory behaviors. We develop a nociceptive behavioral response assay that allows us to apply controlled levels of pain by locally heating worms with an IR laser. The worms' motions are captured by machine vision programming with high spatiotemporal resolution. The resulting behavioral quantification allows us to build a statistical model for inference of the experienced pain level from the behavioral response. Based on the measured nociceptive escape of over 400 worms, we conclude that none of the simple characteristics of the response are reliable indicators of the laser pulse strength. Nonetheless, a more reliable statistical inference of the pain stimulus level from the measured behavior is possible based on a complexity-controlled regression model that takes into account the entire worm behavioral output. This work was partially supported by NSF grant No. IOS/1208126 and HFSP grant No. RGY0084/2011.

  17. Naloxone facilitates appetitive extinction and eliminates escape from frustration.

    Science.gov (United States)

    Norris, Jacob N; Pérez-Acosta, Andrés M; Ortega, Leonardo A; Papini, Mauricio R

    2009-11-01

    Two experiments tested the effects of opioid receptor blockage on behavior. In Experiment 1, rats reinforced for lever pressing with either sucrose or food pellets received treatment with saline, 2, and 10 mg/kg naloxone, i.p. (within-subject design). Naloxone 10 mg/kg increased response latency, but 2 mg/kg had no effect. When shifted to extinction (between-group design), naloxone (2 and 10 mg/kg) facilitated extinction relative to saline animals, after reinforcement with either sucrose or food pellets. In Experiment 2, after 10 sessions of access to 32% sucrose or an empty tube (between-group design), all rats were exposed to the empty tube while allowing them to jump over a barrier into a different compartment. Escape latencies were shorter for downshifted saline than for saline rats always given access to the empty tube. This escape-from-frustration effect was eliminated by naloxone (2 mg/kg, i.p.). Opioid blockage appears to reduce the value of alternative incentives.

  18. Ultra-fast Escape of a Octopus-inspired Rocket

    Science.gov (United States)

    Weymouth, Gabriel; Triantafyllou, Michael

    2013-11-01

    The octopus, squid, and other cephalopods inflate with water and then release a jet to accelerate in the opposite direction. This escape mechanism is particularly interesting in the octopus because they become initially quite bluff, yet this does not hinder them in achieving impressive bursts of speed. We examine this somewhat paradoxical maneuver using a simple deflating spheroid model in both potential and viscous flow. We demonstrate that the dynamic reduction of the width of the body completely changes the flow and forces acting on the escaping rocket in three ways. First, a body which reduces in size can generate an added mass thrust which counteracts the added mass inertia. Second, the motion of the shrinking wall acts similar to suction on a static wall, reducing separation and drag forces in a viscous fluid, but that this effects depends on the rate of size change. Third, using a combination of these two features it is possible to initially load the fluid with kinetic energy when heavy and bluff and then recover that energy when streamlined and light, enabling ultra-fast accelerations. As a notable example, these mechanisms allow a shrinking spheroid rocket in a heavy inviscid fluid to achieve speeds greater than an identical rocket in the vacuum of space. Southampton Marine and Maritime Institute.

  19. Effects of Glucocorticoids on Apoptosis and Clearance of Apoptotic Cells

    Directory of Open Access Journals (Sweden)

    Aisleen McColl

    2007-01-01

    Full Text Available The glucocorticoid (GC drugs are one of the most commonly prescribed and effective anti-inflammatory agents used for the treatment of many inflammatory disorders through their ability to attenuate phlogistic responses. The glucocorticoid receptor (GCR primarily mediates GC actions via activation or repression of gene expression. GCs directly induce the expression of proteins displaying anti-inflammatory activities. However, the likely predominant effect of GCs is the repression of multiple inflammatory genes that invariably are overexpressed during nonresolving chronic inflammation. Although most GC actions are mediated through regulation of transcription, rapid nongenomic actions have also been reported. In addition, GCs modulate inflammatory cell survival, inducing apoptosis in immature thymocytes and eosinophils, while delaying constitutive neutrophil apoptosis. Importantly, GCs promote noninflammatory phagocytosis of apoptotic cell targets, a process important for the successful resolution of inflammation. Here, the effects and mechanisms of action of GC on inflammatory cell apoptosis and phagocytosis will be discussed.

  20. The Procoagulant Activity of Apoptotic Cells Is Mediated by Interaction with Factor XII

    Directory of Open Access Journals (Sweden)

    Aizhen Yang

    2017-09-01

    Full Text Available Apoptotic cells, by externalizing phosphatidylserine (PS as a hallmark feature, are procoagulant. However, the mechanism by which apoptotic cells activate coagulation system remains unknown. Intrinsic coagulation pathway is initiated by coagulation factor XII (FXII of contact activation system. The purpose of this study was to determine whether FXII is involved in procoagulant activity of apoptotic cells. Using western blotting and chromogenic substrate assay, we found that incubation with apoptotic cells, but not with viable cells, resulted in rapid cleavage and activation of FXII in the presence of prekallikrein and high molecular weight kininogen (HK, other two components of contact activation system. As detected by flow cytometry, FXII bound to apoptotic cells in a concentration-dependent manner, which was inhibited by annexin V and PS liposome. Direct association of FXII with PS was confirmed in a surface plasmon resonance assay. Clotting time of FXII-deficient plasma induced by apoptotic cells was significantly prolonged, which was fully reversed by replenishment with FXII. Corn trypsin inhibitor, a FXII inhibitor, completely prevented apoptotic cells-induced intrinsic tenase complex formation. Consistently, apoptotic cells significantly increased thrombin production in normal plasma, which was not affected by an inhibitory anti-tissue factor antibody. However, blocking of PS by annexin V, inhibition of FXII, or the deficiency of FXII suppressed apoptotic cells-induced thrombin generation. Addition of purified FXII to FXII-deficient plasma recovered thrombin generation to the normal plasma level. In conclusion, FXII binds to apoptotic cells via PS and becomes activated, thereby constituting a novel mechanism mediating the procoagulant activity of apoptotic cells.

  1. PARP Inhibition Restores Extrinsic Apoptotic Sensitivity in Glioblastoma

    Science.gov (United States)

    Karpel-Massler, Georg; Pareja, Fresia; Aimé, Pascaline; Shu, Chang; Chau, Lily; Westhoff, Mike-Andrew; Halatsch, Marc-Eric; Crary, John F.; Canoll, Peter; Siegelin, Markus D.

    2014-01-01

    Background Resistance to apoptosis is a paramount issue in the treatment of Glioblastoma (GBM). We show that targeting PARP by the small molecule inhibitors, Olaparib (AZD-2281) or PJ34, reduces proliferation and lowers the apoptotic threshold of GBM cells in vitro and in vivo. Methods The sensitizing effects of PARP inhibition on TRAIL-mediated apoptosis and potential toxicity were analyzed using viability assays and flow cytometry in established GBM cell lines, low-passage neurospheres and astrocytes in vitro. Molecular analyses included western blots and gene silencing. In vivo, effects on tumor growth were examined in a murine subcutaneous xenograft model. Results The combination treatment of PARP inhibitors and TRAIL led to an increased cell death with activation of caspases and inhibition of formation of neurospheres when compared to single-agent treatment. Mechanistically, pharmacological PARP inhibition elicited a nuclear stress response with up-regulation of down-stream DNA-stress response proteins, e.g., CCAAT enhancer binding protein (C/EBP) homology protein (CHOP). Furthermore, Olaparib and PJ34 increased protein levels of DR5 in a concentration and time-dependent manner. In turn, siRNA-mediated suppression of DR5 mitigated the effects of TRAIL/PARP inhibitor-mediated apoptosis. In addition, suppression of PARP-1 levels enhanced TRAIL-mediated apoptosis in malignant glioma cells. Treatment of human astrocytes with the combination of TRAIL/PARP inhibitors did not cause toxicity. Finally, the combination treatment of TRAIL and PJ34 significantly reduced tumor growth in vivo when compared to treatment with each agent alone. Conclusions PARP inhibition represents a promising avenue to overcome apoptotic resistance in GBM. PMID:25531448

  2. Andrographolide induces apoptotic and non-apoptotic death and enhances tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis in gastric cancer cells

    OpenAIRE

    Lim, Sung-Chul; Jeon, Ho Jong; Kee, Keun Hong; Lee, Mi Ja; Hong, Ran; Han, Song Iy

    2017-01-01

    Andrographolide, a natural compound isolated from Andrographis paniculata, has been reported to possess antitumor activity. In the present study, the effect of andrographolide in human gastric cancer (GC) cells was investigated. Andrographolide induced cell death with apoptotic and non-apoptotic features. At a low concentration, andrographolide potentiated apoptosis and reduction of clonogenicity triggered by recombinant human tumor necrosis factor-related apoptosis-inducing ligand (rhTRAIL)....

  3. Orbital and escape dynamics in barred galaxies - III. The 3D system: correlations between the basins of escape and the NHIMs

    Science.gov (United States)

    Zotos, Euaggelos E.; Jung, Christof

    2018-01-01

    The escape dynamics of the stars in a barred galaxy composed of a spherically symmetric central nucleus, a bar, a flat thin disc and a dark matter halo component is investigated by using a realistic three degrees of freedom (3-d.o.f.) dynamical model. Modern colour-coded diagrams are used for distinguishing between bounded and escaping motion. In addition, the smaller alignment index method is deployed for determining the regular, sticky or chaotic nature of bounded orbits. We reveal the basins of escape corresponding to the escape through the two symmetrical escape channels around the Lagrange points L2 and L3 and also we relate them with the corresponding distribution of the escape times of the orbits. Furthermore, we demonstrate how the stable manifolds, around the index-1 saddle points, accurately define the fractal basin boundaries observed in the colour-coded diagrams. The development scenario of the fundamental vertical Lyapunov periodic orbit is thoroughly explored for obtaining a more complete view of the unfolding of the singular behaviour of the dynamics at the cusp values of the parameters. Finally, we examine how the combination of the most important parameters of the bar (such as the semimajor axis and the angular velocity) influences the observed stellar structures (rings and spirals), which are formed by escaping stars guided by the invariant manifolds near the saddle points.

  4. Integrating geographical information and augmented reality techniques for mobile escape guidelines on nuclear accident sites

    International Nuclear Information System (INIS)

    Tsai, Ming-Kuan; Lee, Yung-Ching; Lu, Chung-Hsin; Chen, Mei-Hsin; Chou, Tien-Yin; Yau, Nie-Jia

    2012-01-01

    During nuclear accidents, when radioactive materials spread into the environment, the people in the affected areas should evacuate immediately. However, few information systems are available regarding escape guidelines for nuclear accidents. Therefore, this study constructs escape guidelines on mobile phones. This application is called Mobile Escape Guidelines (MEG) and adopts two techniques. One technique is the geographical information that offers multiple representations; the other is the augmented reality that provides semi-realistic information services. When this study tested the mobile escape guidelines, the results showed that this application was capable of identifying the correct locations of users, showing the escape routes, filtering geographical layers, and rapidly generating the relief reports. Users could evacuate from nuclear accident sites easily, even without relief personnel, since using slim devices to access the mobile escape guidelines is convenient. Overall, this study is a useful reference for a nuclear accident emergency response.

  5. Nanoparticles Escaping RES and Endosome: Challenges for siRNA Delivery for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Shutao Guo

    2011-01-01

    Full Text Available Small interfering RNAs (siRNAs technology has emerged as a promising potential treatment for viral, genetic diseases and cancers. Despite the powerful therapeutic potential of siRNA, there are challenges for developing efficient and specific delivery systems for systemic administration. There are extracellular and intracellular barriers for nanoparticle-mediated delivery. First, nanoparticles are rapidly cleared from the circulation by the reticuloendothelial system (RES. Second, following their cellular uptake, nanoparticles are trapped in endosomes/lysosomes, where siRNA would be degraded by enzymes. In this review, we describe strategies for grafting a polyethylene glycol (PEG brush to the nanoparticles for evading RES, such that they may effectively accumulate in the tumor by the enhanced permeability and retention (EPR effect. PEG has to shed from the nanoparticles to allow close interaction with the tumor cells. Current strategies for facilitating endosome escape, such as ion pair formation, “proton sponge effect”, destabilizing endosome membrane, and hydrophobic modification of the vector, are discussed.

  6. Vaccination and timing influence SIV immune escape viral dynamics in vivo.

    Directory of Open Access Journals (Sweden)

    Liyen Loh

    2008-01-01

    Full Text Available CD8+ cytotoxic T lymphocytes (CTL can be effective at controlling HIV-1 in humans and SIV in macaques, but their utility is partly offset by mutational escape. The kinetics of CTL escape and reversion of escape mutant viruses upon transmission to MHC-mismatched hosts can help us understand CTL-mediated viral control and the fitness cost extracted by immune escape mutation. Traditional methods for following CTL escape and reversion are, however, insensitive to minor viral quasispecies. We developed sensitive quantitative real-time PCR assays to track the viral load of SIV Gag164-172 KP9 wild-type (WT and escape mutant (EM variants in pigtail macaques. Rapid outgrowth of EM virus occurs during the first few weeks of infection. However, the rate of escape plateaued soon after, revealing a prolonged persistence of WT viremia not detectable by standard cloning and sequencing methods. The rate of escape of KP9 correlated with levels of vaccine-primed KP9-specific CD8+ T cells present at that time. Similarly, when non-KP9 responder (lacking the restricting Mane-A*10 allele macaques were infected with SHIVmn229 stock containing a mixture of EM and WT virus, rapid reversion to WT was observed over the first 2 weeks following infection. However, the rate of reversion to WT slowed dramatically over the first month of infection. The serial quantitation of escape mutant viruses evolving during SIV infection shows that rapid dynamics of immune escape and reversion can be observed in early infection, particularly when CD8 T cells are primed by vaccination. However, these early rapid rates of escape and reversion are transient and followed by a significant slowing in these rates later during infection, highlighting that the rate of escape is significantly influenced by the timing of its occurrence.

  7. Sharks modulate their escape behavior in response to predator size, speed and approach orientation.

    Science.gov (United States)

    Seamone, Scott; Blaine, Tristan; Higham, Timothy E

    2014-12-01

    Escape responses are often critical for surviving predator-prey interactions. Nevertheless, little is known about how predator size, speed and approach orientation impact escape performance, especially in larger prey that are primarily viewed as predators. We used realistic shark models to examine how altering predatory behavior and morphology (size, speed and approach orientation) influences escape behavior and performance in Squalus acanthias, a shark that is preyed upon by apex marine predators. Predator models induced C-start escape responses, and increasing the size and speed of the models triggered a more intense response (increased escape turning rate and acceleration). In addition, increased predator size resulted in greater responsiveness from the sharks. Among the responses, predator approach orientation had the most significant impact on escapes, such that the head-on approach, as compared to the tail-on approach, induced greater reaction distances and increased escape turning rate, speed and acceleration. Thus, the anterior binocular vision in sharks renders them less effective at detecting predators approaching from behind. However, it appears that sharks compensate by performing high-intensity escapes, likely induced by the lateral line system, or by a sudden visual flash of the predator entering their field of view. Our study reveals key aspects of escape behavior in sharks, highlighting the modulation of performance in response to predator approach. Copyright © 2014 Elsevier GmbH. All rights reserved.

  8. Antibody escape kinetics of equine infectious anemia virus infection of horses.

    Science.gov (United States)

    Schwartz, Elissa J; Nanda, Seema; Mealey, Robert H

    2015-07-01

    Lentivirus escape from neutralizing antibodies (NAbs) is not well understood. In this work, we quantified antibody escape of a lentivirus, using antibody escape data from horses infected with equine infectious anemia virus. We calculated antibody blocking rates of wild-type virus, fitness costs of mutant virus, and growth rates of both viruses. These quantitative kinetic estimates of antibody escape are important for understanding lentiviral control by antibody neutralization and in developing NAb-eliciting vaccine strategies. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Improving escape panel selectivity in Nephrops directed fisheries by actively stimulating fish behaviour

    DEFF Research Database (Denmark)

    Krag, Ludvig Ahm; Herrmann, Bent; Feekings, Jordan P.

    2017-01-01

    with it. To increase the efficiency of such panels, the contact probability needs to be improved. In this study, we investigate to what extent the efficiency of escape panels can be improved by actively stimulating the escape behaviour of fish. The performance of two identical panel sections was compared...... in a twin-trawl system, one with and one without a stimulation device. A new coupled analysis method was used to explicitly quantify the improvements in contact probability and release efficiency for the escape panel. The results demonstrate that by actively stimulating escape behaviour, the contact...

  10. Will 3552 Don Quixote escape from the Solar System?

    Directory of Open Access Journals (Sweden)

    Suryadi Siregar

    2011-05-01

    Full Text Available Asteroid 1983 SA, well known as 3552 Don Quixote, is one of Near Earth Asteroids (NEAs which is the most probable candidate for the cometary origin, or otherwise as Jupiter-Family-Comets (JFCs. The aim of this study is to investigate the possibility of 3552 Don Quixote to be ejected from the Solar System. This paper presents an orbital evolution of 100 hypothetical asteroids generated by cloning 3552 Don Quixote. Investigation of its orbital evolution is conducted by using the SWIFT subroutine package, where the gravitational perturbations of eight major planets in the Solar System are considered. Over very short time scales (220 kyr relative to the Solar System life time (10 Gyr, the asteroid 3552 Don Quixote gave an example of chaotic motion that can cause asteroid to move outward and may be followed by escaping from the Solar System. Probability of ejection within the 220 kyr time scale is 50%.

  11. Escape and avoidance learning in the earthworm Eisenia hortensis

    Directory of Open Access Journals (Sweden)

    W. Jeffrey Wilson

    2014-01-01

    Full Text Available Interest in instrumental learning in earthworms dates back to 1912 when Yerkes concluded that they can learn a spatial discrimination in a T-maze. Rosenkoetter and Boice determined in the 1970s that the “learning” that Yerkes observed was probably chemotaxis and not learning at all. We examined a different form of instrumental learning: the ability to learn both to escape and to avoid an aversive stimulus. Freely moving “master” worms could turn off an aversive white light by increasing their movement; the behavior of yoked controls had no effect on the light. We demonstrate that in as few as 12 trials the behavior of the master worms comes under the control of this contingency.

  12. Escaping Antiangiogenic Therapy: Strategies Employed by Cancer Cells

    Directory of Open Access Journals (Sweden)

    Mauricio P. Pinto

    2016-09-01

    Full Text Available Tumor angiogenesis is widely recognized as one of the “hallmarks of cancer”. Consequently, during the last decades the development and testing of commercial angiogenic inhibitors has been a central focus for both basic and clinical cancer research. While antiangiogenic drugs are now incorporated into standard clinical practice, as with all cancer therapies, tumors can eventually become resistant by employing a variety of strategies to receive nutrients and oxygen in the event of therapeutic assault. Herein, we concentrate and review in detail three of the principal mechanisms of antiangiogenic therapy escape: (1 upregulation of compensatory/alternative pathways for angiogenesis; (2 vasculogenic mimicry; and (3 vessel co-option. We suggest that an understanding of how a cancer cell adapts to antiangiogenic therapy may also parallel the mechanisms employed in the bourgeoning tumor and isolated metastatic cells delivering responsible for residual disease. Finally, we speculate on strategies to adapt antiangiogenic therapy for future clinical uses.

  13. Novel Anti-Melanoma Immunotherapies: Disarming Tumor Escape Mechanisms

    Directory of Open Access Journals (Sweden)

    Sivan Sapoznik

    2012-01-01

    Full Text Available The immune system fights cancer and sometimes temporarily eliminates it or reaches an equilibrium stage of tumor growth. However, continuous immunological pressure also selects poorly immunogenic tumor variants that eventually escape the immune control system. Here, we focus on metastatic melanoma, a highly immunogenic tumor, and on anti-melanoma immunotherapies, which recently, especially following the FDA approval of Ipilimumab, gained interest from drug development companies. We describe new immunomodulatory approaches currently in the development pipeline, focus on the novel CEACAM1 immune checkpoint, and compare its potential to the extensively described targets, CTLA4 and PD1. This paper combines multi-disciplinary approaches and describes anti-melanoma immunotherapies from molecular, medical, and business angles.

  14. The resonance escape probability during the neutron slowing down

    International Nuclear Information System (INIS)

    Jehouani, A.; Ghassoun, J.; Aboubeker, A.

    1994-01-01

    Three different methods were used to calculate the neutron resonance escape probability during neutron slowing down in homogeneous media : two Monte Carlo simulations and a determinist method. The first simulation is based on a natural process intervening in neutron transport, the second is a nonanalog simulation while the determinist method is based on an iterative solution of the neutron slowing down equation. The results are in a good agreement for the three methods . The second simulation was found to be more efficient than the first one for high dilutions . In fact we have attained a better figure of merite ( FOM = 1/ (sigma sup 2 ) T) by the second simulation than by the first one . 2 figs. ; 2 refs ( author )

  15. RpoS controls the Vibrio cholerae mucosal escape response.

    Directory of Open Access Journals (Sweden)

    Alex Toftgaard Nielsen

    2006-10-01

    Full Text Available Vibrio cholerae causes a severe diarrhoeal disease by secreting a toxin during colonization of the epithelium in the small intestine. Whereas the initial steps of the infectious process have been intensively studied, the last phases have received little attention. Confocal microscopy of V. cholerae O1-infected rabbit ileal loops captured a distinctive stage in the infectious process: 12 h post-inoculation, bacteria detach from the epithelial surface and move into the fluid-filled lumen. Designated the "mucosal escape response," this phenomenon requires RpoS, the stationary phase alternative sigma factor. Quantitative in vivo localization assays corroborated the rpoS phenotype and showed that it also requires HapR. Expression profiling of bacteria isolated from ileal loop fluid and mucus demonstrated a significant RpoS-dependent upregulation of many chemotaxis and motility genes coincident with the emigration of bacteria from the epithelial surface. In stationary phase cultures, RpoS was also required for upregulation of chemotaxis and motility genes, for production of flagella, and for movement of bacteria across low nutrient swarm plates. The hapR mutant produced near-normal numbers of flagellated cells, but was significantly less motile than the wild-type parent. During in vitro growth under virulence-inducing conditions, the rpoS mutant produced 10- to 100-fold more cholera toxin than the wild-type parent. Although the rpoS mutant caused only a small over-expression of the genes encoding cholera toxin in the ileal loop, it resulted in a 30% increase in fluid accumulation compared to the wild-type. Together, these results show that the mucosal escape response is orchestrated by an RpoS-dependent genetic program that activates chemotaxis and motility functions. This may furthermore coincide with reduced virulence gene expression, thus preparing the organism for the next stage in its life cycle.

  16. Initiating a watch list for Ebola virus antibody escape mutations

    Directory of Open Access Journals (Sweden)

    Craig R. Miller

    2016-02-01

    Full Text Available The 2014 Ebola virus (EBOV outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens.

  17. The Anti-Apoptotic Properties of APEX1 in the Endothelium Require the First 20 Amino Acids and Converge on Thioredoxin-1.

    Science.gov (United States)

    Dyballa-Rukes, Nadine; Jakobs, Philipp; Eckers, Anna; Ale-Agha, Niloofar; Serbulea, Vlad; Aufenvenne, Karin; Zschauer, Tim-Christian; Rabanter, Lothar L; Jakob, Sascha; von Ameln, Florian; Eckermann, Olaf; Leitinger, Norbert; Goy, Christine; Altschmied, Joachim; Haendeler, Judith

    2017-04-20

    The APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1) has a disordered N-terminus, a redox, and a DNA repair domain. APEX1 has anti-apoptotic properties, which have been linked to both domains depending on cell type and experimental conditions. As protection against apoptosis is a hallmark of vessel integrity, we wanted to elucidate whether APEX1 acts anti-apoptotic in primary human endothelial cells and, if so, what the underlying mechanisms are. APEX1 inhibits apoptosis in endothelial cells by reducing Cathepsin D (CatD) cleavage, potentially by binding to the unprocessed form. Diminished CatD activation results in increased Thioredoxin-1 protein levels leading to reduced Caspase 3 activation. Consequently, apoptosis rates are decreased. This depends on the first twenty amino acids in APEX1, because APEX1 (21-318) induces CatD activity, decreases Thioredoxin-1 protein levels, and, thus, increases Caspase 3 activity and apoptosis. Along the same lines, APEX1 (1-20) inhibits Caspase 3 cleavage and apoptosis. Furthermore, re-expression of Thioredoxin-1 via lentiviral transduction rescues endothelial cells from APEX1 (21-318)-induced apoptosis. In an in vivo model of restenosis, which is characterized by oxidative stress, endothelial activation, and smooth muscle cell proliferation, Thioredoxin-1 protein levels are reduced in the endothelium of the carotids. APEX1 acts anti-apoptotic in endothelial cells. This anti-apoptotic effect depends on the first 20 amino acids of APEX1. As proper function of the endothelium during life span is a hallmark for individual health span, a detailed characterization of the functions of the APEX1N-terminus is required to understand all its cellular properties. Antioxid. Redox Signal. 26, 616-629.

  18. Host cell killing by the West Nile Virus NS2B-NS3 proteolytic complex: NS3 alone is sufficient to recruit caspase-8-based apoptotic pathway

    International Nuclear Information System (INIS)

    Ramanathan, Mathura P.; Chambers, Jerome A.; Pankhong, Panyupa; Chattergoon, Michael; Attatippaholkun, Watcharee; Dang, Kesen; Shah, Neelima; Weiner, David B.

    2006-01-01

    The West Nile Virus (WNV) non-structural proteins 2B and 3 (NS2B-NS3) constitute the proteolytic complex that mediates the cleavage and processing of the viral polyprotein. NS3 recruits NS2B and NS5 proteins to direct protease and replication activities. In an effort to investigate the biology of the viral protease, we cloned cDNA encoding the NS2B-NS3 proteolytic complex from brain tissue of a WNV-infected dead crow, collected from the Lower Merion area (Merion strain). Expression of the NS2B-NS3 gene cassette induced apoptosis within 48 h of transfection. Electron microscopic analysis of NS2B-NS3-transfected cells revealed ultra-structural changes that are typical of apoptotic cells including membrane blebbing, nuclear disintegration and cytoplasmic vacuolations. The role of NS3 or NS2B in contributing to host cell apoptosis was examined. NS3 alone triggers the apoptotic pathways involving caspases-8 and -3. Experimental results from the use of caspase-specific inhibitors and caspase-8 siRNA demonstrated that the activation of caspase-8 was essential to initiate apoptotic signaling in NS3-expressing cells. Downstream of caspase-3 activation, we observed nuclear membrane ruptures and cleavage of the DNA-repair enzyme, PARP in NS3-expressing cells. Nuclear herniations due to NS3 expression were absent in the cells treated with a caspase-3 inhibitor. Expression of protease and helicase domains themselves was sufficient to trigger apoptosis generating insight into the apoptotic pathways triggered by NS3 from WNV

  19. Enzymes for improved biomass conversion

    Science.gov (United States)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  20. Magnetically responsive enzyme powders

    Science.gov (United States)

    Pospiskova, Kristyna; Safarik, Ivo

    2015-04-01

    Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (-20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties.

  1. Enzymes in animal nutrition

    OpenAIRE

    Scientific Committee on Animal Nutrition

    2011-01-01

    This report brings overview of endogenous as well as exogenous enzymes and their role and importance in animal nutrition. Enzymes for animal nutrition have been systematically developed since 1980´s. Phytase, xylanase and β-glucanase are used in poultry-rising, pig breeding, aquaculture and begin to push to the ruminant nutrition. Phytase increase availability of P, Ca, Zn, digestibility of proteins and fats. Its positive effect on the environment is well described – enzymes decrease the cont...

  2. Profiling the orphan enzymes

    Science.gov (United States)

    2014-01-01

    The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called “orphan enzymes”. The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to “local orphan enzymes” that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new

  3. The EBI enzyme portal

    OpenAIRE

    Alc?ntara, Rafael; Onwubiko, Joseph; Cao, Hong; de Matos, Paula; Cham, Jennifer A.; Jacobsen, Jules; Holliday, Gemma L.; Fischer, Julia D.; Rahman, Syed Asad; Jassal, Bijay; Goujon, Mikael; Rowland, Francis; Velankar, Sameer; L?pez, Rodrigo; Overington, John P.

    2012-01-01

    The availability of comprehensive information about enzymes plays an important role in answering questions relevant to interdisciplinary fields such as biochemistry, enzymology, biofuels, bioengineering and drug discovery. At the EMBL European Bioinformatics Institute, we have developed an enzyme portal (http://www.ebi.ac.uk/enzymeportal) to provide this wealth of information on enzymes from multiple in-house resources addressing particular data classes: protein sequence and structure, reacti...

  4. Enzyme catalysed tandem reactions

    OpenAIRE

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-01-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a r...

  5. Hybrid fluid/kinetic modeling of Pluto’s escaping atmosphere

    Science.gov (United States)

    Erwin, Justin; Tucker, O. J.; Johnson, Robert E.

    2013-09-01

    Predicting the rate of escape and thermal structure of Pluto’s upper atmosphere in preparation for the New Horizons Spacecraft encounter in 2015 is important for planning and interpreting the expected measurements. Having a moderate Jeans parameter Pluto’s atmosphere does not fit the classic definition of Jeans escape for light species escaping from the terrestrial planets, nor does it fit the hydrodynamic outflow from comets and certain exoplanets. It has been proposed for some time that Pluto lies in the region of slow hydrodynamic escape. Using a hybrid fluid/molecular-kinetic model, we previously demonstrated the typical implementation of this model fails to correctly describe the appropriate temperature structure for the upper atmosphere for solar minimum conditions. Here we use a time-dependent solver to allow us to extend those simulations to higher heating rates and we examine fluid models in which Jeans-like escape expressions are used for the upper boundary conditions. We compare these to hybrid simulations of the atmosphere under heating conditions roughly representative of solar minimum and mean conditions as these bracket conditions expected during the New Horizon encounter. Although we find escape rates comparable to those previously estimated by the slow hydrodynamic escape model, and roughly consistent with energy limited escape, our model produces a much more extended atmosphere with higher temperatures roughly consistent with recent observations of CO. Such an extended atmosphere will be affected by Charon and will affect Pluto’s interaction with the solar wind at the New Horizon encounter. For the parameter space covered, we also find an inverse relationship between exobase temperature and altitude and the Jeans escape rate that is consistent with the energy limited escape rate. Since we have previously shown that such models can be scaled, these results have implications for modeling exoplanet atmospheres for which the energy limited

  6. Enzymes from extremophiles.

    Science.gov (United States)

    Demirjian, D C; Morís-Varas, F; Cassidy, C S

    2001-04-01

    The industrial application of enzymes that can withstand harsh conditions has greatly increased over the past decade. This is mainly a result of the discovery of novel enzymes from extremophilic microorganisms. Recent advances in the study of extremozymes point to the acceleration of this trend. In particular, enzymes from thermophilic organisms have found the most practical commercial use to date because of their overall inherent stability. This has also led to a greater understanding of stability factors involved in adaptation of these enzymes to their unusual environments.

  7. Artificial Enzymes, "Chemzymes"

    DEFF Research Database (Denmark)

    Bjerre, Jeannette; Rousseau, Cyril Andre Raphaël; Pedersen, Lavinia Georgeta M

    2008-01-01

    "Chemzymes", based on cyclodextrins and other molecules. Only the chemzymes that have shown enzyme-like activity that has been quantified by different methods will be mentioned. This review will summarize the work done in the field of artificial glycosidases, oxidases, epoxidases, and esterases, as well......Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models...

  8. Tetraarsenic oxide and cisplatin induce apoptotic synergism in cervical cancer.

    Science.gov (United States)

    Byun, Jung Mi; Jeong, Dae Hoon; Lee, Dae Sim; Kim, Joo Ran; Park, Sae Gwang; Kang, Mi Seon; Kim, Young Nam; Lee, Kyung Bok; Sung, Moon Su; Kim, Ki Tae

    2013-04-01

    Tetraarsenic oxide (As4O6, TAO) is a new arsenic compound that inhibits cell growth and induces apoptosis in human cervical cancer cell lines. In the present study, we report that the growth of tumor cells (CaSki) was inhibited by treatment with TAO alone or in combination with cisplatin or paclitaxel in vitro and in vivo. Proliferation was assessed by WST-1 assay, and apoptosis was assessed by Annexin-V/PI FACS analysis in the CaSki cell line treated with a single agent or with the combinations of two agents. Expression of apoptosis-related proteins was analyzed by western blot analysis. A mouse xenograft model using CaSki cells was used to determine the in vivo activity of tetraarsenic oxide alone and in combination with cisplatin or paclitaxel by estimation of tumor size. At the end of the experiment, tumor tissue from each mouse was removed and processed for TUNEL analysis for confirmation of apoptotic cells. TAO was able to inhibit cell proliferation in a time- and dose-dependent manner. A combination of TAO and cisplatin effectively induced apoptosis by activating caspase-3. Using a mouse xenograft model, the sizes of tumors which were treated with a single agent and with a combination of agents decreased in a time-dependent manner. A combination of TAO and cisplatin resulted in a significantly reduced tumor size (Pcisplatin. Thus, TAO is a good candidate for use in a combined regimen with cisplatin for patients with cervical cancer.

  9. Genotoxic and apoptotic effects of Goeckerman therapy for psoriasis

    Energy Technology Data Exchange (ETDEWEB)

    Borska, L.; Andrys, C.; Krejsek, J.; Hamakova, K.; Kremlacek, J.; Palicka, V.; Ranna, D.; Fiala, Z. [Charles University Prague, Prague (Czech Republic). Faculty of Medicine

    2010-03-15

    Goeckerman therapy (GT) for psoriasis is based on cutaneous application of crude coal tar (polycyclic aromatic hydrocarbons (PAH)) and exposure to ultraviolet radiation (UVR). PAH and UVR are mutagenic, carcinogenic and immunotoxic agents that promote apoptosis. We evaluated dermal absorption of PAH as well as the genotoxic and apoptotic effects of GT in 20 patients with psoriasis, by determining numbers of chromosomal abnormalities in peripheral lymphocytes, and levels of 1-hydroxypyrene (1-OHP), p53 protein and soluble FasL (sFasL) in urine and/or blood, before and after GT. Psoriasis Area and Severity Index (PASI) score was used to evaluate clinical efficacy of GT. Compared with pre-treatment levels, there was a significant increase in urine 1-OHP, indicating a high degree of dermal absorption of PAH (P <0.01). We also found a significant increase in the number of chromosomal abnormalities in peripheral blood lymphocytes (P <0.001), suggesting that GT is genotoxic; significantly increased p53 protein in plasma (P <0.05), an indicator of cell response to DNA damage; and significantly increased sFasL in serum (P <0.01), an indicator of apoptosis. The PASI score was significantly decreased after GT (P <0.001), confirming clinical benefit of this treatment. Our results demonstrate high dermal absorption of PAH during GT and provide evidence that GT promotes genotoxicity and apoptosis.

  10. Non-apoptotic cell death associated with perturbations of macropinocytosis.

    Science.gov (United States)

    Maltese, William A; Overmeyer, Jean H

    2015-01-01

    Although macropinocytosis is widely recognized as a distinct form of fluid-phase endocytosis in antigen-presenting dendritic cells, it also occurs constitutively in many other normal and transformed cell types. Recent studies have established that various genetic or pharmacological manipulations can hyperstimulate macropinocytosis or disrupt normal macropinosome trafficking pathways, leading to accumulation of greatly enlarged cytoplasmic vacuoles. In some cases, this extreme vacuolization is associated with a unique form of non-apoptotic cell death termed "methuosis," from the Greek methuo (to drink to intoxication). It remains unclear whether cell death related to dysfunctional macropinocytosis occurs in normal physiological contexts. However, the finding that some types of cancer cells are particularly vulnerable to this unusual form of cell death has raised the possibility that small molecules capable of altering macropinosome trafficking or function might be useful as therapeutic agents against cancers that are resistant to drugs that work by inducing apoptosis. Herein we review examples of cell death associated with dysfunctional macropinocytosis and summarize what is known about the underlying mechanisms.

  11. Non-apoptotic cell death associated with perturbations of macropinocytosis

    Directory of Open Access Journals (Sweden)

    William A. Maltese

    2015-02-01

    Full Text Available Although macropinocytosis is widely recognized as a distinct form of fluid-phase endocytosis in antigen-presenting dendritic cells, it also occurs constitutively in many other normal and transformed cell types. Recent studies have established that various genetic or pharmacological manipulations can hyperstimulate macropinocytosis or disrupt normal macropinosome trafficking pathways, leading to accumulation of greatly enlarged cytoplasmic vacuoles. In some cases, this extreme vacuolization is associated with a unique form of non-apoptotic cell death termed ‘methuosis’, from the Greek methuo (to drink to intoxication. It remains unclear whether cell death related to dysfunctional macropinocytosis occurs in normal physiological contexts. However, the finding that some types of cancer cells are particularly vulnerable to this unusual form of cell death has raised the possibility that small molecules capable of altering macropinosome trafficking or function might be useful as therapeutic agents against cancers that are resistant to drugs that work by inducing apoptosis. Herein we review examples of cell death associated with dysfunctional macropinocytosis and summarize what is known about the underlying mechanisms.

  12. Genes of the mitochondrial apoptotic pathway in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Noelia Estévez-Calvar

    Full Text Available Bivalves play vital roles in marine, brackish, freshwater and terrestrial habitats. In recent years, these ecosystems have become affected through anthropogenic activities. The ecological success of marine bivalves is based on the ability to modify their physiological functions in response to environmental changes. One of the most important mechanisms involved in adaptive responses to environmental and biological stresses is apoptosis, which has been scarcely studied in mollusks, although the final consequence of this process, DNA fragmentation, has been frequently used for pollution monitoring. Environmental stressors induce apoptosis in molluscan cells via an intrinsic pathway. Many of the proteins involved in vertebrate apoptosis have been recognized in model invertebrates; however, this process might not be universally conserved. Mytilus galloprovincialis is presented here as a new model to study the linkage between molecular mechanisms that mediate apoptosis and marine bivalve ecological adaptations. Therefore, it is strictly necessary to identify the key elements involved in bivalve apoptosis. In the present study, six mitochondrial apoptotic-related genes were characterized, and their gene expression profiles following UV irradiation were evaluated. This is the first step for the development of potential biomarkers to assess the biological responses of marine organisms to stress. The results confirmed that apoptosis and, more specifically, the expression of the genes involved in this process can be used to assess the biological responses of marine organisms to stress.

  13. Apoptotic study in Graves disease treated with thyroid arterial embolization

    International Nuclear Information System (INIS)

    Zhao Wei; Gao Bulang; Yi Genfa

    2009-01-01

    The objective of this study was to investigate apoptosis in the thyroid of Graves disease (GD) induced by thyroid arterial embolization. Forty one patients with clinically and laboratorily ascertained GD were treated with thyroid arterial embolization and followed up for 3-54 months following embolization. Prior to embolization and at 1, 3, 6, 12 and 36 months following embolization, thyroid autoimmune antibodies were tested respectively, including thyroid stimulating antibody (TSAb), thyroglobulin antibody (TGAb) and thyroid microsomal antibody (TMAb). Thyroid biopsy was performed under the guidance of computed tomography for immunohistochemistry examination using semi-quantity analysis. The positive staining of Fas and FasL was mostly in the cytoplasma and cell membrane, the positive expression of Bax was mainly in the cytoplasma, and no positive expression of P53 was detected in the thyroid cells before embolization. After arterial embolziation, the positive cell number and staining degree of these genes were both greater than before embolization. The treatment method of thyroid arterial embolization can effectively enhance the positive expression of pro-apoptotic genes of Fas, FasL, Bax, Bcl-2 and P53 in GD thyroid, thus promoting apoptosis of GD thyroid and helping restore the thyroid size and function to normal conditions. (author)

  14. The Apoptotic Effects of the P300 Activator on Breast Cancer and Lung Fibroblast Cell Lines

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Salahshoor

    2013-10-01

    Full Text Available Background: P300 is an enzyme that acetylates histones during stress. It alsoacetylates several non-histone proteins, including P53 which is the most important tumorsuppressor gene. P53 plays an important role in the apoptosis of tumor cells. Hereby,this study describes the potency of cholera toxin B subunit as a P300 activator to induceapoptosis in a breast cancer cell line (MCF-7 and a lung fibroblast cell line (MRC-5as a non-tumorigenic control sample. Methods: MCF-7 and MRC-5 were cultured in RPMI-1640 and treated with orwithout cholera toxin B subunit at the concentration of 85.43 μmol/L, based on the half-maximal inhibitory concentration index at different times (24, 48 and 72 h. Thepercentage of apoptotic cells was measured by flow cytometry. Real-time quantitativeRT-PCR was performed to estimate the mRNA expression of P300 in MCF-7 and MRC-5 with cholera toxin B subunit at different times. We used the ELISA and Bradford proteintechniques to detect levels of total and acetylated P53 protein generated in MCF-7 andMRC-5. Results: Our findings indicated that the cholera toxin B subunit effectively andsignificantly induced more apoptosis in MCF-7 compared to MRC-5. We showed thatexpression of P300 up-regulated by increasing the time of the cholera toxin B subunittreatment in MCF-7 but not in MRC-5. In addition, the acetylated and total P53protein levels increased more in MCF-7 cells than in MRC-5 cells.Conclusion: Cholera toxin B subunit induced significant cell death in MCF-7, butit could be well tolerated in MRC-5. Therefore, cholera toxin B subunit can besuggested as an anti-cancer agent.

  15. The apoptotic effects of sirtuin1 inhibitor on the MCF-7 and MRC-5 cell lines.

    Science.gov (United States)

    Dastjerdi, M Nikbakht; Salahshoor, M R; Mardani, M; Rabbani, M; Hashemibeni, B; Gharagozloo, M; Kazemi, M; Esmaeil, N; Roshankhah, Sh; Golmohammadi, R; Mobarakian, M

    2013-04-01

    Sirtuin1 (SIRT1) is an enzyme that deacetylates histones and several nonhistone proteins including p53 during stress and plays an important role in the survival of tumor cells. Hereby, this study describes the potency of salermide as a SIRT1 inhibitor to induce apoptosis in the MCF-7 and MRC-5 cell lines. MCF7 and MRC-5 cell lines were cultured in RPMI-1640 and treated with or without salermide at concentration of 80.56 μmol/L, based on the half-maximal inhibitory concentration (IC50) index at different times (24, 48 and72 h). The IC50 value was established for the salermide in MCF-7. The percentage of apoptotic cells was measured by flow cytometry. Real-time quantitative RT-PCR was performed to estimate the mRNA expression of sirtuin1 in MCF-7 and MRC-5 with salermide at different times. ELISA and Bradford protein techniques were used to detect endogenous levels of total and acetylated p53 protein generated in MCF-7 and MRC-5 cells. Our findings indicated that salermide can induce apoptosis in MCF-7 significantly more effective than MRC-5 cells. We showed that the expression of SIRT1 was dramatically down-regulated by increasing the time of salermide treatment in MCF-7 but not MRC-5 and that the acetylated and total p53 protein levels were increased more in MCF-7 than MRC-5. Salermide, by decreasing the expression of sirtuin1 gene, can induce acetylation of P53 protein and consequently induce significant cell death in MCF-7 that was well tolerated in MRC-5.

  16. The rate of immune escape vanishes when multiple immune responses control an HIV infection

    NARCIS (Netherlands)

    van Deutekom, Hanneke W. M.; Wijnker, Gilles; de Boer, Rob J.

    2013-01-01

    During the first months of HIV infection, the virus typically evolves several immune escape mutations. These mutations are found in epitopes in viral proteins and reduce the impact of the CD8⁺ T cells specific for these epitopes. Recent data show that only a subset of the epitopes escapes, that most

  17. Computer Self-Efficacy, Competitive Anxiety and Flow State: Escaping from Firing Online Game

    Science.gov (United States)

    Hong, Jon-Chao; Pei-Yu, Chiu; Shih, Hsiao-Feng; Lin, Pei-Shin; Hong, Jon-Chao

    2012-01-01

    Flow state in game playing affected by computer self-efficacy and game competitive anxiety was studied. In order to examine the effect of those constructs with high competition, this study select "Escaping from firing online game" which require college students to escape from fire and rescue people and eliminate the fire damage along the way of…

  18. Effects of Visual Information on Wind-Evoked Escape Behavior of the Cricket, Gryllus bimaculatus.

    Science.gov (United States)

    Kanou, Masamichi; Matsuyama, Akane; Takuwa, Hiroyuki

    2014-09-01

    We investigated the effects of visual information on wind-evoked escape behavior in the cricket, Gryllus bimaculatus. Most agitated crickets were found to retreat into a shelter made of cardboard installed in the test arena within a short time. As this behavior was thought to be a type of escape, we confirmed how a visual image of a shelter affected wind-evoked escape behavior. Irrespective of the brightness of the visual background (black or white) or the absence or presence of a shelter, escape jumps were oriented almost 180° opposite to the source of the air puff stimulus. Therefore, the direction of wind-evoked escape depends solely depended on the direction of the stimulus air puff. In contrast, the turning direction of the crickets during the escape was affected by the position of the visual image of the shelter. During the wind-evoked escape jump, most crickets turned in the direction in which a shelter was presented. This behavioral nature is presumably necessary for crickets to retreat into a shelter within a short time after their escape jump.

  19. Spoon Distance Fading with and without Escape Extinction as Treatment for Food Refusal

    Science.gov (United States)

    Rivas, Kristi D.; Piazza, Cathleen C.; Patel, Meeta R.; Bachmeyer, Melanie H.

    2010-01-01

    Little is known about the characteristics of meals that serve as motivating operations (MOs) for escape behavior. In the current investigation, we showed that the distance at which a therapist held a spoon from a child's lips served as an MO for escape behavior. Based on these results, we implemented spoon distance fading, compared fading with and…

  20. Evaluating the potential ecological effects of transgene escape and persistence in constructed plant communities

    Science.gov (United States)

    To date, published studies with herbicide tolerant transgenic crops have failed to demonstrate that transgene escape to wild relatives results in more competitive hybrids. However, it is important to consider transgene escape in the context of the types of traits, which will lik...

  1. Supraventricular escape rhythms during transient episodes of bradycardia in preterm infants

    NARCIS (Netherlands)

    Andriessen, P.; Koolen, A.M.P.; Bastin, F.H.; Lafeber, H.N.; Meijler, F.L.

    2001-01-01

    Objective: To evaluate the origin of transient episodes of sinus bradycardia, atrial escape rhythm, and atrioventricular nodal escape rhythm in preterm infants. Material and methods: The study was observational, and was carried out in a third level neonatal intensive care unit. We srudied 19

  2. Escapement of Cape hakes under the fishing line of the Namibian ...

    African Journals Online (AJOL)

    The objective of this study was to establish whether Cape hakes Merluccius capensis and M. paradoxus escape under the fishing line and to identify any species or length dependence of escape rates. Experiments were carried out in Namibian waters during two cruises in October 2002 and October 2003. A collection bag ...

  3. The Efficacy of Noncontingent Escape for Decreasing Children's Disruptive Behavior during Restorative Dental Treatment

    Science.gov (United States)

    O'Callaghan, Patrick M.; Allen, Keith D.; Powell, Shawn; Salama, Fouad

    2006-01-01

    We evaluated the effectiveness of a dentist-implemented behavioral intervention in which brief escape from dental treatment was provided on a regular basis, independent of the child's behavior. Within a multiple baseline design across subjects, 5 children, ages 4 to 7 years, were provided with temporary escape from dental treatment on a fixed-time…

  4. 'Ajwa' dates (Phoenix dactylifera L.) extract ameliorates isoproterenol-induced cardiomyopathy through downregulation of oxidative, inflammatory and apoptotic molecules in rodent model.

    Science.gov (United States)

    Al-Yahya, Mohammed; Raish, Mohammad; AlSaid, Mansour S; Ahmad, Ajaz; Mothana, Ramzi A; Al-Sohaibani, Mohammed; Al-Dosari, Mohammed S; Parvez, Mohammad K; Rafatullah, Syed

    2016-10-15

    Ajwa, a special variety of Saudi Arabian dates (Phoenix dactylifera L.) is a rich source of nutrients, fibers and bioactive molecules. While previous studies have shown the therapeutic value of dates phytoconstituents in liver and kidney diseases etc., its cardioprotective potential remains elusive. We therefore, investigated the cardioprotective effect of lyophilized Ajwa extract (AJLE) ex vivo as well as in vivo. Ex vivo cardioprotective effect of AJLE was evaluated on DCFH-toxicated cardiomyoblast cells (H9C2). In vivo hemodynamics, cardiac function, serum cardiac enzymes, myocardial antioxidant, inflammatory and apoptotic biomarkers as well as histopathological parameters were studied in IPS-injured Wistar rat heart tissues. AJLE (250 µg/ml) attenuated the cytotoxicity and enhanced the H9C2 proliferation by up to 40%. Oral administration of AJLE (250 and 500 mg/kg.bw) prevented the depletion of endogenous antioxidants (CAT, SOD, NP-SH and NO) and myocyte injury marker enzymes, and inhibited lipid peroxidation (MDA, MPO). Moreover, AJLE downregulated the expressions of proinflammatory cytokines (IL-6, IL-10 and TNFα) and apoptotic markers (caspase-3 and Bax), and upregulated the anti-apototic protein Bcl2. Histological data showed that AJLE pretreatment reduced myonecrosis, edema, and infiltration of inflammatory cells and restored the cardiomyocytes architecture. Taken together, our data revealed that AJLE had strong antioxidant, hypolipidimic, cardioprotective, anti-inflammatory and anti-apoptotic potential against myocardial damage. This further endorses the use of Ajwa in Arabian traditional medicine against cardiovascular diseases. Copyright © 2015 Elsevier GmbH. All rights reserved.

  5. Magnetically responsive enzyme powders

    International Nuclear Information System (INIS)

    Pospiskova, Kristyna; Safarik, Ivo

    2015-01-01

    Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (−20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties. - Highlights: • Cross-linked enzyme powders were prepared in various liquid media. • Insoluble enzymes were magnetized using iron oxides particles. • Magnetic iron oxides particles were prepared by microwave-assisted synthesis. • Magnetic modification was performed under low (freezing) temperature. • Cross-linked powdered trypsin and lipase can be used repeatedly for reaction

  6. Enzymes in Fermented Fish.

    Science.gov (United States)

    Giyatmi; Irianto, H E

    Fermented fish products are very popular particularly in Southeast Asian countries. These products have unique characteristics, especially in terms of aroma, flavor, and texture developing during fermentation process. Proteolytic enzymes have a main role in hydrolyzing protein into simpler compounds. Fermentation process of fish relies both on naturally occurring enzymes (in the muscle or the intestinal tract) as well as bacteria. Fermented fish products processed using the whole fish show a different characteristic compared to those prepared from headed and gutted fish. Endogenous enzymes like trypsin, chymotrypsin, elastase, and aminopeptidase are the most involved in the fermentation process. Muscle tissue enzymes like cathepsins, peptidases, transaminases, amidases, amino acid decarboxylases, glutamic dehydrogenases, and related enzymes may also play a role in fish fermentation. Due to the decreased bacterial number during fermentation, contribution of microbial enzymes to proteolysis may be expected prior to salting of fish. Commercial enzymes are supplemented during processing for specific purposes, such as quality improvement and process acceleration. In the case of fish sauce, efforts to accelerate fermentation process and to improve product quality have been studied by addition of enzymes such as papain, bromelain, trypsin, pepsin, and chymotrypsin. © 2017 Elsevier Inc. All rights reserved.

  7. Enzyme Vs. Extremozyme -32 ...

    Indian Academy of Sciences (India)

    Enzyme Vs. Extremozyme. What Makes Extremozymes Function Under Harsh Conditions? Santosh Kumar is ... extremozymes to high temperature or pH so that enzymes from mesophiles can be engineered to behave .... alkalinity (above pH 10, soda lake) from which extremozymes have been isolated. F C Lowyer of the ...

  8. Progesterone after Estradiol Modulates Shuttle-Cage Escape by Facilitating Volition

    Directory of Open Access Journals (Sweden)

    Darryl J. Mayeaux

    2015-01-01

    Full Text Available In animal models of depression, depression is defined as performance on a learning task. That task is typically escaping a mild electric shock in a shuttle cage by moving from one side of the cage to the other. Ovarian hormones influence learning in other kinds of tasks, and these hormones are associated with depressive symptoms in humans. The role of these hormones in shuttle-cage escape learning, however, is less clear. This study manipulated estradiol and progesterone in ovariectomized female rats to examine their performance in shuttle-cage escape learning without intentionally inducing a depressive-like state. Progesterone, not estradiol, within four hours of testing affected latencies to escape. The improvement produced by progesterone was in the decision to act, not in the speed of learning or speed of escaping. This parallels depression in humans in that depressed people are slower in volition, in their decisions to take action.

  9. Plasma Clouds and Snowplows: Bulk Plasma Escape from Mars Observed by MAVEN

    Science.gov (United States)

    Halekas, J. S.; Brain, D. A.; Ruhunusiri, S.; McFadden, J. P.; Mitchell, D. L.; Mazelle, C.; Connerney, J. E. P.; Harada, Y.; Hara, T.; Espley, J. R.; hide

    2016-01-01

    We present initial Mars Atmosphere and Volatile EvolutioN (MAVEN) observations and preliminary interpretation of bulk plasma loss from Mars. MAVEN particle and field measurements show that planetary heavy ions derived from the Martian atmosphere can escape in the form of discrete coherent structures or "clouds." The ions in these clouds are unmagnetized or weakly magnetized, have velocities well above the escape speed, and lie directly downstream from magnetic field amplifications, suggesting a "snowplow" effect. This postulated escape process, similar to that successfully used to explain the dynamics of active gas releases in the solar wind and terrestrial magnetosheath, relies on momentum transfer from the shocked solar wind protons to the planetary heavy ions, with the electrons and magnetic field acting as intermediaries. Fluxes of planetary ions on the order of 10(exp 7)/sq cm/s can escape by this process, and if it operates regularly, it could contribute 10-20% of the current ion escape from Mars.

  10. Hydrogen and deuterium loss from the terrestrial atmosphere - A quantitative assessment of nonthermal escape fluxes

    Science.gov (United States)

    Yung, Yuk L.; Wen, Jun-Shan; Moses, Julianne I.; Landry, Bridget M.; Allen, Mark; Hsu, Kuang-Jung

    1989-01-01

    A comprehensive one-dimensional photochemical model extending from the middle atmosphere (50 km) to the exobase (432 km) has been used to study the escape of hydrogen and deuterium from the earth's atmosphere. The model incorporates recent advances in chemical kinetics as well as atmospheric observations by satellites, especially the Atmosphere Explorer C satellite. The results suggest that the escape fluxes of both H and D are limited by the upward transport of total hydrogen and total deuterium at the homopause. About one fourth of total hydrogen escape is thermal, the rest being nonthermal. It is shown that escape of D is nonthermal and that charge exchange and polar wind are important mechanisms for the nonthermal escape of H and D.

  11. Escape windows to improve the size selectivity in the Baltic cod trawl fishery

    DEFF Research Database (Denmark)

    Madsen, Niels; Holst, René; Foldager, L.

    2002-01-01

    A rapid decrease of the stock of Baltic cod (Gadus morhua) has provided the incentive to improve the size selectivity in the trawl fishery. Use of escape windows is permitted in the legislation to give means of improving the size selectivity of cod as an alternative to a traditional standard codend....... The history of the use of escape windows in the Baltic Sea cod fishery is reviewed. The present escape windows do not function optimally. The objective of this new experiment was to compare an improved design of escape window, which is placed in the upper panel, with that of standard codend. Three standard...... (WMS) as that of a standard codend. The L50 of the standard codends decreased with catch weight. An unexplained port- starboard effect was found for the window codends where the L50 depended on which of the two trawls the codend was attached to. The potential of these escape windows as a management...

  12. Antarctic krill; assessment of mesh size selectivity and escape mortality from trawls

    DEFF Research Database (Denmark)

    Krafft, Bjørn A.; Krag, Ludvig Ahm; Herrmann, Bent

    2015-01-01

    This working paper presents the aims and methodology for a three-year-project (commenced in 2015) assessing size selectivity and escape mortality of Antarctic krill from trawl nets. The project is widely based on acquired experiences from a completed study Net Escapement of Antarctic krill......Marine AS. The project will examine krill escape mortality from the codend during a full scale field experiment, model size selectivity and escape mortality in codends including different designs and assess the size selectivity in the trawl body forward of the codend. Based on end results from the preceding...... examinations we will be able to predict size selectivity and escape mortality from the entire trawl body with the appurtenant mortality for different trawl designs...

  13. Industrial Enzymes and Biocatalysis

    Science.gov (United States)

    McAuliffe, Joseph C.; Aehle, Wolfgang; Whited, Gregory M.; Ward, Donald E.

    All life processes are the result of enzyme activity. In fact, life itself, whether plant or animal, involves a complex network of enzymatic reactions. An enzyme is a protein that is synthesized in a living cell. It catalyzes a thermodynamically possible reaction so that the rate of the reaction is compatible with the numerous biochemical processes essential for the growth and maintenance of a cell. The synthesis of an enzyme thus is under tight metabolic regulations and controls that can be genetically or environmentally manipulated sometimes to cause the overproduction of an enzyme by the cell. An enzyme, like chemical catalysts, in no way modifies the equilibrium constant or the free energy change of a reaction.

  14. Microparticles from apoptotic platelets promote resident macrophage differentiation.

    Science.gov (United States)

    Vasina, E M; Cauwenberghs, S; Feijge, M A H; Heemskerk, J W M; Weber, C; Koenen, R R

    2011-09-29

    Platelets shed microparticles not only upon activation, but also upon ageing by an apoptosis-like process (apoptosis-induced platelet microparticles, PM(ap)). While the activation-induced microparticles have widely been studied, not much is known about the (patho)physiological consequences of PM(ap) formation. Flow cytometry and scanning electron microscopy demonstrated that PM(ap) display activated integrins and interact to form microparticle aggregates. PM(ap) were chemotactic for monocytic cells, bound to these cells, an furthermore stimulated cell adhesion and spreading on a fibronectin surface. After prolonged incubation, PM(ap) promoted cell differentiation, but inhibited proliferation. Monocyte membrane receptor analysis revealed increased expression levels of CD11b (integrin α(M)β(2)), CD14 and CD31 (platelet endothelial cell adhesion molecule-1), and the chemokine receptors CCR5 and CXCR4, but not of CCR2. This indicated that PM(ap) polarized the cells into resident M2 monocytes. Cells treated with PM(ap) actively consumed oxidized low-density lipoprotein (oxLDL), and released matrix metalloproteinases and hydrogen peroxide. Further confirmation for the differentiation towards resident professional phagocytes came from the finding that PM(ap) stimulated the expression of the (ox)LDL receptors, CD36 and CD68, and the production of proinflammatory and immunomodulating cytokines by monocytes. In conclusion, interaction of PM(ap) with monocytic cells has an immunomodulating potential. The apoptotic microparticles polarize the cells into a resident M2 subset, and induce differentiation to resident professional phagocytes.

  15. Apoptotic activity of frog Bombina maxima skin albumin.

    Science.gov (United States)

    Zhang, Ying-Xia; Wang, Yuan-Yuan; Lee, Wen-Hui; Zheng, Yong-Tang; Zhang, Yun

    2006-02-01

    Albumin, the most abundant protein components of blood plasma, is synthesized and secreted by liver cells in vertebrates. Recently, it was demonstrated that frog Bombina maxima albumin is also expressed in skin. Both B. maxima albumins from skin and serum (BmA-skin and BmA-serum) have similar biochemical characteristics except that the former contains haem b. Present studies showed that BmA-skin exhibited cytotoxic activity on H9 and C8166 cells. Pretreated with hemin to induce erythroid differentiation, K562 cells lost their resistance to cytotoxicity of BmA-skin. After treating cells with BmA-skin for 48 h, 50 percentage cytotoxic concentrations (CC(50)) of BmA-skin on H9, C8166 and hemin-treated K562 cells were 1.31+/-0.09, 1.59+/-0.08 and 2.28+/-0.06 microM, respectively. The cell death induced by BmA-skin was mediated by apoptosis of the tested cell lines, as demonstrated by nuclear morphological changes, DNA fragmentation and DNA hypodiploidy of apoptosis cells. At BmA-skin concentration of 2 microM, 27.3%, 19.7% and 17.8% of H9, C8166 and hemin-treated K562 cells were found to be apoptotic. In contrast, BmA-serum possessed no cytotoxic and apoptosis-inducing activity on all the cell lines tested, even with concentration used up to 15 microM. These results indicated that bound haem b in BmA-skin contributed significantly to its cytotoxic and apoptosis-inducing activity on the cell lines assayed.

  16. Cyclopamine and jervine induce COX-2 overexpression in human erythroleukemia cells but only cyclopamine has a pro-apoptotic effect

    Energy Technology Data Exchange (ETDEWEB)

    Ghezali, Lamia; Leger, David Yannick; Limami, Youness [Université de Limoges, FR 3503 GEIST, EA 1069 “Laboratoire de Chimie des Substances Naturelles”, GDR CNRS 3049, Faculté de Pharmacie, Laboratoire de Biochimie et Biologie Moléculaire, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France); Cook-Moreau, Jeanne [Université de Limoges, FR 3503 GEIST, UMR CNRS 7276 “Contrôle de la réponse immune B et lymphoproliférations”, Faculté de Médecine, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France); Beneytout, Jean-Louis [Université de Limoges, FR 3503 GEIST, EA 1069 “Laboratoire de Chimie des Substances Naturelles”, GDR CNRS 3049, Faculté de Pharmacie, Laboratoire de Biochimie et Biologie Moléculaire, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France); Liagre, Bertrand, E-mail: bertrand.liagre@unilim.fr [Université de Limoges, FR 3503 GEIST, EA 1069 “Laboratoire de Chimie des Substances Naturelles”, GDR CNRS 3049, Faculté de Pharmacie, Laboratoire de Biochimie et Biologie Moléculaire, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France)

    2013-04-15

    Erythroleukemia is generally associated with a very poor response and survival to current available therapeutic agents. Cyclooxygenase-2 (COX-2) has been described to play a crucial role in the proliferation and differentiation of leukemia cells, this enzyme seems to play an important role in chemoresistance in different cancer types. Previously, we demonstrated that diosgenin, a plant steroid, induced apoptosis in HEL cells with concomitant COX-2 overexpression. In this study, we investigated the antiproliferative and apoptotic effects of cyclopamine and jervine, two steroidal alkaloids with similar structures, on HEL and TF1a human erythroleukemia cell lines and, for the first time, their effect on COX-2 expression. Cyclopamine, but not jervine, inhibited cell proliferation and induced apoptosis in these cells. Both compounds induced COX-2 overexpression which was responsible for apoptosis resistance. In jervine-treated cells, COX-2 overexpression was NF-κB dependent. Inhibition of NF-κB reduced COX-2 overexpression and induced apoptosis. In addition, cyclopamine induced apoptosis and COX-2 overexpression via PKC activation. Inhibition of the PKC pathway reduced both apoptosis and COX-2 overexpression in both cell lines. Furthermore, we demonstrated that the p38/COX-2 pathway was involved in resistance to cyclopamine-induced apoptosis since p38 inhibition reduced COX-2 overexpression and increased apoptosis in both cell lines. - Highlights: ► Cyclopamine alone but not jervine induces apoptosis in human erythroleukemia cells. ► Cyclopamine and jervine induce COX-2 overexpression. ► COX-2 overexpression is implicated in resistance to cyclopamine-induced apoptosis. ► Apoptotic potential of jervine is restrained by NF-κB pathway activation. ► PKC is involved in cyclopamine-induced apoptosis and COX-2 overexpression.

  17. Cyclopamine and jervine induce COX-2 overexpression in human erythroleukemia cells but only cyclopamine has a pro-apoptotic effect

    International Nuclear Information System (INIS)

    Ghezali, Lamia; Leger, David Yannick; Limami, Youness; Cook-Moreau, Jeanne; Beneytout, Jean-Louis; Liagre, Bertrand

    2013-01-01

    Erythroleukemia is generally associated with a very poor response and survival to current available therapeutic agents. Cyclooxygenase-2 (COX-2) has been described to play a crucial role in the proliferation and differentiation of leukemia cells, this enzyme seems to play an important role in chemoresistance in different cancer types. Previously, we demonstrated that diosgenin, a plant steroid, induced apoptosis in HEL cells with concomitant COX-2 overexpression. In this study, we investigated the antiproliferative and apoptotic effects of cyclopamine and jervine, two steroidal alkaloids with similar structures, on HEL and TF1a human erythroleukemia cell lines and, for the first time, their effect on COX-2 expression. Cyclopamine, but not jervine, inhibited cell proliferation and induced apoptosis in these cells. Both compounds induced COX-2 overexpression which was responsible for apoptosis resistance. In jervine-treated cells, COX-2 overexpression was NF-κB dependent. Inhibition of NF-κB reduced COX-2 overexpression and induced apoptosis. In addition, cyclopamine induced apoptosis and COX-2 overexpression via PKC activation. Inhibition of the PKC pathway reduced both apoptosis and COX-2 overexpression in both cell lines. Furthermore, we demonstrated that the p38/COX-2 pathway was involved in resistance to cyclopamine-induced apoptosis since p38 inhibition reduced COX-2 overexpression and increased apoptosis in both cell lines. - Highlights: ► Cyclopamine alone but not jervine induces apoptosis in human erythroleukemia cells. ► Cyclopamine and jervine induce COX-2 overexpression. ► COX-2 overexpression is implicated in resistance to cyclopamine-induced apoptosis. ► Apoptotic potential of jervine is restrained by NF-κB pathway activation. ► PKC is involved in cyclopamine-induced apoptosis and COX-2 overexpression

  18. Arctigenin Treatment Protects against Brain Damage through an Anti-Inflammatory and Anti-Apoptotic Mechanism after Needle Insertion

    Science.gov (United States)

    Song, Jie; Li, Na; Xia, Yang; Gao, Zhong; Zou, Sa-feng; Kong, Liang; Yao, Ying-Jia; Jiao, Ya-Nan; Yan, Yu-Hui; Li, Shao-Heng; Tao, Zhen-Yu; Lian, Guan; Yang, Jing-Xian; Kang, Ting-Guo

    2016-01-01

    Convection enhanced delivery (CED) infuses drugs directly into brain tissue. Needle insertion is required and results in a stab wound injury (SWI). Subsequent secondary injury involves the release of inflammatory and apoptotic cytokines, which have dramatic consequences on the integrity of damaged tissue, leading to the evolution of a pericontusional-damaged area minutes to days after in the initial injury. The present study investigated the capacity for arctigenin (ARC) to prevent secondary brain injury and the determination of the underlying mechanism of action in a mouse model of SWI that mimics the process of CED. After CED, mice received a gavage of ARC from 30 min to 14 days. Neurological severity scores (NSS) and wound closure degree were assessed after the injury. Histological analysis and immunocytochemistry were used to evaluated the extent of brain damage and neuroinflammation. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) was used to detect universal apoptosis. Enzyme-linked immunosorbent assays (ELISA) was used to test the inflammatory cytokines (tumor necrosis factor (TNF)-α, interleukin (IL)-6 and IL-10) and lactate dehydrogenase (LDH) content. Gene levels of inflammation (TNF-α, IL-6, and IL-10) and apoptosis (Caspase-3, Bax and Bcl-2) were detected by reverse transcription-polymerase chain reaction (RT-PCR). Using these, we analyzed ARC’s efficacy and mechanism of action. Results: ARC treatment improved neurological function by reducing brain water content and hematoma and accelerating wound closure relative to untreated mice. ARC treatment reduced the levels of TNF-α and IL-6 and the number of allograft inflammatory factor (IBA)- and myeloperoxidase (MPO)-positive cells and increased the levels of IL-10. ARC-treated mice had fewer TUNEL+ apoptotic neurons and activated caspase-3-positive neurons surrounding the lesion than controls, indicating increased neuronal survival. Conclusions: ARC treatment confers

  19. Cellular Adhesion Promotes Prostate Cancer Cells Escape from Dormancy.

    Science.gov (United States)

    Ruppender, Nazanin; Larson, Sandy; Lakely, Bryce; Kollath, Lori; Brown, Lisha; Coleman, Ilsa; Coleman, Roger; Nguyen, Holly; Nelson, Peter S; Corey, Eva; Snyder, Linda A; Vessella, Robert L; Morrissey, Colm; Lam, Hung-Ming

    2015-01-01

    Dissemination of prostate cancer (PCa) cells to the bone marrow is an early event in the disease process. In some patients, disseminated tumor cells (DTC) proliferate to form active metastases after a prolonged period of undetectable disease known as tumor dormancy. Identifying mechanisms of PCa dormancy and reactivation remain a challenge partly due to the lack of in vitro models. Here, we characterized in vitro PCa dormancy-reactivation by inducing cells from three patient-derived xenograft (PDX) lines to proliferate through tumor cell contact with each other and with bone marrow stroma. Proliferating PCa cells demonstrated tumor cell-cell contact and integrin clustering by immunofluorescence. Global gene expression analyses on proliferating cells cultured on bone marrow stroma revealed a downregulation of TGFB2 in all of the three proliferating PCa PDX lines when compared to their non-proliferating counterparts. Furthermore, constitutive activation of myosin light chain kinase (MLCK), a downstream effector of integrin-beta1 and TGF-beta2, in non-proliferating cells promoted cell proliferation. This cell proliferation was associated with an upregulation of CDK6 and a downregulation of E2F4. Taken together, our data provide the first clinically relevant in vitro model to support cellular adhesion and downregulation of TGFB2 as a potential mechanism by which PCa cells may escape from dormancy. Targeting the TGF-beta2-associated mechanism could provide novel opportunities to prevent lethal PCa metastasis.

  20. Human embryo immune escape mechanisms rediscovered by the tumor.

    Science.gov (United States)

    Ridolfi, Laura; Petrini, Massimiliano; Fiammenghi, Laura; Riccobon, Angela; Ridolfi, Ruggero

    2009-01-01

    Towards the end of the 1990s, the two opposing theories on immunosurveillance and immunostimulation were extensively studied by researchers in an attempt to understand the complex mechanisms that regulate the relation between tumors and the host's immune system. Both theories probably have elements that would help us to comprehend how the host can induce anti-tumor clinical responses through stimulation of the immune system and which could also give us a deeper insight into the mechanisms of tumor immunosuppression. The model that most resembles the behavior of tumor cells in terms of growth, infiltration and suppression of the immune system of the environment in which they live is undoubtedly that of the embryonic cell. The fetus behaves like an allogenic transplant within the mother's body, using every means it has to escape from and defend itself against the mother's immune system. The majority of these mechanisms are the same as those found in tumor cells: antigenic loss, lack of expression of classic HLA-I molecules, production of immunosuppressive cytokines, induction of lack of expression of co-stimulatory molecules in antigen presenting cells, and induction of apoptosis in infiltrating lymphocytes, with activation of a type Th2 regulatory lymphocyte response. A careful and comparative study of key mechanisms capable of triggering tolerance or cytotoxicity in both embryonic and tumor cells could prove immensely valuable in designing new strategies for anti-tumor immunotherapy.

  1. Modified guidance laws to escape microbursts with turbulence

    Directory of Open Access Journals (Sweden)

    Atilla Dogan

    2002-01-01

    Full Text Available This paper introduces Modified Altitude- and Dive-Guidance laws for escaping a microburst with turbulence. The goal is to develop a procedure to estimate the highest altitude at which an aircraft can fly through a microburst without running into stall. First, a new metric is constructed that quantifies the aircraft upward force capability in a microburst encounter. In the absence of turbulence, the metric is shown to be a decreasing function of altitude. This suggests that descending to a low altitude may improve safety in the sense that the aircraft will have more upward force capability to maintain its altitude. In the presence of stochastic turbulence, the metric is treated as a random variable and its probability distribution function is analytically approximated as a function of altitude. This approximation allows us to determine the highest safe altitude at which the aircraft may descend, hence avoiding to descend too low. This highest safe altitude is used as the commanded altitude in Modified Altitude- and Dive-Guidance. Monte Carlo simulations show that these Modified Altitude- and Dive-Guidance strategies can decrease the probability of minimum altitude being lower than a given value without significantly increasing the probability of crash.

  2. EUROGAM: A high efficiency escape suppressed spectrometer array

    International Nuclear Information System (INIS)

    Nolan, P.J.

    1992-01-01

    EUROGAM is a UK-France collaboration to develop and build a high efficiency escape suppressed spectrometer array. The project has involved the development of both germanium (Ge) and bismuth germanate (BGO) detectors to produce crystals which are both bigger and have a more complex geometry. As a major investment for the future, the collaboration has developed a new electronics and data acquisition system based on the VXI and VME standards. The array will start its experimental programme in mid 1992 at the Nuclear Structure Facility at Daresbury, U.K. At this stage it will have a total photopeak efficiency (for 1.33 MeV gamma-rays) of ∼ 4.5%. This will give an improvement in sensitivity (relative to presently operating arrays) of a factor of about 10. When EUROGAM moves to France in mid 1993 its photopeak efficiency will have increased to about 8.5% which will result in an increase in sensitivity of a further factor of about 10. In this article I will concentrate on the array which will operate at Daresbury in 1992 and only briefly cover the developments which will take place for the full array before it is used in France in 1993. (author). 13 refs., 2 tabs., 10 figs

  3. My car is sinking: automobile submersion, lessons in vehicle escape.

    Science.gov (United States)

    Giesbrecht, Gordon G; McDonald, Gerren K

    2010-08-01

    In North America approximately 400 individuals per year die in submersed vehicles, accounting for 5-11% of all drownings. About half of people surveyed would let the vehicle fill with water before attempting exit. We used a crane and two passenger vehicles of the same make, model, and year-one with passenger compartment intact (I) and one with holes (H) in the floor (area approximately 2200 cm2)--to conduct occupied and unoccupied submersions. Three phases of submersion were identified: 1) FLOATING, vehicles floated for 15 s (H) to 63 s (I) before the water reached the bottom of the side windows; 2) SINKING, the subsequent period until the vehicle is completely under water, but before it fills completely; and 3) SUBMERGED, the vehicle was full of water and several feet below the surface. Total time to submersion was 150 s for I but only 37 s for H. Opening the door to exit Vehicle I decreased submersion time from 150 to 30 s. Even the most difficult exit strategy attempted (three men and a child manikin through one window) was quickly performed from Vehicle I (only 51 s). During one exit attempt, initiated during the sinking phase, it was impossible to open the doors or windows until the vehicle was completely full of water. A vehicle is most easily exited during the initial Floating Phase. We suggest the following escape procedure: SEATBELT(s) unfastened; WINDOWS open; CHILDREN released from restraints and brought close to an adult; and OUT, children should exit first.

  4. Intertextuality in Novel: An Escape from Patriarchal Soliloquy

    Directory of Open Access Journals (Sweden)

    Nargess Bagheri

    2015-12-01

    Full Text Available Hypertextuality is one of the intertextual relationships introduced by Gerard Genette. According to him, hypertextuality includes all the relationships which the hypertext has with the previous text, i.e. the hypotext. However, he does not consider the relationship between these two texts to be in such a way that the hypertext is the interpretation of the hypotext. On the other hand, other theorizers including Bakhtin, regard the conversation between texts a way to escape a one-voiced and dominant discourse. From this viewpoint, the intertextual relationships of Sadegh Hedayat’s The Blind Owl, with Shahrnoush Parsipour’s The Blue Mind and Abbas Maroufi’s The Body of Farhad are in such a way that The Blind Owl can be regarded as a hypotext for the other 2 novels but these two novels interpret the text differently. The present study aims to examine the intertextual relationships between these 3 novels and explore how a multiple-voiced conversation is formed between them.

  5. ESCAPE. Energy Security and ClimAte Policy Evaluation

    International Nuclear Information System (INIS)

    Kessels, J.R.; Bakker, S.J.A.

    2005-05-01

    Climate change and energy supply security policy are currently not integrated in most countries, despite possible synergies. The ESCAPE approach suggests that linking climate change policy with security of energy supply could improve climate change policy at both a national and international level. The report explores the interaction between policies of energy security and climate change and the options of inclusion of energy security issues into national and international post-2012 climate negotiations. It emphasises the importance of the US in this regard and takes a close look at US energy policy documents. It appears that current US energy policy is not directed towards reducing its reliance on imported fossil fuel, even though the government has a strong preference for this. This study shows that measures to reduce import dependency are mostly synergetic with climate policy and gives some options that can be implemented. On an international level, linkages of energy security into post-2012 climate policy may be possible in sectoral bottom-up approaches or technology frameworks. As well, inclusion of a security of supply criterion in international emission trading instruments may provide potential benefits

  6. Tests of escape theory of binge eating among Latinas.

    Science.gov (United States)

    Higgins Neyland, M K; Bardone-Cone, Anna M

    2017-07-01

    Despite comparable prevalence of some eating disorders (e.g., binge eating disorder) among Latinas compared with Caucasians, eating disorders are still thought of as primarily afflicting Caucasian women. This has led to a lag in research on eating disorders among Latinas. Our objective was to test 3 escape theory models involving the culturally specific independent variables of acculturative stress, family disconnection, and discriminatory stress; the mediator of negative affect; and the dependent variable of binge eating frequency. We recruited a female sample of 119 Latinas (78 who have suffered from an eating disorder, 41 who have never had an eating disorder). Results indicated that all of the relationships between culturally specific factors and binge eating were mediated by negative affect, and that there was a significant direct pathway from discriminatory stress to binge eating. Findings from this study can be used to tailor interventions to Latinas who engage in binge eating, targeting culturally specific factors and their relationships with negative affect and binge eating. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  7. Apoptotic action of peroxisome proliferator-activated receptor-gamma activation in human non small-cell lung cancer is mediated via proline oxidase-induced reactive oxygen species formation.

    Science.gov (United States)

    Kim, Ki Young; Ahn, Jin Hee; Cheon, Hyae Gyeong

    2007-09-01

    Peroxisome proliferator-activated receptor (PPAR)-gamma ligands have been shown to inhibit human lung cancers by inducing apoptosis and differentiation. In the present study, we elucidated the apoptotic mechanism of PPARgamma activation in human lung cancers by using a novel PPARgamma agonist, 1-(trans-methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-(1H-indene-2-carboxylic acid ethyl ester (KR-62980), and rosiglitazone. PPARgamma activation selectively inhibited cell viability of non-small-cell lung cancer with little effect on small-cell lung cancer and normal lung cells. The cell death induced by PPARgamma activation presented apoptotic features of oligonucleosomal DNA fragmentation in A549 human non-small-cell lung cancer cell line. Reactive oxygen species (ROS) production was accompanied by increased expression of proline oxidase (POX), a redox enzyme expressed in mitochondria, upon incubation with the agonists. POX RNA interference treatment blocked PPARgamma-induced ROS formation and cytotoxicity, suggesting that POX plays a functional role in apoptosis through ROS formation. The apoptotic effects by the agonists were antagonized by bisphenol A diglycidyl ether, a PPARgamma antagonist, and by knockdown of PPARgamma expression, indicating the involvement of PPARgamma in these actions. The results of the present study suggest that PPARgamma activation induces apoptotic cell death in non-small-cell lung carcinoma mainly through ROS formation via POX induction.

  8. Cytotoxic and Apoptotic Effect of the Decoction of the Aerial Parts of ...

    African Journals Online (AJOL)

    Cytotoxic and Apoptotic Effect of the Decoction of the Aerial Parts of Flueggea leucopyrus on Human Endometrial Carcinoma (AN3CA) Cells. SR Samarakoon, SB Kotigala, I Gammana-Liyanage, I Thabrew, KH Tennekoon, A Siriwardana, PB Galhena ...

  9. A Novel Mitochondria-Dependent Apoptotic Pathway (MAP) in Prostate Cancer (Pca) Cells

    National Research Council Canada - National Science Library

    Chandra, Dhyan

    2004-01-01

    ...) are also up-regulated (Chandra et al., J. Biol. Chem., 277, 50842-54; 2002). Later, when the apoptotic machinery is activated, I notice that there is prominent localization of active caspase-9 and -3 in the mitochondria...

  10. Cytotoxic and Apoptotic Effect of the Decoction of the Aerial Parts of ...

    African Journals Online (AJOL)

    , respectively. The decoction also enhanced apoptosis as shown by enhanced DNA fragmentation, microscopic observation of nuclear condensation, fragmentation and apoptotic bodies and enhanced caspase 3 and. 9 activities, as well as ...

  11. Antiproliferative and apoptotic effects of diffractaic acid in A549 and AGS cancer cells

    Science.gov (United States)

    Kızıl, Hamit Emre; Aǧar, Güleray

    2017-04-01

    In this study, we determined the antiproliferative and apoptotic effects of diffractaic acid by measuring the gene expression changes of topo II α, caspase-3 and p53 on A549 and AGS cancer cells. Real time PCR assay was used to measure the change folds. It was determined that concentrations of 12,5, 50 and 100 µg / ml were antiproliferative and apoptotic for the A549 cancer cell line and 50 µg / ml for the AGS cell line.

  12. BRCA1 expression, proliferative and apoptotic activities in ovarian epithelial inclusions

    OpenAIRE

    Wang, Yiying; Wang, Yue; Wei, Li; Hong, Shuhui; Zhao, Miaoqing; Zhang, Xi; Zheng, Wenxin

    2017-01-01

    Background The purpose of this study was to examine proliferative and apoptotic activity in relation with BRCA1 expression in ovarian epithelial inclusions (OEIs), the putative precursor lesions of ovarian epithelial cancer (OEC). Methods Benign ovaries from 95 patients were examined. Dual immunohistochemical staining for both BRCA1 and MIB-1 were performed to examine the relationship between BRCA1 and MIB-1 in OEI cells. Apoptotic activity was assessed on the parallel tissue sections by usin...

  13. Visible tumor surface response to physical plasma and apoptotic cell kill in head and neck cancer.

    Science.gov (United States)

    Schuster, Matthias; Seebauer, Christian; Rutkowski, Rico; Hauschild, Anna; Podmelle, Fred; Metelmann, Camilla; Metelmann, Bibiana; von Woedtke, Thomas; Hasse, Sybille; Weltmann, Klaus-Dieter; Metelmann, Hans-Robert

    2016-09-01

    The aim of the study was to learn, whether clinical application of cold atmospheric pressure plasma (CAP) is able to cause (i) visible tumor surface effects and (ii) apoptotic cell kill in squamous cell carcinoma and (iii) whether CAP-induced visible tumor surface response occurs as often as CAP-induced apoptotic cell kill. Twelve patients with advanced head and neck cancer and infected ulcerations received locally CAP followed by palliative treatment. Four of them revealed tumor surface response appearing 2 weeks after intervention. The tumor surface response expressed as a flat area with vascular stimulation (type 1) or a contraction of tumor ulceration rims forming recesses covered with scabs, in each case surrounded by tumor tissue in visible progress (type 2). In parallel, 9 patients with the same kind of cancer received CAP before radical tumor resection. Tissue specimens were analyzed for apoptotic cells. Apoptotic cells were detectable and occurred more frequently in tissue areas previously treated with CAP than in untreated areas. Bringing together both findings and placing side by side the frequency of clinical tumor surface response and the frequency of analytically proven apoptotic cell kill, detection of apoptotic cells is as common as clinical tumor surface response. There was no patient showing signs of an enhanced or stimulated tumor growth under influence of CAP. CAP was made applicable by a plasma jet, kINPen(®) MED (neoplas tools GmbH, Greifswald, Germany). Copyright © 2016. Published by Elsevier Ltd.

  14. Effects of Malnutrition on Neutrophil/Mononuclear Cell Apoptotic Functions in Children with Acute Lymphoblastic Leukemia.

    Science.gov (United States)

    Cakir, Fatma Betul; Berrak, Su Gülsün; Aydogan, Gonul; Tulunay, Aysin; Timur, Cetin; Canpolat, Cengiz; Eksioglu Demiralp, Emel

    2017-04-01

    Recent studies claim that apoptosis may explain immune dysfunction observed in malnutrition. The objective of this study was to determine the effect of malnutrition on apoptotic functions of phagocytic cells in acute lymphoblastic leukemia (ALL). Twenty-eight ALL patients (13 with malnutrition) and thirty controls were enrolled. Neutrophil and mononuclear cell apoptosis of ALL patients and the control group were studied on admission before chemotherapy and repeated at a minimum of three months after induction of chemotherapy or when the nutritional status of leukemic children improved. The apoptotic functions of both ALL groups on admission were significantly lower than those of the control group. The apoptotic functions were lower in ALL patients with malnutrition than those in ALL patients without malnutrition, but this was not statistically significant. The repeated apoptotic functions of both ALL groups were increased to similar values with the control group. This increase was found to be statistically significant. The apoptotic functions in ALL patients were not found to be affected by malnutrition. However, after dietary intervention, increased apoptotic functions in both ALL patient groups deserve mentioning. Dietary intervention should always be recommended as malnutrition or cachexia leads to multiple complications. Enhanced apoptosis might originate also from remission state of cancer.

  15. Phagocytosis mechanism of apoptotic granulosa cells regulated by milk-fat globule-EGF factor 8.

    Science.gov (United States)

    Naka, Mayumi; Kusakabe, Ken; Takeshita, Ai; Nakagawa, Hiroshi; Ito, Yuko; Shibata, Masa-Aki; Otsuki, Yoshinori

    2009-09-01

    In the process of ovary sexual maturation, most immature ovarian follicles degrade into atretic follicles accompanied by apoptosis in granulosa cells. Macrophages can recognize apoptotic cells through specific binding with phosphatidylserine (PS), exposed on the surface of apoptotic cells, which is mediated by milk-fat globule-EGF factor 8 (MFG-E8). In the present research, we examined the involvement of the MFG-E8-dependent phagocytosis system in the atretic follicles of developing mouse ovaries. The number of atretic follicles and DNA-fragmented granulosa cells significantly increased in B6C3F1 mice during 2 to 6 weeks. Chromatin-condensed granulosa cells were engulfed by macrophages, which existed in the stroma or atretic follicles, or by neighboring normal granulosa cells. MFG-E8 mRNA increased in ovaries during 2 to 6 weeks, and immunoreactivity of MFG-E8 was detected at the surface of apoptotic cells existing around the antrum. Immunoelectron microscopic study revealed MFG-E8-positive signals on the membrane of apoptotic cells near macrophages, but apoptotic cells engulfed by neighboring granulosa cells showed few signals. Anti-Fas antibody elevated the annexin-V-positive reaction in isolated granulosa cells from 3-week-old mouse ovaries. MFG-E8 seems to act on the phagocytosis of apoptotic granulosa cells via macrophages and contribute to the regression process of atretic follicles.

  16. The oncogenic tyrosine kinase Lyn impairs the pro-apoptotic function of Bim.

    Science.gov (United States)

    Aira, Lazaro E; Villa, Elodie; Colosetti, Pascal; Gamas, Parvati; Signetti, Laurie; Obba, Sandrine; Proics, Emma; Gautier, Fabien; Bailly-Maitre, Béatrice; Jacquel, Arnaud; Robert, Guillaume; Luciano, Frédéric; Juin, Philippe P; Ricci, Jean-Ehrland; Auberger, Patrick; Marchetti, Sandrine

    2018-02-02

    Phosphorylation of Ser/Thr residues is a well-established modulating mechanism of the pro-apoptotic function of the BH3-only protein Bim. However, nothing is known about the putative tyrosine phosphorylation of this Bcl-2 family member and its potential impact on Bim function and subsequent Bax/Bak-mediated cytochrome c release and apoptosis. As we have previously shown that the tyrosine kinase Lyn could behave as an anti-apoptotic molecule, we investigated whether this Src family member could directly regulate the pro-apoptotic function of Bim. In the present study, we show that Bim is phosphorylated onto tyrosine residues 92 and 161 by Lyn, which results in an inhibition of its pro-apoptotic function. Mechanistically, we show that Lyn-dependent tyrosine phosphorylation of Bim increases its interaction with anti-apoptotic members such as Bcl-xL, therefore limiting mitochondrial outer membrane permeabilization and subsequent apoptosis. Collectively, our data uncover one molecular mechanism through which the oncogenic tyrosine kinase Lyn negatively regulates the mitochondrial apoptotic pathway, which may contribute to the transformation and/or the chemotherapeutic resistance of cancer cells.

  17. Means of escape provisions and evacuation simulation of public building in Malaysia and Singapore

    Science.gov (United States)

    Samad, Muna Hanim Abdul; Taib, Nooriati; Ying, Choo Siew

    2017-10-01

    The Uniform Building By-law 1984 of Malaysia is the legal document governing fire safety requirements in buildings. Its prescriptive nature has made the requirements out dated from the viewpoint of current performance based approach in most developed countries. The means of escape provisions is a critical requirement to safeguard occupants' safety in fire especially in public buildings. As stipulated in the UBBL 1984, the means of escape provisions includes sufficient escape routes, travel distance, protection of escape routes, etc. designated as means to allow occupants to escape within a safe period of time. This research aims at investigating the effectiveness of those provisions in public buildings during evacuation process involving massive crowd during emergencies. This research includes a scenario-based study on evacuation processes using two software i.e. PyroSim, a crowd modelling software to conduct smoke study and Pathfinder to stimulate evacuation model of building in Malaysia and Singapore as comparative study. The results show that the buildings used as case study were designed according to Malaysian UBBL 1984 and Singapore Firecode, 2013 respectively provide relative safe means of escape. The simulations of fire and smoke and coupled with simulation of evacuation have demonstrated that although there are adequate exits designated according to fire requirements, the impact of the geometry of atriums on the behavior of fire and smoke have significant effect on escape time especially for unfamiliar user of the premises.

  18. Escape of quantum particles from an open nano-circular microcavity

    International Nuclear Information System (INIS)

    Liu, Sheng; Wang, De-hua

    2014-01-01

    When a laser is irradiated on a negative ion, it will provide a coherent, mono-energetic source of detached electrons propagating out from the location of the negative ion. The total escape probability density of the electrons when the negative ion is placed inside an open nano-circular microcavity has been studied on the basis of the semiclassical theory. It is shown that significant oscillations appear in the total escape probability density due to the quantum interference effects. Besides, our study suggests that the escape probability density depends on the laser polarization sensitively. In order to show the correspondence between the escaped probability density and the detached electron's escaped orbits clearly, we calculate the path length spectrum and find that each peak corresponds to the length of one detached electron's escaped orbit. This study provides an example where the quantum nature of the electron's wave function can be observed in the macroscopic world. Our study may guide the future experimental research on the escape and transport process of particles through semiconductor microjunctions.

  19. Reporter Assay for Endo/Lysosomal Escape of Toxin-Based Therapeutics

    Directory of Open Access Journals (Sweden)

    Roger Gilabert-Oriol

    2014-05-01

    Full Text Available Protein-based therapeutics with cytosolic targets are capable of exhibiting their therapeutic effect once they have escaped from the endosomes or lysosomes. In this study, the reporters—horseradish peroxidase (HRP, Alexa Fluor 488 (Alexa and ricin A-chain (RTA—were investigated for their capacity to monitor the endo/lysosomal escape of the ribosome-inactivating protein, saporin. The conjugates—saporin-HRP, Alexasaporin and saporin-KQ-RTA—were constructed, and the endo/lysosomal escape of these conjugates alone (lack of endo/lysosomal release or in combination with certain structurally-specific triterpenoidal saponins (efficient endo/lysosomal escape was characterized. HRP failed in reporting the endo/lysosomal escape of saporin. Contrastingly, Alexa Fluor 488 successfully allowed the report of the process at a toxin concentration of 1000 nM. In addition, single endo/lysosome analysis facilitated the determination of the amount of Alexasaporin released from each vesicle. RTA was also successful in reporting the endo/lysosomal escape of the enzymatically inactive mutant, saporin-KQ, but in this case, the sensitivity of the method reached a toxin concentration of 10 nM. In conclusion, the simultaneous usage of Alexa Fluor 488 and RTA as reporters may provide the possibility of monitoring the endo/lysosomal escape of protein-based therapeutics in the concentration range of 10–1000 nM.

  20. Enzymic lactose hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.J.; Brand, J.C.

    1980-01-01

    Acid or enzymic hydrolysis can be used to hydrolyze lactose. Advantages of both are compared and details of enzymic hydrolysis using yeast or fungal enzymes given. The new scheme outlined involves recycling lactase. Because lactose and lactase react to ultrafiltration (UF) membranes differently separation is possible. Milk or milk products are ultrafiltered to separate a concentrate from a lactose-rich permeate which is treated with lactase in a reactor until hydrolysis reaches a required level. The lactase can be removed by UF as it does not permeate the membrane, and it is recycled back to the reactor. Permeate from the second UF stage may or may not be recombined with the concentrate from the first stage to produce a low lactose product (analysis of a typical low-lactose dried whole milk is given). Batch or continuous processes are explained and a batch process without enzyme recovery is discussed. (Refs. 4).

  1. Indicators: Sediment Enzymes

    Science.gov (United States)

    Sediment enzymes are proteins that are produced by microorganisms living in the sediment or soil. They are indicators of key ecosystem processes and can help determine which nutrients are affecting the biological community of a waterbody.

  2. Enzymes in Analytical Chemistry.

    Science.gov (United States)

    Fishman, Myer M.

    1980-01-01

    Presents tabular information concerning recent research in the field of enzymes in analytic chemistry, with methods, substrate or reaction catalyzed, assay, comments and references listed. The table refers to 128 references. Also listed are 13 general citations. (CS)

  3. Enzyme Vs. Extremozyme -32 ...

    Indian Academy of Sciences (India)

    Enzyme Vs. Extremozyme. What Makes Extremozymes Function Under Harsh Conditions? Santosh Kumar is doing his Ph D at Biotechnology. Centre, Indian Institute of. Technology, Bombay. His research interests include: enzymology, metabolism, metabolic regulation and metabolic engineering of a filamentous fungi,.

  4. Membrane Assisted Enzyme Fractionation

    DEFF Research Database (Denmark)

    Yuan, Linfeng

    . In this thesis, separations using crossflow elecro-membrane filtration (EMF) of amino acids, bovine serum albumin (BSA) and industrial enzymes from Novozymes were performed. The main objective of this study was to investigate the technological feasibility of EMF in the application of industrial enzyme...... fractionation, such as removal of a side activity from the main enzyme activity. As a proof-of-concept, amino acids were used as model solution to test the feasibility of EMF in the application of amphoteric molecule separation. A single amino acid was used to illustrate the effect of an electric field...... on the separation performance were very small in the investigated range. The mass transport of each enzyme can be well explained by the Extended-Nernst-Planck equation. Better separation was observed at lower feed concentration, higher solution pH in the investigated range and with a polysulfone (PS) MF membrane...

  5. Advances in enzyme immobilisation

    CSIR Research Space (South Africa)

    Brady, D

    2009-07-10

    Full Text Available improved protein binding capacity. Novel methods of enzyme self immobilisation have been developed (CLEC, CLEA, Spherezyme), as well as carrier materials (Dendrispheres), encapsulation (PEI Microspheres), and entrapment. Apart from retention, recovery...

  6. Enzyme catalysed tandem reactions.

    Science.gov (United States)

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-04-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a reversible process to become irreversible, to shift the equilibrium reaction in such a way that enantiopure compounds can be obtained from prochiral or racemic substrates, reduce or eliminate problems due to product inhibition or prevent the shortage of substrates by dilution or degradation in the bulk media, etc. In this review we want to illustrate the developments of recent studies involving in vitro multi-enzyme reactions for the synthesis of different classes of organic compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Quantifying the impact of human immunodeficiency virus-1 escape from cytotoxic T-lymphocytes.

    Directory of Open Access Journals (Sweden)

    Ulrich D Kadolsky

    2010-11-01

    Full Text Available HIV-1 escape from the cytotoxic T-lymphocyte (CTL response leads to a weakening of viral control and is likely to be detrimental to the patient. To date, the impact of escape on viral load and CD4(+ T cell count has not been quantified, primarily because of sparse longitudinal data and the difficulty of separating cause and effect in cross-sectional studies. We use two independent methods to quantify the impact of HIV-1 escape from CTLs in chronic infection: mathematical modelling of escape and statistical analysis of a cross-sectional cohort. Mathematical modelling revealed a modest increase in log viral load of 0.051 copies ml(-1 per escape event. Analysis of the cross-sectional cohort revealed a significant positive association between viral load and the number of "escape events", after correcting for length of infection and rate of replication. We estimate that a single CTL escape event leads to a viral load increase of 0.11 log copies ml(-1 (95% confidence interval: 0.040-0.18, consistent with the predictions from the mathematical modelling. Overall, the number of escape events could only account for approximately 6% of the viral load variation in the cohort. Our findings indicate that although the loss of the CTL response for a single epitope results in a highly statistically significant increase in viral load, the biological impact is modest. We suggest that this small increase in viral load is explained by the small growth advantage of the variant relative to the wildtype virus. Escape from CTLs had a measurable, but unexpectedly low, impact on viral load in chronic infection.

  8. Escape of H and D from Mars' Atmosphere and the Evolution of its Crustal Water Reservoirs

    Science.gov (United States)

    Hartle, Richard E.; Einaudi, Franco (Technical Monitor)

    2001-01-01

    The evolution of water on Mars involves preferential escape of hydrogen over deuterium, producing its deuterium rich atmosphere with a D/H ratio 5.2 times that of terrestrial water. In the past decade, several estimates have been made of the magnitudes of current and ancient crustal water reservoirs on Mars that freely exchange with its atmosphere. Some of the differences in the magnitudes of the reservoirs are influenced by differences in the following basic parameters: composition of H, D, H2 and HD at the exobase; thermal history of the atmosphere; escape mechanisms; and the D/H ratio of earlier epochs as inferred from meteorites. The dominant escape mechanism used in the estimates is Jeans escape. However, the Jeans escape flux is enhanced considerably when atmospheric winds and rotation are applied at the exobase . This constraint is of particular importance because the enhancement of the D escape flux can be an order of magnitude greater than the enhancement of the H escape flux. This preferential enhancement of the D escape flux over that of H means that a great deal more H must escape (than in the case without winds and rotation) to attain the same D/H ratio in the today's atmosphere. Another new constraint on reservoir magnitudes comes from the recent interpretation of Martian meteorite data, which suggests that the D/H ratio was 2 times that of terrestrial water at the end of the heavy bombardment period (1). These two constraints together lead to larger current and ancient crustal water reservoirs. Applying Rayleigh fractionation, new estimates of the sizes of the water reservoirs are made using the above constraints along with plausible values for hydrogen and deuterium densities, temperatures, wind speeds and rotation rates at the exobase.

  9. Overproduction of ligninolytic enzymes

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  10. Measurement of enzyme activity.

    Science.gov (United States)

    Harris, T K; Keshwani, M M

    2009-01-01

    To study and understand the nature of living cells, scientists have continually employed traditional biochemical techniques aimed to fractionate and characterize a designated network of macromolecular components required to carry out a particular cellular function. At the most rudimentary level, cellular functions ultimately entail rapid chemical transformations that otherwise would not occur in the physiological environment of the cell. The term enzyme is used to singularly designate a macromolecular gene product that specifically and greatly enhances the rate of a chemical transformation. Purification and characterization of individual and collective groups of enzymes has been and will remain essential toward advancement of the molecular biological sciences; and developing and utilizing enzyme reaction assays is central to this mission. First, basic kinetic principles are described for understanding chemical reaction rates and the catalytic effects of enzymes on such rates. Then, a number of methods are described for measuring enzyme-catalyzed reaction rates, which mainly differ with regard to techniques used to detect and quantify concentration changes of given reactants or products. Finally, short commentary is given toward formulation of reaction mixtures used to measure enzyme activity. Whereas a comprehensive treatment of enzymatic reaction assays is not within the scope of this chapter, the very core principles that are presented should enable new researchers to better understand the logic and utility of any given enzymatic assay that becomes of interest.

  11. Escaping 1 MeV tritons in TFTR

    International Nuclear Information System (INIS)

    Zweben, S.J.; Strachan, J.D.; Boivin, R.; Cavallo, A.; Fredrickson, E.D.; McGuire, K.; Mynick, H.E.; White, R.B.

    1989-01-01

    1 MeV tritons created by D-D reactions can simulate the 'single-particle' behavior expected with 3.5 MeV D-T alphas, since the gyroradii and slowing-down of these two particles are similar. This paper describes measurements of the flux of escaping 1 MeV tritons from the TFTR plasma during high power D 0 →D neutral beam injection, and shows that in most cases the observed triton loss is consistent with the classical (single-particle) first-orbit loss model. In this model tritons are lost if their first orbit intersects the wall due to their large banana width, while almost all tritons confined on their first orbit should stay confined until thermalized. The triton detectors are ZnS(Ag) scintillator screens housed in light-tight boxes located just outside the plasma boundary at the bottom of the TFTR vessel. They are particle 'pinhole' cameras which can resolve the triton flux vs. pitch angle (to ±5 o ), energy (to ±50 %), and time (to <20 μsec). The 2-D images of triton flux onto these scintillators are optically coupled to either an intensified TV camera or to photomultiplyer tubes for fast time resolution. The soft x-ray background in an earlier prototype has been eliminated. Although there are presently 8 such detectors in TFTR, this paper discusses results from only the detector located just below the vessel center (R=259 cm, r=102 cm). Note that the '1 MeV triton' signal discussed below also has about a 30 % contribution from 3 MeV protons; however, since these two particles have identical gyroradii they should behave alike. 5 refs., 5 figs

  12. A new model for estimation of the consequences of chemical hazards - ESCAPE for Windows; Uusi malli kemikaalionnettomuuksien seurausten arvioimiseen - ESCAPE for Windows

    Energy Technology Data Exchange (ETDEWEB)

    Nikmo, J.; Kukkonen, J.; Riikonen, K. [The Finnish Meteorological Institute, Helsinki (Finland)

    1999-07-01

    By the new computerized model 'ESCAPE for Windows' it is possible to estimate the emissions hazardous substance, the spreading and the impacts of them during chemical accidents. The software can best be used e.g. for rescue service if authorities and the industry, in inspections of industrial plants and post-accident impact analyses. The software has 100 users outside the Meteorological Institute. The model consists of a collection of flow and spreading models. The input data needed consist of the weather and emissions data. The more detailed information on the ESCAPE- model can be found in the English WWW-home page of the model in address http://www.fmi.fi/ENG/ILA/escape.html.

  13. Growth arrest and induction of apoptotic and non-apoptotic programmed cell death by, Physalis minima L. chloroform extract in human ovarian carcinoma Caov-3 cells.

    Science.gov (United States)

    Ooi, Kheng Leong; Muhammad, Tengku Sifzizul Tengku; Sulaiman, Shaida Fariza

    2010-03-02

    The decoction of the whole plant of Physalis minima L. is traditionally consumed to treat cancer. Its anticancer property has been previously verified (using in vitro cytotoxicity assays) against NCI-H23 lung, CORL23 lung and MCF7 breast cancer cell lines but the mechanism underlying the anticancer potency towards ovarian carcinoma cells remain unclear. The present study is aimed to systematically determine the cytotoxicity and possible cell death mechanism elicited by the chloroform extract of Physalis minima in human ovarian Caov-3 carcinoma. Cytotoxicity of the extract was measured using the methylene blue assay. The mechanism of cell death was determined using four independent methods, namely DeadEnd assay to label the DNA fragmentation nuclei cells, RT-PCR analysis to determine the mRNA expression level of three apoptotic genes (c-myc, p53 and caspase-3 genes), Transmission Electron Microscope (TEM) analysis to describe the ultra structural characteristics and annexin V and propidium iodide staining to confirm the types and stages of cell deaths. Cytotoxicity screening of the extract on Caov-3 cells exhibited concentration- and time-dependent inhibitory effects. A combination of apoptotic and autophagic programmed cell death was detected. The apoptotic characteristic was initially determined by DNA fragmentation followed by the expression of c-myc and p53 genes that was much earlier than caspase-3. Apoptotic ultra structural changes (including clumping and magination of chromatin, blebbing and convolution of nucleus membrane and formation of apoptotic bodies) and autophagy (Type II non-apoptotic programmed cell death) with distinct vacuolated morphology were detected in TEM analysis. The existence of these programmed cell deaths was then corroborated using annexin V and propidium iodide staining. The chloroform extract of Physalis minima exerted anticancer effect due to a combination of apoptotic and autophagic cell death mechanisms on Caov-3 cells. The

  14. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  15. Proteomic analyses for profiling regulated proteins/enzymes by Fucus vesiculosus fucoidan in B16 melanoma cells: A combination of enzyme kinetics functional study.

    Science.gov (United States)

    Wang, Zhi-Jiang; Zheng, Li; Yang, Jun-Mo; Kang, Yani; Park, Yong-Doo

    2018-06-01

    Fucoidans are complex sulfated polysaccharides that have a wide range of biological activities. Previously, we reported the various effects of Fucus vesiculosus fucoidan on tyrosinase and B16 melanoma cells. In this study, to identify fucoidan-targeted proteins in B16 melanoma cells, we performed a proteomics study and integrated enzyme kinetics. We detected 19 candidate proteins dysregulated by fucoidan treatment. Among the probed proteins, the enzyme kinetics of two candidate enzymes, namely lactate dehydrogenase (LDH) as an upregulated protein and superoxide dismutase (SOD) as a downregulated enzyme, were determined. The enzyme kinetics results showed that Fucus vesiculosus fucoidan significantly inhibited LDH catalytic function while it did not affect SOD activity even at a high dose, while only slightly decreased activity (up to 10%) at a low dose. Based on our previous and present observations, fucoidan could inhibit B16 melanoma cells growth via regulating proteins/enzymes expression levels such as LDH and SOD known as cell survival biomarkers. Interestingly, both expression level and enzyme catalytic activity of LDH were regulated by fucoidan, which could directly induce the apoptotic effect on B16 melanoma cells along with SOD downregulation. This study highlights how combining proteomics with enzyme kinetics can yield valuable insights into fucoidan targets. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Escape and Capture from Deep Gravity Wells (Earth, Moon, Planets) Using Low Thrust Propulsion Systems

    Data.gov (United States)

    National Aeronautics and Space Administration — NASA missions are increasingly looking to use low thrust propulsion to capture into planetary orbits and/or lunar orbits, and to escape from low earth orbit. This...

  17. Escape windows to improve the size selectivity in the Baltic cod trawl fishery

    DEFF Research Database (Denmark)

    Madsen, Niels; Holst, René; Foldager, L.

    2002-01-01

    . The history of the use of escape windows in the Baltic Sea cod fishery is reviewed. The present escape windows do not function optimally. The objective of this new experiment was to compare an improved design of escape window, which is placed in the upper panel, with that of standard codend. Three standard......A rapid decrease of the stock of Baltic cod (Gadus morhua) has provided the incentive to improve the size selectivity in the trawl fishery. Use of escape windows is permitted in the legislation to give means of improving the size selectivity of cod as an alternative to a traditional standard codend...... tool to improve the size selectivity in the Baltic cod fishery is discussed. (C) 2002 Elsevier Science B.V. All rights reserved....

  18. Unsteady motion: escape jumps in planktonic copepods, their kinematics and energetics

    DEFF Research Database (Denmark)

    Kiørboe, Thomas; Andersen, Anders Peter; Langlois, Vincent J.

    2010-01-01

    estimate the force and power output needed to accelerate and overcome drag. Both are very high compared with those of other organisms, as are the escape velocities in comparison to startle velocities of other aquatic animals. Thus, the maximum weight-specific force, which for muscle motors of other animals...... has been found to be near constant at 57 N (kg muscle)−1, is more than an order of magnitude higher for the escaping copepods. We argue that this is feasible because most copepods have different systems for steady propulsion (feeding appendages) and intensive escapes (swimming legs), with the muscular...... arrangement of the latter probably adapted for high force production during short-lasting bursts. The resulting escape velocities scale with body length to power 0.65, different from the size-scaling of both similar sized and larger animals moving at constant velocity, but similar to that found for startle...

  19. 78 FR 54585 - Safety Zone; Escape to Miami Triathlon, Biscayne Bay, Miami, FL

    Science.gov (United States)

    2013-09-05

    ... Road Sports and Entertainment Group are sponsoring the Publix Escape to Miami Triathlon. The event will... direct effect on the States, on the relationship between the national government and the States, or on... Coordination with Indian Tribal Governments, [[Page 54587

  20. Inward contaminant leakage tests of the S-Tron Corporation emergency escape breathing device.

    Science.gov (United States)

    1992-04-01

    At the request of S-Tron Corporation, to support their contract with the U.S. Navy, performance tests of the Emergency Escape Breathing Device (EEBD) were conducted in the Environmental Physiology Research Section contaminant leakage chamber. Sulfur ...

  1. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-01-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C → U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics. PMID:26465508

  2. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-09-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

  3. Enzyme recycling in lignocellulosic biorefineries

    DEFF Research Database (Denmark)

    Jørgensen, Henning; Pinelo, Manuel

    2017-01-01

    platform. Cellulases are the most important enzymes required in this process, but the complex nature of lignocellulose requires several other enzymes (hemicellulases and auxiliary enzymes) for efficient hydrolysis. Enzyme recycling increases the catalytic productivity of the enzymes by reusing them...... upscaled and tested in industrial settings, mainly because of many difficulties with recycling of enzymes from the complex lignocellulose hydrolyzate at industrially relevant conditions, i.e., high solids loadings. The challenges are associated with the large number of different enzymes required...... for efficient hydrolysis, enzyme stability, and the detrimental interaction between enzyme and lignin. This review provides a comprehensive overview of the various methods for enzyme recovery and recycling, for example recycling of free enzymes, readsorption to fresh material, recycling of solids, membrane...

  4. Inhibition of chaotic escape from a potential well using small parametric modulations

    International Nuclear Information System (INIS)

    Chacon, R.; Balibrea, F.; Lopez, M.A.

    1996-01-01

    It is shown theoretically for the first time that, depending on its period, amplitude, and initial phase, a periodic parametric modulation can suppress a chaotic escape from a potential well. The instance of the Helmholtz oscillator is used to demonstrate, by means of Melnikov close-quote s method, that parametric modulations of the linear or quadratic potential terms inhibit chaotic escape when certain resonance conditions are met. copyright 1996 American Institute of Physics

  5. Outlet strut fracture and leaflet escape of Bjork-Shiley convexo-concave valve.

    Science.gov (United States)

    Uchino, Gaku; Yoshida, Hideo; Sakoda, Naoya; Hattori, Shigeru; Kawabata, Takuya; Saiki, Munehiro; Fujita, Yasufumi; Yunoki, Keiji; Hisamochi, Kunikazu; Mine, Yoshinari

    2017-06-01

    Prosthetic valve fracture is a serious complication and may arise in patient post-valve replacement. We experienced an outlet strut fracture and leaflet escape of a Bjork-Shiley convexo-concave valve. We performed an emergency redo mitral valve replacement and successfully retrieved the fractured strut and escaped leaflet from superficial femoral artery and the abdominal aorta. The patient showed an uneventful postoperative recovery.

  6. The relationship between migration and development in the ESCAP region.

    Science.gov (United States)

    Skeldon, R

    1991-01-01

    The relationship between migration and development in the ESCAP region including southeast and south Asian countries and the Pacific island of Fiji, Papua New Guinea, Vanuatu, Kiribati, Samoa, and the Solomon Islands is discussed in terms of mobility transition and origin and destination factors. The changing patterns of mobility in Asia are further delineated in the discussion of internal movements and international movement. Emigration in the smaller countries of the Pacific are treated separately. Future predictions are that the Asia Pacific region will experience continued fertility decline and stabilization of low rates over the next 20 years. The declines will result in slow labor force growth, and increased demand for labor in traditional core and neocore countries as defined and presented in table form by Friedman will be heightened. International movements are likely to increase in large urban areas within destination countries. Tokyo and Singapore are the principal cities in Asia. Tokyo by restrictive government policy has limited immigration, but future labor shortages of unskilled labor from southeast Asia and China are expected. Singapore is already dependent on foreign labor by 10%. Current labor shortages have led to the creation of a growth triangle between Singapore, Indonesia, and Malaysia. Other cities expected to emerge as primary cities in international regional complexes with spillover into the hinterlands include the Hong Kong, Guangzhou, and Macau triangle in the Pearl River delta, Taipei and Seoul, and possibly Kuala Lumpur. Internal migration is expected to increase in the capital cities of Bangkok, Manila,j and centers such as Shanghai, Beijing, and other large cities of southeast Asia. These cities will be linked through the flows of skilled international migrants, which began in the 1960s and is expected to become a future major flow. Recreational and resource niches will be left in much of the Pacific, the Himalayan Kingdoms, and

  7. Enhancing usability of augmented-reality-based mobile escape guidelines for radioactive accidents

    International Nuclear Information System (INIS)

    Tsai, Ming-Kuan; Yau, Nie-Jia

    2013-01-01

    When radioactive accidents occur, modern tools in information technology for emergency response are good solutions to reduce the impact. Since few information-technology-based applications were developed for people during radioactive accidents, a previous study (Tsai et al., 2012) proposed augmented-reality-based mobile escape guidelines. However, because of the lack of transparent escape routes and indoor escape guidelines, the usability of the guidelines is limited. Therefore, this study introduces route planning and mobile three-dimensional (3D) graphics techniques to address the identified problems. The proposed approach could correctly present the geographical relationship from user locations to the anticipated shelters, and quickly show the floor-plan drawings as users are in the buildings. Based on the testing results, in contrast to the previous study, this study offered better escape routes, when the participants performed self-evacuation in outdoor and indoor environments. Overall, this study is not only a useful reference for similar studies, but also a beneficial tool for emergency response during radioactive accidents. -- Highlights: ► Enhancing the efficiency when people escape from radioactive accidents. ► The spatial relationship is transparently displayed in real time. ► In contrast to a previous study, this study offers better escape guidelines

  8. Scaling invariance for the escape of particles from a periodically corrugated waveguide

    Energy Technology Data Exchange (ETDEWEB)

    Leonel, Edson D., E-mail: edleonel@rc.unesp.br [Departamento de Estatística, Matemática Aplicada e Computação, UNESP – Univ Estadual Paulista, Av. 24A, 1515, CEP 13506-900, Rio Claro, SP (Brazil); Costa, Diogo R. da [Departamento de Estatística, Matemática Aplicada e Computação, UNESP – Univ Estadual Paulista, Av. 24A, 1515, CEP 13506-900, Rio Claro, SP (Brazil); Instituto de Física, Univ São Paulo, Rua do Matão, Cidade Universitária, CEP 05314-970, São Paulo, SP (Brazil); Dettmann, Carl P. [School of Mathematics, University of Bristol, Bristol BS8 1TW (United Kingdom)

    2012-01-09

    The escape dynamics of a classical light ray inside a corrugated waveguide is characterised by the use of scaling arguments. The model is described via a two-dimensional nonlinear and area preserving mapping. The phase space of the mapping contains a set of periodic islands surrounded by a large chaotic sea that is confined by a set of invariant tori. When a hole is introduced in the chaotic sea, letting the ray escape, the histogram of frequency of the number of escaping particles exhibits rapid growth, reaching a maximum value at n{sub p} and later decaying asymptotically to zero. The behaviour of the histogram of escape frequency is characterised using scaling arguments. The scaling formalism is widely applicable to critical phenomena and useful in characterisation of phase transitions, including transitions from limited to unlimited energy growth in two-dimensional time varying billiard problems. -- Highlights: ► Escape of light ray inside a corrugated waveguide ► Two-dimensional nonlinear and area preserving mapping ► Scaling for escaping particles.

  9. Effects of Serotonergic and Opioidergic Drugs on Escape Behaviors and Social Status of Male Crickets

    Science.gov (United States)

    Dyakonova, V. E.; Schürmann, F.-W.; Sakharov, D. A.

    We examined the effects of selective serotonin depletion and opioid ligands on social rank and related escape behavior of the cricket Gryllus bimaculatus. Establishment of social rank in a pair of males affected their escape reactions. Losers showed a lower and dominants a higher percentage of jumps in response to tactile cercal stimulation than before a fight. The serotonin-depleting drug α-methyltryptophan (AMTP) caused an activation of the escape reactivity in socially naive crickets. AMTP-treated animals also showed a lower ability to become dominants. With an initial 51.6+/-3.6% of wins in the AMTP group, the percentage decreased to 26+/-1.6% on day 5 after injection. The opiate receptor antagonist naloxone affected fight and escape similarly as AMTP. In contrast to naloxone, the opioid agonist [d-Ala2, N-Me-Phe4, Gly5-ol]-enkephalin decreased escape responsiveness to cercal stimulation in naive and subordinate crickets. We suggest that serotonergic and opioid systems are involved in the dominance induced depression of escape behavior.

  10. An approximate analytic model of a star cluster with potential escapers

    Science.gov (United States)

    Daniel, Kathryne J.; Heggie, Douglas C.; Varri, Anna Lisa

    2017-06-01

    In the context of a star cluster moving on a circular galactic orbit, a 'potential escaper' is a cluster star that has orbital energy greater than the escape energy, and yet is confined within the Jacobi radius of the stellar system. On the other hand, analytic models of stellar clusters typically have a truncation energy equal to the cluster escape energy, and therefore explicitly exclude these energetically unbound stars. Starting from the landmark analysis performed by Hénon of periodic orbits of the circular Hill equations, we present a numerical exploration of the population of 'non-escapers', defined here as those stars that remain within two Jacobi radii for several galactic periods, with energy above the escape energy. We show that they can be characterized by the Jacobi integral and two further approximate integrals, which are based on perturbation theory and ideas drawn from Lidov-Kozai theory. Finally, we use these results to construct an approximate analytic model that includes a phase-space description of a population resembling that of potential escapers, in addition to the usual bound population.

  11. Scaling invariance for the escape of particles from a periodically corrugated waveguide

    International Nuclear Information System (INIS)

    Leonel, Edson D.; Costa, Diogo R. da; Dettmann, Carl P.

    2012-01-01

    The escape dynamics of a classical light ray inside a corrugated waveguide is characterised by the use of scaling arguments. The model is described via a two-dimensional nonlinear and area preserving mapping. The phase space of the mapping contains a set of periodic islands surrounded by a large chaotic sea that is confined by a set of invariant tori. When a hole is introduced in the chaotic sea, letting the ray escape, the histogram of frequency of the number of escaping particles exhibits rapid growth, reaching a maximum value at n p and later decaying asymptotically to zero. The behaviour of the histogram of escape frequency is characterised using scaling arguments. The scaling formalism is widely applicable to critical phenomena and useful in characterisation of phase transitions, including transitions from limited to unlimited energy growth in two-dimensional time varying billiard problems. -- Highlights: ► Escape of light ray inside a corrugated waveguide ► Two-dimensional nonlinear and area preserving mapping ► Scaling for escaping particles.

  12. Lobelia siphilitica plants that escape herbivory in time also have reduced latex production.

    Directory of Open Access Journals (Sweden)

    Amy L Parachnowitsch

    Full Text Available Flowering phenology is an important determinant of a plant's reproductive success. Both assortative mating and niche construction can result in the evolution of correlations between phenology and other reproductive, functional, and life history traits. Correlations between phenology and herbivore defence traits are particularly likely because the timing of flowering can allow a plant to escape herbivory. To test whether herbivore escape and defence are correlated, we estimated phenotypic and genetic correlations between flowering phenology and latex production in greenhouse-grown Lobelia siphilitica L. (Lobeliaceae. Lobelia siphilitica plants that flower later escape herbivory by a specialist pre-dispersal seed predator, and thus should invest fewer resources in defence. Consistent with this prediction, we found that later flowering was phenotypically and genetically correlated with reduced latex production. To test whether herbivore escape and latex production were costly, we also measured four fitness correlates. Flowering phenology was negatively genetically correlated with three out of four fitness estimates, suggesting that herbivore escape can be costly. In contrast, we did not find evidence for costs of latex production. Generally, our results suggest that herbivore escape and defence traits will not evolve independently in L. siphilitica.

  13. Lobelia siphilitica Plants That Escape Herbivory in Time Also Have Reduced Latex Production

    Science.gov (United States)

    Parachnowitsch, Amy L.; Caruso, Christina M.; Campbell, Stuart A.; Kessler, André

    2012-01-01

    Flowering phenology is an important determinant of a plant’s reproductive success. Both assortative mating and niche construction can result in the evolution of correlations between phenology and other reproductive, functional, and life history traits. Correlations between phenology and herbivore defence traits are particularly likely because the timing of flowering can allow a plant to escape herbivory. To test whether herbivore escape and defence are correlated, we estimated phenotypic and genetic correlations between flowering phenology and latex production in greenhouse-grown Lobelia siphilitica L. (Lobeliaceae). Lobelia siphilitica plants that flower later escape herbivory by a specialist pre-dispersal seed predator, and thus should invest fewer resources in defence. Consistent with this prediction, we found that later flowering was phenotypically and genetically correlated with reduced latex production. To test whether herbivore escape and latex production were costly, we also measured four fitness correlates. Flowering phenology was negatively genetically correlated with three out of four fitness estimates, suggesting that herbivore escape can be costly. In contrast, we did not find evidence for costs of latex production. Generally, our results suggest that herbivore escape and defence traits will not evolve independently in L. siphilitica. PMID:22662205

  14. Heat-induced symmetry breaking in ant (Hymenoptera: Formicidae) escape behavior.

    Science.gov (United States)

    Chung, Yuan-Kai; Lin, Chung-Chi

    2017-01-01

    The collective egress of social insects is important in dangerous situations such as natural disasters or enemy attacks. Some studies have described the phenomenon of symmetry breaking in ants, with two exits induced by a repellent. However, whether symmetry breaking occurs under high temperature conditions, which are a common abiotic stress, remains unknown. In our study, we deposited a group of Polyrhachis dives ants on a heated platform and counted the number of escaping ants with two identical exits. We discovered that ants asymmetrically escaped through two exits when the temperature of the heated platform was >32.75°C. The degree of asymmetry increased linearly with the temperature of the platform. Furthermore, the higher the temperature of heated platform was, the more ants escaped from the heated platform. However, the number of escaping ants decreased for 3 min when the temperature was higher than the critical thermal limit (39.46°C), which is the threshold for ants to endure high temperature without a loss of performance. Moreover, the ants tended to form small groups to escape from the thermal stress. A preparatory formation of ant grouping was observed before they reached the exit, indicating that the ants actively clustered rather than accidentally gathered at the exits to escape. We suggest that a combination of individual and grouping ants may help to optimize the likelihood of survival during evacuation.

  15. Heat-induced symmetry breaking in ant (Hymenoptera: Formicidae escape behavior.

    Directory of Open Access Journals (Sweden)

    Yuan-Kai Chung

    Full Text Available The collective egress of social insects is important in dangerous situations such as natural disasters or enemy attacks. Some studies have described the phenomenon of symmetry breaking in ants, with two exits induced by a repellent. However, whether symmetry breaking occurs under high temperature conditions, which are a common abiotic stress, remains unknown. In our study, we deposited a group of Polyrhachis dives ants on a heated platform and counted the number of escaping ants with two identical exits. We discovered that ants asymmetrically escaped through two exits when the temperature of the heated platform was >32.75°C. The degree of asymmetry increased linearly with the temperature of the platform. Furthermore, the higher the temperature of heated platform was, the more ants escaped from the heated platform. However, the number of escaping ants decreased for 3 min when the temperature was higher than the critical thermal limit (39.46°C, which is the threshold for ants to endure high temperature without a loss of performance. Moreover, the ants tended to form small groups to escape from the thermal stress. A preparatory formation of ant grouping was observed before they reached the exit, indicating that the ants actively clustered rather than accidentally gathered at the exits to escape. We suggest that a combination of individual and grouping ants may help to optimize the likelihood of survival during evacuation.

  16. Light-controlled endosomal escape of the novel CD133-targeting immunotoxin AC133-saporin by photochemical internalization - A minimally invasive cancer stem cell-targeting strategy.

    Science.gov (United States)

    Bostad, Monica; Olsen, Cathrine Elisabeth; Peng, Qian; Berg, Kristian; Høgset, Anders; Selbo, Pål Kristian

    2015-05-28

    The cancer stem cell (CSC) marker CD133 is an attractive target to improve antitumor therapy. We have used photochemical internalization (PCI) for the endosomal escape of the novel CD133-targeting immunotoxin AC133-saporin (PCIAC133-saporin). PCI employs an endocytic vesicle-localizing photosensitizer, which generates reactive oxygen species upon light-activation causing a rupture of the vesicle membranes and endosomal escape of entrapped drugs. Here we show that AC133-saporin co-localizes with the PCI-photosensitizer TPCS2a, which upon light exposure induces cytosolic release of AC133-saporin. PCI of picomolar levels of AC133-saporin in colorectal adenocarcinoma WiDr cells blocked cell proliferation and induced 100% inhibition of cell viability and colony forming ability at the highest light doses, whereas no cytotoxicity was obtained in the absence of light. Efficient PCI-based CD133-targeting was in addition demonstrated in the stem-cell-like, triple negative breast cancer cell line MDA-MB-231 and in the aggressive malignant melanoma cell line FEMX-1, whereas no enhanced targeting was obtained in the CD133-negative breast cancer cell line MCF-7. PCIAC133-saporin induced mainly necrosis and a minimal apoptotic response based on assessing cleavage of caspase-3 and PARP, and the TUNEL assay. PCIAC133-saporin resulted in S phase arrest and reduced LC3-II conversion compared to control treatments. Notably, co-treatment with Bafilomycin A1 and PCIAC133-saporin blocked LC3-II conversion, indicating a termination of the autophagic flux in WiDr cells. For the first time, we demonstrate laser-controlled targeting of CD133 in vivo. After only one systemic injection of AC133-saporin and TPCS2a, a strong anti-tumor response was observed after PCIAC133-saporin. The present PCI-based endosomal escape technology represents a minimally invasive strategy for spatio-temporal, light-controlled targeting of CD133+ cells in localized primary tumors or metastasis. Copyright © 2015

  17. Targeting the Anti-Apoptotic Protein c-FLIP for Cancer Therapy

    International Nuclear Information System (INIS)

    Safa, Ahmad R.; Pollok, Karen E.

    2011-01-01

    Cellular FLICE (FADD-like IL-1beta-converting enzyme)-inhibitory protein (c-FLIP) is a major resistance factor and critical anti-apoptotic regulator that inhibits tumor necrosis factor-alpha (TNF-alpha), Fas-L, and TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis as well as chemotherapy-triggered apoptosis in malignant cells. c-FLIP is expressed as long (c-FLIP L ), short (c-FLIP S ), and c-FLIP R splice variants in human cells. c-FLIP binds to FADD and/or caspase-8 or -10 in a ligand-dependent and-independent fashion, which in turn prevents death-inducing signaling complex (DISC) formation and subsequent activation of the caspase cascade. Moreover, c-FLIP L and c-FLIP S are known to have multifunctional roles in various signaling pathways, as well as activating and/or upregulating several cytoprotective signaling molecules. Upregulation of c-FLIP has been found in various tumor types, and its downregulation has been shown to restore apoptosis triggered by cytokines and various chemotherapeutic agents. Hence, c-FLIP is an important target for cancer therapy. For example, small interfering RNAs (siRNAs) that specifically knockdown the expression of c-FLIP L in diverse human cancer cell lines augmented TRAIL-induced DISC recruitment and increased the efficacy of chemotherapeutic agents, thereby enhancing effector caspase stimulation and apoptosis. Moreover, small molecules causing degradation of c-FLIP as well as decreasing mRNA and protein levels of c-FLIP L and c-FLIP S splice variants have been found, and efforts are underway to develop other c-FLIP-targeted cancer therapies. This review focuses on (1) the functional role of c-FLIP splice variants in preventing apoptosis and inducing cytokine and drug resistance; (2) the molecular mechanisms that regulate c-FLIP expression; and (3) strategies to inhibit c-FLIP expression and function

  18. Targeting the Anti-Apoptotic Protein c-FLIP for Cancer Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Safa, Ahmad R., E-mail: asafa@iupui.edu [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Indiana University Simon Cancer Center, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Pollok, Karen E. [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Indiana University Simon Cancer Center, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Herman B. Wells Center for Pediatric Research, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States)

    2011-03-29

    Cellular FLICE (FADD-like IL-1beta-converting enzyme)-inhibitory protein (c-FLIP) is a major resistance factor and critical anti-apoptotic regulator that inhibits tumor necrosis factor-alpha (TNF-alpha), Fas-L, and TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis as well as chemotherapy-triggered apoptosis in malignant cells. c-FLIP is expressed as long (c-FLIP{sub L}), short (c-FLIP{sub S}), and c-FLIP{sub R} splice variants in human cells. c-FLIP binds to FADD and/or caspase-8 or -10 in a ligand-dependent and-independent fashion, which in turn prevents death-inducing signaling complex (DISC) formation and subsequent activation of the caspase cascade. Moreover, c-FLIP{sub L} and c-FLIP{sub S} are known to have multifunctional roles in various signaling pathways, as well as activating and/or upregulating several cytoprotective signaling molecules. Upregulation of c-FLIP has been found in various tumor types, and its downregulation has been shown to restore apoptosis triggered by cytokines and various chemotherapeutic agents. Hence, c-FLIP is an important target for cancer therapy. For example, small interfering RNAs (siRNAs) that specifically knockdown the expression of c-FLIP{sub L} in diverse human cancer cell lines augmented TRAIL-induced DISC recruitment and increased the efficacy of chemotherapeutic agents, thereby enhancing effector caspase stimulation and apoptosis. Moreover, small molecules causing degradation of c-FLIP as well as decreasing mRNA and protein levels of c-FLIP{sub L} and c-FLIP{sub S} splice variants have been found, and efforts are underway to develop other c-FLIP-targeted cancer therapies. This review focuses on (1) the functional role of c-FLIP splice variants in preventing apoptosis and inducing cytokine and drug resistance; (2) the molecular mechanisms that regulate c-FLIP expression; and (3) strategies to inhibit c-FLIP expression and function.

  19. Evaluation of dendritic cells loaded with apoptotic cancer cells or expressing tumour mRNA as potential cancer vaccines against leukemia

    International Nuclear Information System (INIS)

    Jarnjak-Jankovic, Silvija; Pettersen, Rolf D; Sæbøe-Larssen, Stein; Wesenberg, Finn; Gaudernack, Gustav

    2005-01-01

    Leukemia is a clonal disorder characterized by uncontrolled proliferation of haematopoietic cells, and represents the most common form of cancer in children. Advances in therapy for childhood leukemia have relied increasingly on the use of high-dose chemotherapy often combined with stem-cell transplantation. Despite a high success rate and intensification of therapy, children still suffer from relapse and progressive disease resistant to further therapy. Thus, novel forms of therapy are required. This study focuses on dendritic cell (DC) vaccination of childhood leukemia and evaluates the in vitro efficacy of different strategies for antigen loading of professional antigen-presenting cells. We have compared DCs either loaded with apoptotic leukemia cells or transfected with mRNA from the same leukemia cell line, Jurkat E6, for their capacity to induce specific CD4+ and CD8+ T-cell responses. Monocyte-derived DCs from healthy donors were loaded with tumor antigen, matured and co-cultured with autologous T cells. After one week, T-cell responses against antigen-loaded DCs were measured by enzyme-linked immunosorbent spot (ELISPOT) assay. DCs loaded with apoptotic Jurkat E6 cells or transfected with Jurkat E6-cell mRNA were both able to elicit specific T-cell responses in vitro. IFNγ-secreting T cells were observed in both the CD4+ and CD8+ subsets. The results indicate that loading of DCs with apoptotic leukemia cells or transfection with tumour mRNA represent promising strategies for development of cancer vaccines for treatment of childhood leukemia

  20. Angiotensin-converting enzyme

    DEFF Research Database (Denmark)

    Sørensen, P G; Rømer, F K; Cortes, D

    1984-01-01

    In order to evaluate bleomycin-associated lung damage in humans, lung function parameters and serum levels of the endothelial-bound angiotensin-converting enzyme (ACE) were determined by serial measurements in 11 patients who were treated for testicular cancer. None developed clinical or radiolog......In order to evaluate bleomycin-associated lung damage in humans, lung function parameters and serum levels of the endothelial-bound angiotensin-converting enzyme (ACE) were determined by serial measurements in 11 patients who were treated for testicular cancer. None developed clinical...

  1. Apico-basal forces exerted by apoptotic cells drive epithelium folding.

    Science.gov (United States)

    Monier, Bruno; Gettings, Melanie; Gay, Guillaume; Mangeat, Thomas; Schott, Sonia; Guarner, Ana; Suzanne, Magali

    2015-02-12

    Epithelium folding is a basic morphogenetic event that is essential in transforming simple two-dimensional epithelial sheets into three-dimensional structures in both vertebrates and invertebrates. Folding has been shown to rely on apical constriction. The resulting cell-shape changes depend either on adherens junction basal shift or on a redistribution of myosin II, which could be driven by mechanical signals. Yet the initial cellular mechanisms that trigger and coordinate cell remodelling remain largely unknown. Here we unravel the active role of apoptotic cells in initiating morphogenesis, thus revealing a novel mechanism of epithelium folding. We show that, in a live developing tissue, apoptotic cells exert a transient pulling force upon the apical surface of the epithelium through a highly dynamic apico-basal myosin II cable. The apoptotic cells then induce a non-autonomous increase in tissue tension together with cortical myosin II apical stabilization in the surrounding tissue, eventually resulting in epithelium folding. Together our results, supported by a theoretical biophysical three-dimensional model, identify an apoptotic myosin-II-dependent signal as the initial signal leading to cell reorganization and tissue folding. This work further reveals that, far from being passively eliminated as generally assumed (for example, during digit individualization), apoptotic cells actively influence their surroundings and trigger tissue remodelling through regulation of tissue tension.

  2. Modafinil Abrogates Methamphetamine-Induced Neuroinflammation and Apoptotic Effects in the Mouse Striatum

    Science.gov (United States)

    Goitia, Belen; Garcia-Rill, Edgar; Krasnova, Irina N.; Cadet, Jean Lud; Urbano, Francisco J.; Bisagno, Veronica

    2012-01-01

    Methamphetamine is a drug of abuse that can cause neurotoxic damage in humans and animals. Modafinil, a wake-promoting compound approved for the treatment of sleeping disorders, is being prescribed off label for the treatment of methamphetamine dependence. The aim of the present study was to investigate if modafinil could counteract methamphetamine-induced neuroinflammatory processes, which occur in conjunction with degeneration of dopaminergic terminals in the mouse striatum. We evaluated the effect of a toxic methamphetamine binge in female C57BL/6 mice (4×5 mg/kg, i.p., 2 h apart) and modafinil co-administration (2×90 mg/kg, i.p., 1 h before the first and fourth methamphetamine injections) on glial cells (microglia and astroglia). We also evaluated the striatal expression of the pro-apoptotic BAX and anti-apoptotic Bcl-2 proteins, which are known to mediate methamphetamine-induced apoptotic effects. Modafinil by itself did not cause reactive gliosis and counteracted methamphetamine-induced microglial and astroglial activation. Modafinil also counteracted the decrease in tyrosine hydroxylase and dopamine transporter levels and prevented methamphetamine-induced increases in the pro-apoptotic BAX and decreases in the anti-apoptotic Bcl-2 protein expression. Our results indicate that modafinil can interfere with methamphetamine actions and provide protection against dopamine toxicity, cell death, and neuroinflammation in the mouse striatum. PMID:23056363

  3. Apoptotic effect as biomarker of disease, severity and follow-up in interstitial cystitis.

    Science.gov (United States)

    Di Capua-Sacoto, C; Sanchez-Llopis, A; Oconnor, J E; Martinez-Romero, A; Ruiz-Cerdá, J L

    2017-11-10

    To determine whether the apoptotic effect test could serve as a biomarker of severity in bladder pain syndrome/interstitial cystitis. A prospective study was conducted between January 2010 and January 2015, which included 57 patients diagnosed with interstitial cystitis and 49 diagnosed with chronic pelvic pain of gynaecological origin. The urine was exposed to cell cultures, and the urine's capacity for inducing apoptosis in the cultures was analysed. A statistical analysis was then conducted to assess whether the apoptotic effect was associated with the symptoms. After performing an analysis of the association between the degree of apoptotic effect and the symptoms of patients with interstitial cystitis, we observed a significant increase in the mean percentages of apoptosis as the degree of symptom severity increased. After analysing the association between the apoptotic effect and symptoms, we obtained a positive correlation in the patients with interstitial cystitis and a lack of correlation in the patients with chronic pelvic pain of gynaecological origin. The rates of apoptosis increased progressively in the patients with interstitial cystitis as the symptoms increased, while the patients with chronic pelvic pain of gynaecological origin remained stable. The apoptotic effect of the urine of patients with interstitial cystitis could be a marker of disease, thus differentiating patients with interstitial cystitis from patients with chronic pelvic pain. The effect could also provide an objective measure of symptom severity. Copyright © 2017 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

  4. Selection of apoptotic cell specific human antibodies from adult bone marrow.

    Directory of Open Access Journals (Sweden)

    Caroline Grönwall

    Full Text Available Autoreactive antibodies that recognize neo-determinants on apoptotic cells in mice have been proposed to have protective, homeostatic and immunoregulatory properties, although our knowledge about the equivalent antibodies in humans has been much more limited. In the current study, human monoclonal antibodies with binding specificity for apoptotic cells were isolated from the bone marrow of healthy adults using phage display technology. These antibodies were shown to recognize phosphorylcholine (PC-associated neo-determinants. Interestingly, three of the four identified apoptotic cell-specific antibody clones were encoded by VH3 region rearrangements with germline or nearly germline configuration without evidence of somatic hypermutation. Importantly, the different identified antibody clones had diverse heavy chain CDR3 and deduced binding surfaces as suggested by structure modeling. This may suggest a potentially great heterogeneity in human antibodies recognizing PC-related epitopes on apoptotic cells. To re-construct the postulated structural format of the parental anti-PC antibody, the dominant clone was also expressed as a recombinant human polymeric IgM, which revealed a substantially increased binding reactivity, with dose-dependent and antigen-inhibitable binding of apoptotic cells. Our findings may have implication for improved prognostic testing and therapeutic interventions in human inflammatory disease.

  5. Modafinil abrogates methamphetamine-induced neuroinflammation and apoptotic effects in the mouse striatum.

    Directory of Open Access Journals (Sweden)

    Mariana Raineri

    Full Text Available Methamphetamine is a drug of abuse that can cause neurotoxic damage in humans and animals. Modafinil, a wake-promoting compound approved for the treatment of sleeping disorders, is being prescribed off label for the treatment of methamphetamine dependence. The aim of the present study was to investigate if modafinil could counteract methamphetamine-induced neuroinflammatory processes, which occur in conjunction with degeneration of dopaminergic terminals in the mouse striatum. We evaluated the effect of a toxic methamphetamine binge in female C57BL/6 mice (4 × 5 mg/kg, i.p., 2 h apart and modafinil co-administration (2 × 90 mg/kg, i.p., 1 h before the first and fourth methamphetamine injections on glial cells (microglia and astroglia. We also evaluated the striatal expression of the pro-apoptotic BAX and anti-apoptotic Bcl-2 proteins, which are known to mediate methamphetamine-induced apoptotic effects. Modafinil by itself did not cause reactive gliosis and counteracted methamphetamine-induced microglial and astroglial activation. Modafinil also counteracted the decrease in tyrosine hydroxylase and dopamine transporter levels and prevented methamphetamine-induced increases in the pro-apoptotic BAX and decreases in the anti-apoptotic Bcl-2 protein expression. Our results indicate that modafinil can interfere with methamphetamine actions and provide protection against dopamine toxicity, cell death, and neuroinflammation in the mouse striatum.

  6. Uptake of apoptotic cells drives the growth of a pathogenic trypanosome in macrophages

    Science.gov (United States)

    Freire-de-Lima, Célio G.; Nascimento, Danielle O.; Soares, Milena B. P.; Bozza, Patricia T.; Castro-Faria-Neto, Hugo C.; de Mello, Fernando G.; Dosreis, George A.; Lopes, Marcela F.

    2000-01-01

    After apoptosis, phagocytes prevent inflammation and tissue damage by the uptake and removal of dead cells. In addition, apoptotic cells evoke an anti-inflammatory response through macrophages. We have previously shown that there is intense lymphocyte apoptosis in an experimental model of Chagas' disease, a debilitating cardiac illness caused by the protozoan Trypanosoma cruzi. Here we show that the interaction of apoptotic, but not necrotic T lymphocytes with macrophages infected with T. cruzi fuels parasite growth in a manner dependent on prostaglandins, transforming growth factor-β (TGF-β) and polyamine biosynthesis. We show that the vitronectin receptor is critical, in both apoptotic-cell cytoadherence and the induction of prostaglandin E2/TGF-β release and ornithine decarboxylase activity in macrophages. A single injection of apoptotic cells in infected mice increases parasitaemia, whereas treatment with cyclooxygenase inhibitors almost completely ablates it in vivo. These results suggest that continual lymphocyte apoptosis and phagocytosis of apoptotic cells by macrophages have a role in parasite persistence in the host, and that cyclooxygenase inhibitors have potential therapeutic application in the control of parasite replication and spread in Chagas' disease.

  7. Apoptotic cells can induce non-autonomous apoptosis through the TNF pathway

    Science.gov (United States)

    Pérez-Garijo, Ainhoa; Fuchs, Yaron; Steller, Hermann

    2013-01-01

    Apoptotic cells can produce signals to instruct cells in their local environment, including ones that stimulate engulfment and proliferation. We identified a novel mode of communication by which apoptotic cells induce additional apoptosis in the same tissue. Strong induction of apoptosis in one compartment of the Drosophila wing disc causes apoptosis of cells in the other compartment, indicating that dying cells can release long-range death factors. We identified Eiger, the Drosophila tumor necrosis factor (TNF) homolog, as the signal responsible for apoptosis-induced apoptosis (AiA). Eiger is produced in apoptotic cells and, through activation of the c-Jun N-terminal kinase (JNK) pathway, is able to propagate the initial apoptotic stimulus. We also show that during coordinated cell death of hair follicle cells in mice, TNF-α is expressed in apoptotic cells and is required for normal cell death. AiA provides a mechanism to explain cohort behavior of dying cells that is seen both in normal development and under pathological conditions. DOI: http://dx.doi.org/10.7554/eLife.01004.001 PMID:24066226

  8. The ENZYME database in 2000.

    Science.gov (United States)

    Bairoch, A

    2000-01-01

    The ENZYME database is a repository of information related to the nomenclature of enzymes. In recent years it has became an indispensable resource for the development of metabolic databases. The current version contains information on 3705 enzymes. It is available through the ExPASy WWW server (http://www.expasy.ch/enzyme/ ).

  9. Escaping Death: Mitochondrial Redox Homeostasis in Cancer Cells

    Directory of Open Access Journals (Sweden)

    Francesco Ciccarese

    2017-06-01

    Full Text Available Reactive oxygen species (ROS are important signaling molecules that act through the oxidation of nucleic acids, proteins, and lipids. Several hallmarks of cancer, including uncontrolled proliferation, angiogenesis, and genomic instability, are promoted by the increased ROS levels commonly found in tumor cells. To counteract excessive ROS accumulation, oxidative stress, and death, cancer cells tightly regulate ROS levels by enhancing scavenging enzymes, which are dependent on the reducing cofactor nicotinamide adenine dinucleotide phosphate (NADPH. This review focuses on mitochondrial ROS homeostasis with a description of six pathways of NADPH production in mitochondria and a discussion of the possible strategies of pharmacological intervention to selectively eliminate cancer cells by increasing their ROS levels.

  10. The surface science of enzymes

    DEFF Research Database (Denmark)

    Rod, Thomas Holm; Nørskov, Jens Kehlet

    2002-01-01

    One of the largest challenges to science in the coming years is to find the relation between enzyme structure and function. Can we predict which reactions an enzyme catalyzes from knowledge of its structure-or from its amino acid sequence? Can we use that knowledge to modify enzyme function......? To solve these problems we must understand in some detail how enzymes interact with reactants from its surroundings. These interactions take place at the surface of the enzyme and the question of enzyme function can be viewed as the surface science of enzymes. In this article we discuss how to describe...... catalysis by enzymes, and in particular the analogies between enzyme catalyzed reactions and surface catalyzed reactions. We do this by discussing two concrete examples of reactions catalyzed both in nature (by enzymes) and in industrial reactors (by inorganic materials), and show that although analogies...

  11. Magnetically responsive enzyme powders

    Czech Academy of Sciences Publication Activity Database

    Pospišková, K.; Šafařík, Ivo

    2015-01-01

    Roč. 380, APR 2015 (2015), s. 197-200 ISSN 0304-8853 R&D Projects: GA MŠk(CZ) LD13021 Institutional support: RVO:67179843 Keywords : enzyme powders * cross-linking * magnetic modification * magnetic separation * magnetic iron oxides particles * microwave-assisted synthesis Subject RIV: CE - Biochemistry Impact factor: 2.357, year: 2015

  12. ISFET based enzyme sensors

    NARCIS (Netherlands)

    van der Schoot, Bart H.; Bergveld, Piet

    1987-01-01

    This paper reviews the results that have been reported on ISFET based enzyme sensors. The most important improvement that results from the application of ISFETs instead of glass membrane electrodes is in the method of fabrication. Problems with regard to the pH dependence of the response and the

  13. Implantable enzyme amperometric biosensors.

    Science.gov (United States)

    Kotanen, Christian N; Moussy, Francis Gabriel; Carrara, Sandro; Guiseppi-Elie, Anthony

    2012-05-15

    The implantable enzyme amperometric biosensor continues as the dominant in vivo format for the detection, monitoring and reporting of biochemical analytes related to a wide range of pathologies. Widely used in animal studies, there is increasing emphasis on their use in diabetes care and management, the management of trauma-associated hemorrhage and in critical care monitoring by intensivists in the ICU. These frontier opportunities demand continuous indwelling performance for up to several years, well in excess of the currently approved seven days. This review outlines the many challenges to successful deployment of chronically implantable amperometric enzyme biosensors and emphasizes the emerging technological approaches in their continued development. The foreign body response plays a prominent role in implantable biotransducer failure. Topics considering the approaches to mitigate the inflammatory response, use of biomimetic chemistries, nanostructured topographies, drug eluting constructs, and tissue-to-device interface modulus matching are reviewed. Similarly, factors that influence biotransducer performance such as enzyme stability, substrate interference, mediator selection and calibration are reviewed. For the biosensor system, the opportunities and challenges of integration, guided by footprint requirements, the limitations of mixed signal electronics, and power requirements, has produced three systems approaches. The potential is great. However, integration along the multiple length scales needed to address fundamental issues and integration across the diverse disciplines needed to achieve success of these highly integrated systems, continues to be a challenge in the development and deployment of implantable amperometric enzyme biosensor systems. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Photoperiodism and Enzyme Activity

    Science.gov (United States)

    Queiroz, Orlando; Morel, Claudine

    1974-01-01

    Metabolic readjustments after a change from long days to short days appear, in Kalanchoe blossfeldiana, to be achieved through the operation of two main mechanisms: variation in enzyme capacity, and circadian rhythmicity. After a lag time, capacity in phosphoenolpyruvate carboxylase and capacity in aspartate aminotransferase increase exponentially and appear to be allometrically linked during 50 to 60 short days; then a sudden fall takes place in the activity of the former. Malic enzyme and alanine aminotransferase behave differently. Thus, the operation of the two sections of the pathway (before and after the malate step) give rise to a continuously changing functional compartmentation in the pathway. Circadian rhythmicity, on the other hand, produces time compartmentation through phase shifts and variation in amplitude, independently for each enzyme. These characteristics suggest that the operation of a so-called biological clock would be involved. We propose the hypothesis that feedback regulation would be more accurate and efficient when applied to an already oscillating, clock-controlled enzyme system. PMID:16658749

  15. The Contribution of the Fas/FasL Apoptotic Pathway in Ulcer Formation during Leishmania major-Induced Cutaneous Leishmaniasis

    Science.gov (United States)

    Eidsmo, Liv; Nylen, Susanne; Khamesipour, Ali; Hedblad, Mari-Anne; Chiodi, Francesca; Akuffo, Hannah

    2005-01-01

    Cutaneous leishmaniasis (CL), caused by the intracellular protozoan Leishmania major, is characterized by lesion formation and ulceration at the site of infection. The mechanism of ulcer formation during CL is not fully understood. The expression of Fas and FasL and the levels of apoptosis in skin biopsies and in restimulated blood mononuclear cells from patients with 1 to 7 months of L. major-induced CL were analyzed using immunohistochemistry and fluorescence-activated cell sorting analysis. The levels of soluble Fas and FasL were also analyzed by enzyme-linked immunosorbent assay. A substantial number of apoptotic keratinocytes were observed mainly in the superficial epidermis of morphologically active and healing CL skin samples. Fas expression was increased on epidermis in active CL, whereas Fas expression was similar in healing and healthy epidermis. FasL-expressing macrophages and T cells were found in subepidermal infiltrate, mainly in active disease. When CL peripheral blood mononuclear cells were restimulated with L. major, Fas was up-regulated on effector T cells, and high levels of sFasL were secreted. Supernatants from restimulated cultures induced apoptosis in human keratinocytes (HaCaT), possibly through Fas/FasL interactions. Our results indicate that FasL-expressing effector T cells and macrophages may act to induce apoptosis and ulcer formation in Fas-expressing keratinocytes during L. major infection. PMID:15793290

  16. PDE2A2 regulates mitochondria morphology and apoptotic cell death via local modulation of cAMP/PKA signalling.

    Science.gov (United States)

    Monterisi, Stefania; Lobo, Miguel J; Livie, Craig; Castle, John C; Weinberger, Michael; Baillie, George; Surdo, Nicoletta C; Musheshe, Nshunge; Stangherlin, Alessandra; Gottlieb, Eyal; Maizels, Rory; Bortolozzi, Mario; Micaroni, Massimo; Zaccolo, Manuela

    2017-05-02

    cAMP/PKA signalling is compartmentalised with tight spatial and temporal control of signal propagation underpinning specificity of response. The cAMP-degrading enzymes, phosphodiesterases (PDEs), localise to specific subcellular domains within which they control local cAMP levels and are key regulators of signal compartmentalisation. Several components of the cAMP/PKA cascade are located to different mitochondrial sub-compartments, suggesting the presence of multiple cAMP/PKA signalling domains within the organelle. The function and regulation of these domains remain largely unknown. Here, we describe a novel cAMP/PKA signalling domain localised at mitochondrial membranes and regulated by PDE2A2. Using pharmacological and genetic approaches combined with real-time FRET imaging and high resolution microscopy, we demonstrate that in rat cardiac myocytes and other cell types mitochondrial PDE2A2 regulates local cAMP levels and PKA-dependent phosphorylation of Drp1. We further demonstrate that inhibition of PDE2A, by enhancing the hormone-dependent cAMP response locally, affects mitochondria dynamics and protects from apoptotic cell death.

  17. Apoptotic mechanism behind the testicular atrophy in photorefractory and scotosensitive quail: Involvement of GnIH induced p-53 dependent Bax-Caspase-3 mediated pathway.

    Science.gov (United States)

    Banerjee, Somanshu; Chaturvedi, Chandra Mohini

    2017-11-01

    In most of the avian species, daylength or photoperiod is the main environmental factor regulating reproduction. During their annual gonadal cycle, birds once sensitive to short or long day effect develop refractoriness to the same daylength and gonad develop or regress accordingly. The present study investigated the effects of photoperiodic alterations on apoptosis mediated testicular responses of photosensitive/photorefractory and scotosensitive/scotorefractory quail, Coturnix coturnix japonica. Testicular apoptosis in the quail of different photoperiodic conditions was assessed by monitoring the alterations in the local testicular expression of GnRH-I, GnIH, pro-apoptotic proteins (p53 and Bax), inactive caspase (pro-Caspase-3), executioner active-Caspase-3 and inactive/uncleaved PARP-1 (DNA repair enzyme) and TUNEL analysis. Alterations in these parameters indicate that testicular quiescence/regression in scotosensitive and photorefractory quail is mediated by apoptosis of testicular cells and hence apoptosis appears to be the key mechanism of testicular regression in Japanese quail. Present findings demonstrated the underlying molecular mechanism of how avian testes respond differentially to same photoperiodic conditions and exhibit scoto-/photo-sensitivity and refractoriness. It is concluded that photoperiod induced testicular stimulation in photosensitive/scotorefractory quail may be due to apoptotic inhibition and testicular regression in scotosensitive/photorefractory quail is guided by apoptosis, an effect invariably regulated by local action of GnRH and GnIH. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Targeting apoptotic machinery as approach for anticancer therapy: Smac mimetics as anticancer agents

    Directory of Open Access Journals (Sweden)

    Nevine M.Y. Elsayed

    2015-06-01

    Full Text Available Apoptosis is a chief regulator of cellular homeostasis. Impairment of apoptotic machinery is a main characteristic of several diseases such as cancer, where the evasion of apoptosis is a cardinal hallmark of cancer. Apoptosis is regulated by contribution of pro- and anti- apoptotic proteins, where caspases are the main executioners of the apoptotic machinery. IAP (inhibitors of apoptosis proteins is a family of endogenous inhibitors of apoptosis, which perform their function through interference with the function of caspases. Smac (second mitochondria-derived activator of caspases is endogenous inhibitor of IAPs, thus it is one of the major proapoptotic endogenous proteins. Thus, the development of Smac mimetics has evolved as an approach for anticancer therapy. Several Smac mimetic agents have been introduced to clinical trial such as birinapanet 12. Herein, the history of development of Smac mimetics along with the recent development in this field is briefly discussed.

  19. Actin-myosin–based contraction is responsible for apoptotic nuclear disintegration

    Science.gov (United States)

    Croft, Daniel R.; Coleman, Mathew L.; Li, Shuixing; Robertson, David; Sullivan, Teresa; Stewart, Colin L.; Olson, Michael F.

    2005-01-01

    Membrane blebbing during the apoptotic execution phase results from caspase-mediated cleavage and activation of ROCK I. Here, we show that ROCK activity, myosin light chain (MLC) phosphorylation, MLC ATPase activity, and an intact actin cytoskeleton, but not microtubular cytoskeleton, are required for disruption of nuclear integrity during apoptosis. Inhibition of ROCK or MLC ATPase activity, which protect apoptotic nuclear integrity, does not affect caspase-mediated degradation of nuclear proteins such as lamins A, B1, or C. The conditional activation of ROCK I was sufficient to tear apart nuclei in lamin A/C null fibroblasts, but not in wild-type fibroblasts. Thus, apoptotic nuclear disintegration requires actin-myosin contractile force and lamin proteolysis, making apoptosis analogous to, but distinct from, mitosis where nuclear disintegration results from microtubule-based forces and from lamin phosphorylation and depolymerization. PMID:15657395

  20. Anti-apoptotic peptides protect against radiation-induced cell death

    International Nuclear Information System (INIS)

    McConnell, Kevin W.; Muenzer, Jared T.; Chang, Kathy C.; Davis, Chris G.; McDunn, Jonathan E.; Coopersmith, Craig M.; Hilliard, Carolyn A.; Hotchkiss, Richard S.; Grigsby, Perry W.; Hunt, Clayton R.

    2007-01-01

    The risk of terrorist attacks utilizing either nuclear or radiological weapons has raised concerns about the current lack of effective radioprotectants. Here it is demonstrated that the BH4 peptide domain of the anti-apoptotic protein Bcl-xL can be delivered to cells by covalent attachment to the TAT peptide transduction domain (TAT-BH4) and provide protection in vitro and in vivo from radiation-induced apoptotic cell death. Isolated human lymphocytes treated with TAT-BH4 were protected against apoptosis following exposure to 15 Gy radiation. In mice exposed to 5 Gy radiation, TAT-BH4 treatment protected splenocytes and thymocytes from radiation-induced apoptotic cell death. Most importantly, in vivo radiation protection was observed in mice whether TAT-BH4 treatment was given prior to or after irradiation. Thus, by targeting steps within the apoptosis signaling pathway it is possible to develop post-exposure treatments to protect radio-sensitive tissues

  1. Exposure and binding of selected immunodominant La/SSB epitopes on human apoptotic cells.

    Science.gov (United States)

    Neufing, Petra J; Clancy, Robert M; Jackson, Michael W; Tran, Hai Bac; Buyon, Jill P; Gordon, Tom P

    2005-12-01

    Opsonization of apoptotic cells by autoantibodies bound to surface membrane-translocated La/SSB antigens may initiate tissue damage in the setting of congenital heart block. By injecting pregnant mice with human anti-La antibodies, we previously demonstrated the formation of IgG-apoptotic cell complexes in the developing mouse fetus; however, the binding of anti-La antibodies to human-specific epitopes could not be addressed. Accordingly, the objective of the current study was to delineate the epitope specificity of human La antibodies that are exposed on the surface of apoptotic cells. We used fluorescence microscopy and flow cytometry to assess the binding of human anti-La antibodies affinity purified against immunodominant epitopes of La to human cells undergoing spontaneous apoptosis, in a murine xenograft model in vivo and in cultured human fetal cardiocytes rendered apoptotic in vitro, respectively. Anti-La antibodies bound to immunodominant epitopes of La within the NH(2)-terminus and the RNA recognition motif (RRM) region of apoptotic human cells, in both xenografts and fetal cardiocytes. In contrast, human antibodies affinity purified against the COOH-terminal La epitope did not bind apoptotic cells in either model. This defines the topology of redistributed La during apoptosis, with surface exposure of the NH(2)-terminus and RRM regions. The potential importance of anti-La NH(2)-terminal and anti-La RRM specificity was confirmed by detection of this reactivity in mothers of children with congenital heart block. These findings provide insight into both the molecular modification of the La autoantigen during apoptosis and the specificity of antibodies capable of binding to surface-exposed La. Subsequent formation of surface immune complexes may lead to tissue injury in patients with autoimmune diseases such as congenital heart block.

  2. Andrographolide induces apoptotic and non-apoptotic death and enhances tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis in gastric cancer cells.

    Science.gov (United States)

    Lim, Sung-Chul; Jeon, Ho Jong; Kee, Keun Hong; Lee, Mi Ja; Hong, Ran; Han, Song Iy

    2017-05-01

    Andrographolide, a natural compound isolated from Andrographis paniculata , has been reported to possess antitumor activity. In the present study, the effect of andrographolide in human gastric cancer (GC) cells was investigated. Andrographolide induced cell death with apoptotic and non-apoptotic features. At a low concentration, andrographolide potentiated apoptosis and reduction of clonogenicity triggered by recombinant human tumor necrosis factor-related apoptosis-inducing ligand (rhTRAIL). Exposure of GC cells to andrographolide altered the expression level of several growth-inhibiting and apoptosis-regulating proteins, including death receptors. It was demonstrated that activity of the TRAIL-R2 (DR5) pathway was critical in the development of andrographolide-mediated rhTRAIL sensitization, since its inhibition significantly reduced the extent of apoptosis induced by the combination of rhTRAIL and andrographolide. In addition, andrographolide increased reactive oxygen species (ROS) generation in a dose-dependent manner. N-acetyl cysteine prevented andrographolide-mediated DR5 induction and the apoptotic effect induced by the combination of rhTRAIL and andrographolide. Collectively, the present study demonstrated that andrographolide enhances TRAIL-induced apoptosis through induction of DR5 expression. This effect appears to involve ROS generation in GCs.

  3. Escape Excel: A tool for preventing gene symbol and accession conversion errors

    Science.gov (United States)

    Stewart, Paul A.; Kuenzi, Brent M.; Eschrich, James A.

    2017-01-01

    Background Microsoft Excel automatically converts certain gene symbols, database accessions, and other alphanumeric text into dates, scientific notation, and other numerical representations. These conversions lead to subsequent, irreversible, corruption of the imported text. A recent survey of popular genomic literature estimates that one-fifth of all papers with supplementary gene lists suffer from this issue. Results Here, we present an open-source tool, Escape Excel, which prevents these erroneous conversions by generating an escaped text file that can be safely imported into Excel. Escape Excel is implemented in a variety of formats (http://www.github.com/pstew/escape_excel), including a command line based Perl script, a Windows-only Excel Add-In, an OS X drag-and-drop application, a simple web-server, and as a Galaxy web environment interface. Test server implementations are accessible as a Galaxy interface (http://apostl.moffitt.org) and simple non-Galaxy web server (http://apostl.moffitt.org:8000/). Conclusions Escape Excel detects and escapes a wide variety of problematic text strings so that they are not erroneously converted into other representations upon importation into Excel. Examples of problematic strings include date-like strings, time-like strings, leading zeroes in front of numbers, and long numeric and alphanumeric identifiers that should not be automatically converted into scientific notation. It is hoped that greater awareness of these potential data corruption issues, together with diligent escaping of text files prior to importation into Excel, will help to reduce the amount of Excel-corrupted data in scientific analyses and publications. PMID:28953918

  4. Temporal and ontogenetic variation in the escape response of Ameiva festiva (Squamata, Teiidae

    Directory of Open Access Journals (Sweden)

    Lattanzio

    2014-08-01

    Full Text Available Several factors have been shown to affect lizard escape behavior (flight initiation distance or FID, the distance between predator and prey when the prey initiates escape. Patterns of daily activity, such as foraging or movement behavior, vary with respect to time of day, supporting that escape responses may vary temporally as well. However, there remains scant information regarding the effects of time of day on FID. During peak activity, FID may decrease due to increased cost of giving up resources (e.g., prey or potential mates. An alternative hypothesis is that FID may increase because lizard activity in general may serve to alert a predator in advance of its approach. A lizard in this scenario may be favored to flee sooner rather than later. Moreover, juvenile and adult lizards of multiple species may differ in behavioral, ecological, and morphological traits that could influence escape decisions. I tested the effects of time of day (in 30-min intervals and age (juvenile or adult on the FID of a tropical whiptail lizard, Ameiva festiva in Costa Rica. I found that A. festiva escape responses varied with time of day such that in general, their FID decreased throughout the day. In addition, I observed a peak in FID from mid to late-morning that matches published estimates of peak activity times for A. festiva. Overall, juvenile A. festiva initiated an escape response sooner than adults, which may be related to differences in perceived risk associated with differences in size and predator experience between the two age groups. I conclude that escape responses may be contingent on both the activity level of the animal at the time of approach and its age.

  5. Phylogenetic dependency networks: inferring patterns of CTL escape and codon covariation in HIV-1 Gag.

    Directory of Open Access Journals (Sweden)

    Jonathan M Carlson

    2008-11-01

    Full Text Available HIV avoids elimination by cytotoxic T-lymphocytes (CTLs through the evolution of escape mutations. Although there is mounting evidence that these escape pathways are broadly consistent among individuals with similar human leukocyte antigen (HLA class I alleles, previous population-based studies have been limited by the inability to simultaneously account for HIV codon covariation, linkage disequilibrium among HLA alleles, and the confounding effects of HIV phylogeny when attempting to identify HLA-associated viral evolution. We have developed a statistical model of evolution, called a phylogenetic dependency network, that accounts for these three sources of confounding and identifies the primary sources of selection pressure acting on each HIV codon. Using synthetic data, we demonstrate the utility of this approach for identifying sites of HLA-mediated selection pressure and codon evolution as well as the deleterious effects of failing to account for all three sources of confounding. We then apply our approach to a large, clinically-derived dataset of Gag p17 and p24 sequences from a multicenter cohort of 1144 HIV-infected individuals from British Columbia, Canada (predominantly HIV-1 clade B and Durban, South Africa (predominantly HIV-1 clade C. The resulting phylogenetic dependency network is dense, containing 149 associations between HLA alleles and HIV codons and 1386 associations among HIV codons. These associations include the complete reconstruction of several recently defined escape and compensatory mutation pathways and agree with emerging data on patterns of epitope targeting. The phylogenetic dependency network adds to the growing body of literature suggesting that sites of escape, order of escape, and compensatory mutations are largely consistent even across different clades, although we also identify several differences between clades. As recent case studies have demonstrated, understanding both the complexity and the consistency of

  6. Orbital and escape dynamics in barred galaxies - I. The 2D system

    Science.gov (United States)

    Jung, Christof; Zotos, Euaggelos E.

    2016-04-01

    In this paper, we use the two-dimensional version of a new analytical gravitational model in order to explore the orbital as well as the escape dynamics of the stars in a barred galaxy composed of a spherically symmetric central nucleus, a bar, a flat disc and a dark matter halo component. A thorough numerical investigation is conducted for distinguishing between bounded and escaping motion. Furthermore, bounded orbits are further classified into non-escaping regular and trapped chaotic using the Smaller ALingment Index method. Our aim is to determine the basins of escape through the two symmetrical escape channels around the Lagrange points L2 and L3 and also to relate them with the corresponding distribution of the escape rates of the orbits. We integrate initial conditions of orbits in several types of planes so as to obtain a more complete view of the overall orbital properties of the dynamical system. We also present evidence that the unstable manifolds which guide the orbits in and out the interior region are directly related with the formation of spiral and ring stellar structures observed in barred galaxies. In particular, we examine how the bar's semimajor axis determines the resulting morphologies. Our numerical simulations indicate that weak barred structures favour the formation of R1 rings or R_1^' } pseudo-rings, while strong bars on the other hand, give rise to R1R2 and open spiral morphologies. Our results are compared with earlier related work. The escape dynamics and the properties of the manifolds of the full three-dimensional galactic system will be given in an accompanying paper.

  7. Escape Excel: A tool for preventing gene symbol and accession conversion errors.

    Science.gov (United States)

    Welsh, Eric A; Stewart, Paul A; Kuenzi, Brent M; Eschrich, James A

    2017-01-01

    Microsoft Excel automatically converts certain gene symbols, database accessions, and other alphanumeric text into dates, scientific notation, and other numerical representations. These conversions lead to subsequent, irreversible, corruption of the imported text. A recent survey of popular genomic literature estimates that one-fifth of all papers with supplementary gene lists suffer from this issue. Here, we present an open-source tool, Escape Excel, which prevents these erroneous conversions by generating an escaped text file that can be safely imported into Excel. Escape Excel is implemented in a variety of formats (http://www.github.com/pstew/escape_excel), including a command line based Perl script, a Windows-only Excel Add-In, an OS X drag-and-drop application, a simple web-server, and as a Galaxy web environment interface. Test server implementations are accessible as a Galaxy interface (http://apostl.moffitt.org) and simple non-Galaxy web server (http://apostl.moffitt.org:8000/). Escape Excel detects and escapes a wide variety of problematic text strings so that they are not erroneously converted into other representations upon importation into Excel. Examples of problematic strings include date-like strings, time-like strings, leading zeroes in front of numbers, and long numeric and alphanumeric identifiers that should not be automatically converted into scientific notation. It is hoped that greater awareness of these potential data corruption issues, together with diligent escaping of text files prior to importation into Excel, will help to reduce the amount of Excel-corrupted data in scientific analyses and publications.

  8. Escape Excel: A tool for preventing gene symbol and accession conversion errors.

    Directory of Open Access Journals (Sweden)

    Eric A Welsh

    Full Text Available Microsoft Excel automatically converts certain gene symbols, database accessions, and other alphanumeric text into dates, scientific notation, and other numerical representations. These conversions lead to subsequent, irreversible, corruption of the imported text. A recent survey of popular genomic literature estimates that one-fifth of all papers with supplementary gene lists suffer from this issue.Here, we present an open-source tool, Escape Excel, which prevents these erroneous conversions by generating an escaped text file that can be safely imported into Excel. Escape Excel is implemented in a variety of formats (http://www.github.com/pstew/escape_excel, including a command line based Perl script, a Windows-only Excel Add-In, an OS X drag-and-drop application, a simple web-server, and as a Galaxy web environment interface. Test server implementations are accessible as a Galaxy interface (http://apostl.moffitt.org and simple non-Galaxy web server (http://apostl.moffitt.org:8000/.Escape Excel detects and escapes a wide variety of problematic text strings so that they are not erroneously converted into other representations upon importation into Excel. Examples of problematic strings include date-like strings, time-like strings, leading zeroes in front of numbers, and long numeric and alphanumeric identifiers that should not be automatically converted into scientific notation. It is hoped that greater awareness of these potential data corruption issues, together with diligent escaping of text files prior to importation into Excel, will help to reduce the amount of Excel-corrupted data in scientific analyses and publications.

  9. Apoptotic Cells Induced Signaling for Immune Homeostasis in Macrophages and Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Uriel Trahtemberg

    2017-10-01

    Full Text Available Inefficient and abnormal clearance of apoptotic cells (efferocytosis contributes to systemic autoimmune disease in humans and mice, and inefficient chromosomal DNA degradation by DNAse II leads to systemic polyarthritis and a cytokine storm. By contrast, efficient clearance allows immune homeostasis, generally leads to a non-inflammatory state for both macrophages and dendritic cells (DCs, and contributes to maintenance of peripheral tolerance. As many as 3 × 108 cells undergo apoptosis every hour in our bodies, and one of the primary “eat me” signals expressed by apoptotic cells is phosphatidylserine (PtdSer. Apoptotic cells themselves are major contributors to the “anti-inflammatory” nature of the engulfment process, some by secreting thrombospondin-1 (TSP-1 or adenosine monophosphate and possibly other immune modulating “calm-down” signals that interact with macrophages and DCs. Apoptotic cells also produce “find me” and “tolerate me” signals to attract and immune modulate macrophages and DCs that express specific receptors for some of these signals. Neither macrophages nor DCs are uniform, and each cell type may variably express membrane proteins that function as receptors for PtdSer or for opsonins like complement or opsonins that bind to PtdSer, such as protein S and growth arrest-specific 6. Macrophages and DCs also express scavenger receptors, CD36, and integrins that function via bridging molecules such as TSP-1 or milk fat globule-EGF factor 8 protein and that differentially engage in various multi-ligand interactions between apoptotic cells and phagocytes. In this review, we describe the anti-inflammatory and pro-homeostatic nature of apoptotic cell interaction with the immune system. We do not review some forms of immunogenic cell death. We summarize the known apoptotic cell signaling events in macrophages and DCs that are related to toll-like receptors, nuclear factor kappa B, inflammasome, the lipid

  10. Anti-apoptotic signaling as a cytoprotective mechanism in mammalian hibernation

    Directory of Open Access Journals (Sweden)

    Andrew N. Rouble

    2013-02-01

    Full Text Available In the context of normal cell turnover, apoptosis is a natural phenomenon involved in making essential life and death decisions. Apoptotic pathways balance signals which promote cell death (pro-apoptotic pathways or counteract these signals (anti-apoptotic pathways. We proposed that changes in anti-apoptotic proteins would occur during mammalian hibernation to aid cell preservation during prolonged torpor under cellular conditions that are highly injurious to most mammals (e.g. low body temperatures, ischemia. Immunoblotting was used to analyze the expression of proteins associated with pro-survival in six tissues of thirteen-lined ground squirrels, Ictidomys tridecemlineatus. The brain showed a concerted response to torpor with significant increases in the levels of all anti-apoptotic targets analyzed (Bcl-2, Bcl-xL, BI-1, Mcl-1, cIAP1/2, xIAP as well as enhanced phosphorylation of Bcl-2 at S70 and T56. Heart responded similarly with most anti-apoptotic proteins elevated significantly during torpor except for Bcl-xL and xIAP that decreased and Mcl-1 that was unaltered. In liver, BI-1 increased whereas cIAP1/2 decreased. In kidney, there was an increase in BI-1, cIAP and xIAP but decreases in Bcl-xL and p-Bcl-2(T56 content. In brown adipose tissue, protein levels of BI-1, cIAP1/2, and xIAP decreased significantly during torpor (compared with euthermia whereas Bcl-2, Bcl-xL, Mcl-1 were unaltered; however, Bcl-2 showed enhanced phosphorylation at Thr56 but not at Ser70. In skeletal muscle, only xIAP levels changed significantly during torpor (an increase. The data show that anti-apoptotic pathways have organ-specific responses in hibernators with a prominent potential role in heart and brain where coordinated enhancement of anti-apoptotic proteins occurred in response to torpor.

  11. Amelioration of nandrolone decanoate-induced testicular and sperm toxicity in rats by taurine: Effects on steroidogenesis, redox and inflammatory cascades, and intrinsic apoptotic pathway

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Maha A.E., E-mail: mahapharm@yahoo.com

    2015-02-01

    The wide abuse of the anabolic steroid nandrolone decanoate by athletes and adolescents for enhancement of sporting performance and physical appearance may be associated with testicular toxicity and infertility. On the other hand, taurine; a free β-amino acid with remarkable antioxidant activity, is used in taurine-enriched beverages to boost the muscular power of athletes. Therefore, the purpose of this study was to investigate the mechanisms of the possible protective effects of taurine on nandrolone decanoate-induced testicular and sperm toxicity in rats. To achieve this aim, male Wistar rats were randomly distributed into four groups and administered either vehicle, nandrolone decanoate (10 mg/kg/week, I.M.), taurine (100 mg/kg/day, p.o.) or combination of taurine and nandrolone decanoate, for 8 successive weeks. Results of the present study showed that taurine reversed nandrolone decanoate-induced perturbations in sperm characteristics, normalized serum testosterone level, and restored the activities of the key steroidogenic enzymes; 3β-HSD, and 17β-HSD. Moreover, taurine prevented nandrolone decanoate-induced testicular toxicity and DNA damage by virtue of its antioxidant, anti-inflammatory, and anti-apoptotic effects. This was evidenced by taurine-induced modulation of testicular LDH-x activity, redox markers (MDA, NO, GSH contents, and SOD activity), inflammatory indices (TNF-α, ICAM-1 levels, and MMP-9 gene expression), intrinsic apoptotic pathway (cytochrome c gene expression and caspase-3 content), and oxidative DNA damage markers (8-OHdG level and comet assay). In conclusion, at the biochemical and histological levels, taurine attenuated nandrolone decanoate-induced poor sperm quality and testicular toxicity in rats. - Highlights: • Nandrolone decanoate (ND) disrupts sperm profile and steroidogenesis in rats. • ND upregulates gene expression of inflammatory and apoptotic markers. • Taurine normalizes sperm profile and serum testosterone level

  12. Amelioration of nandrolone decanoate-induced testicular and sperm toxicity in rats by taurine: Effects on steroidogenesis, redox and inflammatory cascades, and intrinsic apoptotic pathway

    International Nuclear Information System (INIS)

    Ahmed, Maha A.E.

    2015-01-01

    The wide abuse of the anabolic steroid nandrolone decanoate by athletes and adolescents for enhancement of sporting performance and physical appearance may be associated with testicular toxicity and infertility. On the other hand, taurine; a free β-amino acid with remarkable antioxidant activity, is used in taurine-enriched beverages to boost the muscular power of athletes. Therefore, the purpose of this study was to investigate the mechanisms of the possible protective effects of taurine on nandrolone decanoate-induced testicular and sperm toxicity in rats. To achieve this aim, male Wistar rats were randomly distributed into four groups and administered either vehicle, nandrolone decanoate (10 mg/kg/week, I.M.), taurine (100 mg/kg/day, p.o.) or combination of taurine and nandrolone decanoate, for 8 successive weeks. Results of the present study showed that taurine reversed nandrolone decanoate-induced perturbations in sperm characteristics, normalized serum testosterone level, and restored the activities of the key steroidogenic enzymes; 3β-HSD, and 17β-HSD. Moreover, taurine prevented nandrolone decanoate-induced testicular toxicity and DNA damage by virtue of its antioxidant, anti-inflammatory, and anti-apoptotic effects. This was evidenced by taurine-induced modulation of testicular LDH-x activity, redox markers (MDA, NO, GSH contents, and SOD activity), inflammatory indices (TNF-α, ICAM-1 levels, and MMP-9 gene expression), intrinsic apoptotic pathway (cytochrome c gene expression and caspase-3 content), and oxidative DNA damage markers (8-OHdG level and comet assay). In conclusion, at the biochemical and histological levels, taurine attenuated nandrolone decanoate-induced poor sperm quality and testicular toxicity in rats. - Highlights: • Nandrolone decanoate (ND) disrupts sperm profile and steroidogenesis in rats. • ND upregulates gene expression of inflammatory and apoptotic markers. • Taurine normalizes sperm profile and serum testosterone level

  13. A study on the role of apoptotic human umbilical cord mesenchymal stem cells in bleomycin-induced acute lung injury in rat models.

    Science.gov (United States)

    Liu, F-B; Lin, Q; Liu, Z-W

    2016-03-01

    We sought to determine whether normal human umbilical cord mesenchymal stem cells and apoptotic human umbilical cord mesenchymal stem cells play any role in the lung repair following bleomycin-induced lung injury in rat models. Umbilical cord mesenchymal stem cells were obtained from the umbilical cord following caesarian section from healthy normal babies. Plasmin deprivation method was used for culture of human umbilical cord mesenchymal stem cells and flow cytometry was used to identify cell surface antigen and activity of stem cells and apoptosis. The animal model of acute lung injury was established by a one-off intratracheal instillation of bleomycin (BLM) (5 mg/kg) and then normal stem cells and apoptotic stem cells were separately injected. Alveolar lavage fluid and lung tissue were collected for further analysis prior to the injury and at days 3, 7, 14 after administration of BLM. The number of neutrophils in the broncho alveolar lavage fluid (BALF) was counted; Bicinchoninic Acid (BCA) method was used for estimation of total protein content in alveolar lavage fluid; biochemical assay was used for estimation of myeloperoxidase (MPO) activity; hematoxylin and eosin (HE) staining of lung tissue was used for histopathology analysis; reverse transcription-polymerase chain reaction (RT-PCR) assay was used for the determination of interferon-gamma (INF-γ) and mRNA changes of interleukin-4 (IL-4) in lung tissue. Enzyme-linked immunosorbent assay (ELISA) was used for the determination of cytokines TNF-α in the lung tissue. Apoptotic human umbilical cord mesenchymal stem cells were more effective in reducing lung neutrophil infiltration and total protein leakage in rat models of acute lung injury (ALI). There was also an improvement in the degree of vascular permeability, reduction in the level of proinflammatory cytokines, INF-γ gene level and boost in anti-inflammatory cytokine IL-4 levels which also helps in more effectively reducing the degree of injury in

  14. Indirect evaluation of corneal apoptosis in contact lens wearers by estimation of nitric oxide and antioxidant enzymes in tears

    Directory of Open Access Journals (Sweden)

    R P Bhatia

    2010-01-01

    Full Text Available Background : Contact lens induced trauma to the corneal epithelium results in increased release of inflammatory mediators. The keratocyte apoptosis is directly related to epithelial injury and has been correlated with increased production of nitric oxide. Potent antioxidant enzymes protect cells from oxidative damage by inactivating reactive oxygen species and thus inhibiting apoptosis. This study aims at determination of total nitric oxide and antioxidant enzymes in tears which will be an indirect criteria for assessing apoptosis. Materials and Methods : Nitric oxide and antioxidant enzymes were estimated in tears of 25 soft contact lens wearers and compared with 25 age and sex matched controls. Results : Statistically significant increase of nitric oxide (P< 0.001, superoxide dismutase (P< 0.001 and glutathione peroxidase (P< 0.001 levels was seen in tears of contact lens wearers as compared to controls. There was also statistically significant increase in the levels of antioxidant enzymes, superoxide dismutase (P< 0.05 and glutathione peroxidase (P< 0.01, with increase in the total duration of contact lens wear in years. Conclusions : Increase in the level of nitric oxide and antioxidant enzymes in tears of contact lens wearers suggested that contact lens wear suppresses the process of apoptosis. However, it was also postulated that the increased levels of nitric oxide balances the anti-apoptotic activities of increased levels of antioxidant enzymes by its pro-apoptotic activity leading to protective outcomes in contact lens wearers.

  15. Non-thermal escape rates of atmospheric H and D from Mars using MAVEN data

    Science.gov (United States)

    Gacesa, M.; Zahnle, K. J.

    2017-12-01

    Geological evidence suggests that an ocean of liquid water existed on Mars until at least middle to late Noachian era (4.1 to 3.8 Ga) and possibly, at least episodically, as late as Hesperian. Between 67% and 87% of the total primordial amount of water, equal to about 70 to 110 meters equivalent (spread over the entire Mars' surface), is believed to have escape to space, while about 35 meters remains on or beneath the surface as water ice. Establishing better constraints on these numbers and identifying the responsible atmospheric loss processes remains the major objective of NASA's Mars Atmosphere and Volatile EvolutioN (MAVEN) mission. The ratio of atmospheric Deuterium and Hydrogen (D/H) on Mars is one of the best indicators of water loss to space. While majority of H and D escape through thermal Jeans escape, up to 10% of D can escape to space via non-thermal mechanisms, such as collisions with superthermal neutral atoms. In this study, we present new estimates of non-thermal escape rates of light molecules of interest to the water evolution, including H2, HD, OH, and OD, based on recent measurements of atmospheric density and temperature profiles by MAVEN. The escape mechanisms considered include photochemical sources of hot O, as well as collisions with energetic neutral atoms produced in charge-exchange of solar wind ions with atmospheric gases1,2. Energy transport and escape rates are modeled using quantum reactive scattering formalism3 and seasonal variations are illustrated. Finally, a simple estimate of the role of the non-thermal escape mechanisms in previous eras is given. We conclude that D escape rates can be affected by the non-thermal processes with consequences on the estimates of primordial water inventory based on the D/H ratio. [1] N. Lewkow and V. Kharchenko, Astroph. J., 790, 98 (2014) [2] M. Gacesa, N. Lewkow, V. Kharchenko, Icarus 284, 90 (2017) [3] M. Gacesa and V. Kharchenko, Geophys. Res. Lett., 39, L10203 (2012)

  16. Nosema ceranae escapes fumagillin control in honey bees.

    Science.gov (United States)

    Huang, Wei-Fone; Solter, Leellen F; Yau, Peter M; Imai, Brian S

    2013-03-01

    Fumagillin is the only antibiotic approved for control of nosema disease in honey bees and has been extensively used in United States apiculture for more than 50 years for control of Nosema apis. It is toxic to mammals and must be applied seasonally and with caution to avoid residues in honey. Fumagillin degrades or is diluted in hives over the foraging season, exposing bees and the microsporidia to declining concentrations of the drug. We showed that spore production by Nosema ceranae, an emerging microsporidian pathogen in honey bees, increased in response to declining fumagillin concentrations, up to 100% higher than that of infected bees that have not been exposed to fumagillin. N. apis spore production was also higher, although not significantly so. Fumagillin inhibits the enzyme methionine aminopeptidase2 (MetAP2) in eukaryotic cells and interferes with protein modifications necessary for normal cell function. We sequenced the MetAP2 gene for apid Nosema species and determined that, although susceptibility to fumagillin differs among species, there are no apparent differences in fumagillin binding sites. Protein assays of uninfected bees showed that fumagillin altered structural and metabolic proteins in honey bee midgut tissues at concentrations that do not suppress microsporidia reproduction. The microsporidia, particularly N. ceranae, are apparently released from the suppressive effects of fumagillin at concentrations that continue to impact honey bee physiology. The current application protocol for fumagillin may exacerbate N. ceranae infection rather than suppress it.

  17. Nosema ceranae escapes fumagillin control in honey bees.

    Directory of Open Access Journals (Sweden)

    Wei-Fone Huang

    2013-03-01

    Full Text Available Fumagillin is the only antibiotic approved for control of nosema disease in honey bees and has been extensively used in United States apiculture for more than 50 years for control of Nosema apis. It is toxic to mammals and must be applied seasonally and with caution to avoid residues in honey. Fumagillin degrades or is diluted in hives over the foraging season, exposing bees and the microsporidia to declining concentrations of the drug. We showed that spore production by Nosema ceranae, an emerging microsporidian pathogen in honey bees, increased in response to declining fumagillin concentrations, up to 100% higher than that of infected bees that have not been exposed to fumagillin. N. apis spore production was also higher, although not significantly so. Fumagillin inhibits the enzyme methionine aminopeptidase2 (MetAP2 in eukaryotic cells and interferes with protein modifications necessary for normal cell function. We sequenced the MetAP2 gene for apid Nosema species and determined that, although susceptibility to fumagillin differs among species, there are no apparent differences in fumagillin binding sites. Protein assays of uninfected bees showed that fumagillin altered structural and metabolic proteins in honey bee midgut tissues at concentrations that do not suppress microsporidia reproduction. The microsporidia, particularly N. ceranae, are apparently released from the suppressive effects of fumagillin at concentrations that continue to impact honey bee physiology. The current application protocol for fumagillin may exacerbate N. ceranae infection rather than suppress it.

  18. Escape and surveillance asymmetries in locusts exposed to a Guinea fowl-mimicking robot predator.

    Science.gov (United States)

    Romano, Donato; Benelli, Giovanni; Stefanini, Cesare

    2017-10-09

    Escape and surveillance responses to predators are lateralized in several vertebrate species. However, little is known on the laterality of escapes and predator surveillance in arthropods. In this study, we investigated the lateralization of escape and surveillance responses in young instars and adults of Locusta migratoria during biomimetic interactions with a robot-predator inspired to the Guinea fowl, Numida meleagris. Results showed individual-level lateralization in the jumping escape of locusts exposed to the robot-predator attack. The laterality of this response was higher in L. migratoria adults over young instars. Furthermore, population-level lateralization of predator surveillance was found testing both L. migratoria adults and young instars; locusts used the right compound eye to oversee the robot-predator. Right-biased individuals were more stationary over left-biased ones during surveillance of the robot-predator. Individual-level lateralization could avoid predictability during the jumping escape. Population-level lateralization may improve coordination in the swarm during specific group tasks such as predator surveillance. To the best of our knowledge, this is the first report of lateralized predator-prey interactions in insects. Our findings outline the possibility of using biomimetic robots to study predator-prey interaction, avoiding the use of real predators, thus achieving standardized experimental conditions to investigate complex and flexible behaviours.

  19. On the run: mapping the escape speed across the Galaxy with SDSS

    Science.gov (United States)

    Williams, Angus A.; Belokurov, Vasily; Casey, Andrew R.; Evans, N. Wyn

    2017-06-01

    We measure the variation of the escape speed of the Milky Way across a range of ˜40 kpc in Galactocentric radius. The local escape speed is found to be 521^{+46}_{-30}{ km s^{-1}}, in good agreement with other studies. We find that this has already fallen to 379^{+34}_{-28}{ km s^{-1}} at a radius of 50 kpc. Through measuring the escape speed and its variation, we obtain constraints on the Galactic mass profile and rotation curve. The gradient in the escape speed suggests that the total mass contained within 50 kpc is 30^{+7}_{-5}× 10^{10} M_{⊙}, implying a relatively light dark halo for the Milky Way. The local circular speed is found to be v_c(R_0) = 223^{+40}_{-34}{ km s^{-1}} and falls with radius as a power law with index -0.19 ± 0.05. Our method represents a novel way of estimating the mass of the Galaxy, and has very different systematics to more commonly used models of tracers, which are more sensitive to the central parts of the halo velocity distributions. Using our inference on the escape speed, we then investigate the orbits of high-speed Milky Way dwarf galaxies. For each considered dwarf, we predict small pericentre radii and large orbital eccentricities. This naturally explains the large observed ellipticities of two of the dwarfs, which are likely to have been heavily disrupted at pericentre.

  20. Quantification of pre-mRNA escape rate and synergy in splicing.

    Science.gov (United States)

    Bonde, Marie Mi; Voegeli, Sylvia; Baudrimont, Antoine; Séraphin, Bertrand; Becskei, Attila

    2014-11-10

    Splicing reactions generally combine high speed with accuracy. However, some of the pre-mRNAs escape the nucleus with a retained intron. Intron retention can control gene expression and increase proteome diversity. We calculated the escape rate for the yeast PTC7 intron and pre-mRNA. This prediction was facilitated by the observation that splicing is a linear process and by deriving simple algebraic expressions from a model of co- and post-transcriptional splicing and RNA surveillance that determines the rate of the nonsense-mediated decay (NMD) of the pre-mRNAs with the retained intron. The escape rate was consistent with the observed threshold of splicing rate below which the mature mRNA level declined. When an mRNA contains multiple introns, the outcome of splicing becomes more difficult to predict since not only the escape rate of the pre-mRNA has to be considered, but also the possibility that the splicing of each intron is influenced by the others. We showed that the two adjacent introns in the SUS1 mRNA are spliced cooperatively, but this does not counteract the escape of the partially spliced mRNA. These findings will help to infer promoter activity and to predict the behavior of and to control splicing regulatory networks. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Hydrogen escape from Mars enhanced by deep convection in dust storms

    Science.gov (United States)

    Heavens, Nicholas G.; Kleinböhl, Armin; Chaffin, Michael S.; Halekas, Jasper S.; Kass, David M.; Hayne, Paul O.; McCleese, Daniel J.; Piqueux, Sylvain; Shirley, James H.; Schofield, John T.

    2018-02-01

    Present-day water loss from Mars provides insight into Mars's past habitability1-3. Its main mechanism is thought to be Jeans escape of a steady hydrogen reservoir sourced from odd-oxygen reactions with near-surface water vapour2, 4,5. The observed escape rate, however, is strongly variable and correlates poorly with solar extreme-ultraviolet radiation flux6-8, which was predicted to modulate escape9. This variability has recently been attributed to hydrogen sourced from photolysed middle atmospheric water vapour10, whose vertical and seasonal distribution is only partly characterized and understood11-13. Here, we report multi-annual observational estimates of water content and dust and water transport to the middle atmosphere from Mars Climate Sounder data. We provide strong evidence that the transport of water vapour and ice to the middle atmosphere by deep convection in Martian dust storms can enhance hydrogen escape. Planet-encircling dust storms can raise the effective hygropause (where water content rapidly decreases to effectively zero) from 50 to 80 km above the areoid (the reference equipotential surface). Smaller dust storms contribute to an annual mode in water content at 40-50 km that may explain seasonal variability in escape. Our results imply that Martian atmospheric chemistry and evolution can be strongly affected by the meteorology of the lower and middle atmosphere of Mars.

  2. How Hospitable Are Space Weather Affected Habitable Zones? The Role of Ion Escape

    Energy Technology Data Exchange (ETDEWEB)

    Airapetian, Vladimir S.; Glocer, Alex; Khazanov, George V.; Danchi, William C. [NASA/GSFC, Greenbelt, MD (United States); Loyd, R. O. P.; France, Kevin [University of Colorado/LASP, Boulder, CO (United States); Sojka, Jan [Utah State University, Logan, UT (United States); Liemohn, Michael W. [University of Michigan, Ann Arbor, MI (United States)

    2017-02-10

    Atmospheres of exoplanets in the habitable zones around active young G-K-M stars are subject to extreme X-ray and EUV (XUV) fluxes from their host stars that can initiate atmospheric erosion. Atmospheric loss affects exoplanetary habitability in terms of surface water inventory, atmospheric pressure, the efficiency of greenhouse warming, and the dosage of the UV surface irradiation. Thermal escape models suggest that exoplanetary atmospheres around active K-M stars should undergo massive hydrogen escape, while heavier species including oxygen will accumulate forming an oxidizing atmosphere. Here, we show that non-thermal oxygen ion escape could be as important as thermal, hydrodynamic H escape in removing the constituents of water from exoplanetary atmospheres under supersolar XUV irradiation. Our models suggest that the atmospheres of a significant fraction of Earth-like exoplanets around M dwarfs and active K stars exposed to high XUV fluxes will incur a significant atmospheric loss rate of oxygen and nitrogen, which will make them uninhabitable within a few tens to hundreds of Myr, given a low replenishment rate from volcanism or cometary bombardment. Our non-thermal escape models have important implications for the habitability of the Proxima Centauri’s terrestrial planet.

  3. Nifedipine treatment reduces resting calcium concentration, oxidative and apoptotic gene expression, and improves muscle function in dystrophic mdx mice.

    Science.gov (United States)

    Altamirano, Francisco; Valladares, Denisse; Henríquez-Olguín, Carlos; Casas, Mariana; López, Jose R; Allen, Paul D; Jaimovich, Enrique

    2013-01-01

    Duchenne Muscular Dystrophy (DMD) is a recessive X-linked genetic disease, caused by mutations in the gene encoding dystrophin. DMD is characterized in humans and in mdx mice by a severe and progressive destruction of muscle fibers, inflammation, oxidative/nitrosative stress, and cell death. In mdx muscle fibers, we have shown that basal ATP release is increased and that extracellular ATP stimulation is pro-apoptotic. In normal fibers, depolarization-induced ATP release is blocked by nifedipine, leading us to study the potential therapeutic effect of nifedipine in mdx muscles and its relation with extracellular ATP signaling. Acute exposure to nifedipine (10 µM) decreased [Ca(2+)]r, NF-κB activity and iNOS expression in mdx myotubes. In addition, 6-week-old mdx mice were treated with daily intraperitoneal injections of nifedipine, 1 mg/Kg for 1 week. This treatment lowered the [Ca(2+)]r measured in vivo in the mdx vastus lateralis. We demonstrated that extracellular ATP levels were higher in adult mdx flexor digitorum brevis (FDB) fibers and can be significantly reduced after 1 week of treatment with nifedipine. Interestingly, acute treatment of mdx FDB fibers with apyrase, an enzyme that completely degrades extracellular ATP to AMP, reduced [Ca(2+)]r to a similar extent as was seen in FDB fibers after 1-week of nifedipine treatment. Moreover, we demonstrated that nifedipine treatment reduced mRNA levels of pro-oxidative/nitrosative (iNOS and gp91(phox)/p47(phox) NOX2 subunits) and pro-apoptotic (Bax) genes in mdx diaphragm muscles and lowered serum creatine kinase (CK) levels. In addition, nifedipine treatment increased muscle strength assessed by the inverted grip-hanging test and exercise tolerance measured with forced swimming test in mdx mice. We hypothesize that nifedipine reduces basal ATP release, thereby decreasing purinergic receptor activation, which in turn reduces [Ca(2+)]r in mdx skeletal muscle cells. The results in this work open new perspectives

  4. Nifedipine treatment reduces resting calcium concentration, oxidative and apoptotic gene expression, and improves muscle function in dystrophic mdx mice.

    Directory of Open Access Journals (Sweden)

    Francisco Altamirano

    Full Text Available Duchenne Muscular Dystrophy (DMD is a recessive X-linked genetic disease, caused by mutations in the gene encoding dystrophin. DMD is characterized in humans and in mdx mice by a severe and progressive destruction of muscle fibers, inflammation, oxidative/nitrosative stress, and cell death. In mdx muscle fibers, we have shown that basal ATP release is increased and that extracellular ATP stimulation is pro-apoptotic. In normal fibers, depolarization-induced ATP release is blocked by nifedipine, leading us to study the potential therapeutic effect of nifedipine in mdx muscles and its relation with extracellular ATP signaling. Acute exposure to nifedipine (10 µM decreased [Ca(2+]r, NF-κB activity and iNOS expression in mdx myotubes. In addition, 6-week-old mdx mice were treated with daily intraperitoneal injections of nifedipine, 1 mg/Kg for 1 week. This treatment lowered the [Ca(2+]r measured in vivo in the mdx vastus lateralis. We demonstrated that extracellular ATP levels were higher in adult mdx flexor digitorum brevis (FDB fibers and can be significantly reduced after 1 week of treatment with nifedipine. Interestingly, acute treatment of mdx FDB fibers with apyrase, an enzyme that completely degrades extracellular ATP to AMP, reduced [Ca(2+]r to a similar extent as was seen in FDB fibers after 1-week of nifedipine treatment. Moreover, we demonstrated that nifedipine treatment reduced mRNA levels of pro-oxidative/nitrosative (iNOS and gp91(phox/p47(phox NOX2 subunits and pro-apoptotic (Bax genes in mdx diaphragm muscles and lowered serum creatine kinase (CK levels. In addition, nifedipine treatment increased muscle strength assessed by the inverted grip-hanging test and exercise tolerance measured with forced swimming test in mdx mice. We hypothesize that nifedipine reduces basal ATP release, thereby decreasing purinergic receptor activation, which in turn reduces [Ca(2+]r in mdx skeletal muscle cells. The results in this work open new

  5. Human decidual stromal cells secrete soluble pro-apoptotic factors during decidualization in a cAMP-dependent manner.

    Science.gov (United States)

    Leno-Durán, E; Ruiz-Magaña, M J; Muñoz-Fernández, R; Requena, F; Olivares, E G; Ruiz-Ruiz, C

    2014-10-10

    Is there a relationship between decidualization and apoptosis of decidual stromal cells (DSC)? Decidualization triggers the secretion of soluble factors that induce apoptosis in DSC. The differentiation and apoptosis of DSC during decidualization of the receptive decidua are crucial processes for the controlled invasion of trophoblasts in normal pregnancy. Most DSC regress in a time-dependent manner, and their removal is important to provide space for the embryo to grow. However, the mechanism that controls DSC death is poorly understood. The apoptotic response of DSC was analyzed after exposure to different exogenous agents and during decidualization. The apoptotic potential of decidualized DSC supernatants and prolactin (PRL) was also evaluated. DSC lines were established from samples of decidua from first trimester pregnancies. Apoptosis was assayed by flow cytometry. PRL production, as a marker of decidualization, was determined by enzyme-linked immunosorbent assay. DSCs were resistant to a variety of apoptosis-inducing substances. Nevertheless, DSC underwent apoptosis during decidualization in culture, with cAMP being essential for both apoptosis and differentiation. In addition, culture supernatants from decidualized DSC induced apoptosis in undifferentiated DSC, although paradoxically these supernatants decreased the spontaneous apoptosis of decidual lymphocytes. Exogenously added PRL did not induce apoptosis in DSC and an antibody that neutralized the PRL receptor did not decrease the apoptosis induced by supernatants. Further studies are needed to examine the involvement of other soluble factors secreted by decidualized DSC in the induction of apoptosis. The present results indicate that apoptosis of DSC occurs in parallel to differentiation, in response to decidualization signals, with soluble factors secreted by decidualized DSC being responsible for triggering cell death. These studies are relevant in the understanding of how the regression of decidua

  6. Reduced IRE1α mediates apoptotic cell death by disrupting calcium homeostasis via the InsP3 receptor.

    Science.gov (United States)

    Son, S M; Byun, J; Roh, S-E; Kim, S J; Mook-Jung, I

    2014-04-17

    The endoplasmic reticulum (ER) is not only a home for folding and posttranslational modifications of secretory proteins but also a reservoir for intracellular Ca(2+). Perturbation of ER homeostasis contributes to the pathogenesis of various neurodegenerative diseases, such as Alzheimer's and Parkinson diseases. One key regulator that underlies cell survival and Ca(2+) homeostasis during ER stress responses is inositol-requiring enzyme 1α (IRE1α). Despite extensive studies on this ER membrane-associated protein, little is known about the molecular mechanisms by which excessive ER stress triggers cell death and Ca(2+) dysregulation via the IRE1α-dependent signaling pathway. In this study, we show that inactivation of IRE1α by RNA interference increases cytosolic Ca(2+) concentration in SH-SY5Y cells, leading to cell death. This dysregulation is caused by an accelerated ER-to-cytosolic efflux of Ca(2+) through the InsP3 receptor (InsP3R). The Ca(2+) efflux in IRE1α-deficient cells correlates with dissociation of the Ca(2+)-binding InsP3R inhibitor CIB1 and increased complex formation of CIB1 with the pro-apoptotic kinase ASK1, which otherwise remains inactivated in the IRE1α-TRAF2-ASK1 complex. The increased cytosolic concentration of Ca(2+) induces mitochondrial production of reactive oxygen species (ROS), in particular superoxide, resulting in severe mitochondrial abnormalities, such as fragmentation and depolarization of membrane potential. These Ca(2+) dysregulation-induced mitochondrial abnormalities and cell death in IRE1α-deficient cells can be blocked by depleting ROS or inhibiting Ca(2+) influx into the mitochondria. These results demonstrate the importance of IRE1α in Ca(2+) homeostasis and cell survival during ER stress and reveal a previously unknown Ca(2+)-mediated cell death signaling between the IRE1α-InsP3R pathway in the ER and the redox-dependent apoptotic pathway in the mitochondrion.

  7. Uronic polysaccharide degrading enzymes.

    Science.gov (United States)

    Garron, Marie-Line; Cygler, Miroslaw

    2014-10-01

    In the past several years progress has been made in the field of structure and function of polysaccharide lyases (PLs). The number of classified polysaccharide lyase families has increased to 23 and more detailed analysis has allowed the identification of more closely related subfamilies, leading to stronger correlation between each subfamily and a unique substrate. The number of as yet unclassified polysaccharide lyases has also increased and we expect that sequencing projects will allow many of these unclassified sequences to emerge as new families. The progress in structural analysis of PLs has led to having at least one representative structure for each of the families and for two unclassified enzymes. The newly determined structures have folds observed previously in other PL families and their catalytic mechanisms follow either metal-assisted or Tyr/His mechanisms characteristic for other PL enzymes. Comparison of PLs with glycoside hydrolases (GHs) shows several folds common to both classes but only for the β-helix fold is there strong indication of divergent evolution from a common ancestor. Analysis of bacterial genomes identified gene clusters containing multiple polysaccharide cleaving enzymes, the Polysaccharides Utilization Loci (PULs), and their gene complement suggests that they are organized to process completely a specific polysaccharide. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Inter- vs intra-individual variation and temporal repeatability of escape responses in the coral reef fish Amblyglyphidodon curacao

    Directory of Open Access Journals (Sweden)

    Maïwenn Jornod

    2015-11-01

    Full Text Available Fast-start escape responses are critical behaviours used by fishes during predator-prey encounters and some interactions with hetero- and conspecifics. In experimental studies, escape responses are often measured once per individual and considered representative of maximum performance. However, few studies have compared variability and repeatability in escape performances within and among individuals. Using the tropical damselfish Amblyglyphidodon curacao, we quantified inter- and intra-individual variation in behavioural and kinematic components of escape performance during repeated presentations of a stimulus at 15 min intervals. Individual maximum escape performance was repeatable through time, but there was considerable variation in the magnitude of responses both among and within fish. We found no evidence of habituation or fatigue due to repeated stimulations, suggesting that fish can be stimulated multiple times to ensure that an accurate estimate of maximum escape performance is obtained.

  9. Eosinophil Granulocytes Account for Indoleamine 2,3-Dioxygenase-Mediated Immune Escape in Human Non Small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Simonetta Astigiano

    2005-04-01

    Full Text Available Indoleamine 2,3-dioxygenase (IDO, a catabolizing enzyme of tryptophan, is supposed to play a role in tumor immune escape. Its expression in solid tumors has not yet been well elucidated: IDO can be expressed by the tumor cells themselves, or by ill-defined infiltrating cells, possibly depending on tumor type. We have investigated IDO expression in 25 cases of non small cell lung cancer (NSCLC. Using histochemistry and immunohistochemistry, we found that IDO was expressed not by tumor cells, but by normal cells infiltrating the peritumoral stroma. These cells were neither macrophages nor dendritic cells, and were identified as eosinophil granulocytes. The amount of IDO-positive eosinophils varied in different cases, ranging from a few cells to more than 50 per field at x200 magnification. IDO protein in NSCLC was enzymatically active. Therefore, at least in NSCLC cases displaying a large amount of these cells in the inflammatory infiltrate, IDO-positive eosinophils could exert an effective immunosuppressive action. On analyzing the 17 patients with adequate follow-up, a significant relationship was found between the amount of IDO-positive infiltrate and overall survival. This finding suggests that the degree of IDO-positive infiltrate could be a prognostic marker in NSCLC.

  10. Carbapenemase producing bacteria in the food supply escaping detection.

    Science.gov (United States)

    Morrison, Beverly J; Rubin, Joseph E

    2015-01-01

    Carbapenem antimicrobials are critically important to human health and they are often the only remaining effective antibiotics for treating serious infections. Resistance to these drugs mediated by acquired carbapenemase enzymes is increasingly encountered in gram-negative bacteria and is considered a public health emergency. Animal origin food products are recognized as a potential source of resistant organisms, although carbapenem resistance has only recently been reported. In western countries there are active resistance surveillance programs targeting food animals and retail meat products. These programs primarily target beef, pork and poultry and focus exclusively on E. coli, Salmonella, Campylobacter spp. and Enterococcus spp. This global surveillance strategy does not capture the diversity of foods available nor does it address the presence of resistance gene-bearing mobile genetic elements in non-pathogenic bacterial taxa. To address this gap, a total of 121 seafood products originating in Asia purchased from retail groceries in Canada were tested. Samples were processed using a taxa-independent method for the selective isolation of carbapenem resistant organisms. Isolates were characterized by phenotypic antimicrobial susceptibility testing, PCR and DNA sequencing. Carbapenemase producing bacteria, all blaOXA-48, were isolated from 4 (3.3%) of the samples tested. Positive samples originated from China (n=2) and Korea (n=2) and included squid, sea squirt, clams and seafood medley. Carbapenemase producing organisms found include Pseudomonas, Stenotrophomonas and Myroides species. These findings suggest that non-pathogenic bacteria, excluded from resistance surveillance programs, in niche market meats may serve as a reservoir of carbapenemase genes in the food supply.

  11. Carbapenemase producing bacteria in the food supply escaping detection.

    Directory of Open Access Journals (Sweden)

    Beverly J Morrison

    Full Text Available Carbapenem antimicrobials are critically important to human health and they are often the only remaining effective antibiotics for treating serious infections. Resistance to these drugs mediated by acquired carbapenemase enzymes is increasingly encountered in gram-negative bacteria and is considered a public health emergency. Animal origin food products are recognized as a potential source of resistant organisms, although carbapenem resistance has only recently been reported. In western countries there are active resistance surveillance programs targeting food animals and retail meat products. These programs primarily target beef, pork and poultry and focus exclusively on E. coli, Salmonella, Campylobacter spp. and Enterococcus spp. This global surveillance strategy does not capture the diversity of foods available nor does it address the presence of resistance gene-bearing mobile genetic elements in non-pathogenic bacterial taxa. To address this gap, a total of 121 seafood products originating in Asia purchased from retail groceries in Canada were tested. Samples were processed using a taxa-independent method for the selective isolation of carbapenem resistant organisms. Isolates were characterized by phenotypic antimicrobial susceptibility testing, PCR and DNA sequencing. Carbapenemase producing bacteria, all blaOXA-48, were isolated from 4 (3.3% of the samples tested. Positive samples originated from China (n=2 and Korea (n=2 and included squid, sea squirt, clams and seafood medley. Carbapenemase producing organisms found include Pseudomonas, Stenotrophomonas and Myroides species. These findings suggest that non-pathogenic bacteria, excluded from resistance surveillance programs, in niche market meats may serve as a reservoir of carbapenemase genes in the food supply.

  12. The calcimimetic R-568 induces apoptotic cell death in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Cheng Guangming

    2009-07-01

    Full Text Available Abstract Background Increased serum level of parathyroid hormone (PTH was found in metastatic prostate cancers. Calcimimetic R-568 was reported to reduce PTH expression, to suppress cell proliferation and to induce apoptosis in parathyroid cells. In this study, we investigated the effect of R-568 on cellular survival of prostate cancer cells. Methods Prostate cancer cell lines LNCaP and PC-3 were used in this study. Cellular survival was determined with MTT, trypan blue exclusion and fluorescent Live/Death assays. Western blot assay was utilized to assess apoptotic events induced by R-568 treatment. JC-1 staining was used to evaluate mitochondrial membrane potential. Results In cultured prostate cancer LNCaP and PC-3 cells, R-568 treatment significantly reduced cellular survival in a dose- and time-dependent manner. R-568-induced cell death was an apoptotic event, as evidenced by caspase-3 processing and PARP cleavage, as well as JC-1 color change in mitochondria. Knocking down calcium sensing receptor (CaSR significantly reduced R-568-induced cytotoxicity. Enforced expression of Bcl-xL gene abolished R-568-induced cell death, while loss of Bcl-xL expression led to increased cell death in R-568-treated LNCaP cells,. Conclusion Taken together, our data demonstrated that calcimimetic R-568 triggers an intrinsic mitochondria-related apoptotic pathway, which is dependent on the CaSR and is modulated by Bcl-xL anti-apoptotic pathway.

  13. High mobility group box 1 skews macrophage polarization and negatively influences phagocytosis of apoptotic cells

    NARCIS (Netherlands)

    Schaper, Fleur; de Leeuw, Karina; Horst, Geesje; Bootsma, Hendrika; Limburg, Pieter C.; Heeringa, Peter; Bijl, Marc; Westra, Johanna

    2016-01-01

    OBJECTIVES: Decreased phagocytosis of apoptotic cells plays an important role in the pathogenesis of SLE. This can lead to secondary necrosis and release of nuclear proteins, such as high mobility group box 1 (HMGB1). We hypothesized that increased HMGB1 levels, as present in SLE, skew macrophage

  14. Role of BK channels in the apoptotic volume decrease in native eel intestinal cells

    DEFF Research Database (Denmark)

    Lionetto, Maria Giulia; Giordano, Maria Elena; Calisi, Antonio

    2010-01-01

    of these channels in the Apoptotic Volume Decrease (AVD) of isolated eel enterocytes, and the possible interaction between BK channels and the progression of apoptosis. The detection of apoptosis was performed by confocal microscopy and annexin V and propidium iodide labelling; cell volume changes were monitored...

  15. Antiproliferative and pro-apoptotic effects of Uncaria tomentosa in human medullary thyroid carcinoma cells.

    Science.gov (United States)

    Rinner, Beate; Li, Zeng Xia; Haas, Helga; Siegl, Veronika; Sturm, Sonja; Stuppner, Hermann; Pfragner, Roswitha

    2009-11-01

    Medullary thyroid carcinoma (MTC), a rare calcitonin-producing tumor, is derived from parafollicular C-cells of the thyroid and is characterized by constitutive Bcl-2 overexpression. The tumor is relatively insensitive to radiation therapy as well as conventional chemotherapy. To date, the only curative treatment is the early and complete surgical removal of all neoplastic tissue. In this study, the antiproliferative and pro-apoptotic effects of fractions obtained from Uncaria tomentosa (Willd.) DC, commonly known as uña de gato or cat's claw were investigated. Cell growth of MTC cells as well as enzymatic activity of mitochondrial dehydrogenase was markedly inhibited after treatment with different fractions of the plant. Furthermore, there was an increase in the expressions of caspase-3 and -7 and poly(ADP-ribose) polymerase (PARP) fraction, while bcl-2 overexpression remained constant. In particular, the alkaloids isopterpodine and pteropodine of U. tomentosa exhibited a significant pro-apoptotic effect on MTC cells, whereas the alkaloid-poor fraction inhibited cell proliferation but did not show any pro-apoptotic effects. These promising results indicate the growth-restraining and apoptotic potential of plant extracts against neuroendocrine tumors, which may add to existing therapies for cancer.

  16. Relationship between apoptotic markers in semen from fertile men and demographic, hormonal and seminal characteristics

    DEFF Research Database (Denmark)

    Specht, Ina; Spanò, Marcello; Hougaard, Karin S

    2012-01-01

    by the World Health Organization. Immunofluorescence coupled to flow cytometry was utilized for detection of apoptotic markers in the sperm cell. DNA damage was assessed by flow cytometry using both the sperm chromatin structure assay (SCSA) and the terminal deoxynucleotidyl transferase dUTP nick end labelling...

  17. Geno protective and anti-apoptotic effect of green tea against ...

    African Journals Online (AJOL)

    Geno protective and anti-apoptotic effect of green tea against perinatal lipopolysaccharide-exposure induced liver toxicity in rat newborns. Ahmed A. Allam, Sami A. Gabr, Jamaan Ajarem, Ahmad H. Alghadir, Revathi Sekar, Billy K.C. Chow ...

  18. Antitumor and apoptotic effects of cucurbitacin a in A-549 lung ...

    African Journals Online (AJOL)

    Background: The main aim of this study was to demonstrate the antitumor potential of cucurbitacin A on A-549 NSCLC (non-small cell lung cancer cells). The effects of Cucurbitacin A on apoptotic induction, cell physic, cell cycle failure and m-TOR/PI3K/Akt signalling pathway were also investigated in the present study.

  19. Evaluation of synergistic anticandidal and apoptotic effects of ferulic acid and caspofungin against Candida albicans.

    Science.gov (United States)

    Canturk, Zerrin

    2018-01-01

    This study aimed to investigate the synergy between anticandidal and apoptotic effects of ferulic acid and caspofungin against Candida albicans and Candida glabrata, with the help of a quantitative checkerboard microdilution assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) as a viability dye. Apoptotic effects of caspofungin and ferulic acid concentrations (alone and combined) were analyzed for C. albicans and C. glabrata based on annexin V-propidium iodide binding capacities using flow cytometric analysis. C. albicans showed a synergistic effect, represented by a fractional inhibitory concentration index of 0.5). Early and late apoptotic effects of caspofungin and ferulic acid concentrations (1 μg/mL and 1000 μg/mL) were calculated as 55.7% and 18.3%, respectively, while their necrotic effects were determined as 5.8% and 51.6%, respectively, using flow cytometric analyses. The apoptotic effects of the combination of caspofungin and ferulic acid at concentrations of 1 μg/mL and 1000 μg/mL on C. albicans and C. glabrata were 73.0% and 48.7%, respectively. Ferulic acid also demonstrated a synergistic effect in combination with caspofungin against C. albicans. Another possibility is to combine the existing anticandidal drug with phytochemicals to enhance the efficacy of anticandidal drug. Copyright © 2017. Published by Elsevier B.V.

  20. Chlamydia pneumoniae hides inside apoptotic neutrophils to silently infect and propagate in macrophages.

    Directory of Open Access Journals (Sweden)

    Jan Rupp

    Full Text Available BACKGROUND: Intracellular pathogens have developed elaborate strategies for silent infection of preferred host cells. Chlamydia pneumoniae is a common pathogen in acute infections of the respiratory tract (e.g. pneumonia and associated with chronic lung sequelae in adults and children. Within the lung, alveolar macrophages and polymorph nuclear neutrophils (PMN are the first line of defense against bacteria, but also preferred host phagocytes of chlamydiae. METHODOLOGY/PRINCIPAL FINDINGS: We could show that C. pneumoniae easily infect and hide inside neutrophil granulocytes until these cells become apoptotic and are subsequently taken up by macrophages. C. pneumoniae infection of macrophages via apoptotic PMN results in enhanced replicative activity of chlamydiae when compared to direct infection of macrophages, which results in persistence of the pathogen. Inhibition of the apoptotic recognition of C. pneumoniae infected PMN using PS- masking Annexin A5 significantly lowered the transmission of chlamydial infection to macrophages. Transfer of apoptotic C. pneumoniae infected PMN to macrophages resulted in an increased TGF-ss production, whereas direct infection of macrophages with chlamydiae was characterized by an enhanced TNF-alpha response. CONCLUSIONS/SIGNIFICANCE: Taken together, our data suggest that C. pneumoniae uses neutrophil granulocytes to be silently taken up by long-lived macrophages, which allows for efficient propagation and immune protection within the human host.

  1. Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...

    African Journals Online (AJOL)

    apoptotic genes, BCL2, Bcl-xL, XIAP and Survivin), in cervical carcinoma cells. Methods: Annexin V-FITC/propidium iodide (PI) staining was used for the investigation of cell apoptosis. RNA RNeasy Kits was used to isolate RNA and Omniscript ...

  2. Evaluation of synergistic anticandidal and apoptotic effects of ferulic acid and caspofungin against Candida albicans

    Directory of Open Access Journals (Sweden)

    Zerrin Canturk

    2018-01-01

    Full Text Available This study aimed to investigate the synergy between anticandidal and apoptotic effects of ferulic acid and caspofungin against Candida albicans and Candida glabrata, with the help of a quantitative checkerboard microdilution assay using 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT as a viability dye. Apoptotic effects of caspofungin and ferulic acid concentrations (alone and combined were analyzed for C. albicans and C. glabrata based on annexin V–propidium iodide binding capacities using flow cytometric analysis. C. albicans showed a synergistic effect, represented by a fractional inhibitory concentration index of 0.5. Early and late apoptotic effects of caspofungin and ferulic acid concentrations (1 μg/mL and 1000 μg/mL were calculated as 55.7% and 18.3%, respectively, while their necrotic effects were determined as 5.8% and 51.6%, respectively, using flow cytometric analyses. The apoptotic effects of the combination of caspofungin and ferulic acid at concentrations of 1 μg/mL and 1000 μg/mL on C. albicans and C. glabrata were 73.0% and 48.7%, respectively. Ferulic acid also demonstrated a synergistic effect in combination with caspofungin against C. albicans. Another possibility is to combine the existing anticandidal drug with phytochemicals to enhance the efficacy of anticandidal drug.

  3. Cloning and analysis of a defender against apoptotic cell death (DAD1) homologue from tomato

    NARCIS (Netherlands)

    Hoeberichts, F.A.; Woltering, E.J.

    2001-01-01

    A cDNA clone homologous to the human defender against apoptotic cell death (DAD1) gene, which is believed to be a conserved inhibitor of programmed cell death, was isolated from tomato (Lycopersicon esculentum cv. Prisca). The 351 basepairs open reading frame predicted a 116 amino acid protein

  4. Antiproliferative and Pro-apoptotic activities of the stem bark of ...

    African Journals Online (AJOL)

    Persea americana (Lauraceae) have been used in traditional medicine for a wide range of illness and some of these uses have been proven scientifically. The aim of this present study is to screen for the phytochemical content, determine the proximate parameter and determine the antiproliferative and apoptotic effects of ...

  5. Modulation of Apoptotic Signaling by the Hepatitis B Virus X Protein

    Directory of Open Access Journals (Sweden)

    Michael J. Bouchard

    2012-11-01

    Full Text Available Worldwide, an estimated 350 million people are chronically infected with the Hepatitis B Virus (HBV; chronic infection with HBV is associated with the development of severe liver diseases including hepatitis and cirrhosis. Individuals who are chronically infected with HBV also have a significantly higher risk of developing hepatocellular carcinoma (HCC than uninfected individuals. The HBV X protein (HBx is a key regulatory HBV protein that is important for HBV replication, and likely plays a cofactor role in the development of HCC in chronically HBV-infected individuals. Although some of the functions of HBx that may contribute to the development of HCC have been characterized, many HBx activities, and their putative roles during the development of HBV-associated HCC, remain incompletely understood. HBx is a multifunctional protein that localizes to the cytoplasm, nucleus, and mitochondria of HBV‑infected hepatocytes. HBx regulates numerous cellular signal transduction pathways and transcription factors as well as cell cycle progression and apoptosis. In this review, we will summarize reports in which the impact of HBx expression on cellular apoptotic pathways has been analyzed. Although various effects of HBx on apoptotic pathways have been observed in different model systems, studies of HBx activities in biologically relevant hepatocyte systems have begun to clarify apoptotic effects of HBx and suggest mechanisms that could link HBx modulation of apoptotic pathways to the development of HBV-associated HCC.

  6. Dynamic release of nuclear RanGTP triggers TPX2-dependent microtubule assembly during the apoptotic execution phase.

    Science.gov (United States)

    Moss, David K; Wilde, Andrew; Lane, Jon D

    2009-03-01

    During apoptosis, the interphase microtubule network is dismantled then later replaced by a novel, non-centrosomal microtubule array. These microtubules assist in the peripheral redistribution of nuclear fragments in the apoptotic cell; however, the regulation of apoptotic microtubule assembly is not understood. Here, we demonstrate that microtubule assembly depends upon the release of nuclear RanGTP into the apoptotic cytoplasm because this process is blocked in apoptotic cells overexpressing dominant-negative GDP-locked Ran (T24N). Actin-myosin-II contractility provides the impetus for Ran release and, consequently, microtubule assembly is blocked in blebbistatin- and Y27632-treated apoptotic cells. Importantly, the spindle-assembly factor TPX2 (targeting protein for Xklp2), colocalises with apoptotic microtubules, and siRNA silencing of TPX2, but not of the microtubule motors Mklp1 and Kid, abrogates apoptotic microtubule assembly. These data provide a molecular explanation for the assembly of the apoptotic microtubule network, and suggest important similarities with the process of RanGTP- and TPX2-mediated mitotic spindle formation.

  7. In vitro evidence for participation of DEC-205 expressed by thymic cortical epithelial cells in clearance of apoptotic thymocytes.

    NARCIS (Netherlands)

    Small, M; Kraal, G.

    2003-01-01

    Binding of apoptotic cells was compared after incubation of thymocytes with two clones of murine thymic stromal cells to which CD4(+)/CD8(+) thymocytes attach. With the BA/10, but not the BA/2, clone, thymocytes with apoptotic morphology were bound irreversibly. These tightly bound thymocytes were

  8. European policymaking on the tobacco advertising ban: the importance of escape routes.

    Science.gov (United States)

    Adamini, Sandra; Versluis, Esther; Maarse, Hans

    2011-01-01

    This article analyses the European Union policymaking process regarding tobacco advertising. While others already highlighted the importance of intergovernmental bargaining between member states to explain the outcome of the tobacco advertising case, the main aim of this article is to identify the use of escape routes by the Commission, the European Parliament, the Council and interest groups that played an important role in overcoming the deadlock. When looking at the different institutions that structure policymaking, we argue that indeed focusing on escape routes provides a clear insight in the process and in what strategies were necessary to 'make Europe work'. In the end, it appears to be a combination of escape routes that resulted in the final decision.

  9. Swimming and escape behavior of copepod nauplii: implications for predator-prey interactions among copepods

    DEFF Research Database (Denmark)

    Titelman, Josefin

    2001-01-01

    This study focuses on how prey behavior may affect predation risk through encounter rates and the escape success of the prey given an encounter. Temora longicornis nauplii require stronger hydrodynamic signals to elicit escape than Acartia tonsa nauplii (critical fluid deformation rates, Delta...... detect: an A. tonsa nauplius at a greater distance than a similarly sized T. longicornis nauplius. Observations of attacks of free swimming C. typicus and the naupliar prey confirmed that T. longicornis is poorer at detecting predators than A. tonsa, and that the same predator detects A. tonsa...... (-1) d(-1)) were ca 3-fold that on A. tonsa nauplii (146 +/- 35 ml female (-1) d(-1)) in both single species and mixed treatments. While the low profile motility behavior of T. longicornis appears to reduce encounter rates, its post encounter (i.e., escape) behavior is less effective. In contrast...

  10. The angular position of a refuge affects escape responses in staghorn sculpin Leptocottus armatus.

    Science.gov (United States)

    Shi, X; Møller, J S; Højgaard, J; Johansen, J L; Steffensen, J F; Liu, D; Domenici, P

    2017-06-01

    The effect of the presence and angular position of a refuge on the direction and kinematics of mechanically-induced escape responses was observed in staghorn sculpins Leptocottus armatus using high-speed video. The results showed that the angular position of the refuge did not affect locomotor performance (speed and acceleration), although it did affect the escape trajectories. Therefore, the angular position of a refuge can modulate the direction taken by the L. armatus during the early stages of their escape response and this response can be affected by both repulsive (i.e. threats) and attractive (i.e. refuges) points of reference. © 2017 The Fisheries Society of the British Isles.

  11. Mathematical modeling of the heat treatment and combustion of a coal particle. III. Volatile escape stage

    Science.gov (United States)

    Enkhjargal, Kh.; Salomatov, V. V.

    2011-05-01

    The present paper is a continuation of previous publications of the authors in this journal in which two phases of the multistage process of combustion of a coal particle were considered in detail with the help of mathematical modeling: its radiation-convection heating and drying. In the present work, the escape dynamics of volatiles is investigated. The physico-mathematical model of the thermodestruction of an individual coal particle with a dominant influence of endothermal effects has been formulated. Approximate-analytical solutions of this model that are of paramount importance for detailed analysis of the influence of the physical and regime parameters on the escape dynamics of volatiles have been found. The results obtained form the basis for engineering calculations of the volatile escape stage and can be used successfully in the search for effective regimes of burning of various solid fuels, in particular, Shivé-Ovoos coal of Mongolia.

  12. Thermoresponsive pegylated bubble liposome nanovectors for efficient siRNA delivery via endosomal escape

    KAUST Repository

    Alamoudi, Kholod

    2017-05-19

    Improving the delivery of siRNA into cancer cells via bubble liposomes. Designing a thermoresponsive pegylated liposome through the introduction of ammonium bicarbonate salt into liposomes so as to control their endosomal escape for gene therapy.A sub-200 nm nanovector was fully characterized and examined for cellular uptake, cytotoxicity, endosomal escape and gene silencing.The siRNA-liposomes were internalized into cancer cells within 5 min and then released siRNAs in the cytosol prior to lysosomal degradation upon external temperature elevation. This was confirmed by confocal bioimaging and gene silencing reaching up to 90% and further demonstrated by the protein inhibition of both target genes.The thermoresponsiveness of ammonium bicarbonate containing liposomes enabled the rapid endosomal escape of the particles and resulted in an efficient gene silencing.

  13. Mitotic cells contract actomyosin cortex and generate pressure to round against or escape epithelial confinement

    Science.gov (United States)

    Sorce, Barbara; Escobedo, Carlos; Toyoda, Yusuke; Stewart, Martin P.; Cattin, Cedric J.; Newton, Richard; Banerjee, Indranil; Stettler, Alexander; Roska, Botond; Eaton, Suzanne; Hyman, Anthony A.; Hierlemann, Andreas; Müller, Daniel J.

    2015-01-01

    Little is known about how mitotic cells round against epithelial confinement. Here, we engineer micropillar arrays that subject cells to lateral mechanical confinement similar to that experienced in epithelia. If generating sufficient force to deform the pillars, rounding epithelial (MDCK) cells can create space to divide. However, if mitotic cells cannot create sufficient space, their rounding force, which is generated by actomyosin contraction and hydrostatic pressure, pushes the cell out of confinement. After conducting mitosis in an unperturbed manner, both daughter cells return to the confinement of the pillars. Cells that cannot round against nor escape confinement cannot orient their mitotic spindles and more likely undergo apoptosis. The results highlight how spatially constrained epithelial cells prepare for mitosis: either they are strong enough to round up or they must escape. The ability to escape from confinement and reintegrate after mitosis appears to be a basic property of epithelial cells. PMID:26602832

  14. NRSA enzyme decomposition model data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Microbial enzyme activities measured at more than 2000 US streams and rivers. These enzyme data were then used to predict organic matter decomposition and microbial...

  15. Early low-titer neutralizing antibodies impede HIV-1 replication and select for virus escape.

    Directory of Open Access Journals (Sweden)

    Katharine J Bar

    Full Text Available Single genome sequencing of early HIV-1 genomes provides a sensitive, dynamic assessment of virus evolution and insight into the earliest anti-viral immune responses in vivo. By using this approach, together with deep sequencing, site-directed mutagenesis, antibody adsorptions and virus-entry assays, we found evidence in three subjects of neutralizing antibody (Nab responses as early as 2 weeks post-seroconversion, with Nab titers as low as 1∶20 to 1∶50 (IC(50 selecting for virus escape. In each of the subjects, Nabs targeted different regions of the HIV-1 envelope (Env in a strain-specific, conformationally sensitive manner. In subject CH40, virus escape was first mediated by mutations in the V1 region of the Env, followed by V3. HIV-1 specific monoclonal antibodies from this subject mapped to an immunodominant region at the base of V3 and exhibited neutralizing patterns indistinguishable from polyclonal antibody responses, indicating V1-V3 interactions within the Env trimer. In subject CH77, escape mutations mapped to the V2 region of Env, several of which selected for alterations of glycosylation. And in subject CH58, escape mutations mapped to the Env outer domain. In all three subjects, initial Nab recognition was followed by sequential rounds of virus escape and Nab elicitation, with Nab escape variants exhibiting variable costs to replication fitness. Although delayed in comparison with autologous CD8 T-cell responses, our findings show that Nabs appear earlier in HIV-1 infection than previously recognized, target diverse sites on HIV-1 Env, and impede virus replication at surprisingly low titers. The unexpected in vivo sensitivity of early transmitted/founder virus to Nabs raises the possibility that similarly low concentrations of vaccine-induced Nabs could impair virus acquisition in natural HIV-1 transmission, where the risk of infection is low and the number of viruses responsible for transmission and productive clinical

  16. Generalized Jeans' Escape of Pick-Up Ions in Quasi-Linear Relaxation

    Science.gov (United States)

    Moore, T. E.; Khazanov, G. V.

    2011-01-01

    Jeans escape is a well-validated formulation of upper atmospheric escape that we have generalized to estimate plasma escape from ionospheres. It involves the computation of the parts of particle velocity space that are unbound by the gravitational potential at the exobase, followed by a calculation of the flux carried by such unbound particles as they escape from the potential well. To generalize this approach for ions, we superposed an electrostatic ambipolar potential and a centrifugal potential, for motions across and along a divergent magnetic field. We then considered how the presence of superthermal electrons, produced by precipitating auroral primary electrons, controls the ambipolar potential. We also showed that the centrifugal potential plays a small role in controlling the mass escape flux from the terrestrial ionosphere. We then applied the transverse ion velocity distribution produced when ions, picked up by supersonic (i.e., auroral) ionospheric convection, relax via quasi-linear diffusion, as estimated for cometary comas [1]. The results provide a theoretical basis for observed ion escape response to electromagnetic and kinetic energy sources. They also suggest that super-sonic but sub-Alfvenic flow, with ion pick-up, is a unique and important regime of ion-neutral coupling, in which plasma wave-particle interactions are driven by ion-neutral collisions at densities for which the collision frequency falls near or below the gyro-frequency. As another possible illustration of this process, the heliopause ribbon discovered by the IBEX mission involves interactions between the solar wind ions and the interstellar neutral gas, in a regime that may be analogous [2].

  17. Escape of O(3P), O(1D), and O(1S) from the Martian atmosphere

    Science.gov (United States)

    Fox, Jane L.; Hać, Aleksander B.

    2018-01-01

    We have computed here the escape probabilities, fluxes and rates for hot O atoms that are initially produced in the ground state and the first two excited metastable states, O(1D)and O(1S), in the Martian thermosphere by dissociative recombination of O2+. In order to compare our results with those of our previous calculations and with those of others, we have employed here the pre-MAVEN models that we have used previously. To compute the escape probabilities, we have employed the Monte Carlo escape code that has been described previously, but we here use for the first time energy-dependent elastic cross sections for collisions of the energetic O atoms with each of the twelve background species in our model. We also incorporate three mechanisms that interchange identities of the O(3P) and O(1D) atoms, including collisional excitation of O(3P) to O(1D), quenching of O(1D) to O(3P), and excitation exchange of O(1D) with O(3P). We find that the escape probabilities of O atoms that are produced initially as O(1D) are reduced compared to those in which these processes are not included, but the escape probabilities of O atoms that are initially produced as O(3P) are not significantly reduced. As a guide for our future research and those of other investigators, we review here what is known about the interactions of O atoms with other species in which the energies of the O atoms are altered, and several other sources of hot and escaping O, many of which have been suggested by other investigators. We will incorporate these data in a future MAVEN-like model.

  18. Estimates of N2 narcosis and O2 toxicity during submarine escapes from 600 to 1,000 fsw.

    Science.gov (United States)

    Connor, Christopher W; Ferrigno, Massimo

    2009-01-01

    The U.S. Navy recommends submarine escape for depths down to 600 fsw, with deeper escapes entailing the risks of decompression sickness, nitrogen (N2) narcosis and CNS oxygen (O2) toxicity. However, the escape equipment, including the submarine escape and immersion equipment and the escape trunk, could probably function even at 1,000 fsw. Here we report a theoretical analysis of the risks of both N2 narcosis and CNS O2 toxicity for different escape profiles from 600 to 1,000 fsw. The effect of N2 narcosis, calculated as a function of N2 pressure in the brain using Gas Man software, was expressed as equivalent narcosis depth (END), corresponding to the depth at which the same pressure of N2 would be produced in the brain after five minutes of scuba diving with air. The risk of O2-induced convulsions was estimated using the model developed by Arieli et al. Different dwell times (DTs) at maximal pressure in the escape trunk (from 0 to 60 s) and lungs-to-brain circulation times (10 to 30 s) were included in our analysis. When DT in the escape trunk is very short (e.g., 10 s), the risk of either incapacitating N2 narcosis and/or O2-induced convulsions occurring in the trunk is low, even during escapes from 1,000 fsw.

  19. Apoptotic circulating tumor cells in early and metastatic breast cancer patients.

    Science.gov (United States)

    Kallergi, Galatea; Konstantinidis, Georgios; Markomanolaki, Harris; Papadaki, Maria A; Mavroudis, Dimitris; Stournaras, Christos; Georgoulias, Vassilis; Agelaki, Sofia

    2013-09-01

    The detection of circulating tumor cells (CTC) in breast cancer is strongly associated with disease relapse. Since it is unclear whether all CTCs are capable of generating metastasis, we investigated their apoptotic and proliferative status in 56 CTC-positive (29 early and 27 metastatic) patients with breast cancer. Double-staining immunofluorescence experiments were carried out in peripheral blood mononuclear cells (PBMC) cytospins, using the pancytokeratin A45-B/B3 antibody and either M30 (apoptotic marker) or Ki67 (proliferation marker) antibodies. Apoptosis was also evaluated using a polycaspase detection kit. Patients with metastatic disease had significantly lower numbers of apoptotic CTCs compared with patients with early breast cancer (polycaspase kit: 8.1% vs. 47.4% of the total CTC number; P = 0.0001; M30-antibody: 32.1% vs. 76.63%; P = 0.002). The median percentage of apoptotic CTCs per patient was also lower in patients with advanced compared with those with early disease (polycaspase kit: 0% vs. 53.6%; M30-antibody: 15% vs. 80%). Ki67-positive CTCs were identified in 51.7% and 44% of patients with early and metastatic disease, respectively. Adjuvant chemotherapy reduced both the number of CTCs per patient and the number of proliferating CTCs (63.9% vs. 30%). In conclusion, apoptotic CTCs could be detected in patients with breast cancer irrespective of their clinical status, though the incidence of detection is higher in early compared with metastatic patients. The detection of CTCs that survive despite adjuvant therapy implies that CTC elimination should be attempted using agents targeting their distinctive molecular characteristics.

  20. New insights into the apoptotic process in mollusks: characterization of caspase genes in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Alejandro Romero

    2011-02-01

    Full Text Available Apoptosis is an essential biological process in the development and maintenance of immune system homeostasis. Caspase proteins constitute the core of the apoptotic machinery and can be categorized as either initiators or effectors of apoptosis. Although the genes encoding caspase proteins have been described in vertebrates and in almost all invertebrate phyla, there are few reports describing the initiator and executioner caspases or the modulation of their expression by different stimuli in different apoptotic pathways in bivalves. In the present work, we characterized two initiator and four executioner caspases in the mussel Mytilus galloprovincialis. Both initiators and executioners showed structural features that make them different from other caspase proteins already described. Evaluation of the genes' tissue expression patterns revealed extremely high expression levels within the gland and gills, where the apoptotic process is highly active due to the clearance of damaged cells. Hemocytes also showed high expression values, probably due to of the role of apoptosis in the defense against pathogens. To understand the mechanisms of caspase gene regulation, hemocytes were treated with UV-light, environmental pollutants and pathogen-associated molecular patterns (PAMPs and apoptosis was evaluated by microscopy, flow cytometry and qPCR techniques. Our results suggest that the apoptotic process could be tightly regulated in bivalve mollusks by overexpression/suppression of caspase genes; additionally, there is evidence of caspase-specific responses to pathogens and pollutants. The apoptotic process in mollusks has a similar complexity to that of vertebrates, but presents unique features that may be related to recurrent exposure to environmental changes, pollutants and pathogens imposed by their sedentary nature.

  1. Barium inhibits arsenic-mediated apoptotic cell death in human squamous cell carcinoma cells.

    Science.gov (United States)

    Yajima, Ichiro; Uemura, Noriyuki; Nizam, Saika; Khalequzzaman, Md; Thang, Nguyen D; Kumasaka, Mayuko Y; Akhand, Anwarul A; Shekhar, Hossain U; Nakajima, Tamie; Kato, Masashi

    2012-06-01

    Our fieldwork showed more than 1 μM (145.1 μg/L) barium in about 3 μM (210.7 μg/L) arsenic-polluted drinking well water (n = 72) in cancer-prone areas in Bangladesh, while the mean concentrations of nine other elements in the water were less than 3 μg/L. The types of cancer include squamous cell carcinomas (SCC). We hypothesized that barium modulates arsenic-mediated biological effects, and we examined the effect of barium (1 μM) on arsenic (3 μM)-mediated apoptotic cell death of human HSC-5 and A431 SCC cells in vitro. Arsenic promoted SCC apoptosis with increased reactive oxygen species (ROS) production and JNK1/2 and caspase-3 activation (apoptotic pathway). In contrast, arsenic also inhibited SCC apoptosis with increased NF-κB activity and X-linked inhibitor of apoptosis protein (XIAP) expression level and decreased JNK activity (antiapoptotic pathway). These results suggest that arsenic bidirectionally promotes apoptotic and antiapoptotic pathways in SCC cells. Interestingly, barium in the presence of arsenic increased NF-κB activity and XIAP expression and decreased JNK activity without affecting ROS production, resulting in the inhibition of the arsenic-mediated apoptotic pathway. Since the anticancer effect of arsenic is mainly dependent on cancer apoptosis, barium-mediated inhibition of arsenic-induced apoptosis may promote progression of SCC in patients in Bangladesh who keep drinking barium and arsenic-polluted water after the development of cancer. Thus, we newly showed that barium in the presence of arsenic might inhibit arsenic-mediated cancer apoptosis with the modulation of the balance between arsenic-mediated promotive and suppressive apoptotic pathways.

  2. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutated (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.

  3. The apoptotic effect of simvastatin via the upregulation of BIM in nonsmall cell lung cancer cells.

    Science.gov (United States)

    Lee, Hwa Young; Kim, In Kyoung; Lee, Hye In; Mo, Jin Young; Yeo, Chang Dong; Kang, Hyeon Hui; Moon, Hwa Sik; Lee, Sang Haak

    2016-01-01

    Statins are known to have pleiotropic effects that induce cell death in certain cancer cells. BIM is a member of the bcl-2 gene family, which promotes apoptotic cell death. This study investigated the hypothesis that simvastatin has pro-apoptotic effects in epidermal growth factor receptor (EGFR)-mutated lung cancer cell lines via the upregulation of the expression of the BIM protein. The cytotoxic effects of simvastatin on gefitinib-sensitive (HCC827, E716-A750del) and -resistant (H1975, T790M + L858R) nonsmall cell lung cancer (NSCLC) cells were compared. Cell proliferation and expression of apoptosis-related and EGFR downstream signaling proteins were evaluated. Expression of BIM was compared in H1975 cells after treatment with simvastatin or gefitinib. SiRNA-mediated BIM depletion was performed to confirm whether the cytotoxicity of simvastatin was mediated by the expression of BIM. H1975 cells showed significantly reduced viability compared with HCC827 cells after treatment with simvastatin (2 μM) for 48 hours. In simvastatin-treated H1975 cells, expression of pro-apoptotic proteins was increased and the phosphorylation of ERK 1/2 (p-ERK 1/2) was reduced. Expression of BIM was suppressed by gefitinib (1 μM) treatment in H1975 cells, but it was significantly increased by treatment with simvastatin. BIM depletion by siRNA transfection enhanced the viability of H1975 cells that received simvastatin treatment and increased their expression of anti-apoptotic proteins. Simvastatin restored the expression of BIM to induce apoptotic cell death in NSCLC cells harboring an EGFR-resistant mutation. Our study suggests the potential utility of simvastatin as a BIM-targeted treatment for NSCLC.

  4. Four-channel ZnS scintillator measurements of escaping tritons in TFTR

    Energy Technology Data Exchange (ETDEWEB)

    Zweben, S.J.

    1988-10-01

    A four-channel scintillation detector capable of measuring tritons, protons, and alphas escaping from a tokamak plasma was operated during the 1986 run period of the Tokamak Fusion Test Reactor (TFTR). Signals consistent with the expected 1 MeV triton behavior have been observed during deuterium operation. Backgrounds associated with neutrons, gammas, and soft x-rays have been evaluated in situ. Such a detector should be capable of measuring escaping alphas during the D/T phase of TFTR. 16 refs., 10 figs.

  5. Marketing Plan for a Mobile Game’s Launch, Case: Oddwings Escape

    OpenAIRE

    Fondem, Julius

    2015-01-01

    Tämän opinnäytetyön toimeksiantaja on Small Giant Games Oy, joka on helsinkiläinen mobiilipelien kehittäjä. Yritys on julkaisemassa ensimmäisen pelinsä nimeltään Oddwings Escape kevään 2015 aikana. Oddwings Escape on mobiilipeli, jossa lennetään erilaisilla otuksilla läpi haastavien tasojen. Opinnäytetyön aihe valikoitui, kun tekijä sai tilaisuuden työskennellä pelin julkaisun markkinoinnin parissa. Opinnäytetyön tavoitteena oli tehdä markkinointisuunnitelma pelin julkaisua varten ja tote...

  6. Rejecting escape events in large volume Ge detectors by a pulse shape selection procedure

    Energy Technology Data Exchange (ETDEWEB)

    Del Zoppo, A. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy)); Agodi, C. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy)); Alba, R. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy)); Bellia, G. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy) Dipartimento di Fisica dell' Universita, Catania (Italy)); Coniglione, R. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy)); Loukachine, K. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy)); Maiolino, C. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy)); Migneco, E. (Istituto Nazionale di Fisica Nucleare - Laboratorio Nazionale del Sud, Catania (Italy) Dipartimento di Fisica dell' Universita, Catania (Italy)); Piattelli, P. (Istituto Nazionale di Fisica Nucleare - Labora

    1993-10-01

    The dependence of the response to [gamma]-rays of a large volume Ge detector on the interval width of a selected initial rise pulse slope is investigated. The number of escape events associated with a small pulse slope is found to be greater than the corresponding number of full energy events. An escape event rejection procedure based on the observed correlation between energy deposition and pulse shape is discussed. Such a procedure seems particularly suited for the design of highly granular large volume Ge detector arrays. (orig.)

  7. Rejecting escape events in large volume Ge detectors by a pulse shape selection procedure

    International Nuclear Information System (INIS)

    Del Zoppo, A.; Agodi, C.; Alba, R.; Bellia, G.; Coniglione, R.; Loukachine, K.; Maiolino, C.; Migneco, E.; Piattelli, P.; Santonocito, D.; Sapienza, P.

    1993-01-01

    The dependence of the response to γ-rays of a large volume Ge detector on the interval width of a selected initial rise pulse slope is investigated. The number of escape events associated with a small pulse slope is found to be greater than the corresponding number of full energy events. An escape event rejection procedure based on the observed correlation between energy deposition and pulse shape is discussed. Such a procedure seems particularly suited for the design of highly granular large volume Ge detector arrays. (orig.)

  8. Four-channel ZnS scintillator measurements of escaping tritons in TFTR

    International Nuclear Information System (INIS)

    Zweben, S.J.

    1988-10-01

    A four-channel scintillation detector capable of measuring tritons, protons, and alphas escaping from a tokamak plasma was operated during the 1986 run period of the Tokamak Fusion Test Reactor (TFTR). Signals consistent with the expected 1 MeV triton behavior have been observed during deuterium operation. Backgrounds associated with neutrons, gammas, and soft x-rays have been evaluated in situ. Such a detector should be capable of measuring escaping alphas during the D/T phase of TFTR. 16 refs., 10 figs

  9. Effects of stressor predictability on escape learning and sleep in mice.

    Science.gov (United States)

    Machida, Mayumi; Yang, Linghui; Wellman, Laurie L; Sanford, Larry D

    2013-03-01

    Controllable stress, modeled by escapable shock (ES), can produce significant alterations in post-stress sleep, including increased rapid eye movement (REM) sleep. Recent work has demonstrated that post-stress sleep may be influenced by stressor predictability, modeled by predictive auditory cues. In this study, we trained mice with ES, either signaled (SES) or unsignaled (UES) by auditory cues, and investigated the effects of predictability on escape learning and sleep associated with ES. Adult male BALB/cJ mice were implanted for recording electroencephalography and activity via telemetry. After the mice recovered from surgery, baseline sleep recordings were obtained. The mice were then randomly assigned to SES and UES conditions. Both groups had control over the duration of footshocks (0.5 mA; 5.0 sec maximum duration) by moving to the non-occupied chamber in a shuttlebox. SES mice were presented tones (90 dB, 2 kHz, 10 sec maximum duration) that started 5.0 sec prior to and co-terminated with footshocks. UES mice were presented identical tones that were not synchronized to shock presentation. ES training continued for 2 consecutive days (EST1 and EST2) with 20 footshock presentations (1 min inter-stimulus intervals). Seven days after EST2, the animals were re-exposed to the training chamber (context) alone for 30 min. Escape latency was used to determine successful or unsuccessful escape learning. Sleep was scored for 20 h for baseline and on each treatment day. Freezing in the training context was scored as a behavioral index of fear. Nine of 14 SES mice successfully learned escape (SESl), and 5 failed to learn escape (SESf). Compared with baseline, SESl mice, but not SESf mice, showed significantly increased post-shock REM. All UES mice learned escape and showed enhanced post-shock REM. Freezing and sleep did not differ among groups on the context re-exposure day. The results indicate that information available in a stressful situation can affect an animal

  10. Tumor suppressor genes that escape from X-inactivation contribute to cancer sex bias

    OpenAIRE

    Dunford, Andrew; Weinstock, David M.; Savova, Virginia; Schumacher, Steven E.; Cleary, John P.; Yoda, Akinori; Sullivan, Timothy J.; Hess, Julian M.; Gimelbrant, Alexander A.; Beroukhim, Rameen; Lawrence, Michael S.; Getz, Gad; Lane, Andrew A.

    2016-01-01

    There is a striking and unexplained male predominance across many cancer types. A subset of X chromosome (chrX) genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative “Escape from X-Inactivation Tumor Suppressor” (EXITS) genes, we compared somatic alterations from >4100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) chrX genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) ...

  11. Increased transcapillary escape rate of albumin in patients with cirrhosis of the liver

    DEFF Research Database (Denmark)

    Parving, H H; Ranek, L; Lassen, N A

    1977-01-01

    The transcapillary escape rate of albumin (TERalb), i.e. the fraction of intravascular mass of albumin that passes to the extravascular space per unit time, was determined from the disappearance of intravenously injected 125I-labelled human serum albumin during the first 60 min after injection...... was only moderately reduced. The transcapillary escape rate of albumin was significantly elevated in all the cirrhotics, mean 10.2%/h, range 8.8 to 12.3%/h, in comparison to values for twenty-eight normal subjects 5.4%/h, range 3.5-7.2%/h. Our results can best be explained by increased filtration out...

  12. Rural-Urban Differences in Escape Behavior of European Birds across a Latitudinal Gradient

    Directory of Open Access Journals (Sweden)

    Diogo S. M. Samia

    2017-06-01

    Full Text Available Behavioral adjustment is a key factor that facilitates species' coexistence with humans in a rapidly urbanizing world. Because urban animals often experience reduced predation risk compared to their rural counterparts, and because escape behavior is energetically costly, we expect that urban environments will select for increased tolerance to humans. Many studies have supported this expectation by demonstrating that urban birds have reduced flight initiation distance (FID = predator-prey distance when escape by the prey begins than rural birds. Here, we advanced this approach and, for the first time, assessed how 32 species of birds, found in 92 paired urban-rural populations, along a 3,900 km latitudinal gradient across Europe, changed their predation risk assessment and escape strategy as a function of living in urban areas. We found that urban birds took longer than rural birds to be alerted to human approaches, and urban birds tolerated closer human approach than rural birds. While both rural and urban populations took longer to become aware of an approaching human as latitude increased, this behavioral change with latitude is more intense in urban birds (for a given unit of latitude, urban birds increased their pre-detection distance more than rural birds. We also found that as mean alert distance was shorter, urban birds escaped more quickly from approaching humans, but there was no such a relationship in rural populations. Although, both rural and urban populations tended to escape more quickly as latitude increased, urban birds delayed their escape more at low latitudes when compared with rural birds. These results suggest that urban birds in Europe live under lower predation risk than their rural counterparts. Furthermore, the patterns found in our study indicate that birds prioritize the reduction of on-going monitoring costs when predation risk is low. We conclude that splitting escape variables into constituent components may provide

  13. The Catalytic Function of Enzymes.

    Science.gov (United States)

    Splittgerber, Allan G.

    1985-01-01

    Discusses: structure of the enzyme molecule; active site; reaction mechanism; transition state; factors affecting enzyme reaction rates, concentration of enzyme; concentration of substrate; product concentration; temperature effects and pH effects; factors causing a lowering of activation energy; proximity and orientation effects; substrate strain…

  14. Enzymes as Sensors.

    Science.gov (United States)

    Staiano, Maria; Pennacchio, Angela; Varriale, Antonio; Capo, Alessandro; Majoli, Adelia; Capacchione, Clotilde; D'Auria, Sabato

    2017-01-01

    Over the last few decades the development of new technologies, the fabrication of new materials, and the introduction of nanotechnologies created new trends in a series of advances that produced innovations in biological sensing devices with a wide range of application from health, security, defense, food, and medicine, to the environment. Specificity, low cost, rapidity, sensitivity, and multiplicity are some of the reasons for their growth, and their commercial success is expected to increase in the next future. Biosensors are devices in which the recognition part of the target molecule is accomplished by biological macromolecules such as proteins, enzymes, antibodies, aptamers, etc. These biomolecules are able to bind to the target molecules with high selectivity and specificity. The interaction between the target molecule and the specific biomolecule is reflected as a change of the biomolecule structural features. The extent of this change is strictly related to the biosensor response. Fluorescence spectroscopy, due to its sensitivity, is often used as the principal technique to monitor biological interactions, and thus the biosensor response as well. Both the intrinsic ultraviolet fluorescence of protein, arising from aromatic amino acids (tryptophan, tyrosine, and phenylalanine), and extrinsic fluorescent labels emitting in the visible region of the spectrum together allow for very flexible transduction of the analyte recognition, suitable for many different applications. This chapter focuses special attention on enzymes as practically unmatched recognition elements for biosensors and emphasizes the potential advantages of customized biosensor devices using apo- or holo forms of enzymes also isolated from thermophile sources. © 2017 Elsevier Inc. All rights reserved.

  15. Protein Crystal Malic Enzyme

    Science.gov (United States)

    1992-01-01

    Malic Enzyme is a target protein for drug design because it is a key protein in the life cycle of intestinal parasites. After 2 years of effort on Earth, investigators were unable to produce any crystals that were of high enough quality and for this reason the structure of this important protein could not be determined. Crystals obtained from one STS-50 were of superior quality allowing the structure to be determined. This is just one example why access to space is so vital for these studies. Principal Investigator is Larry DeLucas.

  16. Antagonism between apoptotic (Bax/Bcl-2) and anti-apoptotic (IAP) signals in human osteoblastic cells under vector-averaged gravity condition.

    Science.gov (United States)

    Nakamura, Hiroshi; Kumei, Yasuhiro; Morita, Sadao; Shimokawa, Hitoyata; Ohya, Keiichi; Shinomiya, Kenichi

    2003-12-01

    A functional disorder associated with weightlessness is well documented in osteoblasts. The apototic features of this disorder are poorly understood. Harmful stress induces apoptosis in cells via mitochondria and/or Fas. The Bax triggers cytochrome c release from mitochondria, which can be blocked by the Bcl-2. Released cytochrome c then activates the initiator caspase, caspase-9, which can be blocked by the anti-apototic (IAP) family of molecules. The effector caspase, caspase-3, finally exerts DNA fragmentation. We conducted this study to examine the apoptotic effects of vector-averaged gravity on normal human osteoblastic cells. Cell culture flasks were incubated on the clinostat, which generated vector-averaged gravity condition (simulated microgravity) for 12, 24, 48, and 96 hours. Upon termination of clinostat cultures, the cell number and cell viability were assessed. DNA fragmentation was analyzed on the agarose-gel electrophoresis. The mRNA levels for Bax, Bcl-2, XIAP, and caspase-3 genes were analyzed by semi-quantitative RT-PCR. Twenty-four hours after starting clinostat rotation, the ratios of Bax/Bcl-2 mRNA levels (indicator of apoptosis) were significantly increased to 136% of the 1G static controls. However, the XIAP mRNA levels (anti-apoptotic molecule) were increased concomitantly to 138% of the 1G static controls. Thus, cell proliferation or cell viability was not affected by vector-averaged gravity. DNA fragmentation was not observed in clinostat group as well as in control group. Finally, the caspase-3 mRNA levels were not affected by vector-averaged gravity. Simulated microgravity might modulate some apoptotic signals upstream the mitochondrial pathway.

  17. Quantifying factors determining the rate of CTL escape and reversion during acute and chronic phases of HIV infection

    Energy Technology Data Exchange (ETDEWEB)

    Ganusov, Vitaly V [Los Alamos National Laboratory; Korber, Bette M [Los Alamos National Laboratory; Perelson, Alan S [Los Alamos National Laboratory

    2009-01-01

    Human immunodeficiency virus (HIV) often evades cytotoxic T cell (CTL) responses by generating variants that are not recognized by CTLs. However, the importance and quantitative details of CTL escape in humans are poorly understood. In part, this is because most studies looking at escape of HIV from CTL responses are cross-sectional and are limited to early or chronic phases of the infection. We use a novel technique of single genome amplification (SGA) to identify longitudinal changes in the transmitted/founder virus from the establishment of infection to the viral set point at 1 year after the infection. We find that HIV escapes from virus-specific CTL responses as early as 30-50 days since the infection, and the rates of viral escapes during acute phase of the infection are much higher than was estimated in previous studies. However, even though with time virus acquires additional escape mutations, these late mutations accumulate at a slower rate. A poor correlation between the rate of CTL escape in a particular epitope and the magnitude of the epitope-specific CTL response suggests that the lower rate of late escapes is unlikely due to a low efficacy of the HIV-specific CTL responses in the chronic phase of the infection. Instead, our results suggest that late and slow escapes are likely to arise because of high fitness cost to the viral replication associated with such CTL escapes. Targeting epitopes in which virus escapes slowly or does not escape at all by CTL responses may, therefore, be a promising direction for the development of T cell based HIV vaccines.

  18. Copper induced immunotoxicity promote differential apoptotic pathways in spleen and thymus

    International Nuclear Information System (INIS)

    Mitra, Soham; Keswani, Tarun; Ghosh, Nabanita; Goswami, Suranjana; Datta, Anuradha; Das, Salomie; Maity, Subhajit; Bhattacharyya, Arindam

    2013-01-01

    Highlights: ► Copper-induced ROS generation and mitochondrial trans-membrane potential changes result in different consequences in spleen and thymus. ► Inflammation appeared in both the spleen and thymus after to copper treatment. ► Apoptosis in the spleen appears to follow a p53-independent pathway. ► Apoptosis in the thymus appears to follow a p53-dependent intrinsic and extrinsic pathway. ► In both the spleen and thymus, the CD4+ T cell population decreased and CD8+ T cell population increased after copper treatment. - Abstract: Inorganic copper, such as that in drinking water and copper supplements, largely bypasses the liver and enters the free copper pool of the blood directly and that promote immunosuppression. Nevertheless, the signaling pathways underlying copper-induced immune cell death remains largely unclear. According to our previous in vivo report, to evaluate the further details of the apoptotic mechanism, we have investigated how copper regulates apoptotic pathways in spleen and thymus. We have analyzed different protein expression by western blotting and immunohistochemistry and mRNA expression by RT-PCR and gel electrophoresis. We also have measured mitochondrial trans-membrane potential, ROS and CD4 + and CD8 + population by flow cytometry. Sub lethal doses of copper in spleen and thymus of in vivo Swiss albino mice promote different apoptotic pathways. In case of spleen, ROS generation and mitochondrial trans-membrane potential changes promotes intrinsic pathway of apoptosis that was p53 independent, ultimately leads to decrease in CD4 + T cell population and increase in CD8 + T cell population. However in case of thymus, ROS generation and mitochondrial trans-membrane potential changes lead to death receptor that regulate extrinsic and intrinsic pathways of apoptosis and the apoptotic mechanism which was p53 dependent. Due to copper treatment, thymic CD4 + T cell population decreased and CD8 + T cell population was increased or

  19. Using Stimulus Fading without Escape Extinction to Increase Compliance with Toothbrushing in Children with Autism

    Science.gov (United States)

    Bishop, Michele R.; Kenzer, Amy L.; Coffman, Christine M.; Tarbox, Courtney M.; Tarbox, Jonathan; Lanagan, Taira M.

    2013-01-01

    Routine toothbrushing is an essential part of good oral hygiene. This study investigated the use of stimulus fading without escape extinction to increase compliance with toothbrushing with three children with autism spectrum disorder (ASD). A 30-step stimulus fading hierarchy was implemented; gradually increasing the proximity of the toothbrush to…

  20. Identification of a peptide-pheromone that enhances Listeria monocytogenes escape from host cell vacuoles.

    Science.gov (United States)

    Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E

    2015-03-01

    Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol.

  1. Escaping Poverty: Rural Low-Income Mothers' Opportunity to Pursue Post-Secondary Education

    Science.gov (United States)

    Woodford, Michelle; Mammen, Sheila

    2010-01-01

    Using human capital theory, this paper identifies the factors that may affect the opportunity for rural low-income mothers to pursue post-secondary education or training in order to escape poverty. Dependent variables used in the logistic regression model included micro-level household variables as well as the effects of state-wide welfare…

  2. Queer(y)ing and Recrafting Agency: Moving Away from a Model of Coercion versus Escape

    Science.gov (United States)

    Gowlett, Christina

    2014-01-01

    This paper applies a Butlerian-inspired "queer(y)ing" methodology to disrupt the utility of agency being framed within the binary of escape and coercion. In particular, it uses Butler's concept of performative resignification to analyse how Simon, a 16-year-old white male student, maneouvres his way through the social conventions of…

  3. Race as/and the Trace of the Ghost: Jurisprudential Escapism ...

    African Journals Online (AJOL)

    Secondly, how the escape from those legal texts evinces, or perhaps even facilitated, a certain evasion of, or anxiety towards the horizontal application of the Bill of Rights which explicitly proscribes overt (racial) discrimination by private non-state actors. And thirdly, how by following a formalist legal approach, one in which ...

  4. HIV-1 can escape from RNA interference by evolving an alternative structure in its RNA genome

    NARCIS (Netherlands)

    Westerhout, Ellen M.; Ooms, Marcel; Vink, Monique; Das, Atze T.; Berkhout, Ben

    2005-01-01

    HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. However, HIV-1 escape variants emerged after prolonged culturing. These RNAi-resistant viruses contain nucleotide substitutions or deletions in or near the targeted sequence. We observed

  5. Pleiotropic effects of hemagglutinin amino acid substitutions of H5 influenza escape mutants

    Energy Technology Data Exchange (ETDEWEB)

    Rudneva, Irina A.; Timofeeva, Tatiana A.; Ignatieva, Anna V.; Shilov, Aleksandr A.; Krylov, Petr S. [D.I. Ivanovsky Institute of Virology, 123098 Moscow (Russian Federation); Ilyushina, Natalia A., E-mail: Natalia.Ilyushina@fda.hhs.gov [FDA CDER, 29 Lincoln Drive, Bethesda, MD 20892 (United States); Kaverin, Nikolai V., E-mail: nik.kaverin@gmail.com [D.I. Ivanovsky Institute of Virology, 123098 Moscow (Russian Federation)

    2013-12-15

    In the present study we assessed pleiotropic characteristics of the antibody-selected mutations. We examined pH optimum of fusion, temperatures of HA heat inactivation, and in vitro and in vivo replication kinetics of the previously obtained influenza H5 escape mutants. Our results showed that HA1 N142K mutation significantly lowered the pH of fusion optimum. Mutations of the escape mutants located in the HA lateral loop significantly affected H5 HA thermostability (P<0.05). HA changes at positions 131, 144, 145, and 156 and substitutions at positions 131, 142, 145, and 156 affected the replicative ability of H5 escape mutants in vitro and in vivo, respectively. Overall, a co-variation between antigenic specificity and different HA phenotypic properties has been demonstrated. We believe that the monitoring of pleiotropic effects of the HA mutations found in H5 escape mutants is essential for accurate prediction of mutants with pandemic potential. - Highlights: • HA1 N142K mutation significantly lowered the pH of fusion optimum. • Mutations located in the HA lateral loop significantly affected H5 HA thermostability. • HA changes at positions 131, 142, 144, 145, and 156 affected the replicative ability of H5 mutants. • Acquisition of glycosylation site could lead to the emergence of multiple pleiotropic effects.

  6. How long do offenders escape arrest? Using DNA traces to analyse when serial offenders are caught

    NARCIS (Netherlands)

    Lammers, M.; Bernasco, W.; Elffers, H.

    2012-01-01

    Keywords:clearance;serial offenders;DNA traces;unidentified offenders;Cox proportional hazards model;hazard ratio Abstract Why is it that some serial offenders are arrested quickly and others only after a long period, or never at all? What characterises offenders who continue to escape arrest

  7. A New Window into Escaping Exoplanet Atmospheres: 10830 Å Line of Helium

    Science.gov (United States)

    Oklopčić, Antonija; Hirata, Christopher M.

    2018-03-01

    Observational evidence for escaping exoplanet atmospheres has been obtained for a few exoplanets to date. It comes from strong transit signals detected in the ultraviolet, most notably in the wings of the hydrogen Lyα (Lyα) line. However, the core of the Lyα line is often heavily affected by interstellar absorption and geocoronal emission, limiting the information about the atmosphere that can be extracted from that part of the spectrum. Transit observations in atomic lines that are (a) sensitive enough to trace the rarefied gas in the planetary wind and (b) do not suffer from significant extinction by the interstellar medium could enable more detailed observations, and thus provide better constraints on theoretical models of escaping atmospheres. The absorption line of a metastable state of helium at 10830 Å could satisfy both of these conditions for some exoplanets. We develop a simple 1D model of escaping planetary atmospheres containing hydrogen and helium. We use it to calculate the density profile of helium in the 23S metastable excited state and the expected in-transit absorption at 10830 Å for two exoplanets known to have escaping atmospheres. Our results indicate that exoplanets similar to GJ 436b and HD 209458b should exhibit enhanced transit depths at 10830 Å, with ∼8% and ∼2% excess absorption in the line core, respectively.

  8. Low-energy gamma-ray spectroscopy using an X-ray-escape gated proportional counter

    DEFF Research Database (Denmark)

    Gregers Hansen, P.; Nielsen, H.L.; Williams, E.T.

    1965-01-01

    The utility of a gas-filled proportional counter in low-energy γ spectroscopy is greatly increased if it is operated in coincidence with an escaping fluorescent X-ray. An apparatus, having an efficiency greater than 10% of singles, is described and several examples are given. An efficiency curve...

  9. X-ray escape effects in Si, Ge, and NaI detectors

    International Nuclear Information System (INIS)

    Brunner, G.

    1989-01-01

    A 3-parameter representation of the type x = K 1 [1 -L(ln(1 + 1/L))] together with L = K 2 E K 3 is recommended for the escape to parent peak ratio. Parameter values are provided for Si, Ge, and NaI detectors. Scattering, which has been neglected up to now, is included. (author)

  10. Educational Gaming for Pharmacy Students - Design and Evaluation of a Diabetes-themed Escape Room.

    Science.gov (United States)

    Eukel, Heidi N; Frenzel, Jeanne E; Cernusca, Dan

    2017-09-01

    Objective. To design an educational game that will increase third-year professional pharmacy students' knowledge of diabetes mellitus disease management and to evaluate their perceived value of the game. Methods. Faculty members created an innovative educational game, the diabetes escape room. An authentic escape room gaming environment was established through the use of a locked room, an escape time limit, and game rules within which student teams completed complex puzzles focused on diabetes disease management. To evaluate the impact, students completed a pre-test and post-test to measure the knowledge they've gained and a perception survey to identify moderating factors that could help instructors improve the game's effectiveness and utility. Results. Students showed statistically significant increases in knowledge after completion of the game. A one-sample t -test indicated that students' mean perception was statistically significantly higher than the mean value of the evaluation scale. This statically significant result proved that this gaming act offers a potential instructional benefit beyond its novelty. Conclusion. The diabetes escape room proved to be a valuable educational game that increased students' knowledge of diabetes mellitus disease management and showed a positive perceived overall value by student participants.

  11. The disclosure of a metaphysical horizon, or how to escape dialectics

    African Journals Online (AJOL)

    In a footnote to The Inoperative Community French philosopher Jean-Luc Nancy wonders how to escape Hegelian dialectics. Because Nancy in his later work often returns to this attempt of a 'disclosure of our metaphysical horizon', we not only consider this note as a crucial one in his attempt to 'disclose' our metaphysical ...

  12. GAMMA-RAY EMISSION OF ACCELERATED PARTICLES ESCAPING A SUPERNOVA REMNANT IN A MOLECULAR CLOUD

    International Nuclear Information System (INIS)

    Ellison, Donald C.; Bykov, Andrei M.

    2011-01-01

    We present a model of gamma-ray emission from core-collapse supernovae (SNe) originating from the explosions of massive young stars. The fast forward shock of the supernova remnant (SNR) can accelerate particles by diffusive shock acceleration (DSA) in a cavern blown by a strong, pre-SN stellar wind. As a fundamental part of nonlinear DSA, some fraction of the accelerated particles escape the shock and interact with a surrounding massive dense shell producing hard photon emission. To calculate this emission, we have developed a new Monte Carlo technique for propagating the cosmic rays (CRs) produced by the forward shock of the SNR, into the dense, external material. This technique is incorporated in a hydrodynamic model of an evolving SNR which includes the nonlinear feedback of CRs on the SNR evolution, the production of escaping CRs along with those that remain trapped within the remnant, and the broadband emission of radiation from trapped and escaping CRs. While our combined CR-hydro-escape model is quite general and applies to both core collapse and thermonuclear SNe, the parameters we choose for our discussion here are more typical of SNRs from very massive stars whose emission spectra differ somewhat from those produced by lower mass progenitors directly interacting with a molecular cloud.

  13. A trouser bag experiment that quantify by-catch species escaping ...

    African Journals Online (AJOL)

    Sea fishing trials were conducted to quantify by-catch species escaping from a modified shrimp trawl codend and retained in a trouser bag. Modification was by inserting a rectangular aluminum frame excluder device with bar spacing of 20mm at the anterior bunt. Thirty replicate landings showed that; Drepane africana have ...

  14. Escape as a Factor in the Aggressive Behavior of Two Retarded Children.

    Science.gov (United States)

    Carr, Edward G.; And Others

    1980-01-01

    The study sought to identify some of the variables controlling the severely aggressive behavior of two severely retarded children (ages 9 and 14). Experiments conducted under various conditions showed that, while aggressive behaviors sometimes serve as an escape function, the behaviors can be terminated through reduction of the causative situation…

  15. Escape as a Factor in the Maintenance of Aggression, Tantrums and Self-Injury.

    Science.gov (United States)

    Carr, Edward G.

    Aggression, tantrums, and self-injury can function as escape behaviors, allowing children to terminate aversive demand (teaching) situations. In one group of six psychotic children, these behaviors were frequent in demand situations, and rare in nondemand situations. Further, when stimuli correlated with the termination of demands were presented,…

  16. Pleiotropic effects of hemagglutinin amino acid substitutions of H5 influenza escape mutants

    International Nuclear Information System (INIS)

    Rudneva, Irina A.; Timofeeva, Tatiana A.; Ignatieva, Anna V.; Shilov, Aleksandr A.; Krylov, Petr S.; Ilyushina, Natalia A.; Kaverin, Nikolai V.

    2013-01-01

    In the present study we assessed pleiotropic characteristics of the antibody-selected mutations. We examined pH optimum of fusion, temperatures of HA heat inactivation, and in vitro and in vivo replication kinetics of the previously obtained influenza H5 escape mutants. Our results showed that HA1 N142K mutation significantly lowered the pH of fusion optimum. Mutations of the escape mutants located in the HA lateral loop significantly affected H5 HA thermostability (P<0.05). HA changes at positions 131, 144, 145, and 156 and substitutions at positions 131, 142, 145, and 156 affected the replicative ability of H5 escape mutants in vitro and in vivo, respectively. Overall, a co-variation between antigenic specificity and different HA phenotypic properties has been demonstrated. We believe that the monitoring of pleiotropic effects of the HA mutations found in H5 escape mutants is essential for accurate prediction of mutants with pandemic potential. - Highlights: • HA1 N142K mutation significantly lowered the pH of fusion optimum. • Mutations located in the HA lateral loop significantly affected H5 HA thermostability. • HA changes at positions 131, 142, 144, 145, and 156 affected the replicative ability of H5 mutants. • Acquisition of glycosylation site could lead to the emergence of multiple pleiotropic effects

  17. Effect of Brief Clinic-Based Training on the Ability of Caregivers to Implement Escape Extinction

    Science.gov (United States)

    McCartney, Ellen J.; Anderson, Cynthia M.; English, Carie L.

    2005-01-01

    Escape extinction has been demonstrated to be an effective treatment for children exhibiting food refusal. To date, most studies have been conducted in inpatient treatment settings by trained clinicians. Few studies have evaluated the extent to which caregivers are able to implement efficacious interventions in their home for their food-selective…

  18. Autonomous Soft Robotic Fish Capable of Escape Maneuvers Using Fluidic Elastomer Actuators.

    Science.gov (United States)

    Marchese, Andrew D; Onal, Cagdas D; Rus, Daniela

    2014-03-01

    In this work we describe an autonomous soft-bodied robot that is both self-contained and capable of rapid, continuum-body motion. We detail the design, modeling, fabrication, and control of the soft fish, focusing on enabling the robot to perform rapid escape responses. The robot employs a compliant body with embedded actuators emulating the slender anatomical form of a fish. In addition, the robot has a novel fluidic actuation system that drives body motion and has all the subsystems of a traditional robot onboard: power, actuation, processing, and control. At the core of the fish's soft body is an array of fluidic elastomer actuators. We design the fish to emulate escape responses in addition to forward swimming because such maneuvers require rapid body accelerations and continuum-body motion. These maneuvers showcase the performance capabilities of this self-contained robot. The kinematics and controllability of the robot during simulated escape response maneuvers are analyzed and compared with studies on biological fish. We show that during escape responses, the soft-bodied robot has similar input-output relationships to those observed in biological fish. The major implication of this work is that we show soft robots can be both self-contained and capable of rapid body motion.

  19. Self-consciousness and binge eating in college women : an escape from rumination?

    NARCIS (Netherlands)

    Dalley, Simon; Donofrio, Stacey

    2014-01-01

    Background: Binge-eating is a highly distressing symptom that has been found to co-occur with other symptoms of eating disorders such as bulimia nervosa. One perspective of binge eating is that it is an attempt to escape high levels of aversive self-consciousness. A primary aim of this study is to

  20. Co-lethality studied as an asset against viral drug escape: the HIV protease case

    Directory of Open Access Journals (Sweden)

    Ollivier Emmanuelle

    2010-06-01

    Full Text Available Abstract Background Co-lethality, or synthetic lethality is the documented genetic situation where two, separately non-lethal mutations, become lethal when combined in one genome. Each mutation is called a "synthetic lethal" (SL or a co-lethal. Like invariant positions, SL sets (SL linked couples are choice targets for drug design against fast-escaping RNA viruses: mutational viral escape by loss of affinity to the drug may induce (synthetic lethality. Results From an amino acid sequence alignment of the HIV protease, we detected the potential SL couples, potential SL sets, and invariant positions. From the 3D structure of the same protein we focused on the ones that were close to each other and accessible on the protein surface, to possibly bind putative drugs. We aligned 24,155 HIV protease amino acid sequences and identified 290 potential SL couples and 25 invariant positions. After applying the distance and accessibility filter, three candidate drug design targets of respectively 7 (under the flap, 4 (in the cantilever and 5 (in the fulcrum amino acid positions were found. Conclusions These three replication-critical targets, located outside of the active site, are key to our anti-escape strategy. Indeed, biological evidence shows that 2/3 of those target positions perform essential biological functions. Their mutational variations to escape antiviral medication could be lethal, thus limiting the apparition of drug-resistant strains. Reviewers This article was reviewed by Arcady Mushegian, Shamil Sunyaev and Claus Wilke.

  1. Ginkgo biloba and Angelica archangelica bring back an impartial hepatic apoptotic to anti-apoptotic protein ratio after exposure to technetium 99mTc.

    Science.gov (United States)

    Raafat, Bassem M; Saleh, Ahmed; Shafaa, Medhat W; Khedr, Mahmoud; Ghafaar, Amany A

    2013-02-01

    The aim of this study was to study the effect of ionizing radiation on apoptosis-related protein concentrations as well as the radio-protective role of Ginkgo biloba and Angelica archangelica. The experiments were performed on 68 adult Wistar rats weighing 175 g (±10 g). Animals were subdivided into control group in which the animals received neither the protector nor the isotopes. The second group represents the animals that received 1 mCi of (99m)Tc only. The third group represents the animals that received A. archangelica for 7 days. The fourth group represents the animals that received G. biloba for 7 days. The fifth group represents the animals that received 1 mCi of (99m)Tc once after receiving A. archangelica for 7 days. The sixth group represents the animals that received mCi of (99m)Tc once after receiving G. biloba for 7 days. Radiation was administered as intravenous injection by 1 mCi of (99m)Tc with the legend methoxyisobutylisonitrile for 24 h. The concentration of p53, Bcl2 and malondialdehyde in liver as well as histopathological examination of liver cells were carried out. Results showed that apoptotic to anti-apoptotic protein ratio significantly (p archangelica and G. biloba in a dose based on the animal body weight. Electron microscope photographing supported this finding. It was concluded that both antioxidants can be used as radio-protective agents in cases of ionizing radiation exposure.

  2. Automated guidance algorithms for a space station-based crew escape vehicle.

    Science.gov (United States)

    Flanary, R; Hammen, D G; Ito, D; Rabalais, B W; Rishikof, B H; Siebold, K H

    2003-04-01

    An escape vehicle was designed to provide an emergency evacuation for crew members living on a space station. For maximum escape capability, the escape vehicle needs to have the ability to safely evacuate a station in a contingency scenario such as an uncontrolled (e.g., tumbling) station. This emergency escape sequence will typically be divided into three events: The first separation event (SEP1), the navigation reconstruction event, and the second separation event (SEP2). SEP1 is responsible for taking the spacecraft from its docking port to a distance greater than the maximum radius of the rotating station. The navigation reconstruction event takes place prior to the SEP2 event and establishes the orbital state to within the tolerance limits necessary for SEP2. The SEP2 event calculates and performs an avoidance burn to prevent station recontact during the next several orbits. This paper presents the tools and results for the whole separation sequence with an emphasis on the two separation events. The first challenge includes collision avoidance during the escape sequence while the station is in an uncontrolled rotational state, with rotation rates of up to 2 degrees per second. The task of avoiding a collision may require the use of the Vehicle's de-orbit propulsion system for maximum thrust and minimum dwell time within the vicinity of the station vicinity. The thrust of the propulsion system is in a single direction, and can be controlled only by the attitude of the spacecraft. Escape algorithms based on a look-up table or analytical guidance can be implemented since the rotation rate and the angular momentum vector can be sensed onboard and a-priori knowledge of the position and relative orientation are available. In addition, crew intervention has been provided for in the event of unforeseen obstacles in the escape path. The purpose of the SEP2 burn is to avoid re-contact with the station over an extended period of time. Performing this maneuver requires

  3. Leptin suppresses non-apoptotic cell death in ischemic rat cardiomyocytes by reduction of iPLA{sub 2} activity

    Energy Technology Data Exchange (ETDEWEB)

    Takatani-Nakase, Tomoka, E-mail: nakase@mukogawa-u.ac.jp; Takahashi, Koichi, E-mail: koichi@mukogawa-u.ac.jp

    2015-07-17

    Caspase-independent, non-apoptotic cell death is an important therapeutic target in myocardial ischemia. Leptin, an adipose-derived hormone, is known to exhibit cytoprotective effects on the ischemic heart, but the mechanisms are poorly understood. In this research, we found that pretreatment of leptin strongly suppressed ischemic-augmented nuclear shrinkage and non-apoptotic cell death on cardiomyocytes. Leptin was also shown to significantly inhibit the activity of iPLA{sub 2}, which is considered to play crucial roles in non-apoptotic cell death, resulting in effective prevention of ischemia-induced myocyte death. These findings provide the first evidence of a protective mechanism of leptin against ischemia-induced non-apoptotic cardiomyocyte death. - Highlights: • Myocardial ischemia-model induces in caspase-independent, non-apoptotic cell death. • Leptin strongly inhibits ischemic-augmented non-apoptotic cell death. • Leptin reduces iPLA{sub 2} activity, leading to avoidance of non-apoptotic cell death.

  4. Escape of HIV-1-infected dendritic cells from TRAIL-mediated NK cell cytotoxicity during NK-DC cross-talk--a pivotal role of HMGB1.

    Directory of Open Access Journals (Sweden)

    Marie-Thérèse Melki

    2010-04-01

    Full Text Available Early stages of Human Immunodeficiency Virus-1 (HIV-1 infection are associated with local recruitment and activation of important effectors of innate immunity, i.e. natural killer (NK cells and dendritic cells (DCs. Immature DCs (iDCs capture HIV-1 through specific receptors and can disseminate the infection to lymphoid tissues following their migration, which is associated to a maturation process. This process is dependent on NK cells, whose role is to keep in check the quality and the quantity of DCs undergoing maturation. If DC maturation is inappropriate, NK cells will kill them ("editing process" at sites of tissue inflammation, thus optimizing the adaptive immunity. In the context of a viral infection, NK-dependent killing of infected-DCs is a crucial event required for early elimination of infected target cells. Here, we report that NK-mediated editing of iDCs is impaired if DCs are infected with HIV-1. We first addressed the question of the mechanisms involved in iDC editing, and we show that cognate NK-iDC interaction triggers apoptosis via the TNF-related apoptosis-inducing ligand (TRAIL-Death Receptor 4 (DR4 pathway and not via the perforin pathway. Nevertheless, once infected with HIV-1, DC(HIV become resistant to NK-induced TRAIL-mediated apoptosis. This resistance occurs despite normal amounts of TRAIL released by NK cells and comparable DR4 expression on DC(HIV. The escape of DC(HIV from NK killing is due to the upregulation of two anti-apoptotic molecules, the cellular-Flice like inhibitory protein (c-FLIP and the cellular inhibitor of apoptosis 2 (c-IAP2, induced by NK-DC(HIV cognate interaction. High-mobility group box 1 (HMGB1, an alarmin and a key mediator of NK-DC cross-talk, was found to play a pivotal role in NK-dependent upregulation of c-FLIP and c-IAP2 in DC(HIV. Finally, we demonstrate that restoration of DC(HIV susceptibility to NK-induced TRAIL killing can be obtained either by silencing c-FLIP and c-IAP2 by specific

  5. Desing and synthesis of potent anti-Trypanosoma cruzi agents new thiazoles derivatives which induce apoptotic parasite death.

    Science.gov (United States)

    da Silva, Elany Barbosa; Oliveira E Silva, Dayane Albuquerque; Oliveira, Arsênio Rodrigues; da Silva Mendes, Carlos Henrique; Dos Santos, Thiago André Ramos; da Silva, Aline Caroline; de Castro, Maria Carolina Acioly; Ferreira, Rafaela Salgado; Moreira, Diogo Rodrigo Magalhães; Cardoso, Marcos Veríssimo de Oliveira; de Simone, Carlos Alberto; Pereira, Valéria Rêgo Alves; Leite, Ana Cristina Lima

    2017-04-21

    Chagas disease, caused by the kinetoplastid protozoan parasite Trypanosoma cruzi, remains a relevant cause of illness and premature death and it is estimated that 6 million to 7 million people are infected worldwide. Although chemotherapy options are limited presenting serious problems, such as low efficacy and high toxicity. T. cruzi is susceptible to thiazoles, making this class of compounds appealing for drug development. Previously, thiazoles resulted in an increase in anti-T. cruzi activity in comparison to thiosemicarbazones. Here, we report the structural planning, synthesis and anti-T. cruzi evaluation of new thiazoles derivatives (3a-m and 4a-m), designed from molecular hybridization associated with non-classical bioisosterism. By varying substituents attached to the phenyl and thiazole rings, substituents were observed to retain, enhance or greatly increase their anti-T. cruzi activity, in comparison to the corresponding thiosemicarbazones. In most cases, electron-withdrawing substituents, such as bromine, 3,4-dichloro and nitro groups, greatly increased antiparasitic activity. Specifically, new thiazoles were identified that inhibit the epimastigote proliferation and were toxic for trypomastigotes without affecting macrophages viability. These compounds were also evaluated against cruzain. However, inhibition of this enzyme was not observed, suggesting that the compounds work through another mechanism. In addition, examination of T. cruzi cell death showed that these molecules induce apoptosis. In conclusion, except for compounds 3h and 3k, all thiazoles derivatives evaluated exhibited higher cytotoxic activity against the trypomastigote forms than the reference medicament benznidazole, without affecting macrophages viability. Compounds 4d and 4k were highlights, CC50 = 1.2 e 1.6 μM, respectively. Mechanistically, these compounds do not inhibit the cruzain, but induce T. cruzi cell death by an apoptotic process, being considered a good starting

  6. Anti-oxidative and anti-apoptotic roles of spermatogonial stem cells in reversing cisplatin-induced testicular toxicity.

    Science.gov (United States)

    Hussein, Yousri M; Mohamed, Randa H; Shalaby, Sally M; Abd El-Haleem, Manal R; Abd El Motteleb, Dalia M

    2015-11-01

    Because of reproductive toxic effects of chemotherapy, researchers have taken some techniques to preserve fertility potential. The present study was designed to point out the potential role of spermatogonial stem cell (SSC) therapy in reversing cisplatin (CP)-induced testicular toxicity and restore the spermatogenesis. Sixty rats were randomly divided into three groups: group 1, control group; group 2, rats received CP in a dose of 7 mg/kg/day for 5 consecutive days; group 3, CP was injected at 7 mg/kg per day for 5 consecutive days, and, on the 6th day of the experiment, rats were treated with SSC. Forty days after receiving the last dose of CP, rats were euthanized under anesthesia; testes were collected, and gene expression using real-time polymerase chain reaction for P53, Bax, caspase 9 and cytochrome c, testicular histological findings and oxidative status were determined. Administration of cisplatin caused significant increases in malondialdehyde levels, Bax and caspase 9 genes expression levels concomitant with significant decreases in anti-oxidant enzyme activities, p53 and cytochrome c gene expression levels, along with some histopathological lesions in testicular tissue. SCC attenuated the disturbance in oxidant/anti-oxidant status and testicular apoptosis; this is associated with improvements in the histopathological view of the testicular tissue. The current study highlights evidence that the SCC has anti-oxidative and anti-apoptotic properties that could reverse CP-induced testicular toxicity, in addition to their role in spermatogenesis. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  7. Conformational restriction of aryl thiosemicarbazones produces potent and selective anti-Trypanosoma cruzi compounds which induce apoptotic parasite death.

    Science.gov (United States)

    Magalhaes Moreira, Diogo Rodrigo; de Oliveira, Ana Daura Travassos; Teixeira de Moraes Gomes, Paulo André; de Simone, Carlos Alberto; Villela, Filipe Silva; Ferreira, Rafaela Salgado; da Silva, Aline Caroline; dos Santos, Thiago André Ramos; Brelaz de Castro, Maria Carolina Accioly; Pereira, Valéria Rego Alves; Leite, Ana Cristina Lima

    2014-03-21

    Chagas disease, caused by Trypanosoma cruzi, is a life-threatening infection leading to approximately 12,000 deaths per year. T. cruzi is susceptible to thiosemicarbazones, making this class of compounds appealing for drug development. Previously, the homologation of aryl thiosemicarbazones resulted in an increase in anti-T. cruzi activity in comparison to aryl thiosemicarbazones without a spacer group. Here, we report the structural planning, synthesis and anti-T. cruzi evaluation of new aryl thiosemicarbazones (9a-x), designed as more conformationally restricted compounds. By varying substituents attached to the phenyl ring, substituents were observed to retain, enhance or greatly increase the anti-T. cruzi activity, in comparison to the nonsubstituted derivative. In most cases, hydrophobic and bulky substituents, such as bromo, biphenyl and phenoxyl groups, greatly increased antiparasitic activity. Specifically, thiosemicarbazones were identified that inhibit the epimastigote proliferation and were toxic for trypomastigotes without affecting mouse splenocytes viability. The most potent anti-T. cruzi thiosemicarbazones were evaluated against cruzain. However, inhibition of this enzyme was not observed, suggesting that the compounds work through another mechanism. In addition, examination of T. cruzi cell death showed that these thiosemicarbazones induce apoptosis. In conclusion, the structural design executed within the series of aryl thiosemicarbazones (9a-x) led to the identification of new potent anti-T. cruzi agents, such as compounds (9h) and (9r), which greatly inhibited epimastigote proliferation, and demonstrated a toxicity for trypomastigotes, but not for splenocytes. Mechanistically, these compounds do not inhibit the cruzain, but induce T. cruzi cell death by an apoptotic process. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  8. Mandible-Powered Escape Jumps in Trap-Jaw Ants Increase Survival Rates during Predator-Prey Encounters.

    Directory of Open Access Journals (Sweden)

    Fredrick J Larabee

    Full Text Available Animals use a variety of escape mechanisms to increase the probability of surviving predatory attacks. Antipredator defenses can be elaborate, making their evolutionary origin unclear. Trap-jaw ants are known for their rapid and powerful predatory mandible strikes, and some species have been observed to direct those strikes at the substrate, thereby launching themselves into the air away from a potential threat. This potential escape mechanism has never been examined in a natural context. We studied the use of mandible-powered jumping in Odontomachus brunneus during their interactions with a common ant predator: pit-building antlions. We observed that while trap-jaw ant workers escaped from antlion pits by running in about half of interactions, in 15% of interactions they escaped by mandible-powered jumping. To test whether escape jumps improved individual survival, we experimentally prevented workers from jumping and measured their escape rate. Workers with unrestrained mandibles escaped from antlion pits significantly more frequently than workers with restrained mandibles. Our results indicate that some trap-jaw ant species can use mandible-powered jumps to escape from common predators. These results also provide a charismatic example of evolutionary co-option, where a trait that evolved for one function (predation has been co-opted for another (defense.

  9. Mandible-Powered Escape Jumps in Trap-Jaw Ants Increase Survival Rates during Predator-Prey Encounters.

    Science.gov (United States)

    Larabee, Fredrick J; Suarez, Andrew V

    2015-01-01

    Animals use a variety of escape mechanisms to increase the probability of surviving predatory attacks. Antipredator defenses can be elaborate, making their evolutionary origin unclear. Trap-jaw ants are known for their rapid and powerful predatory mandible strikes, and some species have been observed to direct those strikes at the substrate, thereby launching themselves into the air away from a potential threat. This potential escape mechanism has never been examined in a natural context. We studied the use of mandible-powered jumping in Odontomachus brunneus during their interactions with a common ant predator: pit-building antlions. We observed that while trap-jaw ant workers escaped from antlion pits by running in about half of interactions, in 15% of interactions they escaped by mandible-powered jumping. To test whether escape jumps improved individual survival, we experimentally prevented workers from jumping and measured their escape rate. Workers with unrestrained mandibles escaped from antlion pits significantly more frequently than workers with restrained mandibles. Our results indicate that some trap-jaw ant species can use mandible-powered jumps to escape from common predators. These results also provide a charismatic example of evolutionary co-option, where a trait that evolved for one function (predation) has been co-opted for another (defense).

  10. Centering Single Cells in Microgels via Delayed Crosslinking Supports Long-Term 3D Culture by Preventing Cell Escape

    NARCIS (Netherlands)

    Kamperman, Tom; Henke, Sieger; Visser, Claas Willem; Karperien, Marcel; Leijten, Jeroen

    2017-01-01

    Single-cell-laden microgels support physiological 3D culture conditions while enabling straightforward handling and high-resolution readouts of individual cells. However, their widespread adoption for long-term cultures is limited by cell escape. In this work, it is demonstrated that cell escape is

  11. Variation of NO2 and NOx concentrations between and within 36 European study areas: Results from the ESCAPE study

    NARCIS (Netherlands)

    Cyrys, J.; Eeftens, M.R.|info:eu-repo/dai/nl/315028300; Heinrich, J.; Ampe, C.; Armengaud, A.; Beelen, R.; Bellander, T.; Beregszaszi, T.; Birk, M.; Cesaroni, G.; Cirach, M.; de Hoogh, K.; de Nazelle, A.; de Vocht, F.; Declercq, C.; Dėdelė, A.; Dimakopoulou, K.; Eriksen, K.; Galassi, C.; Grąulevičienė, R.; Grivas, G.; Gruzieva, O.; Gustafsson, A.H.; Hoffmann, B.; Iakovides, M.; Ineichen, A.; Krämer, U.; Lanki, T.; Lozano, P.; Madsen, C.; Meliefste, K.; Modig, L.; Mölter, A.; Mosler, G.; Nieuwenhuijsen, M.; Nonnemacher, M.; Oldenwening, M.; Peters, A.; Pontet, S.; Probst-Hensch, N.; Quass, U.; Raaschou-Nielsen, O.; Ranzi, A.; Sugiri, D.; Stephanou, E.G.; Taimisto, P.; Tsai, M-Y.; Vaskövi, É.; Villani, S.; Wang, M.|info:eu-repo/dai/nl/345480279; Brunekreef, B.|info:eu-repo/dai/nl/067548180; Hoek, G.|info:eu-repo/dai/nl/069553475

    2012-01-01

    The ESCAPE study (European Study of Cohorts for Air Pollution Effects) investigates long-term effects of exposure to air pollution on human health in Europe. This paper documents the spatial variation of measured NO2 and NOx concentrations between and within 36 ESCAPE study areas across Europe. In

  12. Comparing Effective Treatments for Attention-Maintained and Escape- Maintained Behaviors in Children with Behavior Disorders: Brief Review and Analysis

    OpenAIRE

    Lauren Worcester; T. F. McLaughlin

    2013-01-01

    This literature review compares treatment for attention-maintainedversus escape maintained aberrant behavior in children with behavior disorders. Specifically, studies utilizing time out procedures, differential reinforcement procedures, noncontingent reinforcement, and functional communication training are discussed. It was found that these are effective treatments for attention-maintained behaviors; while escape extinction, positive and negative reinforcement, functional communication trai...

  13. Comparison of heavy metal levels of farmed and escaped farmed rainbow trout and health risk assessment associated with their consumption.

    Science.gov (United States)

    Varol, Memet; Sünbül, Muhammet Raşit

    2017-10-01

    In this study, levels of ten metals (arsenic, cadmium, cobalt, chromium, copper, iron, manganese, nickel, lead, and zinc) in muscles of farmed and escaped farmed rainbow trout (Oncorhynchus mykiss) in the Keban Dam Reservoir (Turkey) were determined. Also, human health risks associated with their consumption were assessed. Of ten metals, only Co and Fe levels in escaped rainbow trout were significantly higher than those in farmed rainbow trout. The metal levels in farmed and escaped rainbow trout were below the maximum permissible limits. The estimated daily intake (EDI) of each metal in both farmed and escaped farmed rainbow trout was much lower than the respective tolerable daily intake (TDI). The target hazard quotient (THQ) values for individual metal and the total THQ values for combined metals were lower than 1 in both farmed and escaped rainbow trout, indicating no health risk for humans. The cancer risk (CR) values estimated for inorganic As in both farmed and escaped rainbow trout indicated low carcinogenic risk to the consumers. According to the maximum allowable monthly consumption limits (CR mm) , adults may safely consume 24 meals of farmed rainbow trout per month or 39 meals of escaped rainbow trout per month, with minimal adverse carcinogenic and non-carcinogenic health effects. This study revealed that the risk from consuming farmed and escaped farmed rainbow trout in the Keban Dam Reservoir due to these trace elements is minimal.

  14. The prototypic tissue pentraxin PTX3, in contrast to the short pentraxin serum amyloid P, inhibits phagocytosis of late apoptotic neutrophils by macrophages

    NARCIS (Netherlands)

    van Rossum, AP; Fazzini, F; Limburg, PC; Manfredi, AA; Rovere-Querini, P; Mantovani, A; Kallenberg, CGM

    Objective. Phagocytosis of apoptotic cells can be facilitated by complement components and short pentraxins, such as serum amyloid P (SAP). In contrast, the long pentraxin PTX3 was shown to inhibit phagocytosis of apoptotic Jurkat cells by dendritic cells and to bind late apoptotic polymorphonuclear

  15. Oxygen escape from the Earth during geomagnetic reversals: Implications to mass extinction

    Science.gov (United States)

    Wei, Yong; Pu, Zuyin; Zong, Qiugang; Wan, Weixing; Ren, Zhipeng; Fraenz, Markus; Dubinin, Eduard; Tian, Feng; Shi, Quanqi; Fu, Suiyan; Hong, Minghua

    2014-05-01

    The evolution of life is affected by variations of atmospheric oxygen level and geomagnetic field intensity. Oxygen can escape into interplanetary space as ions after gaining momentum from solar wind, but Earth's strong dipole field reduces the momentum transfer efficiency and the ion outflow rate, except for the time of geomagnetic polarity reversals when the field is significantly weakened in strength and becomes Mars-like in morphology. The newest databases available for the Phanerozoic era illustrate that the reversal rate increased and the atmospheric oxygen level decreased when the marine diversity showed a gradual pattern of mass extinctions lasting millions of years. We propose that accumulated oxygen escape during an interval of increased reversal rate could have led to the catastrophic drop of oxygen level, which is known to be a cause of mass extinction. We simulated the oxygen ion escape rate for the Triassic-Jurassic event, using a modified Martian ion escape model with an input of quiet solar wind inferred from Sun-like stars. The results show that geomagnetic reversal could enhance the oxygen escape rate by 3-4 orders only if the magnetic field was extremely weak, even without consideration of space weather effects. This suggests that our hypothesis could be a possible explanation of a correlation between geomagnetic reversals and mass extinction. Therefore, if this causal relation indeed exists, it should be a "many-to-one" scenario rather the previously considered "one-to-one", and planetary magnetic field should be much more important than previously thought for planetary habitability.

  16. Characterization of extra-solar planets and their atmospheres (Spectroscopy of transits and atmospheric escape)

    International Nuclear Information System (INIS)

    Bourrier, Vincent

    2014-01-01

    Hot Jupiters are exo-planets so close to their star that their atmosphere can lose gas because of hydrodynamic escape. Transiting gaseous giants are an excellent way to understand this mechanism, but it is necessary to study other types of planets to determine its impact on the exo-planetary population. This thesis aims at using transit spectroscopy to observe the atmosphere of several exo-planets, to study their properties and to contribute to the characterization of hydrodynamic escape. UV lines observed with the Hubble telescope are analyzed with the numerical model of upper atmospheres we developed. Using the Ly-α line we identify energetic and dynamical interactions between the atmospheres of the hot Jupiters HD209458b and HD189733b and their stars. We study the dependence of the escape on the environment of a planet and on its physical properties, through the observation of a super-Earth and a warm Jupiter in the 55 Cnc system. Using observations of HD209458b, we show that magnesium lines are a window on the region of formation of hydrodynamic escape. We study the potential of transit spectroscopy in the near-UV to detect new cases of atmospheric escape. This mechanism is fostered by the proximity of a planet to its star, which makes it even more important to understand the formation and migration processes that can be traced in the alignment of a planetary system. Using measures from the spectrographs HARPS-N and SOPHIE we study the alignments of 55 Cnc e and the Kepler candidate KOI 12.01, whose planetary nature we also seek to validate. (author)

  17. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States.

    Science.gov (United States)

    Brueggemann, Angela B; Pai, Rekha; Crook, Derrick W; Beall, Bernard

    2007-11-01

    The heptavalent pneumococcal conjugate vaccine (PCV7) was introduced in the United States (US) in 2000 and has significantly reduced invasive pneumococcal disease; however, the incidence of nonvaccine serotype invasive disease, particularly due to serotype 19A, has increased. The serotype 19A increase can be explained in part by expansion of a genotype that has been circulating in the US prior to vaccine implementation (and other countries since at least 1990), but also by the emergence of a novel "vaccine escape recombinant" pneumococcal strain. This strain has a genotype that previously was only associated with vaccine serotype 4, but now expresses a nonvaccine serotype 19A capsule. Based on prior evidence for capsular switching by recombination at the capsular locus, the genetic event that resulted in this novel serotype/genotype combination might be identifiable from the DNA sequence of individual pneumococcal strains. Therefore, the aim of this study was to characterise the putative recombinational event(s) at the capsular locus that resulted in the change from a vaccine to a nonvaccine capsular type. Sequencing the capsular locus flanking regions of 51 vaccine escape (progeny), recipient, and putative donor pneumococci revealed a 39 kb recombinational fragment, which included the capsular locus, flanking regions, and two adjacent penicillin-binding proteins, and thus resulted in a capsular switch and penicillin nonsusceptibility in a single genetic event. Since 2003, 37 such vaccine escape strains have been detected, some of which had evolved further. Furthermore, two new types of serotype 19A vaccine escape strains emerged in 2005. To our knowledge, this is the first time a single recombinational event has been documented in vivo that resulted in both a change of serotype and penicillin nonsusceptibility. Vaccine escape by genetic recombination at the capsular locus has the potential to reduce PCV7 effectiveness in the longer term.

  18. A convergent and essential interneuron pathway for Mauthner-cell-mediated escapes.

    Science.gov (United States)

    Lacoste, Alix M B; Schoppik, David; Robson, Drew N; Haesemeyer, Martin; Portugues, Ruben; Li, Jennifer M; Randlett, Owen; Wee, Caroline L; Engert, Florian; Schier, Alexander F

    2015-06-01

    The Mauthner cell (M-cell) is a command-like neuron in teleost fish whose firing in response to aversive stimuli is correlated with short-latency escapes [1-3]. M-cells have been proposed as evolutionary ancestors of startle response neurons of the mammalian reticular formation [4], and studies of this circuit have uncovered important principles in neurobiology that generalize to more complex vertebrate models [3]. The main excitatory input was thought to originate from multisensory afferents synapsing directly onto the M-cell dendrites [3]. Here, we describe an additional, convergent pathway that is essential for the M-cell-mediated startle behavior in larval zebrafish. It is composed of excitatory interneurons called spiral fiber neurons, which project to the M-cell axon hillock. By in vivo calcium imaging, we found that spiral fiber neurons are active in response to aversive stimuli capable of eliciting escapes. Like M-cell ablations, bilateral ablations of spiral fiber neurons largely eliminate short-latency escapes. Unilateral spiral fiber neuron ablations shift the directionality of escapes and indicate that spiral fiber neurons excite the M-cell in a lateralized manner. Their optogenetic activation increases the probability of short-latency escapes, supporting the notion that spiral fiber neurons help activate M-cell-mediated startle behavior. These results reveal that spiral fiber neurons are essential for the function of the M-cell in response to sensory cues and suggest that convergent excitatory inputs that differ in their input location and timing ensure reliable activation of the M-cell, a feedforward excitatory motif that may extend to other neural circuits. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States.

    Directory of Open Access Journals (Sweden)

    Angela B Brueggemann

    2007-11-01

    Full Text Available The heptavalent pneumococcal conjugate vaccine (PCV7 was introduced in the United States (US in 2000 and has significantly reduced invasive pneumococcal disease; however, the incidence of nonvaccine serotype invasive disease, particularly due to serotype 19A, has increased. The serotype 19A increase can be explained in part by expansion of a genotype that has been circulating in the US prior to vaccine implementation (and other countries since at least 1990, but also by the emergence of a novel "vaccine escape recombinant" pneumococcal strain. This strain has a genotype that previously was only associated with vaccine serotype 4, but now expresses a nonvaccine serotype 19A capsule. Based on prior evidence for capsular switching by recombination at the capsular locus, the genetic event that resulted in this novel serotype/genotype combination might be identifiable from the DNA sequence of individual pneumococcal strains. Therefore, the aim of this study was to characterise the putative recombinational event(s at the capsular locus that resulted in the change from a vaccine to a nonvaccine capsular type. Sequencing the capsular locus flanking regions of 51 vaccine escape (progeny, recipient, and putative donor pneumococci revealed a 39 kb recombinational fragment, which included the capsular locus, flanking regions, and two adjacent penicillin-binding proteins, and thus resulted in a capsular switch and penicillin nonsusceptibility in a single genetic event. Since 2003, 37 such vaccine escape strains have been detected, some of which had evolved further. Furthermore, two new types of serotype 19A vaccine escape strains emerged in 2005. To our knowledge, this is the first time a single recombinational event has been documented in vivo that resulted in both a change of serotype and penicillin nonsusceptibility. Vaccine escape by genetic recombination at the capsular locus has the potential to reduce PCV7 effectiveness in the longer term.

  20. Space Weathering of Super-Earths: Model Simulations of Exospheric Sodium Escape from 61 Virgo b

    Energy Technology Data Exchange (ETDEWEB)

    Yoneda, M.; Berdyugina, S.; Kuhn, J. [Kiepenheuer Institute for Solar Physics, Schöneckstraße 6, 79104 Freiburg im Breisgau (Germany)

    2017-10-01

    Rocky exoplanets are expected to be eroded by space weather in a similar way as in the solar system. In particular, Mercury is one of the dramatically eroded planets whose material continuously escapes into its exosphere and further into space. This escape is well traced by sodium atoms scattering sunlight. Due to solar wind impact, micrometeorite impacts, photo-stimulated desorption and thermal desorption, sodium atoms are released from surface regolith. Some of these released sodium atoms are escaping from Mercury’s gravitational-sphere. They are dragged anti-Sun-ward and form a tail structure. We expect similar phenomena on exoplanets. The hot super-Earth 61 Vir b orbiting a G3V star at only 0.05 au may show a similar structure. Because of its small separation from the star, the sodium release mechanisms may be working more efficiently on hot super-Earths than on Mercury, although the strong gravitational force of Earth-sized or even more massive planets may be keeping sodium atoms from escaping from the planet. Here, we performed model simulations for Mercury (to verify our model) and 61 Vir b as a representative super-Earth. We have found that sodium atoms can escape from this exoplanet due to stellar wind sputtering and micrometeorite impacts, to form a sodium tail. However, in contrast to Mercury, the tail on this hot super-Earth is strongly aligned with the anti-starward direction because of higher light pressure. Our model suggests that 61 Vir b seems to have an exo-base atmosphere like that of Mercury.

  1. Evolution of Enzyme Kinetic Mechanisms.

    Science.gov (United States)

    Ulusu, Nuriye Nuray

    2015-06-01

    This review paper discusses the reciprocal kinetic behaviours of enzymes and the evolution of structure-function dichotomy. Kinetic mechanisms have evolved in response to alterations in ecological and metabolic conditions. The kinetic mechanisms of single-substrate mono-substrate enzyme reactions are easier to understand and much simpler than those of bi-bi substrate enzyme reactions. The increasing complexities of kinetic mechanisms, as well as the increasing number of enzyme subunits, can be used to shed light on the evolution of kinetic mechanisms. Enzymes with heterogeneous kinetic mechanisms attempt to achieve specific products to subsist. In many organisms, kinetic mechanisms have evolved to aid survival in response to changing environmental factors. Enzyme promiscuity is defined as adaptation to changing environmental conditions, such as the introduction of a toxin or a new carbon source. Enzyme promiscuity is defined as adaptation to changing environmental conditions, such as the introduction of a toxin or a new carbon source. Enzymes with broad substrate specificity and promiscuous properties are believed to be more evolved than single-substrate enzymes. This group of enzymes can adapt to changing environmental substrate conditions and adjust catalysing mechanisms according to the substrate's properties, and their kinetic mechanisms have evolved in response to substrate variability.

  2. Zinc protoporphyrin-IX stimulates tumor immunity by disrupting the immunosuppressive enzyme indoleamine 2,3-dioxygenase

    OpenAIRE

    Metz, Richard; DuHadaway, James B.; Rust, Sonja; Munn, David H.; Muller, Alexander J.; Mautino, Mario; Prendergast, George C.

    2010-01-01

    The tryptophan catabolic enzyme indoleamine 2,3-dioxygenase (IDO) has emerged as an important driver of immune escape in a growing number of cancers and cancer-associated chronic infections. In this study, we define novel immunotherapeutic applications for the heme precursor compound zinc protoporphyrin IX (ZnPP) based on our discovery that it is a potent small molecule inhibitor of IDO. Inhibitory activity was determined using in vitro and in-cell enzyme assays as well as a novel in vivo pha...

  3. Measuring the Enzyme Activity of Arabidopsis Deubiquitylating Enzymes.

    Science.gov (United States)

    Kalinowska, Kamila; Nagel, Marie-Kristin; Isono, Erika

    2016-01-01

    Deubiquitylating enzymes, or DUBs, are important regulators of ubiquitin homeostasis and substrate stability, though the molecular mechanisms of most of the DUBs in plants are not yet understood. As different ubiquitin chain types are implicated in different biological pathways, it is important to analyze the enzyme characteristic for studying a DUB. Quantitative analysis of DUB activity is also important to determine enzyme kinetics and the influence of DUB binding proteins on the enzyme activity. Here, we show methods to analyze DUB activity using immunodetection, Coomassie Brilliant Blue staining, and fluorescence measurement that can be useful for understanding the basic characteristic of DUBs.

  4. Enzyme changes associated with mitochondrial malic enzyme deficiency in mice

    Energy Technology Data Exchange (ETDEWEB)

    Mohrenweiser, H.W.; Erickson, R.P.

    1979-01-01

    A genetically determined absence of mitochondrial malic enzyme (EC 1.1.1.40) in c/sup 3H//c/sup 6H/ mice is accompanied by a four-fold increase in liver glucose-6-phosphate dehydrogenase and a two-fold increase for 6-phosphogluconate dehydrogenase activity. Smaller increases in the activity of serine dehydratase and glutamic oxaloacetic transaminase are observed while the level of glutamic pyruvate transaminase activity is reduced in the liver of deficient mice. Unexpectedly, the level of activity of total malic enzyme in the livers of mitochrondrial malic enzyme-deficient mice is increased approximately 50% compared to littermate controls. No similar increase in solublle malic enzyme activity is observed in heart of kidney tissue of mutant mice and the levels of total malic enzyme in these tissues are in accord with expected levels of activity in mitochondrial malic enzyme-deficient mice. The divergence in levels of enzyme activity between mutant and wild-type mice begins at 19 to 21 days of age. Immunoinactivation experiments with monospecific antisera to the soluble malic enzyme and glucose-6-phosphate dehydrogenase demonstrate that the activity increases represent increases in the amount of enzyme protein. The alterations are not consistent with a single hormonal response.

  5. Transfer to near-Earth asteroids from a lunar orbit via Earth flyby and direct escaping trajectories

    Science.gov (United States)

    Wang, Yamin; Zhang, Yonghe; Qiao, Dong; Mao, Qingyun; Jiang, Jun

    2017-04-01

    In this paper, transfer trajectories from the Moon to near-Earth asteroids with different escaping trajectory options, Earth flyby and direct escaping, are investigated. The former executes an Earth flyby maneuver to increase the orbital energy during the transfer. The latter realizes the transfer by a single impulse at perilune. In this work, these two kinds of escaping orbits in the Earth-Moon planar circular-restricted three-body (PCRTB) system are analyzed firstly. The abilities to achieve the same Earth hyperbolic excess velocity for both orbits with minimum velocity impulse expenditure are calculated and analyzed. Then, the asteroid flyby trajectory in ephemeris model via two types of escaping orbits is designed. Asteroids 4179 Toutatis from Apollo and 3908 Nyx from Amor, represent the small and large transfer energy, respectively, are chosen as targets. The selection strategy of escaping trajectories for small and large-energy transfers is discussed.

  6. The apoptotic effects of escin in the H-Ras transformed 5RP7 cell line.

    Science.gov (United States)

    Güney, G; Kutlu, H M; Işcan, A

    2013-06-01

    Extracts of Aesculus hippocastanum L. (horse chestnut) seed have been used in the treatment of chronic venous insufficiency, edema and hemorrhoids. Most of the beneficial effects of horse chestnut are attributed to its principal component β-escin or escin. We have evaluated the cytotoxic and apoptotic effects of escin in the H-Ras 5RP7 cell line by analyzing cell growth inhibition, apoptosis and caspase-3 dependent activity. We have also shown structural and ultrastructural changes in these cell using confocal and transmission electron microscopy. The results indicated that escin has significant inhibitory effects on cell growth and the percentage of apoptotic cells increased after treatment with escin, and the micrographs confirmed that escin damaged these cells and induced apoptosis. Copyright © 2012 John Wiley & Sons, Ltd.

  7. The anti-apoptotic members of the Bcl-2 family are attractive tumor-associated antigens

    DEFF Research Database (Denmark)

    Straten, Per thor; Andersen, Mads Hald; Andersen, Mads Hald

    2010-01-01

    Anti-apoptotic members of the Bcl-2 family (Bcl-2, Bcl-X(L) and Mcl-2) are pivotal regulators of apoptotic cell death. They are all highly overexpressed in cancers of different origin in which they enhance the survival of the cancer cells. Consequently, they represent prime candidates for anti......-cancer therapy and specific antisense oligonucleotides or small molecule inhibitors have shown broad anti-cancer activities in pre-clinical models and are currently tested in clinical trials. In addition, immune-mediated tumor destruction is emerging as an interesting modality to treat cancer patients. Notably......, spontaneous cellular immune responses against the Bcl-2 family proteins have been identified as frequent features in cancer patients underscoring that these proteins are natural targets for the immune system. Thus, Bcl-2 family may serve as an important and widely applicable target for anti...

  8. Cell-Centric View of Apoptosis and Apoptotic Cell Death-Inducing Antitumoral Strategies

    Directory of Open Access Journals (Sweden)

    Maria Dolores Boyano

    2011-03-01

    Full Text Available Programmed cell death and especially apoptotic cell death, occurs under physiological conditions and is also desirable under pathological circumstances. However, the more we learn about cellular signaling cascades, the less plausible it becomes to find restricted and well-limited signaling pathways. In this context, an extensive description of pathway-connections is necessary in order to point out the main regulatory molecules as well as to select the most appropriate therapeutic targets. On the other hand, irregularities in programmed cell death pathways often lead to tumor development and cancer-related mortality is projected to continue increasing despite the effort to develop more active and selective antitumoral compounds. In fact, tumor cell plasticity represents a major challenge in chemotherapy and improvement on anticancer therapies seems to rely on appropriate drug combinations. An overview of the current status regarding apoptotic pathways as well as available chemotherapeutic compounds provides a new perspective of possible future anticancer strategies.

  9. Modulation of Apoptotic Pathways by Human Papillomaviruses (HPV: Mechanisms and Implications for Therapy

    Directory of Open Access Journals (Sweden)

    Chung-Hsiang Yuan

    2012-12-01

    Full Text Available The ability of the host to trigger apoptosis in infected cells is perhaps the most powerful tool by which viruses can be cleared from the host organism. To avoid elimination by this mechanism, human papillomaviruses (HPV have developed several mechanisms that enable the cells they infect to elude both extrinsic and intrinsic apoptosis. In this manuscript, we review the current literature regarding how HPV-infected cells avoid apoptosis and the molecular mechanisms involved in these events. In particular, we will discuss the modifications in intrinsic and extrinsic apoptotic pathways caused by proteins encoded by HPV early genes. Many of the current efforts regarding anti-cancer drug development are focused on directing tumor cells to undergo apoptosis. However, the ability of HPV-infected cells to resist apoptotic signals renders such therapies ineffective. Possible mechanisms for overcoming the resistance of HPV-infected tumor cells to anticancer drugs will be discussed.

  10. Photoluminescent graphene quantum dots for in vivo imaging of apoptotic cells

    Science.gov (United States)

    Roy, Prathik; Periasamy, Arun Prakash; Lin, Chiu-Ya; Her, Guor-Mour; Chiu, Wei-Jane; Li, Chi-Lin; Shu, Chia-Lun; Huang, Chih-Ching; Liang, Chi-Te; Chang, Huan-Tsung

    2015-01-01

    Apoptosis (programmed cell death) is linked to many incurable neurodegenerative, cardiovascular and cancer causing diseases. Numerous methods have been developed for imaging apoptotic cells in vitro; however, there are few methods available for imaging apoptotic cells in live animals (in vivo). Here we report a novel method utilizing the unique photoluminescence properties of plant leaf-derived graphene quantum dots (GQDs) modified with annexin V antibody (AbA5) to form (AbA5)-modified GQDs (AbA5-GQDs) enabling us to label apoptotic cells in live zebrafish (Danio rerio). The key is that zebrafish shows bright red photoluminescence in the presence of apoptotic cells. The toxicity of the GQDs has also been investigated with the GQDs exhibiting high biocompatibility as they were excreted from the zebrafish's body without affecting its growth significantly at a concentration lower than 2 mg mL-1 over a period of 4 to 72 hour post fertilization. The GQDs have further been used to image human breast adenocarcinoma cell line (MCF-7 cells), human cervical cancer cell line (HeLa cells), and normal human mammary epithelial cell line (MCF-10A). These results are indispensable to further the advance of graphene-based nanomaterials for biomedical applications.Apoptosis (programmed cell death) is linked to many incurable neurodegenerative, cardiovascular and cancer causing diseases. Numerous methods have been developed for imaging apoptotic cells in vitro; however, there are few methods available for imaging apoptotic cells in live animals (in vivo). Here we report a novel method utilizing the unique photoluminescence properties of plant leaf-derived graphene quantum dots (GQDs) modified with annexin V antibody (AbA5) to form (AbA5)-modified GQDs (AbA5-GQDs) enabling us to label apoptotic cells in live zebrafish (Danio rerio). The key is that zebrafish shows bright red photoluminescence in the presence of apoptotic cells. The toxicity of the GQDs has also been investigated with

  11. Caloric restriction suppresses apoptotic cell death in the mammalian cochlea and leads to prevention of presbycusis.

    Science.gov (United States)

    Someya, Shinichi; Yamasoba, Tatsuya; Weindruch, Richard; Prolla, Tomas A; Tanokura, Masaru

    2007-10-01

    Presbycusis is characterized by an age-related progressive decline of auditory function, and arises mainly from the degeneration of hair cells or spiral ganglion (SG) cells in the cochlea. Here we show that caloric restriction suppresses apoptotic cell death in the mouse cochlea and prevents late onset of presbycusis. Calorie restricted (CR) mice, which maintained body weight at the same level as that of young control (YC) mice, retained normal hearing and showed no cochlear degeneration. CR mice also showed a significant reduction in the number of TUNEL-positive cells and cleaved caspase-3-positive cells relative to middle-age control (MC) mice. Microarray analysis revealed that CR down-regulated the expression of 24 apoptotic genes, including Bak and Bim. Taken together, our findings suggest that loss of critical cells through apoptosis is an important mechanism of presbycusis in mammals, and that CR can retard this process by suppressing apoptosis in the inner ear tissue.

  12. Proinflammatory cytokines activate the intrinsic apoptotic pathway in beta-cells

    DEFF Research Database (Denmark)

    Grunnet, Lars G; Aikin, Reid; Tonnesen, Morten F

    2009-01-01

    OBJECTIVE: Proinflammatory cytokines are cytotoxic to beta-cells and have been implicated in the pathogenesis of type 1 diabetes and islet graft failure. The importance of the intrinsic mitochondrial apoptotic pathway in cytokine-induced beta-cell death is unclear. Here, cytokine activation...... of the intrinsic apoptotic pathway and the role of the two proapoptotic Bcl-2 proteins, Bad and Bax, were examined in beta-cells. RESEARCH DESIGN AND METHODS: Human and rat islets and INS-1 cells were exposed to a combination of proinflammatory cytokines (interleukin-1beta, interferon-gamma, and/or tumor necrosis...... to investigate the role of Bad and Bax activation, respectively. RESULTS: We found that proinflammatory cytokines induced calcineurin-dependent dephosphorylation of Bad Ser136, mitochondrial stress, cytochrome c release, activation of caspase-9 and -3, and DNA fragmentation. Inhibition of Bad Ser136...

  13. Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under ER stress conditions.

    Science.gov (United States)

    Deegan, Shane; Saveljeva, Svetlana; Logue, Susan E; Pakos-Zebrucka, Karolina; Gupta, Sanjeev; Vandenabeele, Peter; Bertrand, Mathieu J M; Samali, Afshin

    2014-01-01

    Endoplasmic reticulum (ER) stress-induced cell death is normally associated with activation of the mitochondrial apoptotic pathway, which is characterized by CYCS (cytochrome c, somatic) release, apoptosome formation, and caspase activation, resulting in cell death. In this study, we demonstrate that under conditions of ER stress cells devoid of CASP9/caspase-9 or BAX and BAK1, and therefore defective in the mitochondrial apoptotic pathway, still undergo a delayed form of cell death associated with the activation of caspases, therefore revealing the existence of an alternative stress-induced caspase activation pathway. We identified CASP8/caspase-8 as the apical protease in this caspase cascade, and found that knockdown of either of the key autophagic genes, ATG5 or ATG7, impacted on CASP8 activation and cell death induction, highlighting the crucial role of autophagy in the activation of this novel ER stress-induced death pathway. In line with this, we identified a protein complex composed of ATG5, FADD, and pro-CASP8 whose assembly coincides with caspase activation and cell death induction. Together, our results reveal the toxic potential of autophagy in cells undergoing ER stress that are defective in the mitochondrial apoptotic pathway, and suggest a model in which the autophagosome functions as a platform facilitating pro-CASP8 activation. Chemoresistance, a common problem in the treatment of cancer, is frequently caused by the downregulation of key mitochondrial death effector proteins. Alternate stress-induced apoptotic pathways, such as the one described here, may become of particular relevance for tackling the problem of chemoresistance in cancer cells.

  14. A selective procedure for DNA extraction from apoptotic cells applicable for gel electrophoresis and flow cytometry.

    Science.gov (United States)

    Gong, J; Traganos, F; Darzynkiewicz, Z

    1994-05-01

    In cells undergoing apoptosis (programmed cell death), a fraction of nuclear DNA is fragmented to the size equivalent of DNA in mono- or oligonucleosomes. When such DNA is analyzed by agarose gel electrophoresis it generates the characteristic "ladder" pattern of discontinuous DNA fragments. Such a pattern of DNA degradation generally serves as a marker of the apoptotic mode of cell death. We developed a simple, rapid, and selective procedure for extraction of the degraded, low-molecular-weight DNA from apoptotic cells. The cells are prefixed in 70% ethanol, DNA is extracted with 0.2 M phosphate-citrate buffer at pH 7.8, and the extract is sequentially treated with RNase A and proteinase K and then subjected to electrophoresis. The ladder pattern was detected from DNA extracted from 1-2 x 10(6) HL-60 cells, of which as few as 8% were apoptotic, by flow cytometric criteria, as well as from blood and bone marrow samples from leukemic patients undergoing chemotherapy. The method is rapid and uses nontoxic reagents (no phenol, chloroform, etc.). This approach permits the analysis of DNA extracted from the very same cell population that is subjected to measurements by flow cytometry to estimate DNA ploidy, the cell cycle distribution of nonapoptotic cells, the percentage of apoptotic cells, or other parameters. Furthermore, the cells may be stored in 70% ethanol for at least several weeks before analysis without any significant DNA degradation. Treatment with ethanol also inactivates several pathogens, thereby increasing the safety of sample handling. The method is applicable to clinical samples, which can be fixed in ethanol and then stored and/or safety transported prior to analysis.

  15. Investigating The Anti-apoptotic Effects of Shigella Flexneri Infection In Epithelial Cells

    Science.gov (United States)

    2009-08-13

    Nakamura, Y . Nakamura, and H. Arakawa. 2002. p53AIP1 regulates the mitochondrial apoptotic pathway. Cancer Res. 62:2883-2889. 48. Micheau, O., S. Lens...hydrogen peroxide; protects from CD95 -induced apoptosis in breast cancer cells IER3 protection of cells from Fas- or TNF-alpha-induced apoptosis; involved...Glutathione peroxidase functions in the detoxification of hydrogen peroxide; protects from CD95 -induced apoptosis in breast cancer cells GSTA1

  16. Early radiation effects in highly apoptotic murine lymphoma xenografts monitored by 31P magnetic resonance spectroscopy

    International Nuclear Information System (INIS)

    Sakurai, Hideyuki; Mitsuhashi, Norio; Murata, Osamu; Kitamoto, Yoshizumi; Saito, Yoshihiro; Hasegawa, Masatoshi; Akimoto, Tetsuo; Takahashi, Takeo; Nasu, Sachiko; Niibe, Hideo

    1998-01-01

    Purpose: Phosphorus-31 magnetic resonance spectra ( 31 P-MRS) were obtained from highly apoptotic murine lymphoma xenografts before and up to 24 hr following graded doses of radiation ranging from 2 to 30 Gy. Radiation-induced apoptosis was also estimated up to 24 hr by scoring apoptotic cells in tumor tissue. Methods and Materials: Highly apoptotic murine lymphoma cells, EL4, were subcutaneously transplanted into C57/BL mice. At 7 days after transplantation, radiation was given to the tumor with a single dose at 3, 10, and 30 Gy. The β-ATP/Pi, PME/Pi, and β-ATP/PME values were calculated from the peak area of each spectrum. Radiation-induced apoptosis was scored with counting apoptotic cells on hematoxylin and eosin stained specimens (%apoptosis). Results: The values of % apoptosis 4, 8, and 24 hr after radiation were 21.8, 19.6, and 4.6% at 3 Gy, 35.1, 25.6, and 14.8% at 10 Gy, 38.4, 38.0, and 30.6% at 30 Gy, respectively (cf. 4.4% in control). There was no correlation between early change in β-ATP/Pi and % apoptosis at 4 hr after radiation when most of the apoptosis occurred. An early decrease in PME/Pi was observed at 4 hr after radiation dose at 30 Gy. For each dose, the values of β-ATP/Pi 24 hr after radiation were inversely related to radiation dose. Conclusion: The increase in β-ATP/Pi observed by 31 P-MRS was linked to the degree of histological recovery from radiation-induced apoptosis

  17. Lentinan diminishes apoptotic bodies in the ileal crypts associated with S-1 administration.

    Science.gov (United States)

    Suga, Yasuyo; Takehana, Kenji

    2017-09-01

    S-1 is an oral agent containing tegafur (a prodrug of 5-fluorouracil) that is used to treat various cancers, but adverse effects are frequent. Two pilot clinical studies have suggested that lentinan (LNT; β-1,3-glucan) may reduce the incidence of adverse effects caused by S-1 therapy. In this study, we established a murine model for assessment of gastrointestinal toxicity associated with S-1 and studied the effect of LNT. S-1 was administered orally to BALB/c mice at the effective dose (8.3mg/kg, as tegafur equivalent) once daily (5days per week) for 3weeks. Stool consistency and intestinal specimens were examined. We investigated the effect of combined intravenous administration of LNT at 0.1mg, which is an effective dose in murine tumor models. We also investigated the effect of a single administration of S-1. During long-term administration of S-1, some mice had loose stools and an increase in apoptotic bodies was observed in the ileal crypts. An increase in apoptotic bodies was also noted after a single administration of S-1 (15mg/kg). Prior or concomitant administration of LNT inhibited the increase in apoptotic bodies in both settings. Administration of LNT also increased the accumulation of CD11b + TIM-4 + cells in the ileum, while depletion of these cells by liposomal clodronate diminished the inhibitory effect of LNT on S-1 toxicity. Combined administration of LNT with S-1 led to a decrease in apoptotic bodies in the ileal crypts, possibly because LNT promoted phagocytosis of damaged cells by CD11b + TIM-4 + cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Distinct RNA profiles in subpopulations of extracellular vesicles: apoptotic bodies, microvesicles and exosomes.

    Science.gov (United States)

    Crescitelli, Rossella; Lässer, Cecilia; Szabó, Tamas G; Kittel, Agnes; Eldh, Maria; Dianzani, Irma; Buzás, Edit I; Lötvall, Jan

    2013-01-01

    In recent years, there has been an exponential increase in the number of studies aiming to understand the biology of exosomes, as well as other extracellular vesicles. However, classification of membrane vesicles and the appropriate protocols for their isolation are still under intense discussion and investigation. When isolating vesicles, it is crucial to use systems that are able to separate them, to avoid cross-contamination. EVS RELEASED FROM THREE DIFFERENT KINDS OF CELL LINES: HMC-1, TF-1 and BV-2 were isolated using two centrifugation-based protocols. In protocol 1, apoptotic bodies were collected at 2,000×g, followed by filtering the supernatant through 0.8 µm pores and pelleting of microvesicles at 12,200×g. In protocol 2, apoptotic bodies and microvesicles were collected together at 16,500×g, followed by filtering of the supernatant through 0.2 µm pores and pelleting of exosomes at 120,000×g. Extracellular vesicles were analyzed by transmission electron microscopy, flow cytometry and the RNA profiles were investigated using a Bioanalyzer(®). RNA profiles showed that ribosomal RNA was primary detectable in apoptotic bodies and smaller RNAs without prominent ribosomal RNA peaks in exosomes. In contrast, microvesicles contained little or no RNA except for microvesicles collected from TF-1 cell cultures. The different vesicle pellets showed highly different distribution of size, shape and electron density with typical apoptotic body, microvesicle and exosome characteristics when analyzed by transmission electron microscopy. Flow cytometry revealed the presence of CD63 and CD81 in all vesicles investigated, as well as CD9 except in the TF-1-derived vesicles, as these cells do not express CD9. Our results demonstrate that centrifugation-based protocols are simple and fast systems to distinguish subpopulations of extracellular vesicles. Different vesicles show different RNA profiles and morphological characteristics, but they are indistinguishable using

  19. Reemergence of apoptotic cells between fractionated doses in irradiated murine tumors

    International Nuclear Information System (INIS)

    Meyn, R.E.; Hunter, N.R.; Milas, L.

    1994-01-01

    The purpose of this investigation was to follow up our previous studies on the development of apoptosis in irradiated murine tumors by testing whether an apoptotic subpopulation of cells reemerges between fractionated exposures. Mice bearing a murine ovarian carcinoma, OCa-I, were treated in vivo with two fractionation protocols: two doses of 12.5 Gy separated by various times out to 5 days and multiple daily fractions of 2.5 Gy. Animals were killed 4 h after the last dose in each protocol, and the percent apoptosis was scored from stained histological sections made from the irradiated tumors according to the specific features characteristic of this mode of cell death. The 12.5+12.5 Gy protocol yielded a net total percent apoptosis of about 45% when the two doses were separated by 5 days (total dose = 25 Gy), whereas the 2.5 Gy per day protocol yielded about 50% net apoptotic cells when given for 5 days (total dose = 12.5 Gy). These values are to be compared to the value of 36% apoptotic cells that is yielded by large single doses (> 25 Gy). Thus, these results indicate that an apoptotic subpopulation of cells reemerged between the fractions in both protocols, but the kinetics appeared to be delayed in the 12.5+12.5 Gy vs. the multiple 2.5 Gy protocol. This reemergence of cells with the propensity for radiation-induced apoptosis between fractionated exposures is consistent with a role for this mode of cell death in the response of tumors to radiotherapy and may represent the priming of a new subpopulation of tumor cells for apoptosis as part of normal tumor homeostasis to counterbalance cell division. 25 refs., 3 figs., 1 tab

  20. Parkin Promotes Degradation of the Mitochondrial Pro-Apoptotic ARTS Protein

    Science.gov (United States)

    Kemeny, Stav; Dery, Dikla; Loboda, Yelena; Rovner, Marshall; Lev, Tali; Zuri, Dotan; Finberg, John P. M.; Larisch, Sarit

    2012-01-01

    Parkinson’s disease (PD) is associated with excessive cell death causing selective loss of dopaminergic neurons. Dysfunction of the Ubiquitin Proteasome System (UPS) is associated with the pathophysiology of PD. Mutations in Parkin which impair its E3-ligase activity play a major role in the pathogenesis of inherited PD. ARTS (Sept4_i2) is a mitochondrial protein, which initiates caspase activation upstream of cytochrome c release in the mitochondrial apoptotic pathway. Here we show that Parkin serves as an E3-ubiquitin ligase to restrict the levels of ARTS through UPS-mediated degradation. Though Parkin binds equally to ARTS and Sept4_i1 (H5/PNUTL2), the non-apoptotic splice variant of Sept4, Parkin ubiquitinates and degrades only ARTS. Thus, the effect of Parkin on ARTS is specific and probably related to its pro-apoptotic function. High levels of ARTS are sufficient to promote apoptosis in cultured neuronal cells, and rat brains treated with 6-OHDA reveal high levels of ARTS. However, over-expression of Parkin can protect cells from ARTS-induced apoptosis. Furthermore, Parkin loss-of-function experiments reveal that reduction of Parkin causes increased levels of ARTS and apoptosis. We propose that in brain cells in which the E3-ligase activity of Parkin is compromised, ARTS levels increase and facilitate apoptosis. Thus, ARTS is a novel substrate of Parkin. These observations link Parkin directly to a pro-apoptotic protein and reveal a novel connection between Parkin, apoptosis, and PD. PMID:22792159