WorldWideScience

Sample records for apoptotic enzymes escape

  1. Echinacoside induces apoptotic cancer cell death by inhibiting the nucleotide pool sanitizing enzyme MTH1

    Directory of Open Access Journals (Sweden)

    Dong L

    2015-12-01

    Full Text Available Liwei Dong,1 Hongge Wang,1 Jiajing Niu,1 Mingwei Zou,2 Nuoting Wu,1 Debin Yu,1 Ye Wang,1 Zhihua Zou11Key Laboratory for Molecular Enzymology and Engineering of the Ministry of Education, National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, Jilin Province, People’s Republic of China; 2Department of Psychology, College of Liberal Arts and Social Sciences, University of Houston, Houston, TX, USA Abstract: Inhibition of the nucleotide pool sanitizing enzyme MTH1 causes extensive oxidative DNA damages and apoptosis in cancer cells and hence may be used as an anticancer strategy. As natural products have been a rich source of medicinal chemicals, in the present study, we used the MTH1-catalyzed enzymatic reaction as a high-throughput in vitro screening assay to search for natural compounds capable of inhibiting MTH1. Echinacoside, a compound derived from the medicinal plants Cistanche and Echinacea, effectively inhibited the catalytic activity of MTH1 in an in vitro assay. Treatment of various human cancer cell lines with Echinacoside resulted in a significant increase in the cellular level of oxidized guanine (8-oxoguanine, while cellular reactive oxygen species level remained unchanged, indicating that Echinacoside also inhibited the activity of cellular MTH1. Consequently, Echinacoside treatment induced an immediate and dramatic increase in DNA damage markers and upregulation of the G1/S-CDK inhibitor p21, which were followed by marked apoptotic cell death and cell cycle arrest in cancer but not in noncancer cells. Taken together, these studies identified a natural compound as an MTH1 inhibitor and suggest that natural products can be an important source of anticancer agents. Keywords: Echinacoside, MTH1, 8-oxoG, DNA damage, apoptosis, cell cycle arrest

  2. Thymosin beta 4 protects cardiomyocytes from oxidative stress by targeting anti-oxidative enzymes and anti-apoptotic genes.

    Directory of Open Access Journals (Sweden)

    Chuanyu Wei

    Full Text Available BACKGROUND: Thymosin beta-4 (Tβ4 is a ubiquitous protein with many properties relating to cell proliferation and differentiation that promotes wound healing and modulates inflammatory mediators. The mechanism by which Tβ4 modulates cardiac protection under oxidative stress is not known. The purpose of this study is to dissect the cardioprotective mechanism of Tβ4 on H(2O(2 induced cardiac damage. METHODS: Rat neonatal cardiomyocytes with or without Tβ4 pretreatment were exposed to H(2O(2 and expression of antioxidant, apoptotic, and anti-inflammatory genes was evaluated by quantitative real-time PCR and western blotting. ROS levels were estimated by DCF-DA using fluorescent microscopy and fluorimetry. Selected antioxidant, anti-inflammatory and antiapoptotic genes were silenced by siRNA transfections in neonatal cardiomyocytes and effect of Tβ4 on H(2O(2-induced cardiac damage was evaluated. RESULTS: Pre-treatment of Tβ4 resulted in reduction of the intracellular ROS levels induced by H(2O(2 in cardiomyocytes. Tβ4 pretreatment also resulted in an increase in the expression of antiapoptotic proteins and reduction of Bax/BCl(2 ratio in the cardiomyocytes. Pretreatment with Tβ4 resulted in stimulating the expression of antioxidant enzymes copper/zinc SOD and catalase in cardiomyocytes at both transcription and translation levels. Tβ4 treatment resulted in the increased expression of anti-apoptotic and anti-inflammatory genes. Silencing of Cu/Zn SOD and catalase gene resulted in apoptotic cell death in the cardiomyocytes which was prevented by treatment with Tβ4. CONCLUSION: This is the first report that demonstrates the effect of Tβ4 on cardiomyocytes and its capability to selectively upregulate anti-oxidative enzymes, anti-inflammatory genes, and antiapoptotic enzymes in the neonatal cardiomyocytes thus preventing cell death thereby protecting the myocardium. Tβ4 treatment resulted in decreased oxidative stress and inflammation in the

  3. Reactive oxygen species are related to ionic fluxes and volume decrease in apoptotic cerebellar granule neurons: role of NOX enzymes.

    Science.gov (United States)

    Hernández-Enríquez, Berenice; Guemez-Gamboa, Alicia; Morán, Julio

    2011-05-01

    Reactive oxygen species (ROS) are produced early during apoptosis of cerebellar granule neurons induced by low potassium (K5) and staurosporine (Sts). In addition, K5 and Sts activate NADPH oxidases (NOX). Recently, we described that K5 and Sts induce apoptotic volume decrease (AVD) at a time when ROS generation and NOX activity occur. In the present study, we evaluated the relationship between ROS generation and ionic fluxes during AVD. Here, we showed that K5- and Sts-induced AVD was inhibited by antioxidants and that direct ROS production induced AVD. Moreover, NOX inhibitors eliminated AVD induced by both K5 and Sts. Sts, but not K5, failed to induce AVD in cerebellar granule neurons from NOX2 knockout mice. These findings suggest that K5- and Sts-induced AVD is largely mediated by ROS produced by NOX. On the other hand, we also found that the blockage of ionic fluxes involved in AVD inhibited both ROS generation and NOX activity. These findings suggest that ROS generation and NOX activity are involved in ionic fluxes activation, which in turn could maintain ROS generation by activating NOX, leading to a self-amplifying cycle.

  4. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  5. Enzyme

    Science.gov (United States)

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  6. Bacillus anthracis factors for phagosomal escape.

    Science.gov (United States)

    Tonello, Fiorella; Zornetta, Irene

    2012-07-01

    The mechanism of phagosome escape by intracellular pathogens is an important step in the infectious cycle. During the establishment of anthrax, Bacillus anthracis undergoes a transient intracellular phase in which spores are engulfed by local phagocytes. Spores germinate inside phagosomes and grow to vegetative bacilli, which emerge from their resident intracellular compartments, replicate and eventually exit from the plasma membrane. During germination, B. anthracis secretes multiple factors that can help its resistance to the phagocytes. Here the possible role of B. anthracis toxins, phospholipases, antioxidant enzymes and capsules in the phagosomal escape and survival, is analyzed and compared with that of factors of other microbial pathogens involved in the same type of process.

  7. Escape in Hill's Problem

    CERN Document Server

    Heggie, D C

    2000-01-01

    This didactic paper is motivated by the problem of understanding how stars escape from globular star clusters. One formulation of this problem is known, in dynamical astronomy, as Hill's problem. Originally intended as a model for the motion of the moon around the earth with perturbations by the sun, with simple modifications it also serves as a model for the motion of a star in a star cluster with perturbations by the galaxy. The paper includes introductory sections on the derivation of the equations of motion of Hill's problem, their elementary properties, and extensions to deal with non-point masses and non-circular orbits. We then show how the rate of escape may be calculated numerically and estimated theoretically, and discuss how this simple picture is modified if the stars in a cluster are also undergoing two-body relaxation. Finally we introduce some established ideas for obtaining the distribution of escape times.

  8. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis

    Science.gov (United States)

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia; Erler, Silvio; Kryger, Per; Lewkowski, Oleg; Müller, Thomas; Widder, Miriam; Moritz, Robin F. A.

    2015-01-01

    Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host’s apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap)-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion. PMID:26445372

  9. Nosema Tolerant Honeybees (Apis mellifera Escape Parasitic Manipulation of Apoptosis.

    Directory of Open Access Journals (Sweden)

    Christoph Kurze

    Full Text Available Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host's apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion.

  10. A Lucky Escape

    Institute of Scientific and Technical Information of China (English)

    王道庚

    2009-01-01

    @@ This story concerns(有关)a spider(蜘蛛)and a certain general of ancient times who had lost a battle and,in the company of(在……陪同下)a faithful(忠诚的)servant,was trying to escape(逃脱)from the enemy.Both were extremely(极度,非常)tired,and both were hungry and thirsty,but they did not dare to go into any town for fear of (担心,害怕)being discovered and captured(捉)by the enemy.Toward evening they arrived at a mountain where there was a small cave.

  11. Escape from the Alternative

    Directory of Open Access Journals (Sweden)

    Marin Dinu

    2006-12-01

    Full Text Available This paper sets out to elaborate on Romania’s specific agenda regarding the approach to the integration process in the EU as a project of modernization. The focus is on the functional aspects, the type of strategic solutions destined to consolidate the specific transformations belonging to post-communist transition seen as an internal transition, on the one hand and on the other hand to push convergence as the essence of integration, marked by the vision of EU integration as a continuation of change, which is the stage of external transition. Identifying the prominent factors and the pragmatic priorities of the escape from the peripheries of development by engaging in evolution by way of the second modernization constitutes as well a target for analysis. One particularity of the method of analysis is the review if the value-set of the bobsled effect of path dependency – the path of the peripheries – as well as of the set of values of the escape from the peripheries.

  12. Mars - an escaping planet?

    CERN Document Server

    Dvorak, R

    2005-01-01

    The chaotic behaviour of the motion of the planets in our Solar System is well established. Numerical experiments with a modified Solar System consisting of a more massive Earth have shown, that for special values of an enlargement factor K around 5 the dynamical state of a truncated planetary system (excluding Mercury and the outer planets Uranus and Neptune) is highly chaotic. On the contrary for values of the mass of the Earth up to the mass of Saturn no irregular dynamical behaviour was observed. We extended our investigations to the complete planetary system and showed, that this chaotic window found before still exists. Tests in different 'Solar Systems' showed that only including Jupiter and Saturn with their actual masses together with a 'massive' Earth (between 4 and 6 times more massive) destabilize the orbit of Mars so that even escapes from the system are possible.

  13. An escape from crowding.

    Science.gov (United States)

    Freeman, Jeremy; Pelli, Denis G

    2007-10-26

    Crowding occurs when nearby flankers jumble the appearance of a target object, making it hard to identify. Crowding is feature integration over an inappropriately large region. What determines the size of that region? According to bottom-up proposals, the size is that of an anatomically determined isolation field. According to top-down proposals, the size is that of the spotlight of attention. Intriligator and Cavanagh (2001) proposed the latter, but we show that their conclusion rests on an implausible assumption. Here we investigate the role of attention in crowding using the change blindness paradigm. We measure capacity for widely and narrowly spaced letters during a change detection task, both with and without an interstimulus cue. We find that standard crowding manipulations-reducing spacing and adding flankers-severely impair uncued change detection but have no effect on cued change detection. Because crowded letters look less familiar, we must use longer internal descriptions (less compact representations) to remember them. Thus, fewer fit into working memory. The memory limit does not apply to the cued condition because the observer need remember only the cued letter. Cued performance escapes the effects of crowding, as predicted by a top-down account. However, our most parsimonious account of the results is bottom-up: Cued change detection is so easy that the observer can tolerate feature degradation and letter distortion, making the observer immune to crowding. The change detection task enhances the classic partial report paradigm by making the test easier (same/different instead of identifying one of many possible targets), which increases its sensitivity, so it can reveal degraded memory traces.

  14. Escape rates for Gibbs measures

    CERN Document Server

    Ferguson, Andrew

    2010-01-01

    We study the asymptotic behaviour of the escape rate of a Gibbs measure supported on a conformal repeller through a small hole. There are additional applications to the convergence of Hausdorff dimension of the survivor set.

  15. Direction of escape in reindeer

    OpenAIRE

    Baskin, Leonid M.; Terje Skogland

    1997-01-01

    We tested the hypothesis that reindeer prefer to run uphill and upwind when escaping from man. Groups of wild and feral reindeer in Norway, Svalbard and on Wrangel Island were approached and their behaviour and direction of escape were recorded. Two stages of interaction with man were studied: first flight and final withdrawal. First flights proved to be away from man, upwind and uphill. Most final withdrawals were in the direction reindeer were moving when first observed.

  16. Direction of escape in reindeer

    Directory of Open Access Journals (Sweden)

    Leonid M. Baskin

    1997-04-01

    Full Text Available We tested the hypothesis that reindeer prefer to run uphill and upwind when escaping from man. Groups of wild and feral reindeer in Norway, Svalbard and on Wrangel Island were approached and their behaviour and direction of escape were recorded. Two stages of interaction with man were studied: first flight and final withdrawal. First flights proved to be away from man, upwind and uphill. Most final withdrawals were in the direction reindeer were moving when first observed.

  17. Submarine Escape Set Test Facilities

    Directory of Open Access Journals (Sweden)

    G.S.N. Murthy

    2009-07-01

    Full Text Available Submarine Escape Set (SES is used by submariners to escape from a sunken submarine. This set caters for breathing needs of the submariner under water, until he reaches the surface. Evaluation of such life-saving equipment is of paramount importance. This paper describes the submarine escape set and various constructional features and schedules of operation of test facilities designed indegenously and which can evaluate the SES. The test facility is divided into two parts: the reducer test facility, and the breathing bag test facility. The equipment has been rigorously tested and accepted by Indian Navy. Two such test facilities have been developed, one of which is installed at INS Satavahana, Visakhapatnam, and are working satisfactorily.

  18. Immunosuppressive effects of apoptotic cells

    Science.gov (United States)

    Voll, Reinhard E.; Herrmann, Martin; Roth, Edith A.; Stach, Christian; Kalden, Joachim R.; Girkontaite, Irute

    1997-11-01

    Apoptotic cell death is important in the development and homeostasis of multicellular organisms and is a highly controlled means of eliminating dangerous, damaged or unnecessary cells without causing an inflammatory response or tissue damage,. We now show that the presence of apoptotic cells during monocyte activation increases their secretion of the anti-inflammatory and immunoregulatory cytokine interleukin 10 (IL-10) and decreases secretion of the proinflammatory cytokines tumour necrosis factor-α (TNF-α), IL-1 and IL-12. This may inhibit inflammation and contribute to impaired cell-mediated immunity in conditions associated with increased apoptosis, such as viral infections, pregnancy, cancer and exposure to radiation.

  19. DYNAMICS OF THE ESCAPE RESPONSE.

    Science.gov (United States)

    requirements. It has been shown that force is a lawful response measure under positive reinforcement (Notterman and Mintz, 1965). Subjects will adjust...concluded that response force in an escape situation is a lawful response measure, and that it operates in a manner similar to force under positive reinforcement .

  20. Cold Ion Escape from Mars

    Science.gov (United States)

    Fränz, M.; Dubinin, E.; Wei, Y.; Morgan, D.; Andrews, D.; Barabash, S.; Lundin, R.; Fedorov, A.

    2013-09-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express in combination with the MARSIS radar experiment. We first compare calculations of the mean ion flux observed by ASPERA-3 alone with previously published results. We then combine observations of the cold ion velocity by ASPERA-3 with observations of the cold plasma density by MARSIS since ASPERA-3 misses the cold core of the ion distribution. We show that the mean density of the nightside plasma observed by MARSIS is about two orders higher than observed by ASPERA-3 (Fig.1). Combining both datasets we show that the main escape channel is along the shadow boundary on the tailside of Mars (Fig. 2). At a distance of about 0.5 R_M the flux settles at a constant value (Fig. 3) which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  1. Apoptotic markers in protozoan parasites

    Directory of Open Access Journals (Sweden)

    Fasel Nicolas

    2010-11-01

    Full Text Available Abstract The execution of the apoptotic death program in metazoans is characterized by a sequence of morphological and biochemical changes that include cell shrinkage, presentation of phosphatidylserine at the cell surface, mitochondrial alterations, chromatin condensation, nuclear fragmentation, membrane blebbing and the formation of apoptotic bodies. Methodologies for measuring apoptosis are based on these markers. Except for membrane blebbing and formation of apoptotic bodies, all other events have been observed in most protozoan parasites undergoing cell death. However, while techniques exist to detect these markers, they are often optimised for metazoan cells and therefore may not pick up subtle differences between the events occurring in unicellular organisms and multi-cellular organisms. In this review we discuss the markers most frequently used to analyze cell death in protozoan parasites, paying special attention to changes in cell morphology, mitochondrial activity, chromatin structure and plasma membrane structure/permeability. Regarding classical regulators/executors of apoptosis, we have reviewed the present knowledge of caspase-like and nuclease activities.

  2. Apoptotic markers in protozoan parasites.

    Science.gov (United States)

    Jiménez-Ruiz, Antonio; Alzate, Juan Fernando; Macleod, Ewan Thomas; Lüder, Carsten Günter Kurt; Fasel, Nicolas; Hurd, Hilary

    2010-11-09

    The execution of the apoptotic death program in metazoans is characterized by a sequence of morphological and biochemical changes that include cell shrinkage, presentation of phosphatidylserine at the cell surface, mitochondrial alterations, chromatin condensation, nuclear fragmentation, membrane blebbing and the formation of apoptotic bodies. Methodologies for measuring apoptosis are based on these markers. Except for membrane blebbing and formation of apoptotic bodies, all other events have been observed in most protozoan parasites undergoing cell death. However, while techniques exist to detect these markers, they are often optimised for metazoan cells and therefore may not pick up subtle differences between the events occurring in unicellular organisms and multi-cellular organisms.In this review we discuss the markers most frequently used to analyze cell death in protozoan parasites, paying special attention to changes in cell morphology, mitochondrial activity, chromatin structure and plasma membrane structure/permeability. Regarding classical regulators/executors of apoptosis, we have reviewed the present knowledge of caspase-like and nuclease activities.

  3. ESCAPE AS REINFORCEMENT AND ESCAPE EXTINCTION IN THE TREATMENT OF FEEDING PROBLEMS

    OpenAIRE

    LaRue, Robert H; Stewart, Victoria; Piazza, Cathleen C; Volkert, Valerie M.; Patel, Meeta R; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of swallowing), escape as reinforcement for mouth clean plus escape extinction (EE), and EE alone as treatment for the food refusal of 5 children. Results were si...

  4. Photochemical Escape of Oxygen from Early Mars

    CERN Document Server

    Zhao, Jinjin

    2015-01-01

    Photochemical escape is an important process for oxygen escape from present Mars. In this work, a 1-D Monte-Carlo Model is developed to calculate escape rates of energetic oxygen atoms produced from O2+ dissociative recombination reactions (DR) under 1, 3, 10, and 20 times present solar XUV fluxes. We found that although the overall DR rates increase with solar XUV flux almost linearly, oxygen escape rate increases from 1 to 10 times present solar XUV conditions but decreases when increasing solar XUV flux further. Analysis shows that atomic species in the upper thermosphere of early Mars increases more rapidly than O2+ when increasing XUV fluxes. While the latter is the source of energetic O atoms, the former increases the collision probability and thus decreases the escape probability of energetic O. Our results suggest that photochemical escape be a less important escape mechanism than previously thought for the loss of water and/or CO2 from early Mars.

  5. Energy-limited escape revised

    CERN Document Server

    Salz, M; Czesla, S; Schmitt, J H M M

    2016-01-01

    Gas planets in close proximity to their host stars experience photoevaporative mass loss. The energy-limited escape concept is generally used to derive estimates for the planetary mass-loss rates. Our photoionization hydrodynamics simulations of the thermospheres of hot gas planets show that the energy-limited escape concept is valid only for planets with a gravitational potential lower than $\\log_\\mathrm{10}\\left( -\\Phi_{\\mathrm{G}}\\right) < 13.11~$erg$\\,$g$^{-1}$ because in these planets the radiative energy input is efficiently used to drive the planetary wind. Massive and compact planets with $\\log_\\mathrm{10}\\left( -\\Phi_{\\mathrm{G}}\\right) \\gtrsim 13.6~$erg$\\,$g$^{-1}$ exhibit more tightly bound atmospheres in which the complete radiative energy input is re-emitted through hydrogen Ly$\\alpha$ and free-free emission. These planets therefore host hydrodynamically stable thermospheres. Between these two extremes the strength of the planetary winds rapidly declines as a result of a decreasing heating eff...

  6. Bacillus anthracis Factors for Phagosomal Escape

    Directory of Open Access Journals (Sweden)

    Irene Zornetta

    2012-07-01

    Full Text Available The mechanism of phagosome escape by intracellular pathogens is an important step in the infectious cycle. During the establishment of anthrax, Bacillus anthracis undergoes a transient intracellular phase in which spores are engulfed by local phagocytes. Spores germinate inside phagosomes and grow to vegetative bacilli, which emerge from their resident intracellular compartments, replicate and eventually exit from the plasma membrane. During germination, B. anthracis secretes multiple factors that can help its resistance to the phagocytes. Here the possible role of B. anthracis toxins, phospholipases, antioxidant enzymes and capsules in the phagosomal escape and survival, is analyzed and compared with that of factors of other microbial pathogens involved in the same type of process.

  7. Apoptotic engulfment pathway and schizophrenia.

    Directory of Open Access Journals (Sweden)

    Xiangning Chen

    Full Text Available BACKGROUND: Apoptosis has been speculated to be involved in schizophrenia. In a previously study, we reported the association of the MEGF10 gene with the disease. In this study, we followed the apoptotic engulfment pathway involving the MEGF10, GULP1, ABCA1 and ABCA7 genes and tested their association with the disease. METHODOLOGY/PRINCIPAL FINDINGS: Ten, eleven and five SNPs were genotyped in the GULP1, ABCA1 and ABCA7 genes respectively for the ISHDSF and ICCSS samples. In all 3 genes, we observed nominally significant associations. Rs2004888 at GULP1 was significant in both ISHDSF and ICCSS samples (p = 0.0083 and 0.0437 respectively. We sought replication in independent samples for this marker and found highly significant association (p = 0.0003 in 3 Caucasian replication samples. But it was not significant in the 2 Chinese replication samples. In addition, we found a significant 2-marker (rs2242436 * rs3858075 interaction between the ABCA1 and ABCA7 genes in the ISHDSF sample (p = 0.0022 and a 3-marker interaction (rs246896 * rs4522565 * rs3858075 amongst the MEGF10, GULP1 and ABCA1 genes in the ICCSS sample (p = 0.0120. Rs3858075 in the ABCA1 gene was involved in both 2- and 3-marker interactions in the two samples. CONCLUSIONS/SIGNIFICANCE: From these data, we concluded that the GULP1 gene and the apoptotic engulfment pathway are involved in schizophrenia in subjects of European ancestry and multiple genes in the pathway may interactively increase the risks to the disease.

  8. Apoptotic engulfment pathway and schizophrenia.

    LENUS (Irish Health Repository)

    Chen, Xiangning

    2009-01-01

    BACKGROUND: Apoptosis has been speculated to be involved in schizophrenia. In a previously study, we reported the association of the MEGF10 gene with the disease. In this study, we followed the apoptotic engulfment pathway involving the MEGF10, GULP1, ABCA1 and ABCA7 genes and tested their association with the disease. METHODOLOGY\\/PRINCIPAL FINDINGS: Ten, eleven and five SNPs were genotyped in the GULP1, ABCA1 and ABCA7 genes respectively for the ISHDSF and ICCSS samples. In all 3 genes, we observed nominally significant associations. Rs2004888 at GULP1 was significant in both ISHDSF and ICCSS samples (p = 0.0083 and 0.0437 respectively). We sought replication in independent samples for this marker and found highly significant association (p = 0.0003) in 3 Caucasian replication samples. But it was not significant in the 2 Chinese replication samples. In addition, we found a significant 2-marker (rs2242436 * rs3858075) interaction between the ABCA1 and ABCA7 genes in the ISHDSF sample (p = 0.0022) and a 3-marker interaction (rs246896 * rs4522565 * rs3858075) amongst the MEGF10, GULP1 and ABCA1 genes in the ICCSS sample (p = 0.0120). Rs3858075 in the ABCA1 gene was involved in both 2- and 3-marker interactions in the two samples. CONCLUSIONS\\/SIGNIFICANCE: From these data, we concluded that the GULP1 gene and the apoptotic engulfment pathway are involved in schizophrenia in subjects of European ancestry and multiple genes in the pathway may interactively increase the risks to the disease.

  9. Escape as Reinforcement and Escape Extinction in the Treatment of Feeding Problems

    Science.gov (United States)

    LaRue, Robert H.; Stewart, Victoria; Piazza, Cathleen C.; Volkert, Valerie M.; Patel, Meeta R.; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of…

  10. Escape of atmospheric gases from the Moon

    Indian Academy of Sciences (India)

    Da Dao-an; Yang Ya-tian

    2005-12-01

    The escape rate of atmospheric molecules on the Moon is calculated.Based on the assumption that the rates of emission and escape of gases attain equilibrium, the ratio of molecular number densities during day and night, 0/0, can be explained. The plausible emission rate of helium and radioactive elements present in the Moon has also been calculated.

  11. Escaping in Literature. Teaching in the Library.

    Science.gov (United States)

    Hurst, Carol Otis

    1993-01-01

    Explores the "escape" genre of children's literature, and recommends and describes several books that deal with such topics as escape from prison camps, from slavery, from the Holocaust, from war, and from Utopian societies. These books should provoke meaningful classroom discussions and allow children to view their own world from different…

  12. Statin escape phenomenon: Fact or fiction?

    Science.gov (United States)

    Barkas, Fotios; Elisaf, Moses; Klouras, Eleftherios; Dimitriou, Theodora; Tentolouris, Nikolaos; Liberopoulos, Evangelos

    2017-01-01

    AIM To evaluate the presence of the so called “statin escape” phenomenon among hyperlipidemic subjects attending a lipid clinic. METHODS This was a retrospective analysis of 1240 hyperlipidemic individuals followed-up for ≥ 3 years. We excluded those individuals meeting one of the following criteria: Use of statin therapy at baseline visit, discontinuation of statin treatment at most recent visit, change in statin treatment during follow-up and poor compliance to treatment. Statin escape phenomenon was defined as an increase in low-density lipoprotein cholesterol (LDL-C) levels at the most recent visit by > 10% compared with the value at 6 mo following initiation of statin treatment. RESULTS Of 181 eligible subjects, 31% exhibited the statin escape phenomenon. No major differences regarding baseline characteristics were found between statin escapers and non-statin escapers. Both escapers and non-escapers had similar baseline LDL-C levels [174 (152-189) and 177 (152-205) mg/dL, respectively]. In comparison with non-escapers, statin escapers demonstrated lower LDL-C levels at 6 mo after treatment initiation [88 (78-97) mg/dL vs 109 (91-129) mg/dL, P statin-treated individuals. The clinical significance of this phenomenon remains uncertain.

  13. Atmospheric escape, redox evolution, and planetary habitability

    Science.gov (United States)

    Catling, D. C.; Zahnle, K. J.

    2011-12-01

    Through the greenhouse effect, the presence and composition of an atmosphere is critical for defining a (conventional) circumstellar habitable zone in terms of planetary surface temperatures suitable for liquid water. Lack of knowledge of planetary atmospheres is likely to frustrate attempts to say with any certainty whether detected terrestrial-sized exoplanets may or may not be habitable. Perhaps an underappreciated role in such considerations is the evolutionary effect of atmospheric escape for determining atmospheric composition or whether an atmosphere exists in the first place. Whether atmospheres exist at all on planets is demonstrably connected to the effect of integrated atmospheric escape. When we observe our own Solar System and transiting exoplanets, the existence of an atmosphere is clearly delineated by a relative vulnerability to thermal escape and impact erosion. The prevalence of thermal escape as a key evolutionary determinant for the presence of planetary atmosphere is shown by a relationship between the relative solar (or stellar) heating and the escape velocity. Those bodies with too much stellar heating and too smaller escape velocity end up devoid of atmospheres. Impact erosion is evident in the relationship between impact velocity and escape velocity. Escape due to impacts is particularly important for understanding the large differences in the atmospheres of giant planet moons, such as Ganymede versus Titan. It is also significant for Mars-sized planets. The oxidation state of atmospheres is important for some theories of the origin of life (where an early reducing atmosphere is helpful for organic synthesis) and the evolution of advanced life (where free molecular oxygen is the best source of high energy metabolism). Surfaces on some relatively small planets and moons are observed to have evolved to an oxidized state, which theory and observation can explain through atmospheric escape. There are several examples in the Solar System where a

  14. Enhanced apoptotic response to photodynamic therapy after bcl-2 transfection.

    Science.gov (United States)

    Kim, H R; Luo, Y; Li, G; Kessel, D

    1999-07-15

    Apoptosis is a cellular death process involving the sequential activation of a series of caspases, endonucleases, and other enzymes. The initiation of apoptosis can be inhibited by overexpression of bcl-2 and certain other members of a related family of proteins. We examined the effects of bcl-2 overexpression on the apoptotic response to photodynamic therapy (PDT), using aluminum phthalocyanine as the photosensitizing agent. In this study, we compared the immortalized human breast epithelial cell line MCF10A with a subline (MCF10A/bcl-2) transfected with the human bcl-2 gene. The latter was approximately 2-fold more sensitive to the phototoxic effects of PDT. At a 50 mJ/cm2 light dose, photodamage to MCF-10A/bcl-2 resulted in a greater loss of the mitochondrial membrane potential (delta(psi)m), enhanced release of mitochondrial cytochrome c, a more rapid and greater activation of caspase-3, and a greater apoptotic response. Western blot analysis revealed that the transfected cell line showed overexpression of both bcl-2 and bax, and that PDT caused selective destruction of bcl-2, leaving bax unaffected. The greater apoptotic response by the transfected line is, therefore, attributed to the higher bax:bcl-2 ratio after photodamage.

  15. Optimal escape theory predicts escape behaviors beyond flight initiation distance: risk assessment and escape by striped plateau lizards Sceloporus virgatus

    Institute of Scientific and Technical Information of China (English)

    William E.COOPER Jr

    2009-01-01

    Escape theory predicts that flight initiation distance (FID=distance between predator and prey when escape begins) is longer when risk is greater and shorter when escape is more costly. A few tests suggest that escape theory applies to distance fled. Escape models have not addressed stochastic variables, such as probability of fleeing and of entering refuge, but their economic logic might be applicable. Experiments on several risk factors in the lizard Sceloporus virgatus confirmed all predictions for the above escape variables. FID was greater when approach was faster and more direct, for lizards on ground than on trees, for lizards rarely exposed to humans, for the second of two approaches, and when the predator turned toward lizards rather than away. Lizards fled further during rapid and second consecutive approaches. They were more likely to flee when approached directly, when a predator turned toward them, and during second approaches. They were more likely to enter refuge when approached rapidly. A novel finding is that perch height in trees was unrelated to FID because lizards escaped by moving out of sight, then moving up or down unpredictably. These findings add to a growing body of evidence supporting predictions of escape theory for FID and distance fled. They show that two probabilistic aspects of escape are predictable based on relative predation risk levels. Because individuals differ in boldness, the assessed optimal FID and threshold risks for fleeing and entering refuge are exceeded for an increasing proportion of individuals as risk increases[Current Zoology 55(2):123-131,2009].

  16. Quantifying Distributions of Lyman Continuum Escape Fraction

    CERN Document Server

    Cen, Renyue

    2015-01-01

    Simulations have indicated that most of the escaped Lyman continuum photons escape through a minority of solid angles with near complete transparency, with the remaining majority of the solid angles largely opaque, resulting in a very broad and skewed probability distribution function (PDF) of the escape fraction when viewed at different angles. Thus, the escape fraction of Lyman continuum photons of a galaxy observed along a line of sight merely represents the properties of the interstellar medium along that line of sight, which may be an ill-representation of true escape fraction of the galaxy averaged over its full sky. Here we study how Lyman continuum photons escape from galaxies at $z=4-6$, utilizing high-resolution large-scale cosmological radiation-hydrodynamic simulations. We compute the PDF of the mean escape fraction ($\\left$) averaged over mock observational samples, as a function of the sample size, compared to the true mean (had you an infinite sample size). We find that, when the sample size is...

  17. The escape velocity and Schwarzschild metric

    CERN Document Server

    Murzagalieva, A G; Murzagaliev, G Z

    2002-01-01

    The escape velocity value in the terms of general relativity by means Schwarzschild metric is provided to make of the motion equation with Friedman cosmological model behavior build in the terms of Robertson-Worker metric. (author)

  18. Intercellular transfer of apoptotic signals via electrofusion

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jin Suk; Lee, Wilson; McCulloch, Christopher A., E-mail: christopher.mcculloch@utoronto.ca

    2012-05-01

    We determined whether cells that are induced to undergo anoikis by matrix detachment can initiate apoptosis in healthy cells following electroporation-induced fusion. Separate populations of MDCK cells undergoing anoikis and stained with FITC-annexin or viable MDCK cells that were labeled with spectrally discrete fluorescent beads were electroporated. Cells were analyzed by flow cytometry for enumeration of viable cells with beads, apoptotic cells or fused cells. Electroporation promoted a 49-fold increase of the percentage of viable cells that had fused with apoptotic cells. Apoptotic cell-viable cell fusions were 8-fold more likely to not attach to cell culture plastic and 2.3-fold less likely to proliferate after 24 hr incubation than viable cell fusion controls. These data demonstrate that apoptotic signals can be transferred between cells by electrofusion, possibly suggesting a novel investigative approach for optimizing targeted cell deletion in cancer treatment.

  19. Polymer escape from a confining potential

    Energy Technology Data Exchange (ETDEWEB)

    Mökkönen, Harri, E-mail: harri.mokkonen@aalto.fi [Department of Applied Physics and COMP CoE, Aalto University School of Science, P.O. Box 11100, FIN-00076 Aalto, Espoo (Finland); Faculty of Physical Sciences, University of Iceland, Reykjavík (Iceland); Ikonen, Timo [Department of Applied Physics and COMP CoE, Aalto University School of Science, P.O. Box 11100, FIN-00076 Aalto, Espoo (Finland); VTT Technical Research Centre of Finland, P.O. Box 1000, FI-02044 VTT (Finland); Jónsson, Hannes [Department of Applied Physics and COMP CoE, Aalto University School of Science, P.O. Box 11100, FIN-00076 Aalto, Espoo (Finland); Faculty of Physical Sciences, University of Iceland, Reykjavík (Iceland); Department of Physics, Brown University, Providence, Rhode Island 02912-1843 (United States); Ala-Nissila, Tapio [Department of Applied Physics and COMP CoE, Aalto University School of Science, P.O. Box 11100, FIN-00076 Aalto, Espoo (Finland); Department of Physics, Brown University, Providence, Rhode Island 02912-1843 (United States)

    2014-02-07

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  20. Genes that escape from X inactivation.

    Science.gov (United States)

    Berletch, Joel B; Yang, Fan; Xu, Jun; Carrel, Laura; Disteche, Christine M

    2011-08-01

    To achieve a balanced gene expression dosage between males (XY) and females (XX), mammals have evolved a compensatory mechanism to randomly inactivate one of the female X chromosomes. Despite this chromosome-wide silencing, a number of genes escape X inactivation: in women about 15% of X-linked genes are bi-allelically expressed and in mice, about 3%. Expression from the inactive X allele varies from a few percent of that from the active allele to near equal expression. While most genes have a stable inactivation pattern, a subset of genes exhibit tissue-specific differences in escape from X inactivation. Escape genes appear to be protected from the repressive chromatin modifications associated with X inactivation. Differences in the identity and distribution of escape genes between species and tissues suggest a role for these genes in the evolution of sex differences in specific phenotypes. The higher expression of escape genes in females than in males implies that they may have female-specific roles and may be responsible for some of the phenotypes observed in X aneuploidy.

  1. Escape statistics for parameter sweeps through bifurcations.

    Science.gov (United States)

    Miller, Nicholas J; Shaw, Steven W

    2012-04-01

    We consider the dynamics of systems undergoing parameter sweeps through bifurcation points in the presence of noise. Of interest here are local codimension-one bifurcations that result in large excursions away from an operating point that is transitioning from stable to unstable during the sweep, since information about these "escape events" can be used for system identification, sensing, and other applications. The analysis is based on stochastic normal forms for the dynamic saddle-node and subcritical pitchfork bifurcations with a time-varying bifurcation parameter and additive noise. The results include formulation and numerical solution for the distribution of escape events in the general case and analytical approximations for delayed bifurcations for which escape occurs well beyond the corresponding quasistatic bifurcation points. These bifurcations result in amplitude jumps encountered during parameter sweeps and are particularly relevant to nano- and microelectromechanical systems, for which noise can play a significant role.

  2. Thermal escape from extrasolar giant planets.

    Science.gov (United States)

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres.

  3. Cosmic ray escape from supernova remnants

    CERN Document Server

    Gabici, Stefano

    2011-01-01

    Galactic cosmic rays are believed to be accelerated at supernova remnants via diffusive shock acceleration. Though this mechanism gives fairly robust predictions for the spectrum of particles accelerated at the shock, the spectrum of the cosmic rays which are eventually injected in the interstellar medium is more uncertain and depends on the details of the process of particle escape from the shock. Knowing the spectral shape of these escaping particles is of crucial importance in order to assess the validity of the supernova remnant paradigm for cosmic ray origin. Moreover, after escaping from a supernova remnant, cosmic rays interact with the surrounding ambient gas and produce gamma rays in the vicinity of the remnant itself. The detection of this radiation can be used as an indirect proof of the fact that the supernova remnant was indeed accelerating cosmic rays in the past.

  4. Martian Atmospheric and Ionospheric plasma Escape

    Science.gov (United States)

    Lundin, Rickard

    2016-04-01

    Solar forcing is responsible for the heating, ionization, photochemistry, and erosion processes in the upper atmosphere throughout the lifetime of the terrestrial planets. Of the four terrestrial planets, the Earth is the only one with a fully developed biosphere, while our kin Venus and Mars have evolved into arid inhabitable planets. As for Mars, there are ample evidences for an early Noachian, water rich period on Mars. The question is, what made Mars evolve so differently compared to the Earth? Various hydrosphere and atmospheric evolution scenarios for Mars have been forwarded based on surface morphology, chemical composition, simulations, semi-empiric (in-situ data) models, and the long-term evolution of the Sun. Progress has been made, but the case is still open regarding the changes that led to the present arid surface and tenuous atmosphere at Mars. This presentation addresses the long-term variability of the Sun, the solar forcing impact on the Martian atmosphere, and its interaction with the space environment - an electromagnetic wave and particle interaction with the upper atmosphere that has implications for its photochemistry, composition, and energization that governs thermal and non-thermal escape. Non-thermal escape implies an electromagnetic upward energization of planetary ions and molecules to velocities above escape velocity, a process governed by a combination of solar EUV radiation (ionization), and energy and momentum transfer by the solar wind. The ion escape issue dates back to the early Soviet and US-missions to Mars, but the first more accurate estimates of escape rates came with the Phobos-2 mission in 1989. Better-quality ion composition measurement results of atmospheric/ionospheric ion escape from Mars, obtained from ESA Mars Express (MEX) instruments, have improved our understanding of the ion escape mechanism. With the NASA MAVEN spacecraft orbiting Mars since Sept. 2014, dual in-situ measurement with plasma instruments are now

  5. Do the visual conditions at the point of escape affect European sea bass escape behavior?

    Directory of Open Access Journals (Sweden)

    I.E. PAPADAKIS

    2013-04-01

    Full Text Available European sea bass (Dicentrarchus labrax, an important species for the Mediterranean aquaculture industry, has been reported to escape from sea cage installations. Fish escapes are caused mainly by operational and technical failures that eventually result into a creation of a tear. Escapees may interact with wild stocks through interbreeding, transfer of pathogens and competition for food. The aim of this study was to examine at which extent the presence of a visible obstacle close to a tear on the net have an influence on sea bass propensity to escape. Fish were initially confined into small sea cages, with a tear at one side. The escape behavior was tested under experimental conditions. It is clearly demonstrated that sea bass was able to locate a tear on the net pen, immediately after its appearance. Crossings occurred in all cages, in singles or in a series of up to seven individuals. The presence of an obstacle close to the net tear altered the escape behavior of D. labrax resulting in a delay that eventually reduced the escape rate. Concluding, it is highly recommended that sea bass cages should be kept internally the culture array. Furthermore, the placement of artificial obstacles close to the sea cages could be an efficient practice that mitigates the escape risk after severe environmental conditions.

  6. Nociception and escape behavior in planarians

    Science.gov (United States)

    Schoetz Collins, Eva-Maria

    2015-03-01

    Planarians are famous and widely studied for their regenerative capabilities. When a moving planarian is cut through the middle, the resulting head and tail pieces instantaneously retract and exhibit a characteristic escape response that differs from normal locomotion. In asexual animals, a similar reaction is observed when the planarian undergoes fission, suggesting that reproduction through self-tearing is a rather traumatic event for the animal. Using a multiscale approach, we unravel the dynamics, mechanics, and functional aspects of the planarian escape response. This musculature-driven gait was found to be a dominating response that supersedes the urge to feed or reproduce and quantitatively differs from other modes of planarian locomotion (gliding, peristalsis). We show that this escape gait constitutes the animal's pain response mediated by TRP like receptors and the neurotransmitter histamine, and that it can be induced through adverse thermal, mechanical, electrical or chemical stimuli. Ultimately, we will examine the neuronal subpopulations involved in mediating escape reflexes in planarians and how they are functionally restored during regeneration, thereby gaining mechanistic insight into the neuronal circuits required for specific behaviors. Supported by BWF CASI and Sloan Foundation.

  7. Net escapement of Antartic krill in trawls

    DEFF Research Database (Denmark)

    Krafft, B.A.; Krag, Ludvig Ahm; Herrmann, Bent;

    This document describes the aims and methodology of a three year project (commenced in 2012) entitled Net Escapement of Antarctic krill in Trawls (NEAT). The study will include a morphology based mathematical modeling (FISHSELECT) of different sex and maturity groups of Antarctic krill (Euphausia...

  8. Centrifugally Stimulated Exospheric Ion Escape at Mercury

    Science.gov (United States)

    Delcourt, Dominique; Seki, K.; Terada, N.; Moore, Thomas E.

    2012-01-01

    We investigate the transport of ions in the low-altitude magnetosphere magnetosphere of Mercury. We show that, because of small spatial scales, the centrifugal effect due to curvature of the E B drift paths can lead to significant particle energization in the parallel direction. We demonstrate that because of this effect, ions with initial speed smaller than the escape speed such as those produced via thermal desorption can overcome gravity and escape into the magnetosphere. The escape route of this low-energy exosphere originating material is largely controlled by the magnetospheric convection rate. This escape route spreads over a narrower range of altitudes when the convection rate increases. Bulk transport of low-energy planetary material thus occurs within a limited region of space once moderate magnetospheric convection is established. These results suggest that, via release of material otherwise gravitationally trapped, the E B related centrifugal acceleration is an important mechanism for the net supply of plasma to the magnetosphere of Mercury.

  9. Apoptotic activity in Libyan breast cancer

    Directory of Open Access Journals (Sweden)

    Boder Jamela

    2012-06-01

    Full Text Available Abstract Background We evaluated the relationship of the apoptotic activity index (AI and the standardized mitotic-apoptotic ratio (SMI/AI with clinicopathological features and prognosis in Libyan female breast cancer (BC patients. We then compared our results with corresponding results in Finnish and Nigerian female BC patients. Methods Histological samples of breast carcinoma from 130 patients were retrospectively studied: an estimation of the apoptotic activity per square millimeter (expressed as apoptotic activity index (AI, and standardized mitotic-apoptotic ratio (SMI/AI was made, and the results compared with the clinicopathological features and the patient’s survival. Results There was a statistically significant correlation between the AI and most of the clinicopathological features; the strongest association was observed for clinical stage lymph node (LN status (P = 0.005. There were also correlations between AI and histological grade (P = 0.035, large tumor size (P = 0.011 and the clinical stage (P = 0.009. There were, however, prominent AI differences between Libyan, Nigerian and Finnish populations. The mean values of AI and SMI/AI in Libyan BC patients were 12.8 apoptotic figures per square millimeter and 2.8, respectively. The Libyan AI is slightly higher than in Nigeria, but much higher than in Finland. The differences between countries are seen throughout the samples as well as being present in certain subgroups. The survival analysis indicated that short survival time was associated with high apoptotic indices values and so can identify aggressive tumors and provide significant prognostic support. The cutoff (4 and 18 apoptosis/mm2 of AI might be applied as a quantitative criterion for Libyan BC to separate the patients into good, moderate and bad prognosis groups. Conclusions The results indicated that the differences in AI among the three countries may be due to the known variation in the distribution of

  10. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  11. Enzyme assays.

    Science.gov (United States)

    Reymond, Jean-Louis; Fluxà, Viviana S; Maillard, Noélie

    2009-01-07

    Enzyme assays are analytical tools to visualize enzyme activities. In recent years a large variety of enzyme assays have been developed to assist the discovery and optimization of industrial enzymes, in particular for "white biotechnology" where selective enzymes are used with great success for economically viable, mild and environmentally benign production processes. The present article highlights the aspects of fluorogenic and chromogenic substrates, sensors, and enzyme fingerprinting, which are our particular areas of interest.

  12. The escape problem for mortal walkers

    CERN Document Server

    Grebenkov, D S

    2016-01-01

    We introduce and investigate the escape problem for random walkers that may eventually die, decay, bleach, or lose activity during their diffusion towards an escape or reactive region on the boundary of a confining domain. In the case of a first-order kinetics (i.e., exponentially distributed lifetimes), we study the effect of the associated death rate onto the survival probability, the exit probability, and the mean first passage time. We derive the upper and lower bounds and some approximations for these quantities. We reveal three asymptotic regimes of small, intermediate and large death rates. General estimates and asymptotics are compared to several explicit solutions for simple domains, and to numerical simulations. These results allow one to account for stochastic photobleaching of fluorescent tracers in bio-imaging, degradation of mRNA molecules in genetic translation mechanisms, or high mortality rates of spermatozoa in the fertilization process. This is also a mathematical ground for optimizing stor...

  13. Escape and Stand of the Pluto Atmosphere

    Institute of Scientific and Technical Information of China (English)

    GAO Chong-Yi

    2002-01-01

    Molar mass μmin of the lightest gas, which will exist "forever" in the atmosphere at the planet surface,can be evaluated by Jeans rule. The μmin of Pluto is 17.3 g@ mol-1. It is evident that both N2 and CO can be major atmospheric composition at the Pluto surface, and will exist "forever". CH4 can only be escaping slowly from Pluto atmosphere, and still holds quite a proportion in current Pluto atmosphere. However, it will not escape from Titan (or Jupiter, Saturn) atmosphere largely, and will exist "forever". Given the quantitylevelof partial pressure of CH4 in Pluto and Titan (or Jupiter, Saturn) original atmosphere is the same, it will be clear that the current partial pressure of CH4 in Pluto surface atmosphere is 10-3 Pa.

  14. Stabilization Of Apoptotic Cells: Generation Of Zombie Cells

    Directory of Open Access Journals (Sweden)

    José A. Sánchez Alcázar

    2015-08-01

    Stabilization of apoptotic cells can be used for reliable detection and quantification of apoptosis in cultured cells and may allow a safer administration of apoptotic cells in clinical applications. Furthermore, it opens new avenues in the functional reconstruction of apoptotic cells for longer preservation.

  15. Effects of submarine escape training on the pulmonary function and carbon dioxide retention in the escape

    Institute of Scientific and Technical Information of China (English)

    CHEN Rui-yong; WANG Wen-bo; FANG Yi-qun; XU Ji; XU Lin-jun

    2011-01-01

    Objective Fast buoyancy ascent escape used in submarine escape is the most probable choice of survival in case of a submarine accident.Rate of success for escape depends very much on the extent of training,in spite of the fact that rapid compression and decompression pose great challenges to the human body in terms of enormous stresses.To minimize stresses experienced during sub escape training has always been a research subject for us.Lungs are susceptible to rapid change in pressure during escape.Dynamic pulmonary function and the end-tidal PCO2 ( PETCO2 ) might be the best indicator for its effect on the pulmonary function of the submarine escapee.Methods Five male navy divers received submarine escape trainings,at different depths from 3-60 m.They were compressed at different rates (with pressure doubled every 20 s or 30 s),in the simulated submarine escape tower located in the Naval Medical Research Institute.The gas of end-expiration was collected immediately after escape,respiratory rate (RR) and dynamic pulmonary function were closely monitored,and PETCO2 was determined with the mass spectrometer.Results Experimental results showed that forced expiratory volume in 1 second (FEV1.0) tended to increase with increasing depth,and that it increased significantly at 50 m and 60 m,when compared with the basic data (P < 0.05 ),and it was coupled with a decrease in forced expiratory flow at 25 % ( FEF25% ),indicating that it had certain effect on the function of small airways.PETCO2 and RR all elevated markedly following escapes.No significant differences could be seen in RR following escapes at various depths.PETCO2 and depth ( r =0.387,P < 0.01 ) were positively correlated with compression rate ( r =0.459,P < 0.01 ) and RR ( r =0.467,P < 0.01 ).CO2 retention might be attributed to pulmonary ventilation disorder induced by rapid changes in pressure.PETCO2 was within normal range,following escapes at various depths,suggesting that increased RR might be

  16. Apoptotic death sensor: an organelle's alter ego?

    Science.gov (United States)

    Bratton, S B; Cohen, G M

    2001-06-01

    Caspases are intracellular cysteine proteases that are primarily responsible for the stereotypic morphological and biochemical changes that are associated with apoptosis. Caspases are often activated by the apoptotic protease-activating factor 1 (APAF-1) apoptosome, a complex that is formed following mitochondrial release of cytochrome c in response to many death-inducing stimuli. Both pro- and anti-apoptotic BCL-2 family members regulate apoptosis, primarily by their effects on mitochondria, whereas many inhibitor of apoptosis proteins (IAPs) regulate apoptosis by directly inhibiting distinct caspases. Exposure of cells to chemicals and radiation, as well as loss of trophic stimuli, perturb cellular homeostasis and, depending on the type of cellular stress, particular or multiple organelles appear to 'sense' the damage and signal the cell to undergo apoptosis by stimulating the formation of unique and/or common caspase-activating complexes.

  17. Xenon Fractionation and Archean Hydrogen Escape

    Science.gov (United States)

    Zahnle, K. J.

    2015-01-01

    Xenon is the heaviest gas found in significant quantities in natural planetary atmospheres. It would seem the least likely to escape. Yet there is more evidence for xenon escape from Earth than for any element other than helium and perhaps neon. The most straightforward evidence is that most of the radiogenic Xe from the decay of (129)I (half-life 15.7 Myr) and (244)Pu (half-life 81 Myr) that is Earth's birthright is missing. The missing xenon is often attributed to the impact erosion of early atmospheres of Earth and its ancestors. It is obvious that if most of the radiogenic xenon were driven off by impacts, most of the rest of the atmophiles fared the same fate. The other line of evidence is in the nonradiogenic isotopes of xenon and its silent partner, krypton. Atmospheric xenon is strongly mass fractionated (at about 4% per amu) compared to any known solar system source (Figure 1). This is in stark contrast to krypton, which may not be fractionated at all: atmospheric Kr is slightly heavier than solar Kr (at about 0.5% per amu), but it is the same as in carbonaceous chondrites. Nonradiogenic xenon is also under abundant relative to krypton (the so-called "missing xenon" problem). Together these observations imply that xenon has been subject to fractionating escape and krypton not.

  18. Risks incurred by hydrogen escaping from containers and conduits

    Energy Technology Data Exchange (ETDEWEB)

    Swain, M.R.; Grilliot, E.S. [Univ. of Miami, Coral Gables, FL (United States); Swain, M.N. [Analytical Technologies, Inc., Miami, FL (United States)

    1998-08-01

    This paper is a discussion of a method for hydrogen leak classification. Leaks are classified as; gas escapes into enclosed spaces, gas escapes into partially enclosed spaces (vented), and gas escapes into unenclosed spaces. Each of the three enclosure classifications is further divided into two subclasses; total volume of hydrogen escaped and flow rate of escaping hydrogen. A method to aid in risk assessment determination in partially enclosed spaces is proposed and verified for several enclosure geometries. Examples are discussed for additional enclosure geometries.

  19. The roles and acting mechanism of Caenorhabditis elegans DNase II genes in apoptotic dna degradation and development.

    Directory of Open Access Journals (Sweden)

    Huey-Jen Lai

    Full Text Available DNase II enzymes are acidic endonucleases that have been implicated in mediating apoptotic DNA degradation, a critical cell death execution event. C. elegans genome contains three DNase II homologues, NUC-1, CRN-6, and CRN-7, but their expression patterns, acting sites, and roles in apoptotic DNA degradation and development are unclear. We have conducted a comprehensive analysis of three C. elegans DNase II genes and found that nuc-1 plays a major role, crn-6 plays an auxiliary role, and crn-7 plays a negligible role in resolving 3' OH DNA breaks generated in apoptotic cells. Promoter swapping experiments suggest that crn-6 but not crn-7 can partially substitute for nuc-1 in mediating apoptotic DNA degradation and both fail to replace nuc-1 in degrading bacterial DNA in intestine. Despite of their restricted and largely non-overlapping expression patterns, both CRN-6 and NUC-1 can mediate apoptotic DNA degradation in many cells, suggesting that they are likely secreted nucleases that are retaken up by other cells to exert DNA degradation functions. Removal or disruption of NUC-1 secretion signal eliminates NUC-1's ability to mediate DNA degradation across its expression border. Furthermore, blocking cell corpse engulfment does not affect apoptotic DNA degradation mediated by nuc-1, suggesting that NUC-1 acts in apoptotic cells rather than in phagocytes to resolve 3' OH DNA breaks. Our study illustrates how multiple DNase II nucleases play differential roles in apoptotic DNA degradation and development and reveals an unexpected mode of DNase II action in mediating DNA degradation.

  20. Escape from attracting sets in randomly perturbed systems.

    Science.gov (United States)

    Rodrigues, Christian S; Grebogi, Celso; de Moura, Alessandro P S

    2010-10-01

    The dynamics of escape from an attractive state due to random perturbations is of central interest to many areas in science. Previous studies of escape in chaotic systems have rather focused on the case of unbounded noise, usually assumed to have Gaussian distribution. In this paper, we address the problem of escape induced by bounded noise. We show that the dynamics of escape from an attractor's basin is equivalent to that of a closed system with an appropriately chosen "hole." Using this equivalence, we show that there is a minimum noise amplitude above which escape takes place, and we derive analytical expressions for the scaling of the escape rate with noise amplitude near the escape transition. We verify our analytical predictions through numerical simulations of two well-known two-dimensional maps with noise.

  1. The cost of the sword: escape performance in male swordtails.

    Directory of Open Access Journals (Sweden)

    Alex Baumgartner

    Full Text Available The handicap theory of sexual selection posits that male display traits that are favored in mate choice come at a significant cost to performance. We tested one facet of this hypothesis in the green swordtail (Xiphophorus helleri. In this species, the lower ray of male caudal fin is extended into a 'sword', which serves to attract potential mates. However, bearing a long sword may increase drag and thus compromise a male's ability to swim effectively. We tested escape performance in this species by eliciting C-start escape responses, an instinctive escape behavior, in males with various sword lengths. We then removed males' swords and retested escape performance. We found no relationship between escape performance and sword length and no effect of sword removal on escape performance. While having a large sword may attract a predator's attention, our results suggest that sword size does not compromise a male's escape performance.

  2. Arduino adventures escape from Gemini station

    CERN Document Server

    Kelly, James Floyd

    2013-01-01

    Arduino Adventures: Escape from Gemini Station provides a fun introduction to the Arduino microcontroller by putting you (the reader) into the action of a science fiction adventure story.  You'll find yourself following along as Cade and Elle explore Gemini Station-an orbiting museum dedicated to preserving and sharing technology throughout the centuries. Trouble ensues. The station is evacuated, including Cade and Elle's class that was visiting the station on a field trip. Cade and Elle don't make it aboard their shuttle and are trapped on the station along with a friendly artificial intellig

  3. Serial Escape System For Aircraft Crews

    Science.gov (United States)

    Wood, Kenneth E.

    1990-01-01

    Emergency escape system for aircraft and aerospace vehicles ejects up to seven crewmembers, one by one, within 120 s. Intended for emergencies in which disabled craft still in stable flight at no more than 220 kn (113 m/s) equivalent airspeed and sinking no faster than 110 ft/s (33.5 m/s) at altitudes up to 50,000 ft (15.2 km). Ejection rockets load themselves from magazine after each crewmember ejected. Jumpmaster queues other crewmembers and helps them position themselves on egress ramp. Rockets pull crewmembers clear of aircraft structure. Provides orderly, controlled exit and avoids ditching at sea or landing in rough terrain.

  4. Evolutionary escape from the prisoner's dilemma.

    Science.gov (United States)

    Worden, Lee; Levin, Simon A

    2007-04-07

    The classic prisoner's dilemma model of game theory is modified by introducing occasional variations on the options available to players. Mutation and selection of game options reliably change the game matrix, gradually, from a prisoner's dilemma game into a byproduct mutualism one, in which cooperation is stable, and "temptation to defect" is replaced by temptation to cooperate. This result suggests that when there are many different potential ways of interacting, exploring those possibilities may make escape from prisoner's dilemmas a common outcome in the world. A consequence is that persistent prisoner's dilemma structures may be less common than one might otherwise expect.

  5. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    Directory of Open Access Journals (Sweden)

    Nakamura Shinichiro

    2011-01-01

    Full Text Available Abstract Background Runt-related transcription factor 3 (RUNX3 is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC. Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91% and tissues (90%. RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis.

  6. Fast escaping points of entire functions

    CERN Document Server

    Rippon, P J

    2010-01-01

    Let $f$ be a transcendental entire function and let $A(f)$ denote the set of points that escape to infinity `as fast as possible' under iteration. By writing $A(f)$ as a countable union of closed sets, called `levels' of $A(f)$, we obtain a new understanding of the structure of this set. For example, we show that if $U$ is a Fatou component in $A(f)$, then $\\partial U\\subset A(f)$ and this leads to significant new results and considerable improvements to existing results about $A(f)$. In particular, we study functions for which $A(f)$, and each of its levels, has the structure of an `infinite spider's web'. We show that there are many such functions and that they have a number of strong dynamical properties. This new structure provides an unexpected connection between a conjecture of Baker concerning the components of the Fatou set and a conjecture of Eremenko concerning the components of the escaping set.

  7. Molecular Dications in Planetary Atmospheric Escape

    Directory of Open Access Journals (Sweden)

    Stefano Falcinelli

    2016-08-01

    Full Text Available Fundamental properties of multiply charged molecular ions, such as energetics, structure, stability, lifetime and fragmentation dynamics, are relevant to understand and model the behavior of gaseous plasmas as well as ionosphere and astrophysical environments. Experimental determinations of the Kinetic Energy Released (KER for ions originating from dissociations reactions, induced by Coulomb explosion of doubly charged molecular ions (molecular dications produced by double photoionization of CO2, N2O and C2H2 molecules of interest in planetary atmospheres, are reported. The KER measurement as a function of the ultraviolet (UV photon energy in the range of 28–65 eV was extracted from the electron-ion-ion coincidence spectra obtained by using tunable synchrotron radiation coupled with ion imaging techniques at the ELETTRA Synchrotron Light Laboratory Trieste, Italy. These experiments, coupled with a computational analysis based on a Monte Carlo trajectory simulation, allow assessing the probability of escape for simple ionic species in the upper atmosphere of Mars, Venus and Titan. The measured KER in the case of H+, C+, CH+, CH2+, N+, O+, CO+, N2+ and NO+ fragment ions range between 1.0 and 5.5 eV, being large enough to allow these ionic species to participate in the atmospheric escape from such planets into space. In the case of Mars, we suggest a possible explanation for the observed behavior of the O+ and CO22+ ion density profiles.

  8. Escape of water molecular from Carbon Nanotubes

    Science.gov (United States)

    Li, Jiaxi; Li, Wenfeng; Zhang, Jianwei

    2014-03-01

    Understanding and controlling the transport of water molecules through nanopores have attracted great interest due to potential applications for designing novel nanofluidic devices, machines and sensors. In this work, we theoretically investigate the effects of an external nonuniform electric field on the escape of water molecules through single-walled carbon nanotubes (SWNTs) by using of molecular dynamics (MD) simulations. When polar water molecules are placed in the gradient electric field, the electric force is experienced that can drive the water molecules. Molecular dynamics simulations show that the escape probability of water obeys the Boltzmann distribution. Our results show that energy barrier delta E is independent of temperature which indicates that it is a single-barrier system. From the MD results statistics, the key parameters could be determined such that the relationship between energy barrier delta E and diameter of SWNTs and nozzle distance of the charge r would be revealed that could deepen our current theoretical understanding on transport of water molecular inside SWNTs with the nonuniform electric field.

  9. Uremic escape of renal allograft rejection

    Energy Technology Data Exchange (ETDEWEB)

    van Schilfgaarde, R. (Rijksuniversiteit Leiden (Netherlands). Academisch Ziekenhuis); van Breda Vriesman, P.J.C. (Rijksuniversiteit Limburg Maastricht (Netherlands). Dept. of Immunopathology)

    1981-10-01

    It is demonstrated in rats that, in the presence of early postoperative severe but transient uremia, the survival of first set Brown-Norway (BN) renal allografts in Lewis (LEW) recipients is at least three times prolonged when compared to non-uremic controls. This phenomenon is called 'uremic escape of renal allograft rejection'. By means of lethal X-irradiation of donors of BN kidneys transplanted into transiently uremic and non-uremic LEW recipients, the presence of passenger lymphocyte immunocompetence is demonstrated to be obilgatory for this phenomenon to occur. As a result of mobile passenger lymphocyte immunocompetence, a graft-versus-host (GVH) reaction is elicited in the spleens of LEW recipients of BN kidneys which amplifies the host response. The splenomegaly observed in LEW recipients of BN kidneys is caused not only by this GVH reaction, which is shown to be exquisitely sensitive to even mild uremia. It is also contributed to by a proliferative response of the host against the graft (which latter response is equated with an in vivo equivalent of a unilateral mixed lymphocyte reaction (MLR)), since the reduction in spleen weights caused by abrogation of mobile passenger lymphocyte immunocompetence brought about by lethal donor X-irradiation is increased significantly by early postoperative severe but transient uremia. It is concluded that in uremic escape of renal allograft rejection both reactions are suppressed by uremia during the early post-operative period.

  10. Escape from viscosity : the kinematics and hydrodynamics of copepod foraging and escape swimming

    NARCIS (Netherlands)

    van Duren, LA; Videler, JJ

    2003-01-01

    Feeding and escape swimming in adult females of the calanoid copepod. Temora lopgicornis Muller were investigated and compared. Swimming velocities were calculated using a 3-D filming setup., Foraging velocities ranged between 2 and 6 min s(-1), while maximum velocities of up to 80 mm s(-1) were rea

  11. Genistein suppresses the mitochondrial apoptotic pathway in hippocampal neurons in rats with Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Yan Wang

    2016-01-01

    Full Text Available Genistein is effective against amyloid-β toxicity, but the underlying mechanisms are unclear. We hypothesized that genistein may protect neurons by inhibiting the mitochondrial apoptotic pathway, and thereby play a role in the prevention of Alzheimer's disease. A rat model of Alzheimer's disease was established by intraperitoneal injection of D-galactose and intracerebral injection of amyloid-β peptide (25–35. In the genistein treatment groups, a 7-day pretreatment with genistein (10, 30, 90 mg/kg was given prior to establishing Alzheimer's disease model, for 49 consecutive days. Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling assay demonstrated a reduction in apoptosis in the hippocampus of rats treated with genistein. Western blot analysis showed that expression levels of capase-3, Bax and cytochrome c were decreased compared with the model group. Furthermore, immunohistochemical staining revealed reductions in cytochrome c and Bax immunoreactivity in these rats. Morris water maze revealed a substantial shortening of escape latency by genist-ein in Alzheimer's disease rats. These findings suggest that genistein decreases neuronal loss in the hippocampus, and improves learning and memory ability. The neuroprotective effects of genistein are associated with the inhibition of the mitochondrial apoptotic pathway, as shown by its ability to reduce levels of caspase-3, Bax and cytochrome c.

  12. Galectin-1 and Galectin-3 induce mitochondrial apoptotic pathway in Jurkat cells

    Science.gov (United States)

    Vasil'eva, O. A.; Isaeva, A. V.; Prokhorenko, T. S.; Zima, A. P.; Novitsky, V. V.

    2016-08-01

    Cellular malignant transformation is often accompanied by increased gene expression of low-molecular proteins of lectins family-galectins. But it is unknown how galectins promote tumor growth and malignization. Galectins-1 and galectin-3 are thought to be possible immunoregulators exerting their effects by regulating the balance of CD4+ lymphocytes. In addition it is known that tumor cells overexpressing galectins are capable of escaping immunological control, causing apoptosis of lymphocytes. The aim of the study is to investigate the role of galectin-1 and galectin-3 in the implementation of mitochondrial apoptotic pathway in Jurkat cells. Methods: Jurkat cells were used as a model for the study of T-lymphocytes. Jurkat cells were activated with antibodies to CD3 and CD28 and cultured with recombinant galectin-1 and -3. Apoptosis of Jurkat cells and depolarization of the mitochondrial membrane were assessed by flow cytometry. It was found that galectin-1 and galectin-3 have a dose-dependent pro-apoptotic effect on Jurkat cells in vitro and enlarge the number of cells with decreased mitochondrial membrane potential compared with intact cells.

  13. Genistein suppresses the mitochondrial apoptotic pathway in hippocampal neurons in rats with Alzheimer’s disease

    Institute of Scientific and Technical Information of China (English)

    Yan Wang; Biao Cai; Jing Shao; Ting-ting Wang; Run-ze Cai; Chang-ju Ma; Tao Han; Jun Du

    2016-01-01

    Genistein is effective against amyloid-βtoxicity, but the underlying mechanisms are unclear. We hypothesized that genistein may protect neurons by inhibiting the mitochondrial apoptotic pathway, and thereby play a role in the prevention of Alzheimer’s disease. A rat model of Alzheimer’s disease was established by intraperitoneal injection of D-galactose and intracerebral injection of amyloid-βpeptide (25–35). In the genistein treatment groups, a 7-day pretreatment with genistein (10, 30, 90 mg/kg) was given prior to establishing Alzheimer’s dis-ease model, for 49 consecutive days. Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling assay demonstrated a reduction in apoptosis in the hippocampus of rats treated with genistein. Western blot analysis showed that expression levels of capase-3, Bax and cytochrome c were decreased compared with the model group. Furthermore, immunohistochemical staining revealed reductions in cytochrome c and Bax immunoreactivity in these rats. Morris water maze revealed a substantial shortening of escape latency by genist-ein in Alzheimer’s disease rats. These ifndings suggest that genistein decreases neuronal loss in the hippocampus, and improves learning and memory ability. The neuroprotective effects of genistein are associated with the inhibition of the mitochondrial apoptotic pathway, as shown by its ability to reduce levels of caspase-3, Bax and cytochrome c.

  14. Potential for Modulation of the Fas Apoptotic Pathway by Epidermal Growth Factor in Sarcomas

    Directory of Open Access Journals (Sweden)

    David E. Joyner

    2011-01-01

    Full Text Available One important mechanism by which cancer cells parasitize their host is by escaping apoptosis. Thus, selectively facilitating apoptosis is a therapeutic mechanism by which oncotherapy may prove highly advantageous. One major apoptotic pathway is mediated by Fas ligand (FasL. The death-inducing signaling Ccmplex (DISC and subsequent death-domain aggregations are created when FasL is bound by its receptor thereby enabling programmed cell death. Conceptually, if a better understanding of the Fas pathway can be garnered, an oncoselective prodeath therapeutic approach can be tailored. Herein, we propose that EGF and CTGF play essential roles in the regulation of the Fas apoptotic pathway in sarcomas. Tumor and in vitro data suggest viable cells counter the prodeath signal induced by FasL by activating EGF, which in turn induces prosurvival CTGF. The prosurvival attributes of CTGF ultimately predominate over the death-inducing FasL. Cells destined for elimination inhibit this prosurvival response via a presently undefined pathway. This scenario represents a novel role for EGF and CTGF as regulators of the Fas pathway in sarcomas.

  15. Non-apoptotic function of apoptotic proteins in the development of Malpighian tubules of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Madhu G Tapadia; Naveen K Gautam

    2011-08-01

    Drosophila metamorphosis is characterized by the histolysis of larval structures by programmed cell death, which paves the way for the establishment of adult-specific structures under the influence of the steroid hormone ecdysone. Malpighian tubules function as an excretory system and are one of the larval structures that are not destroyed during metamorphosis and are carried over to adulthood. The pupal Malpighian tubules evade destruction in spite of expressing apoptotic proteins, Reaper, Hid, Grim, Dronc and Drice. Here we show that in the Malpighian tubules expression of apoptotic proteins commences right from embryonic development and continues throughout the larval stages. Overexpression of these proteins in the Malpighian tubules causes larval lethality resulting in malformed tubules. The number and regular organization of principal and stellate cells of Malpighian tubules is disturbed, in turn disrupting the physiological functioning of the tubules as well. Strikingly, the localization of -tubulin, F-actin and Disclarge (Dlg) is also disrupted. These results suggest that the apoptotic proteins could be having non-apoptotic function in the development of Malpighian tubules.

  16. Apoptotic cell clearance: basic biology and therapeutic potential.

    Science.gov (United States)

    Poon, Ivan K H; Lucas, Christopher D; Rossi, Adriano G; Ravichandran, Kodi S

    2014-03-01

    The prompt removal of apoptotic cells by phagocytes is important for maintaining tissue homeostasis. The molecular and cellular events that underpin apoptotic cell recognition and uptake, and the subsequent biological responses, are increasingly better defined. The detection and disposal of apoptotic cells generally promote an anti-inflammatory response at the tissue level, as well as immunological tolerance. Consequently, defects in apoptotic cell clearance have been linked with various inflammatory diseases and autoimmunity. Conversely, under certain conditions, such as the killing of tumour cells by specific cell-death inducers, the recognition of apoptotic tumour cells can promote an immunogenic response and antitumour immunity. Here, we review the current understanding of the complex process of apoptotic cell clearance in physiology and pathology, and discuss how this knowledge could be harnessed for new therapeutic strategies.

  17. Strong purifying selection at genes escaping X chromosome inactivation.

    Science.gov (United States)

    Park, Chungoo; Carrel, Laura; Makova, Kateryna D

    2010-11-01

    To achieve dosage balance of X-linked genes between mammalian males and females, one female X chromosome becomes inactivated. However, approximately 15% of genes on this inactivated chromosome escape X chromosome inactivation (XCI). Here, using a chromosome-wide analysis of primate X-linked orthologs, we test a hypothesis that such genes evolve under a unique selective pressure. We find that escape genes are subject to stronger purifying selection than inactivated genes and that positive selection does not significantly affect the evolution of these genes. The strength of selection does not differ between escape genes with similar versus different expression levels in males versus females. Intriguingly, escape genes possessing Y homologs evolve under the strongest purifying selection. We also found evidence of stronger conservation in gene expression levels in escape than inactivated genes. We hypothesize that divergence in function and expression between X and Y gametologs is driving such strong purifying selection for escape genes.

  18. Interplay and escape in three-body scattering.

    Science.gov (United States)

    Shebalin, J. V.; Tippens, A. L.

    1996-05-01

    The problem of three gravitationally interacting bodies, with total energy less than zero, is investigated numerically. After introducing the concepts of `periastron graphs' and `composite binaries', time-of-escape and interplay are precisely defined. These definitions are useful in characterizing the complete scattering process: escape to t=-{infinity}, interplay, and escape to t=+{infinity}. These definitions are also useful for the efficient and automatic termination of a numerical simulation of interplay.

  19. The Fastest Saccadic Responses Escape Visual Masking

    DEFF Research Database (Denmark)

    M. Crouzet, Sébastien; Overgaard, Morten; Busch, Niko A.

    2014-01-01

    , which gives access to very early stages of visual processing, target visibility was reduced either by OSM, conventional backward masking, or low stimulus contrast. A general reduction of performance was observed in all three conditions. However, the fastest saccades did not show any sign of interference......Object-substitution masking (OSM) occurs when a briefly presented target in a search array is surrounded by small dots that remain visible after the target disappears. The reduction of target visibility occurring after OSM has been suggested to result from a specific interference with reentrant...... visual processing while the initial feedforward processing is thought to be left intact. We tested a prediction derived from this hypothesis: the fastest responses, being triggered before the beginning of reentrant processing, should escape the OSM interference. In a saccadic choice reaction time task...

  20. The regulation of apoptotic cell death

    Directory of Open Access Journals (Sweden)

    G.P. Amarante-Mendes

    1999-09-01

    Full Text Available Apoptosis is a fundamental biological phenomenon in which the death of a cell is genetically and biochemically regulated. Different molecules are involved in the regulation of the apoptotic process. Death receptors, coupled to distinct members of the caspases as well as other adapter molecules, are involved in the initiation of the stress signals (The Indictment. Members of the Bcl-2 family control at the mitochondrial level the decision between life and death (The Judgement. The effector caspases are responsible for all morphological and biochemical changes related to apoptosis including the "eat-me" signals perceived by phagocytes and neighboring cells (The Execution. Finally, apoptosis would have little biological significance without the recognition and removal of the dying cells (The Burial.

  1. The regulation of apoptotic cell death

    Directory of Open Access Journals (Sweden)

    Amarante-Mendes G.P.

    1999-01-01

    Full Text Available Apoptosis is a fundamental biological phenomenon in which the death of a cell is genetically and biochemically regulated. Different molecules are involved in the regulation of the apoptotic process. Death receptors, coupled to distinct members of the caspases as well as other adapter molecules, are involved in the initiation of the stress signals (The Indictment. Members of the Bcl-2 family control at the mitochondrial level the decision between life and death (The Judgement. The effector caspases are responsible for all morphological and biochemical changes related to apoptosis including the "eat-me" signals perceived by phagocytes and neighboring cells (The Execution. Finally, apoptosis would have little biological significance without the recognition and removal of the dying cells (The Burial.

  2. Innate recognition of apoptotic cells: novel apoptotic cell-associated molecular patterns revealed by crossreactivity of anti-LPS antibodies.

    Science.gov (United States)

    Tennant, I; Pound, J D; Marr, L A; Willems, J J L P; Petrova, S; Ford, C A; Paterson, M; Devitt, A; Gregory, C D

    2013-05-01

    Cells dying by apoptosis are normally cleared by phagocytes through mechanisms that can suppress inflammation and immunity. Molecules of the innate immune system, the pattern recognition receptors (PRRs), are able to interact not only with conserved structures on microbes (pathogen-associated molecular patterns, PAMPs) but also with ligands displayed by apoptotic cells. We reasoned that PRRs might therefore interact with structures on apoptotic cells - apoptotic cell-associated molecular patterns (ACAMPs) - that are analogous to PAMPs. Here we show that certain monoclonal antibodies raised against the prototypic PAMP, lipopolysaccharide (LPS), can crossreact with apoptotic cells. We demonstrate that one such antibody interacts with a constitutively expressed intracellular protein, laminin-binding protein, which translocates to the cell surface during apoptosis and can interact with cells expressing the prototypic PRR, mCD14 as well as with CD14-negative cells. Anti-LPS cross reactive epitopes on apoptotic cells colocalised with annexin V- and C1q-binding sites on vesicular regions of apoptotic cell surfaces and were released associated with apoptotic cell-derived microvesicles (MVs). These results confirm that apoptotic cells and microbes can interact with the immune system through common elements and suggest that anti-PAMP antibodies could be used strategically to characterise novel ACAMPs associated not only with apoptotic cells but also with derived MVs.

  3. The Origins and Underpinning Principles of E-Scape

    Science.gov (United States)

    Kimbell, Richard

    2012-01-01

    In this article I describe the context within which we developed project e-scape and the early work that laid the foundations of the project. E-scape (e-solutions for creative assessment in portfolio environments) is centred on two innovations. The first concerns a web-based approach to portfolio building; allowing learners to build their…

  4. Green Pea Galaxies Reveal Secrets of Lyα Escape

    Science.gov (United States)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Dijkstra, Mark; Jaskot, Anne; Zheng, Zhenya; Wang, Junxian

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  5. Behavioural asymmetry affects escape performance in a teleost fish

    NARCIS (Netherlands)

    Dadda, Marco; Koolhaas, Wouter H.; Domenici, Paolo

    2010-01-01

    Escape performance is fundamental for survival in fish and most other animals. While previous work has shown that both intrinsic (e.g. size, shape) and extrinsic (e.g. temperature, hypoxia) factors can affect escape performance, the possibility that behavioural asymmetry may affect timing and locomo

  6. 46 CFR 169.313 - Means of escape.

    Science.gov (United States)

    2010-10-01

    ... a hold-back to hold the scuttle in an open position. (e) The required means of escape must not have... escape is acceptable provided that— (1) There is no source of fire in the space, such as a galley stove... back of the ladder; and (4) Except when unavoidable obstructions are encountered, there must be...

  7. How many ions have escaped the Martian atmosphere?

    Science.gov (United States)

    Brain, David; McFadden, James; Halekas, Jasper; Connerney, J. E. P.; Eparvier, Frank; Mitchell, David; Bougher, Stephen W.; Bowers, Charlie; Curry, Shannon; Dong, Chuanfei; Dong, Yaxue; Egan, Hilary; Fang, Xiaohua; Harada, Yuki; Jakosky, Bruce; Lillis, Robert; Luhmann, Janet; Ma, Yingjuan; Modolo, Ronan; Weber, Tristan

    2016-10-01

    The Mars Atmosphere and Volatile EvolutioN (MAVEN) mission has been making science measurements of the Martian upper atmosphere and its escape to space since November 2014. A key part of this effort is the measurement of the escape rates of charged particles (ions) at present and over solar system history. The lack of a global dynamo magnetic field at Mars leaves its upper atmosphere more directly exposed to the impinging solar wind than magnetized planets such as Earth. For this reason it is thought that ion escape at Mars may have played a significant role in long term climate change. MAVEN measures escaping planetary ions directly, with high energy, mass, and time resolution.With nearly two years of observations in hand, we will report the average ion escape rate and the spatial distribution of escaping ions as measured by MAVEN and place them in context with previous measurements of ion loss by other spacecraft (e.g. Phobos 2 and Mars Express). We will then report on the measured variability in ion escape rates with different drivers (e.g. solar EUV, solar wind pressure, etc.). Finally, we will use these results to provide an initial estimate of the total ion escape from Mars over billions of years.

  8. Escape response of planktonic protists to fluid mechanical signals

    DEFF Research Database (Denmark)

    Jakobsen, Hans Henrik

    2001-01-01

    The escape response to fluid mechanical signals was examined in 6 protists, 4 ciliates and 2 dinoflagellates. When exposed to a siphon flow. 3 species of ciliates, Balanion comatum, Strobilidium sp., and Mesodinium pulex, responded with escape jumps. The threshold deformation rates required...

  9. Vascular endothelial growth factor enhances macrophage clearance of apoptotic cells

    Science.gov (United States)

    Dalal, Samay; Horstmann, Sarah A.; Richens, Tiffany R.; Tanaka, Takeshi; Doe, Jenna M.; Boe, Darren M.; Voelkel, Norbert F.; Taraseviciene-Stewart, Laimute; Janssen, William J.; Lee, Chun G.; Elias, Jack A.; Bratton, Donna; Tuder, Rubin M.; Henson, Peter M.; Vandivier, R. William

    2012-01-01

    Efficient clearance of apoptotic cells from the lung by alveolar macrophages is important for the maintenance of tissue structure and function. Lung tissue from humans with emphysema contains increased numbers of apoptotic cells and decreased levels of vascular endothelial growth factor (VEGF). Mice treated with VEGF receptor inhibitors have increased numbers of apoptotic cells and develop emphysema. We hypothesized that VEGF regulates apoptotic cell clearance by alveolar macrophages (AM) via its interaction with VEGF receptor 1 (VEGF R1). Our data show that the uptake of apoptotic cells by murine AMs and human monocyte-derived macrophages is inhibited by depletion of VEGF and that VEGF activates Rac1. Antibody blockade or pharmacological inhibition of VEGF R1 activity also decreased apoptotic cell uptake ex vivo. Conversely, overexpression of VEGF significantly enhanced apoptotic cell uptake by AMs in vivo. These results indicate that VEGF serves a positive regulatory role via its interaction with VEGF R1 to activate Rac1 and enhance AM apoptotic cell clearance. PMID:22307908

  10. Split-second escape decisions in blue tits (Parus caeruleus)

    Science.gov (United States)

    Lind, Johan; Kaby, Ulrika; Jakobsson, Sven

    2002-07-01

    Bird mortality is heavily affected by birds of prey. Under attack, take-off is crucial for survival and even minor mistakes in initial escape response can have devastating consequences. Birds may respond differently depending on the character of the predator's attack and these split-second decisions were studied using a model merlin (Falco columbarius) that attacked feeding blue tits (Parus caeruleus) from two different attack angles in two different speeds. When attacked from a low attack angle they took off more steeply than when attacked from a high angle. This is the first study to show that escape behaviour also depends on predator attack speed. The blue tits responded to a high-speed attack by dodging sideways more often than when attacked at a low speed. Escape speed was not significantly affected by the different treatments. Although they have only a split-second before escaping an attack, blue tits do adjust their escape strategy to the prevailing attack conditions.

  11. Escaping in couples facilitates evacuation: Experimental study and modeling

    CERN Document Server

    Guo, Ning; Hu, Mao-Bin; Ding, Jian-Xun; Ding, Zhong-Jun

    2015-01-01

    In this paper, the impact of escaping in couples on the evacuation dynamics has been investigated via experiments and modeling. Two sets of experiments have been implemented, in which pedestrians are asked to escape either in individual or in couples. The experiments show that escaping in couples can decrease the average evacuation time. Moreover, it is found that the average evacuation time gap is essentially constant, which means that the evacuation speed essentially does not depend on the number of pedestrians that have not yet escaped. To model the evacuation dynamics, an improved social force model has been proposed, in which it is assumed that the driving force of a pedestrian cannot be fulfilled when the composition of physical forces exceeds a threshold because the pedestrian cannot keep his/her body balance under this circumstance. To model the effect of escaping in couples, attraction force has been introduced between the partners. Simulation results are in good agreement with the experimental ones.

  12. The fastest saccadic responses escape visual masking.

    Directory of Open Access Journals (Sweden)

    Sébastien M Crouzet

    Full Text Available Object-substitution masking (OSM occurs when a briefly presented target in a search array is surrounded by small dots that remain visible after the target disappears. The reduction of target visibility occurring after OSM has been suggested to result from a specific interference with reentrant visual processing while the initial feedforward processing is thought to be left intact. We tested a prediction derived from this hypothesis: the fastest responses, being triggered before the beginning of reentrant processing, should escape the OSM interference. In a saccadic choice reaction time task, which gives access to very early stages of visual processing, target visibility was reduced either by OSM, conventional backward masking, or low stimulus contrast. A general reduction of performance was observed in all three conditions. However, the fastest saccades did not show any sign of interference under either OSM or backward masking, as they did under the low-contrast condition. This finding supports the hypothesis that masking interferes mostly with reentrant processing at later stages, while leaving early feedforward processing largely intact.

  13. Candida albicans escapes from mouse neutrophils.

    Science.gov (United States)

    Ermert, David; Niemiec, Maria J; Röhm, Marc; Glenthøj, Andreas; Borregaard, Niels; Urban, Constantin F

    2013-08-01

    Candida albicans, the most commonly isolated human fungal pathogen, is able to grow as budding yeasts or filamentous forms, such as hyphae. The ability to switch morphology has been attributed a crucial role for the pathogenesis of C. albicans. To mimic disseminated candidiasis in humans, the mouse is the most widely used model organism. Neutrophils are essential immune cells to prevent opportunistic mycoses. To explore potential differences between the rodent infection model and the human host, we compared the interactions of C. albicans with neutrophil granulocytes from mice and humans. We revealed that murine neutrophils exhibited a significantly lower ability to kill C. albicans than their human counterparts. Strikingly, C. albicans yeast cells formed germ tubes upon internalization by murine neutrophils, eventually rupturing the neutrophil membrane and thereby, killing the phagocyte. On the contrary, growth and subsequent escape of C. albicans are blocked inside human neutrophils. According to our findings, this blockage in human neutrophils might be a result of higher levels of MPO activity and the presence of α-defensins. We therefore outline differences in antifungal immune defense between humans and mouse strains, which facilitates a more accurate interpretation of in vivo results.

  14. Immune Escape Strategies of Malaria Parasites

    Science.gov (United States)

    Gomes, Pollyanna S.; Bhardwaj, Jyoti; Rivera-Correa, Juan; Freire-De-Lima, Celio G.; Morrot, Alexandre

    2016-01-01

    Malaria is one of the most life-threatening infectious diseases worldwide. Immunity to malaria is slow and short-lived despite the repeated parasite exposure in endemic areas. Malaria parasites have evolved refined machinery to evade the immune system based on a range of genetic changes that include allelic variation, biomolecular exposure of proteins, and intracellular replication. All of these features increase the probability of survival in both mosquitoes and the vertebrate host. Plasmodium species escape from the first immunological trap in its invertebrate vector host, the Anopheles mosquitoes. The parasites have to pass through various immunological barriers within the mosquito such as anti-microbial molecules and the mosquito microbiota in order to achieve successful transmission to the vertebrate host. Within these hosts, Plasmodium species employ various immune evasion strategies during different life cycle stages. Parasite persistence against the vertebrate immune response depends on the balance among virulence factors, pathology, metabolic cost of the host immune response, and the parasites ability to evade the immune response. In this review we discuss the strategies that Plasmodium parasites use to avoid the vertebrate host immune system and how they promote successful infection and transmission. PMID:27799922

  15. The apoptotic effect of apigenin on human gastric carcinoma cells through mitochondrial signal pathway.

    Science.gov (United States)

    Chen, Jiayu; Chen, Jiaqi; Li, Zhaoyun; Liu, Chibo; Yin, Lihui

    2014-08-01

    This study aims to explore the apoptotic function of apigenin on the gastric cancer cells and the related mechanism. The gastric cancer cell lines HGC-27 and SGC-7901, and normal gastric epithelial cell line GES1 were treated with different concentrations of apigenin. Cell proliferation was tested. Morphological changes of the apoptotic cells were observed after Hoechst33342 staining. The apoptosis rate of the gastric cancer cells were measured with flow cytometry. Changes of the cell cycle were explored. The mitochondrial membrane potential changes were analyzed after JC-1 staining. Bcl-2 family proteins and caspases-3 expression with apigenin treatment was analyzed by real-time PCR. Cell proliferation of HGC-27 and SGC-7901 was inhibited by apigenin, and the inhibition was dose-time-dependent. Gastric carcinoma cells treated by apigenin had no obvious cell cycle arrest, but were observed with the higher apoptosis rate and the typical apoptotic morphological changes of the cell nucleus. JC-1 staining showed that apigenin could reduce mitochondrial membrane potential of gastric carcinoma cells. Real-time PCR results showed that apigenin significantly increased caspase-3 and Bax expression level, and down-regulated Bcl-2 expression in a dose-dependent manner in gastric carcinoma cells. However, the GES1 was almost not affected by apigenin treatment. Apigenin can inhibit cell lines HGC-27 and SGC-7901 proliferation in a time and dose-dependent manner, reduce anti-apoptotic protein Bcl-2 levels, enhance apoptosis-promoting protein Bax level, result in mitochondrial membrane potential decreasing and caspase-3 enzyme activating, then lead to cell apoptosis.

  16. Efficiently estimating salmon escapement uncertainty using systematically sampled data

    Science.gov (United States)

    Reynolds, Joel H.; Woody, Carol Ann; Gove, Nancy E.; Fair, Lowell F.

    2007-01-01

    Fish escapement is generally monitored using nonreplicated systematic sampling designs (e.g., via visual counts from towers or hydroacoustic counts). These sampling designs support a variety of methods for estimating the variance of the total escapement. Unfortunately, all the methods give biased results, with the magnitude of the bias being determined by the underlying process patterns. Fish escapement commonly exhibits positive autocorrelation and nonlinear patterns, such as diurnal and seasonal patterns. For these patterns, poor choice of variance estimator can needlessly increase the uncertainty managers have to deal with in sustaining fish populations. We illustrate the effect of sampling design and variance estimator choice on variance estimates of total escapement for anadromous salmonids from systematic samples of fish passage. Using simulated tower counts of sockeye salmon Oncorhynchus nerka escapement on the Kvichak River, Alaska, five variance estimators for nonreplicated systematic samples were compared to determine the least biased. Using the least biased variance estimator, four confidence interval estimators were compared for expected coverage and mean interval width. Finally, five systematic sampling designs were compared to determine the design giving the smallest average variance estimate for total annual escapement. For nonreplicated systematic samples of fish escapement, all variance estimators were positively biased. Compared to the other estimators, the least biased estimator reduced bias by, on average, from 12% to 98%. All confidence intervals gave effectively identical results. Replicated systematic sampling designs consistently provided the smallest average estimated variance among those compared.

  17. Lyman-Werner UV escape fractions from primordial haloes

    Science.gov (United States)

    Schauer, Anna T. P.; Whalen, Daniel J.; Glover, Simon C. O.; Klessen, Ralf S.

    2015-12-01

    Population III (Pop III) stars can regulate star formation in the primordial Universe in several ways. They can ionize nearby haloes, and even if their ionizing photons are trapped by their own haloes, their Lyman-Werner (LW) photons can still escape and destroy H2 in other haloes, preventing them from cooling and forming stars. LW escape fractions are thus a key parameter in cosmological simulations of early reionization and star formation but have not yet been parametrized for realistic haloes by halo or stellar mass. To do so, we perform radiation hydrodynamical simulations of LW UV escape from 9-120 M⊙ Pop III stars in 105-107 M⊙ haloes with ZEUS-MP. We find that photons in the LW lines (i.e. those responsible for destroying H2 in nearby systems) have escape fractions ranging from 0 to 85 per cent. No LW photons escape the most massive halo in our sample, even from the most massive star. Escape fractions for photons elsewhere in the 11.18-13.6 eV energy range, which can be redshifted into the LW lines at cosmological distances, are generally much higher, being above 60 per cent for all but the least massive stars in the most massive haloes. We find that shielding of H2 by neutral hydrogen, which has been neglected in most studies to date, produces escape fractions that are up to a factor of 3 smaller than those predicted by H2 self-shielding alone.

  18. Macrophage recognition of ICAM-3 on apoptotic leukocytes.

    Science.gov (United States)

    Moffatt, O D; Devitt, A; Bell, E D; Simmons, D L; Gregory, C D

    1999-06-01

    Cells undergoing apoptosis are cleared rapidly by phagocytes, thus preventing tissue damage caused by loss of plasma membrane integrity. In this study, we show that the surface of leukocytes is altered during apoptosis such that the first Ig-like domain of ICAM-3 (CD50) can participate in the recognition and phagocytosis of the apoptotic cells by macrophages. Macrophage recognition of apoptotic cell-associated ICAM-3 was demonstrated both on leukocytes and, following transfection of exogenous ICAM-3, on nonleukocytes. The change in ICAM-3 was a consistent consequence of apoptosis triggered by various stimuli, suggesting that it occurs as part of a final common pathway of apoptosis. Alteration of ICAM-3 on apoptotic cells permitting recognition by macrophages resulted in a switch in ICAM-3-binding preference from the prototypic ICAM-3 counterreceptor, LFA-1, to an alternative macrophage receptor. Using mAbs to block macrophage/apoptotic cell interactions, we were unable to obtain evidence that either the alternative ICAM-3 counterreceptor alpha d beta 2 or the apoptotic cell receptor alpha v beta 3 was involved in the recognition of ICAM-3. By contrast, mAb blockade of macrophage CD14 inhibited ICAM-3-dependent recognition of apoptotic cells. These results show that ICAM-3 can function as a phagocytic marker of apoptotic leukocytes on which it acquires altered macrophage receptor-binding activity.

  19. Cobra venom cytotoxins; apoptotic or necrotic agents?

    Science.gov (United States)

    Ebrahim, Karim; Shirazi, Farshad H; Mirakabadi, Abbas Zare; Vatanpour, Hossein

    2015-12-15

    Organs homeostasis is controlled by a dynamic balance between cell proliferation and apoptosis. Failure to induction of apoptosis has been implicated in tumor development. Cytotoxin-I (CTX-I) and cytotoxin-II (CTX-II) are two physiologically active polypeptides found in Caspian cobra venom. Anticancer activity and mechanism of cell death induced by these toxins have been studied. The toxins were purified by different chromatographic steps and their cytotoxicity and pattern of cell death were determined by MTT, LDH release, acridine orange/ethidium bromide (AO/EtBr) double staining, flow cytometric analysis, caspase-3 activity and neutral red assays. The IC50 of CTX-II in MCF-7, HepG2, DU-145 and HL-60 was 4.1 ± 1.3, 21.2 ± 4.4, 9.4 ± 1.8 μg/mL and 16.3 ± 1.9 respectively while the IC50 of this toxin in normal MDCK cell line was 54.5 ± 3.9 μg/mL. LDH release suddenly increase after a specific toxins concentrations in all cell lines. AO/EtBr double staining, flow cytometric analysis and caspase-3 activity assay confirm dose and time-dependent induction of apoptosis by both toxins. CTX-I and CTX-II treated cells lost their lysosomal membrane integrity and couldn't uptake neutral red day. CTX-I and CTX-II showed significant anticancer activity with minimum effects on normal cells and better IC50 compared to current anticancer drug; cisplatin. They induce their apoptotic effect via lysosomal pathways and release of cathepsins to cytosol. These effects were seen in limited rage of toxins concentrations and pattern of cell death rapidly changes to necrosis by increase in toxin's concentration. In conclusion, significant apoptogenic effects of these toxins candidate them as a possible anticancer agent.

  20. On the large escape of ionizing radiation from GEHRs

    CERN Document Server

    Castellanos, M; Tenorio-Tagle, G

    2001-01-01

    A thorough analysis of well studied giant HII regions on galactic discs for which we know the ionizing stellar population, the gas metallicity and the Wolf-Rayet population, leads to photoionization models which can only match all observed line intensity ratios ([OIII], [OII], [NII], [SII] and [SIII] with respect to the intensity of H$\\beta$), as well as the H$\\beta$ luminosity and equivalent width if one allows for an important escape of energetic ionizing radiation. For the three regions presented here, the fractions of escaping Lyman continuum photons amount to 10 to 73 % and, in all cases, the larger fraction of escaping photons has energies between 13.6 and 24.4 eV. These escaping photons clearly must have an important impact as a source of ionization of the diffuse ionized gas (DIG) found surrounding many galaxies, as well as of the intergalactic medium (IGM).

  1. Behavior of the Escape Rate Function in Hyperbolic Dynamical Systems

    CERN Document Server

    Demers, Mark

    2011-01-01

    For a fixed initial reference measure, we study the dependence of the escape rate on the hole for a smooth or piecewise smooth hyperbolic map. First, we prove the existence and Holder continuity of the escape rate for systems with small holes admitting Young towers. Then we consider general holes for Anosov diffeomorphisms, without size or Markovian restrictions. We prove bounds on the upper and lower escape rates using the notion of pressure on the survivor set and show that a variational principle holds under generic conditions. However, we also show that the escape rate function forms a devil's staircase with jumps along sequences of regular holes and present examples to elucidate some of the difficulties involved in formulating a general theory.

  2. Amplitude modulation control of escape from a potential well

    Energy Technology Data Exchange (ETDEWEB)

    Chacón, R. [Departamento de Física Aplicada, Escuela de Ingenierías Industriales, Universidad de Extremadura, Apartado Postal 382, E-06006 Badajoz (Spain); Martínez García-Hoz, A. [Departamento de Física Aplicada, Escuela Universitaria Politécnica, Universidad de Castilla-La Mancha, E-13400 Almadén (Ciudad Real) (Spain); Miralles, J.J. [Departamento de Física Aplicada, Escuela de Ingenieros Industriales, Universidad de Castilla-La Mancha, E-02071 Albacete (Spain); Martínez, P.J. [Departamento de Física Aplicada, E.I.N.A., Universidad de Zaragoza, E-50018 Zaragoza (Spain); Instituto de Ciencia de Materiales de Aragón, CSIC – Universidad de Zaragoza, E-50009 Zaragoza (Spain)

    2014-03-01

    We demonstrate the effectiveness of periodic amplitude modulations in controlling (suppressing and enhancing) escape from a potential well through the universal model of a damped Helmholtz oscillator subjected to an external periodic excitation (the escape-inducing excitation) whose amplitude is periodically modulated (the escape-controlling excitation). Analytical and numerical results show that this multiplicative control works reliably for different subharmonic resonances between the two periodic excitations involved, and that its effectiveness is comparable to those of different methods of additive control. Additionally, we demonstrate the robustness of the multiplicative control against the presence of low-intensity Gaussian noise. -- Highlights: •Multiplicative control of escape from a potential well has been demonstrated. •Theoretical predictions are obtained from a Melnikov analysis. •It has been shown the robustness of the multiplicative control against noise.

  3. Theoretical Study on Ion Escape in Martian Atmosphere

    Institute of Scientific and Technical Information of China (English)

    SHI Jian-Kui; LIU Zhen-Xing; Klaus TORKAR; Tielong ZHANG

    2007-01-01

    @@ Based on the observation that Martian magnetic moment is gradually reducing from the ancient to the present,we investigate the O+ ion flux distribution along magnetic field lines and the ion escaping flux in Martian tail with different assumed Martian magnetic moments. The results show that the O+ ion flux along magnetic field lines decreases with distance from Mars; the ion flux along the field line decreases more quickly if the magnetic moment is larger; the larger the magnetic moment, the smaller the ion escaping flux in the Martian tail. The ion escaping flux depends on Z-coordinate in the Martian tail. With decrease of the magnetic moment, the ion escaping flux in the Martian tail increases. The results are significant for studying the water loss from Mars surface.

  4. Oxygen Escape from Venus During High Dynamic Pressure ICMEs

    Science.gov (United States)

    McEnulty, Tess; Luhmann, J. G.; Brain, D. A.; Fedorov, A.; Jian, L. K.; Russell, C. T.; Zhang, T.; Möstl, C.; Futaana, Y.; de Pater, I.

    2013-10-01

    Previous studies using data from Pioneer Venus suggested that oxygen ion escape flux may be enhanced by orders of magnitude during Interplanetary Coronal Mass Ejections. However, this large enhancement has been ambiguous in Venus Express ion data - with some analyses showing no flux enhancement or a small enhancement (within 2 times undisturbed cases). One possible explanation is that high escape flux may be due to high dynamic pressure in the solar wind, and the dynamic pressure has been lower during the VEX time period. So, we focus on ICMEs with the largest dynamic pressure and with VEX sampling of the escaping ions during the sheath of the ICMEs (during which the highest dynamic pressures in the solar wind occur). We will show the characteristics of these large events measured by VEX, and compare them to the largest ICMEs measured by PVO. We will then discuss estimates of the oxygen ion escape flux during these events.

  5. Experimental Analysis and Extinction of Self-Injurious Escape Behavior.

    Science.gov (United States)

    Iwata, Brian A.; And Others

    1990-01-01

    Three studies investigated environmental correlates of self-injurious behavior in seven developmentally disabled children and adolescents which were then later used for treatment. Correlates investigated included positive reinforcement, negative reinforcement, automatic reinforcement, and control. "Escape extinction" was successfully…

  6. In vitro study of immunosuppressive effect of apoptotic cells

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-jin; ZHENG Shu-sen

    2005-01-01

    Recent studies revealed that apoptotic cells are actively involved in immunosuppression and anti-inflammation. After being phagocytosed by macrophages, apoptotic cells can actively regulate cytokines secretion from lipopolysaccharide (LPS)-stimulated macrophages, in which the secretion of immunosuppressive cytokines such as interleukin-10 (IL-10) is increased while the pro-inflammatory cytokines such as tumor necrosis factor-alpha (TNFα), interleukin-1beta (IL-1β) and leukin-8 (IL-8) are suppressed. In this paper, we first present evidence that phagocytosed apoptotic cells regulate cytokine secretion of LPS-stimulated macrophages, but also inhibit the activation of T lymphocytes stimulated by ConA. These data suggest that apoptotic cells can alter the biological behavior of macrophages which gain immunosuppressive property.

  7. Pioneer Venus Orbiter (PVO) Ionosphere Evidence for Atmospheric Escape

    Science.gov (United States)

    Grebowsky, J. M.; Hoegy, W. R.

    2009-12-01

    An early estimate of escape of H2O from Venus [McElroy et al., 1982] using observed hot oxygen densities inferred by Nagy et al. [1981] from PVO OUVS 1304 Å dayglow and using ionization rates from photoionization and electron impact. This resulted in an estimated oxygen ionization rate planet-wide above the plasmapause of 3x1025 atoms/s. Based on the energetic O+ being swept up and removed by solar wind, McElroy et al. [1982] gave an estimate of a loss rate for O of 6x106 atoms/cm2/s. Using a different method of estimating escape based data in the ionotail of Venus, Brace et al. [1987] estimated a total planetary O+ escape rate of 5x1025 ions/s. Their estimate was based on PVO measurements of superthermal O+ (energy range 9-16 eV) in the tail ray plasma between 2000 and 3000 km. Their estimated global mean flux was 107 atoms/cm2/s. The two escape rates are remarkably close considering all the errors involved in such estimates of escape. A study of escape by Luhmann et al. [2008] using VEX observations at low solar activity finds modest escape rates, prompting the authors to reconsider the evidence from both PVO and VEX of the possibility of enhanced escape during extreme interplanetary conditions. We reexamine the variation of escape under different solar wind conditions using ion densities and plasma content in the dayside and nightside of Venus using PVO ionosphere density during times of high solar activity. Citations: Brace, L.H., W. T. Kasprzak, H.A. Taylor, R. F. Theis, C. T. Russess, A. Barnes, J. D. Mihalov, and D. M. Hunten, "The Ionotail of Venus: Its Configuration and Evidence for Ion Escape", J. Geophys. Res. 92, 15-26, 1987. Luhmann, J.G., A. Fedorov, S. Barabash, E. Carlsson, Y. Futaana, T.L. Zhang, C.T. Russell, J.G. Lyon, S.A. Ledvina, and D.A. Brain, “Venus Express observations of atmospheric oxygen escape during the passage of several coronal mass ejections”, J. Geophys. Res., 113, 2008. McElroy, M. B., M. J. Prather, J. M. Rodiquez, " Loss

  8. Purinergic Inhibition of ENaC Produces Aldosterone Escape

    OpenAIRE

    Stockand, James D.; Mironova, Elena; Bugaj, Vladislav; Rieg, Timo; Insel, Paul A.; Vallon, Volker; Peti-Peterdi, Janos; Pochynyuk, Oleh

    2010-01-01

    The mechanisms underlying “aldosterone escape,” which refers to the excretion of sodium (Na+) during high Na+ intake despite inappropriately increased levels of mineralocorticoids, are incompletely understood. Because local purinergic tone in the aldosterone-sensitive distal nephron downregulates epithelial Na+ channel (ENaC) activity, we tested whether this mechanism mediates aldosterone escape. Here, urinary ATP concentration increased with dietary Na+ intake in mice. Physiologic concentrat...

  9. GREEN PEA GALAXIES REVEAL SECRETS OF Lyα ESCAPE

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Huan; Wang, Junxian [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China (China); Malhotra, Sangeeta; Rhoads, James E. [Arizona State University, School of Earth and Space Exploration (United States); Gronke, Max; Dijkstra, Mark [Institute of Theoretical Astrophysics, University of Oslo (Norway); Jaskot, Anne [Smith College, Northampton, MA (United States); Zheng, Zhenya, E-mail: yanghuan@mail.ustc.edu.cn, E-mail: huan.y@asu.edu, E-mail: Sangeeta.Malhotra@asu.edu, E-mail: James.Rhoads@asu.edu [Pontificia Universidad Católica de Chile, Santiago (Chile)

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  10. Group chase and escape with sight-limited chasers

    Science.gov (United States)

    Wang, Huodong; Han, Wenchen; Yang, Junzhong

    2017-01-01

    We study group chase and escape with sight-limited chasers. Two search strategies, random-walk-strategy and relocation-strategy, are introduced for chasers when escapers are out of their fields of vision. There exist two regimes for the group lifetime of escapers. In the narrow sight regime, the group lifetime is a decreasing function of chasers' sight range. In the wide sight regime, the group lifetime stays at a constant when chasers adopting random-walk-strategy while increases with the sight range when chasers adopting relocation-strategy. The impacts of the two search strategies on group chase and escape are studied by investigating the lifetime distribution of all escapers and the dependence of the minimum lifetime on the number of chasers. We also find that, to reach the most efficient and the lowest energy cost chase for chasers, the ratio between the number of chasers and escapers stays at around 6 under random-walk-strategy. However, the optimal number of chasers vanishes and the energy cost monotonically increases with increasing the number of chasers under relocation-strategy.

  11. Dynamics of immune escape during HIV/SIV infection.

    Directory of Open Access Journals (Sweden)

    Christian L Althaus

    Full Text Available Several studies have shown that cytotoxic T lymphocytes (CTLs play an important role in controlling HIV/SIV infection. Notably, the observation of escape mutants suggests a selective pressure induced by the CTL response. However, it remains difficult to assess the definite role of the cellular immune response. We devise a computational model of HIV/SIV infection having a broad cellular immune response targeting different viral epitopes. The CTL clones are stimulated by viral antigen and interact with the virus population through cytotoxic killing of infected cells. Consequently, the virus population reacts through the acquisition of CTL escape mutations. Our model provides realistic virus dynamics and describes several experimental observations. We postulate that inter-clonal competition and immunodominance may be critical factors determining the sequential emergence of escapes. We show that even though the total killing induced by the CTL response can be high, escape rates against a single CTL clone are often slow and difficult to estimate from infrequent sequence measurements. Finally, our simulations show that a higher degree of immunodominance leads to more frequent escape with a reduced control of viral replication but a substantially impaired replicative capacity of the virus. This result suggests two strategies for vaccine design: Vaccines inducing a broad CTL response should decrease the viral load, whereas vaccines stimulating a narrow but dominant CTL response are likely to induce escape but may dramatically reduce the replicative capacity of the virus.

  12. Lyman-Werner UV Escape Fractions from Primordial Halos

    CERN Document Server

    Schauer, Anna T P; Glover, Simon C O; Klessen, Ralf S

    2015-01-01

    Population III stars can regulate star formation in the primordial Universe in several ways. They can ionize nearby halos, and even if their ionizing photons are trapped by their own halos, their Lyman-Werner (LW) photons can still escape and destroy H$_2$ in other halos, preventing them from cooling and forming stars. LW escape fractions are thus a key parameter in cosmological simulations of early reionization and star formation but have not yet been parametrized for realistic halos by halo or stellar mass. To do so, we perform radiation hydrodynamical simulations of LW UV escape from 9--120 M$_{\\odot}$ Pop III stars in $10^5$ to $10^7$ M$_{\\odot}$ halos with ZEUS-MP. We find that photons in the LW lines (i.e. those responsible for destroying H$_{2}$ in nearby systems) have escape fractions ranging from 0% to 85%. No LW photons escape the most massive halo in our sample, even from the most massive star. Escape fractions for photons elsewhere in the 11.18--13.6~eV energy range, which can be redshifted into t...

  13. Green Pea Galaxies Reveal Secrets of Ly$\\alpha$ Escape

    CERN Document Server

    Yang, Huan; Gronke, Max; Rhoads, James E; Jaskot, Anne; Zheng, Zhenya; Dijkstra, Mark

    2015-01-01

    Star-formation in galaxies generates a lot of Ly$\\alpha$ photons. Understanding the escape of Ly$\\alpha$ photons from galaxies is a key issue in studying high redshift galaxies and probing cosmic reionization with Ly$\\alpha$. To understand Ly$\\alpha$ escape, it is valuable to study analogs of high redshift Ly$\\alpha$ emitters in nearby universe. However, most nearby analogs have too small a Ly$\\alpha$ equivalent width and escape fraction compared to high redshift Ly$\\alpha$ emitters. One different group of nearby analogs are "Green Pea" galaxies, selected by their high equivalent width optical emission lines. Here we show that Green Pea galaxies have strong Ly$\\alpha$ emission lines and high Ly$\\alpha$ escape fraction (see also Henry et al. 2015), providing an opportunity to solve Ly$\\alpha$ escape problem. Green Peas have a Ly$\\alpha$ equivalent width distribution similar to high redshift Ly$\\alpha$ emitters. The Ly$\\alpha$ escape fraction correlates with many quantities of Ly$\\alpha$ profile, especially the...

  14. Escape dynamics and fractal basin boundaries in Seyfert galaxies

    CERN Document Server

    Zotos, Euaggelos E

    2015-01-01

    The escape dynamics in a simple analytical gravitational model which describes the motion of stars in a Seyfert galaxy is investigated in detail. We conduct a thorough numerical analysis distinguishing between regular and chaotic orbits as well as between trapped and escaping orbits, considering only unbounded motion for several energy levels. In order to distinguish safely and with certainty between ordered and chaotic motion, we apply the Smaller ALingment Index (SALI) method. It is of particular interest to locate the escape basins through the openings around the collinear Lagrangian points $L_1$ and $L_2$ and relate them with the corresponding spatial distribution of the escape times of the orbits. Our exploration takes place both in the physical $(x,y)$ and in the phase $(x,\\dot{x})$ space in order to elucidate the escape process as well as the overall orbital properties of the galactic system. Our numerical analysis reveals the strong dependence of the properties of the considered escape basins with the...

  15. Food Enzymes

    Science.gov (United States)

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  16. Enzyme immunoassay

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, B; Dinesen, B; Deckert, M

    1985-01-01

    An enzyme linked immunoadsorbent assay for urinary albumin using commercially available reagents is described. The assay range is 2.5-120 micrograms/l. When samples are analysed in two standard dilutions, the assayable albumin concentration range is 2.5-240 mg/l, covering the clinical range from...

  17. Apoptotic pathways as a therapeutic target for colorectal cancer treatment

    Institute of Scientific and Technical Information of China (English)

    Aman M Abraha; Ezra B Ketema

    2016-01-01

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment.

  18. Human CD14 mediates recognition and phagocytosis of apoptotic cells.

    Science.gov (United States)

    Devitt, A; Moffatt, O D; Raykundalia, C; Capra, J D; Simmons, D L; Gregory, C D

    1998-04-02

    Cells undergoing programmed cell death (apoptosis) are cleared rapidly in vivo by phagocytes without inducing inflammation. Here we show that the glycosylphosphatidylinositol-linked plasma-membrane glycoprotein CD14 on the surface of human macrophages is important for the recognition and clearance of apoptotic cells. CD14 can also act as a receptor that binds bacterial lipopolysaccharide (LPS), triggering inflammatory responses. Overstimulation of CD14 by LPS can cause the often fatal toxic-shock syndrome. Here we show that apoptotic cells interact with CD14, triggering phagocytosis of the apoptotic cells. This interaction depends on a region of CD14 that is identical to, or at least closely associated with, a region known to bind LPS. However, apoptotic cells, unlike LPS, do not provoke the release of pro-inflammatory cytokines from macrophages. These results indicate that clearance of apoptotic cells is mediated by a receptor whose interactions with 'non-self' components (LPS) and 'self' components (apoptotic cells) produce distinct macrophage responses.

  19. Cytosolic pro-apoptotic SPIKE induces mitochondrial apoptosis in cancer.

    Science.gov (United States)

    Nikolic, Ivana; Kastratovic, Tatjana; Zelen, Ivanka; Zivanovic, Aleksandar; Arsenijevic, Slobodan; Mitrovic, Marina

    2010-04-30

    Proteins of the BCL-2 family are important regulators of apoptosis. The BCL-2 family includes three main subgroups: the anti-apoptotic group, such as BCL-2, BCL-XL, BCL-W, and MCL-1; multi-domain pro-apoptotic BAX, BAK; and pro-apoptotic "BH3-only" BIK, PUMA, NOXA, BID, BAD, and SPIKE. SPIKE, a rare pro-apoptotic protein, is highly conserved throughout the evolution, including Caenorhabditis elegans, whose expression is downregulated in certain tumors, including kidney, lung, and breast. In the literature, SPIKE was proposed to interact with BAP31 and prevent BCL-XL from binding to BAP31. Here, we utilized the Position Weight Matrix method to identify SPIKE to be a BH3-only pro-apoptotic protein mainly localized in the cytosol of all cancer cell lines tested. Overexpression of SPIKE weakly induced apoptosis in comparison to the known BH3-only pro-apoptotic protein BIK. SPIKE promoted mitochondrial cytochrome c release, the activation of caspase 3, and the caspase cleavage of caspase's downstream substrates BAP31 and p130CAS. Although the informatics analysis of SPIKE implicates this protein as a member of the BH3-only BCL-2 subfamily, its role in apoptosis remains to be elucidated.

  20. Teratogen-induced apoptotic cell death: does the apoptotic machinery act as a protector of embryos exposed to teratogens?

    Science.gov (United States)

    Torchinsky, Arkady; Fein, Amos; Toder, Vladimir

    2005-12-01

    Considerable evidence has been collected demonstrating that many teratogens induce apoptotic cell death in embryonic structures that turn out to be malformed in fetuses and newborns. Apoptosis is a genetically regulated process that is realized by the activation of death and pro-survival signaling cascades, and the interplay between these cascades determines whether the cell exposed to apoptotic stimuli dies or survives. Therefore, there is intense interest in understanding how the apoptotic machinery functions in embryos exposed to teratogens. However, the interpretation of the results obtained remains problematic. The main problem is that excessive embryonic cell death, regardless of its nature, if uncompensated for, ultimately leads to maldevelopment or embryonic death. Therefore, we can easily interpret results when the intensity of teratogen-induced cell death and the severity or incidence of teratogen-induced anomalies directly correlate with each other. However, when teratogen-induced cell death is not followed by the formation of anomalies, a usual explanation is that teratogen-induced apoptotic cell death contributes to the renewal of teratogen-targeted cell populations by promoting the removal of injured cells. It is clear that such an explanation leaves vague the role of the anti-apoptotic signaling mechanism (and, hence, the apoptotic machinery as a whole) with respect to protecting the embryo against teratogenic stress. In this review, we summarize the data from studies addressing the function of the apoptotic machinery in embryos exposed to teratogens, and then we discuss approaches to interpreting the results of these studies. We hypothesize that activation of a proapoptotic signaling in teratogen-targeted cell populations is a necessary condition for an anti-apoptotic signaling that counteracts the process of maldevelopment to be activated. If such a scenario is true, we need to modify our approaches to choosing molecular targets for studies

  1. Alterations in oxidative, inflammatory and apoptotic events in short-lived and long-lived mice testes

    Science.gov (United States)

    Matzkin, María Eugenia; Miquet, Johanna Gabriela; Fang, Yimin; Hill, Cristal Monique; Turyn, Daniel; Calandra, Ricardo Saúl; Bartke, Andrzej; Frungieri, Mónica Beatriz

    2016-01-01

    Aged testes undergo profound histological and morphological alterations leading to a reduced functionality. Here, we investigated whether variations in longevity affect the development of local inflammatory processes, the oxidative state and the occurrence of apoptotic events in the testis. To this aim, well-established mouse models with delayed (growth hormone releasing hormone-knockout and Ames dwarf mice) or accelerated (growth hormone-transgenic mice) aging were used. We hereby show that the testes of short-lived mice show a significant increase in cyclooxygenase 2 expression, PGD2 production, lipid peroxidation, antioxidant enzymes expression, local macrophages and TUNEL-positive germ cells numbers, and the levels of both pro-caspase-3 and cleaved caspase-3. In contrast, although the expression of antioxidant enzymes remained unchanged in testes of long-lived mice, the remainder of the parameters assessed showed a significant reduction. This study provides novel evidence that longevity confers anti-inflammatory, anti-oxidant and anti-apoptotic capacities to the adult testis. Oppositely, short-lived mice suffer testicular inflammatory, oxidative and apoptotic processes. PMID:26805572

  2. Low expression of pro-apoptotic Bcl-2 family proteins sets the apoptotic threshold in Waldenström macroglobulinemia.

    Science.gov (United States)

    Gaudette, B T; Dwivedi, B; Chitta, K S; Poulain, S; Powell, D; Vertino, P; Leleu, X; Lonial, S; Chanan-Khan, A A; Kowalski, J; Boise, L H

    2016-01-28

    Waldenström macroglobulinemia (WM) is a proliferative disorder of IgM-secreting, lymphoplasmacytoid cells that inhabit the lymph nodes and bone marrow. The disease carries a high prevalence of activating mutations in MyD88 (91%) and CXCR4 (28%). Because signaling through these pathways leads to Bcl-xL induction, we examined Bcl-2 family expression in WM patients and cell lines. Unlike other B-lymphocyte-derived malignancies, which become dependent on expression of anti-apoptotic proteins to counter expression of pro-apoptotic proteins, WM samples expressed both pro- and anti-apoptotic Bcl-2 proteins at low levels similar to their normal B-cell and plasma cell counterparts. Three WM cell lines expressed pro-apoptotic Bcl-2 family members Bim or Bax and Bak at low levels, which determined their sensitivity to inducers of intrinsic apoptosis. In two cell lines, miR-155 upregulation, which is common in WM, was responsible for the inhibition of FOXO3a and Bim expression. Both antagonizing miR-155 to induce Bim and proteasome inhibition increased the sensitivity to ABT-737 in these lines indicating a lowering of the apoptotic threshold. In this manner, treatments that increase pro-apoptotic protein expression increase the efficacy of agents treated in combination in addition to direct killing.

  3. Alkylating enzymes.

    Science.gov (United States)

    Wessjohann, Ludger A; Keim, Jeanette; Weigel, Benjamin; Dippe, Martin

    2013-04-01

    Chemospecific and regiospecific modifications of natural products by methyl, prenyl, or C-glycosyl moieties are a challenging and cumbersome task in organic synthesis. Because of the availability of an increasing number of stable and selective transferases and cofactor regeneration processes, enzyme-assisted strategies turn out to be promising alternatives to classical synthesis. Two categories of alkylating enzymes become increasingly relevant for applications: firstly prenyltransferases and terpene synthases (including terpene cyclases), which are used in the production of terpenoids such as artemisinin, or meroterpenoids like alkylated phenolics and indoles, and secondly methyltransferases, which modify flavonoids and alkaloids to yield products with a specific methylation pattern such as 7-O-methylaromadendrin and scopolamine.

  4. 78 FR 54585 - Safety Zone; Escape to Miami Triathlon, Biscayne Bay, Miami, FL

    Science.gov (United States)

    2013-09-05

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Escape to Miami Triathlon, Biscayne Bay... during the Publix Escape to Miami Triathlon. The Publix Escape to Miami Triathlon is scheduled to take... of life on navigable waters of the United States during the Publix Escape to Miami Triathlon....

  5. Curcumin induces differential expression of cytoprotective enzymes but similar apoptotic responses in fibroblasts and myofibroblasts

    NARCIS (Netherlands)

    Lundvig, D.M.S.; Pennings, S.W.C.; Brouwer, K.M.; Mtaya-Mlangwa, M.; Mugonzibwa, E.A.; Kuijpers-Jagtman, A.M.; Hoff, J.W. Von den; Wagener, F.A.D.T.G.

    2015-01-01

    Excessive extracellular matrix (ECM) deposition and tissue contraction after injury can lead to esthetic and functional problems. Fibroblasts and myofibroblasts activated by transforming growth factor (TGF)-beta1 play a key role in these processes. The persistence of (myo)fibroblasts and their exces

  6. Comparison of spacecraft crew escape systems through dynamic optimization

    Science.gov (United States)

    Hart, William G., III

    Crew escape systems have been a vital component of ensuring safety onboard manned spacecraft. Although there have been only a few aborts involving their use, their operation helps decrease risk in what is known to be a hazardous field. But despite their high reliability, crew escape systems typically suffer from heavy weight, lack of control and hazardous chemical propellants. Hybrid propulsion systems could be a viable solution to all of these problems. With their inert components, ability to throttle and higher specific impulse than solids, hybrids have obtained interest in recent years. This dissertation presents a method that can be used to compare solid and hybrid propulsion systems for the crew escape systems of spacecraft. The concepts of dynamic optimization, Monte Carlo simulation and propulsion system design are combined to produce a tool which can predict the probability of survival for a given abort scenario. The method can also determine the effect of uncertain variables, such as reaction time or the payload of the vehicle, in the safety of the crew. The method is then used to compare crew escape systems for two separate vehicles: a separable crew cabin proposed for the Space Shuttle Launch Vehicle and the Launch Escape System for the Crew Exploration Vehicle scheduled to begin operation in 2012. The effects of uncertain parameters are also studied. The results show the utility of this method and the objective function, and how it could be used in the design process for future space vehicles.

  7. Extreme hydrodynamic atmospheric loss near the critical thermal escape regime

    CERN Document Server

    Erkaev, N V; Odert, P; Kulikov, Yu N; Kislyakova, K G

    2015-01-01

    By considering martian-like planetary embryos inside the habitable zone of solar-like stars we study the behavior of the hydrodynamic atmospheric escape of hydrogen for small values of the Jeans escape parameter $\\beta < 3$, near the base of the thermosphere, that is defined as a ratio of the gravitational and thermal energy. Our study is based on a 1-D hydrodynamic upper atmosphere model that calculates the volume heating rate in a hydrogen dominated thermosphere due to the absorption of the stellar soft X-ray and extreme ultraviolet (XUV) flux. We find that when the $\\beta$ value near the mesopause/homopause level exceeds a critical value of $\\sim$2.5, there exists a steady hydrodynamic solution with a smooth transition from subsonic to supersonic flow. For a fixed XUV flux, the escape rate of the upper atmosphere is an increasing function of the temperature at the lower boundary. Our model results indicate a crucial enhancement of the atmospheric escape rate, when the Jeans escape parameter $\\beta$ decr...

  8. Single-File Escape of Colloidal Particles from Microfluidic Channels

    Science.gov (United States)

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-01

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10-15 N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions.

  9. Escape dynamics in a binary system of interacting galaxies

    CERN Document Server

    Zotos, Euaggelos E

    2016-01-01

    The escape dynamics in an analytical gravitational model which describes the motion of stars in a binary system of interacting dwarf spheroidal galaxies is investigated in detail. We conduct a numerical analysis distinguishing between regular and chaotic orbits as well as between trapped and escaping orbits, considering only unbounded motion for several energy levels. In order to distinguish safely and with certainty between ordered and chaotic motion, we apply the Smaller ALingment Index (SALI) method. It is of particular interest to locate the escape basins through the openings around the collinear Lagrangian points $L_1$ and $L_2$ and relate them with the corresponding spatial distribution of the escape times of the orbits. Our exploration takes place both in the configuration $(x,y)$ and in the phase $(x,\\dot{x})$ space in order to elucidate the escape process as well as the overall orbital properties of the galactic system. Our numerical analysis reveals the strong dependence of the properties of the con...

  10. Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics.

    Science.gov (United States)

    Lönn, Peter; Kacsinta, Apollo D; Cui, Xian-Shu; Hamil, Alexander S; Kaulich, Manuel; Gogoi, Khirud; Dowdy, Steven F

    2016-09-08

    Bioactive macromolecular peptides and oligonucleotides have significant therapeutic potential. However, due to their size, they have no ability to enter the cytoplasm of cells. Peptide/Protein transduction domains (PTDs), also called cell-penetrating peptides (CPPs), can promote uptake of macromolecules via endocytosis. However, overcoming the rate-limiting step of endosomal escape into the cytoplasm remains a major challenge. Hydrophobic amino acid R groups are known to play a vital role in viral escape from endosomes. Here we utilize a real-time, quantitative live cell split-GFP fluorescence complementation phenotypic assay to systematically analyze and optimize a series of synthetic endosomal escape domains (EEDs). By conjugating EEDs to a TAT-PTD/CPP spilt-GFP peptide complementation assay, we were able to quantitatively measure endosomal escape into the cytoplasm of live cells via restoration of GFP fluorescence by intracellular molecular complementation. We found that EEDs containing two aromatic indole rings or one indole ring and two aromatic phenyl groups at a fixed distance of six polyethylene glycol (PEG) units from the TAT-PTD-cargo significantly enhanced cytoplasmic delivery in the absence of cytotoxicity. EEDs address the critical rate-limiting step of endosomal escape in delivery of macromolecular biologic peptide, protein and siRNA therapeutics into cells.

  11. Immunosuppressive cells in tumor immune escape and metastasis.

    Science.gov (United States)

    Liu, Yang; Cao, Xuetao

    2016-05-01

    Tumor immune escape and the initiation of metastasis are critical steps in malignant progression of tumors and have been implicated in the failure of some clinical cancer immunotherapy. Tumors develop numerous strategies to escape immune surveillance or metastasize: Tumors not only modulate the recruitment and expansion of immunosuppressive cell populations to develop the tumor microenvironment or pre-metastatic niche but also switch the phenotype and function of normal immune cells from a potentially tumor-reactive state to a tumor-promoting state. Immunosuppressive cells facilitate tumor immune escape by inhibiting antitumor immune responses and furthermore promote tumor metastasis by inducing immunosuppression, promoting tumor cell invasion and intravasation, establishing a pre-metastatic niche, facilitating epithelial-mesenchymal transition, and inducing angiogenesis at primary tumor or metastatic sites. Numerous translational studies indicate that it is possible to inhibit tumor immune escape and prevent tumor metastasis by blocking immunosuppressive cells and eliminating immunosuppressive mechanisms that are induced by either immunosuppressive cells or tumor cells. Furthermore, many clinical trials targeting immunosuppressive cells have also achieved good outcome. In this review, we focus on the underlying mechanisms of immunosuppressive cells in promoting tumor immune escape and metastasis, discuss our current understanding of the interactions between immunosuppressive cells and tumor cells in the tumor microenvironment, and suggest future research directions as well as potential clinical strategies in cancer immunotherapy.

  12. Enhancing endosomal escape for nanoparticle mediated siRNA delivery

    Science.gov (United States)

    Ma, Da

    2014-05-01

    Gene therapy with siRNA is a promising biotechnology to treat cancer and other diseases. To realize siRNA-based gene therapy, a safe and efficient delivery method is essential. Nanoparticle mediated siRNA delivery is of great importance to overcome biological barriers for systemic delivery in vivo. Based on recent discoveries, endosomal escape is a critical biological barrier to be overcome for siRNA delivery. This feature article focuses on endosomal escape strategies used for nanoparticle mediated siRNA delivery, including cationic polymers, pH sensitive polymers, calcium phosphate, and cell penetrating peptides. Work has been done to develop different endosomal escape strategies based on nanoparticle types, administration routes, and target organ/cell types. Also, enhancement of endosomal escape has been considered along with other aspects of siRNA delivery to ensure target specific accumulation, high cell uptake, and low toxicity. By enhancing endosomal escape and overcoming other biological barriers, great progress has been achieved in nanoparticle mediated siRNA delivery.

  13. Expression of leptin and its receptor in female breast cancer in relation with selected apoptotic markers.

    Directory of Open Access Journals (Sweden)

    Stanislaw Sulkowski

    2008-04-01

    Full Text Available Leptin and its receptor may be engaged in pathogenesis of breast cancer among various human tumors. In vitro investigations showed leptin-mediated escalation of estrogen synthesis and boosted activity of estrogen receptor ERalpha. Furthermore, leptin induced growth of malignant cells, counteracted apoptosis and stimulated cell migration as well as overexpression of angiogenic factors and degrading enzymes that split network of intercellular matrix. On the other side, leptin has been reported to favor apoptosis, lately. Proapoptotic effect of leptin action was revealed in interstitial cells of bone marrow and adipocytes. Our past reports provide evidences for overexpression of leptin and its receptor in breast cancer in comparison with benign mammary lesions. In current study we aimed at assessment of eventual relationships between leptin, leptin receptor and selected protein regulators of apoptosis in breast cancer. We applied immunohistochemistry for leptin, leptin receptor, anti-apoptotic Bcl-2 and Bcl-xL as well as pro-apoptotic Bak and Bax expression assessment in 106 cases of human breast cancers. The immunoreaction was graded and statistically evaluated. Expression of leptin was positively correlated with Bcl-xL, Bak and Bax (p<0.001, r=0.614; p<0.001, r=0.518; p<0.001, r=0.511, respectively. Statistical significances were noted between expression of leptin receptor and Bcl-xL or Bax (p=0.011, r=0.210; p<0.001, r=0.313, respectively. No correlation was encountered between leptin and Bcl-2, either leptin receptor and Bcl-2 or leptin receptor and Bak. On the basis of obtained results, leptin system could interfere in balance among expressions of pro- and anti-apoptotic proteins and regulate cell turnover and--by means of it--facilitate breast cancer progression.

  14. Resveratrol engages selective apoptotic signals in gastric adenocarcinoma cells

    Institute of Scientific and Technical Information of China (English)

    William L Riles; Jason Erickson; Sanjay Nayyar; Mary Jo Atten; Bashar M Attar; Oksana Holian

    2006-01-01

    AIM: To investigate the intracellular apoptotic signals engaged by resveratrol in three gastric adenocarcinoma cancer cell lines, two of which (AGS and SNU-1) express p53 and one (KATO-Ⅲ) with deleted p53.METHODS: Nuclear fragmentation was used to quantitate apoptotic cells; caspase activity was determined by photometric detection of cleaved substrates; formation of oxidized cytochrome C was used to measure cytochrome C activity, and Western blot analysis was used to determine protein expression.RESULTS: Gastric cancer cells, irrespective of their p53 status, responded to resveratrol with fragmentation of DNA and cleavage of nuclear lamins A and B and PARP, Resveratrol, however, has no effect on mitochondria-associated apoptotic proteins Bcl-2, Bclxl, Bax, Bid or Smac/Diablo, and did not promote subcellular redistribution of cytochrome C, indicating that resveratrol-induced apoptosis of gastric carcinoma cells does not require breakdown of mitochondrial membrane integrity. Resveratrol up-regulated p53 protein in SNU-1 and AGS cells but there was a difference in response of intracellular apoptotic signals between these cell lines.SNU-1 cells responded to resveratrol treatment with down-regulation of survivin, whereas in AGS and KATO-Ⅲ cells resveratrol stimulated caspase 3 and cytochrome C oxidase activities.CONCLUSION: These findings indicate that even within a specific cancer the intracellular apoptotic signals engaged by resveratrol are cell type dependent and suggest that such differences may be related to differentiation or lack of differentiation of these cells.

  15. Escape rate and diffusion of a Stochastically Driven particle

    Science.gov (United States)

    Piscitelli, Antonio; Pica Ciamarra, Massimo

    2017-01-01

    The dynamical properties of a tracer repeatedly colliding with heat bath particles can be described within a Langevin framework provided that the tracer is more massive than the bath particles, and that the collisions are frequent. Here we consider the escape of a particle from a potential well, and the diffusion coefficient in a periodic potential, without making these assumptions. We have thus investigated the dynamical properties of a Stochastically Driven particle that moves under the influence of the confining potential in between successive collisions with the heat bath. In the overdamped limit, both the escape rate and the diffusion coefficient coincide with those of a Langevin particle. Conversely, in the underdamped limit the two dynamics have a different temperature dependence. In particular, at low temperature the Stochastically Driven particle has a smaller escape rate, but a larger diffusion coefficient. PMID:28120904

  16. Escape probability of the super-Penrose process

    CERN Document Server

    Ogasawara, Kota; Miyamoto, Umpei; Igata, Takahisa; Patil, Mandar

    2016-01-01

    We consider a head-on collision of two massive particles that move in the equatorial plane of an extremal Kerr black hole, which results in the production of two massless particles. Focusing a typical case, where both of the colliding particles have zero angular momenta, we show that a massless particle produced in such a collision can escape to infinity with arbitrarily large energy in the near-horizon limit of the collision point. Furthermore, if we assume that the emission of the produced massless particles is isotropic in the center-of-mass frame but confined to the equatorial plane, the escape probability of the produced massless particle approaches $5/12$ and almost all escaping massless particles have arbitrarily large energy at infinity and an impact parameter approaching $2M$.

  17. Local Augmented Angiotensinogen Secreted from Apoptotic Vascular Endothelial Cells Is a Vital Mediator of Vascular Remodelling.

    Directory of Open Access Journals (Sweden)

    Shyh-Jong Wu

    Full Text Available Vascular remodelling is a critical vasculopathy found in atheromatous diseases and allograft failures. The local renin angiotensin system (RAS has been implicated in vascular remodelling. However, the mechanisms by which the augmented local RAS is associated with the initial event of endothelial cell apoptosis in injured vasculature remain undefined. We induced the apoptosis of human umbilical vein endothelial cells (HUVECs and vascular smooth muscle cells (VSMCs through serum starvation (SS. After the cells were subjected to SS, we found that the mRNA expression of angiotensinogen (AGT was increased by >3-fold in HUVECs and by approximately 2.5-fold in VSMCs. In addition, the expression of angiotensin-converting enzyme (ACE mRNA was increased in VSMCs but decreased to 50% in HUVECs during the same apoptotic process. Increases in the expression of AGT protein and angiotensin II (Ang II were found in a serum-free medium conditioned by HUVECs (SSC. The increased Ang II was suppressed using lisinopril (an ACE inhibitor treatment. Moreover, the activation of ERK1/2 induced by the SSC in VSMCs was also suppressed by losartan. In conclusion, we first demonstrated that the augmented AGT released from apoptotic endothelial cells acts as a vital progenitor of Ang II to accelerate vascular remodelling, and we suggest that blocking local augmented Ang II might be an effective strategy for restraining intimal hyperplasia.

  18. Usage of whey protein may cause liver damage via inflammatory and apoptotic responses.

    Science.gov (United States)

    Gürgen, S G; Yücel, A T; Karakuş, A Ç; Çeçen, D; Özen, G; Koçtürk, S

    2015-07-01

    The purpose of this study was to investigate the long- and short-term inflammatory and apoptotic effects of whey protein on the livers of non-exercising rats. Thirty rats were divided into three groups namely (1) control group, (2) short-term whey (WS) protein diet (252 g/kg for 5 days), and (3) long-term whey (WL) protein diet (252 g/kg for 4 weeks). Interleukin 1β (IL-1β), IL-6, tumor necrosis factor α (TNF-α), and cytokeratin 18 (CK-18-M30) were assessed using enzyme-linked immunosorbent assay and immunohistochemical methods. Apoptosis was evaluated using the terminal transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) method. Hepatotoxicity was evaluated by quantitation of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Based on the biochemical levels and immunohistochemical results, the highest level of IL-1β was identified in the WL group (p whey protein is used in an uninformed manner and without exercising, adverse effects on the liver may occur by increasing the apoptotic signal in the short term and increasing inflammatory markers and hepatotoxicity in the long term.

  19. Lactadherin inhibits secretory phospholipase A2 activity on pre-apoptotic leukemia cells.

    Directory of Open Access Journals (Sweden)

    Steffen Nyegaard

    Full Text Available Secretory phospholipase A2 (sPLA2 is a critical component of insect and snake venoms and is secreted by mammalian leukocytes during inflammation. Elevated secretory PLA2 concentrations are associated with autoimmune diseases and septic shock. Many sPLA2's do not bind to plasma membranes of quiescent cells but bind and digest phospholipids on the membranes of stimulated or apoptotic cells. The capacity of these phospholipases to digest membranes of stimulated or apoptotic cells correlates to the exposure of phosphatidylserine. In the present study, the ability of the phosphatidyl-L-serine-binding protein, lactadherin to inhibit phospholipase enzyme activity has been assessed. Inhibition of human secretory phospholipase A2-V on phospholipid vesicles exceeded 90%, whereas inhibition of Naja mossambica sPLA2 plateaued at 50-60%. Lactadherin inhibited 45% of activity of Naja mossambica sPLA2 and >70% of human secretory phospholipase A2-V on the membranes of human NB4 leukemia cells treated with calcium ionophore A23187. The data indicate that lactadherin may decrease inflammation by inhibiting sPLA2.

  20. Escape of protists in predator-generated feeding currents

    DEFF Research Database (Denmark)

    Jakobsen, Hans Henrik

    2002-01-01

    The ciliate Strobilidium sp. and 2 flagellates, Chrysochromulina simplex and Gymnodinium sp., were exposed to predator-generated feeding currents, and their escape responses were quantified using 2- and 3-dimensional video techniques. All 3 studied organisms responded by escaping at a defined...... of Strobilidium sp. to the copepod Temora longicornis. The predicted reaction distance fit closely that measured, When the flagellates were exposed to the flow field of the ciliate Uronema filificum, they both responded up-stream to the feeding current. From the distance at which the flagellates responded...

  1. Escape probability based routing for ad hoc networks

    Institute of Scientific and Technical Information of China (English)

    Zhang Xuanping; Qin Zheng; Li Xin

    2006-01-01

    Routes in an ad hoc network may fail frequently because of node mobility. Stability therefore can be an important element in the design of routing protocols. The node escape probability is introduced to estimate the lifetime and stability of link between neighboring nodes and the escape probability based routing (EPBR) scheme to discover stable routes is proposed. Simulation results show that the EPBR can discover stable routes to reduce the number of route rediscovery, and is applicable for the situation that has highly dynamic network topology with broad area of communication.

  2. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery

    Science.gov (United States)

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-06-01

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds’ escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds’ cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier.

  3. Glycine tomentella Hayata inhibits IL-1β and IL-6 production, inhibits MMP-9 activity, and enhances RAW264.7 macrophage clearance of apoptotic cells

    Directory of Open Access Journals (Sweden)

    Sun Yu-Shu

    2010-11-01

    Full Text Available Abstract Background To assess the effects of Glycine tomentella Hayata (GTH, a traditional herbal medicine for treatment of rheumatic diseases on the expression of the proinflammatory cytokines and on the clearance of apoptotic cells by macrophages. Methods RAW264.7 cells were cultured with lipopolysaccharide (LPS in the presence or absence of ethanol extract of GTH. The expression of proinflammatory cytokines IL-1β, IL-6, and TNF-α, and inducible nitric oxide synthase (iNOS and transglutaminase 2 (TG2 were assayed by reverse transcriptase-polymerase chain reaction (RT-PCR and enzyme-linked immunosorbent assay (ELISA. Matrix metalloproteinase (MMP-2 and MMP-9 were assayed by gelatin zymography. For detecting uptake of apoptotic cells, RAW264.7 cells were cultured with carboxyfluorescein diacetate (CFDA-stained apoptotic cells and assayed by flow cytometry. Results The major components of GTH analyzed by high-performance liquid chromatography (HPLC chromatogram were daidzein (42.5%, epicatechin (28.8%, and naringin (9.4%. GTH treatment inhibited the expression of proinflammatory cytokines IL-1β, IL-6 and MMP-9 but did not affect the expression of TNF-α and iNOS. GTH significantly enhanced the expression of TG2 and the clearance of apoptotic cells by RAW264.7 macrophages. Conclusions GTH inhibits proinflammatory cytokine secretion and MMP-9 activity, enhances apoptotic cell uptake and up-regulates TG2 expression. Our data show that GTH might have beneficial effects on rheumatic diseases.

  4. Upregulation of Phagocytic Clearance of Apoptotic Cells by Autoimmune Regulator

    Institute of Scientific and Technical Information of China (English)

    石亮; 胡丽华; 李一荣

    2010-01-01

    To investigate the effect of autoimmune regulator(AIRE) on phagocytic clearance of apoptotic cells,a recombinant expression vector containing full-length human AIRE cDNA was transfected into 16HBE cells.After incubation with transfected 16HBE cells,engulfment of apoptotic HL-60 cells induced by camptothecin was detected by myeloperoxidase(MPO) staining.The change in the expression of Rac 1 in transfected 16HBE cells was determined by RT-PCR and Western blotting.The results showed that the phagocytosis perce...

  5. Autologous HIV-1 neutralizing antibodies: emergence of neutralization-resistant escape virus and subsequent development of escape virus neutralizing antibodies

    DEFF Research Database (Denmark)

    Arendrup, M; Nielsen, C; Hansen, J E;

    1992-01-01

    The capacity of consecutive human sera to neutralize sequentially obtained autologous virus isolates was studied. HIV-1 was isolated three times over a 48-164-week period from three individuals immediately after seroconversion and from two individuals in later stages of infection. Development of ...... escape virus may be part of the explanation of the apparent failure of the immune system to control HIV infection.......The capacity of consecutive human sera to neutralize sequentially obtained autologous virus isolates was studied. HIV-1 was isolated three times over a 48-164-week period from three individuals immediately after seroconversion and from two individuals in later stages of infection. Development...... of neutralizing antibodies to the primary virus isolates was detected 13-45 weeks after seroconversion. Emergence of escape virus with reduced sensitivity to neutralization by autologous sera was demonstrated. The patients subsequently developed neutralizing antibodies against the escape virus but after a delay...

  6. The apoptotic effect and the plausible mechanism of microwave radiation on rat myocardial cells.

    Science.gov (United States)

    Zhu, Wenhe; Cui, Yan; Feng, Xianmin; Li, Yan; Zhang, Wei; Xu, Junjie; Wang, Huiyan; Lv, Shijie

    2016-08-01

    Microwaves may exert adverse biological effects on the cardiovascular system at the integrated system and cellular levels. However, the mechanism underlying such effects remains poorly understood. Here, we report a previously uncharacterized mechanism through which microwaves damage myocardial cells. Rats were treated with 2450 MHz microwave radiation at 50, 100, 150, or 200 mW/cm(2) for 6 min. Microwave treatment significantly enhanced the levels of various enzymes in serum. In addition, it increased the malondialdehyde content while decreasing the levels of antioxidative stress enzymes, activities of enzyme complexes I-IV, and ATP in myocardial tissues. Notably, irradiated myocardial cells exhibited structural damage and underwent apoptosis. Furthermore, Western blot analysis revealed significant changes in expression levels of proteins involved in oxidative stress regulation and apoptotic signaling pathways, indicating that microwave irradiation could induce myocardial cell apoptosis by interfering with oxidative stress and cardiac energy metabolism. Our findings provide useful insights into the mechanism of microwave-induced damage to the cardiovascular system.

  7. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects.

    Science.gov (United States)

    Hamed, Sherifa S; Al-Yhya, Nouf A; El-Khadragy, Manal F; Al-Olayan, Ebtesam M; Alajmi, Reem A; Hassan, Zeinab K; Hassan, Salwa B; Abdel Moneim, Ahmed E

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds.

  8. Spatial and Nonspatial Escape Strategies in the Barnes Maze

    Science.gov (United States)

    Harrison, Fiona E.; Reiserer, Randall S.; Tomarken, Andrew J.; McDonald, Michael P.

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either…

  9. Entrapment and escape of liquid lubricant in metal forming

    DEFF Research Database (Denmark)

    Bech, Jakob Ilsted; Bay, Niels; Eriksen, Morten

    1999-01-01

    with Varying viscosity, speed, reduction, workpiece material, back tension and friction. The mechanisms are influenced by all these parameters in an explicable way. Theoretical models of the escape mechanisms are established combining continuum mechanic analyses of the die pressure distribution with a fluid...

  10. Enuresis Control through Fading, Escape, and Avoidance Training.

    Science.gov (United States)

    Hansen, Gordon D.

    1979-01-01

    A twin signal device that provides both escape and avoidance conditioning in enuresis control was documented with case studies of two enuretic children (eight and nine years old). In addition, a technique of fading as an adjunct to the process was utilized with one subject. (Author/SBH)

  11. Brain size as a driver of avian escape strategy.

    Science.gov (United States)

    Samia, Diogo S M; Pape Møller, Anders; Blumstein, Daniel T

    2015-07-03

    After detecting an approaching predator, animals make a decision when to flee. Prey will initiate flight soon after detecting a predator so as to minimize attentional costs related to on-going monitoring of the whereabouts of the predator. Such costs may compete with foraging and other maintenance activities and hence be larger than the costs of immediate flight. The drivers of interspecific variation in escape strategy are poorly known. Here we investigated the morphological, life history and natural history traits that correlate with variation in avian escape strategy across a sample of 96 species of birds. Brain mass, body size, habitat structure and group size were the main predictors of escape strategy. The direction of the effect of these traits was consistent with selection for a reduction of monitoring costs. Therefore, attentional costs depend on relative brain size, which determines the ability to monitor the whereabouts of potential predators and the difficulty of this task as reflected by habitat and social complexity. Thus brain size, and the cognitive functions associated with it, constitute a general framework for explaining the effects of body size, habitat structure and sociality identified as determinants of avian escape strategy.

  12. The spectrum of Cosmic Rays escaping from relativistic shocks

    CERN Document Server

    Katz, Boaz; Waxman, Eli

    2010-01-01

    We derive expressions for the time integrated spectrum of Cosmic Rays (CRs) that are accelerated in a decelerating relativistic shock wave and escape ahead of the shock. It is assumed that at any given time the CRs have a power law form, carry a constant fraction of the energy E_tot of the shocked plasma, and escape continuously at the maximal energy attainable. The spectrum of escaping particles is highly sensitive to the instantaneous spectral index due to the fact that the minimal energy, E_min ~ \\Gamma^2 m_pc^2 where \\Gamma is the shock Lorentz factor, changes with time. In particular, the escaping spectrum may be considerably harder than the canonical N(E)\\propto E^-2 spectrum. For a shock expanding into a plasma of density n, a spectral break is expected at the maximal energy attainable at the transition to non relativistic velocities, E ~ 10^19 (\\epsilon_B/0.1)(n/1 cm^-3)^(1/6)(E_tot/10^51 erg)^(1/3) eV where \\epsilon_B is the fraction of the energy flux carried by the magnetic field. If ultra-high ene...

  13. Entropy, Lyapunov Exponents and Escape Rates in Open Systems

    CERN Document Server

    Demers, Mark; Young, Lai-Sang

    2011-01-01

    We study the relation between escape rates and pressure in general dynamical systems with holes, where pressure is defined to be the difference between entropy and the sum of positive Lyapunov exponents. Central to the discussion is the formulation of a class of invariant measures supported on the survivor set over which we take the supremum to measure the pressure. Upper bounds for escape rates are proved for general diffeomorphisms of manifolds, possibly with singularities, for arbitrary holes and natural initial distributions including Lebesgue and SRB measures. Lower bounds do not hold in such generality, but for systems admitting Markov tower extensions with spectral gaps, we prove the equality of the escape rate with the absolute value of the pressure and the existence of an invariant measure realizing the escape rate, i.e. we prove a full variational principle. As an application of our results, we prove a variational principle for the billiard map associated with a planar Lorentz gas of finite horizon ...

  14. Escaping Embarrassment: Face-Work in the Rap Cipher

    Science.gov (United States)

    Lee, Jooyoung

    2009-01-01

    How do individuals escape embarrassing moments in interaction? Drawing from ethnographic fieldwork, in-depth interviews, and video recordings of weekly street corner ciphers (impromptu rap sessions), this paper expands Goffman's theory of defensive and protective face-work. The findings reveal formulaic and indirect dimensions of face-work. First,…

  15. Purinergic inhibition of ENaC produces aldosterone escape.

    Science.gov (United States)

    Stockand, James D; Mironova, Elena; Bugaj, Vladislav; Rieg, Timo; Insel, Paul A; Vallon, Volker; Peti-Peterdi, Janos; Pochynyuk, Oleh

    2010-11-01

    The mechanisms underlying "aldosterone escape," which refers to the excretion of sodium (Na(+)) during high Na(+) intake despite inappropriately increased levels of mineralocorticoids, are incompletely understood. Because local purinergic tone in the aldosterone-sensitive distal nephron downregulates epithelial Na(+) channel (ENaC) activity, we tested whether this mechanism mediates aldosterone escape. Here, urinary ATP concentration increased with dietary Na(+) intake in mice. Physiologic concentrations of ATP decreased ENaC activity in a dosage-dependent manner. P2Y(2)(-/-) mice, which lack the purinergic receptor, had significantly less increased Na(+) excretion than wild-type mice in response to high-Na(+) intake. Exogenous deoxycorticosterone acetate and deletion of the P2Y(2) receptor each modestly increased the resistance of ENaC to changes in Na(+) intake; together, they markedly increased resistance. Under the latter condition, ENaC could not respond to changes in Na(+) intake. In contrast, as a result of aldosterone escape, wild-type mice had increased Na(+) excretion in response to high-Na(+) intake regardless of the presence of high deoxycorticosterone acetate. These data suggest that control of ENaC by purinergic signaling is necessary for aldosterone escape.

  16. The Dutch approach to the escape from large compartments

    NARCIS (Netherlands)

    Janse, E.W.; Leur, P.H.E. van de

    1999-01-01

    In the Netherlands, the building regulations have no design mies for large fire compartments (over 1000 m2). With respect to the ability of people to escape from a fire in such large spaces, the Centre for Fire Research of TNO Building and Construction Research has developed a guideline that integra

  17. Regulation of Apoptotic Endonucleases by EndoG

    Science.gov (United States)

    Zhdanov, Dmitry D.; Fahmi, Tariq; Wang, Xiaoying; Apostolov, Eugene O.; Sokolov, Nikolai N.; Javadov, Sabzali

    2015-01-01

    Cells contain several apoptotic endonucleases, which appear to act simultaneously before and after cell death by destroying the host cell DNA. It is largely unknown how the endonucleases are being induced and whether they can regulate each other. This study was performed to determine whether apoptotic mitochondrial endonuclease G (EndoG) can regulate expression of other apoptotic endonucleases. The study showed that overexpression of mature EndoG in kidney tubular epithelial NRK-52E cells can increase expression of caspase-activated DNase (CAD) and four endonucleases that belong to DNase I group including DNase I, DNase X, DNase IL2, and DNase γ, but not endonucleases of the DNase 2 group. The induction of DNase I-type endonucleases was associated with DNA degradation in promoter/exon 1 regions of the endonuclease genes. These results together with findings on colocalization of immunostained endonucleases and TUNEL suggest that DNA fragmentation after EndoG overexpression was caused by DNase I endonucleases and CAD in addition to EndoG itself. Overall, these data provide first evidence for the existence of the integral network of apoptotic endonucleases regulated by EndoG. PMID:25849439

  18. Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Zodwa Dlamini

    2015-11-01

    Full Text Available Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets.

  19. Plasma-induced Escape and Alterations of Planetary Atmospheres

    Science.gov (United States)

    Johnson, R. E.; Tucker, O. J.; Ewrin, J.; Cassidy, T. A.; Leblanc, F.

    2009-12-01

    The atmospheres of planets and planetary satellites are typically imbedded in space plasmas. Depending on the interaction with the induced or intrinsic fields energetic ions can have access to the thermosphere and the corona affecting their composition and thermal structure and causing loss to space. These processes are often lumped together as ‘atmospheric sputtering’ (Johnson 1994). In this talk I will review the results of simulations of the plasma bombardment at a number of solar system bodies and use those data to describe the effect on the upper atmosphere and on escape. Of considerable recent interest is the modeling of escape from Titan. Prior to Cassini’s tour of the Saturnian system, plasma-induced escape was suggested to be the dominant loss process, but recent models of enhanced thermal escape, often referred to as ‘slow hydrodynamic’ escape, have been suggested to lead to much larger Titan atmospheric loss rates (Strobel 2008; Cui et al. 2008). Such a process has been suggested to be active at some point in time on a number of solar system bodies. I will present hybrid fluid/ kinetic models of the upper atmosphere of certain bodies in order to test both the plasma-induced and thermal escape processes. Preliminary results suggest that the loss rates estimated using the ‘slow hydrodynamic’ escape process can be orders of magnitude too large. The implications for Mars, Titan and Pluto will be discussed. Background for this talk is contained in the following papers (Johnson 2004; 2009; Chaufray et al. 2007; Johnson et al. 2008; 2009; Tucker and Johnson 2009). References: Chaufray, J.Y., R. Modolo, F. Leblanc, G. Chanteur, R.E. Johnson, and J.G. Luhmann, Mars Solar Wind interaction: formation of the Martian corona and atmosphric loss to space, JGR 112, E09009, doi:10.1029/2007JE002915 (2007) Cui, J., Yelle, R. V., Volk, K. Distribution and escape of molecular hydrogen in Titan's thermosphere and exosphere. J. Geophys. Res. 113, doi:10

  20. Differential nitric oxide synthesis and host apoptotic events correlate with bleaching susceptibility in reef corals

    Science.gov (United States)

    Hawkins, T. D.; Krueger, T.; Becker, S.; Fisher, P. L.; Davy, S. K.

    2014-03-01

    Coral bleaching poses a threat to coral reefs worldwide. As a consequence of the temperature-induced breakdown in coral-dinoflagellate symbiosis, bleaching can have extensive effects on reef communities. However, our understanding of bleaching at a cellular level is limited, and this is particularly true regarding differential susceptibility among coral species. Recent work suggests that bleaching may represent a host innate immune-like response to symbiont dysfunction that involves synthesis of the signalling compound nitric oxide (NO) and the induction of host apoptotic-like cell death. In this study, we examined the activity of apoptosis-regulating enzymes alongside oxidised NO accumulation (a proxy for NO synthesis) in the reef corals Acropora millepora, Montipora digitata, and Pocillopora damicornis during experimental thermal stress. P. damicornis was the most sensitive species, suffering mortality (tissue sloughing) after 5 days at 33 °C but non-lethal bleaching after 9 days at 31.5 °C. A. millepora bleached at 33 °C but remained structurally intact, while M. digitata showed little evidence of bleaching. P. damicornis and A. millepora both exhibited evidence of temperature-induced NO synthesis and, after 5 days of heating, levels of oxidised NO in both species were fivefold higher than in controls maintained at 28.5 °C. These responses preceded bleaching by a number of days and may have occurred before symbiont dysfunction (measured as chlorophyll a degradation and oxidised NO accumulation). In A. millepora, apparent NO synthesis correlated with the induction of host apoptotic-like pathways, while in P. damicornis, the upregulation of apoptotic pathways occurred later. No evidence of elevated NO production or apoptosis was observed in M. digitata at 33 °C and baseline activity of apoptosis-regulating enzymes was negligible in this species. These findings provide important physiological data in the context of the responses of corals to global change and

  1. Escape chambers in the German coal mining industry. Fluchtkammern im deutschen Steinkohlenbergbau

    Energy Technology Data Exchange (ETDEWEB)

    Kock, F.J.; Langer, G. (Bergbau-Forschung G.m.b.H. - Forschungsinstitut des Steinkohlenbergbauvereins, Essen (Germany, F.R.). Hauptstelle fuer das Grubenrettungswesen); Velsen-Zerweck, R. von; Boettcher, K. (Bergbau AG Westfalen, Dortmund (Germany, F.R.). Hauptabteilung Sicherheitswesen)

    1989-08-17

    Escape chambers are used in special cases in German mines for self-rescue of the work force. On the basis of the newly laid down requirements concerning escape chambers a specification for mobile escape chambers was drawn up. The Safety Department of Bergbau AG Westfalen purchased two escape chambers of different manufacturers for 10 persons in each case, which are curently being tested at collieries of Bergbau AG Westfalen. The German coal mining industry thus has escape chambers at its disposal to make self-rescue of the work force even safer in the event of difficult and long escape routes. (orig.).

  2. Action and mechanism of Fas and Fas ligand in immune escape of gallbladder carcinoma

    Institute of Scientific and Technical Information of China (English)

    Li-Ning Xu; Sheng-Quan Zou; Jian-Ming Wang

    2005-01-01

    AIM: To study the role of Fas and Fas ligand (FasL) in biological behaviors of gallbladder carcinoma, and their correlated action and mechanism in tumor escape.METHODS: Streptavidin-biotin-peroxidase immunohistochemistry technique was used to study the expression of Fas and FasL protein in 26 gallbladder carcinoma tissues,18 gallbladder adenoma tissues, 3 gallbladder dysplasia tissues and 20 chronic cholecystitis tissues. Apoptosis of the infiltrating lymphocytes in these tissues was studied by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) method. Expression of both proteins and apoptosis of the tumor infiltrating lymphocytes in cancer tissues of primary foci was compared with clinicopathological features of gallbladder carcinoma.RESULTS: The positive rates of Fas were not significantly different among carcinoma, adenoma, dysplasia and chronic cholecystitis. The positive rate of FasL in carcinoma was significantly higher than that in chronic cholecystitis (x2 = 4.89, P<0.05). The apoptotic index (AI) in carcinoma was significantly higher than that in adenoma (t'= 4.19, P<0.01) and chronic cholecystitis (t'= 8.06, P<0.01). The AI was significantly lower in well-differentiated carcinoma and Nevin Ⅰ-Ⅲ carcinoma than that in poorly-differentiated carcinoma (t'= 2.63, P<0.05) and Nevin Ⅳ-Ⅴ carcinoma(t'= 3.33, P<0.01). The confidence interval (CI) ofinfiltrating lymphocytes in adenoma, chronic cholecystitis, well-differentiated carcinoma and Nevin Ⅰ-Ⅲ carcinoma wasvery significantly lower than that in carcinoma (t' = 6.99,P<0.01), adenoma (t' = 3.66, P<0.01), poorly-differentiated carcinoma (t' = 5.31, P<0.01) and Nevin Ⅳ-Ⅴ carcinoma(t' = 3.76, P<0.01), respectively. The CI of apoptosis of infiltrating lymphocytes in well-differentiated carcinoma was significantly lower than that in poorly-differentiated carcinoma (t = 2.52, P<0.05), and was not significantly lower in Nevin Ⅰ-Ⅲ carcinoma than

  3. Formulation of a Cooperative-Confinement-Escape problem of multiple cooperative defenders against an evader escaping from a circular region

    Science.gov (United States)

    Li, Wei

    2016-10-01

    In this paper, we propose and formulate the Cooperative-Confinement-Escape (CCE) problem of multiple cooperative defenders against an evader escaping from a circular region, in which the defenders are moving on the circle with attempt to prevent possible escape of a single evader who is initially located inside the circle. The main contributions are summarized as follows: (1) we first provide an effective formulation of the CCE problem, which is an emphasis of this paper, with design of two nonlinear control strategies for the cooperative defenders and the adversarial evader, respectively. Particularly, we consider to include a proper interaction between each pair of the nearest-neighbor defenders, and an adaptive trajectory prediction mechanism in the strategies of the defenders to increase the chance of successful confinement. (2) For the first attempt on analyzing the CCE dynamics which is unavoidably strongly nonlinear, we analyze the minimum energy of the evader for possible escape. (3) For understanding of the behaviors of the system under different parameters, (i) we illustrate the effectiveness of the confinement strategy using the adaptive trajectory prediction mechanism, and (ii) the physical roles of the system parameters with respect to the system dynamics, some of which may be unexpected or not straightforward. A separate paper will be presented for systematic analysis of the agents' behaviors with respect to the large intervals of the parameter settings.

  4. An Empirical Investigation of Time-Out with and without Escape Extinction to Treat Escape-Maintained Noncompliance

    Science.gov (United States)

    Everett, Gregory E.; Olmi, D. Joe; Edwards, Ron P.; Tingstrom, Daniel H.; Sterling-Turner, Heather E.; Christ, Theodore J.

    2007-01-01

    The present study evaluates the effectiveness of two time-out (TO) procedures in reducing escape-maintained noncompliance of 4 children. Noncompliant behavioral function was established via a functional assessment (FA), including indirect and direct descriptive procedures and brief confirmatory experimental analyses. Following FA, parents were…

  5. Effect of administration of apoptotic blebs on disease development in lupus mice.

    NARCIS (Netherlands)

    Fransen, J.H.; Berden, J.H.M.; Koeter, C.M.; Adema, G.J.; Vlag, J. van der; Hilbrands, L.B.

    2012-01-01

    INTRODUCTION: Systemic lupus erythematosus (SLE) is an autoimmune disease characterised by the formation of autoantibodies against nuclear components. Disturbed apoptosis and reduced clearance of apoptotic material have been assigned a role in the pathogenesis of SLE. During apoptosis, apoptotic ble

  6. Apoptotic cell death and its relationship to gastric carcinogenesis

    Institute of Scientific and Technical Information of China (English)

    Ferda Bir; Nese Calli-Demirkan; A Cevik Tufan; Metin Akbulut; N Lale Satiroglu-Tufan

    2007-01-01

    AIM: To investigate the apoptotic process of cells within the intestinal metaplasia areas co-localizing with chronic gastritis and gastric carcinomas and to analyze the involvement of proteins regulating apoptosis in the process of intestinal metaplasia related gastric carcinogenesis.METHODS: Forty-two gastric carcinoma and seventeen chronic gastritis cases were included in this study. All cases were examined for the existence of intestinal metaplasia. Ten cases randomly selected from each group were processed for TUNEL assay. TUNEL positive cells within the intestinal metaplasia areas, colocalizing either to gastric carcinoma or chronic gastritis,were counted and converted to apoptotic indices.In addition, p53, bcl-2 and bax expression patterns within these tissues were analyzed on the basis of immunohistochemistry.RESULTS: Twenty-eight of the cases were intestinal and 14 of the cases were diffuse type adenocarcinomas.64% (27/42) of the gastric carcinoma cases had intestinal metaplasia. Intestinal metaplasia co-localized more with intestinal type carcinomas compared with diffuse type carcinomas [75% (21/28) vs 42% (6/14),respectively; P≤0.05]. The mean apoptotic index in tumor cells was 0.70±0.08. The mean apoptotic index in intestinal metaplasias co-localizing to tumors was significantly higher than that of intestinal metaplasias co-localizing to chronic gastritis (0.70±0.03 vs 0.09±0.01, respectively; P≤0.05). P53 positivity was not observed in areas of intestinal metaplasia adjacent to tumors or chronic gastritis. Intestinal metaplasia areas adjacent to tumors showed lower cytoplasmic bcl-2 positivity compared to intestinal metaplasia areas adjacent to chronic gastritis [55.5% (15/27) vs 70.5%(12/17), respectively]. On the other hand, intestinal metaplasia areas adjacent to tumors showed significantly higher cytoplasmic bax positivity compared to intestinal metaplasia areas adjacent to chronic gastritis [44.4%(12/27) vs 11.7% (2/17), respectively; P≤0

  7. Stream life of spawning pink salmon and the method of escapement enumeration by aerial survey: Draft

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Aerial surveys are currently used as the method tor escapement enumeration of pink salmon throughout Alaska. Other escapement enumeration methods cannot be...

  8. Parameter Optimization on Experimental Study to Reduce Ammonia Escape in CO2 Absorption by Ammonia Scrubbing

    Institute of Scientific and Technical Information of China (English)

    Hao Leng; Jianmin Gao; Mingyue He; Min Xie; Qian Du; Rui Sun; Shaohua Wu

    2016-01-01

    In order to research ammonia escape in CO2 absorption by ammonia scrubbing, ammonia escape was studied in CO2 absorption process using the bubbling reactor in different conditions as gas flow rate, CO2 ratio, absorbent temperature and ammonia concentration and quantity of escaped ammonia was measured by chemical titration. The results indicated that, the amount of ammonia escape can be around 20% of original amount in 90 min and the escaped amount will increase with the rise of gas flow rate, absorbent temperature, concentration of ammonia while decrease as CO2 ratio goes up. Through the analysis of the law of ammonia escape, at the same time, combined with ammonia escape and the influence of the relationship between the CO2 absorption efficiency, reducing ammonia escape working condition parameter optimization is given.

  9. A functional yeast survival screen of tumor-derived cDNA libraries designed to identify anti-apoptotic mammalian oncogenes.

    Directory of Open Access Journals (Sweden)

    Moritz Eißmann

    Full Text Available Yeast cells can be killed upon expression of pro-apoptotic mammalian proteins. We have established a functional yeast survival screen that was used to isolate novel human anti-apoptotic genes overexpressed in treatment-resistant tumors. The screening of three different cDNA libraries prepared from metastatic melanoma, glioblastomas and leukemic blasts allowed for the identification of many yeast cell death-repressing cDNAs, including 28% of genes that are already known to inhibit apoptosis, 35% of genes upregulated in at least one tumor entity and 16% of genes described as both anti-apoptotic in function and upregulated in tumors. These results confirm the great potential of this screening tool to identify novel anti-apoptotic and tumor-relevant molecules. Three of the isolated candidate genes were further analyzed regarding their anti-apoptotic function in cell culture and their potential as a therapeutic target for molecular therapy. PAICS, an enzyme required for de novo purine biosynthesis, the long non-coding RNA MALAT1 and the MAST2 kinase are overexpressed in certain tumor entities and capable of suppressing apoptosis in human cells. Using a subcutaneous xenograft mouse model, we also demonstrated that glioblastoma tumor growth requires MAST2 expression. An additional advantage of the yeast survival screen is its universal applicability. By using various inducible pro-apoptotic killer proteins and screening the appropriate cDNA library prepared from normal or pathologic tissue of interest, the survival screen can be used to identify apoptosis inhibitors in many different systems.

  10. Escape rate of active particles in the effective equilibrium approach

    Science.gov (United States)

    Sharma, A.; Wittmann, R.; Brader, J. M.

    2017-01-01

    The escape rate of a Brownian particle over a potential barrier is accurately described by the Kramers theory. A quantitative theory explicitly taking the activity of Brownian particles into account has been lacking due to the inherently out-of-equilibrium nature of these particles. Using an effective equilibrium approach [Farage et al., Phys. Rev. E 91, 042310 (2015), 10.1103/PhysRevE.91.042310] we study the escape rate of active particles over a potential barrier and compare our analytical results with data from direct numerical simulation of the colored noise Langevin equation. The effective equilibrium approach generates an effective potential that, when used as input to Kramers rate theory, provides results in excellent agreement with the simulation data.

  11. Partial control of chaotic transients using escape times

    Energy Technology Data Exchange (ETDEWEB)

    Sabuco, Juan; Zambrano, Samuel; Sanjuan, Miguel A F, E-mail: juan.sabuco@urjc.e [Departamento de Fisica, Universidad Rey Juan Carlos, Tulipan s/n, 28933 Mostoles, Madrid (Spain)

    2010-11-15

    The partial control technique allows one to keep the trajectories of a dynamical system inside a region where there is a chaotic saddle and from which nearly all the trajectories diverge. Its main advantage is that this goal is achieved even if the corrections applied to the trajectories are smaller than the action of environmental noise on the dynamics, a counterintuitive result that is obtained by using certain safe sets. Using the Henon map as a paradigm, we show here the deep relationship between the safe sets and the sets of points with different escape times, the escape time sets. Furthermore, we show that it is possible to find certain extended safe sets that can be used instead of the safe sets in the partial control technique. Numerical simulations confirm our findings and show that in some situations, the use of extended safe sets can be more advantageous.

  12. Behavioral analysis of the escape response in larval zebrafish

    Science.gov (United States)

    Feng, Ruopei; Girdhar, Kiran; Chemla, Yann; Gruebele, Martin

    The behavior of larval zebrafish is of great interest because the limited number of locomotor neurons in larval zebrafish couples with its rich repertoire of movements as a vertebrate animal. Current research uses a priori-selected parameters to describe their swimming behavior while our lab has built a parameter-free model based on singular value decomposition analysis to characterize it. Our previous work has analyzed the free swimming of larval zebrafish and presented a different picture from the current classification of larval zebrafish locomotion. Now we are extending this work to the studies of their escape response to acoustic stimulus. Analysis has shown intrinsic difference in the locomotion between escape response and free swimming.

  13. Dynamics of the verge and foliot clock escapement

    CERN Document Server

    Hoyng, P

    2016-01-01

    The verge and foliot escapement has received relatively little attention in horology, despite the fact that it has been used in clocks for ages. We analyse the operation of a verge and foliot escapement in stationary swing. It is driven by a torque $m=\\pm\\mu$, switching sign at fixed swing angles $\\pm\\phi_0$, and $\\mu$ is taken to be constant. Friction is assumed to exert a torque proportional to the angular speed. We determine the shape of the swing angle $\\varphi(t)$, and compute the period and the swing amplitude of the foliot as a function of the model parameters. We find that the period of the foliot scales as $P\\propto\\mu^{-1}$ for weak driving, gradually changing into $P\\propto\\mu^{-1/3}$ for strong driving (large $\\mu$), which underlines that the motion of the foliot is not isochonous.

  14. Quantum and thermal phase escape in extended Josephson systems

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, A.

    2006-07-12

    In this work I examine phase escape in long annular Josephson tunnel junctions. The sine-Gordon equation governs the dynamics of the phase variable along the junction. This equation supports topological soliton solutions, which correspond to quanta of magnetic flux trapped in the junction barrier. For such Josephson vortices an effective potential is formed by an external magnetic field, while a bias current acts as a driving force. Both together form a metastable potential well, which the vortex is trapped in. When the driving force exceeds the pinning force of the potential, the vortex escapes and the junction switches to the voltage state. At a finite temperature the driving force fluctuates. If the junction's energy scale is small, the phase variable can undergo a macroscopic quantum tunneling (MQT) process at temperatures below the crossover temperature. Without a vortex trapped, the metastable state is not a potential minimum in space, but a potential minimum at zero phase difference. (orig.)

  15. Escape Time of Josephson Junctions for Signal Detection

    CERN Document Server

    Addesso, P; Pierro, V

    2014-01-01

    In this Chapter we investigate with the methods of signal detection the response of a Josephson junction to a perturbation to decide if the perturbation contains a coherent oscillation embedded in the background noise. When a Josephson Junction is irradiated by an external noisy source, it eventually leaves the static state and reaches a steady voltage state. The appearance of a voltage step allows to measure the time spent in the metastable state before the transition to the running state, thus defining an escape time. The distribution of the escape times depends upon the characteristics of the noise and the Josephson junction. Moreover, the properties of the distribution depends on the features of the signal (amplitude, frequency and phase), which can be therefore inferred through the appropriate signal processing methods. Signal detection with JJ is interesting for practical purposes, inasmuch as the superconductive elements can be (in principle) cooled to the absolute zero and therefore can add (in practi...

  16. Kuiper Prize Lecture - Escape of atmospheres, ancient and modern

    Energy Technology Data Exchange (ETDEWEB)

    Hunten, D.M. (Arizona Univ., Tucson (USA))

    1990-05-01

    A development history is presented for theories concerning planetary atmosphere gas-escape phenomena, which although firmly grounded in the kinetics of gases achieved truly productive results only after spacecraft remote sensing data for both the earth atmosphere and the planets became widely available. The most significant initial advances, encompassing diffusion-limited flow, nonthermal escape mechanisms, bound nonthermal coronas, and mass fractionation during early blowoff, followed from sounding rocket studies of the earth upper atmosphere, Mariner 5 results on hydrogen near Venus, and the nitrogen isotopic composition discovered by Viking in Mars. Attention has more recently been given to the xenon isotopic patterns in various atmospheres, as well as to the puzzling behavior of the Io atmosphere and plasma torus. 126 refs.

  17. Escape of Mars atmospheric carbon through time by photochemical means

    Science.gov (United States)

    Luhmann, J. G.; Kim, J.; Nagy, A. F.

    Luhmann et al. recently suggested that sputtering of the Martian atmosphere by re-entering O(+) pickup ions could have provided a significant route of escape for CO2 and its products throughout Mars' history. They estimated that the equivalent of C in an approximately 140-mbar CO2 atmosphere should have been lost this way if the Sun and solar wind evolved according to available models. Another source of escaping C (and O) that is potentially important is the dissociative recombination of ionospheric CO(+) near the exobase. We have evaluated the loss rates due to this process for 'ancient' solar EUV radiation fluxes of 1, 3, and 6 times the present flux in order to calculate the possible cumulative loss over the last 3.5 Gyr.

  18. Apoptotic Cells Are Cleared by Directional Migration and elmo1-Dependent Macrophage Engulfment

    NARCIS (Netherlands)

    van Ham, Tjakko J.; Kokel, David; Peterson, Randall T.

    2012-01-01

    Apoptotic cell death is essential for development and tissue homeostasis [1, 2]. Failure to clear apoptotic cells can ultimately cause inflammation and autoimmunity [3, 4]. Apoptosis has primarily been studied by staining of fixed tissue sections, and a clear understanding of the behavior of apoptot

  19. The C. elegans touch response facilitates escape from predacious fungi

    OpenAIRE

    Maguire, Sean M.; Clark, Christopher M.; Nunnari, John; Pirri, Jennifer K.; Alkema, Mark J.

    2011-01-01

    Predator-prey interactions are vital determinants in the natural selection of behavioral traits. However, we have few insights into both the neural mechanisms and the selective advantage of specific behavioral traits. Gentle touch to the anterior half of the body of Caenorhabditis elegans elicits an escape response in which the animal quickly reverses and suppresses exploratory head movements [1]. Even though the C. elegans touch response has provided one of the rare examples of how neural ne...

  20. Escape Geography--Developing Middle-School Students' Sense of Place.

    Science.gov (United States)

    Allen, Rodney F.; Molina, Laurie E. S.

    1992-01-01

    Suggests a social studies unit on escaping geography. Examines escape from dangerous places including an airliner, hotel fire, or war zone or from a social situation such as a boring speech or party. Describes historic escapes such as the Underground Railroad and the Berlin Wall. Lists learning strategies such as awareness of space and cognitive…

  1. On the Relative Contributions of Noncontingent Reinforcement and Escape Extinction in the Treatment of Food Refusal

    Science.gov (United States)

    Reed, Gregory K.; Piazza, Cathleen C.; Patel, Meeta R.; Layer, Stacy A.; Bachmeyer, Melanie H.; Bethke, Stephanie D.; Gutshall, Katharine A.

    2004-01-01

    In the current investigation, we evaluated the relative effects of noncontingent reinforcement (NCR), escape extinction, and a combination of NCR and escape extinction as treatment for the feeding problems exhibited by 4 children. For each participant, consumption increased only when escape extinction was implemented, independent of whether NCR…

  2. 46 CFR 56.50-25 - Safety and relief valve escape piping.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Safety and relief valve escape piping. 56.50-25 Section 56.50-25 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING PIPING SYSTEMS AND APPURTENANCES Design Requirements Pertaining to Specific Systems § 56.50-25 Safety and relief valve escape piping. (a) Escape piping...

  3. MAVEN in situ measurements of photochemical escape of oxygen from Mars

    Science.gov (United States)

    Lillis, Robert; Deighan, Justin; Fox, Jane; Bougher, Stephen; Lee, Yuni; Cravens, Thomas; Rahmati, Ali; Mahaffy, Paul; Benna, Mehdi; Groller, Hannes; Jakosky, Bruce

    2016-04-01

    One of the primary goals of the MAVEN mission is to characterize rates of atmospheric escape from Mars at the present epoch and relate those escape rates to solar drivers. One of the known escape processes is photochemical escape, where a) an exothermic chemical reaction in the atmosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through subsequent collisions. At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher. Thus characterizing this escape process and its variability with solar drivers is central to understanding the role escape to space has played in Mars' climate evolution. We use near-periapsis (atoms. The second is a Monte Carlo hot atom transport model that takes that distribution of initial O energies and the measured neutral density profiles and calculates the probability that a hot atom born at that altitude will escape. The third takes the measured electron and ion densities and electron temperatures and calculates the production rate of hot O atoms. We then multiply together the profiles of hot atom production and escape probability to get profiles of the production rate of escaping atoms. We integrate with respect to altitude to give us the escape flux of hot oxygen atoms for that periapsis pass. We have sufficient coverage in solar zenith angle (SZA) to estimate total escape rates for two intervals with the obvious assumption that escape rates are the same at all points with the same SZA. We estimate total escape rates of 3.5-5.8 x 1025 s-1 for Ls = 289° to 319° and 1.6-2.6 x 1025 s-1 for Ls = 326° to 348°. The latter is the most directly comparable to previous model-based estimates and is roughly in line with several of them. Total photochemical loss over Mars history is not very useful to

  4. Enzyme detection by microfluidics

    DEFF Research Database (Denmark)

    2013-01-01

    Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...... by that enzyme...

  5. The inflammatory role of phagocyte apoptotic pathways in rheumatic diseases.

    Science.gov (United States)

    Cuda, Carla M; Pope, Richard M; Perlman, Harris

    2016-08-23

    Rheumatoid arthritis affects nearly 1% of the world's population and is a debilitating autoimmune condition that can result in joint destruction. During the past decade, inflammatory functions have been described for signalling molecules classically involved in apoptotic and non-apoptotic death pathways, including, but not limited to, Toll-like receptor signalling, inflammasome activation, cytokine production, macrophage polarization and antigen citrullination. In light of these remarkable advances in the understanding of inflammatory mechanisms of the death machinery, this Review provides a snapshot of the available evidence implicating death pathways, especially within the phagocyte populations of the innate immune system, in the perpetuation of rheumatoid arthritis and other rheumatic diseases. Elevated levels of signalling mediators of both extrinsic and intrinsic apoptosis, as well as the autophagy, are observed in the joints of patients with rheumatoid arthritis. Furthermore, risk polymorphisms are present in signalling molecules of the extrinsic apoptotic and autophagy death pathways. Although research into the mechanisms underlying these pathways has made considerable progress, this Review highlights areas where further investigation is particularly needed. This exploration is critical, as new discoveries in this field could lead to the development of novel therapies for rheumatoid arthritis and other rheumatic diseases.

  6. Targeting apoptotic pathways in myocardial infarction: attenuated by phytochemicals.

    Science.gov (United States)

    Haidarali, Shaikh; Patil, Chandragouda R; Ojha, Shreesh; Mohanraj, Rajesh; Arya, Dharamvir S; Goyal, Sameer N

    2014-01-01

    Myocardial infarction (MI) is an insidious disease, gently spreading in developed and developing countries. MI is the consequence of hypoxia in myocardial tissue, which may lead to apoptosis, narcosis and followed by cardiac cell death. Activation of apoptotic pathways during MI is frequently reported in clinical, preclinical and post-mortem studies. Several mediators of apoptosis signalling cascades culminate into MI leading to cardiomyocytes death. Such involvements of ischemia-induced apoptosis in MI are widely accepted. Apoptosis is a natural phenomenon for regulating the homeostasis in cellular organelles. Unlike the necrosis, it is a synchronized energy dependent process which is carried out by shrinkage of the cell. This contraction of cells leads to squeezing of nuclei and nuclear chromatin into brusquely demarcated masses. However, such programmed cell death in several tissues, including the myocardium becomes pathogenic under certain conditions. Moreover, reactive oxygen species (ROS) generated oxidative stress also plays a key role in production of apoptosis and several associated signalling alterations which ultimately lead to MI. Recently, certain natural products, especially from the plant kingdom have been evaluated for their anti-apoptotic potential. There is an uprise in the investigations delineating the exact mechanisms through which natural phytochemicals target apoptosis associated MI. This review explores novel signalling pathways and target sites for anti-apoptotic phytochemicals having potential to check the cellular apoptosis consequent to MI. A new vista may explore the prospective treatment of MI by using apoptosis-modulating natural products.

  7. Apoptotic mimicry: an altruistic behavior in host/Leishmania interplay

    Directory of Open Access Journals (Sweden)

    Wanderley J.L.M.

    2005-01-01

    Full Text Available Apoptosis is the most common phenotype observed when cells die through programmed cell death. The morphologic and biochemical changes that characterize apoptotic cells depend on the activation of a diverse set of genes. Apoptosis is essential for multicellular organisms since their development and homeostasis are dependent on extensive cell renewal. In fact, there is strong evidence for the correlation between the emergence of multicellular organisms and apoptosis during evolution. On the other hand, no obvious advantages can be envisaged for unicellular organisms to carry the complex machinery required for programmed cell death. However, accumulating evidence shows that free-living and parasitic protozoa as well as yeasts display apoptotic markers. This phenomenon has been related to altruistic behavior, when a subpopulation of protozoa or yeasts dies by apoptosis, with clear benefits for the entire population. Recently, phosphatidylserine (PS exposure and its recognition by a specific receptor (PSR were implicated in the infectivity of amastigote forms of Leishmania, an obligatory vertebrate intramacrophagic parasite, showing for the first time that unicellular organisms use apoptotic features for the establishment and/or maintenance of infection. Here we focus on PS exposure in the outer leaflet of the plasma membrane - an early hallmark of apoptosis - and how it modulates the inflammatory activity of phagocytic cells. We also discuss the possible mechanisms by which PS exposure can define Leishmania survival inside host cells and the evolutionary implications of apoptosis at the unicellular level.

  8. Apoptotic HPV positive cancer cells exhibit transforming properties.

    Directory of Open Access Journals (Sweden)

    Emilie Gaiffe

    Full Text Available Previous studies have shown that DNA can be transferred from dying engineered cells to neighboring cells through the phagocytosis of apoptotic bodies, which leads to cellular transformation. Here, we provide evidence of an uptake of apoptotic-derived cervical cancer cells by human mesenchymal cells. Interestingly, HeLa (HPV 18+ or Ca Ski (HPV16+ cells, harboring integrated high-risk HPV DNA but not C-33 A cells (HPV-, were able to transform the recipient cells. Human primary fibroblasts engulfed the apoptotic bodies effectively within 30 minutes after co-cultivation. This mechanism is active and involves the actin cytoskeleton. In situ hybridization of transformed fibroblasts revealed the presence of HPV DNA in the nucleus of a subset of phagocytosing cells. These cells expressed the HPV16/18 E6 gene, which contributes to the disruption of the p53/p21 pathway, and the cells exhibited a tumorigenic phenotype, including an increased proliferation rate, polyploidy and anchorage independence growth. Such horizontal transfer of viral oncogenes to surrounding cells that lack receptors for HPV could facilitate the persistence of the virus, the main risk factor for cervical cancer development. This process might contribute to HPV-associated disease progression in vivo.

  9. Cell shape and organelle modification in apoptotic U937 cells

    Directory of Open Access Journals (Sweden)

    MR Montinari

    2009-12-01

    Full Text Available U937 cells induced to apoptosis, progressively and dramatically modified their cell shape by intense blebbing formation, leading to the production of apoptotic bodies. The blebs evolved with time; milder forms of blebbing involving only a region or just the cortical part of the cytoplasm were observed within the first hour of incubation with puromycin; blebbing involving the whole cell body with very deep constrictions is the most frequent event observed during late times of incubation. The ultrastructural analysis of apoptotic cells revealed characteristic features of nuclear fragmentation (budding and cleavage mode and cytoplasmatic modifications. The cytoplasm of blebs does not contain organelles, such as ribosomes or mitochondria. Scarce presence of endoplasmic reticulum can be observed at the site of bleb detachment. However, blebbing is a dispensable event as evaluated by using inhibitor of actin polymerization. In the present study, the progressive modifications of the nucleus, mitochondria, nuclear fragmentation, cytoplasmic blebs formation and production of apoptotic bodies in U937 monocytic cells induced to apoptosis by puromycin (an inhibitor of protein synthesis were simultaneously analyzed.

  10. Apoptotic cell signaling in cancer progression and therapy.

    Science.gov (United States)

    Plati, Jessica; Bucur, Octavian; Khosravi-Far, Roya

    2011-04-01

    Apoptosis is a tightly regulated cell suicide program that plays an essential role in the development and maintenance of tissue homeostasis by eliminating unnecessary or harmful cells. Impairment of this native defense mechanism promotes aberrant cellular proliferation and the accumulation of genetic defects, ultimately resulting in tumorigenesis, and frequently confers drug resistance to cancer cells. The regulation of apoptosis at several levels is essential to maintain the delicate balance between cellular survival and death signaling that is required to prevent disease. Complex networks of signaling pathways act to promote or inhibit apoptosis in response to various cues. Apoptosis can be triggered by signals from within the cell, such as genotoxic stress, or by extrinsic signals, such as the binding of ligands to cell surface death receptors. Various upstream signaling pathways can modulate apoptosis by converging on, and thereby altering the activity of, common central control points within the apoptotic signaling pathways, which involve the BCL-2 family proteins, inhibitor of apoptosis (IAP) proteins, and FLICE-inhibitory protein (c-FLIP). This review highlights the role of these fundamental regulators of apoptosis in the context of both normal apoptotic signaling mechanisms and dysregulated apoptotic pathways that can render cancer cells resistant to cell death. In addition, therapeutic strategies aimed at modulating the activity of BCL-2 family proteins, IAPs, and c-FLIP for the targeted induction of apoptosis are briefly discussed.

  11. Apoptotic cell signaling in cancer progression and therapy†

    Science.gov (United States)

    Plati, Jessica; Bucur, Octavian; Khosravi-Far, Roya

    2011-01-01

    Apoptosis is a tightly regulated cell suicide program that plays an essential role in the development and maintenance of tissue homeostasis by eliminating unnecessary or harmful cells. Impairment of this native defense mechanism promotes aberrant cellular proliferation and the accumulation of genetic defects, ultimately resulting in tumorigenesis, and frequently confers drug resistance to cancer cells. The regulation of apoptosis at several levels is essential to maintain the delicate balance between cellular survival and death signaling that is required to prevent disease. Complex networks of signaling pathways act to promote or inhibit apoptosis in response to various cues. Apoptosis can be triggered by signals from within the cell, such as genotoxic stress, or by extrinsic signals, such as the binding of ligands to cell surface death receptors. Various upstream signaling pathways can modulate apoptosis by converging on, and thereby altering the activity of, common central control points within the apoptotic signaling pathways, which involve the BCL-2 family proteins, inhibitor of apoptosis (IAP) proteins, and FLICE-inhibitory protein (c-FLIP). This review highlights the role of these fundamental regulators of apoptosis in the context of both normal apoptotic signaling mechanisms and dysregulated apoptotic pathways that can render cancer cells resistant to cell death. In addition, therapeutic strategies aimed at modulating the activity of BCL-2 family proteins, IAPs, and c-FLIP for the targeted induction of apoptosis are briefly discussed. PMID:21340093

  12. Elevated Liver Enzymes

    Science.gov (United States)

    Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...

  13. Broad CTL Response in Early HIV Infection Drives Multiple Concurrent CTL Escapes.

    Science.gov (United States)

    Leviyang, Sivan; Ganusov, Vitaly V

    2015-10-01

    Recent studies have highlighted the ability of HIV to escape from cytotoxic T lymphocyte (CTL) responses that concurrently target multiple viral epitopes. Yet, the viral dynamics involved in such escape are incompletely understood. Previous analyses have made several strong assumptions regarding HIV escape from CTL responses such as independent or non-concurrent escape from individual CTL responses. Using experimental data from evolution of HIV half genomes in four patients we observe concurrent viral escape from multiple CTL responses during early infection (first 100 days of infection), providing confirmation of a recent result found in a study of one HIV-infected patient. We show that current methods of estimating CTL escape rates, based on the assumption of independent escapes, are biased and perform poorly when CTL escape proceeds concurrently at multiple epitopes. We propose a new method for analyzing longitudinal sequence data to estimate the rate of CTL escape across multiple epitopes; this method involves few parameters and performs well in simulation studies. By applying our novel method to experimental data, we find that concurrent multiple escapes occur at rates between 0.03 and 0.4 day(-1), a relatively broad range that reflects uncertainty due to sparse sampling and wide ranges of parameter values. However, we show that concurrent escape at rates 0.1-0.2 day(-1) across multiple epitopes is consistent with our patient datasets.

  14. A comparison of positive and negative reinforcement for compliance to treat problem behavior maintained by escape.

    Science.gov (United States)

    Slocum, Sarah K; Vollmer, Timothy R

    2015-09-01

    Previous research has shown that problem behavior maintained by escape can be treated using positive reinforcement. In the current study, we directly compared functional (escape) and nonfunctional (edible) reinforcers in the treatment of escape-maintained problem behavior for 5 subjects. In the first treatment, compliance produced a break from instructions. In the second treatment, compliance produced a small edible item. Neither treatment included escape extinction. Results suggested that the delivery of a positive reinforcer for compliance was effective for treating escape-maintained problem behavior for all 5 subjects, and the delivery of escape for compliance was ineffective for 3 of the 5 subjects. Implications and future directions related to the use of positive reinforcers in the treatment of escape behavior are discussed.

  15. Experimental analysis and extinction of self-injurious escape behavior.

    Science.gov (United States)

    Iwata, B A; Pace, G M; Kalsher, M J; Cowdery, G E; Cataldo, M F

    1990-01-01

    Three studies are presented in which environmental correlates of self-injurious behavior were systematically examined and later used as the basis for treatment. In Study 1, 7 developmentally disabled subjects were exposed to a series of conditions designed to identify factors that maintain self-injurious behavior: attention contingent on self-injurious behavior (positive reinforcement), escape from or avoidance of demands contingent on self-injurious behaviour (negative reinforcement), alone (automatic reinforcement), and play (control). Results of a multielement design showed that each subject's self-injurious behavior occurred more frequently in the demand condition, suggesting that the behavior served an avoidance or escape function. Six of the 7 subjects participated in Study 2. During educational sessions, "escape extinction" was applied as treatment for their self-injurious behavior in a multiple baseline across subjects design. Results showed noticeable reduction or elimination of self-injurious behavior for each subject and an increase in compliance with instructions in all subjects for whom compliance data were taken. The 7th subject, whose self-injurious behavior during Study 1 occurred in response to medical demands (i.e., physical examinations), participated in Study 3. Treatment was comprised of extinction, as in Study 2, plus reinforcement for tolerance of the examination procedure, and was evaluated in a multiple baseline across settings design. Results showed that the treatment was successful in eliminating self-injurious behavior and that its effects transferred across eight new therapists and three physicians. General implications for the design, interpretation, and uses of assessment studies are discussed.

  16. First-passage and escape problems in the Feller process

    CERN Document Server

    Masoliver, Jaume

    2012-01-01

    The Feller process is an one-dimensional diffusion process with linear drift and state-dependent diffusion coefficient vanishing at the origin. The process is positive definite and it is this property along with its linear character that have made Feller process a convenient candidate for the modeling of a number of phenomena ranging from single neuron firing to volatility of financial assets. While general properties of the process are well known since long, less known are properties related to level crossing such as the first-passage and the escape problems. In this work we thoroughly address these questions.

  17. First-passage and escape problems in the Feller process

    Science.gov (United States)

    Masoliver, Jaume; Perelló, Josep

    2012-10-01

    The Feller process is an one-dimensional diffusion process with linear drift and state-dependent diffusion coefficient vanishing at the origin. The process is positive definite and it is this property along with its linear character that have made Feller process a convenient candidate for the modeling of a number of phenomena ranging from single-neuron firing to volatility of financial assets. While general properties of the process have long been well known, less known are properties related to level crossing such as the first-passage and the escape problems. In this work we thoroughly address these questions.

  18. Chases and escapes the mathematics of pursuit and evasion

    CERN Document Server

    Nahin, Paul J

    2012-01-01

    We all played tag when we were kids. What most of us don't realize is that this simple chase game is in fact an application of pursuit theory, and that the same principles of games like tag, dodgeball, and hide-and-seek are also at play in military strategy, high-seas chases by the Coast Guard, and even romantic pursuits. In Chases and Escapes, Paul Nahin gives us the first complete history of this fascinating area of mathematics, from its classical analytical beginnings to the present day. Drawing on game theory, geometry, linear algebra, target-tracking algorithms, and much

  19. Experimental study of subsonic microjet escaping from a rectangular nozzle

    Science.gov (United States)

    Aniskin, V. M.; Maslov, A. A.; Mukhin, K. A.

    2016-10-01

    The first experiments on the subsonic laminar microjets escaping from the nozzles of rectangular shape are carried out. The nozzle size is 83.3x3823 microns. Reynolds number calculated by the nozzle height and the average flow velocity at the nozzle exit ranged from 58 to 154. The working gas was air at room temperature. The velocity decay and velocity fluctuations along the center line of the jet are determined. The fundamental difference between the laminar microjets characteristics and subsonic turbulent jets of macro size is shown. Based on measurements of velocity fluctuations it is shown the presence of laminar-turbulent transition in microjets and its location is determined.

  20. The mirror of the escaped God – Alejandra Pizarnik

    Directory of Open Access Journals (Sweden)

    Mariano Carou

    2015-04-01

    Full Text Available Alejandra Pizarnik (1936-1972 shows many different stands regarding to “God’s escape” in her poetry and his diaries: from the psalmist’s request to the more combative atheism. There is, however, a constant development of a symbolic constellation to speak about God’s mistery, and the certitude –inherited from German romanticism– that the poet has always something to say about God’s escape, searching for a new hope in which is maybe a new form of mysticism.

  1. Test of time: what if little Albert had escaped?

    Science.gov (United States)

    Field, Andy P; Nightingale, Zoë C

    2009-04-01

    Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him.

  2. Natural terpenes prevent mitochondrial dysfunction, oxidative stress and release of apoptotic proteins during nimesulide-hepatotoxicity in rats.

    Directory of Open Access Journals (Sweden)

    Brijesh Kumar Singh

    Full Text Available Nimesulide, an anti-inflammatory and analgesic drug, is reported to cause severe hepatotoxicity. In this study, molecular mechanisms involved in deranged oxidant-antioxidant homeostasis and mitochondrial dysfunction during nimesulide-induced hepatotoxicity and its attenuation by plant derived terpenes, camphene and geraniol has been explored in male Sprague-Dawley rats. Hepatotoxicity due to nimesulide (80 mg/kg BW was evident from elevated SGPT, SGOT, bilirubin and histo-pathological changes. Antioxidants and key redox enzymes (iNOS, mtNOS, Cu/Zn-SOD, Mn-SOD, GPx and GR were altered significantly as assessed by their mRNA expression, Immunoblot analysis and enzyme activities. Redox imbalance along with oxidative stress was evident from decreased NAD(PH and GSH (56% and 74% respectively; P<0.001, increased superoxide and secondary ROS/RNS generation along with oxidative damage to cellular macromolecules. Nimesulide reduced mitochondrial activity, depolarized mitochondria and caused membrane permeability transition (MPT followed by release of apoptotic proteins (AIF; apoptosis inducing factor, EndoG; endonuclease G, and Cyto c; cytochrome c. It also significantly activated caspase-9 and caspase-3 and increased oxidative DNA damage (level of 8-Oxoguanine glycosylase; P<0.05. A combination of camphene and geraniol (CG; 1:1, when pre-administered in rats (10 mg/kg BW, accorded protection against nimesulide hepatotoxicity in vivo, as evident from normalized serum biomarkers and histopathology. mRNA expression and activity of key antioxidant and redox enzymes along with oxidative stress were also normalized due to CG pre-treatment. Downstream effects like decreased mitochondrial swelling, inhibition in release of apoptotic proteins, prevention of mitochondrial depolarization along with reduction in oxidized NAD(PH and increased mitochondrial electron flow further supported protective action of selected terpenes against nimesulide toxicity. Therefore

  3. Overcoming resistance of targeted EGFR monotherapy by inhibition of STAT3 escape pathway in soft tissue sarcoma

    Science.gov (United States)

    Wang, Xiaochun; Goldstein, David; Crowe, Philip J.; Yang, Mark; Garrett, Kerryn; Zeps, Nikolajs; Yang, Jia-Lin

    2016-01-01

    Although epidermal growth factor receptor (EGFR) is often over-expressed in soft tissue sarcoma (STS), a phase II trial using an EGFR inhibitor gefitinib showed a low response rate. This study identified a new secondary resistance mechanism of gefitinib in STS, and developed new strategies to improve the effectiveness of EGFR inhibition particularly by blocking the STAT3 pathway. We demonstrated that seven STS cell lines of diverse histological origin showed resistance to gefitinib despite blockade of phosphorylated EGFR (pEGFR) and downstream signal transducers (pAKT and pERK) in PI3K/AKT and RAS/ERK pathways. Gefitinib exposure was not associated with decrease in the ratio of pSTAT3/pSTAT1. The relative STAT3 abundance and activation may be responsible for the drug resistance. We therefore hypothesized that the addition of a STAT3 inhibitor could overcome the STAT3 escape pathway. We found that the addition of STAT3 inhibitor S3I-201 to gefitinib achieved synergistic anti-proliferative and pro-apoptotic effects in all three STS cell lines examined. This was confirmed in a fibrosarcoma xenografted mouse model, where the tumours from the combination group (418mm3) were significantly smaller than those from untreated (1032mm3) or single drug (912 and 798mm3) groups. Our findings may have clinical implications for optimising EGFR-targeted therapy in STS. PMID:26909593

  4. Escape of Hydrogen from the Exosphere of Mars

    Science.gov (United States)

    Bhattacharyya, Dolon; Clarke, John T.; Bertaux, Jean-Loup; Chaufray, Jean-Yves; Mayyasi-Matta, Majd A.

    2016-10-01

    After decades of exploration, the martian neutral hydrogen exosphere has remained largely uncharacterized even today. In my dissertation I have attempted to constrain the characteristics of the martian hydrogen exosphere using Hubble Space Telescope observations obtained during October-November 2007 and 2014. These observations reveal short-term seasonal changes exhibited by the martian hydrogen exosphere that are inconsistent with the diffusion-limited escape scenario. This seasonal behavior adds a new element towards backtracking the history of water loss from Mars. Modeling of the data also indicates the likely presence of a superthermal population of hydrogen created by non-thermal processes at Mars, another key element to understand the present-day escape. Exploration of the latitudinal symmetry of the martian exosphere indicates that it is symmetric above 2.5 martian radii and asymmetric below this altitude, which could be due to temperature differences between the day and night sides. Finally, the large uncertainties in determining the characteristics of the martian exosphere after decades of exploration is due to various assumptions about the intrinsic characteristics of the martian exosphere in the modeling process, degeneracy in the two modeling parameters temperature and density of the hydrogen atoms, unaccounted seasonal effects, and uncertainties introduced from spacecraft instrumentation as well as their viewing geometry.

  5. Metastatic Tumor Dormancy in Cutaneous Melanoma: Does Surgery Induce Escape?

    Energy Technology Data Exchange (ETDEWEB)

    Tseng, William W. [Department of Surgery, University of California at San Francisco, 513 Parnassus Avenue, Room S-321, San Francisco, CA 94143 (United States); Fadaki, Niloofar; Leong, Stanley P., E-mail: leongsx@cpmcri.org [Department of Surgery and Center for Melanoma Research and Treatment, California Pacific Medical Center and Research Institute, 2340 Clay Street, 2nd floor, San Francisco, CA 94115 (United States)

    2011-02-21

    According to the concept of tumor dormancy, tumor cells may exist as single cells or microscopic clusters of cells that are clinically undetectable, but remain viable and have the potential for malignant outgrowth. At metastatic sites, escape from tumor dormancy under more favorable local microenvironmental conditions or through other, yet undefined stimuli, may account for distant recurrence after supposed “cure” following surgical treatment of the primary tumor. The vast majority of evidence to date in support of the concept of tumor dormancy originates from animal studies; however, extensive epidemiologic data from breast cancer strongly suggests that this process does occur in human disease. In this review, we aim to demonstrate that metastatic tumor dormancy does exist in cutaneous melanoma based on evidence from mouse models and clinical observations of late recurrence and occult transmission by organ transplantation. Experimental data underscores the critical role of impaired angiogenesis and immune regulation as major mechanisms for maintenance of tumor dormancy. Finally, we examine evidence for the role of surgery in promoting escape from tumor dormancy at metastatic sites in cutaneous melanoma.

  6. Metastatic Tumor Dormancy in Cutaneous Melanoma: Does Surgery Induce Escape?

    Directory of Open Access Journals (Sweden)

    William W. Tseng

    2011-02-01

    Full Text Available According to the concept of tumor dormancy, tumor cells may exist as single cells or microscopic clusters of cells that are clinically undetectable, but remain viable and have the potential for malignant outgrowth. At metastatic sites, escape from tumor dormancy under more favorable local microenvironmental conditions or through other, yet undefined stimuli, may account for distant recurrence after supposed “cure” following surgical treatment of the primary tumor. The vast majority of evidence to date in support of the concept of tumor dormancy originates from animal studies; however, extensive epidemiologic data from breast cancer strongly suggests that this process does occur in human disease. In this review, we aim to demonstrate that metastatic tumor dormancy does exist in cutaneous melanoma based on evidence from mouse models and clinical observations of late recurrence and occult transmission by organ transplantation. Experimental data underscores the critical role of impaired angiogenesis and immune regulation as major mechanisms for maintenance of tumor dormancy. Finally, we examine evidence for the role of surgery in promoting escape from tumor dormancy at metastatic sites in cutaneous melanoma.

  7. Random fluctuation leads to forbidden escape of particles.

    Science.gov (United States)

    Rodrigues, Christian S; de Moura, Alessandro P S; Grebogi, Celso

    2010-08-01

    A great number of physical processes are described within the context of Hamiltonian scattering. Previous studies have rather been focused on trajectories starting outside invariant structures, since the ones starting inside are expected to stay trapped there forever. This is true though only for the deterministic case. We show however that, under finitely small random fluctuations of the field, trajectories starting inside Kolmogorov-Arnold-Moser (KAM) islands escape within finite time. The nonhyperbolic dynamics gains then hyperbolic characteristics due to the effect of the random perturbed field. As a consequence, trajectories which are started inside KAM curves escape with hyperboliclike time decay distribution, and the fractal dimension of a set of particles that remain in the scattering region approaches that for hyperbolic systems. We show a universal quadratic power law relating the exponential decay to the amplitude of noise. We present a random walk model to relate this distribution to the amplitude of noise, and investigate these phenomena with a numerical study applying random maps.

  8. Ultra-fast Escape of a Octopus-inspired Rocket

    Science.gov (United States)

    Weymouth, Gabriel; Triantafyllou, Michael

    2013-11-01

    The octopus, squid, and other cephalopods inflate with water and then release a jet to accelerate in the opposite direction. This escape mechanism is particularly interesting in the octopus because they become initially quite bluff, yet this does not hinder them in achieving impressive bursts of speed. We examine this somewhat paradoxical maneuver using a simple deflating spheroid model in both potential and viscous flow. We demonstrate that the dynamic reduction of the width of the body completely changes the flow and forces acting on the escaping rocket in three ways. First, a body which reduces in size can generate an added mass thrust which counteracts the added mass inertia. Second, the motion of the shrinking wall acts similar to suction on a static wall, reducing separation and drag forces in a viscous fluid, but that this effects depends on the rate of size change. Third, using a combination of these two features it is possible to initially load the fluid with kinetic energy when heavy and bluff and then recover that energy when streamlined and light, enabling ultra-fast accelerations. As a notable example, these mechanisms allow a shrinking spheroid rocket in a heavy inviscid fluid to achieve speeds greater than an identical rocket in the vacuum of space. Southampton Marine and Maritime Institute.

  9. Slow and Fast Escape for Open Intermittent Maps

    Science.gov (United States)

    Demers, Mark F.; Todd, Mike

    2017-04-01

    If a system mixes too slowly, putting a hole in it can completely destroy the richness of the dynamics. Here we study this instability for a class of intermittent maps with a family of slowly mixing measures. We show that there are three regimes: (1) standard hyperbolic-like behavior where the rate of mixing is faster than the rate of escape through the hole, there is a unique limiting absolutely continuous conditionally invariant measure (accim) and there is a complete thermodynamic description of the dynamics on the survivor set; (2) an intermediate regime, where the rate of mixing and escape through the hole coincide, limiting accims exist, but much of the thermodynamic picture breaks down; (3) a subexponentially mixing regime where the slow mixing means that mass simply accumulates on the parabolic fixed point. We give a complete picture of the transitions and stability properties (in the size of the hole and as we move through the family) in this class of open systems. In particular, we are able to recover a form of stability in the third regime above via the dynamics on the survivor set, even when no limiting accim exists.

  10. The C. elegans touch response facilitates escape from predacious fungi.

    Science.gov (United States)

    Maguire, Sean M; Clark, Christopher M; Nunnari, John; Pirri, Jennifer K; Alkema, Mark J

    2011-08-09

    Predator-prey interactions are vital determinants in the natural selection of behavioral traits. Gentle touch to the anterior half of the body of Caenorhabditis elegans elicits an escape response in which the animal quickly reverses and suppresses exploratory head movements [1, 2]. Here, we investigate the ecological significance of the touch response in predator-prey interactions between C. elegans and predacious fungi that catch nematodes using constricting hyphal rings. We show that the constricting rings of Drechslerella doedycoides catch early larval stages with a diameter similar to the trap opening. There is a delay between the ring entry and ring closure, which allows the animal to withdraw from the trap before being caught. Mutants that fail to suppress head movements in response to touch are caught more efficiently than the wild-type. This demonstrates that the coordination of motor programs allows C. elegans to smoothly retract from a fungal noose and evade capture. Our results suggest that selective pressures imposed by predacious fungi have shaped the evolution of C. elegans escape behavior.

  11. Tectonic escape in the evolution of the continental crust

    Science.gov (United States)

    Burke, K.; Sengor, C.

    1986-01-01

    The continental crust originated by processes similar to those operating today and continents consist of material most of which originated long ago in arc-systems that have later been modified, especially at Andean margins and in continental collisions where crustal thickening is common. Collision-related strike-slip motion is a general process in continental evolution. Because buoyant continental (or arc) material generally moves during collision toward a nearby oceanic margin where less buoyant lithosphere crops out, the process of major strike-slip dominated motion toward a 'free-face' is called 'tectonic escape'. Tectonic escape is and has been an element in continental evolution throughout recorded earth-history. It promotes: (1) rifting and the formation of rift-basins with thinning of thickened crust; (2) pervasive strike-slip faulting late in orogenic history which breaks up mountain belts across strike and may juxtapose unrelated sectors in cross-section; (3) localized compressional mountains and related foreland-trough basins.

  12. The coxsackievirus B 3C protease cleaves MAVS and TRIF to attenuate host type I interferon and apoptotic signaling.

    Directory of Open Access Journals (Sweden)

    Amitava Mukherjee

    2011-03-01

    Full Text Available The host innate immune response to viral infections often involves the activation of parallel pattern recognition receptor (PRR pathways that converge on the induction of type I interferons (IFNs. Several viruses have evolved sophisticated mechanisms to attenuate antiviral host signaling by directly interfering with the activation and/or downstream signaling events associated with PRR signal propagation. Here we show that the 3C(pro cysteine protease of coxsackievirus B3 (CVB3 cleaves the innate immune adaptor molecules mitochondrial antiviral signaling protein (MAVS and Toll/IL-1 receptor domain-containing adaptor inducing interferon-beta (TRIF as a mechanism to escape host immunity. We found that MAVS and TRIF were cleaved in CVB3-infected cells in culture. CVB3-induced cleavage of MAVS and TRIF required the cysteine protease activity of 3C(pro, occurred at specific sites and within specialized domains of each molecule, and inhibited both the type I IFN and apoptotic signaling downstream of these adaptors. 3C(pro-mediated MAVS cleavage occurred within its proline-rich region, led to its relocalization from the mitochondrial membrane, and ablated its downstream signaling. We further show that 3C(pro cleaves both the N- and C-terminal domains of TRIF and localizes with TRIF to signalosome complexes within the cytoplasm. Taken together, these data show that CVB3 has evolved a mechanism to suppress host antiviral signal propagation by directly cleaving two key adaptor molecules associated with innate immune recognition.

  13. Development of novel cyclic peptides as pro-apoptotic agents.

    Science.gov (United States)

    Brindisi, Margherita; Maramai, Samuele; Brogi, Simone; Fanigliulo, Emanuela; Butini, Stefania; Guarino, Egeria; Casagni, Alice; Lamponi, Stefania; Bonechi, Claudia; Nathwani, Seema M; Finetti, Federica; Ragonese, Francesco; Arcidiacono, Paola; Campiglia, Pietro; Valenti, Salvatore; Novellino, Ettore; Spaccapelo, Roberta; Morbidelli, Lucia; Zisterer, Daniela M; Williams, Clive D; Donati, Alessandro; Baldari, Cosima; Campiani, Giuseppe; Ulivieri, Cristina; Gemma, Sandra

    2016-07-19

    Our recent finding that paclitaxel behaves as a peptidomimetic of the endogenous protein Nur77 inspired the design of two peptides (PEP1 and PEP2) reproducing the effects of paclitaxel on Bcl-2 and tubulin, proving the peptidomimetic nature of paclitaxel. Starting from these peptide-hits, we herein describe the synthesis and the biological investigation of linear and cyclic peptides structurally related to PEP2. While linear peptides (2a,b, 3a,b, 4, 6a-f) were found inactive in cell-based assays, biological analysis revealed a pro-apoptotic effect for most of the cyclic peptides (5a-g). Cellular permeability of 5a (and also of 2a,b) on HL60 cells was assessed through confocal microscopy analysis. Further cellular studies on a panel of leukemic cell lines (HL60, Jurkat, MEC, EBVB) and solid tumor cell lines (breast cancer MCF-7 cells, human melanoma A375 and 501Mel cells, and murine melanoma B16F1 cells) confirmed the pro-apoptotic effect of the cyclic peptides. Cell cycle analysis revealed that treatment with 5a, 5c, 5d or 5f resulted in an increase in the number of cells in the sub-G0/G1 peak. Direct interaction with tubulin (turbidimetric assay) and with microtubules (immunostaining experiments) was assessed in vitro for the most promising compounds.

  14. Apoptotic and nonapoptotic function of caspase 7 in spermatogenesis.

    Science.gov (United States)

    Lei, Bin; Zhou, Xuming; Lv, Daojun; Wan, Bo; Wu, Huayan; Zhong, Liren; Shu, Fangpeng; Mao, Xiangming

    2017-01-01

    Recent studies have reported that caspase 7 has an apoptotic and nonapoptotic function. However, the relationship between caspase 7 and spermatogenesis remains unknown. This study aimed to investigate the possible function of caspase 7 during normal and abnormal spermatogenesis. The cleaved form of caspase 7 was detected in testis tissues at different postpartum times (5-14 weeks) by qRT-PCR, Western blot and immunohistochemistry (IHC). Then, the mice models of spermatogenic dysfunction were obtained by busulfan (30 mg kg-1 to further evaluate the potential function and mechanism of caspase 7. qRT-PCR and Western blot results showed that caspase 7 expression was gradually elevated from 5 to 14 weeks, which was not connected with apoptosis. IHC results revealed that caspase 7 was mainly located in spermatogenic cells and Leydig cells. In addition, spermatogenic dysfunction induced by busulfan gradually enhanced the apoptosis and elevated the expression of caspase 3, caspase 6, and caspase 9, but decreased the expression of caspase 7 in spermatogenic cells. However, when spermatogenic cells were mostly disappeared at the fourth week after busulfan treatment, caspase 7 expression in Leydig cells was significantly increased and positively correlated with the expression of caspase 3, caspase 6, and caspase 9. Therefore, these results indicate that caspase 7 has a nonapoptic function that participates in normal spermatogenesis, but also displays apoptotic function in spermatogenic dysfunction.

  15. Interaction of late apoptotic and necrotic cells with vitronectin.

    Directory of Open Access Journals (Sweden)

    Ondrej Stepanek

    Full Text Available BACKGROUND: Vitronectin is an abundant plasma glycoprotein identified also as a part of extracellular matrix. Vitronectin is substantially enriched at sites of injured, fibrosing, inflamed, and tumor tissues where it is believed to be involved in wound healing and tissue remodeling. Little is known about the mechanism of vitronectin localization into the damaged tissues. METHODOLOGY/PRINCIPAL FINDINGS: 2E12 antibody has been described to bind a subset of late apoptotic cells. Using immunoisolation followed by mass spectrometry, we identified the antigen recognized by 2E12 antibody as vitronectin. Based on flow cytometry, we described that vitronectin binds to the late apoptotic and necrotic cells in cell cultures in vitro as well as in murine thymus and spleen in vivo. Confocal microscopy revealed that vitronectin binds to an intracellular cytoplasmic structure after the membrane rupture. CONCLUSIONS/SIGNIFICANCE: We propose that vitronectin could serve as a marker of membrane disruption in necrosis and apoptosis for flow cytometry analysis. Moreover, we suggest that vitronectin binding to dead cells may represent one of the mechanisms of vitronectin incorporation into the injured tissues.

  16. PUMA-mediated mitochondrial apoptotic disruption by hypoxic postconditioning.

    Science.gov (United States)

    Li, YuZhen; Guo, Qi; Liu, XiuHua; Wang, Chen; Song, DanDan

    2015-08-01

    Postconditioning can reduce ischemia-reperfusion (I/R)-induced cardiomyocyte apoptosis by targeting mitochondria. p53 upregulated modulator of apoptosis (PUMA) is involved in lethal I/R injury. Here, we hypothesized that postconditioning might inhibit mitochondrial pathway-mediated cardiomyocyte apoptosis by controlling PUMA expression. The cultured neonatal rat cardiomyocytes underwent 3 h of hypoxia and 3 h of reoxygenation. Postconditioning consisted of three cycles of 5 min reoxygenation and 5 min hypoxia after prolonged hypoxia. Hypoxic postconditioning reduced the levels of PUMA mRNA and protein. Concomitantly, the loss of mitochondrial membrane potential, cytochrome c release and caspase-3 activation were decreased significantly by postconditioning. Overexpression of PUMA increased greatly not only the number of apoptotic cardiomyocytes, but also the collapse of mitochondrial membrane potential, cytochrome c release and caspase-3 activation under postconditioning condition. The data suggest that reduction of PUMA expression mediates the endogenous cardioprotective mechanisms of postconditioning by disrupting mitochondrial apoptotic pathway.

  17. Histone deacetylase inhibitor upregulates peroxisomal fatty acid oxidation and inhibits apoptotic cell death in abcd1-deficient glial cells.

    Directory of Open Access Journals (Sweden)

    Jaspreet Singh

    Full Text Available In X-ALD, mutation/deletion of ALD gene (ABCD1 and the resultant very long chain fatty acid (VLCFA derangement has dramatically opposing effects in astrocytes and oligodendrocytes. While loss of Abcd1 in astrocytes produces a robust inflammatory response, the oligodendrocytes undergo cell death leading to demyelination in X-linked adrenoleukodystrophy (X-ALD. The mechanisms of these distinct pathways in the two cell types are not well understood. Here, we investigated the effects of Abcd1-knockdown and the subsequent alteration in VLCFA metabolism in human U87 astrocytes and rat B12 oligodendrocytes. Loss of Abcd1 inhibited peroxisomal β-oxidation activity and increased expression of VLCFA synthesizing enzymes, elongase of very long chain fatty acids (ELOVLs (1 and 3 in both cell types. However, higher induction of ELOVL's in Abcd1-deficient B12 oligodendrocytes than astrocytes suggests that ELOVL pathway may play a prominent role in oligodendrocytes in X-ALD. While astrocytes are able to maintain the cellular homeostasis of anti-apoptotic proteins, Abcd1-deletion in B12 oligodendrocytes downregulated the anti-apototic (Bcl-2 and Bcl-xL and cell survival (phospho-Erk1/2 proteins, and upregulated the pro-apoptotic proteins (Bad, Bim, Bax and Bid leading to cell loss. These observations provide insights into different cellular signaling mechanisms in response to Abcd1-deletion in two different cell types of CNS. The apoptotic responses were accompanied by activation of caspase-3 and caspase-9 suggesting the involvement of mitochondrial-caspase-9-dependent mechanism in Abcd1-deficient oligodendrocytes. Treatment with histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA corrected the VLCFA derangement both in vitro and in vivo, and inhibited the oligodendrocytes loss. These observations provide a proof-of principle that HDAC inhibitor SAHA may have a therapeutic potential for X-ALD.

  18. Cobalt iron oxide nanoparticles induce cytotoxicity and regulate the apoptotic genes through ROS in human liver cells (HepG2).

    Science.gov (United States)

    Ahamed, Maqusood; Akhtar, Mohd Javed; Khan, M A Majeed; Alhadlaq, Hisham A; Alshamsan, Aws

    2016-12-01

    Cobalt iron oxide (CoFe2O4) nanoparticles (CIO NPs) have been one of the most widely explored magnetic NPs because of their excellent chemical stability, mechanical hardness and heat generating potential. However, there is limited information concerning the interaction of CIO NPs with biological systems. In this study, we investigated the reactive oxygen species (ROS) mediated cytotoxicity and apoptotic response of CIO NPs in human liver cells (HepG2). Diameter of crystalline CIO NPs was found to be 23nm with a band gap of 1.97eV. CIO NPs induced cell viability reduction and membrane damage, and degree of induction was dose- and time-dependent. CIO NPs were also found to induce oxidative stress revealed by induction of ROS, depletion of glutathione and lower activity of superoxide dismutase enzyme. Real-time PCR data has shown that mRNA level of tumor suppressor gene p53 and apoptotic genes (bax, CASP3 and CASP9) were higher, while the expression level of anti-apoptotic gene bcl-2 was lower in cells following exposure to CIO NPs. Activity of caspase-3 and caspase-9 enzymes was also higher in CIO NPs exposed cells. Furthermore, co-exposure of N-acetyl-cysteine (ROS scavenger) efficiently abrogated the modulation of apoptotic genes along with the prevention of cytotoxicity caused by CIO NPs. Overall, we observed that CIO NPs induced cytotoxicity and apoptosis in HepG2 cells through ROS via p53 pathway. This study suggests that toxicity mechanisms of CIO NPs should be further investigated in animal models.

  19. Allograft tolerance induced by donor apoptotic lymphocytes requires phagocytosis in the recipient

    Science.gov (United States)

    Sun, E.; Gao, Y.; Chen, J.; Roberts, A. I.; Wang, X.; Chen, Z.; Shi, Y.

    2004-01-01

    Cell death through apoptosis plays a critical role in regulating cellular homeostasis. Whether the disposal of apoptotic cells through phagocytosis can actively induce immune tolerance in vivo, however, remains controversial. Here, we report in a rat model that without using immunosuppressants, transfusion of apoptotic splenocytes from the donor strain prior to transplant dramatically prolonged survival of heart allografts. Histological analysis verified that rejection signs were significantly ameliorated. Splenocytes from rats transfused with donor apoptotic cells showed a dramatically decreased response to donor lymphocyte stimulation. Most importantly, blockade of phagocytosis in vivo, either with gadolinium chloride to disrupt phagocyte function or with annexin V to block binding of exposed phosphotidylserine to its receptor on phagocytes, abolished the beneficial effect of transfused apoptotic cells on heart allograft survival. Our results demonstrate that donor apoptotic cells promote specific allograft acceptance and that phagocytosis of apoptotic cells in vivo plays a crucial role in maintaining immune tolerance.

  20. Angiotensin II reactivation and aldosterone escape phenomena in renin-angiotensin-aldosterone system blockade: is oral renin inhibition the solution?

    Science.gov (United States)

    Athyros, Vasilios G; Mikhailidis, Dimitri P; Kakafika, Anna I; Tziomalos, Konstantinos; Karagiannis, Asterios

    2007-04-01

    This editorial considers the use of the first selective oral renin inhibitor, aliskiren, in reducing angiotensin (Ang) II reactivation or aldosterone (ALDO) escape during renin-angiotensin-aldosterone system (RAAS) inhibition. RAAS blockade with angiotensin converting enzyme inhibitors (ACEIs) and/or angiotensin receptor AT(1) blockers (ARBs) is very useful for the treatment of arterial hypertension, chronic heart failure (CHF), atherosclerosis and diabetes. 'Ang II reactivation' and 'ALDO escape' or 'breakthrough' have been observed during either ACEI or ARB treatment, and may attenuate the clinical benefit of RAAS blockade. Renin and Ang I accumulate during ACE inhibition, and might overcome the ability of an ACEI to effectively suppress ACE activity. There is also data suggesting that 30 - 40% of Ang II formation in the healthy human during RAAS activation is formed via renin-dependent, but ACE-independent, pathways. Moreover, ACE gene polymorphisms contribute to the modulation and adequacy of the neurohormonal response to long-term ACE inhibition, at least in patients with CHF (up to 45% of CHF patients have elevated Ang II levels despite the long-term use of an ACEI) or diabetes. The reactivated Ang II promotes ALDO secretion and sodium reabsorption. ALDO breakthrough also occurs during long-term ARB therapy, mainly by an AT(2)-dependent mechanism. This was related to target-organ damage in animal models. Oral renin inhibition with aliskiren has showed excellent efficacy and safety in the treatment of hypertension. Aliskiren can be co-administered with ACEIs, ARBs or hydrochlorothiazide. Furthermore, there is evidence suggesting that aliskiren reduces Ang II reactivation in ACE inhibition and ALDO escape during treatment with an ACEI or an ARB, at least to the degree that this is associated with the RAAS. For RAAS-independent ALDO production, the combination of aliskiren with eplerenone might prove useful.

  1. Vaccination and timing influence SIV immune escape viral dynamics in vivo.

    Directory of Open Access Journals (Sweden)

    Liyen Loh

    2008-01-01

    Full Text Available CD8+ cytotoxic T lymphocytes (CTL can be effective at controlling HIV-1 in humans and SIV in macaques, but their utility is partly offset by mutational escape. The kinetics of CTL escape and reversion of escape mutant viruses upon transmission to MHC-mismatched hosts can help us understand CTL-mediated viral control and the fitness cost extracted by immune escape mutation. Traditional methods for following CTL escape and reversion are, however, insensitive to minor viral quasispecies. We developed sensitive quantitative real-time PCR assays to track the viral load of SIV Gag164-172 KP9 wild-type (WT and escape mutant (EM variants in pigtail macaques. Rapid outgrowth of EM virus occurs during the first few weeks of infection. However, the rate of escape plateaued soon after, revealing a prolonged persistence of WT viremia not detectable by standard cloning and sequencing methods. The rate of escape of KP9 correlated with levels of vaccine-primed KP9-specific CD8+ T cells present at that time. Similarly, when non-KP9 responder (lacking the restricting Mane-A*10 allele macaques were infected with SHIVmn229 stock containing a mixture of EM and WT virus, rapid reversion to WT was observed over the first 2 weeks following infection. However, the rate of reversion to WT slowed dramatically over the first month of infection. The serial quantitation of escape mutant viruses evolving during SIV infection shows that rapid dynamics of immune escape and reversion can be observed in early infection, particularly when CD8 T cells are primed by vaccination. However, these early rapid rates of escape and reversion are transient and followed by a significant slowing in these rates later during infection, highlighting that the rate of escape is significantly influenced by the timing of its occurrence.

  2. On the relative contributions of positive reinforcement and escape extinction in the treatment of food refusal.

    OpenAIRE

    Piazza, Cathleen C; Patel, Meeta R; Gulotta, Charles S; Sevin, Bari M; Layer, Stacy A

    2003-01-01

    We compared the effects of positive reinforcement alone, escape extinction alone, and positive reinforcement with escape extinction in the treatment of the food and fluid refusal of 4 children who had been diagnosed with a pediatric feeding disorder. Consumption did not increase when positive reinforcement was implemented alone. By contrast, consumption increased for all participants when escape extinction was implemented, independent of the presence or absence of positive reinforcement. Howe...

  3. Momentum versus extinction effects in the treatment of self-injurious escape behavior.

    OpenAIRE

    Zarcone, J R; Iwata, B A; Hughes, C.E; Vollmer, T R

    1993-01-01

    An individual's self-injurious escape behavior was treated using a high-probability instructional sequence with and without extinction. When presented alone, the high-probability sequence did not reduce self-injurious behavior. When escape extinction was implemented either alone or in combination with the high-probability sequence, self-injury decreased and compliance increased, suggesting that extinction may be a necessary component of the treatment for behavior problems maintained by escape.

  4. Barley aleurone cell death is not apoptotic: characterization of nuclease activities and DNA degradation.

    Science.gov (United States)

    Fath, A; Bethke, P C; Jones, R L

    1999-11-01

    Barley aleurone cells undergo programmed cell death (PCD) when exposed to gibberellic acid (GA), but incubation in abscisic acid (ABA) prevent PCD. We tested the hypothesis that PCD in aleurone cells occurs by apoptosis, and show that the hallmark of apoptosis, namely DNA cleavage into 180 bp fragments, plasma membrane blebbing, and the formation of apoptotic bodies do not occur when aleurone cells die. We show that endogenous barley aleurone nucleases and nucleases present in enzymes used for protoplast preparation degrade aleurone DNA and that DNA degradation by these nucleases is rapid and can result in the formation of 180 bp DNA ladders. Methods are described that prevent DNA degradation during isolation from aleurone layers or protoplasts. Barley aleurone cells contain three nucleases whose activities are regulated by GA and ABA. CA induction and ABA repression of nuclease activities correlate with PCD in aleurone cells. Cells incubated in ABA remain alive and do not degrade their DNA, but living aleurone cells treated with GA accumulate nucleases and hydrolyze their nuclear DNA. We propose that barley nucleases play a role in DNA cleavage during aleurone PCD.

  5. Characterization of escape times of Josephson junctions for signal detection.

    Science.gov (United States)

    Addesso, Paolo; Filatrella, Giovanni; Pierro, Vincenzo

    2012-01-01

    The measurement of the escape time of a Josephson junction might be used to detect the presence of a sinusoidal signal embedded in noise when use of standard signal processing tools can be prohibitive due to the extreme weakness of the source or to the huge amount of data. In this paper we show that the prescriptions for the experimental setup and some physical behaviors depend on the detection strategy. More specifically, by exploitation of the sample mean of escape times to perform detection, two resonant regions are identified. At low frequencies there is a stochastic resonance or activation phenomenon, while near the plasma frequency a geometric resonance appears. Furthermore, detection performance in the geometric resonance region is maximized at the prescribed value of the bias current. The naive sample mean detector is outperformed, in terms of error probability, by the optimal likelihood ratio test. The latter exhibits only geometric resonance, showing monotonically increasing performance as the bias current approaches the junction critical current. In this regime the escape times are vanishingly small and therefore performance is essentially limited by measurement electronics. The behavior of the likelihood ratio and sample mean detector for different values of incoming signal to noise ratio is discussed, and a relationship with the error probability is found. Detectors based on the likelihood ratio test could be employed also to estimate unknown parameters in the applied input signal. As a prototypical example we study the phase estimation problem of a sinusoidal current, which is accomplished by using the filter bank approach. Finally we show that for a physically feasible detector the performances are found to be very close to the Cramer-Rao theoretical bound. Applications might be found, for example, in some astronomical detection problems (where the all-sky gravitational and/or radio wave search for pulsars requires the analysis of nearly sinusoidal

  6. Tuberin and PRAS40 are anti-apoptotic gatekeepers during early human amniotic fluid stem-cell differentiation.

    Science.gov (United States)

    Fuchs, Christiane; Rosner, Margit; Dolznig, Helmut; Mikula, Mario; Kramer, Nina; Hengstschläger, Markus

    2012-03-01

    Embryoid bodies (EBs) are three-dimensional multicellular aggregates allowing the in vitro investigation of stem-cell differentiation processes mimicking early embryogenesis. Human amniotic fluid stem (AFS) cells harbor high proliferation potential, do not raise the ethical issues of embryonic stem cells, have a lower risk for tumor development, do not need exogenic induction of pluripotency and are chromosomal stable. Starting from a single human AFS cell, EBs can be formed accompanied by the differentiation into cells of all three embryonic germ layers. Here, we report that siRNA-mediated knockdown of the endogenous tuberous sclerosis complex-2 (TSC2) gene product tuberin or of proline-rich Akt substrate of 40 kDa (PRAS40), the two major negative regulators of mammalian target of rapamycin (mTOR), leads to massive apoptotic cell death during EB development of human AFS cells without affecting the endodermal, mesodermal and ectodermal cell differentiation spectrum. Co-knockdown of endogenous mTOR demonstrated these effects to be mTOR-dependent. Our findings prove this enzyme cascade to be an essential anti-apoptotic gatekeeper of stem-cell differentiation during EB formation. These data allow new insights into the regulation of early stem-cell maintenance and differentiation and identify a new role of the tumor suppressor tuberin and the oncogenic protein PRAS40 with the relevance for a more detailed understanding of the pathogenesis of diseases associated with altered activities of these gene products.

  7. Effects of cinnamon (Cinnamomum zeylanicum) bark oil on testicular antioxidant values, apoptotic germ cell and sperm quality.

    Science.gov (United States)

    Yüce, A; Türk, G; Çeribaşi, S; Sönmez, M; Çiftçi, M; Güvenç, M

    2013-08-01

    Cinnamon and its contents have multifactorial properties such as antioxidant, anti-inflammatory and antidiabetic. Male infertility is one of the major health problems in life. The aim of this study was to investigate the effects of long-term cinnamon bark oil (CBO) ingestion on testicular antioxidant values, apoptotic germ cell and sperm quality of adult rats. Twelve male healthy Wistar rats were divided into two groups, each group containing six rats. While olive oil was given to control group, 100 mg kg(-1)  CBO was administered to the other group by gavage daily for 10 weeks. Body and reproductive organ weights, sperm characteristics, testicular lipid peroxidation and antioxidant enzyme activities, and testicular apoptosis via terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL) method were examined. A significant decrease in malondialdehyde level and marked increases in reduced glutathione level, glutathione peroxidase and catalase activities were observed in rats treated with CBO compared with the control group. CBO consumption provided a significant increase in weights of testes and epididymides, epididymal sperm concentration, sperm motility and diameter of seminiferous tubules when compared with the control group. However, CBO consumption tended to decrease the abnormal sperm rate and apoptotic germ cell count, but it did not reach statistical significance. It is concluded that CBO has improvement effect on testicular oxidant-antioxidant balance and sperm quality, and its consumption may be useful for asthenozoospermic men.

  8. PKC{eta} confers protection against apoptosis by inhibiting the pro-apoptotic JNK activity in MCF-7 cells

    Energy Technology Data Exchange (ETDEWEB)

    Rotem-Dai, Noa; Oberkovitz, Galia; Abu-Ghanem, Sara [The Schraga Segal Department of Microbiology and Immunology, Faculty of Health Sciences and the Cancer Research Center, Ben - Gurion University, Beer Sheva 84105 (Israel); Livneh, Etta, E-mail: etta@bgumail.bgu.ac.il [The Schraga Segal Department of Microbiology and Immunology, Faculty of Health Sciences and the Cancer Research Center, Ben - Gurion University, Beer Sheva 84105 (Israel)

    2009-09-10

    Apoptosis is frequently regulated by different protein kinases including protein kinase C family enzymes. Both inhibitory and stimulatory effects were demonstrated for several of the different PKC isoforms. Here we show that the novel PKC isoform, PKC{eta}, confers protection against apoptosis induced by the DNA damaging agents, UVC irradiation and the anti-cancer drug - Camptothecin, of the breast epithelial adenocarcinoma MCF-7 cells. The induced expression of PKC{eta} in MCF-7 cells, under the control of the tetracycline-responsive promoter, resulted in increased cell survival and inhibition of cleavage of the apoptotic marker PARP-1. Activation of caspase-7 and 9 and the release of cytochrome c were also inhibited by the inducible expression of PKC{eta}. Furthermore, JNK activity, required for apoptosis in MCF-7, as indicated by the inhibition of both caspase-7 cleavage and cytochrome c release from the mitochondria in the presence of the JNK inhibitor SP600125, was also suppressed by PKC{eta} expression. Hence, in contrast to most PKC isoforms enhancing JNK activation, our studies show that PKC{eta} is an anti-apoptotic protein, acting as a negative regulator of JNK activity. Thus, PKC{eta} could represent a target for intervention aimed to reduce resistance to anti-cancer treatments.

  9. Phosphorylation of Puma modulates its apoptotic function by regulating protein stability

    OpenAIRE

    M. Fricker; O'Prey, J; Tolkovsky, A. M.; Ryan, K.M.

    2010-01-01

    Puma is a potent BH3-only protein that antagonises anti-apoptotic Bcl-2 proteins, promotes Bax/Bak activation and has an essential role in multiple apoptotic models. Puma expression is normally kept very low, but can be induced by several transcription factors including p53, p73, E2F1 and FOXO3a, whereby it can induce an apoptotic response. As Puma can to bind and inactivate all anti-apoptotic members of the Bcl-2 family, its activity must be tightly controlled. We report here, for the first ...

  10. On the relative contributions of positive reinforcement and escape extinction in the treatment of food refusal.

    Science.gov (United States)

    Piazza, Cathleen C; Patel, Meeta R; Gulotta, Charles S; Sevin, Bari M; Layer, Stacy A

    2003-01-01

    We compared the effects of positive reinforcement alone, escape extinction alone, and positive reinforcement with escape extinction in the treatment of the food and fluid refusal of 4 children who had been diagnosed with a pediatric feeding disorder. Consumption did not increase when positive reinforcement was implemented alone. By contrast, consumption increased for all participants when escape extinction was implemented, independent of the presence or absence of positive reinforcement. However, the addition of positive reinforcement to escape extinction was associated with beneficial effects (e.g., greater decreases in negative vocalizations and inappropriate behavior) for some participants.

  11. Experiment for Development of Simple Escape Countermeasures for Frogs Falling into Concrete Canals

    Science.gov (United States)

    Watabe, Keiji; Mori, Atsushi; Koizumi, Noriyuki; Takemura, Takeshi; Park, Myeong Soo

    Three prototype escape countermeasures for frogs that can be easily installed in U-shaped canals with widths of 30-50 cm and depths of 30-50 cm were experimentally produced because frogs cannot escape from agricultural canals with deep concrete walls after falling into the canal. The differences of effectiveness of the 3 prototypes in places for the countermeasures (1 and 2) and flow conditions (dry and water running) were investigated for 2 frog species (Tokyo Daruma Pond Frog and Japanese Brown Frog). The brown frogs escaped from the canals more easily than the pond frogs. The brown frogs escaped regardless of their body size, but the small pond frogs escaped more easily than the large pond frogs. The prototype with slopes beside both canal walls and a net spread across the center line of the canal enabled frogs to escape from the canal more easily than the prototypes with only slopes or nets beside both canal walls. Increasing the number of places for the countermeasures enhanced frog escape. The differences in frog escape between dry canals and canals with water running were not significant. Therefore, the prototypes were confirmed sufficient as escape countermeasures that is inexpensive and can be easily placed in and removed from agricultural canals.

  12. Improving escape panel selectivity in Nephrops directed fisheries by actively stimulating fish behaviour

    DEFF Research Database (Denmark)

    Krag, Ludvig Ahm; Herrmann, Bent; Feekings, Jordan P.

    2016-01-01

    with it. To increase the efficiency of such panels, the contact probability needs to be improved. In this study, we investigate to what extent the efficiency of escape panels can be improved by actively stimulating the escape behaviour of fish. The performance of two identical panel sections was compared...... in a twin-trawl system, one with and one without a stimulation device. A new coupled analysis method was used to explicitly quantify the improvements in contact probability and release efficiency for the escape panel. The results demonstrate that by actively stimulating escape behaviour, the contact...

  13. Sharks modulate their escape behavior in response to predator size, speed and approach orientation.

    Science.gov (United States)

    Seamone, Scott; Blaine, Tristan; Higham, Timothy E

    2014-12-01

    Escape responses are often critical for surviving predator-prey interactions. Nevertheless, little is known about how predator size, speed and approach orientation impact escape performance, especially in larger prey that are primarily viewed as predators. We used realistic shark models to examine how altering predatory behavior and morphology (size, speed and approach orientation) influences escape behavior and performance in Squalus acanthias, a shark that is preyed upon by apex marine predators. Predator models induced C-start escape responses, and increasing the size and speed of the models triggered a more intense response (increased escape turning rate and acceleration). In addition, increased predator size resulted in greater responsiveness from the sharks. Among the responses, predator approach orientation had the most significant impact on escapes, such that the head-on approach, as compared to the tail-on approach, induced greater reaction distances and increased escape turning rate, speed and acceleration. Thus, the anterior binocular vision in sharks renders them less effective at detecting predators approaching from behind. However, it appears that sharks compensate by performing high-intensity escapes, likely induced by the lateral line system, or by a sudden visual flash of the predator entering their field of view. Our study reveals key aspects of escape behavior in sharks, highlighting the modulation of performance in response to predator approach.

  14. PEGylated apoptotic protein-loaded PLGA microspheres for cancer therapy

    Directory of Open Access Journals (Sweden)

    Byeon HJ

    2015-01-01

    Full Text Available Hyeong Jun Byeon,1 Insoo Kim,1 Ji Su Choi,1 Eun Seong Lee,2 Beom Soo Shin,3 Yu Seok Youn11Department of Pharmaceutical Sciences, School of Pharmacy, Sungkyunkwan University, Suwon, Republic of Korea; 2Division of Biotechnology, The Catholic University of Korea, Bucheon-si, Republic of Korea; 3Department of Pharmacy, College of Pharmacy, Catholic University of Daegu, Gyeongsan-si, Republic of KoreaAbstract: The aim of the current study was to investigate the antitumor potential of poly(D,L-lactic-co-glycolic acid microspheres (PLGA MSs containing polyethylene glycol (PEG-conjugated (PEGylated tumor necrosis factor–related apoptosis-inducing ligand (PEG-TRAIL. PEG-TRAIL PLGA MSs were prepared by using a water-in-oil-in-water double-emulsion method, and the apoptotic activities of supernatants released from the PLGA MSs at days 1, 3, and 7 were examined. The antitumor effect caused by PEG-TRAIL PLGA MSs was evaluated in pancreatic Mia Paca-2 cell-xenografted mice. PEG-TRAIL PLGA MS was found to be spherical and 14.4±1.06 µm in size, and its encapsulation efficiency was significantly greater than that of TRAIL MS (85.7%±4.1% vs 43.3%±10.9%, respectively. The PLGA MS gradually released PEG-TRAIL for 14 days, and the released PEG-TRAIL was shown to have clear apoptotic activity in Mia Paca-2 cells, whereas TRAIL released after 1 day had a negligible activity. Finally, PEG-TRAIL PLGA MS displayed remarkably greater antitumor efficacy than blank or TRAIL PLGA MS in Mia Paca-2 cell-xenografted mice in terms of tumor volume and weight, apparently due to increased stability and well-retained apoptotic activity of PEG-TRAIL in PLGA MS. We believe that this PLGA MS system, combined with PEG-TRAIL, should be considered a promising candidate for treating pancreatic cancer.Keywords: Poly(D,L-lactic-co-glycolic acid, controlled release, PEGylation, TRAIL, pancreatic cancer

  15. The structure of spider's web fast escaping sets

    CERN Document Server

    Osborne, J W

    2010-01-01

    Building on recent work by Rippon and Stallard, we explore the intricate structure of the spider's web fast escaping sets associated with certain transcendental entire functions. Our results are expressed in terms of the components of the complement of the set (the 'holes' in the web). We describe the topology of such components and give a characterisation of their possible orbits under iteration. We show that there are uncountably many components having each of a number of orbit types, and we prove that components with bounded orbits are quasiconformally homeomorphic to components of the filled Julia set of a polynomial. We also show that there are singleton periodic components and that these are dense in the Julia set.

  16. Bacillus cereus immune escape: a journey within macrophages.

    Science.gov (United States)

    Tran, Seav-Ly; Ramarao, Nalini

    2013-10-01

    During bacterial infection, professional phagocytes are attracted to the site of infection, where they constitute a first line of host cell defense. Their function is to engulf and destroy the pathogens. Thus, bacteria must withstand the bactericidal activity of professional phagocytes, including macrophages to counteract the host immune system. Bacillus cereus infections are characterized by bacteremia despite the accumulation of inflammatory cells at the site of infection. This implies that the bacteria have developed means of resisting the host immune system. Bacillus cereus spores survive, germinate, and multiply in contact with macrophages, eventually producing toxins that kill these cells. However, the exact mechanism by which B. cereus evades immune attack remains unclear. This review addresses the interaction between B. cereus and macrophages, highlighting, in particular, the ways in which the bacteria escape the microbicidal activities of professional phagocytes.

  17. Escape and avoidance learning in the earthworm Eisenia hortensis

    Directory of Open Access Journals (Sweden)

    W. Jeffrey Wilson

    2014-01-01

    Full Text Available Interest in instrumental learning in earthworms dates back to 1912 when Yerkes concluded that they can learn a spatial discrimination in a T-maze. Rosenkoetter and Boice determined in the 1970s that the “learning” that Yerkes observed was probably chemotaxis and not learning at all. We examined a different form of instrumental learning: the ability to learn both to escape and to avoid an aversive stimulus. Freely moving “master” worms could turn off an aversive white light by increasing their movement; the behavior of yoked controls had no effect on the light. We demonstrate that in as few as 12 trials the behavior of the master worms comes under the control of this contingency.

  18. Escaping Antiangiogenic Therapy: Strategies Employed by Cancer Cells

    Directory of Open Access Journals (Sweden)

    Mauricio P. Pinto

    2016-09-01

    Full Text Available Tumor angiogenesis is widely recognized as one of the “hallmarks of cancer”. Consequently, during the last decades the development and testing of commercial angiogenic inhibitors has been a central focus for both basic and clinical cancer research. While antiangiogenic drugs are now incorporated into standard clinical practice, as with all cancer therapies, tumors can eventually become resistant by employing a variety of strategies to receive nutrients and oxygen in the event of therapeutic assault. Herein, we concentrate and review in detail three of the principal mechanisms of antiangiogenic therapy escape: (1 upregulation of compensatory/alternative pathways for angiogenesis; (2 vasculogenic mimicry; and (3 vessel co-option. We suggest that an understanding of how a cancer cell adapts to antiangiogenic therapy may also parallel the mechanisms employed in the bourgeoning tumor and isolated metastatic cells delivering responsible for residual disease. Finally, we speculate on strategies to adapt antiangiogenic therapy for future clinical uses.

  19. On Escaping a Galaxy Cluster in an Accelerating Universe

    CERN Document Server

    Stark, Alejo; Gifford, Daniel

    2016-01-01

    We derive the escape velocity profile for an Einasto density field in an accelerating universe and demonstrate its physical viability by comparing theoretical expectations to both light-cone data generated from N-body simulations and archival data on 20 galaxy clusters. We demonstrate that the projection function ($g(\\beta )$) is deemed physically viable only for the theoretical expectation that includes a cosmology-dependent term. Using simulations, we show that the inferred velocity anisotropy is more than 6{\\sigma} away from the expected value for the theoretical profile that ignores the acceleration of the universe. In the archival data, we constrain the average velocity anisotropy parameter of a sample of 20 clusters to be $\\beta ={0.248}_{-0.360}^{+0.164}$ at the 68% confidence level. Lastly, we briefly discuss how our analytic model may be used as a novel cosmological probe based on galaxy clusters.

  20. An Introduction to Survival, Evasion, Resistance, and Escape (SERE) Medicine.

    Science.gov (United States)

    Smith, Michael B

    2013-01-01

    When an individual finds himself/herself in a survival, evasion, resistance, or escape (SERE) scenario, the ability to treat injuries/illnesses can be the difference between life and death. SERE schools are responsible for preparing military members for these situations, but the concept of SERE medicine is not particularly well defined. To provide a comprehensive working description of SERE medicine, operational and training components were examined. Evidence suggests that SERE medicine is diverse, injury/illness patterns are situationally dependent, and treatment options often differ from conventional clinical medicine. Ideally, medical lessons taught in SERE training are based on actual documented events. Unfortunately, the existing body of literature is dated and does not appear to be expanding. In this article, four distinct facets of SERE medicine are presented to establish a basis for future discussion and research. Recommendations to improve SERE medical curricula and data-gathering processes are also provided.

  1. Will 3552 Don Quixote escape from the Solar System?

    Directory of Open Access Journals (Sweden)

    Suryadi Siregar

    2011-05-01

    Full Text Available Asteroid 1983 SA, well known as 3552 Don Quixote, is one of Near Earth Asteroids (NEAs which is the most probable candidate for the cometary origin, or otherwise as Jupiter-Family-Comets (JFCs. The aim of this study is to investigate the possibility of 3552 Don Quixote to be ejected from the Solar System. This paper presents an orbital evolution of 100 hypothetical asteroids generated by cloning 3552 Don Quixote. Investigation of its orbital evolution is conducted by using the SWIFT subroutine package, where the gravitational perturbations of eight major planets in the Solar System are considered. Over very short time scales (220 kyr relative to the Solar System life time (10 Gyr, the asteroid 3552 Don Quixote gave an example of chaotic motion that can cause asteroid to move outward and may be followed by escaping from the Solar System. Probability of ejection within the 220 kyr time scale is 50%.

  2. Escape of Mycobacterium tuberculosis from oxidative killing by neutrophils.

    Science.gov (United States)

    Corleis, Björn; Korbel, Daniel; Wilson, Robert; Bylund, Johan; Chee, Ronnie; Schaible, Ulrich E

    2012-07-01

    Neutrophils enter sites of infection, where they can eliminate pathogenic bacteria in an oxidative manner. Despite their predominance in active tuberculosis lesions, the function of neutrophils in this important human infection is still highly controversial. We observed that virulent Mycobacterium tuberculosis survived inside human neutrophils despite prompt activation of these defence cells' microbicidal effectors. Survival of M. tuberculosis was accompanied by necrotic cell death of infected neutrophils. Necrotic cell death entirely depended on radical oxygen species production since chronic granulomatous disease neutrophils were protected from M. tuberculosis-triggered necrosis. More, importantly, the M. tuberculosis ΔRD1 mutant failed to induce neutrophil necrosis rendering this strain susceptible to radical oxygen species-mediated killing. We conclude that this virulence function is instrumental for M. tuberculosis to escape killing by neutrophils and contributes to pathogenesis in tuberculosis.

  3. Novel Anti-Melanoma Immunotherapies: Disarming Tumor Escape Mechanisms

    Directory of Open Access Journals (Sweden)

    Sivan Sapoznik

    2012-01-01

    Full Text Available The immune system fights cancer and sometimes temporarily eliminates it or reaches an equilibrium stage of tumor growth. However, continuous immunological pressure also selects poorly immunogenic tumor variants that eventually escape the immune control system. Here, we focus on metastatic melanoma, a highly immunogenic tumor, and on anti-melanoma immunotherapies, which recently, especially following the FDA approval of Ipilimumab, gained interest from drug development companies. We describe new immunomodulatory approaches currently in the development pipeline, focus on the novel CEACAM1 immune checkpoint, and compare its potential to the extensively described targets, CTLA4 and PD1. This paper combines multi-disciplinary approaches and describes anti-melanoma immunotherapies from molecular, medical, and business angles.

  4. Fast Escape from Quantum Mazes in Integrated Photonics

    CERN Document Server

    Caruso, Filippo; Ciriolo, Anna Gabriella; Sciarrino, Fabio; Osellame, Roberto

    2015-01-01

    Escaping from a complex maze, by exploring different paths with several decision-making branches in order to reach the exit, has always been a very challenging and fascinating task. Wave field and quantum objects may explore a complex structure in parallel by interference effects, but without necessarily leading to more efficient transport. Here, inspired by recent observations in biological energy transport phenomena, we demonstrate how a quantum walker can efficiently reach the output of a maze by partially suppressing the presence of interference. In particular, we show theoretically an unprecedented improvement in transport efficiency for increasing maze size with respect to purely quantum and classical approaches. In addition, we investigate experimentally these hybrid transport phenomena, by mapping the maze problem in an integrated waveguide array, probed by coherent light, hence successfully testing our theoretical results. These achievements may lead towards future bio-inspired photonics technologies...

  5. Escaped and Trapped Emission of Organic Light-Emitting Diodes

    Institute of Scientific and Technical Information of China (English)

    LIANG Shi-Xiong; WU Zhao-Xin; ZHAO Xuan-Ke; HOU Xun

    2012-01-01

    By locating the emitters around the first and second antinode of the metal electrode, the escaped and trapped emission of small molecule based bottom emission organic light-emitting diodes is investigated by using an integrating sphere, a fiber spectrometer and a glass hemisphere. It is found that the external coupling ratio by locating the emitters at the second antinode (at a distance of 220 nm from the cathode) is 70%, which is higher than that of an emitter at the first antinode (60 nm from the cathode) in theory and experiment. Extending the "half-space" dipole model by taking the dipole radiation pattern into account, we also calculate the optical coupling efficiency for the emitter at both the first and second antinode. Our experimental and theoretical results will benefit the optimization of device structures for the higher out-coupling efficiency.%By locating the emitters around the first and second antinode of the metal electrode,the escaped and trapped emission of small molecule based bottom emission organic light-emitting diodes is investigated by using an integrating sphere,a fiber spectrometer and a glass hemisphere.It is found that the external coupling ratio by locating the emitters at the second antinode (at a distance of 220 nm from the cathode) is 70%,which is higher than that of an emitter at the first antinode (60nm from the cathode) in theory and experiment.Extending the "half-space" dipole model by taking the dipole radiation pattern into account,we also calculate the optical coupling efficiency for the emitter at both the first and second antinode.Our experimental and theoretical results will benefit the optimization of device structures for the higher out-coupling efficiency.

  6. ESCAP holds expert group meeting on population issues facing adolescents.

    Science.gov (United States)

    1997-01-01

    This article summarizes the activities at the ESCAP Population Division Expert Group Meeting on Adolescents that was held during September-October 1997 in Bangkok, Thailand. The meeting was a follow-up to the 1994 International Conference on Population and Development (ICPD). The meeting considered 1) the ICPD recommendations; 2) the recommendations contained in the Jakarta Plan of Action on Human Resource Development; and 3) the Proposals for Action on Human Resources Development for Youth in Asia and the Pacific. Participants included about 25 people from Australia, Bangladesh, China, India, Indonesia, Philippines, Sri Lanka, and Thailand. The conference relied on 8 invited experts, two resource persons, advisors from the UNFPA Country Support Team for East and Southeast Asia, and representatives of UNFPA, the Population Council, and the East-West Center. A concern was the declining age of menarche of girls in the ESCAP region and the increasing age of marriage. During the time of menarche and marriage, girls are migrating and moving away from their family and community in rural areas. Family structure and relationships are changing. Increases are observed in adolescent premarital sexual activity, the incidence of sexually transmitted diseases, substance abuse, teenage pregnancy, and abortion. The mass media and information technologies have both a positive and a negative influence on adolescents. Parent-child communication exchanges and teacher-student exchanges are "less than ideal." Old traditions and practices change slower than people change. Boys and girls are affected differently by the sociocultural and economic environment. The societal norms set expectations for behavior that may conflict with individual beliefs and practices. Changes brought by globalization and rapid economic growth provide greater opportunity for young girls and women to obtain employment and autonomy.

  7. RpoS controls the Vibrio cholerae mucosal escape response.

    Directory of Open Access Journals (Sweden)

    Alex Toftgaard Nielsen

    2006-10-01

    Full Text Available Vibrio cholerae causes a severe diarrhoeal disease by secreting a toxin during colonization of the epithelium in the small intestine. Whereas the initial steps of the infectious process have been intensively studied, the last phases have received little attention. Confocal microscopy of V. cholerae O1-infected rabbit ileal loops captured a distinctive stage in the infectious process: 12 h post-inoculation, bacteria detach from the epithelial surface and move into the fluid-filled lumen. Designated the "mucosal escape response," this phenomenon requires RpoS, the stationary phase alternative sigma factor. Quantitative in vivo localization assays corroborated the rpoS phenotype and showed that it also requires HapR. Expression profiling of bacteria isolated from ileal loop fluid and mucus demonstrated a significant RpoS-dependent upregulation of many chemotaxis and motility genes coincident with the emigration of bacteria from the epithelial surface. In stationary phase cultures, RpoS was also required for upregulation of chemotaxis and motility genes, for production of flagella, and for movement of bacteria across low nutrient swarm plates. The hapR mutant produced near-normal numbers of flagellated cells, but was significantly less motile than the wild-type parent. During in vitro growth under virulence-inducing conditions, the rpoS mutant produced 10- to 100-fold more cholera toxin than the wild-type parent. Although the rpoS mutant caused only a small over-expression of the genes encoding cholera toxin in the ileal loop, it resulted in a 30% increase in fluid accumulation compared to the wild-type. Together, these results show that the mucosal escape response is orchestrated by an RpoS-dependent genetic program that activates chemotaxis and motility functions. This may furthermore coincide with reduced virulence gene expression, thus preparing the organism for the next stage in its life cycle.

  8. Initiating a watch list for Ebola virus antibody escape mutations

    Directory of Open Access Journals (Sweden)

    Craig R. Miller

    2016-02-01

    Full Text Available The 2014 Ebola virus (EBOV outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens.

  9. Phenotypic mismatches reveal escape from arms-race coevolution.

    Directory of Open Access Journals (Sweden)

    Charles T Hanifin

    2008-03-01

    Full Text Available Because coevolution takes place across a broad scale of time and space, it is virtually impossible to understand its dynamics and trajectories by studying a single pair of interacting populations at one time. Comparing populations across a range of an interaction, especially for long-lived species, can provide insight into these features of coevolution by sampling across a diverse set of conditions and histories. We used measures of prey traits (tetrodotoxin toxicity in newts and predator traits (tetrodotoxin resistance of snakes to assess the degree of phenotypic mismatch across the range of their coevolutionary interaction. Geographic patterns of phenotypic exaggeration were similar in prey and predators, with most phenotypically elevated localities occurring along the central Oregon coast and central California. Contrary to expectations, however, these areas of elevated traits did not coincide with the most intense coevolutionary selection. Measures of functional trait mismatch revealed that over one-third of sampled localities were so mismatched that reciprocal selection could not occur given current trait distributions. Estimates of current locality-specific interaction selection gradients confirmed this interpretation. In every case of mismatch, predators were "ahead" of prey in the arms race; the converse escape of prey was never observed. The emergent pattern suggests a dynamic in which interacting species experience reciprocal selection that drives arms-race escalation of both prey and predator phenotypes at a subset of localities across the interaction. This coadaptation proceeds until the evolution of extreme phenotypes by predators, through genes of large effect, allows snakes to, at least temporarily, escape the arms race.

  10. Phenotypic mismatches reveal escape from arms-race coevolution.

    Science.gov (United States)

    Hanifin, Charles T; Brodie, Edmund D; Brodie, Edmund D

    2008-03-11

    Because coevolution takes place across a broad scale of time and space, it is virtually impossible to understand its dynamics and trajectories by studying a single pair of interacting populations at one time. Comparing populations across a range of an interaction, especially for long-lived species, can provide insight into these features of coevolution by sampling across a diverse set of conditions and histories. We used measures of prey traits (tetrodotoxin toxicity in newts) and predator traits (tetrodotoxin resistance of snakes) to assess the degree of phenotypic mismatch across the range of their coevolutionary interaction. Geographic patterns of phenotypic exaggeration were similar in prey and predators, with most phenotypically elevated localities occurring along the central Oregon coast and central California. Contrary to expectations, however, these areas of elevated traits did not coincide with the most intense coevolutionary selection. Measures of functional trait mismatch revealed that over one-third of sampled localities were so mismatched that reciprocal selection could not occur given current trait distributions. Estimates of current locality-specific interaction selection gradients confirmed this interpretation. In every case of mismatch, predators were "ahead" of prey in the arms race; the converse escape of prey was never observed. The emergent pattern suggests a dynamic in which interacting species experience reciprocal selection that drives arms-race escalation of both prey and predator phenotypes at a subset of localities across the interaction. This coadaptation proceeds until the evolution of extreme phenotypes by predators, through genes of large effect, allows snakes to, at least temporarily, escape the arms race.

  11. Whole-body volume regulation and escape from antidiuresis.

    Science.gov (United States)

    Verbalis, Joseph G

    2006-07-01

    Both individual cells and organs regulate their volume in response to sustained hypo-osmolality via solute and water losses. Similar processes occur in the whole body to regulate the volumes of extracellular fluid (ECF) and intravascular spaces toward normal levels. Body water losses occur via the phenomena "escape from antidiuresis"; solute losses occur through the secondary natriuresis induced by water retention. As a result of resistance to arginine vasopressin (AVP) signaling, escape from antidiuresis is caused by downregulation of kidney aquaporin-2 expression despite high AVP plasma levels. Recent data have implicated downregulation of vasopressin V2R as a potential mechanism of resistance, and suggest that this may be a result of decreased intrarenal angiotensin II signaling in combination with increased intrarenal nitric oxide and prostaglandin E2 signaling. The natriuresis that results in volume regulation of the ECF and vascular spaces is the result of intrarenal hemodynamic changes produced by volume expansion, but the degree to which these effects are modulated by aldosterone secretion and the activity of distal sodium cotransporters and channels remains to be elucidated. The clinical implication of these volume-regulatory processes is that the chronic hyponatremic state is one of water retention and solute losses from intracellular fluid and ECF compartments. The degree to which solute losses versus water retention contribute to hyponatremia will vary in association with many factors, including the etiology of the hyponatremia, the rapidity of development of the hyponatremia, the chronicity of the hyponatremia, the volume of daily water loading, and individual variability. Understanding these volume-regulatory processes allows a better understanding of many aspects of the conundrum of patients with "clinical euvolemia" and dilutional hyponatremia from AVP-induced water retention.

  12. Modulation of mammalian apoptotic pathways by intracellular protozoan parasites.

    Science.gov (United States)

    Rodrigues, V; Cordeiro-da-Silva, A; Laforge, M; Ouaissi, A; Silvestre, R; Estaquier, J

    2012-03-01

    During intracellular parasitic infections, pathogens and host cells take part in a complex web of events that are crucial for the outcome of the infection. Modulation of host cell apoptosis by pathogens attracted the attention of scientists during the last decade. Apoptosis is an efficient mechanism used by the host to control infection and limit pathogen multiplication and dissemination. In order to ensure completion of their complex life cycles and to guarantee transmission between different hosts, intracellular parasites have developed mechanisms to block apoptosis and sustain the viability of their host cells. Here, we review how some of the most prominent intracellular protozoan parasites modulate the main mammalian apoptotic pathways by emphasizing the advances from the last decade, which have begun to dissect this dynamic and complex interaction.

  13. Effects of glucocorticoids on apoptosis and clearance of apoptotic cells.

    Science.gov (United States)

    McColl, Aisleen; Michlewska, Sylwia; Dransfield, Ian; Rossi, Adriano G

    2007-08-17

    The glucocorticoid (GC) drugs are one of the most commonly prescribed and effective anti-inflammatory agents used for the treatment of many inflammatory disorders through their ability to attenuate phlogistic responses. The glucocorticoid receptor (GCR) primarily mediates GC actions via activation or repression of gene expression. GCs directly induce the expression of proteins displaying anti-inflammatory activities. However, the likely predominant effect of GCs is the repression of multiple inflammatory genes that invariably are overexpressed during nonresolving chronic inflammation. Although most GC actions are mediated through regulation of transcription, rapid nongenomic actions have also been reported. In addition, GCs modulate inflammatory cell survival, inducing apoptosis in immature thymocytes and eosinophils, while delaying constitutive neutrophil apoptosis. Importantly, GCs promote noninflammatory phagocytosis of apoptotic cell targets, a process important for the successful resolution of inflammation. Here, the effects and mechanisms of action of GC on inflammatory cell apoptosis and phagocytosis will be discussed.

  14. Effects of Glucocorticoids on Apoptosis and Clearance of Apoptotic Cells

    Directory of Open Access Journals (Sweden)

    Aisleen McColl

    2007-01-01

    Full Text Available The glucocorticoid (GC drugs are one of the most commonly prescribed and effective anti-inflammatory agents used for the treatment of many inflammatory disorders through their ability to attenuate phlogistic responses. The glucocorticoid receptor (GCR primarily mediates GC actions via activation or repression of gene expression. GCs directly induce the expression of proteins displaying anti-inflammatory activities. However, the likely predominant effect of GCs is the repression of multiple inflammatory genes that invariably are overexpressed during nonresolving chronic inflammation. Although most GC actions are mediated through regulation of transcription, rapid nongenomic actions have also been reported. In addition, GCs modulate inflammatory cell survival, inducing apoptosis in immature thymocytes and eosinophils, while delaying constitutive neutrophil apoptosis. Importantly, GCs promote noninflammatory phagocytosis of apoptotic cell targets, a process important for the successful resolution of inflammation. Here, the effects and mechanisms of action of GC on inflammatory cell apoptosis and phagocytosis will be discussed.

  15. Myotonic dystrophy protein kinase (DMPK) induces actin cytoskeletal reorganization and apoptotic-like blebbing in lens cells

    Science.gov (United States)

    Jin, S.; Shimizu, M.; Balasubramanyam, A.; Epstein, H. F.

    2000-01-01

    DMPK, the product of the DM locus, is a member of the same family of serine-threonine protein kinases as the Rho-associated enzymes. In DM, membrane inclusions accumulate in lens fiber cells producing cataracts. Overexpression of DMPK in cultured lens epithelial cells led to apoptotic-like blebbing of the plasma membrane and reorganization of the actin cytoskeleton. Enzymatically active DMPK was necessary for both effects; inactive mutant DMPK protein did not produce either effect. Active RhoA but not constitutive GDP-state mutant protein produced similar effects as DMPK. The similar actions of DMPK and RhoA suggest that they may function in the same regulatory network. The observed effects of DMPK may be relevant to the removal of membrane organelles during normal lens differentiation and the retention of intracellular membranes in DM lenses. Copyright 2000 Wiley-Liss, Inc.

  16. Involvement of caspase-12-dependent apoptotic pathway in ionic radiocontrast urografin-induced renal tubular cell injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Cheng Tien [Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Weng, Te I. [Department of Forensic Medicine, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Chen, Li Ping [Department of Dentistry, Chang Gang Memorial Hospital, Chang Gang University, Taoyuan, Taiwan (China); Chiang, Chih Kang [Department of Integrated Diagnostics and Therapeutics, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan (China); Department of Internal Medicine, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan (China); Liu, Shing Hwa, E-mail: shinghwaliu@ntu.edu.tw [Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Department of Urology, National Taiwan University Hospital, Taipei, Taiwan (China)

    2013-01-01

    Contrast medium (CM) induces a direct toxic effect on renal tubular cells. This toxic effect subjects in the disorder of CM-induced nephropathy. Our previous work has demonstrated that CM shows to activate the endoplasmic reticulum (ER)-related adaptive unfolding protein response (UPR) activators. Glucose-regulated protein 78 (GRP78)/eukaryotic initiation factor 2α (eIF2α)-related pathways play a protective role during the urografin (an ionic CM)-induced renal tubular injury. However, the involvement of ER stress-related apoptotic signals in the urografin-induced renal tubular cell injury remains unclear. Here, we examined by the in vivo and in vitro experiments to explore whether ER stress-regulated pro-apoptotic activators participate in urografin-induced renal injury. Urografin induced renal tubular dilation, tubular cells detachment, and necrosis in the kidneys of rats. The tubular apoptosis, ER stress-related pro-apoptotic transcriptional factors, and kidney injury marker-1 (kim-1) were also conspicuously up-regulated in urografin-treated rats. Furthermore, treatment of normal rat kidney (NRK)-52E tubular cells with urografin augmented the expressions of activating transcription factor-6 (ATF-6), C/EBP homologous protein (CHOP), Bax, caspase-12, JNK, and inositol-requiring enzyme (IRE) 1 signals. Urografin-induced renal tubular cell apoptosis was not reversed by the inhibitors of ATF-6, JNK signals or CHOP siRNA transfection, but it could be partially reversed by the inhibitor of caspase-12. Taken together, the present results and our previous findings suggest that exposure of CM/urografin activates the ER stress-regulated survival- and apoptosis-related signaling pathways in renal tubular cells. Caspase-12-dependent apoptotic pathway may be partially involved in the urografin-induced nephropathy. -- Highlights: ► Ionic contrast medium-urografin induces renal tubular cell apoptosis. ► Urografin induces the ER stress-regulated survival and apoptosis

  17. Role of apoptotic hepatocytes in HCV dissemination: regulation by acetaldehyde.

    Science.gov (United States)

    Ganesan, Murali; Natarajan, Sathish Kumar; Zhang, Jinjin; Mott, Justin L; Poluektova, Larisa I; McVicker, Benita L; Kharbanda, Kusum K; Tuma, Dean J; Osna, Natalia A

    2016-06-01

    Alcohol consumption exacerbates hepatitis C virus (HCV) pathogenesis and promotes disease progression, although the mechanisms are not quite clear. We have previously observed that acetaldehyde (Ach) continuously produced by the acetaldehyde-generating system (AGS), temporarily enhanced HCV RNA levels, followed by a decrease to normal or lower levels, which corresponded to apoptosis induction. Here, we studied whether Ach-induced apoptosis caused depletion of HCV-infected cells and what role apoptotic bodies (AB) play in HCV-alcohol crosstalk. In liver cells exposed to AGS, we observed the induction of miR-122 and miR-34a. As miR-34a has been associated with apoptotic signaling and miR-122 with HCV replication, these findings may suggest that cells with intensive viral replication undergo apoptosis. Furthermore, when AGS-induced apoptosis was blocked by a pan-caspase inhibitor, the expression of HCV RNA was not changed. AB from HCV-infected cells contained HCV core protein and the assembled HCV particle that infect intact hepatocytes, thereby promoting the spread of infection. In addition, AB are captured by macrophages to switch their cytokine profile to the proinflammatory one. Macrophages exposed to HCV(+) AB expressed more IL-1β, IL-18, IL-6, and IL-10 mRNAs compared with those exposed to HCV(-) AB. The generation of AB from AGS-treated HCV-infected cells even enhanced the induction of aforementioned cytokines. We conclude that HCV and alcohol metabolites trigger the formation of AB containing HCV particles. The consequent spread of HCV to neighboring hepatocytes via infected AB, as well as the induction of liver inflammation by AB-mediated macrophage activation potentially exacerbate the HCV infection course by alcohol and worsen disease progression.

  18. Fas transduces dual apoptotic and trophic signals in hematopoietic progenitors.

    Science.gov (United States)

    Pearl-Yafe, Michal; Stein, Jerry; Yolcu, Esma S; Farkas, Daniel L; Shirwan, Haval; Yaniv, Isaac; Askenasy, Nadir

    2007-12-01

    Stem cells and progenitors are often required to realize their differentiation potential in hostile microenvironments. The Fas/Fas ligand (FasL) interaction is a major effector pathway of apoptosis, which negatively regulates the expansion of differentiated hematopoietic cells. The involvement of this molecular interaction in the function of hematopoietic stem and progenitor cells is not well understood. In the murine syngeneic transplant setting, both Fas and FasL are acutely upregulated in bone marrow-homed donor cells; however, the Fas(+) cells are largely insensitive to FasL-induced apoptosis. In heterogeneous populations of lineage-negative (lin(-)) bone marrow cells and progenitors isolated by counterflow centrifugal elutriation, trimerization of the Fas receptor enhanced the clonogenic activity. Inhibition of caspases 3 and 8 did not affect the trophic signals mediated by Fas, yet it efficiently blocked the apoptotic pathways. Fas-mediated tropism appears to be of physiological significance, as pre-exposure of donor cells to FasL improved the radioprotective qualities of hematopoietic progenitors, resulting in superior survival of myeloablated hosts. Under these conditions, the activity of long-term reconstituting cells was not affected, as determined in sequential secondary and tertiary transplants. Dual caspase-independent tropic and caspase-dependent apoptotic signaling place the Fas receptor at an important junction of activation and death. This regulatory mechanism of hematopoietic homeostasis activates progenitors to promote the recovery from aplasia and converts into a negative regulator in distal stages of cell differentiation. Disclosure of potential conflicts of interest is found at the end of this article.

  19. Enzyme inhibition by iminosugars

    DEFF Research Database (Denmark)

    López, Óscar; Qing, Feng-Ling; Pedersen, Christian Marcus

    2013-01-01

    Imino- and azasugar glycosidase inhibitors display pH dependant inhibition reflecting that both the inhibitor and the enzyme active site have groups that change protonation state with pH. With the enzyme having two acidic groups and the inhibitor one basic group, enzyme-inhibitor complexes...

  20. Hepatitis E virus ORF2 protein activates the pro-apoptotic gene CHOP and anti-apoptotic heat shock proteins.

    Directory of Open Access Journals (Sweden)

    Lijo John

    Full Text Available BACKGROUND: Hepatitis E virus (HEV is a non-enveloped plus-strand RNA virus that causes acute hepatitis. The capsid protein open reading frame 2 (ORF2 is known to induce endoplasmic reticulum stress in ORF2 expressing cells. METHODOLOGY/PRINCIPAL FINDINGS: In this study we found that HEV ORF2 activates the expression of the pro-apoptotic gene C/EBP homologous protein (CHOP. ORF2 stimulates the CHOP promoter mainly through AARE (amino acid response elements and to a minor extent the ERSE (endoplasmic reticulum stress response elements. Activating transcription factor 4 (ATF4 protein binds and activates the AARE regulatory sites of the CHOP promoter. ORF2 expression also leads to increased phosphorylation of eukaryotic initiation factor 2 alpha (eIF2α that in turn initiates the translation of ATF4 mRNA. The pro-apoptotic gene CHOP is an important trigger to initiate endoplasmic reticulum stress induced apoptosis. However, the activation of CHOP by ORF2 in this study did not induce apoptosis, nor did BCL2-associated X protein (Bax translocate to mitochondria. Microarray analysis revealed an ORF2 specific increased expression of chaperones Hsp72, Hsp70B', and co-chaperone Hsp40. Co-immunoprecipitation (Co-IP and in silico molecular docking analysis suggests that HEV ORF2 interacts with Hsp72. In addition, Hsp72 shows nuclear accumulation in ORF2 expressing cells. CONCLUSIONS/SIGNIFICANCE: These data provide new insight into simultaneously occurring counter-acting effects of HEV ORF2 that may be part of a strategy to prevent host suicide before completion of the viral replication cycle.

  1. The anti-apoptotic members of the Bcl-2 family are attractive tumor-associated antigens

    DEFF Research Database (Denmark)

    Straten, Per thor; Andersen, Mads Hald

    2010-01-01

    Anti-apoptotic members of the Bcl-2 family (Bcl-2, Bcl-X(L) and Mcl-2) are pivotal regulators of apoptotic cell death. They are all highly overexpressed in cancers of different origin in which they enhance the survival of the cancer cells. Consequently, they represent prime candidates for anti-ca...

  2. Enhanced activation of dendritic cells by autologous apoptotic microvesicles in MRL/lpr mice

    NARCIS (Netherlands)

    Dieker, J.W.; Hilbrands, L.B.; Thielen, A.; Dijkman, H.B.P.M.; Berden, J.H.M.; Vlag, J. van der

    2015-01-01

    INTRODUCTION: Systemic lupus erythematosus is associated with a persistent circulation of modified autoantigen-containing apoptotic debris that might be capable of breaking tolerance. We aimed to evaluate apoptotic microvesicles obtained from lupus or control mice for the presence of apoptosis-assoc

  3. Pro-apoptotic gene regulation in the Caribbean fruit fly, Anastrepha suspensa

    Science.gov (United States)

    Transcriptional activation of pro-apoptotic genes in response to cytotoxic stimuli is a conserved feature of the cell death pathway proposed for metazoans. However, understanding the extent of this conservation in insects, as well as other organisms, has been limited by the lack of known pro-apoptot...

  4. The phosphatidylserine receptor has essential functions during embryogenesis but not in apoptotic cell removal

    Directory of Open Access Journals (Sweden)

    Hafner Martin

    2004-08-01

    Full Text Available Abstract Background Phagocytosis of apoptotic cells is fundamental to animal development, immune function and cellular homeostasis. The phosphatidylserine receptor (Ptdsr on phagocytes has been implicated in the recognition and engulfment of apoptotic cells and in anti-inflammatory signaling. To determine the biological function of the phosphatidylserine receptor in vivo, we inactivated the Ptdsr gene in the mouse. Results Ablation of Ptdsr function in mice causes perinatal lethality, growth retardation and a delay in terminal differentiation of the kidney, intestine, liver and lungs during embryogenesis. Moreover, eye development can be severely disturbed, ranging from defects in retinal differentiation to complete unilateral or bilateral absence of eyes. Ptdsr -/- mice with anophthalmia develop novel lesions, with induction of ectopic retinal-pigmented epithelium in nasal cavities. A comprehensive investigation of apoptotic cell clearance in vivo and in vitro demonstrated that engulfment of apoptotic cells was normal in Ptdsr knockout mice, but Ptdsr-deficient macrophages were impaired in pro- and anti-inflammatory cytokine signaling after stimulation with apoptotic cells or with lipopolysaccharide. Conclusion Ptdsr is essential for the development and differentiation of multiple organs during embryogenesis but not for apoptotic cell removal. Ptdsr may thus have a novel, unexpected developmental function as an important differentiation-promoting gene. Moreover, Ptdsr is not required for apoptotic cell clearance by macrophages but seems to be necessary for the regulation of macrophage cytokine responses. These results clearly contradict the current view that the phosphatidylserine receptor primarily functions in apoptotic cell clearance.

  5. Spoon Distance Fading with and without Escape Extinction as Treatment for Food Refusal

    Science.gov (United States)

    Rivas, Kristi D.; Piazza, Cathleen C.; Patel, Meeta R.; Bachmeyer, Melanie H.

    2010-01-01

    Little is known about the characteristics of meals that serve as motivating operations (MOs) for escape behavior. In the current investigation, we showed that the distance at which a therapist held a spoon from a child's lips served as an MO for escape behavior. Based on these results, we implemented spoon distance fading, compared fading with and…

  6. Hepatitis A Virus Vaccine Escape Variants and Potential New Serotype Emergence

    Science.gov (United States)

    Pérez-Sautu, Unai; Costafreda, M. Isabel; Caylà, Joan; Tortajada, Cecilia; Lite, Josep; Bosch, Albert

    2011-01-01

    Six hepatitis A virus antigenic variants that likely escaped the protective effect of available vaccines were isolated, mostly from men who have sex with men. The need to complete the proper vaccination schedules is critical, particularly in the immunocompromised population, to prevent the emergence of vaccine-escaping variants. PMID:21470474

  7. Computer Self-Efficacy, Competitive Anxiety and Flow State: Escaping from Firing Online Game

    Science.gov (United States)

    Hong, Jon-Chao; Pei-Yu, Chiu; Shih, Hsiao-Feng; Lin, Pei-Shin; Hong, Jon-Chao

    2012-01-01

    Flow state in game playing affected by computer self-efficacy and game competitive anxiety was studied. In order to examine the effect of those constructs with high competition, this study select "Escaping from firing online game" which require college students to escape from fire and rescue people and eliminate the fire damage along the way of…

  8. Treatment of Escape-Maintained Behavior with Positive Reinforcement: The Role of Reinforcement Contingency and Density

    Science.gov (United States)

    Ingvarsson, Einar T.; Hanley, Gregory P.; Welter, Katherine M.

    2009-01-01

    Functional analyses suggested that the disruptive behavior of three preschool children was maintained by escape from demands. While keeping the escape contingency intact, we conducted (a) a density analysis in which the children earned preferred items for task completion according to two schedules that varied in reinforcement density, and (b) a…

  9. The Effects of Fixed-Time Escape on Inappropriate and Appropriate Classroom Behavior

    Science.gov (United States)

    Waller, Rachael D.; Higbee, Thomas S.

    2010-01-01

    Few studies have explored the effects of fixed-time (FT) reinforcement on escape-maintained behavior of students in a classroom setting. We measured the effects of an FT schedule on the disruptive and appropriate academic behaviors of 2 junior high students in a public school setting. Results demonstrated that FT escape from tasks resulted in a…

  10. Competing Contingencies for Escape Behavior: Effects of Negative Reinforcement Magnitude and Quality

    Science.gov (United States)

    Hammond, Jennifer L.

    2009-01-01

    Previous research has shown that problem behavior maintained by social-negative reinforcement can be treated without escape extinction by enhancing the quality of positive reinforcement for an appropriate alternative response such as compliance. By contrast, negative reinforcement (escape) for compliance generally has been ineffective in the…

  11. Hepatitis A Virus Vaccine Escape Variants and Potential New Serotype Emergence

    OpenAIRE

    Pérez-Sautu, Unai; Costafreda, M. Isabel; Caylà, Joan; Tortajada, Cecilia; Lite, Josep; Bosch, Albert; Pintó, Rosa M.

    2011-01-01

    Six hepatitis A virus antigenic variants that likely escaped the protective effect of available vaccines were isolated, mostly from men who have sex with men. The need to complete the proper vaccination schedules is critical, particularly in the immunocompromised population, to prevent the emergence of vaccine-escaping variants.

  12. Identification of genes escaping X inactivation by allelic expression analysis in a novel hybrid mouse model.

    Science.gov (United States)

    Berletch, Joel B; Ma, Wenxiu; Yang, Fan; Shendure, Jay; Noble, William S; Disteche, Christine M; Deng, Xinxian

    2015-12-01

    X chromosome inactivation (XCI) is a female-specific mechanism that serves to balance gene dosage between the sexes whereby one X chromosome in females is inactivated during early development. Despite this silencing, a small portion of genes escape inactivation and remain expressed from the inactive X (Xi). Little is known about the distribution of escape from XCI in different tissues in vivo and about the mechanisms that control tissue-specific differences. Using a new binomial model in conjunction with a mouse model with identifiable alleles and skewed X inactivation we are able to survey genes that escape XCI in vivo. We show that escape from X inactivation can be a common feature of some genes, whereas others escape in a tissue specific manner. Furthermore, we characterize the chromatin environment of escape genes and show that expression from the Xi correlates with factors associated with open chromatin and that CTCF co-localizes with escape genes. Here, we provide a detailed description of the experimental design and data analysis pipeline we used to assay allele-specific expression and epigenetic characteristics of genes escaping X inactivation. The data is publicly available through the GEO database under ascension numbers GSM1014171, GSE44255, and GSE59779. Interpretation and discussion of these data are included in a previously published study (Berletch et al., 2015) [1].

  13. Anti-apoptotic mechanism of Bacoside rich extract against reactive nitrogen species induced activation of iNOS/Bax/caspase 3 mediated apoptosis in L132 cell line.

    Science.gov (United States)

    Anand, T; Pandareesh, M D; Bhat, Pratiksha V; Venkataramana, M

    2014-10-01

    Nitric oxide is a highly reactive free radical gas that reacts with a wide range of bio-molecules to produce reactive nitrogen species and exerts nitrative stress. Bacopa monniera is a traditional folk and ayurvedic medicine known to alleviate a variety of disorders. Aim of the present study is to evaluate the protective propensity of Bacopa monniera extract (BME) through its oxido-nitrosative and anti-apoptotic mechanism to attenuate sodium nitroprusside (SNP)-induced apoptosis in a human embryonic lung epithelial cell line (L132). Our results elucidate that pre-treatment of L132 cells with BME ameliorates the mitochondrial and plasma membrane damage induced by SNP as evidenced by MTT and LDH leakage assays. BME pre-treatment inhibited NO generation by down-regulating inducible nitric oxide synthase expression. BME exhibited potent antioxidant activity by up-regulating the antioxidant enzymes. SNP-induced damage to cellular, nuclear and mitochondrial integrity was also restored by BME, which was confirmed by ROS estimation, comet assay and mitochondrial membrane potential assays respectively. BME pre-treatment efficiently attenuated the SNP-induced apoptotic biomarkers such as Bax, cytochrome-c and caspase-3, which orchestrate the proteolytic damage of the cell. By considering all these findings, we report that BME protects L132 cells against SNP-induced toxicity via its free radical scavenging and anti-apoptotic mechanism.

  14. Direct interaction of the molecular scaffolds POSH and JIP is required for apoptotic activation of JNKs.

    Science.gov (United States)

    Kukekov, Nickolay V; Xu, Zhiheng; Greene, Lloyd A

    2006-06-02

    A sequential pathway (the JNK pathway) that includes activation of Rac1/Cdc42, mixed lineage kinases, MAP kinase kinases 4 and 7, and JNKs plays a required role in many paradigms of apoptotic cell death. However, the means by which this pathway is assembled and directed toward apoptotic death has been unclear. Here, we report that propagation of the apoptotic JNK pathway requires the cooperative interaction of two molecular scaffolds, POSH and JIPs. POSH (plenty of SH3s) is a multidomain GTP-Rac1-interacting protein that binds and promotes activation of mixed lineage kinases. JIPs are reported to bind MAP kinase kinases 4/7 and JNKs. We find that POSH and JIPs directly associate with one another to form a multiprotein complex, PJAC (POSH-JIP apoptotic complex), that includes all of the known kinase components of the pathway. Our observations indicate that this complex is required for JNK activation and cell death in response to apoptotic stimuli.

  15. A non-apoptotic role for BAX and BAK in eicosanoid metabolism

    Science.gov (United States)

    Zhang, Tejia; Walensky, Loren D.; Saghatelian, Alan

    2015-01-01

    BCL-2 proteins are key regulators of programmed cell death. The interplay between pro- and anti-apoptotic BCL-2 members has important roles in many cancers. In addition to their apoptotic function, recent evidence supports key non-apoptotic roles for several BCL-2 proteins. We used an unbiased lipidomics strategy to reveal that the pro-apoptotic proteins BAX, and to a lesser extent BAK, regulate the cellular inflammatory response by mediating COX-2 expression and prostaglandin biosynthesis. COX-2 upregulation in response to the bacterial endotoxin lipopolysaccharide is blunted in the absence of BAX, and Bax−/− mouse embryonic fibroblasts display altered kinetics of NFκB and MAPK signaling following endotoxin treatment. Our approach uncovers a novel, non-apoptotic function for BAX in regulation of the cellular inflammatory response and suggests that inflammation and apoptosis are more tightly connected than previously anticipated. PMID:25815636

  16. Farming-up coastal fish assemblages through a massive aquaculture escape event.

    Science.gov (United States)

    Toledo-Guedes, Kilian; Sanchez-Jerez, Pablo; Benjumea, María E; Brito, Alberto

    2014-07-01

    We investigated the changes on the mean trophic level of fish assemblages across different spatiotemporal scales, before and after a massive escape event occurred off La Palma (Canary Islands), which resulted in the release of 1.5 million fish (mostly Dicentrarchus labrax) into the wild. The presence of escaped fish altered significantly the mean trophic level of fish assemblages in shallow coastal waters. This alteration was exacerbated by the massive escape. A nearby marine protected area buffered the changes in mean trophic level but exhibited the same temporal patterns as highly fished areas. Moreover, escaped fish exploited natural resources according to their total length and possibly, time since escapement. New concerns arise as a "farming up" process is detected in shallow coastal fish assemblages where marine aquaculture is established.

  17. Apoptotic Capacity and Risk of Squamous Cell Carcinoma of the Head and Neck

    Science.gov (United States)

    Liu, Zhensheng; Liu, Hongliang; Han, Peng; Gao, Fengqin; Dahlstrom, Kristina R.; Li, Guojun; Owzar, Kouros; Zevallos, Jose P.; Sturgis, Erich M.; Wei, Qingyi

    2017-01-01

    Background Tobacco smoke and alcohol drinking are the major risk factors for squamous cell carcinoma of the head and neck (SCCHN). Smoking and drinking cause DNA damage leading to apoptosis, and insufficient apoptotic capacity may favor development of cancer because of the dysfunction of removing damaged cells. In the present study, we investigated the association between camptothecin (CPT)-induced apoptotic capacity and risk of SCCHN in a North American population. Methods In a case-control study of 708 SCCHN patients and 685 matched cancer-free controls, we measured apoptotic capacity in cultured peripheral blood lymphocytes (PBLs) in response to in vitro exposure to CPT by using the flow cytometry-based method. Results We found that the mean level of apoptotic capacity in the cases (45.9±23.3%) was significantly lower than that in the controls (49.0±23.1%) (P = 0.002). When we used the median level of apoptotic capacity in the controls as the cutoff value for calculating adjusted odds ratios (ORs), subjects with a reduced apoptotic capacity had an increased risk (adjusted OR = 1.42, 95% confidence interval [CI] = 1.13–1.78, P = 0.002), especially for those who were age ≥57 (1.73, 1.25–2.38, 0.0009), men (1.76, 1.36–2.27, < 0.0001) and ever drinkers (1.67, 1.27–2.21, 0.0003), and these variables significantly interacted with apoptotic capacity (Pinteraction = 0.015, 0.005 and 0.009, respectively). A further fitted prediction model suggested that the inclusion of apoptotic capacity significantly improved in the prediction of SCCHN risk. Conclusion Individuals with a reduced CPT-induced apoptotic capacity may be at an increased risk of developing SCCHN, and apoptotic capacity may be a biomarker for susceptibility to SCCHN. PMID:28033527

  18. DR-induced escape of O and C from early Mars

    Science.gov (United States)

    Zhao, Jinjin; Tian, Feng; Ni, Yufang; Huang, Xiaomeng

    2017-03-01

    Energetic particles produced in Dissociative recombination (DR) reactions could escape planets with low gravity, such as Mars, if they could overcome collisions with the surrounding background gases. In this work, a 3-D Monte Carlo model is developed to study these photochemical escape processes on early Mars. Although the DR reaction rates of O2+, CO2+, and CO+ increase monotonically with solar soft X-ray and extreme ultraviolet (XUV) flux, the peak of the calculated DR-induced escape rates of O is near 3 × XUV, and the DR-induced escape rates of C increase with XUV until 10 × XUV. The non-monotonic behavior can be explained by the increased column densities of background species in high XUV conditions, which can deflect energetic particles through collisions more efficiently. At 20 × XUV, CO+ DR is the main source of escaping O and C, and the escape of secondary particles could contribute to 30∼40% and 10% of the total escape of O and C respectively. The time-integrated DR-induced escape of O and C is equivalent to 1 m of H2O and 20 mbar of CO2 escaping early Mars since 4.5 billion years ago. The accumulated CO2 loss is much lower than what's needed to explain the carbon isotopic ratios on Mars and much lower than the total CO2 needed to warm up early Mars. If more vigorous escape mechanisms were absent on early Mars, substantial inventories of volatiles have not been detected yet.

  19. Photochemical escape of oxygen from the Martian atmosphere: new insights from MAVEN

    Science.gov (United States)

    Lillis, R. J.; Deighan, J.; Bougher, S. W.; Cravens, T.; Fox, J. L.; Lee, Y.; Rahmati, A.; McFadden, J. P.; Benna, M.; Mahaffy, P. R.; Elrod, M. K.; Andersson, L.; Fowler, C. M.; Curry, S.; Gröller, H.; Jakosky, B. M.

    2015-12-01

    One of the primary goals of the MAVEN mission is to characterize rates of atmospheric escape from Mars at the present epoch and relate those escape rates to solar drivers. One of the known escape processes is photochemical escape, where a) an exothermic chemical reaction in the atmosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through any subsequent collisions. Because escaping hot atoms are not directly measured, models of production and transport (through the atmosphere) of such atoms must be used to constrain photochemical escape rates. These models require altitude profiles of neutral densities and electron and ion densities and temperatures, as well as compositional information, all of which are measured by MAVEN instruments at the relevant altitudes (150-300 km). For every altitude profile: Profiles of O2+ dissociative recombination (DR) rates will be calculated from electron temperature, electron density and O2+ density. Profiles of energy distributions of hot O atoms will be calculated from profiles of electron and ion temperatures. Profiles of all neutral densities will be input into models of hot O transport in order to calculate photochemical escape fluxes from DR of O2+. We will present photochemical escape fluxes as a function of several factors, in particular solar zenith angle and EUV flux. This, combined with further simulations with progressively higher EUV fluxes, will eventually enable a total integrated loss estimate over the course of Martian history and hence a determination of the impact of this loss process on the evolution of the Martian climate.

  20. Enzyme kinetics of conjugating enzymes: PAPS sulfotransferase.

    Science.gov (United States)

    James, Margaret O

    2014-01-01

    The sulfotransferase (SULT) enzymes catalyze the formation of sulfate esters or sulfamates from substrates that contain hydroxy or amine groups, utilizing 3'-phosphoadenosyl-5'-phosphosulfate (PAPS) as the donor of the sulfonic group. The rate of product formation depends on the concentrations of PAPS and substrate as well as the sulfotransferase enzyme; thus, if PAPS is held constant while varying substrate concentration (or vice versa), the kinetic constants derived are apparent constants. When studied over a narrow range of substrate concentrations, classic Michaelis-Menten kinetics can be observed with many SULT enzymes and most substrates. Some SULT enzymes exhibit positive or negative cooperativity during conversion of substrate to product, and the kinetics fit the Hill plot. A characteristic feature of most sulfotransferase-catalyzed reactions is that, when studied over a wide range of substrate concentrations, the rate of product formation initially increases as substrate concentration increases, then decreases at high substrate concentrations, i.e., they exhibit substrate inhibition or partial substrate inhibition. This chapter gives an introduction to sulfotransferases, including a historical note, the nomenclature, a description of the function of SULTs with different types of substrates, presentation of examples of enzyme kinetics with SULTs, and a discussion of what is known about mechanisms of substrate inhibition in the sulfotransferases.

  1. Apoptotic effect of noscapine in breast cancer cell lines.

    Science.gov (United States)

    Quisbert-Valenzuela, Edwin O; Calaf, Gloria M

    2016-06-01

    Cancer is a public health problem in the world and breast cancer is the most frequently cancer in women. Approximately 15% of the breast cancers are triple-negative. Apoptosis regulates normal growth, homeostasis, development, embryogenesis and appropriate strategy to treat cancer. Bax is a protein pro-apoptotic enhancer of apoptosis in contrast to Bcl-2 with antiapoptotic properties. Initiator caspase-9 and caspase-8 are features of intrinsic and extrinsic apoptosis pathway, respectively. NF-κB is a transcription factor known to be involved in the initiation and progression of breast cancer. Noscapine, an alkaloid derived from opium is used as antitussive and showed antitumor properties that induced apoptosis in cancer cell lines. The aim of the present study was to determine the apoptotic effect of noscapine in breast cancer cell lines compared to breast normal cell line. Three cell lines were used: i) a control breast cell line MCF-10F; ii) a luminal-like adenocarcinoma triple-positive breast cell line MCF-7; iii) breast cancer triple-negative cell line MDA-MB-231. Our results showed that noscapine had lower toxicity in normal cells and was an effective anticancer agent that induced apoptosis in breast cancer cells because it increases Bax gene and protein expression in three cell lines, while decreases Bcl-xL gene expression, and Bcl-2 protein expression decreased in breast cancer cell lines. Therefore, Bax/Bcl-2 ratio increased in the three cell lines. This drug increased caspase-9 gene expression in breast cancer cell lines and caspase-8 gene expression increased in MCF-10F and MDA-MB-231. Furthermore, it increased cleavage of caspase-8, suggesting that noscapine-induced apoptosis is probably due to the involvement of extrinsic and intrinsic apoptosis pathways. Antiapoptotic gene and protein expression diminished and proapoptotic gene and protein expression increased noscapine-induced expression, probably due to decrease in NF-κB gene and protein expression

  2. Complex Economies Have a Lateral Escape from the Poverty Trap

    Science.gov (United States)

    Pugliese, Emanuele; Chiarotti, Guido L.; Zaccaria, Andrea; Pietronero, Luciano

    2017-01-01

    We analyze the decisive role played by the complexity of economic systems at the onset of the industrialization process of countries over the past 50 years. Our analysis of the input growth dynamics, considering a further dimension through a recently introduced measure of economic complexity, reveals that more differentiated and more complex economies face a lower barrier (in terms of GDP per capita) when starting the transition towards industrialization. As a consequence, we can extend the classical concept of a one-dimensional poverty trap, by introducing a two-dimensional poverty trap: a country will start the industrialization process if it is rich enough (as in neo-classical economic theories), complex enough (using this new dimension and laterally escaping from the poverty trap), or a linear combination of the two. This naturally leads to the proposal of a Complex Index of Relative Development (CIRD) which shows, when analyzed as a function of the growth due to input, a shape of an upside down parabola similar to that expected from the standard economic theories when considering only the GDP per capita dimension. PMID:28072867

  3. Modified guidance laws to escape microbursts with turbulence

    Directory of Open Access Journals (Sweden)

    Atilla Dogan

    2002-01-01

    Full Text Available This paper introduces Modified Altitude- and Dive-Guidance laws for escaping a microburst with turbulence. The goal is to develop a procedure to estimate the highest altitude at which an aircraft can fly through a microburst without running into stall. First, a new metric is constructed that quantifies the aircraft upward force capability in a microburst encounter. In the absence of turbulence, the metric is shown to be a decreasing function of altitude. This suggests that descending to a low altitude may improve safety in the sense that the aircraft will have more upward force capability to maintain its altitude. In the presence of stochastic turbulence, the metric is treated as a random variable and its probability distribution function is analytically approximated as a function of altitude. This approximation allows us to determine the highest safe altitude at which the aircraft may descend, hence avoiding to descend too low. This highest safe altitude is used as the commanded altitude in Modified Altitude- and Dive-Guidance. Monte Carlo simulations show that these Modified Altitude- and Dive-Guidance strategies can decrease the probability of minimum altitude being lower than a given value without significantly increasing the probability of crash.

  4. Escape of the martian protoatmosphere and initial water inventory

    CERN Document Server

    Erkaev, N V; Elkins-Tanton, L; Stökl, A; Odert, P; Marcq, E; Dorfi, E A; Kislyakova, K G; Kulikov, Yu N; Leitzinger, M; Güdel, M

    2013-01-01

    Latest research in planet formation indicate that Mars formed within a few million years (Myr) and remained a planetary embryo that never grew to a more massive planet. It can also be expected from dynamical models, that most of Mars' building blocks consisted of material that formed in orbital locations just beyond the ice line which could have contained ~0.1-0.2 wt. % of H2O. By using these constraints, we estimate the nebula-captured and catastrophically outgassed volatile contents during the solidification of Mars' magma ocean and apply a hydrodynamic upper atmosphere model for the study of the soft X-ray and extreme ultraviolet (XUV) driven thermal escape of the martian protoatmosphere during the early active epoch of the young Sun. The amount of gas that has been captured from the protoplanetary disk into the planetary atmosphere is calculated by solving the hydrostatic structure equations in the protoplanetary nebula. Depending on nebular properties such as the dust grain depletion factor, planetesimal...

  5. Dynamical correlations in the escape strategy of Influenza A virus

    Science.gov (United States)

    Taggi, L.; Colaiori, F.; Loreto, V.; Tria, F.

    2013-03-01

    The evolutionary dynamics of human Influenza A virus presents a challenging theoretical problem. An extremely high mutation rate allows the virus to escape, at each epidemic season, the host immune protection elicited by previous infections. At the same time, at each given epidemic season a single quasi-species, that is a set of closely related strains, is observed. A non-trivial relation between the genetic (i.e., at the sequence level) and the antigenic (i.e., related to the host immune response) distances can shed light into this puzzle. In this paper we introduce a model in which, in accordance with experimental observations, a simple interaction rule based on spatial correlations among point mutations dynamically defines an immunity space in the space of sequences. We investigate the static and dynamic structure of this space and we discuss how it affects the dynamics of the virus-host interaction. Interestingly we observe a staggered time structure in the virus evolution as in the real Influenza evolutionary dynamics.

  6. Breakdown of the escape dynamics in Josephson junctions

    Science.gov (United States)

    Massarotti, D.; Stornaiuolo, D.; Lucignano, P.; Galletti, L.; Born, D.; Rotoli, G.; Lombardi, F.; Longobardi, L.; Tagliacozzo, A.; Tafuri, F.

    2015-08-01

    We have identified anomalous behavior of the escape rate out of the zero-voltage state in Josephson junctions with a high critical current density Jc. For this study we have employed YBa2Cu3O7 -x grain boundary junctions, which span a wide range of Jc and have appropriate electrodynamical parameters. Such high Jc junctions, when hysteretic, do not switch from the superconducting to the normal state following the expected stochastic Josephson distribution, despite having standard Josephson properties such as a Fraunhofer magnetic field pattern. The switching current distributions (SCDs) are consistent with nonequilibrium dynamics taking place on a local rather than a global scale. This means that macroscopic quantum phenomena seem to be practically unattainable for high Jc junctions. We argue that SCDs are an accurate means to measure nonequilibrium effects. This transition from global to local dynamics is of relevance for all kinds of weak links, including the emergent family of nanohybrid Josephson junctions. Therefore caution should be applied in the use of such junctions in, for instance, the search for Majorana fermions.

  7. Enzymes for improved biomass conversion

    Science.gov (United States)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  8. Unhairing with enzymes

    OpenAIRE

    Crispim, A.; Mota, M.

    2003-01-01

    The use of enzymes in the leather industry is increasing and their application is being widened to include operations such as de-greasing, unhairing and other wet-end operations. Enzymes can also be used to assist with recycling leather wastes as well as to avoid pollution. The present work is devoted to illustrate the potential application of enzymes in unhairing without hair destruction. Enzymatic unhairing is based upon the weakening of the epidermis basal layer to which the hair is at...

  9. Suppression of interleukin-33 bioactivity through proteolysis by apoptotic caspases.

    Science.gov (United States)

    Lüthi, Alexander U; Cullen, Sean P; McNeela, Edel A; Duriez, Patrick J; Afonina, Inna S; Sheridan, Clare; Brumatti, Gabriela; Taylor, Rebecca C; Kersse, Kristof; Vandenabeele, Peter; Lavelle, Ed C; Martin, Seamus J

    2009-07-17

    Interleukin-33 (IL-33) is a member of the IL-1 family and is involved in polarization of T cells toward a T helper 2 (Th2) cell phenotype. IL-33 is thought to be activated via caspase-1-dependent proteolysis, similar to the proinflammatory cytokines IL-1 beta and IL-18, but this remains unproven. Here we showed that IL-33 was processed by caspases activated during apoptosis (caspase-3 and -7) but was not a physiological substrate for caspases associated with inflammation (caspase-1, -4, and -5). Furthermore, caspase-dependent processing of IL-33 was not required for ST2 receptor binding or ST2-dependent activation of the NF-kappaB transcription factor. Indeed, caspase-dependent proteolysis of IL-33 dramatically attenuated IL-33 bioactivity in vitro and in vivo. These data suggest that IL-33 does not require proteolysis for activation, but rather, that IL-33 bioactivity is diminished through caspase-dependent proteolysis within apoptotic cells. Thus, caspase-mediated proteolysis acts as a switch to dampen the proinflammatory properties of IL-33.

  10. Genotoxic and apoptotic effects of Goeckerman therapy for psoriasis

    Energy Technology Data Exchange (ETDEWEB)

    Borska, L.; Andrys, C.; Krejsek, J.; Hamakova, K.; Kremlacek, J.; Palicka, V.; Ranna, D.; Fiala, Z. [Charles University Prague, Prague (Czech Republic). Faculty of Medicine

    2010-03-15

    Goeckerman therapy (GT) for psoriasis is based on cutaneous application of crude coal tar (polycyclic aromatic hydrocarbons (PAH)) and exposure to ultraviolet radiation (UVR). PAH and UVR are mutagenic, carcinogenic and immunotoxic agents that promote apoptosis. We evaluated dermal absorption of PAH as well as the genotoxic and apoptotic effects of GT in 20 patients with psoriasis, by determining numbers of chromosomal abnormalities in peripheral lymphocytes, and levels of 1-hydroxypyrene (1-OHP), p53 protein and soluble FasL (sFasL) in urine and/or blood, before and after GT. Psoriasis Area and Severity Index (PASI) score was used to evaluate clinical efficacy of GT. Compared with pre-treatment levels, there was a significant increase in urine 1-OHP, indicating a high degree of dermal absorption of PAH (P <0.01). We also found a significant increase in the number of chromosomal abnormalities in peripheral blood lymphocytes (P <0.001), suggesting that GT is genotoxic; significantly increased p53 protein in plasma (P <0.05), an indicator of cell response to DNA damage; and significantly increased sFasL in serum (P <0.01), an indicator of apoptosis. The PASI score was significantly decreased after GT (P <0.001), confirming clinical benefit of this treatment. Our results demonstrate high dermal absorption of PAH during GT and provide evidence that GT promotes genotoxicity and apoptosis.

  11. Genes of the mitochondrial apoptotic pathway in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Noelia Estévez-Calvar

    Full Text Available Bivalves play vital roles in marine, brackish, freshwater and terrestrial habitats. In recent years, these ecosystems have become affected through anthropogenic activities. The ecological success of marine bivalves is based on the ability to modify their physiological functions in response to environmental changes. One of the most important mechanisms involved in adaptive responses to environmental and biological stresses is apoptosis, which has been scarcely studied in mollusks, although the final consequence of this process, DNA fragmentation, has been frequently used for pollution monitoring. Environmental stressors induce apoptosis in molluscan cells via an intrinsic pathway. Many of the proteins involved in vertebrate apoptosis have been recognized in model invertebrates; however, this process might not be universally conserved. Mytilus galloprovincialis is presented here as a new model to study the linkage between molecular mechanisms that mediate apoptosis and marine bivalve ecological adaptations. Therefore, it is strictly necessary to identify the key elements involved in bivalve apoptosis. In the present study, six mitochondrial apoptotic-related genes were characterized, and their gene expression profiles following UV irradiation were evaluated. This is the first step for the development of potential biomarkers to assess the biological responses of marine organisms to stress. The results confirmed that apoptosis and, more specifically, the expression of the genes involved in this process can be used to assess the biological responses of marine organisms to stress.

  12. Apoptotic pathway induced by noscapine in human myelogenous leukemic cells.

    Science.gov (United States)

    Heidari, Nastaran; Goliaei, Bahram; Moghaddam, Parvaneh Rahimi; Rahbar-Roshandel, Nahid; Mahmoudian, Massoud

    2007-11-01

    It has been shown that noscapine, an opium-derived phthalideisoquinoline alkaloid that is currently being used as an oral antitussive drug, induces apoptosis in myeloid leukemia cells. The molecular mechanism responsible for the anticancer effects of noscapine is poorly understood. In the current study, the apoptotic effects of noscapine on two myeloid cell lines, apoptosis-proficient HL60 cells and apoptosis-resistant K562 cells, were analyzed. An increase in the activity of caspase-2, -3, -6, -8 and -9, poly(ADP ribose) polymerase cleavage, detection of phosphatidylserine on the outer layer of the cell membrane, nucleation of chromatin, and DNA fragmentation suggested the induction of apoptosis. Noscapine increased the Bax/Bcl-2 ratio with a significant decrease of Bcl-2 expression accompanied with Bcl-2 phosphorylation. Using an inhibitory approach, the activation of the caspase cascade involved in the noscapine-induced apoptosis was analyzed. We observed no inhibitory effect of the caspase-8 inhibitor on caspase-9 activity. In view of these results and taking into consideration that K562 cells are Fas-null, we suggested that caspase-8 is activated in a Fas-independent manner downstream of caspase-9. In conclusion, noscapine can induce apoptosis in both apoptosis-proficient and apoptosis-resistant leukemic cells, and it can be a novel candidate in the treatment of hematological malignancies.

  13. An overview of caspase: Apoptotic protein for silicosis

    Directory of Open Access Journals (Sweden)

    Tumane Rajani

    2010-01-01

    Full Text Available Silicosis is a chronic lung disease characterized by granulomatous and fibrotic lesions, which occurs due to accumulation of respirable silica mineral particles. Apoptosis is an important phenomenon of cell death in silicosis. The relationship between silica dust and its exposure is well established. But, the complex chain of cellular responses, which leads to caspase activation in silicosis, has not been fully discovered. Caspase activation plays a central role in the execution of apoptosis. Silica-induced apoptosis of the alveolar macrophages could potentially favor a proinflammatory state, occurring in the lungs of silicotic patients, resulting in the activation of caspase prior to induction of the intrinsic and extrinsic apoptosis pathways. Recent studies indicated that apoptosis may involve in pulmonary disorders. This review summarizes the current knowledge about the underling mechanism of biochemical pathways in caspase activation that have been ignored so far in silicosis. In addition, caspase could be a key apoptotic protein that can be used as an effective biomarker for the study of occupational diseases. It may provide an important link in understanding the molecular mechanisms of silica-induced lung pathogenesis.

  14. Thyroid hormone regulation of apoptotic tissue remodeling during anuran metamorphosis

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Anuran metamorphosis involves systematic transformations of individual organs in a thyroid hormone (TH)-dependent manner. Morphological and cellular studies have shown that the removal of larval or gans/tissues such the tail and the tadpole intestinal epithelium is through programmed cell death or apop tosis. Recent molecular investigations suggest that TH regulates metamorphosis by regulating target gene expression through thyroid hormone receptors (TRs), which are DNA-binding transcription factors. Cloning and characterization of TH response genes show that diverse groups of early response genes are induced by TH. The products of these TH response genes are believed to directly or indirectly affect the expression and/or functions of cell death genes, which are conserved at both sequence and function levels in different animal species. A major challenge for future research lies at determining the signaling pathways leading to the activation of apoptotic processes and whether different death genes are involved in the regulation of apoptosis in different tissues/organs to effect tissue-specific transformations.

  15. Microbial amylolytic enzymes.

    Science.gov (United States)

    Vihinen, M; Mäntsälä, P

    1989-01-01

    Starch-degrading, amylolytic enzymes are widely distributed among microbes. Several activities are required to hydrolyze starch to its glucose units. These enzymes include alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase, pullulan-degrading enzymes, exoacting enzymes yielding alpha-type endproducts, and cyclodextrin glycosyltransferase. Properties of these enzymes vary and are somewhat linked to the environmental circumstances of the producing organisms. Features of the enzymes, their action patterns, physicochemical properties, occurrence, genetics, and results obtained from cloning of the genes are described. Among all the amylolytic enzymes, the genetics of alpha-amylase in Bacillus subtilis are best known. Alpha-Amylase production in B. subtilis is regulated by several genetic elements, many of which have synergistic effects. Genes encoding enzymes from all the amylolytic enzyme groups dealt with here have been cloned, and the sequences have been found to contain some highly conserved regions thought to be essential for their action and/or structure. Glucoamylase appears usually in several forms, which seem to be the results of a variety of mechanisms, including heterogeneous glycosylation, limited proteolysis, multiple modes of mRNA splicing, and the presence of several structural genes.

  16. Adenylate-forming enzymes

    Science.gov (United States)

    Schmelz, Stefan; Naismith, James H.

    2012-01-01

    Thioesters, amides and esters are common chemical building blocks in a wide array of natural products. The formation of these bonds can be catalyzed in a variety of ways. For chemists, the use of an activating group is a common strategy and adenylate enzymes are exemplars of this approach. Adenylating enzymes activate the otherwise unreactive carboxylic acid by transforming the normal hydroxyl leaving group into adenosine monophosphate. Recently there have been a number of studies of such enzymes and in this review we suggest a new classification scheme. The review highlights the diversity in enzyme fold, active site architecture and metal coordination that has evolved to catalyze this particular reaction. PMID:19836944

  17. Review of One Illness Away: Why People Become Poor and How They Escape Poverty

    OpenAIRE

    Afia B. Yamoah

    2011-01-01

    Afia B. Yamoah reviews One Illness Away: Why People Become Poor and How They Escape Poverty, by Anirudh Krishna. Krishna argues that poverty policy needs to address reasons why people become poor and how they can escape poverty.

  18. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis

    DEFF Research Database (Denmark)

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia;

    2015-01-01

    apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing...

  19. Extracellular Matrix Proteins Modulate Antimigratory and Apoptotic Effects of Doxorubicin

    Directory of Open Access Journals (Sweden)

    Georges Said

    2012-01-01

    Full Text Available Anticancer drug resistance is a multifactorial process that includes acquired and de novo drug resistances. Acquired resistance develops during treatment, while de novo resistance is the primary way for tumor cells to escape chemotherapy. Tumor microenvironment has been recently shown to be one of the important factors contributing to de novo resistance and called environment-mediated drug resistance (EMDR. Two forms of EMDR have been described: soluble factor-mediated drug resistance (SFM-DR and cell adhesion-mediated drug resistance (CAM-DR. Anthracyclines, among the most potent chemotherapeutic agents, are widely used in clinics against hematopoietic and solid tumors. Their main mechanism of action relies on the inhibition of topoisomerase I and/or II and the induction of apoptosis. Beyond this well-known antitumor activity, it has been recently demonstrated that anthracyclines may display potent anti-invasive effects when used at subtoxic concentrations. In this paper, we will describe two particular modes of EMDR by which microenvironment may influence tumor-cell response to one of these anthracyclines, doxorubicin. The first one considers the influence of type I collagen on the antimigratory effect of doxorubicin (CAM-DR. The second considers the protection of tumor cells by thrombospondin-I against doxorubicin-induced apoptosis (SFM-DR.

  20. ARK, the Apaf-1 related killer in Drosophila, requires diverse domains for its apoptotic activity.

    Science.gov (United States)

    Srivastava, M; Scherr, H; Lackey, M; Xu, D; Chen, Z; Lu, J; Bergmann, A

    2007-01-01

    In mammals and Drosophila, apoptotic caspases are under positive control of the CED-4-like proteins Apaf-1 and ARK, respectively. In an EMS-mutagenesis screen, we isolated 33 ark mutants as recessive suppressors of hid-induced apoptosis. The ark mutants are loss-of-function alleles characterized by reduced developmental apoptosis. Using the phenotypic series of these alleles, we identified helical domain I in the nucleotide oligomerization domain as critical for ARK's apoptotic activity. Interestingly, the WD40 region may also have an unanticipated positive requirement for the apoptotic activity of ARK. Considering structural information, we discuss the roles of these domains for assembly and activity of the ARK apoptosome, and propose that the WD40 region is anti-apoptotic in the absence of apoptotic signals, and pro-apoptotic in the presence of such signals. Furthermore, a defined null allele reveals that ark is required for most, but not all apoptosis suggesting the existence of an ARK-independent apoptotic pathway.

  1. Reporter assay for endo/lysosomal escape of toxin-based therapeutics.

    Science.gov (United States)

    Gilabert-Oriol, Roger; Thakur, Mayank; von Mallinckrodt, Benedicta; Bhargava, Cheenu; Wiesner, Burkhard; Eichhorst, Jenny; Melzig, Matthias F; Fuchs, Hendrik; Weng, Alexander

    2014-05-22

    Protein-based therapeutics with cytosolic targets are capable of exhibiting their therapeutic effect once they have escaped from the endosomes or lysosomes. In this study, the reporters-horseradish peroxidase (HRP), Alexa Fluor 488 (Alexa) and ricin A-chain (RTA)-were investigated for their capacity to monitor the endo/lysosomal escape of the ribosome-inactivating protein, saporin. The conjugates-saporin-HRP, (Alexa)saporin and saporin-KQ-RTA-were constructed, and the endo/lysosomal escape of these conjugates alone (lack of endo/lysosomal release) or in combination with certain structurally-specific triterpenoidal saponins (efficient endo/lysosomal escape) was characterized. HRP failed in reporting the endo/lysosomal escape of saporin. Contrastingly, Alexa Fluor 488 successfully allowed the report of the process at a toxin concentration of 1000 nM. In addition, single endo/lysosome analysis facilitated the determination of the amount of (Alexa)saporin released from each vesicle. RTA was also successful in reporting the endo/lysosomal escape of the enzymatically inactive mutant, saporin-KQ, but in this case, the sensitivity of the method reached a toxin concentration of 10 nM. In conclusion, the simultaneous usage of Alexa Fluor 488 and RTA as reporters may provide the possibility of monitoring the endo/lysosomal escape of protein-based therapeutics in the concentration range of 10-1000 nM.

  2. Failure of rats to escape from a potentially lethal microwave field

    Energy Technology Data Exchange (ETDEWEB)

    Carroll, D.R.; Levinson, D.M.; Justesen, D.R.; Clarke, R.L.

    1980-01-01

    Ocularly pigmented rats, all mature females of the Long-Evans strain, were repeatedly presented an opportunity to escape from an intense 918-MHz field (whole-body dose rate . 60 mW/g) to a field of lower intensity (40, 30, 20, or 2 mW/g) by performing a simple locomotor response. Other rats could escape 800-microamperemeter faradic shock to the feet and tail by performing the same response in the same milieu, a multimode cavity. None of 20 irradiated rats learned to associate entry into a visually well-demarcated area of the cavity with immediate reduction of dose rate, in spite of field-induced elevations of body temperature to levels that exceeded 41 degrees C and would have been lethal but for a limit on durations of irradiation. In contrast, all of ten rats motivated by faradic shock rapidly learned to escape. The failure of escape learning by irradiated animals probably arose from deficiencies of motivation and, especially, sensory feedback. Whole-body hyperthermia induced by a multipath field may lack the painful or directional sensory properties that optimally promote the motive to escape. Moreover, a decline of body temperature after an escape-response-contingent reduction of field strength will be relatively slow because of the large thermal time constants of mammalian tissues. Without timely sensory feedback, which is an essential element of negative reinforcement, stimulus-response associability would be imparied, which could retard or preclude learning of an escape response.

  3. H Escape Rates Inferred from MAVEN/IUVS Observations of the Mars Hydrogen Corona

    Science.gov (United States)

    Chaffin, Michael S.; Chaufray, Jean-Yves; Deighan, Justin; Schneider, Nicholas M.; McClintock, William; Stewart, A. Ian F.; Thiemann, E. M.; Clarke, John T.; Holsclaw, Gregory; Jain, Sonal Kumar; Crismani, Matteo; Stiepen, Arnaud; Montmessin, Franck; Eparvier, Francis; Jakosky, Bruce

    2016-10-01

    H escape oxidizes and dessicates the Mars atmosphere and surface, providing a key control on the present-day chemistry and long-term evolution of the planet. Recently, large variations in the escape rate of H as a function of season have been reported by several studies, making continued observation of the variation a high priority. We present escape rates derived from Mars Atmosphere and Volatile EvolutioN (MAVEN) mission Imaging UltraViolet Spectrograph (IUVS) observations of the extended atmosphere of Mars at H Lyman alpha (121.6 nm), which must be interpreted with a coupled density/radiative transfer model owing to the optically thick nature of the emission and the small fraction of H present in the corona on escaping trajectories. We recover densities, temperatures, and escape rates under the assumption of spherical symmetry for multiple periods across MAVEN's mission so far, beginning in December 2014 (escape rates ~4e8/cm2/s). We describe the observed variation and compare it with previously observed seasonal variation in retrieved H escape rates, providing a necessary input for future photochemical modeling studies and estimates of water loss from Mars over its history.

  4. Reporter Assay for Endo/Lysosomal Escape of Toxin-Based Therapeutics

    Directory of Open Access Journals (Sweden)

    Roger Gilabert-Oriol

    2014-05-01

    Full Text Available Protein-based therapeutics with cytosolic targets are capable of exhibiting their therapeutic effect once they have escaped from the endosomes or lysosomes. In this study, the reporters—horseradish peroxidase (HRP, Alexa Fluor 488 (Alexa and ricin A-chain (RTA—were investigated for their capacity to monitor the endo/lysosomal escape of the ribosome-inactivating protein, saporin. The conjugates—saporin-HRP, Alexasaporin and saporin-KQ-RTA—were constructed, and the endo/lysosomal escape of these conjugates alone (lack of endo/lysosomal release or in combination with certain structurally-specific triterpenoidal saponins (efficient endo/lysosomal escape was characterized. HRP failed in reporting the endo/lysosomal escape of saporin. Contrastingly, Alexa Fluor 488 successfully allowed the report of the process at a toxin concentration of 1000 nM. In addition, single endo/lysosome analysis facilitated the determination of the amount of Alexasaporin released from each vesicle. RTA was also successful in reporting the endo/lysosomal escape of the enzymatically inactive mutant, saporin-KQ, but in this case, the sensitivity of the method reached a toxin concentration of 10 nM. In conclusion, the simultaneous usage of Alexa Fluor 488 and RTA as reporters may provide the possibility of monitoring the endo/lysosomal escape of protein-based therapeutics in the concentration range of 10–1000 nM.

  5. Do malaria parasites manipulate the escape behaviour of their avian hosts? An experimental study.

    Science.gov (United States)

    Garcia-Longoria, Luz; Møller, Anders P; Balbontín, Javier; de Lope, Florentino; Marzal, Alfonso

    2015-12-01

    Escape behaviour is the behaviour that birds and other animals display when already caught by a predator. An individual exhibiting higher intensity of such anti-predator behaviour could have greater probabilities of escape from predators. Parasites are known to affect different aspects of host behaviour to increase their own fitness. Vector-transmitted parasites such as malaria parasites should gain by manipulating their hosts to enhance the probability of transmission. Several studies have shown that malaria parasites can manipulate their vectors leading to increased transmission success. However, little is known about whether malaria parasites can manipulate escape behaviour of their avian hosts thereby increasing the spread of the parasite. Here we used an experimental approach to explore if Plasmodium relictum can manipulate the escape behaviour of one of its most common avian hosts, the house sparrow Passer domesticus. We experimentally tested whether malaria parasites manipulate the escape behaviour of their avian host. We showed a decrease in the intensity of biting and tonic immobility after removal of infection with anti-malaria medication compared to pre-experimental behaviour. These outcomes suggest that infected sparrows performed more intense escape behaviour, which would increase the likelihood of individuals escaping from predators, but also benefit the parasite by increasing its transmission opportunities.

  6. APOPTOTIC, HEPATOPROTECTIVE AND ANTIOXIDANT POTENTIAL OF A TRIHERBAL FORMULATION AGAINST D-GALACTOSAMINE HEPATOTOXICITY

    Directory of Open Access Journals (Sweden)

    Onyekachi Ogbonnaya IROANYA

    2016-12-01

    Full Text Available A triherbal formulation prepared from hydroethanolic mixture of Gongronema latifolia, Ocimum gratissimum and Vernonia amygdalina leaves (GOV was evaluated to ascertain its heamatologic, hepatoprotective potentials, antioxidant properties and the fold increase in caspase 2, 3 and 9 activities against D-galactosamine-induced toxicity using Wistar albino rats. Forty-nine Wistar albino rats were divided equally into seven groups. Two control experiments which included normal rats treated with D-galactosamine and normal rats that received only distilled water. Three groups were treated with different doses of GOV extract (2, 4 and 8 g kg-1 b. wt while two groups received standard hepatoprotective drugs (Liv 52 and Silymarin for 13 days prior to intoxication with D-galactosamine. The activities of serum liver enzymes, concentrations of some biochemical analytes, effect on heamatologic parameters, antioxidant status and fold increase in caspase 2, 3 and 9 activities were monitored. HPTLC of GOV showed the presence of ascorbic acid, rutin, eugenol and β-sitosterol. Administration of GOV significantly (p<0.05 increased the Packed Cell Volume, Red Cell Count, Haemoglobin, White Blood Cell, platelet count, Mean Cell Haemoglobin, granulocytes and lymphocytes while the Mean Cell Volume and monocytes were significantly (p<0.05 depreciated dose dependently compared to the toxin control group. GOV dose dependently exhibited significant (p<0.05 decrease in levels of Alkaline phosphatase, Alanine aminotransferase, aspartate aminotransferase, L-γ-glutamyltransferase, Lactate dehydrogenase, cholesterol, creatinine, triglycerides, urea and Malondialdehyde. Subsequently, it significantly (p<0.05 increased the albumin, total protein, catalase, Glutathione Peroxidase, Reduced Glutathione, Glutathione-S-Transferase and Superoxide Dismutase levels. GOV significantly (p≤0.05 attenuated the fold increase in caspase 2, 3 and 9 activities compared to the toxin control

  7. Biochemical and biophysical investigations of the interaction between human glucokinase and pro-apoptotic BAD.

    Science.gov (United States)

    Rexford, Alix; Zorio, Diego A R; Miller, Brian G

    2017-01-01

    The glycolytic enzyme glucokinase (GCK) and the pro-apoptotic protein BAD reportedly reside within a five-membered complex that localizes to the mitochondria of mammalian hepatocytes and pancreatic β-cells. Photochemical crosslinking studies using a synthetic analog of BAD's BH3 domain and in vitro transcription/translation experiments support a direct interaction between BAD and GCK. To investigate the biochemical and biophysical consequences of the BAD:GCK interaction, we developed a method for the production of recombinant human BAD. Consistent with published reports, recombinant BAD displays high affinity for Bcl-xL (KD = 7 nM), and phosphorylation of BAD at S118, within the BH3 domain, abolishes this interaction. Unexpectedly, we do not detect association of recombinant, full-length BAD with recombinant human pancreatic GCK over a range of protein concentrations using various biochemical methods including size-exclusion chromatography, chemical cross-linking, analytical ultracentrifugation, and isothermal titration calorimetry. Furthermore, fluorescence polarization assays and isothermal titration calorimetry detect no direct interaction between GCK and BAD BH3 peptides. Kinetic characterization of GCK in the presence of high concentrations of recombinant BAD show modest (BAD BH3 peptides. These results raise questions as to the mechanism of action of stapled peptide analogs modeled after the BAD BH3 domain, which reportedly enhance the Vmax value of GCK and stimulate insulin release in BAD-deficient islets. Based on our results, we postulate that the BAD:GCK interaction, and any resultant regulatory effect(s) upon GCK activity, requires the participation of additional members of the mitochondrial complex.

  8. The Apoptotic Effects of the P300 Activator on Breast Cancer and Lung Fibroblast Cell Lines

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Salahshoor

    2013-10-01

    Full Text Available Background: P300 is an enzyme that acetylates histones during stress. It alsoacetylates several non-histone proteins, including P53 which is the most important tumorsuppressor gene. P53 plays an important role in the apoptosis of tumor cells. Hereby,this study describes the potency of cholera toxin B subunit as a P300 activator to induceapoptosis in a breast cancer cell line (MCF-7 and a lung fibroblast cell line (MRC-5as a non-tumorigenic control sample. Methods: MCF-7 and MRC-5 were cultured in RPMI-1640 and treated with orwithout cholera toxin B subunit at the concentration of 85.43 μmol/L, based on the half-maximal inhibitory concentration index at different times (24, 48 and 72 h. Thepercentage of apoptotic cells was measured by flow cytometry. Real-time quantitativeRT-PCR was performed to estimate the mRNA expression of P300 in MCF-7 and MRC-5 with cholera toxin B subunit at different times. We used the ELISA and Bradford proteintechniques to detect levels of total and acetylated P53 protein generated in MCF-7 andMRC-5. Results: Our findings indicated that the cholera toxin B subunit effectively andsignificantly induced more apoptosis in MCF-7 compared to MRC-5. We showed thatexpression of P300 up-regulated by increasing the time of the cholera toxin B subunittreatment in MCF-7 but not in MRC-5. In addition, the acetylated and total P53protein levels increased more in MCF-7 cells than in MRC-5 cells.Conclusion: Cholera toxin B subunit induced significant cell death in MCF-7, butit could be well tolerated in MRC-5. Therefore, cholera toxin B subunit can besuggested as an anti-cancer agent.

  9. Quantifying the impact of human immunodeficiency virus-1 escape from cytotoxic T-lymphocytes.

    Directory of Open Access Journals (Sweden)

    Ulrich D Kadolsky

    Full Text Available HIV-1 escape from the cytotoxic T-lymphocyte (CTL response leads to a weakening of viral control and is likely to be detrimental to the patient. To date, the impact of escape on viral load and CD4(+ T cell count has not been quantified, primarily because of sparse longitudinal data and the difficulty of separating cause and effect in cross-sectional studies. We use two independent methods to quantify the impact of HIV-1 escape from CTLs in chronic infection: mathematical modelling of escape and statistical analysis of a cross-sectional cohort. Mathematical modelling revealed a modest increase in log viral load of 0.051 copies ml(-1 per escape event. Analysis of the cross-sectional cohort revealed a significant positive association between viral load and the number of "escape events", after correcting for length of infection and rate of replication. We estimate that a single CTL escape event leads to a viral load increase of 0.11 log copies ml(-1 (95% confidence interval: 0.040-0.18, consistent with the predictions from the mathematical modelling. Overall, the number of escape events could only account for approximately 6% of the viral load variation in the cohort. Our findings indicate that although the loss of the CTL response for a single epitope results in a highly statistically significant increase in viral load, the biological impact is modest. We suggest that this small increase in viral load is explained by the small growth advantage of the variant relative to the wildtype virus. Escape from CTLs had a measurable, but unexpectedly low, impact on viral load in chronic infection.

  10. The impact of escaped farmed Atlantic salmon (Salmo salar L. on catch statistics in Scotland.

    Directory of Open Access Journals (Sweden)

    Darren M Green

    Full Text Available In Scotland and elsewhere, there are concerns that escaped farmed Atlantic salmon (Salmo salar L. may impact on wild salmon stocks. Potential detrimental effects could arise through disease spread, competition, or inter-breeding. We investigated whether there is evidence of a direct effect of recorded salmon escape events on wild stocks in Scotland using anglers' counts of caught salmon (classified as wild or farmed and sea trout (Salmo trutta L.. This tests specifically whether documented escape events can be associated with reduced or elevated escapes detected in the catch over a five-year time window, after accounting for overall variation between areas and years. Alternate model frameworks were somewhat inconsistent, however no robust association was found between documented escape events and higher proportion of farm-origin salmon in anglers' catch, nor with overall catch size. A weak positive correlation was found between local escapes and subsequent sea trout catch. This is in the opposite direction to what would be expected if salmon escapes negatively affected wild fish numbers. Our approach specifically investigated documented escape events, contrasting with earlier studies examining potentially wider effects of salmon farming on wild catch size. This approach is more conservative, but alleviates some potential sources of confounding, which are always of concern in observational studies. Successful analysis of anglers' reports of escaped farmed salmon requires high data quality, particularly since reports of farmed salmon are a relatively rare event in the Scottish data. Therefore, as part of our analysis, we reviewed studies of potential sensitivity and specificity of determination of farmed origin. Specificity estimates are generally high in the literature, making an analysis of the form we have performed feasible.

  11. Turning pain into cues for goal-directed behavior : Implementation intentions reduce escape-avoidance behavior on a painful task

    NARCIS (Netherlands)

    Karsdorp, P.A.; Geenen, R.; Kroese, F.M.; Vlaeyen, J.W.S.

    2016-01-01

    Pain automatically elicits escape-avoidance behavior to avert bodily harm. In patients with chronic pain, long-term escape-avoidance behavior may increase the risk of chronic disability. The aim of the presents study was to examine whether implementation intentions reduce escape-avoidance behavior d

  12. Optimal search and ambush for a hider who can escape the search region

    OpenAIRE

    Alpern, Steve; Fokkink, Robbert; Simanjuntak, Martin

    2016-01-01

    Search games for a mobile or immobile hider traditionally have the hider permanently confined to a compact ‘search region’ making eventual capture inevitable. Hence the payoff can be taken as time until capture. However in many real life search problems it is possible for the hider to escape an area in which he was known to be located (e.g. Bin Laden from Tora Bora) or for a prey animal to escape a predator’s hunting territory. We model and solve such continuous time problems with escape wher...

  13. Mean Exit Time and Escape Probability for a Tumor Growth System under Non-Gaussian Noise

    CERN Document Server

    Ren, Jian; Gao, Ting; Kan, Xingye; Duan, Jinqiao

    2011-01-01

    Effects of non-Gaussian $\\alpha-$stable L\\'evy noise on the Gompertz tumor growth model are quantified by considering the mean exit time and escape probability of the cancer cell density from inside a safe or benign domain. The mean exit time and escape probability problems are formulated in a differential-integral equation with a fractional Laplacian operator. Numerical simulations are conducted to evaluate how the mean exit time and escape probability vary or bifurcates when $\\alpha$ changes. Some bifurcation phenomena are observed and their impacts are discussed.

  14. Magnetically responsive enzyme powders

    Energy Technology Data Exchange (ETDEWEB)

    Pospiskova, Kristyna, E-mail: kristyna.pospiskova@upol.cz [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Safarik, Ivo, E-mail: ivosaf@yahoo.com [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Institute of Nanobiology and Structural Biology of GCRC, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)

    2015-04-15

    Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (−20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties. - Highlights: • Cross-linked enzyme powders were prepared in various liquid media. • Insoluble enzymes were magnetized using iron oxides particles. • Magnetic iron oxides particles were prepared by microwave-assisted synthesis. • Magnetic modification was performed under low (freezing) temperature. • Cross-linked powdered trypsin and lipase can be used repeatedly for reaction.

  15. Regulation of signal transducer and activator of transcription 3 and apoptotic pathways by betaine attenuates isoproterenol-induced acute myocardial injury in rats.

    Science.gov (United States)

    Zheng, P; Liu, J; Mai, S; Yuan, Y; Wang, Y; Dai, G

    2015-05-01

    The present study was designed to investigate the cardioprotective effects of betaine on acute myocardial ischemia induced experimentally in rats focusing on regulation of signal transducer and activator of transcription 3 (STAT3) and apoptotic pathways as the potential mechanism underlying the drug effect. Male Sprague Dawley rats were treated with betaine (100, 200, and 400 mg/kg) orally for 40 days. Acute myocardial ischemic injury was induced in rats by subcutaneous injection of isoproterenol (85 mg/kg), for two consecutive days. Serum cardiac marker enzyme, histopathological variables and expression of protein levels were analyzed. Oral administration of betaine (200 and 400 mg/kg) significantly reduced the level of cardiac marker enzyme in the serum and prevented left ventricular remodeling. Western blot analysis showed that isoproterenol-induced phosphorylation of STAT3 was maintained or further enhanced by betaine treatment in myocardium. Furthermore, betaine (200 and 400 mg/kg) treatment increased the ventricular expression of Bcl-2 and reduced the level of Bax, therefore causing a significant increase in the ratio of Bcl-2/Bax. The protective role of betaine on myocardial damage was further confirmed by histopathological examination. In summary, our results showed that betaine pretreatment attenuated isoproterenol-induced acute myocardial ischemia via the regulation of STAT3 and apoptotic pathways.

  16. Artificial Enzymes, "Chemzymes"

    DEFF Research Database (Denmark)

    Bjerre, Jeannette; Rousseau, Cyril Andre Raphaël; Pedersen, Lavinia Georgeta M;

    2008-01-01

    Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models...... that successfully perform Michaelis-Menten catalysis under enzymatic conditions (i.e., aqueous medium, neutral pH, ambient temperature) and for those that do, very high rate accelerations are seldomly seen. This review will provide a brief summary of the recent developments in artificial enzymes, so called...... "Chemzymes", based on cyclodextrins and other molecules. Only the chemzymes that have shown enzyme-like activity that has been quantified by different methods will be mentioned. This review will summarize the work done in the field of artificial glycosidases, oxidases, epoxidases, and esterases, as well...

  17. Cotton cellulose: enzyme adsorption and enzymic hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Beltrame, P.L.; Carniti, P.; Focher, B.; Marzetti, A.; Cattaneo, M.

    1982-01-01

    The adsorption of a crude cellulase complex from Trichoderma viride on variously pretreated cotton cellulose samples was studied in the framework of the Langmuir approach at 2-8 degrees. The saturation amount of adsorbed enzyme was related to the susceptibility of the substrates to hydrolysis. In every case the adsorption process was faster by 2-3 orders of magnitude than the hydrolysis step to give end products. For ZnCl/sub 2/-treated cotton cellulose the Langmuir parameters correlated fairly well with the value of the Michaelis constant, measured for its enzymic hydrolysis, and the adsorptive complex was indistinguishable from the complex of the Michaelis-Menten model for the hydrolysis.

  18. Role of cytokines in promoting immune escape of FasL-expressing human colon cancer cells

    Institute of Scientific and Technical Information of China (English)

    Tong Xu; Bao-Cun Sun; Qiang Li; Xi-Shan Hao

    2005-01-01

    AIM: To investigate the potential role of cytokines in promoting Fas ligand (FasL)-expressing colon cancer cells.METHODS: Immunohistochemical SABC method was used to observe the expression of Fas receptor and ligand in SW620 colon cancer cell line and Jurkat T cells in order to provide the morphological evidence for the functions of Fas receptor and ligand. To examine the cytotoxicity of effector cells, CytoTox96(R) non-radioactive cytotoxicity assay was adopted to measure the lactate dehydrogenase-releasing value after SW620 cells were co-cultured with Jurkat T lymphocytes.RESULTS: The FasL of colon cancer SW620 cells was positive. The positive substances were distributed in the cell membrane and cytoplasm. The Fas receptor of colon cancer SW620 cells was negative. The Fas receptor and ligand of Jurkat T lymphocytes tumed out to be positive. The positive substances were distributed in the cell membrane.After phytohemagglutinin (PHA)-stimulated Jurkat T lymphocytes were co-cultured with phorbol 12-myristate 13-acetate (PMA)-plus-ionomycin-stimulated (for 48 h) SW620ceils or tumor necrosis factor-alpha (TNF-α)-stimulated (for 48 h) SW620 cells or unstimulated SW620 cells for 4 h,the cytotoxicity of SW620 cells to PHA-stimulated Jurkat cells at effector-to-target ratios of 10:1, 5:1, 2.5:1, and 1.25:1was 74.6%, 40.8%, 32.4%, and 10.9% (F= 8.19, P<0.05);or 54.9%, 35.3%, 22.0%, and 10.3% (F= 11.12, P<0.05);or 14.9%, 10.5%, 6.9%, and 5.8% (F= 3.45, P<0.05).After PHA-stimulated Jurkat T lymphocytes were co-cultured with unstimulated SW620 cells for 8 h, the cytotoxicity of SW620 cells to PHA-stimulated Jurkat cells at effector-totarget ratios of 5:1, 2.5:1, and 1.25:1 from the experiment was 83.9%, 74.1%, and 28.5% (F= 137.04, P<0.05)respectively. Non-radioactive cytotoxicity assay showed that the apoptotic rate of Jurkat cells remarkably increased with the increase of planting concentration of SW620 cells and co-culture time after the SW620 cells were co

  19. Cyclopamine and jervine induce COX-2 overexpression in human erythroleukemia cells but only cyclopamine has a pro-apoptotic effect

    Energy Technology Data Exchange (ETDEWEB)

    Ghezali, Lamia; Leger, David Yannick; Limami, Youness [Université de Limoges, FR 3503 GEIST, EA 1069 “Laboratoire de Chimie des Substances Naturelles”, GDR CNRS 3049, Faculté de Pharmacie, Laboratoire de Biochimie et Biologie Moléculaire, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France); Cook-Moreau, Jeanne [Université de Limoges, FR 3503 GEIST, UMR CNRS 7276 “Contrôle de la réponse immune B et lymphoproliférations”, Faculté de Médecine, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France); Beneytout, Jean-Louis [Université de Limoges, FR 3503 GEIST, EA 1069 “Laboratoire de Chimie des Substances Naturelles”, GDR CNRS 3049, Faculté de Pharmacie, Laboratoire de Biochimie et Biologie Moléculaire, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France); Liagre, Bertrand, E-mail: bertrand.liagre@unilim.fr [Université de Limoges, FR 3503 GEIST, EA 1069 “Laboratoire de Chimie des Substances Naturelles”, GDR CNRS 3049, Faculté de Pharmacie, Laboratoire de Biochimie et Biologie Moléculaire, 2 rue du Docteur Marcland, 87025 Limoges Cedex (France)

    2013-04-15

    Erythroleukemia is generally associated with a very poor response and survival to current available therapeutic agents. Cyclooxygenase-2 (COX-2) has been described to play a crucial role in the proliferation and differentiation of leukemia cells, this enzyme seems to play an important role in chemoresistance in different cancer types. Previously, we demonstrated that diosgenin, a plant steroid, induced apoptosis in HEL cells with concomitant COX-2 overexpression. In this study, we investigated the antiproliferative and apoptotic effects of cyclopamine and jervine, two steroidal alkaloids with similar structures, on HEL and TF1a human erythroleukemia cell lines and, for the first time, their effect on COX-2 expression. Cyclopamine, but not jervine, inhibited cell proliferation and induced apoptosis in these cells. Both compounds induced COX-2 overexpression which was responsible for apoptosis resistance. In jervine-treated cells, COX-2 overexpression was NF-κB dependent. Inhibition of NF-κB reduced COX-2 overexpression and induced apoptosis. In addition, cyclopamine induced apoptosis and COX-2 overexpression via PKC activation. Inhibition of the PKC pathway reduced both apoptosis and COX-2 overexpression in both cell lines. Furthermore, we demonstrated that the p38/COX-2 pathway was involved in resistance to cyclopamine-induced apoptosis since p38 inhibition reduced COX-2 overexpression and increased apoptosis in both cell lines. - Highlights: ► Cyclopamine alone but not jervine induces apoptosis in human erythroleukemia cells. ► Cyclopamine and jervine induce COX-2 overexpression. ► COX-2 overexpression is implicated in resistance to cyclopamine-induced apoptosis. ► Apoptotic potential of jervine is restrained by NF-κB pathway activation. ► PKC is involved in cyclopamine-induced apoptosis and COX-2 overexpression.

  20. Phototherapy-treated apoptotic tumor cells induce pro-inflammatory cytokines production in macrophage

    Science.gov (United States)

    Lu, Cuixia; Wei, Yanchun; Xing, Da

    2014-09-01

    Our previous studies have demonstrated that as a mitochondria-targeting cancer phototherapy, high fluence low-power laser irradiation (HF-LPLI) induces mitochondrial superoxide anion burst, resulting in oxidative damage to tumor cells. In this study, we further explored the immunological effects of HF-LPLI-induced apoptotic tumor cells. When macrophages were co-incubated with apoptotic cells induced by HF-LPLI, we observed the increased levels of TNF-α secretion and NO production in macrophages. Further experiments showed that NF-κB was activated in macrophages after co-incubation with HF-LPLI-induced apoptotic cells, and inhibition of NF-κB activity by pyrrolidinedithiocarbamic acid (PDTC) reduced the elevated levels of TNF-α secretion and NO production. These data indicate that HF-LPLI-induced apoptotic tumor cells induce the secretion of pro-inflammatory cytokines in macrophages, which may be helpful for better understanding the biological effects of cancer phototherapy.

  1. Apoptotic killing of HIV-1-infected macrophages is subverted by the viral envelope glycoprotein.

    Directory of Open Access Journals (Sweden)

    Simon Swingler

    2007-09-01

    Full Text Available Viruses have evolved strategies to protect infected cells from apoptotic clearance. We present evidence that HIV-1 possesses a mechanism to protect infected macrophages from the apoptotic effects of the death ligand TRAIL (tumor necrosis factor-related apoptosis-inducing ligand. In HIV-1-infected macrophages, the viral envelope protein induced macrophage colony-stimulating factor (M-CSF. This pro-survival cytokine downregulated the TRAIL receptor TRAIL-R1/DR4 and upregulated the anti-apoptotic genes Bfl-1 and Mcl-1. Inhibition of M-CSF activity or silencing of Bfl-1 and Mcl-1 rendered infected macrophages highly susceptible to TRAIL. The anti-cancer agent Imatinib inhibited M-CSF receptor activation and restored the apoptotic sensitivity of HIV-1-infected macrophages, suggesting a novel strategy to curtail viral persistence in the macrophage reservoir.

  2. Escaping the poverty trap: modeling the interplay between economic growth and the ecology of infectious disease

    CERN Document Server

    Goerg, Georg M; Hébert-Dufresne, Laurent; Althouse, Benjamin M

    2013-01-01

    The dynamics of economies and infectious disease are inexorably linked: economic well-being influences health (sanitation, nutrition, treatment capacity, etc.) and health influences economic well-being (labor productivity lost to sickness and disease). Often societies are locked into ``poverty traps'' of poor health and poor economy. Here, using a simplified coupled disease-economic model with endogenous capital growth we demonstrate the formation of poverty traps, as well as ways to escape them. We suggest two possible mechanisms of escape both motivated by empirical data: one, through an influx of capital (development aid), and another through changing the percentage of GDP spent on healthcare. We find that a large influx of capital is successful in escaping the poverty trap, but increasing health spending alone is not. Our results demonstrate that escape from a poverty trap may be possible, and carry important policy implications in the world-wide distribution of aid and within-country healthcare spending.

  3. Escape dynamics in collinear atomic-like three mass point systems

    CERN Document Server

    Pasca, Daniel; Stoica, Cristina

    2009-01-01

    The present paper studies the escape mechanism in collinear three point mass systems with small-range-repulsive/large-range-attractive pairwise-interaction. Specifically, we focus on systems with non-negative total energy. We show that on the zero energy level set, most of the orbits lead to binary escape configurations and the set of initial conditions leading to escape configurations where all three separations infinitely increase as $t \\to \\infty 1$ has zero Lebesgue measure. We also give numerical evidence of the existence of a periodic orbit for the case when the two outer masses are equal. For positive energies, we prove that the set of initial conditions leading to escape configurations where all three separations infinitely increase as $t \\to \\infty$ has positive Lebesgue measure. Keywords: linear three point

  4. Unsteady motion: escape jumps in planktonic copepods, their kinematics and energetics

    DEFF Research Database (Denmark)

    Kiørboe, Thomas; Andersen, Anders Peter; Langlois, Vincent J.;

    2010-01-01

    estimate the force and power output needed to accelerate and overcome drag. Both are very high compared with those of other organisms, as are the escape velocities in comparison to startle velocities of other aquatic animals. Thus, the maximum weight-specific force, which for muscle motors of other animals...... has been found to be near constant at 57 N (kg muscle)−1, is more than an order of magnitude higher for the escaping copepods. We argue that this is feasible because most copepods have different systems for steady propulsion (feeding appendages) and intensive escapes (swimming legs), with the muscular...... arrangement of the latter probably adapted for high force production during short-lasting bursts. The resulting escape velocities scale with body length to power 0.65, different from the size-scaling of both similar sized and larger animals moving at constant velocity, but similar to that found for startle...

  5. Pizza or Pancake? Formation Models of Gas Escape Biosignatures in Terrestrial and Martian Sediments

    Science.gov (United States)

    Bonaccorsi, R.; Fairen, A. G.; Baker, L.; McKay, C. P.; Willson, D.

    2016-05-01

    Fine-grained sedimentary hollowed structures were imaged in Gale Crater, but no biomarkers identified to support biology. Our observation-based (gas escape) terrestrial model could inform on possible martian paleoenvironments at time of formation.

  6. Decreased Apoptotic Rate of Alveolar Macrophages of Patients with Idiopathic Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    Fotios Drakopanagiotakis

    2012-01-01

    and control group. No difference was found between the respiratory function parameters of the two treatment groups after six months. A positive correlation was found between the number of bcl-2 positive stained macrophages and DLCO after treatment. Conclusions. The decreased apoptotic rate of AM of patients with IPF is not associated with decreased expression of apoptosis mediators involved in the external or internal apoptotic pathway.

  7. Influence of throat configuration and fish density on escapement of channel catfish from hoop nets

    Science.gov (United States)

    Porath, Mark T.; Pape, Larry D.; Richters, Lindsey K.

    2011-01-01

    In recent years, several state agencies have adopted the use of baited, tandemset hoop nets to assess lentic channel catfish Ictalurus punctatus populations. Some level of escapement from the net is expected because an opening exists in each throat of the net, although factors influencing rates of escapement from hoop nets have not been quantified. We conducted experiments to quantify rates of escapement and to determine the influence of throat configuration and fish density within the net on escapement rates. An initial experiment to determine the rate of escapement from each net compartment utilized individually tagged channel catfish placed within the entrance (between the two throats) and cod (within the second throat) compartments of a single hoop net for overnight sets. From this experiment, the mean rate (±SE) of channel catfish escaping was 4.2% (±1.5) from the cod (cod throat was additionally restricted from the traditionally manufactured product), and 74% (±4.2) from the entrance compartments. In a subsequent experiment, channel catfish were placed only in the cod compartment with different throat configurations (restricted or unrestricted) and at two densities (low [6 fish per net] and high [60 fish per net]) for overnight sets to determine the influence of fish density and throat configuration on escapement rates. Escapement rates between throat configurations were doubled at low fish density (13.3 ± 5.4% restricted versus 26.7 ± 5.6% unrestricted) and tripled at high fish density (14.3 ± 4.9% restricted versus 51.9 ± 5.0% unrestricted). These results suggest that retention efficiency is high from cod compartments with restricted throat entrances. However, managers and researchers need to be aware that modification to the cod throats (restrictions) is needed for hoop nets ordered from manufacturers. Managers need to be consistent in their use and reporting of cod end throat configurations when using this gear.

  8. Solution of the boundary value problem for optimal escape in continuous stochastic systems and maps.

    OpenAIRE

    S; Beri; Mannella, R.; Luchinsky, Dmitry G.; Silchenko, A. N.; McClintock, Peter V. E.

    2005-01-01

    Topologies of invariant manifolds and optimal trajectories are investigated in stochastic continuous systems and maps. A topological method is introduced that simplifies the solution of boundary value problems: The activation energy is calculated as a function of a set of parameters characterizing the initial conditions of the escape path. The method is applied explicitly to compute the optimal escape path and the activation energy for a variety of dynamical systems and maps.

  9. Choices between positive and negative reinforcement during treatment for escape-maintained behavior.

    Science.gov (United States)

    DeLeon, I G; Neidert, P L; Anders, B M; Rodriguez-Catter, V

    2001-01-01

    Positive reinforcement was more effective than negative reinforcement in promoting compliance and reducing escape-maintained problem behavior for a child with autism. Escape extinction was then added while the child was given a choice between positive or negative reinforcement for compliance and the reinforcement schedule was thinned. When the reinforcement requirement reached 10 consecutive tasks, the treatment effects became inconsistent and reinforcer selection shifted from a strong preference for positive reinforcement to an unstable selection pattern.

  10. THE EFFECTS OF FIXED-TIME ESCAPE ON INAPPROPRIATE AND APPROPRIATE CLASSROOM BEHAVIOR

    OpenAIRE

    Waller, Rachael D; Higbee, Thomas S.

    2010-01-01

    Few studies have explored the effects of fixed-time (FT) reinforcement on escape-maintained behavior of students in a classroom setting. We measured the effects of an FT schedule on the disruptive and appropriate academic behaviors of 2 junior high students in a public school setting. Results demonstrated that FT escape from tasks resulted in a substantial decrease in disruptive behavior and an increase in time engaged in tasks for both participants.

  11. Choices between positive and negative reinforcement during treatment for escape-maintained behavior.

    OpenAIRE

    DeLeon, I G; Neidert, P L; Anders, B M; Rodriguez-Catter, V

    2001-01-01

    Positive reinforcement was more effective than negative reinforcement in promoting compliance and reducing escape-maintained problem behavior for a child with autism. Escape extinction was then added while the child was given a choice between positive or negative reinforcement for compliance and the reinforcement schedule was thinned. When the reinforcement requirement reached 10 consecutive tasks, the treatment effects became inconsistent and reinforcer selection shifted from a strong prefer...

  12. The relationship between migration and development in the ESCAP region.

    Science.gov (United States)

    Skeldon, R

    1991-01-01

    The relationship between migration and development in the ESCAP region including southeast and south Asian countries and the Pacific island of Fiji, Papua New Guinea, Vanuatu, Kiribati, Samoa, and the Solomon Islands is discussed in terms of mobility transition and origin and destination factors. The changing patterns of mobility in Asia are further delineated in the discussion of internal movements and international movement. Emigration in the smaller countries of the Pacific are treated separately. Future predictions are that the Asia Pacific region will experience continued fertility decline and stabilization of low rates over the next 20 years. The declines will result in slow labor force growth, and increased demand for labor in traditional core and neocore countries as defined and presented in table form by Friedman will be heightened. International movements are likely to increase in large urban areas within destination countries. Tokyo and Singapore are the principal cities in Asia. Tokyo by restrictive government policy has limited immigration, but future labor shortages of unskilled labor from southeast Asia and China are expected. Singapore is already dependent on foreign labor by 10%. Current labor shortages have led to the creation of a growth triangle between Singapore, Indonesia, and Malaysia. Other cities expected to emerge as primary cities in international regional complexes with spillover into the hinterlands include the Hong Kong, Guangzhou, and Macau triangle in the Pearl River delta, Taipei and Seoul, and possibly Kuala Lumpur. Internal migration is expected to increase in the capital cities of Bangkok, Manila,j and centers such as Shanghai, Beijing, and other large cities of southeast Asia. These cities will be linked through the flows of skilled international migrants, which began in the 1960s and is expected to become a future major flow. Recreational and resource niches will be left in much of the Pacific, the Himalayan Kingdoms, and

  13. Enzyme molecules as nanomotors.

    Science.gov (United States)

    Sengupta, Samudra; Dey, Krishna K; Muddana, Hari S; Tabouillot, Tristan; Ibele, Michael E; Butler, Peter J; Sen, Ayusman

    2013-01-30

    Using fluorescence correlation spectroscopy, we show that the diffusive movements of catalase enzyme molecules increase in the presence of the substrate, hydrogen peroxide, in a concentration-dependent manner. Employing a microfluidic device to generate a substrate concentration gradient, we show that both catalase and urease enzyme molecules spread toward areas of higher substrate concentration, a form of chemotaxis at the molecular scale. Using glucose oxidase and glucose to generate a hydrogen peroxide gradient, we induce the migration of catalase toward glucose oxidase, thereby showing that chemically interconnected enzymes can be drawn together.

  14. Quantifying the Escape Mortality of Trawl Caught Antarctic Krill (Euphausia superba)

    Science.gov (United States)

    Krafft, Bjørn A.; Krag, Ludvig A.; Engås, Arill; Nordrum, Sigve; Bruheim, Inge; Herrmann, Bent

    2016-01-01

    Antarctic krill (Euphausia superba) is an abundant fishery resource, the harvest levels of which are expected to increase. However, many of the length classes of krill can escape through commonly used commercial trawl mesh sizes. A vital component of the overall management of a fishery is to estimate the total fishing mortality and quantify the mortality rate of individuals that escape from fishing gear. The methods for determining fishing mortality in krill are still poorly developed. We used a covered codend sampling technique followed by onboard observations made in holding tanks to monitor mortality rates of escaped krill. Haul duration, hydrological conditions, maximum fishing depth and catch composition all had no significant effect on mortality of krill escaping 16 mm mesh size nets, nor was any further mortality associated with the holding tank conditions. A non- parametric Kaplan-Meier analysis was used to model the relationship between mortality rates of escapees and time. There was a weak tendency, though not significant, for smaller individuals to suffer higher mortality than larger individuals. The mortality of krill escaping the trawl nets in our study was 4.4 ± 4.4%, suggesting that krill are fairly tolerant of the capture-and-escape process in trawls. PMID:27622510

  15. Escape of Mars' CO2 atmosphere by suprathermal atoms during the past 4 Gyrs

    Science.gov (United States)

    Amerstorfer, Ute; Gröller, Hannes; Lichtenegger, Herbert; Lammer, Helmut; Tian, Feng

    2016-04-01

    The escape of atmospheric particles plays a crucial role in the evolution of the atmosphere of Mars. Especially, the escape of oxygen and carbon is thought to have influenced its amount of CO2. With a Monte-Carlo model we investigate the escape of hot oxygen and carbon from the martian atmosphere for three points in time in its history corresponding to 3, 10, and 20 times the present EUV level. We study and discuss different possible sources of hot oxygen and carbon atoms in the thermosphere and their changing importance with the EUV flux. We find that the escape due to photodissociation increases with increasing EUV level, as is a commonly assumed opinion. However, for the escape via other reactions, e.g. dissociative recombination, this is only true until the EUV level reaches 10 times the present EUV flux, but then the rates start to decrease. Our results thus suggest that some escape mechanisms related to the loss of CO2 are less important than previously thought for atmospheres exposed to higher EUV radiation. This work receives funding from the Austrian Science Fund (FWF): P 24247-N16.

  16. Hot oxygen escape from Mars: Simple scaling with solar EUV irradiance

    Science.gov (United States)

    Cravens, T. E.; Rahmati, A.; Fox, Jane L.; Lillis, R.; Bougher, S.; Luhmann, J.; Sakai, S.; Deighan, J.; Lee, Yuni; Combi, M.; Jakosky, B.

    2017-01-01

    The evolution of the atmosphere of Mars and the loss of volatiles over the lifetime of the solar system is a key topic in planetary science. An important loss process for atomic species, such as oxygen, is ionospheric photochemical escape. Dissociative recombination of O2+ ions (the major ion species) produces fast oxygen atoms, some of which can escape from the planet. Many theoretical hot O models have been constructed over the years, although a number of uncertainties are present in these models, particularly concerning the elastic cross sections of O atoms with CO2. Recently, the Mars Atmosphere and Volatile Evolution mission has been rapidly improving our understanding of the upper atmosphere and ionosphere of Mars and its interaction with the external environment (e.g., solar wind), allowing a new assessment of this important loss process. The purpose of the current paper is to take a simple analytical approach to the oxygen escape problem in order to (1) study the role that variations in solar radiation or solar wind fluxes could have on escape in a transparent fashion and (2) isolate the effects of uncertainties in oxygen cross sections on the derived oxygen escape rates. In agreement with several more elaborate numerical models, we find that the escape flux is directly proportional to the incident solar extreme ultraviolet irradiance and is inversely proportional to the backscatter elastic cross section. The amount of O lost due to ion transport in the topside ionosphere is found to be about 5-10% of the total.

  17. Lobelia siphilitica plants that escape herbivory in time also have reduced latex production.

    Directory of Open Access Journals (Sweden)

    Amy L Parachnowitsch

    Full Text Available Flowering phenology is an important determinant of a plant's reproductive success. Both assortative mating and niche construction can result in the evolution of correlations between phenology and other reproductive, functional, and life history traits. Correlations between phenology and herbivore defence traits are particularly likely because the timing of flowering can allow a plant to escape herbivory. To test whether herbivore escape and defence are correlated, we estimated phenotypic and genetic correlations between flowering phenology and latex production in greenhouse-grown Lobelia siphilitica L. (Lobeliaceae. Lobelia siphilitica plants that flower later escape herbivory by a specialist pre-dispersal seed predator, and thus should invest fewer resources in defence. Consistent with this prediction, we found that later flowering was phenotypically and genetically correlated with reduced latex production. To test whether herbivore escape and latex production were costly, we also measured four fitness correlates. Flowering phenology was negatively genetically correlated with three out of four fitness estimates, suggesting that herbivore escape can be costly. In contrast, we did not find evidence for costs of latex production. Generally, our results suggest that herbivore escape and defence traits will not evolve independently in L. siphilitica.

  18. CD4 binding site broadly neutralizing antibody selection of HIV-1 escape mutants.

    Science.gov (United States)

    Dreja, Hanna; Pade, Corinna; Chen, Lei; McKnight, Áine

    2015-07-01

    All human immunodeficiency virus type-1 (HIV-1) viruses use CD4 to enter cells. Consequently, the viral envelope CD4-binding site (CD4bs) is relatively conserved, making it a logical neutralizing antibody target. It is important to understand how CD4-binding site variation allows for escape from neutralizing antibodies. Alanine scanning mutagenesis identifies residues in antigenic sites, whereas escape mutant selection identifies viable mutants. We selected HIV-1 to escape CD4bs neutralizing mAbs b12, A12 and HJ16. Viruses that escape from A12 and b12 remained susceptible to HJ16, VRC01 and J3, whilst six different viruses that escape HJ16 remained sensitive to A12, b12 and J3. In contrast, their sensitivity to VRC01 was variable. Triple HJ16/A12/b12-resistant virus proved that HIV-1 could escape multiple broadly neutralizing monoclonal antibodies, but still retain sensitivity to VRC01 and the llama-derived J3 nanobody. This antigenic variability may reflect that occurring in circulating viruses, so studies like this can predict immunologically relevant antigenic forms of the CD4bs for inclusion in HIV-1 vaccines.

  19. Orbital and escape dynamics in barred galaxies - I. The 2D system

    CERN Document Server

    Jung, Christof

    2016-01-01

    In this paper we use the two-dimensional (2D) version of a new analytical gravitational model in order to explore the orbital as well as the escape dynamics of the stars in a barred galaxy composed of a spherically symmetric central nucleus, a bar, a flat disk and a dark matter halo component. A thorough numerical investigation is conducted for distinguishing between bounded and escaping motion. Furthermore bounded orbits are further classified into non-escaping regular and trapped chaotic using the Smaller ALingment Index (SALI) method. Our aim is to determine the basins of escape through the two symmetrical escape channels around the Lagrange points $L_2$ and $L_3$ and also to relate them with the corresponding distribution of the escape rates of the orbits. We integrate initial conditions of orbits in several types of planes so as to obtain a more complete view of the overall orbital properties of the dynamical system. We also present evidence that the unstable manifolds which guide the orbits in and out t...

  20. Escape-Route Planning of Underground Coal Mine Based on Improved Ant Algorithm

    Directory of Open Access Journals (Sweden)

    Guangwei Yan

    2013-01-01

    Full Text Available When a mine disaster occurs, to lessen disaster losses and improve survival chances of the trapped miners, good escape routes need to be found and used. Based on the improved ant algorithm, we proposed a new escape-route planning method of underground mines. At first, six factors which influence escape difficulty are evaluated and a weight calculation model is built to form a weighted graph of the underground tunnels. Then an improved ant algorithm is designed and used to find good escape routes. We proposed a tunnel network zoning method to improve the searching efficiency of the ant algorithm. We use max-min ant system method to optimize the meeting strategy of ants and improve the performance of the ant algorithm. In addition, when a small part of the mine tunnel network changes, the system may fix the optimal routes and avoid starting a new processing procedure. Experiments show that the proposed method can find good escape routes efficiently and can be used in the escape-route planning of large and medium underground coal mines.

  1. Fundamental Experiment to Determine Escape Countermeasures for Frogs Falling into Agricultural Canals

    Science.gov (United States)

    Watabe, Keiji; Mori, Atsushi; Koizumi, Noriyuki; Takemura, Takeshi

    Frogs often drown in agricultural canals with deep concrete walls, which are installed commonly in paddy fields after land improvement projects in Japan, because they cannot escape after falling into the canal. Therefore, countermeasures that enable frogs to escape from canals are required in some rural areas. An experimental canal with partially sloped walls was used as an escape countermeasure to investigate the preferable angle of slope for the walls, water depth and flow velocity that enables Tokyo Daruma Pond Frogs (Rana porosa porosa), which have no adhesive discs, to easily escape. Walls with slopes of 30-45 degrees allowed 50-60% of frogs to escape from the experimental canals, frogs especially easily climbed the 30 degree sloped walls. When the water depth was 5 cm or flow velocity was greater than 20 cm/s, approximately 80% of the frogs moved downstream and reached the sloped walls because the frogs' toes did not reach the bottom of the canal. However, if the depth was 2 cm and the flow velocity was 5 cm/s, only 4% of the frogs climbed the sloped walls because they could move freely. The frogs appeared to not be good at long-distance swimming and could not remain a long-time under running water. Therefore, walls sloped less than 30 degrees and control of both water depth and flow velocity appears important for enabling frogs to easily escape from canals.

  2. Effects of Serotonergic and Opioidergic Drugs on Escape Behaviors and Social Status of Male Crickets

    Science.gov (United States)

    Dyakonova, V. E.; Schürmann, F.-W.; Sakharov, D. A.

    We examined the effects of selective serotonin depletion and opioid ligands on social rank and related escape behavior of the cricket Gryllus bimaculatus. Establishment of social rank in a pair of males affected their escape reactions. Losers showed a lower and dominants a higher percentage of jumps in response to tactile cercal stimulation than before a fight. The serotonin-depleting drug α-methyltryptophan (AMTP) caused an activation of the escape reactivity in socially naive crickets. AMTP-treated animals also showed a lower ability to become dominants. With an initial 51.6+/-3.6% of wins in the AMTP group, the percentage decreased to 26+/-1.6% on day 5 after injection. The opiate receptor antagonist naloxone affected fight and escape similarly as AMTP. In contrast to naloxone, the opioid agonist [d-Ala2, N-Me-Phe4, Gly5-ol]-enkephalin decreased escape responsiveness to cercal stimulation in naive and subordinate crickets. We suggest that serotonergic and opioid systems are involved in the dominance induced depression of escape behavior.

  3. Chaotic escape from an open vase-shaped cavity. I. Numerical and experimental results

    Science.gov (United States)

    Novick, Jaison; Keeler, Matthew L.; Giefer, Joshua; Delos, John B.

    2012-01-01

    We present part I in a two-part study of an open chaotic cavity shaped as a vase. The vase possesses an unstable periodic orbit in its neck. Trajectories passing through this orbit escape without return. For our analysis, we consider a family of trajectories launched from a point on the vase boundary. We imagine a vertical array of detectors past the unstable periodic orbit and, for each escaping trajectory, record the propagation time and the vertical detector position. We find that the escape time exhibits a complicated recursive structure. This recursive structure is explored in part I of our study. We present an approximation to the Helmholtz equation for waves escaping the vase. By choosing a set of detector points, we interpolate trajectories connecting the source to the different detector points. We use these interpolated classical trajectories to construct the solution to the wave equation at a detector point. Finally, we construct a plot of the detector position versus the escape time and compare this graph to the results of an experiment using classical ultrasound waves. We find that generally the classical trajectories organize the escaping ultrasound waves.

  4. Chaotic escape from an open vase-shaped cavity. II. Topological theory.

    Science.gov (United States)

    Novick, Jaison; Delos, John B

    2012-01-01

    We present part II of a study of chaotic escape from an open two-dimensional vase-shaped cavity. A surface of section reveals that the chaotic dynamics is controlled by a homoclinic tangle, the union of stable and unstable manifolds attached to a hyperbolic fixed point. Furthermore, the surface of section rectifies escape-time graphs into sequences of escape segments; each sequence is called an epistrophe. Some of the escape segments (and therefore some of the epistrophes) are forced by the topology of the dynamics of the homoclinic tangle. These topologically forced structures can be predicted using the method called homotopic lobe dynamics (HLD). HLD takes a finite length of the unstable manifold and a judiciously altered topology and returns a set of symbolic dynamical equations that encode the folding and stretching of the unstable manifold. We present three applications of this method to three different lengths of the unstable manifold. Using each set of dynamical equations, we compute minimal sets of escape segments associated with the unstable manifold, and minimal sets associated with a burst of trajectories emanating from a point on the vase's boundary. The topological theory predicts most of the early escape segments that are found in numerical computations.

  5. Enzymic lactose hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.J.; Brand, J.C.

    1980-01-01

    Acid or enzymic hydrolysis can be used to hydrolyze lactose. Advantages of both are compared and details of enzymic hydrolysis using yeast or fungal enzymes given. The new scheme outlined involves recycling lactase. Because lactose and lactase react to ultrafiltration (UF) membranes differently separation is possible. Milk or milk products are ultrafiltered to separate a concentrate from a lactose-rich permeate which is treated with lactase in a reactor until hydrolysis reaches a required level. The lactase can be removed by UF as it does not permeate the membrane, and it is recycled back to the reactor. Permeate from the second UF stage may or may not be recombined with the concentrate from the first stage to produce a low lactose product (analysis of a typical low-lactose dried whole milk is given). Batch or continuous processes are explained and a batch process without enzyme recovery is discussed. (Refs. 4).

  6. Enzymes in Analytical Chemistry.

    Science.gov (United States)

    Fishman, Myer M.

    1980-01-01

    Presents tabular information concerning recent research in the field of enzymes in analytic chemistry, with methods, substrate or reaction catalyzed, assay, comments and references listed. The table refers to 128 references. Also listed are 13 general citations. (CS)

  7. Membrane Assisted Enzyme Fractionation

    DEFF Research Database (Denmark)

    Yuan, Linfeng

    . In this thesis, separations using crossflow elecro-membrane filtration (EMF) of amino acids, bovine serum albumin (BSA) and industrial enzymes from Novozymes were performed. The main objective of this study was to investigate the technological feasibility of EMF in the application of industrial enzyme...... fractionation, such as removal of a side activity from the main enzyme activity. As a proof-of-concept, amino acids were used as model solution to test the feasibility of EMF in the application of amphoteric molecule separation. A single amino acid was used to illustrate the effect of an electric field...... on the separation performance were very small in the investigated range. The mass transport of each enzyme can be well explained by the Extended-Nernst-Planck equation. Better separation was observed at lower feed concentration, higher solution pH in the investigated range and with a polysulfone (PS) MF membrane...

  8. Chronic NMDA administration to rats increases brain pro-apoptotic factors while decreasing anti-Apoptotic factors and causes cell death

    Directory of Open Access Journals (Sweden)

    Rapoport Stanley I

    2009-09-01

    Full Text Available Abstract Background Chronic N-Methyl-d-aspartate (NMDA administration to rats is reported to increase arachidonic acid signaling and upregulate neuroinflammatory markers in rat brain. These changes may damage brain cells. In this study, we determined if chronic NMDA administration (25 mg/kg i.p., 21 days to rats would alter expression of pro- and anti-apoptotic factors in frontal cortex, compared with vehicle control. Results Using real time RT-PCR and Western blotting, chronic NMDA administration was shown to decrease mRNA and protein levels of anti-apoptotic markers Bcl-2 and BDNF, and of their transcription factor phospho-CREB in the cortex. Expression of pro-apoptotic Bax, Bad, and 14-3-3ζ was increased, as well as Fluoro-Jade B (FJB staining, a marker of neuronal loss. Conclusion This alteration in the balance between pro- and anti-apoptotic factors by chronic NMDA receptor activation in this animal model may contribute to neuronal loss, and further suggests that the model can be used to examine multiple processes involved in excitotoxicity.

  9. Overproduction of ligninolytic enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  10. RNA-modifying enzymes.

    Science.gov (United States)

    Ferré-D'Amaré, Adrian R

    2003-02-01

    A bewildering number of post-transcriptional modifications are introduced into cellular RNAs by enzymes that are often conserved among archaea, bacteria and eukaryotes. The modifications range from those with well-understood functions, such as tRNA aminoacylation, to widespread but more mysterious ones, such as pseudouridylation. Recent structure determinations have included two types of RNA nucleobase modifying enzyme: pseudouridine synthases and tRNA guanine transglycosylases.

  11. Two cases of atmospheric escape in the Solar System: Titan and Earth

    Science.gov (United States)

    Dandouras, I.

    2012-01-01

    Escape into space of the constituents of a planetary upper atmosphere can occur either in the form of neutral gas (thermal escape or non-thermal escape), or in the form of plasma. The long-term stability of an atmosphere results from the balance between source and escape rates. Two cases will be examined: Titan and Earth. Titan is the second largest planetary satellite in the Solar System and is the only one that has an atmosphere as substantial as that of the Earth. Titan's nitrogen rich atmosphere is embedded within Saturn's magnetosphere, and is directly bombarded by energetic ions due to Titan's lack of a significant intrinsic magnetic field. In addition to thermal escape, energy input from Saturn's magnetosphere and from Solar UV radiation can drive several non-thermal escape mechanisms in Titan's upper atmosphere: sputtering, dissociation and dissociative ionization of molecular nitrogen producing pick-up ions, photochemical production of fast neutrals etc. Earth also constantly loses matter, mostly in the form of H+ and O+ ions, through various outflow processes from the upper atmosphere and ionosphere. Most of the ions are low-energy (plasma reservoir is the plasmasphere, which is a toroidal region encircling the Earth and containing cold and dense plasma. Plasma plumes, forming in the outer plasmasphere and released outwards, constitute a well-established mode for plasmaspheric material release to the magnetosphere. They are associated to geomagnetically active periods and the related electric field change. In 1992 Lemaire and Shunk proposed the existence of an additional mode for plasmaspheric material release and escape: a plasmaspheric wind, steadily transporting cold plasmaspheric plasma outwards across the geomagnetic field lines. This has been proposed on a theoretical basis. Direct detection of this wind has, however, eluded observation in the past. Analysis of ion measurements, acquired in the outer plasmasphere by the CIS experiment onboard the

  12. Temporal and ontogenetic variation in the escape response of Ameiva festiva (Squamata, Teiidae

    Directory of Open Access Journals (Sweden)

    Lattanzio

    2014-08-01

    Full Text Available Several factors have been shown to affect lizard escape behavior (flight initiation distance or FID, the distance between predator and prey when the prey initiates escape. Patterns of daily activity, such as foraging or movement behavior, vary with respect to time of day, supporting that escape responses may vary temporally as well. However, there remains scant information regarding the effects of time of day on FID. During peak activity, FID may decrease due to increased cost of giving up resources (e.g., prey or potential mates. An alternative hypothesis is that FID may increase because lizard activity in general may serve to alert a predator in advance of its approach. A lizard in this scenario may be favored to flee sooner rather than later. Moreover, juvenile and adult lizards of multiple species may differ in behavioral, ecological, and morphological traits that could influence escape decisions. I tested the effects of time of day (in 30-min intervals and age (juvenile or adult on the FID of a tropical whiptail lizard, Ameiva festiva in Costa Rica. I found that A. festiva escape responses varied with time of day such that in general, their FID decreased throughout the day. In addition, I observed a peak in FID from mid to late-morning that matches published estimates of peak activity times for A. festiva. Overall, juvenile A. festiva initiated an escape response sooner than adults, which may be related to differences in perceived risk associated with differences in size and predator experience between the two age groups. I conclude that escape responses may be contingent on both the activity level of the animal at the time of approach and its age.

  13. Androstane derivatives induce apoptotic death in MDA-MB-231 breast cancer cells.

    Science.gov (United States)

    Jakimov, Dimitar S; Kojić, Vesna V; Aleksić, Lidija D; Bogdanović, Gordana M; Ajduković, Jovana J; Djurendić, Evgenija A; Penov Gaši, Katarina M; Sakač, Marija N; Jovanović-Šanta, Suzana S

    2015-11-15

    Biological investigation was conducted to study in vitro antiproliferative and pro-apoptotic potential of selected 17α-picolyl and 17(E)-picolinylidene androstane derivatives. The antiproliferative impact was examined on six human tumor cell lines, including two types of breast (MCF-7 and MDA-MB-231), prostate (PC3), cervical (HeLa), colon (HT 29) and lung cancer (A549), as well as one normal fetal lung fibroblasts cell line (MRC-5). All derivatives selectively decreased proliferation of estrogen receptor negative MDA-MB-231 breast cancer cells after 48 h and 72 h treatment and compounds showed time-dependent activity. We used this cell line to investigate cell cycle modulation and apoptotic cell death induction by flow cytometry, expression of apoptotic proteins by Western blot and apoptotic morphology by visual observation. Tested androstane derivatives affected the cell cycle distribution and induced apoptosis and necrosis. Compounds had different and specific mode of action, depending on derivative type and exposure time. Some compounds induced significant apoptosis measured by Annexin V test compared to reference compound formestane. Higher expression of pro-apoptotic BAX, downregulation of anti-apoptotic Bcl-2 and cleavage of PARP protein were confirmed in almost all treated samples, but the lack of caspase-3 activation suggested the induction of apoptosis in caspase-independent manner. More cells with apoptotic morphology were observed in samples after prolonged treatment. Structure-activity relationship analysis was performed to find correlations between the structure variations of investigated derivatives and observed biological effects. Results of this study showed that some of the investigated androstane derivatives have good biomedical potential and could be candidates for anticancer drug development.

  14. Modeling the endosomal escape of cell-penetrating peptides: transmembrane pH gradient driven translocation across phospholipid bilayers.

    Science.gov (United States)

    Magzoub, Mazin; Pramanik, Aladdin; Gräslund, Astrid

    2005-11-15

    Cell-penetrating peptides (CPPs) are able to mediate the efficient cellular uptake of a wide range of cargoes. Internalization of a number of CPPs requires uptake by endocytosis, initiated by binding to anionic cell surface heparan sulfate (HS), followed by escape from endosomes. To elucidate the endosomal escape mechanism, we have modeled the process for two CPPs: penetratin (pAntp) and the N-terminal signal peptide of the unprocessed bovine prion protein (bPrPp). Large unilamellar phospholipid vesicles (LUVs) were produced encapsulating either peptide, and an ionophore, nigericin, was used to create a transmembrane pH gradient (DeltapH(mem), inside acidic) similar to the one arising in endosomes in vivo. In the absence of DeltapH(mem), no pAntp escape from the LUVs is observed, while a fraction of bPrPp escapes. In the presence of DeltapH(mem), a significant amount of pAntp escapes and an even higher degree of bPrPp escape takes place. These results, together with the differences in kinetics of escape, indicate different escape mechanisms for the two peptides. A minimum threshold peptide concentration exists for the escape of both peptides. Coupling of the peptides to a cargo reduces the fraction escaping, while complexation with HS significantly hinders the escape. Fluorescence correlation spectroscopy results show that during the escape process the LUVs are intact. Taken together, these results suggest a model for endosomal escape of CPPs: DeltapH(mem)-mediated mechanism, following dissociation from HS of the peptides, above a minimum threshold peptide concentration, in a process that does not involve lysis of the vesicles.

  15. Red cell enzymes.

    Science.gov (United States)

    Paniker, N V

    1975-03-01

    As compared to other cells of the body, the mammalian red cell has one of the simplest structural organizations. As a result, this cell has been extensively used in studies involving the structure, function, and integrity of cell membranes as well as cytoplasmic events. Additionally, the metabolic activities of the red blood cell are also relatively simple. During the past quarter century or so, an ocean of knowledge has been gathered on various aspects of red cell metabolism and function. The fields of enzymes, hemoglobin, membrane, and metabolic products comprise the major portion of this knowledge. These advances have made valuable contributions to biochemistry and medicine. Despite these favorable aspects of this simple, anucleated cell, it must be conceded that our knowledge about the red cell is far from complete. We are still in the dark concerning the mechanism involved in several aspects of its membrane, hemoglobin, enzymes, and a large number of other constituents. For example, a large number of enzymes with known catalytic activity but with unknown function have eluded investigators despite active pursuit. This review will be a consolidation of our present knowledge of human red cell enzymes, with particular reference to their usefulness in the diagnosis and therapy of disease. Owing to the multitude of publications by prominent investigators on each of the approximately 50 enzymes discussed in this review, it was impossible to cite a majority of them.

  16. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-01-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C → U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics. PMID:26465508

  17. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-09-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

  18. Random-walk enzymes.

    Science.gov (United States)

    Mak, Chi H; Pham, Phuong; Afif, Samir A; Goodman, Myron F

    2015-09-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C→U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

  19. Enzyme recycling in lignocellulosic biorefineries

    DEFF Research Database (Denmark)

    Jørgensen, Henning; Pinelo, Manuel

    2017-01-01

    platform. Cellulases are the most important enzymes required in this process, but the complex nature of lignocellulose requires several other enzymes (hemicellulases and auxiliary enzymes) for efficient hydrolysis. Enzyme recycling increases the catalytic productivity of the enzymes by reusing them...... upscaled and tested in industrial settings, mainly because of many difficulties with recycling of enzymes from the complex lignocellulose hydrolyzate at industrially relevant conditions, i.e., high solids loadings. The challenges are associated with the large number of different enzymes required...... for efficient hydrolysis, enzyme stability, and the detrimental interaction between enzyme and lignin. This review provides a comprehensive overview of the various methods for enzyme recovery and recycling, for example recycling of free enzymes, readsorption to fresh material, recycling of solids, membrane...

  20. Chronic hepatitis B serum promotes apoptotic damage in human renal tubular cells

    Institute of Scientific and Technical Information of China (English)

    Cun-Liang Deng; Xin-Wen Song; Hai-Jun Liang; Chen Feng; Yun-Jian Sheng; Ming-Yong Wang

    2006-01-01

    AIM: To investigate the effect of the serum of patients with chronic hepatitis B (CHB) on apoptosis of renal tubular epithelial cells in vitro and to study the role of hepatitis B virus (HBV) and transforming growth factor-β1 (TGF-β1) in the pathogenesis of hepatitis B virus associated glomerulonephritis (HBV-GN).METHODS: The levels of serum TGF-β1 were measured by specific enzyme linked immunosorbent assay (ELISA) and HBV DNA was tested by polymerase chain reaction (PCR) in 44 patients with CHB ,and 20 healthy persons as the control. The normal human kidney proximal tubular cell (HK-2) was cultured together with the sera of healthy persons, CHB patients with HBV-DNA negative(20 cases) and HBV-DNA positive (24 cases) for up to 72 h. Apoptosis and Fas expression of the HK-2 were detected by flow cytometer.RESULTS: The apoptosis rate and Fas expression of HK-2 cells were significantly higher in HBV DNA positive serum group 19.01±5.85% and 17.58±8.35%, HBV DNA negative serum group 8.12±2.80% and 6.96 ± 2.76% than those in control group 4.25±0.65% and 2.33 ± 1.09%, respectively (P < 0.01). The apoptosis rate and Fas expression of HK-2 in HBV DNA positive serum group was significantly higher than those in HBV DNA negative serum (P < 0.01). Apoptosis rate of HK-2 cells in HBV DNA positive serum group was positively correlated with the level of HBV-DNA (r = 0.657). The level of serum TGF-β1 in CHB group was 163.05 ± 91.35 μg/L, significantly higher as compared with 81.40 ± 40.75 μg/L in the control group (P < 0.01).CONCLUSION: The serum of patients with chronic hepatitis B promotes apoptotic damage in human renal tubular cells by triggering a pathway of Fas up-regulation. HBV and TGF-β1 may play important roles in the mechanism of hepatitis B virus associated glomerulonephritis.

  1. Targeting the Anti-Apoptotic Protein c-FLIP for Cancer Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Safa, Ahmad R., E-mail: asafa@iupui.edu [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Indiana University Simon Cancer Center, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Pollok, Karen E. [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Indiana University Simon Cancer Center, Indiana University School of Medicine, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States); Herman B. Wells Center for Pediatric Research, 980 W. Walnut Street, R3-C524, Indianapolis, IN 46202 (United States)

    2011-03-29

    Cellular FLICE (FADD-like IL-1beta-converting enzyme)-inhibitory protein (c-FLIP) is a major resistance factor and critical anti-apoptotic regulator that inhibits tumor necrosis factor-alpha (TNF-alpha), Fas-L, and TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis as well as chemotherapy-triggered apoptosis in malignant cells. c-FLIP is expressed as long (c-FLIP{sub L}), short (c-FLIP{sub S}), and c-FLIP{sub R} splice variants in human cells. c-FLIP binds to FADD and/or caspase-8 or -10 in a ligand-dependent and-independent fashion, which in turn prevents death-inducing signaling complex (DISC) formation and subsequent activation of the caspase cascade. Moreover, c-FLIP{sub L} and c-FLIP{sub S} are known to have multifunctional roles in various signaling pathways, as well as activating and/or upregulating several cytoprotective signaling molecules. Upregulation of c-FLIP has been found in various tumor types, and its downregulation has been shown to restore apoptosis triggered by cytokines and various chemotherapeutic agents. Hence, c-FLIP is an important target for cancer therapy. For example, small interfering RNAs (siRNAs) that specifically knockdown the expression of c-FLIP{sub L} in diverse human cancer cell lines augmented TRAIL-induced DISC recruitment and increased the efficacy of chemotherapeutic agents, thereby enhancing effector caspase stimulation and apoptosis. Moreover, small molecules causing degradation of c-FLIP as well as decreasing mRNA and protein levels of c-FLIP{sub L} and c-FLIP{sub S} splice variants have been found, and efforts are underway to develop other c-FLIP-targeted cancer therapies. This review focuses on (1) the functional role of c-FLIP splice variants in preventing apoptosis and inducing cytokine and drug resistance; (2) the molecular mechanisms that regulate c-FLIP expression; and (3) strategies to inhibit c-FLIP expression and function.

  2. IMF-induced escape of molecular ions from the Martian ionosphere

    Directory of Open Access Journals (Sweden)

    Y. Kubota

    2013-08-01

    Full Text Available Since Mars does not possess a significant global intrinsic magnetic field, the solar wind interacts directly with the Martian ionosphere and can induce ion escapes from it. Phobos-2 and recent Mars Express (MEX observations have shown that the escaping ions are O+ as well as molecular O2+ and CO2+. While O+ escape can be understood by the ion pick-up of non-thermal O corona extended around the planet, regarding the heavy molecular O2+ and CO2+, which are buried in the lower ionosphere, a novel escape mechanism needs to considered. Here we attack this problem by global magnetohydrodynamic (MHD simulations. First, we clarify the global structure of the streamlines that result from the interaction with the solar wind. Then, by focusing on the streamlines that dip into the low-altitude part of the dayside ionosphere, we investigate the escape path of the molecular ions. The effects of the interplanetary magnetic field (IMF on the molecular ion escape process are investigated by comparing the results with and without IMF. IMF has little effect on O+ escape via ion pick-up mediated by solar wind electron impact ionization of the O corona. O2+ and CO2+ are shoveled from the low-altitude regions of the dayside ionosphere by magnetic tension in the presence of IMF. These ions are pulled by the U-shaped field lines to the north and south poles, and at the terminator, they are concentrated in the noon–midnight meridian plane. These ions remain confined to the noon–midnight plane as they are transported to the nightside to form the tail ray. Then they escape along the streamlines open to the interplanetary space. Under a typical solar wind and IMF condition expected at Mars, O+, O2+ and CO2+ escape fluxes are 8.0 × 1023, 3.5 × 1023 and 5.0 × 1022 ion s−1, respectively, which are in good agreement with the MEX observations.

  3. Extinction Correction Significantly Influences the Estimate of the Lyα Escape Fraction

    Science.gov (United States)

    An, Fang Xia; Zheng, Xian Zhong; Hao, Cai-Na; Huang, Jia-Sheng; Xia, Xiao-Yang

    2017-02-01

    The Lyα escape fraction is a key measure to constrain the neutral state of the intergalactic medium and then to understand how the universe was fully reionized. We combine deep narrowband imaging data from the custom-made filter NB393 and the {{{H}}}2S1 filter centered at 2.14 μm to examine the Lyα emitters and Hα emitters at the same redshift z = 2.24. The combination of these two populations allows us to determine the Lyα escape fraction at z = 2.24. Over an area of 383 arcmin2 in the Extended Chandra Deep Field South (ECDFS), 124 Lyα emitters are detected down to NB393 = 26.4 mag at the 5σ level, and 56 Hα emitters come from An et al. Of these, four have both Lyα and Hα emissions (LAHAEs). We also collect the Lyα emitters and Hα emitters at z = 2.24 in the COSMOS field from the literature, and increase the number of LAHAEs to 15 in total. About one-third of them are AGNs. We measure the individual/volumetric Lyα escape fraction by comparing the observed Lyα luminosity/luminosity density to the extinction-corrected Hα luminosity/luminosity density. We revisit the extinction correction for Hα emitters using the Galactic extinction law with color excess for nebular emission. We also adopt the Calzetti extinction law together with an identical color excess for stellar and nebular regions to explore how the uncertainties in extinction correction affect the estimate of individual and global Lyα escape fractions. In both cases, an anti-correlation between the Lyα escape fraction and dust attenuation is found among the LAHAEs, suggesting that dust absorption is responsible for the suppression of the escaping Lyα photons. However, the estimated Lyα escape fraction of individual LAHAEs varies by up to ∼3 percentage points between the two methods of extinction correction. We find the global Lyα escape fraction at z = 2.24 to be (3.7 ± 1.4)% in the ECDFS. The variation in the color excess of the extinction causes a discrepancy of ∼1 percentage

  4. The Escape of Ionizing Photons from OB Associations in Disk Galaxies Radiation Transfer Through Superbubbles

    CERN Document Server

    Dove, J B; Ferrara, A; Dove, James B.; Ferrara, Andrea

    1999-01-01

    By solving the time-dependent radiation transfer problem of stellar radiation through evolving superbubbles within a smoothly varying H I distribution, we have estimated the fraction of ionizing photons emitted by OB associations that escapes the H I disk of our Galaxy. We considered a coeval star-formation history and a Gaussian star-formation history with a time spread sigma_t = 2 Myr. We find that the shells of the expanding superbubbles quickly trap or attenuate the ionizing flux, such that most of the escaping radiation escapes shortly after the formation of the superbubble. Superbubbles of large associations can blowout of the H I disk and form dynamic chimneys, which allow the ionizing radiation directly to escape the H I disk. However, blowout occurs when the ionizing photon luminosity has dropped well below the association's maximum luminosity. For the coeval star-formation history, the fraction of photons that escape each side of the disk in the solar vicinity is f_esc approx 6% (the total fraction ...

  5. Sputtering at Mars: MAVEN observations of precipitating and escaping oxygen during nominal and extreme conditions

    Science.gov (United States)

    Curry, Shannon; Luhmann, Janet; Dong, Chuanfei; Ma, Yingjuan; Leblanc, Francois; Modolo, Ronan; Brain, David; Gruesbeck, Jacob; Hara, Takuya; Halekas, Jasper; Dong, Yaxue; Williamson, Hayley N.; Johnson, Robert E.; McFadden, James; Espley, Jared R.; Mitchell, David; Connerney, Jack; Eparvier, Frank; Lillis, Robert J.; Jakosky, Bruce

    2016-10-01

    Sputtering is believed to be one of the dominant escape mechanisms during the early epochs of our solar system when the solar activity and EUV intensities were much higher than the present day. Mars lacks a global dynamo magnetic field, which creates a scenario where the solar wind directly interacts with the upper atmosphere and newly created ions can be picked up and swept away by the background convection electric field. These pick-up ions can directly escape or precipitate back into the atmosphere and induce atmospheric sputtering of neutrals.The MAVEN spacecraft has observed the Mars upper atmosphere, ionosphere, magnetic topology and interactions with the Sun and solar wind during numerous Interplanetary Coronal Mass Ejection (ICME) impacts spanning from March 2015 to June 2016. ICMEs are associated with enhanced solar wind velocities, densities and magnetic field strength, and often drive heavy ion precipitation at much higher rates than during nominal conditions. Thus, ICMEs provide a unique environment for observing sputtering. We will compare MAVEN observations of heavy ion precipitation during nominal conditions as well as during ICMEs. Additionally, we will present global MHD and test particle simulations of the ICMEs in order to calculate sputtering escape rates for oxygen. Finally, we will use the observed and modeled sputtering escape rates to provide an initial estimate of the total sputtered atmospheric escape from Mars over billions of years.

  6. How Hospitable Are Space Weather Affected Habitable Zones? The Role of Ion Escape

    Science.gov (United States)

    Airapetian, Vladimir S.; Glocer, Alex; Khazanov, George V.; Loyd, R. O. P.; France, Kevin; Sojka, Jan; Danchi, William C.; Liemohn, Michael W.

    2017-02-01

    Atmospheres of exoplanets in the habitable zones around active young G-K-M stars are subject to extreme X-ray and EUV (XUV) fluxes from their host stars that can initiate atmospheric erosion. Atmospheric loss affects exoplanetary habitability in terms of surface water inventory, atmospheric pressure, the efficiency of greenhouse warming, and the dosage of the UV surface irradiation. Thermal escape models suggest that exoplanetary atmospheres around active K-M stars should undergo massive hydrogen escape, while heavier species including oxygen will accumulate forming an oxidizing atmosphere. Here, we show that non-thermal oxygen ion escape could be as important as thermal, hydrodynamic H escape in removing the constituents of water from exoplanetary atmospheres under supersolar XUV irradiation. Our models suggest that the atmospheres of a significant fraction of Earth-like exoplanets around M dwarfs and active K stars exposed to high XUV fluxes will incur a significant atmospheric loss rate of oxygen and nitrogen, which will make them uninhabitable within a few tens to hundreds of Myr, given a low replenishment rate from volcanism or cometary bombardment. Our non-thermal escape models have important implications for the habitability of the Proxima Centauri’s terrestrial planet.

  7. Escape from Telomere-Driven Crisis Is DNA Ligase III Dependent

    Directory of Open Access Journals (Sweden)

    Rhiannon E. Jones

    2014-08-01

    Full Text Available Short dysfunctional telomeres are capable of fusion, generating dicentric chromosomes and initiating breakage-fusion-bridge cycles. Cells that escape the ensuing cellular crisis exhibit large-scale genomic rearrangements that drive clonal evolution and malignant progression. We demonstrate that there is an absolute requirement for fully functional DNA ligase III (LIG3, but not ligase IV (LIG4, to facilitate the escape from a telomere-driven crisis. LIG3- and LIG4-dependent alternative (A and classical (C nonhomologous end-joining (NHEJ pathways were capable of mediating the fusion of short dysfunctional telomeres, both displaying characteristic patterns of microhomology and deletion. Cells that failed to escape crisis exhibited increased proportions of C-NHEJ-mediated interchromosomal fusions, whereas those that escaped displayed increased proportions of intrachromosomal fusions. We propose that the balance between inter- and intrachromosomal telomere fusions dictates the ability of human cells to escape crisis and is influenced by the relative activities of A- and C-NHEJ at short dysfunctional telomeres.

  8. EFFECT OF ESCAPE DEVICE FOR SUBMERGED FLOATING TUNNEL (SFT) ON HYDRODYNAMIC LOADS APPLIED TO SFT

    Institute of Scientific and Technical Information of China (English)

    DONG Man-sheng; MIAO Guo-ping; YONG Long-chang; NIU Zhong-rong; PANG Huan-ping; HOU Chao-qun

    2012-01-01

    This paper presents a potential approach to settle the problem of surviving major safety accidents in Submerged Floating Tunnel (SFT) that detachable emergency escape devices are set up outside SFT.The Computational Fluid Dynamics (CFD)technology is used to investigate the effect of emergency escape devices on the hydrodynamic load acting on SFT in uniform and oscillatory flows and water waves by numerical test.The governing equations,i.e.,the Reynolds-Averaged Navier-Stokes (RANS)equations and k - ε standard turbulence equations,are solved by the Finite Volume Method (FVM).Analytic solutions for the Airy wave are applied to set boundary conditions to generate water wave.The VOF method is used to trace the free surface.In uniform flow,hydrodynamic loads,applied to SFT with emergency escape device,reduce obviously.But,in oscillatory flow,it has little influence on hydrodynamic loads acting on SFT.Horizontal and vertical wave loads of SFT magnify to some extend due to emergency escape devices so that the influence of emergency escape devices on hydrodynamic loads of SFT should be taken into consideration when designed.

  9. Selectivity of escape-hole size in tube traps for whitespotted conger Conger myriaster

    Institute of Scientific and Technical Information of China (English)

    YANG Bingzhong; TANG Yanli; LIANG Zhenlin

    2011-01-01

    Comparative fishing experiments were carried out in 2010 using tube traps with five hole diameters (8,15,18,20 and 22 mm) to establish the size selectivity of escape holes for white-spotted conger.Selectivity and split parameters of the SELECT model were calculated using the estimated-split and equal-spilt model.From likelihood ratio tests and AIC (Akaike's Information Criterion) values,the estimated-split model was selected as the best-fit model.Size selectivity of escape holes in the tube traps was expressed as a logistic curve,similar to mesh selectivity.The 50% selection length of white-spotted conger in the estimated-split model was 28.26,33.35,39.31 and 47.30 cm for escape-hole diameters of 15,18,20 and 22 mm,respectively.The optimum escape-hole size is discussed with respect to management of the white-spotted conger fishery.The results indicate that tube traps with escape holes of 18 mm in diameter would benefit this fishery.

  10. The Mannose Receptor Is Involved in the Phagocytosis of Mycobacteria-Induced Apoptotic Cells

    Directory of Open Access Journals (Sweden)

    Teresa Garcia-Aguilar

    2016-01-01

    Full Text Available Upon Mycobacterium tuberculosis infection, macrophages may undergo apoptosis, which has been considered an innate immune response. The pathways underlying the removal of dead cells in homeostatic apoptosis have been extensively studied, but little is known regarding how cells that undergo apoptotic death during mycobacterial infection are removed. This study shows that macrophages induced to undergo apoptosis with mycobacteria cell wall proteins are engulfed by J-774A.1 monocytic cells through the mannose receptor. This demonstration was achieved through assays in which phagocytosis was inhibited with a blocking anti-mannose receptor antibody and with mannose receptor competitor sugars. Moreover, elimination of the mannose receptor by a specific siRNA significantly diminished the expression of the mannose receptor and the phagocytosis of apoptotic cells. As shown by immunofluorescence, engulfed apoptotic bodies are initially located in Rab5-positive phagosomes, which mature to express the phagolysosome marker LAMP1. The phagocytosis of dead cells triggered an anti-inflammatory response with the production of TGF-β and IL-10 but not of the proinflammatory cytokines IL-12 and TNF-α. This study documents the previously unreported participation of the mannose receptor in the removal of apoptotic cells in the setting of tuberculosis (TB infection. The results challenge the idea that apoptotic cell phagocytosis in TB has an immunogenic effect.

  11. Selection of apoptotic cell specific human antibodies from adult bone marrow.

    Directory of Open Access Journals (Sweden)

    Caroline Grönwall

    Full Text Available Autoreactive antibodies that recognize neo-determinants on apoptotic cells in mice have been proposed to have protective, homeostatic and immunoregulatory properties, although our knowledge about the equivalent antibodies in humans has been much more limited. In the current study, human monoclonal antibodies with binding specificity for apoptotic cells were isolated from the bone marrow of healthy adults using phage display technology. These antibodies were shown to recognize phosphorylcholine (PC-associated neo-determinants. Interestingly, three of the four identified apoptotic cell-specific antibody clones were encoded by VH3 region rearrangements with germline or nearly germline configuration without evidence of somatic hypermutation. Importantly, the different identified antibody clones had diverse heavy chain CDR3 and deduced binding surfaces as suggested by structure modeling. This may suggest a potentially great heterogeneity in human antibodies recognizing PC-related epitopes on apoptotic cells. To re-construct the postulated structural format of the parental anti-PC antibody, the dominant clone was also expressed as a recombinant human polymeric IgM, which revealed a substantially increased binding reactivity, with dose-dependent and antigen-inhibitable binding of apoptotic cells. Our findings may have implication for improved prognostic testing and therapeutic interventions in human inflammatory disease.

  12. Homocysteine and its thiolactone may promote apoptotic events in blood platelets in vitro.

    Science.gov (United States)

    Olas, Beata; Malinowska, Joanna; Rywaniak, Joanna

    2010-01-01

    The actions of homocysteine and its major metabolite, cyclic thioester, homocysteine thiolactone on endothelial cells, blood platelets, plasmatic fibrinogen and plasminogen--the important major components of haemostasis, regulating the flowing properties of blood--are complex and sometimes controversial. Homocysteine (Hcys) can promote apoptosis in endothelial cells, but the role of Hcys and its thiolactone in the apoptotic process in blood platelets is unknown. In order to study the appearance of apoptosis in platelets after treatment with the reduced form of Hcys or its thiolactone different markers were chosen: annexin V binding (phosphatidylserine exposure), platelet microparticle formation, mitochondrial membrane depolarization and αIIbβ3 expression in vitro. Apoptotic events and platelet activation were measured by a flow cytometer. In gel-filtered platelets treated with different concentrations of the reduced form of Hcys (25, 50 and 100 µM, 10 min) a significant increase of phosphatidylserine exposure (about 37% at the highest concentration, p < 0.001) and platelet microparticle formation were observed. Homocysteine caused also a dose-dependent depolarization of mitochondrial potential. The same apoptotic markers appeared in HTL-treated platelets (0.2 and 1 µM). Moreover, resveratrol (25 µM), a well known antioxidant, distinctly reduced the level of apoptotic markers. The obtained results indicate that Hcys and its thiolactone may promote in vitro apoptotic events in human gel-filtered platelets.

  13. Apoptotic effects of salinomycin on human ovarian cancer cell line (OVCAR-3).

    Science.gov (United States)

    Kaplan, Fuat; Teksen, Fulya

    2016-03-01

    In this study, we studied the apoptotic and cytotoxic effects of salinomycin on human ovarian cancer cell line (OVCAR-3) as salinomycin is known as a selectively cancer stem cell killer agent. We used immortal human ovarian epithelial cell line (IHOEC) as control group. Ovarian cancer cells and ovarian epithelial cells were treated by different concentrations of salinomycin such as 0.1, 1, and 40 μM and incubated for 24, 48, and 72 h. Dimethylthiazol (MTT) cell viability assay was performed to determine cell viability and toxicity. On the other hand, the expression levels of some of the apoptosis-related genes, namely anti-apoptotic Bcl-2, apoptotic Bax, and Caspase-3 were determined by quantitative real-time polymerase chain reaction (qRT-PCR). Additionally, Caspase-3 protein level was also determined. As a result, we concluded that incubation of human OVCAR-3 by 0.1 μM concentration of salinomycin for 24 h killed 40 % of the cancer cells by activating apoptosis but had no effect on normal cells. The apoptotic Bax gene expression was upregulated but anti-apoptotic Bcl-2 gene expression was downregulated. Active Caspase-3 protein level was increased significantly (p < 0.05).

  14. Modafinil abrogates methamphetamine-induced neuroinflammation and apoptotic effects in the mouse striatum.

    Directory of Open Access Journals (Sweden)

    Mariana Raineri

    Full Text Available Methamphetamine is a drug of abuse that can cause neurotoxic damage in humans and animals. Modafinil, a wake-promoting compound approved for the treatment of sleeping disorders, is being prescribed off label for the treatment of methamphetamine dependence. The aim of the present study was to investigate if modafinil could counteract methamphetamine-induced neuroinflammatory processes, which occur in conjunction with degeneration of dopaminergic terminals in the mouse striatum. We evaluated the effect of a toxic methamphetamine binge in female C57BL/6 mice (4 × 5 mg/kg, i.p., 2 h apart and modafinil co-administration (2 × 90 mg/kg, i.p., 1 h before the first and fourth methamphetamine injections on glial cells (microglia and astroglia. We also evaluated the striatal expression of the pro-apoptotic BAX and anti-apoptotic Bcl-2 proteins, which are known to mediate methamphetamine-induced apoptotic effects. Modafinil by itself did not cause reactive gliosis and counteracted methamphetamine-induced microglial and astroglial activation. Modafinil also counteracted the decrease in tyrosine hydroxylase and dopamine transporter levels and prevented methamphetamine-induced increases in the pro-apoptotic BAX and decreases in the anti-apoptotic Bcl-2 protein expression. Our results indicate that modafinil can interfere with methamphetamine actions and provide protection against dopamine toxicity, cell death, and neuroinflammation in the mouse striatum.

  15. Inhibitory effects of apoptotic cell ingestion upon endotoxin-driven myeloid dendritic cell maturation.

    Science.gov (United States)

    Stuart, Lynda M; Lucas, Mark; Simpson, Cathy; Lamb, Jonathan; Savill, John; Lacy-Hulbert, Adam

    2002-02-15

    Dendritic cells (DCs) are the sentinels of the immune system, able to interact with both naive and memory T cells. The recent observation that DCs can ingest cells dying by apoptosis has raised the possibility that DCs may, in fact, present self-derived Ags, initiating both autoimmunity and tumor-specific responses, especially if associated with appropriate danger signals. Although the process of ingestion of apoptotic cells has not been shown to induce DC maturation, the exact fate of these phagocytosing DCs remains unclear. In this paper we demonstrate that DCs that ingest apoptotic cells are able to produce TNF-alpha but have a diminished ability to produce IL-12 in response to external stimuli, a property that corresponds to a failure to up-regulate CD86. By single-cell analysis we demonstrate that these inhibitory effects are restricted to those DCs that have engulfed apoptotic cells, with bystander DCs remaining unaffected. These changes were independent of the production of anti-inflammatory cytokines TGF-beta1 and IL-10 and corresponded with a diminished capacity to stimulate naive T cells. Thus, the ingestion of apoptotic cells is not an immunologically null event but is capable of modulating DC maturation. These results have important implications for our understanding of the role of clearance of dying cells by DCs not only in the normal resolution of inflammation but also in control of subsequent immune responses to apoptotic cell-derived Ags.

  16. FSAP-mediated nucleosome release from late apoptotic cells is inhibited by autoantibodies present in SLE.

    Science.gov (United States)

    Marsman, Gerben; Stephan, Femke; de Leeuw, Karina; Bulder, Ingrid; Ruinard, Jessica T; de Jong, Jan; Westra, Johanna; Bultink, Irene E M; Voskuyl, Alexandre E; Aarden, Lucien A; Luken, Brenda M; Kallenberg, Cees G M; Zeerleder, Sacha

    2016-03-01

    Inefficient clearance of apoptotic cells and the subsequent exposure of the immune system to nuclear contents are crucially involved in the pathogenesis of systemic lupus erythematosus (SLE). Factor VII-activating protease (FSAP) is activated in serum upon contact with dead cells, and releases nucleosomes from late apoptotic cells into the extracellular environment. We investigated whether FSAP-mediated nucleosome release from late apoptotic cells is affected in SLE patients. Nucleosome release in sera of 27 SLE patients and 30 healthy controls was investigated by incubating late apoptotic Jurkat cells with serum and analyzing the remaining DNA content by flow cytometry. We found that nucleosome release in sera of SLE patients with high disease activity was significantly decreased when compared with that in SLE sera obtained during low disease activity or from healthy individuals. Upon removal of IgG/IgM antibodies from SLE sera, nucleosome release was restored. Similarly, monoclonal antinuclear antibodies inhibited nucleosome release in healthy donor serum or by plasma-purified FSAP. This inhibition was lost when Fab fragments were used, suggesting that antigen cross-linking is involved. In conclusion, FSAP-mediated nucleosome release from late apoptotic cells is greatly impaired in SLE patient sera, possibly hampering the clearance of these cells and thereby propagating inflammation.

  17. Milk fat globule-EGF factor 8 mediates the enhancement of apoptotic cell clearance by glucocorticoids.

    Science.gov (United States)

    Lauber, K; Keppeler, H; Munoz, L E; Koppe, U; Schröder, K; Yamaguchi, H; Krönke, G; Uderhardt, S; Wesselborg, S; Belka, C; Nagata, S; Herrmann, M

    2013-09-01

    The phagocytic clearance of apoptotic cells is essential to prevent chronic inflammation and autoimmunity. The phosphatidylserine-binding protein milk fat globule-EGF factor 8 (MFG-E8) is a major opsonin for apoptotic cells, and MFG-E8(-/-) mice spontaneously develop a lupus-like disease. Similar to human systemic lupus erythematosus (SLE), the murine disease is associated with an impaired clearance of apoptotic cells. SLE is routinely treated with glucocorticoids (GCs), whose anti-inflammatory effects are consentaneously attributed to the transrepression of pro-inflammatory cytokines. Here, we show that the GC-mediated transactivation of MFG-E8 expression and the concomitantly enhanced elimination of apoptotic cells constitute a novel aspect in this context. Patients with chronic inflammation receiving high-dose prednisone therapy displayed substantially increased MFG-E8 mRNA levels in circulating monocytes. MFG-E8 induction was dependent on the GC receptor and several GC response elements within the MFG-E8 promoter. Most intriguingly, the inhibition of MFG-E8 induction by RNA interference or genetic knockout strongly reduced or completely abolished the phagocytosis-enhancing effect of GCs in vitro and in vivo. Thus, MFG-E8-dependent promotion of apoptotic cell clearance is a novel anti-inflammatory facet of GC treatment and renders MFG-E8 a prospective target for future therapeutic interventions in SLE.

  18. Apico-basal forces exerted by apoptotic cells drive epithelium folding.

    Science.gov (United States)

    Monier, Bruno; Gettings, Melanie; Gay, Guillaume; Mangeat, Thomas; Schott, Sonia; Guarner, Ana; Suzanne, Magali

    2015-02-12

    Epithelium folding is a basic morphogenetic event that is essential in transforming simple two-dimensional epithelial sheets into three-dimensional structures in both vertebrates and invertebrates. Folding has been shown to rely on apical constriction. The resulting cell-shape changes depend either on adherens junction basal shift or on a redistribution of myosin II, which could be driven by mechanical signals. Yet the initial cellular mechanisms that trigger and coordinate cell remodelling remain largely unknown. Here we unravel the active role of apoptotic cells in initiating morphogenesis, thus revealing a novel mechanism of epithelium folding. We show that, in a live developing tissue, apoptotic cells exert a transient pulling force upon the apical surface of the epithelium through a highly dynamic apico-basal myosin II cable. The apoptotic cells then induce a non-autonomous increase in tissue tension together with cortical myosin II apical stabilization in the surrounding tissue, eventually resulting in epithelium folding. Together our results, supported by a theoretical biophysical three-dimensional model, identify an apoptotic myosin-II-dependent signal as the initial signal leading to cell reorganization and tissue folding. This work further reveals that, far from being passively eliminated as generally assumed (for example, during digit individualization), apoptotic cells actively influence their surroundings and trigger tissue remodelling through regulation of tissue tension.

  19. The deubiquitinating enzyme DUBAI stabilizes DIAP1 to suppress Drosophila apoptosis.

    Science.gov (United States)

    Yang, C-S; Sinenko, S A; Thomenius, M J; Robeson, A C; Freel, C D; Horn, S R; Kornbluth, S

    2014-04-01

    Deubiquitinating enzymes (DUBs) counteract ubiquitin ligases to modulate the ubiquitination and stability of target signaling molecules. In Drosophila, the ubiquitin-proteasome system has a key role in the regulation of apoptosis, most notably, by controlling the abundance of the central apoptotic regulator DIAP1. Although the mechanism underlying DIAP1 ubiquitination has been extensively studied, the precise role of DUB(s) in controlling DIAP1 activity has not been fully investigated. Here we report the identification of a DIAP1-directed DUB using two complementary approaches. First, a panel of putative Drosophila DUBs was expressed in S2 cells to determine whether DIAP1 could be stabilized, despite treatment with death-inducing stimuli that would induce DIAP1 degradation. In addition, RNAi fly lines were used to detect modifiers of DIAP1 antagonist-induced cell death in the developing eye. Together, these approaches identified a previously uncharacterized protein encoded by CG8830, which we named DeUBiquitinating-Apoptotic-Inhibitor (DUBAI), as a novel DUB capable of preserving DIAP1 to dampen Drosophila apoptosis. DUBAI interacts with DIAP1 in S2 cells, and the putative active site of its DUB domain (C367) is required to rescue DIAP1 levels following apoptotic stimuli. DUBAI, therefore, represents a novel locus of apoptotic regulation in Drosophila, antagonizing cell death signals that would otherwise result in DIAP1 degradation.

  20. Entropy and Enzyme Catalysis.

    Science.gov (United States)

    Åqvist, Johan; Kazemi, Masoud; Isaksen, Geir Villy; Brandsdal, Bjørn Olav

    2017-02-21

    The role played by entropy for the enormous rate enhancement achieved by enzymes has been debated for many decades. There are, for example, several confirmed cases where the activation free energy is reduced by around 10 kcal/mol due to entropic effects, corresponding to a rate enhancement of ∼10(7) compared to the uncatalyzed reaction. However, despite substantial efforts from both the experimental and theoretical side, no real consensus has been reached regarding the origin of such large entropic contributions to enzyme catalysis. Another remarkable instance of entropic effects is found in enzymes that are adapted by evolution to work at low temperatures, near the freezing point of water. These cold-adapted enzymes invariably show a more negative entropy and a lower enthalpy of activation than their mesophilic orthologs, which counteracts the exponential damping of reaction rates at lower temperature. The structural origin of this universal phenomenon has, however, remained elusive. The basic problem with connecting macroscopic thermodynamic quantities, such as activation entropy and enthalpy derived from Arrhenius plots, to the 3D protein structure is that the underlying detailed (microscopic) energetics is essentially inaccessible to experiment. Moreover, attempts to calculate entropy contributions by computer simulations have mostly focused only on substrate entropies, which do not provide the full picture. We have recently devised a new approach for accessing thermodynamic activation parameters of both enzyme and solution reactions from computer simulations, which turns out to be very successful. This method is analogous to the experimental Arrhenius plots and directly evaluates the temperature dependence of calculated reaction free energy profiles. Hence, by extensive molecular dynamics simulations and calculations of up to thousands of independent free energy profiles, we are able to extract activation parameters with sufficient precision for making

  1. Angiotensin-converting enzyme

    DEFF Research Database (Denmark)

    Sørensen, P G; Rømer, F K; Cortes, D

    1984-01-01

    In order to evaluate bleomycin-associated lung damage in humans, lung function parameters and serum levels of the endothelial-bound angiotensin-converting enzyme (ACE) were determined by serial measurements in 11 patients who were treated for testicular cancer. None developed clinical or radiolog......In order to evaluate bleomycin-associated lung damage in humans, lung function parameters and serum levels of the endothelial-bound angiotensin-converting enzyme (ACE) were determined by serial measurements in 11 patients who were treated for testicular cancer. None developed clinical...

  2. Inter- vs intra-individual variation and temporal repeatability of escape responses in the coral reef fish Amblyglyphidodon curacao

    Directory of Open Access Journals (Sweden)

    Maïwenn Jornod

    2015-11-01

    Full Text Available Fast-start escape responses are critical behaviours used by fishes during predator-prey encounters and some interactions with hetero- and conspecifics. In experimental studies, escape responses are often measured once per individual and considered representative of maximum performance. However, few studies have compared variability and repeatability in escape performances within and among individuals. Using the tropical damselfish Amblyglyphidodon curacao, we quantified inter- and intra-individual variation in behavioural and kinematic components of escape performance during repeated presentations of a stimulus at 15 min intervals. Individual maximum escape performance was repeatable through time, but there was considerable variation in the magnitude of responses both among and within fish. We found no evidence of habituation or fatigue due to repeated stimulations, suggesting that fish can be stimulated multiple times to ensure that an accurate estimate of maximum escape performance is obtained.

  3. 3D Simulations of the variability of the atmospheric escape at Mars with the EUV solar flux

    Science.gov (United States)

    Chaufray, J.-Y.; Leblanc, F.; Modolo, R.; Gonzalez-Galindo, F.; Lopez-Valverde, M.; Forget, F.

    2014-04-01

    The exosphere is the collisionless region surrounding a planetary atmosphere. The exosphere of Mars is an important region to characterize the escape processes. It is mainly formed from processes responsible of the atmospheric escape in the underlying atmosphere/ionosphere. The Martian exosphere is mainly composed of atomic hydrogen, molecular hydrogen and atomic oxygen. Atomic and molecular hydrogen escape is dominated by the thermal escape while the oxygen escape is dominated by the O2+ dissociative recombination in the Martian upper ionosphere. Therefore their escape rates are expected to vary strongly with the EUV solar flux which is the main driver of the heating and ionization of the Martian upper atmosphere. In this presentation, we will present simulations obtained from a 3D Martian exospheric model, coupled to the 3D GCM-LMD model for different solar UV conditions representative of current and past conditions.

  4. Carbapenemase producing bacteria in the food supply escaping detection.

    Directory of Open Access Journals (Sweden)

    Beverly J Morrison

    Full Text Available Carbapenem antimicrobials are critically important to human health and they are often the only remaining effective antibiotics for treating serious infections. Resistance to these drugs mediated by acquired carbapenemase enzymes is increasingly encountered in gram-negative bacteria and is considered a public health emergency. Animal origin food products are recognized as a potential source of resistant organisms, although carbapenem resistance has only recently been reported. In western countries there are active resistance surveillance programs targeting food animals and retail meat products. These programs primarily target beef, pork and poultry and focus exclusively on E. coli, Salmonella, Campylobacter spp. and Enterococcus spp. This global surveillance strategy does not capture the diversity of foods available nor does it address the presence of resistance gene-bearing mobile genetic elements in non-pathogenic bacterial taxa. To address this gap, a total of 121 seafood products originating in Asia purchased from retail groceries in Canada were tested. Samples were processed using a taxa-independent method for the selective isolation of carbapenem resistant organisms. Isolates were characterized by phenotypic antimicrobial susceptibility testing, PCR and DNA sequencing. Carbapenemase producing bacteria, all blaOXA-48, were isolated from 4 (3.3% of the samples tested. Positive samples originated from China (n=2 and Korea (n=2 and included squid, sea squirt, clams and seafood medley. Carbapenemase producing organisms found include Pseudomonas, Stenotrophomonas and Myroides species. These findings suggest that non-pathogenic bacteria, excluded from resistance surveillance programs, in niche market meats may serve as a reservoir of carbapenemase genes in the food supply.

  5. A Case of Hepatitis B Reactivation due to the Hepatitis B Virus Escape Mutant in a Patient undergoing Chemotherapy

    Institute of Scientific and Technical Information of China (English)

    Chunchen Wu; Hui Shi; Yun Wang; Mengji Lu; Yang Xu; Xinwen Chen

    2012-01-01

    A 62-year-old man had chronic hepatitis B virus (HBV) infection and was diagnosed with liver cirrhosis.At the time of diagnosis the patient's virologic markers were positive for hepatitis B surface antigen (HBsAg),antibody to hepatitis B e antigen (anti-HBe) and antibody to hepatitis B core antigen (anti-HBc),while antibody to hepatitis B surface antigen (anti-HBs) and HBV DNA were negative.Later the patient received chemotherapy for malignancy.However,this was interrupted due to elevated liver enzymes.At the same time HBV DNA became positive.Lamivudine (LMV) therapy was administered immediately.However,the levels of serum aminotransferase and total bilirubin (TB) were still rising.Finally the patient died of fulminant hepatic failure.A sequence revealed HBV genotype C (HBsAg subtype adw) with immune escape mutations,F8L,S34L,F41S,G44V,F93C,V96G,L110I,C149Y and F161Y.The high morbidity and mortality of this complication is one of the major obstacles to completing the standard treatment for malignancy in HBV carriers.Therefore,the relative risk of antiviral prophylactic failure should be further assessed and the optimal strategy for antiviral prophylaxis in HBsAg-positive patients with oncologic and hematologic malignancies undergoing chemotherapy should be revised.

  6. Eosinophil Granulocytes Account for Indoleamine 2,3-Dioxygenase-Mediated Immune Escape in Human Non Small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Simonetta Astigiano

    2005-04-01

    Full Text Available Indoleamine 2,3-dioxygenase (IDO, a catabolizing enzyme of tryptophan, is supposed to play a role in tumor immune escape. Its expression in solid tumors has not yet been well elucidated: IDO can be expressed by the tumor cells themselves, or by ill-defined infiltrating cells, possibly depending on tumor type. We have investigated IDO expression in 25 cases of non small cell lung cancer (NSCLC. Using histochemistry and immunohistochemistry, we found that IDO was expressed not by tumor cells, but by normal cells infiltrating the peritumoral stroma. These cells were neither macrophages nor dendritic cells, and were identified as eosinophil granulocytes. The amount of IDO-positive eosinophils varied in different cases, ranging from a few cells to more than 50 per field at x200 magnification. IDO protein in NSCLC was enzymatically active. Therefore, at least in NSCLC cases displaying a large amount of these cells in the inflammatory infiltrate, IDO-positive eosinophils could exert an effective immunosuppressive action. On analyzing the 17 patients with adequate follow-up, a significant relationship was found between the amount of IDO-positive infiltrate and overall survival. This finding suggests that the degree of IDO-positive infiltrate could be a prognostic marker in NSCLC.

  7. The Contribution of the Fas/FasL Apoptotic Pathway in Ulcer Formation during Leishmania major-Induced Cutaneous Leishmaniasis

    Science.gov (United States)

    Eidsmo, Liv; Nylen, Susanne; Khamesipour, Ali; Hedblad, Mari-Anne; Chiodi, Francesca; Akuffo, Hannah

    2005-01-01

    Cutaneous leishmaniasis (CL), caused by the intracellular protozoan Leishmania major, is characterized by lesion formation and ulceration at the site of infection. The mechanism of ulcer formation during CL is not fully understood. The expression of Fas and FasL and the levels of apoptosis in skin biopsies and in restimulated blood mononuclear cells from patients with 1 to 7 months of L. major-induced CL were analyzed using immunohistochemistry and fluorescence-activated cell sorting analysis. The levels of soluble Fas and FasL were also analyzed by enzyme-linked immunosorbent assay. A substantial number of apoptotic keratinocytes were observed mainly in the superficial epidermis of morphologically active and healing CL skin samples. Fas expression was increased on epidermis in active CL, whereas Fas expression was similar in healing and healthy epidermis. FasL-expressing macrophages and T cells were found in subepidermal infiltrate, mainly in active disease. When CL peripheral blood mononuclear cells were restimulated with L. major, Fas was up-regulated on effector T cells, and high levels of sFasL were secreted. Supernatants from restimulated cultures induced apoptosis in human keratinocytes (HaCaT), possibly through Fas/FasL interactions. Our results indicate that FasL-expressing effector T cells and macrophages may act to induce apoptosis and ulcer formation in Fas-expressing keratinocytes during L. major infection. PMID:15793290

  8. Mathematical modeling of the heat treatment and combustion of a coal particle. III. Volatile escape stage

    Science.gov (United States)

    Enkhjargal, Kh.; Salomatov, V. V.

    2011-05-01

    The present paper is a continuation of previous publications of the authors in this journal in which two phases of the multistage process of combustion of a coal particle were considered in detail with the help of mathematical modeling: its radiation-convection heating and drying. In the present work, the escape dynamics of volatiles is investigated. The physico-mathematical model of the thermodestruction of an individual coal particle with a dominant influence of endothermal effects has been formulated. Approximate-analytical solutions of this model that are of paramount importance for detailed analysis of the influence of the physical and regime parameters on the escape dynamics of volatiles have been found. The results obtained form the basis for engineering calculations of the volatile escape stage and can be used successfully in the search for effective regimes of burning of various solid fuels, in particular, Shivé-Ovoos coal of Mongolia.

  9. Intermittent cold water swim stress increases immobility and interferes with escape performance in rat.

    Science.gov (United States)

    Christianson, John P; Drugan, Robert C

    2005-11-30

    The behavioral consequences of intermittent, 5 s cold-water swims (15 degrees C) or confinement were assessed 24 h after stress in a 5 min forced swim test or an instrumental swim escape test (SET). The SET was conducted with temporal and instrumental parameters similar to the shock-motivated shuttle escape test. The tests detected significantly increased immobility in the forced swim test and increased latency to escape in the SET. These results extend previous findings with intermittent swim stress and provide evidence that intermittent swim stress produces behavioral deficits similar to other stress models. This new model may be a useful tool for exploring the physiological mechanisms underlying the stress response.

  10. Precipitation of Energetic Neutral Atoms and Induced Non-Thermal Escape Fluxes from the Martian Atmosphere

    CERN Document Server

    Lewkow, Nicholas

    2014-01-01

    The precipitation of energetic neutral atoms (ENAs), produced through charge exchange (CX) collisions between solar wind (SW) ions and thermal atmospheric gases, is investigated. Subsequent induced non-thermal escape fluxes have been carried out for the Martian atmosphere. Detailed modeling of the ENA energy input and determination of connections between parameters of precipitating ENAs and resulting escape fluxes, reflection coefficients of fast atoms from the Mars atmosphere, and altitude dependent ENA energy distributions are established using Monte Carlo (MC) simulations of the precipitation process with accurate quantum mechanical (QM) cross sections. Detailed descriptions of secondary hot (SH) atoms and molecules induced by ENAs have been obtained for a better understanding of the mechanisms responsible for atmospheric escape and evolution. The effects of using isotropic hard sphere (HS) cross sections as compared to realistic, anisotropic quantum cross sections are examined for energy-deposition profil...

  11. Escape and collision dynamics in the planar equilateral restricted four-body problem

    CERN Document Server

    Zotos, Euaggelos E

    2016-01-01

    We consider the planar circular equilateral restricted four body-problem where a test particle of infinitesimal mass is moving under the gravitational attraction of three primary bodies which move on circular orbits around their common center of gravity, such that their configuration is always an equilateral triangle. The case where all three primaries have equal masses is numerically investigated. A thorough numerical analysis takes place in the configuration $(x,y)$ as well as in the $(x,C)$ space in which we classify initial conditions of orbits into four main categories: (i) bounded regular orbits, (ii) trapped chaotic orbits, (iii) escaping orbits and (iv) collision orbits. Interpreting the collision motion as leaking in the phase space we related our results to both chaotic scattering and the theory of leaking Hamiltonian systems. We successfully located the escape and the collision basins and we managed to correlate them with the corresponding escape and collision times of orbits. We hope our contribut...

  12. Studying Lyman-alpha escape and reionization in Green Pea galaxies

    Science.gov (United States)

    Yang, Huan; Malhotra, Sangeeta; Rhoads, James E.; Gronke, Max; Leitherer, Claus; Wofford, Aida; Dijkstra, Mark

    2017-01-01

    Green Pea galaxies are low-redshift galaxies with extreme [OIII]5007 emission line. We built the first statistical sample of Green Peas observed by HST/COS and used them as analogs of high-z Lyman-alpha emitters to study Ly-alpha escape and Ly-alpha sizes. Using the HST/COS 2D spectra, we found that Ly-alpha sizes of Green Peas are larger than the UV continuum sizes. We found many correlations between Ly-alpha escape fraction and galactic properties -- dust extinction, Ly-alpha kinematic features, [OIII]/[OII] ratio, and gas outflow velocities. We fit an empirical relation to predict Ly-alpha escape fraction from dust extinction and Ly-alpha red-peak velocity. In the JWST era, we can use this relation to derive the IGM HI column density along the line of sight of each high-z Ly-alpha emitter and probe the reionization process.

  13. The surface science of enzymes

    DEFF Research Database (Denmark)

    Rod, Thomas Holm; Nørskov, Jens Kehlet

    2002-01-01

    One of the largest challenges to science in the coming years is to find the relation between enzyme structure and function. Can we predict which reactions an enzyme catalyzes from knowledge of its structure-or from its amino acid sequence? Can we use that knowledge to modify enzyme function......? To solve these problems we must understand in some detail how enzymes interact with reactants from its surroundings. These interactions take place at the surface of the enzyme and the question of enzyme function can be viewed as the surface science of enzymes. In this article we discuss how to describe...... catalysis by enzymes, and in particular the analogies between enzyme catalyzed reactions and surface catalyzed reactions. We do this by discussing two concrete examples of reactions catalyzed both in nature (by enzymes) and in industrial reactors (by inorganic materials), and show that although analogies...

  14. Apoptotic cell and phagocyte interplay: recognition and consequences in different cell systems

    Directory of Open Access Journals (Sweden)

    Moreira Maria Elisabete C.

    2004-01-01

    Full Text Available Cell death by apoptosis is characterized by specific biochemical changes, including the exposure of multiple ligands, expected to tag the dying cell for prompt recognition by phagocytes. In non-pathological conditions, an efficient clearance is assured by the redundant interaction between apoptotic cell ligands and multiple receptor molecules present on the engulfing cell surface. This review concentrates on the molecular interactions operating in mammalian and non-mammalian systems for apoptotic cell recognition, as well as on the consequences of their signaling. Furthermore, some cellular models where the exposure of the phosphatidylserine (PS phospholipid, a classical hallmark of the apoptotic phenotype, is not followed by cell death will be discussed.

  15. Citohistological Manifestations of the Apoptotic Process in the Prepubescent Mouse Ovary (14-17 days

    Directory of Open Access Journals (Sweden)

    Liliana Petculescu Ciochina

    2015-05-01

    Full Text Available Follicular atresia is a process commonly encountered at ovarian level that limits the number of ovulations and, respectively, the reproductive potential of a female. Ovarian cells death is essential for maintaining homeostasis of this organ and is based on an apoptotic mechanism that ensures selection of the dominant follicle and the disappearance of follicles in excess. The present study evaluates the incidence of morphological changes specific for this process in the prepubescent mouse ovary by applying optical microscopy techniques. Microscopic analysis was performed on sections of ovarian tissue from mice females line NMRI aged 14-17 days. The results show, at this age, significant morphological changes at cellular level, specific for apoptotic process, as condensation and fragmentation of the genetic material, vacuolization of cell cytoplasm, destabilization of cell adhesion junctions and appearance of wide intercellular spaces, invasion of spaces created with leukocytes infiltrated, formation of apoptotic bodies.

  16. Cell-to-Cell stochastic fluctuations in apoptotic signaling can decide between life and death

    CERN Document Server

    Raychaudhuri, S; Nguyen, T; Khan, E M; Goldkorn, T

    2007-01-01

    Apoptosis, or genetically programmed cell death, is a crucial cellular process that maintains the balance between life and death in cells. The precise molecular mechanism of apoptosis signaling and how these two pathways are differentially activated under distinct apoptotic stimuli is poorly understood. We developed a Monte Carlo-based stochastic simulation model that can characterize distinct signaling behaviors in the two major pathways of apoptotic signaling using a novel probability distribution-based approach. Specifically, we show that for a weak death signal, such as low levels of death ligand Fas (CD95) binding or under stress conditions, the type 2 mitochondrial pathway dominates apoptotic signaling. Our results also show signaling in the type 2 pathway is stochastic, where the population average over many cells does not capture the cell-to-cell fluctuations in the time course (~1 - 10 hours) of downstream caspase-3 activation. On the contrary, the probability distribution of caspase-3 activation for...

  17. Hippocampal expression of apoptotic protease activating factor-1 following diffuse axonal injury under mild hypothermia

    Institute of Scientific and Technical Information of China (English)

    Peng Yang; Limin Zhang; Yunhe Zhang; Xifeng Zou; Qunxi Li; Yun Li; Jun Zhu; Jianmin Li; Aijun Fu; Qingjun Liu; Tong Chen; Zelin Sun; Zhiyong Zhang

    2011-01-01

    The influence of mild hypothermia on neural cell apoptosis remains poorly understood. Therefore, the present study established rat models of diffuse axonal injury (DAI) at 33 °C. Morris water maze results demonstrated significantly better learning and memory functions in DAI rats with hypothermia compared with DAI rats with normothermia. Expression of apoptotic protease activating factor-1 in the hippocampal CA1 region was significantly lower in the DAI hypothermia group compared with the DAI normothermia group. Expression of apoptotic protease activating factor-1 positively correlated with latency, but negatively correlated with platform location times and time of swimming in the quadrant area. Results suggested that post-traumatic mild hypothermia in a rat model of DAI could provide cerebral protection by attenuating expression of apoptotic protease activating factor-1.

  18. Apoptosis in Cellular Society: Communication between Apoptotic Cells and Their Neighbors

    Directory of Open Access Journals (Sweden)

    Yuhei Kawamoto

    2016-12-01

    Full Text Available Apoptosis is one of the cell-intrinsic suicide programs and is an essential cellular behavior for animal development and homeostasis. Traditionally, apoptosis has been regarded as a cell-autonomous phenomenon. However, recent in vivo genetic studies have revealed that apoptotic cells actively influence the behaviors of surrounding cells, including engulfment, proliferation, and production of mechanical forces. Such interactions can be bidirectional, and apoptosis is non-autonomously induced in a cellular community. Of note, it is becoming evident that active communication between apoptotic cells and living cells contributes to physiological processes during tissue remodeling, regeneration, and morphogenesis. In this review, we focus on the mutual interactions between apoptotic cells and their neighbors in cellular society and discuss issues relevant to future studies of apoptosis.

  19. Ultrastructural observation of human neutrophils during apoptotic cell death triggered by Entamoeba histolytica.

    Science.gov (United States)

    Sim, Seobo; Kim, Kyeong Ah; Yong, Tai-Soon; Park, Soon-Jung; Im, Kyung-il; Shin, Myeong Heon

    2004-12-01

    Neutrophils are important effector cells against protozoan extracellular parasite Entamoeba histolytica, which causes amoebic colitis and liver abscess in human beings. Apoptotic cell death of neutrophils is an important event in the resolution of inflammation and parasite's survival in vivo. This study was undertaken to investigate the ultrastructural aspects of apoptotic cells during neutrophil death triggered by Entamoeba histolytica. Isolated human neutrophils from the peripheral blood were incubated with or without live trophozoites of E. histolytica and examined by transmission electron microscopy (TEM). Neutrophils incubated with E. histolytica were observed to show apoptotic characteristics, such as compaction of the nuclear chromatin and swelling of the nuclear envelop. In contrast, neutrophils incubated in the absence of the amoeba had many protrusions of irregular cell surfaces and heterogenous nuclear chromatin. Therefore, it is suggested that Entamoeba-induced neutrophil apoptosis contribute to prevent unwanted tissue inflammation and damage in the amoeba-invaded lesions in vivo.

  20. Amperometric Enzyme Electrodes

    Science.gov (United States)

    1989-12-01

    form of carbon (glascy carbon, graphite, reticulated vitreous carbon, carbon paste, fiber or foil). Carbon is favored for enzyme immoblization...interference from spurious electroactive species in blood, t proprietary multilayer membranie that includes a cellulose acetate memirane and a Nucleopore

  1. Hydroalcoholic extract of cyperus rotundus ameliorates H2O2-induced human neuronal cell damage via its anti-oxidative and anti-apoptotic machinery.

    Science.gov (United States)

    Kumar, K Hemanth; Khanum, Farhath

    2013-01-01

    Hydrogen peroxide (H(2)O(2)), a major reactive oxygen species produced during oxidative stress, has been implicated in the pathophysiology of various neurodegenerative conditions. Cyperus rotundus is a traditional medicinal herb that has recently found applications in food and confectionary industries. In the current study, the neuroprotective effects of Cyperus rotundus rhizome extract (CRE) through its antioxidant and anti-apoptotic machinery to attenuate H(2)O(2)-induced cell damage on human neuroblastoma SH-SY5Y cells have been explored. The results obtained demonstrate that pretreatment of cells with CRE for 2 h before administration of H(2)O(2) for 24 h ameliorates the cytotoxicity induced by H(2)O(2) as evidenced by MTT and LDH assays. CRE exhibited potent antioxidant activity by regulating the enzymes/proteins levels such as SOD, CAT, GPx, GR, HSP-70, Caspase-3, and Bcl-2. The pretreatment restored H(2)O(2)-induced cellular, nuclear, and mitochondrial morphologies as well as increased the expression of Brain derived nerve growth factor (BDNF). The anti-oxidant and anti-apoptotic potentials of the plant extract may account for its high content of phenolics, flavonoids, and other active principles. Taken together, our findings suggest that CRE might be developed as an agent for neurodegeneration prevention or therapy.

  2. Interaction of apoptotic cells with macrophages upregulates COX-2/PGE2 and HGF expression via a positive feedback loop.

    Science.gov (United States)

    Byun, Ji Yeon; Youn, Young-So; Lee, Ye-Ji; Choi, Youn-Hee; Woo, So-Yeon; Kang, Jihee Lee

    2014-01-01

    Recognition of apoptotic cells by macrophages is crucial for resolution of inflammation, immune tolerance, and tissue repair. Cyclooxygenase-2 (COX-2)/prostaglandin E2 (PGE2) and hepatocyte growth factor (HGF) play important roles in the tissue repair process. We investigated the characteristics of macrophage COX-2 and PGE2 expression mediated by apoptotic cells and then determined how macrophages exposed to apoptotic cells in vitro and in vivo orchestrate the interaction between COX-2/PGE2 and HGF signaling pathways. Exposure of RAW 264.7 cells and primary peritoneal macrophages to apoptotic cells resulted in induction of COX-2 and PGE2. The COX-2 inhibitor NS-398 suppressed apoptotic cell-induced PGE2 production. Both NS-398 and COX-2-siRNA, as well as the PGE2 receptor EP2 antagonist, blocked HGF expression in response to apoptotic cells. In addition, the HGF receptor antagonist suppressed increases in COX-2 and PGE2 induction. The in vivo relevance of the interaction between the COX-2/PGE2 and HGF pathways through a positive feedback loop was shown in cultured alveolar macrophages following in vivo exposure of bleomycin-stimulated lungs to apoptotic cells. Our results demonstrate that upregulation of the COX-2/PGE2 and HGF in macrophages following exposure to apoptotic cells represents a mechanism for mediating the anti-inflammatory and antifibrotic consequences of apoptotic cell recognition.

  3. Interaction of Apoptotic Cells with Macrophages Upregulates COX-2/PGE2 and HGF Expression via a Positive Feedback Loop

    Directory of Open Access Journals (Sweden)

    Ji Yeon Byun

    2014-01-01

    Full Text Available Recognition of apoptotic cells by macrophages is crucial for resolution of inflammation, immune tolerance, and tissue repair. Cyclooxygenase-2 (COX-2/prostaglandin E2 (PGE2 and hepatocyte growth factor (HGF play important roles in the tissue repair process. We investigated the characteristics of macrophage COX-2 and PGE2 expression mediated by apoptotic cells and then determined how macrophages exposed to apoptotic cells in vitro and in vivo orchestrate the interaction between COX-2/PGE2 and HGF signaling pathways. Exposure of RAW 264.7 cells and primary peritoneal macrophages to apoptotic cells resulted in induction of COX-2 and PGE2. The COX-2 inhibitor NS-398 suppressed apoptotic cell-induced PGE2 production. Both NS-398 and COX-2-siRNA, as well as the PGE2 receptor EP2 antagonist, blocked HGF expression in response to apoptotic cells. In addition, the HGF receptor antagonist suppressed increases in COX-2 and PGE2 induction. The in vivo relevance of the interaction between the COX-2/PGE2 and HGF pathways through a positive feedback loop was shown in cultured alveolar macrophages following in vivo exposure of bleomycin-stimulated lungs to apoptotic cells. Our results demonstrate that upregulation of the COX-2/PGE2 and HGF in macrophages following exposure to apoptotic cells represents a mechanism for mediating the anti-inflammatory and antifibrotic consequences of apoptotic cell recognition.

  4. To the nucleolar density and size in apoptotic human leukemic myeloblasts produced in vitro by Trichostatin A

    Directory of Open Access Journals (Sweden)

    K Smetana

    2009-08-01

    Full Text Available The present study was designed to provide more information on nucleoli in apoptotic cells, which were represented in the present study by cultured leukemic myeloblasts (Kasumi-1 cells. The apoptotic process in these cells was produced by trichostatin A (TSA that is a histone deacetylase inhibitor with strong cytostatic effects. The selected TSA concentration added to cultures facilitated to study apoptotic and notapoptotic cells in one and the same specimen. The nucleolar diameter and density were determined using computer assisted measurement and densitometry in specimens stained for RNA. In comparison with not-apoptotic cells, in apoptotic cells, nucleolar mean diameter did not change significantly and nucleolar RNA density was also not apparently different. On the other hand, the cytoplasmic RNA density in apoptotic cells was markedly reduced. Thus it seemed to be possible that the transcribed RNA remained “frozen” within the nucleolus but its transport to the cytoplasm decreased or stopped. However, the possibility of the RNA degradation in the cytoplasm of apoptotic cells based on the present study cannot be eliminated. At this occasion it should be added that AgNORs reflecting nucleolar biosynthetic and cell proliferation activity in apoptotic cells decreased in number or disappeared. The presented results also indicated that large nucleoli intensely stained for RNA need not be necessarily related to the high nucleolar biosynthetic or cell proliferation activity and may be also present in apoptotic cells responding to the cytostatic treatment.

  5. Effect of hrHPV infection on anti-apoptotic gene and pro-apoptotic gene expression in cervical cancer tissue

    Institute of Scientific and Technical Information of China (English)

    Min-Er Tang

    2016-01-01

    Objective:To study the effect of hrHPV infection on anti-apoptotic gene and pro-apoptotic gene expression in cervical cancer tissue.Methods: A total of 56 patients with cervical cancer, 94 cases of patients with cervical intraepithelial neoplasia and 48 cases of patients with chronic cervicitis who were treated in our hospital from May 2013 to December 2015 were selected for study and included in malignant group, precancerous lesion group and benign group respectively. hrHPV infection as well as the expression of anti-apoptotic genes and pro-apoptotic genes in cervical tissue were detected.Results:hrHPV infection rate and viral load in cervical tissue of malignant group were significantly higher than those of precancerous lesion group and benign group; P27 and p16 levels in cervical tissue of malignant group were significantly lower than those of precancerous lesion group and benign group, and K-ras, c-myc, Prdx4 and TNFAIP8 levels were significantly higher than those of precancerous lesion group and benign group; the greater the HPV virus load, the lower the p27 and p16 levels and the higher the K-ras, c-myc, Prdx4 and TNFAIP8 levels in cervical tissue.Conclusions:hrHPV infection can result in tumor suppressor genes p27 and p16 expression deletion and increase the expression of proto-oncogene and apoptosis-inhibiting genes, and it is associated with the occurrence and development of cervical cancer.

  6. Computational enzyme design

    Science.gov (United States)

    Bolon, Daniel N.

    2002-08-01

    The long-term objective of computational enzyme design is the ability to generate efficient protein catalysts for any chemical reaction. This thesis develops and experimentally validates a general computational approach for the design of enzymes with novel function. In order to include catalytic mechanism in protein design, a high-energy state (HES) rotamer (side chain representation) was constructed. In this rotamer, substrate atoms are in a HES. In addition, at least one amino acid side chain is positioned to interact favorably with substrate atoms in their HES and facilitate the reaction. Including an amino acid side chain in the HES rotamer automatically positions substrate relative to a protein scaffold and allows protein design algorithms to search for sequences capable of interacting favorably with the substrate. Because chemical similarity exists between the transition state and the high-energy state, optimizing the protein sequence to interact favorably with the HES rotamer should lead to transition state stabilization. In addition, the HES rotamer model focuses the subsequent computational active site design on a relevant phase space where an amino acid is capable of interacting in a catalytically active geometry with substrate. Using a HES rotamer model of the histidine mediated nucleophilic hydrolysis of p-nitrophenyl acetate, the catalytically inert 108 residue E. coli thioredoxin as a scaffold, and the ORBIT protein design software to compute sequences, an active site scan identified two promising active site designs. Experimentally, both candidate ?protozymes? demonstrated catalytic activity significantly above background. In addition, the rate enhancement of one of these ?protozymes? was the same order of magnitude as the first catalytic antibodies. Because polar groups are frequently buried at enzyme-substrate interfaces, improved modeling of buried polar interactions may benefit enzyme design. By studying native protein structures, rules have been

  7. Role and Association of Inflammatory and Apoptotic Caspases in Renal Tubulointerstitial Fibrosis

    Directory of Open Access Journals (Sweden)

    You Ke

    2016-09-01

    Full Text Available Background/Aims: Caspases, an evolutionary conserved family of aspartate-specific cystein proteases, play pivotal roles in apoptotic and inflammatory signaling. Thus far, 14 mammalian caspases are identified and categorized into 3 distinct sub-types: inflammatory caspases, apoptotic initiator and apoptotic executioner. Caspase-1 is an inflammatory caspase, while caspase-7 belongs to apoptotic executioner. The roles and association of these two distinct types of caspases in renal tubulointerstitial fibrosis (TIF have not been well recognized. Methods: Caspase-1 inhibitor Z-YVAD-FMK and caspase-7 siRNA were used in tubular epithelial cell line NRK-52E (TECs to test their effects on transforming growth factor-beta1 (TGF-β1 stimulation. In vivo, Unilateral ureteral obstruction (UUO animal model was employed in wild-type (WT and caspase-1 knock out (KO (caspase-1-/- mice. Results: In current study, we found that caspase-7 was obviously activated in cultured TECs stimulated by TGF-β1 and in UUO model of WT mice. While in UUO model of caspase-1 KO mice, the increased caspase-7 activation was suppressed significantly along with reduced trans-differentiation and minimized extracellular matrix (ECM accumulation, as demonstrated by western blot, Masson trichrome staining and immunohistochemistry. In addition, pharmacological inhibition of caspase-1 dampened caspase-7 activation and TECs' transdifferentiation induced by TGF-β1 exposure, which was consistent with in vivo study. Notably, caspase-7 gene knock down by specific siRNA abrogated TGF-β1 driven TECs' trans-differentiation and reduced ECM accumulation. Conclusions: Our study associated inflammatory and apoptotic caspases in TIF for the first time and we further confirmed that caspase-1 activation is an upstream event of apoptotic caspase-7 induction in TIF triggered by UUO and in TECs mediated by TGF-β1 induced transdifferentiation.

  8. BAD-mediated apoptotic pathway is associated with human cancer development.

    Science.gov (United States)

    Stickles, Xiaomang B; Marchion, Douglas C; Bicaku, Elona; Al Sawah, Entidhar; Abbasi, Forough; Xiong, Yin; Bou Zgheib, Nadim; Boac, Bernadette M; Orr, Brian C; Judson, Patricia L; Berry, Amy; Hakam, Ardeshir; Wenham, Robert M; Apte, Sachin M; Berglund, Anders E; Lancaster, Johnathan M

    2015-04-01

    The malignant transformation of normal cells is caused in part by aberrant gene expression disrupting the regulation of cell proliferation, apoptosis, senescence and DNA repair. Evidence suggests that the Bcl-2 antagonist of cell death (BAD)-mediated apoptotic pathway influences cancer chemoresistance. In the present study, we explored the role of the BAD-mediated apoptotic pathway in the development and progression of cancer. Using principal component analysis to derive a numeric score representing pathway expression, we evaluated clinico-genomic datasets (n=427) from corresponding normal, pre-invasive and invasive cancers of different types, such as ovarian, endometrial, breast and colon cancers in order to determine the associations between the BAD-mediated apoptotic pathway and cancer development. Immunofluorescence was used to compare the expression levels of phosphorylated BAD [pBAD (serine-112, -136 and -155)] in immortalized normal and invasive ovarian, colon and breast cancer cells. The expression of the BAD-mediated apoptotic pathway phosphatase, PP2C, was evaluated by RT-qPCR in the normal and ovarian cancer tissue samples. The growth-promoting effects of pBAD protein levels in the immortalized normal and cancer cells were assessed using siRNA depletion experiments with MTS assays. The expression of the BAD-mediated apoptotic pathway was associated with the development and/or progression of ovarian (n=106, pcancers, as well as with ovarian endometriosis (n=20, pcancer cells compared to the immortalized normal cells, whereas PP2C gene expression was lower in the cancer compared to the ovarian tumor tissue samples (n=76, pcancer cells. The BAD-mediated apoptotic pathway is thus associated with the development of human cancers likely influenced by the protein levels of pBAD.

  9. Estimates of N2 narcosis and O2 toxicity during submarine escapes from 600 to 1,000 fsw.

    Science.gov (United States)

    Connor, Christopher W; Ferrigno, Massimo

    2009-01-01

    The U.S. Navy recommends submarine escape for depths down to 600 fsw, with deeper escapes entailing the risks of decompression sickness, nitrogen (N2) narcosis and CNS oxygen (O2) toxicity. However, the escape equipment, including the submarine escape and immersion equipment and the escape trunk, could probably function even at 1,000 fsw. Here we report a theoretical analysis of the risks of both N2 narcosis and CNS O2 toxicity for different escape profiles from 600 to 1,000 fsw. The effect of N2 narcosis, calculated as a function of N2 pressure in the brain using Gas Man software, was expressed as equivalent narcosis depth (END), corresponding to the depth at which the same pressure of N2 would be produced in the brain after five minutes of scuba diving with air. The risk of O2-induced convulsions was estimated using the model developed by Arieli et al. Different dwell times (DTs) at maximal pressure in the escape trunk (from 0 to 60 s) and lungs-to-brain circulation times (10 to 30 s) were included in our analysis. When DT in the escape trunk is very short (e.g., 10 s), the risk of either incapacitating N2 narcosis and/or O2-induced convulsions occurring in the trunk is low, even during escapes from 1,000 fsw.

  10. The Moderately Efficient Enzyme: Futile Encounters and Enzyme Floppiness.

    Science.gov (United States)

    Bar-Even, Arren; Milo, Ron; Noor, Elad; Tawfik, Dan S

    2015-08-18

    The pioneering model of Henri, Michaelis, and Menten was based on the fast equilibrium assumption: the substrate binds its enzyme reversibly, and substrate dissociation is much faster than product formation. Here, we examine this assumption from a somewhat different point of view, asking what fraction of enzyme-substrate complexes are futile, i.e., result in dissociation rather than product formation. In Knowles' notion of a "perfect" enzyme, all encounters of the enzyme with its substrate result in conversion to product. Thus, the perfect enzyme's catalytic efficiency, kcat/KM, is constrained by only the diffusion on-rate, and the fraction of futile encounters (defined as φ) approaches zero. The available data on >1000 different enzymes suggest that for ≥90% of enzymes φ > 0.99 and for the "average enzyme" φ ≥ 0.9999; namely, <1 of 10(4) encounters is productive. Thus, the "fast equilibrium" assumption holds for the vast majority of enzymes. We discuss possible molecular origins for the dominance of futile encounters, including the coexistence of multiple sub-states of an enzyme's active site (enzyme floppiness) and/or its substrate. Floppiness relates to the inherent flexibility of proteins, but also to conflicting demands, or trade-offs, between rate acceleration (the rate-determining chemical step) and catalytic turnover, or between turnover rate and accuracy. The study of futile encounters and active-site floppiness may contribute to a better understanding of enzyme catalysis, enzyme evolution, and improved enzyme design.

  11. Entire functions for which the escaping set is a spider's web

    Science.gov (United States)

    Sixsmith, D. J.

    2011-11-01

    We construct several new classes of transcendental entire functions, f, such that both the escaping set, I(f), and the fast escaping set, A(f), have a structure known as a spider's web. We show that some of these classes have a degree of stability under changes in the function. We show that new examples of functions for which I(f) and A(f) are spiders' webs can be constructed by composition, by differentiation, and by integration of existing examples. We use a property of spiders' webs to give new results concerning functions with no unbounded Fatou components.

  12. Entire functions for which the escaping set is a spider's web

    CERN Document Server

    Sixsmith, D J

    2010-01-01

    We construct several new classes of transcendental entire functions, f, such that both the escaping set, I(f), and the fast escaping set, A(f), have a structure known as a spider's web. We show that some of these classes have a degree of stability under changes in the function. We show that new examples of functions for which I(f) and A(f) are spiders' webs can be constructed by composition, by differentiation, and by integration of existing examples. We use a property of spiders' webs to give new results concerning functions with no unbounded Fatou components.

  13. Carrier transfer and thermal escape in CdTe/ZnTe quantum dots.

    Science.gov (United States)

    Man, Minh Tan; Lee, Hong Seok

    2014-02-24

    We report on the carrier transfer and thermal escape in CdTe/ZnTe quantum dots (QDs) grown on a GaAs substrate. The significant emission-energy-dependent decay time at high excitation intensity (35 W/cm2) is attributed to the lateral transfer of carriers in the QDs. At low temperature (thermally activated transition occurs between two different states separated by approximately 9 meV, while the main contribution to nonradiative processes is the thermal escape from QDs that is assisted by carrier scattering via the emission of longitudinal phonons through the excited QD states at high temperature, with energies of approximately 19 meV.

  14. Escape from intermittent repellers: periodic orbit theory for crossover from exponential to algebraic decay.

    Science.gov (United States)

    Dahlqvist, P

    1999-12-01

    We apply periodic orbit theory to study the asymptotic distribution of escape times from an intermittent map. The dynamical zeta function exhibits a branch point which is associated with an asymptotic power law escape. By an analytic continuation technique we compute a pair of complex conjugate zeroes beyond the branch point, associated with a preasymptotic exponential decay. The crossover time from an exponential to a power law is also predicted. The theoretical predictions are confirmed by numerical simulation. Applications to conductance fluctuations in quantum dots are discussed.

  15. Cubic Polynomial Maps with Periodic Critical Orbit, Part II: Escape Regions

    CERN Document Server

    Bonifant, Araceli; Milnor, John

    2009-01-01

    The parameter space $\\mathcal{S}_p$ for monic centered cubic polynomial maps with a marked critical point of period $p$ is a smooth affine algebraic curve whose genus increases rapidly with $p$. Each $\\mathcal{S}_p$ consists of a compact connectedness locus together with finitely many escape regions, each of which is biholomorphic to a punctured disk and is characterized by an essentially unique Puiseux series. This note will describe the topology of $\\mathcal{S}_p$, and of its smooth compactification, in terms of these escape regions. It concludes with a discussion of the real sub-locus of $\\mathcal{S}_p$.

  16. Escaping from a Liquidity Trap and Deflation: The Foolproof Way and Others

    OpenAIRE

    Svensson, Lars E. O.

    2003-01-01

    Existing proposals to escape from a liquidity trap and deflation, including my "Foolproof Way," are discussed in the light of the optimal way to escape. The optimal way involves three elements: (1) an explicit central-bank commitment to a higher future price level; (2) a concrete action that demonstrates the central bank's commitment, induces expectations of a higher future price level and jump-starts the economy; and (3) an exit strategy that specifies when and how to get back to normal. A c...

  17. Dynamical Creation of Channels for Particle Escape in the Solar Corona

    CERN Document Server

    Mahajan, S M; Nikolskaya, K I; Shatashvili, N L; Mahajan, Swadesh M.; Miklaszewski, Riszard; Nikol'skaya, Komunela I.; Shatashvili, Nana L.

    2003-01-01

    It is shown that the connection of sufficiently fast flows with dynamical channels for particle escape in the Solar Corona is rather direct: it depends on their ability to deform (in specific cases to distort) the ambient magnetic field lines to temporarily stretch (shrink, destroy) the closed field lines so that the flow can escape the local region. Using a dissipative two--fluid code in which the flows are treated at par with the currents, we have demonstrated channel creation in a variety of closed--field line structures. This self--induced transparency constitutes the active mode for the formation of the solar wind.

  18. Quantifying the escape mortality of trawl caught Antarctic krill (Euphausia superba)

    DEFF Research Database (Denmark)

    Krafft, Bjørn A; Krag, Ludvig Ahm; Engås, Arill;

    2016-01-01

    Antarctic krill (Euphausia superba) is an abundant fishery resource, the harvest levels of which are expected to increase. However, many of the length classes of krill can escape through commonly used commercial trawl mesh sizes. A vital component of the overall management of a fishery is to esti......Antarctic krill (Euphausia superba) is an abundant fishery resource, the harvest levels of which are expected to increase. However, many of the length classes of krill can escape through commonly used commercial trawl mesh sizes. A vital component of the overall management of a fishery...

  19. Escape of DNA from a weakly biased thin nanopore: Experimental evidence for a universal diffusive behavior

    Science.gov (United States)

    Hoogerheide, David P.; Albertorio, Fernando; Golovchenko, Jene A.

    2014-01-01

    We report experimental escape time distributions of double-stranded DNA (dsDNA) molecules initially threaded halfway through a thin solid-state nanopore. We find a universal behavior of the escape time distributions consistent with a one-dimensional first passage formulation notwithstanding the geometry of the experiment and the potential role of complex molecule-liquid-pore interactions. Diffusion constants that depend on the molecule length and pore size are determined. Also discussed are the practical implications of long time diffusive molecule trapping in the nanopore. PMID:24483704

  20. Stellar wind interaction and pick-up ion escape of the Kepler-11 "super-Earths"

    Science.gov (United States)

    Kislyakova, Kristina; Johnstone, Colin; Odert, Petra; Erkaev, Nikolai; Lammer, Helmut; Lüftinger, Theresa; Holmstöm, Mats; Khodachenko, Maxim; Güdel, Manuel

    2014-05-01

    We present the results of modeling of the interactions between stellar wind and the extended hydrogen-dominated upper atmospheres of planets and estimate the resulting escape of planetary pick-up ions from the 5 «super-Earths» in the compact Kepler-11 system. We compare the escape rates with the efficiency of the thermal escape of neutral hydrogen atoms. Assuming the stellar wind of Kepler-11 is similar to the solar wind, we used a polytropic 1D hydrodynamic wind model to estimate the wind properties at the planetary orbits. We applied a Direct Simulation Monte Carlo Model to model the hydrogen coronae and the stellar wind plasma interaction around Kepler-11b-f planets within a realistic expected heating efficiency range of 15-40%. The same model was used to estimate the ion pick-up escape from the XUV heated and hydrodynamically extended upper atmospheres of Kepler-11b-f. Modeling clarifies the influence of possible magnetic moments on escape processes and allows to estimate the charge exchange and photoionization production rates of planetary ions as well as the loss rates of pick-up H+ ions for all five planets. This study presents also the comparison of the results between the five 'super-Earths' and in a more general sense also with the thermal escape rates of the neutral planetary hydrogen atoms. Our results show that for all Kepler-11b-f exoplanets, a huge neutral hydrogen corona is formed around the planet. The non-symmetric form of the corona changes from planet to planet and is defined mostly by radiation pressure, charge-exchange and gravitational effects. According to our estimates, nonthermal escape rates of pick-up ionized hydrogen atoms for Kepler-11 «super-Earths» vary between ~ 6.4 × 1030 s-1 and ~ 4.1 × 1031 s-1 depending on the planet's orbital location and assumed heating efficiency. These values correspond to non-thermal mass loss rates of ~ 1.07 × 107 g·s-1 and ~ 6.8 × 107 g·s-1 respectively, which is a few percent of the thermal

  1. "We are free, you are slaves. Come on, let's run away": Escape from Constantia, 1712.

    OpenAIRE

    Paulse, Michele

    2014-01-01

    Slaves were imported to the Cape from 1658 to 1808. The majority of the captives lived in Cape Town and many other slaves lived on farms. Added to this captive population were political exiles. In 1712, 23 slaves and exiles gathered at Constantia, a renowned wine farm, to run away. Since the holding was an important homestead, one would expect that this escape would have been reconstructed in the histories of the farm and slavery at the Cape. At the time, the escape raised s...

  2. Antarctic krill; assessment of mesh size selectivity and escape mortality from trawls

    DEFF Research Database (Denmark)

    Krafft, Bjørn A.; Krag, Ludvig Ahm; Herrmann, Bent;

    2015-01-01

    This working paper presents the aims and methodology for a three-year-project (commenced in 2015) assessing size selectivity and escape mortality of Antarctic krill from trawl nets. The project is widely based on acquired experiences from a completed study Net Escapement of Antarctic krill...... in Trawls (NEAT), presented in WG-EMM 2012/24, WGEMM 2013/34, WG-EMM 2014/14 and WG-EMM 2014/16. Funding is provided by the Norwegian Research Council and ship-time for executing the field-experiments is offered free-of-charge by two Norwegian commercial fishing companies; Olympic Seafood AS and Aker Bio...

  3. Anti-apoptotic signaling as a cytoprotective mechanism in mammalian hibernation

    Directory of Open Access Journals (Sweden)

    Andrew N. Rouble

    2013-02-01

    Full Text Available In the context of normal cell turnover, apoptosis is a natural phenomenon involved in making essential life and death decisions. Apoptotic pathways balance signals which promote cell death (pro-apoptotic pathways or counteract these signals (anti-apoptotic pathways. We proposed that changes in anti-apoptotic proteins would occur during mammalian hibernation to aid cell preservation during prolonged torpor under cellular conditions that are highly injurious to most mammals (e.g. low body temperatures, ischemia. Immunoblotting was used to analyze the expression of proteins associated with pro-survival in six tissues of thirteen-lined ground squirrels, Ictidomys tridecemlineatus. The brain showed a concerted response to torpor with significant increases in the levels of all anti-apoptotic targets analyzed (Bcl-2, Bcl-xL, BI-1, Mcl-1, cIAP1/2, xIAP as well as enhanced phosphorylation of Bcl-2 at S70 and T56. Heart responded similarly with most anti-apoptotic proteins elevated significantly during torpor except for Bcl-xL and xIAP that decreased and Mcl-1 that was unaltered. In liver, BI-1 increased whereas cIAP1/2 decreased. In kidney, there was an increase in BI-1, cIAP and xIAP but decreases in Bcl-xL and p-Bcl-2(T56 content. In brown adipose tissue, protein levels of BI-1, cIAP1/2, and xIAP decreased significantly during torpor (compared with euthermia whereas Bcl-2, Bcl-xL, Mcl-1 were unaltered; however, Bcl-2 showed enhanced phosphorylation at Thr56 but not at Ser70. In skeletal muscle, only xIAP levels changed significantly during torpor (an increase. The data show that anti-apoptotic pathways have organ-specific responses in hibernators with a prominent potential role in heart and brain where coordinated enhancement of anti-apoptotic proteins occurred in response to torpor.

  4. Cloning and sequencing of a DNA fragment encoding N37 apoptotic peptide derived from p53

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Objective It was reported that p53 apoptotic peptide (N37) could inhibit p73 gene through being bound with iASPP,which could induce tumor cell apoptosis. To further explore the function of N37,we constructed the cloning plasmid of DNA fragment encoding p53 (N37) apoptotic peptide by using DNA synthesis and molecular biology methods. Methods According to human p53 sequence from the GenBank database,the primer of p53(N37) gene was designed using Primer V7.0 software. The DNA fragment encoding p53 (N37) apopto...

  5. Synthesis of apoptotic chalcone analogues in HepG2 human hepatocellular carcinoma cells.

    Science.gov (United States)

    Park, Cheon-Soo; Ahn, Yongchel; Lee, Dahae; Moon, Sung Won; Kim, Ki Hyun; Yamabe, Noriko; Hwang, Gwi Seo; Jang, Hyuk Jai; Lee, Heesu; Kang, Ki Sung; Lee, Jae Wook

    2015-12-15

    Eight chalcone analogues were prepared and evaluated for their cytotoxic effects in human hepatoma HepG2 cells. Compound 5 had a potent cytotoxic effect. The percentage of apoptotic cells was significantly higher in compound 5-treated cells than in control cells. Exposure to compound 5 for 24h induced cleavage of caspase-8 and -3, and poly (ADP-ribose) polymerase (PARP). Our findings suggest that compound 5 is the active chalcone analogue that contributes to cell death in HepG2 cells via the extrinsic apoptotic pathway.

  6. Regulation of apoptotic signal transduction pathways by the heat shock proteins

    Institute of Scientific and Technical Information of China (English)

    LI; Zhengyu; ZHAO; Xia; WEI; Yuquan

    2004-01-01

    The study about apoptotic signal transductions has become a project to reveal the molecular mechanisms of apoptosis. Heat shock proteins (hsps), which play an important role in cell growth and apoptosis, have attracted great attentions. A lot of researches have showed there is a hsps superfamily including hsp90, hsp70, hsp60 and hsp27, etc., which regulates the biological behaviors of cells, particularly apoptotic signal transduction in Fas pathway, JNK/SAPK pathway and caspases pathway at different levels, partly by the function of molecular chaperone.

  7. Amelioration of nandrolone decanoate-induced testicular and sperm toxicity in rats by taurine: Effects on steroidogenesis, redox and inflammatory cascades, and intrinsic apoptotic pathway

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Maha A.E., E-mail: mahapharm@yahoo.com

    2015-02-01

    The wide abuse of the anabolic steroid nandrolone decanoate by athletes and adolescents for enhancement of sporting performance and physical appearance may be associated with testicular toxicity and infertility. On the other hand, taurine; a free β-amino acid with remarkable antioxidant activity, is used in taurine-enriched beverages to boost the muscular power of athletes. Therefore, the purpose of this study was to investigate the mechanisms of the possible protective effects of taurine on nandrolone decanoate-induced testicular and sperm toxicity in rats. To achieve this aim, male Wistar rats were randomly distributed into four groups and administered either vehicle, nandrolone decanoate (10 mg/kg/week, I.M.), taurine (100 mg/kg/day, p.o.) or combination of taurine and nandrolone decanoate, for 8 successive weeks. Results of the present study showed that taurine reversed nandrolone decanoate-induced perturbations in sperm characteristics, normalized serum testosterone level, and restored the activities of the key steroidogenic enzymes; 3β-HSD, and 17β-HSD. Moreover, taurine prevented nandrolone decanoate-induced testicular toxicity and DNA damage by virtue of its antioxidant, anti-inflammatory, and anti-apoptotic effects. This was evidenced by taurine-induced modulation of testicular LDH-x activity, redox markers (MDA, NO, GSH contents, and SOD activity), inflammatory indices (TNF-α, ICAM-1 levels, and MMP-9 gene expression), intrinsic apoptotic pathway (cytochrome c gene expression and caspase-3 content), and oxidative DNA damage markers (8-OHdG level and comet assay). In conclusion, at the biochemical and histological levels, taurine attenuated nandrolone decanoate-induced poor sperm quality and testicular toxicity in rats. - Highlights: • Nandrolone decanoate (ND) disrupts sperm profile and steroidogenesis in rats. • ND upregulates gene expression of inflammatory and apoptotic markers. • Taurine normalizes sperm profile and serum testosterone level

  8. Quantifying factors determining the rate of CTL escape and reversion during acute and chronic phases of HIV infection

    Energy Technology Data Exchange (ETDEWEB)

    Ganusov, Vitaly V [Los Alamos National Laboratory; Korber, Bette M [Los Alamos National Laboratory; Perelson, Alan S [Los Alamos National Laboratory

    2009-01-01

    Human immunodeficiency virus (HIV) often evades cytotoxic T cell (CTL) responses by generating variants that are not recognized by CTLs. However, the importance and quantitative details of CTL escape in humans are poorly understood. In part, this is because most studies looking at escape of HIV from CTL responses are cross-sectional and are limited to early or chronic phases of the infection. We use a novel technique of single genome amplification (SGA) to identify longitudinal changes in the transmitted/founder virus from the establishment of infection to the viral set point at 1 year after the infection. We find that HIV escapes from virus-specific CTL responses as early as 30-50 days since the infection, and the rates of viral escapes during acute phase of the infection are much higher than was estimated in previous studies. However, even though with time virus acquires additional escape mutations, these late mutations accumulate at a slower rate. A poor correlation between the rate of CTL escape in a particular epitope and the magnitude of the epitope-specific CTL response suggests that the lower rate of late escapes is unlikely due to a low efficacy of the HIV-specific CTL responses in the chronic phase of the infection. Instead, our results suggest that late and slow escapes are likely to arise because of high fitness cost to the viral replication associated with such CTL escapes. Targeting epitopes in which virus escapes slowly or does not escape at all by CTL responses may, therefore, be a promising direction for the development of T cell based HIV vaccines.

  9. Halophilic adaptation of enzymes.

    Science.gov (United States)

    Madern, D; Ebel, C; Zaccai, G

    2000-04-01

    It is now clear that the understanding of halophilic adaptation at a molecular level requires a strategy of complementary experiments, combining molecular biology, biochemistry, and cellular approaches with physical chemistry and thermodynamics. In this review, after a discussion of the definition and composition of halophilic enzymes, the effects of salt on their activity, solubility, and stability are reviewed. We then describe how thermodynamic observations, such as parameters pertaining to solvent-protein interactions or enzyme-unfolding kinetics, depend strongly on solvent composition and reveal the important role played by water and ion binding to halophilic proteins. The three high-resolution crystal structures now available for halophilic proteins are analyzed in terms of haloadaptation, and finally cellular response to salt stress is discussed briefly.

  10. Nifedipine treatment reduces resting calcium concentration, oxidative and apoptotic gene expression, and improves muscle function in dystrophic mdx mice.

    Science.gov (United States)

    Altamirano, Francisco; Valladares, Denisse; Henríquez-Olguín, Carlos; Casas, Mariana; López, Jose R; Allen, Paul D; Jaimovich, Enrique

    2013-01-01

    Duchenne Muscular Dystrophy (DMD) is a recessive X-linked genetic disease, caused by mutations in the gene encoding dystrophin. DMD is characterized in humans and in mdx mice by a severe and progressive destruction of muscle fibers, inflammation, oxidative/nitrosative stress, and cell death. In mdx muscle fibers, we have shown that basal ATP release is increased and that extracellular ATP stimulation is pro-apoptotic. In normal fibers, depolarization-induced ATP release is blocked by nifedipine, leading us to study the potential therapeutic effect of nifedipine in mdx muscles and its relation with extracellular ATP signaling. Acute exposure to nifedipine (10 µM) decreased [Ca(2+)]r, NF-κB activity and iNOS expression in mdx myotubes. In addition, 6-week-old mdx mice were treated with daily intraperitoneal injections of nifedipine, 1 mg/Kg for 1 week. This treatment lowered the [Ca(2+)]r measured in vivo in the mdx vastus lateralis. We demonstrated that extracellular ATP levels were higher in adult mdx flexor digitorum brevis (FDB) fibers and can be significantly reduced after 1 week of treatment with nifedipine. Interestingly, acute treatment of mdx FDB fibers with apyrase, an enzyme that completely degrades extracellular ATP to AMP, reduced [Ca(2+)]r to a similar extent as was seen in FDB fibers after 1-week of nifedipine treatment. Moreover, we demonstrated that nifedipine treatment reduced mRNA levels of pro-oxidative/nitrosative (iNOS and gp91(phox)/p47(phox) NOX2 subunits) and pro-apoptotic (Bax) genes in mdx diaphragm muscles and lowered serum creatine kinase (CK) levels. In addition, nifedipine treatment increased muscle strength assessed by the inverted grip-hanging test and exercise tolerance measured with forced swimming test in mdx mice. We hypothesize that nifedipine reduces basal ATP release, thereby decreasing purinergic receptor activation, which in turn reduces [Ca(2+)]r in mdx skeletal muscle cells. The results in this work open new perspectives

  11. Nifedipine treatment reduces resting calcium concentration, oxidative and apoptotic gene expression, and improves muscle function in dystrophic mdx mice.

    Directory of Open Access Journals (Sweden)

    Francisco Altamirano

    Full Text Available Duchenne Muscular Dystrophy (DMD is a recessive X-linked genetic disease, caused by mutations in the gene encoding dystrophin. DMD is characterized in humans and in mdx mice by a severe and progressive destruction of muscle fibers, inflammation, oxidative/nitrosative stress, and cell death. In mdx muscle fibers, we have shown that basal ATP release is increased and that extracellular ATP stimulation is pro-apoptotic. In normal fibers, depolarization-induced ATP release is blocked by nifedipine, leading us to study the potential therapeutic effect of nifedipine in mdx muscles and its relation with extracellular ATP signaling. Acute exposure to nifedipine (10 µM decreased [Ca(2+]r, NF-κB activity and iNOS expression in mdx myotubes. In addition, 6-week-old mdx mice were treated with daily intraperitoneal injections of nifedipine, 1 mg/Kg for 1 week. This treatment lowered the [Ca(2+]r measured in vivo in the mdx vastus lateralis. We demonstrated that extracellular ATP levels were higher in adult mdx flexor digitorum brevis (FDB fibers and can be significantly reduced after 1 week of treatment with nifedipine. Interestingly, acute treatment of mdx FDB fibers with apyrase, an enzyme that completely degrades extracellular ATP to AMP, reduced [Ca(2+]r to a similar extent as was seen in FDB fibers after 1-week of nifedipine treatment. Moreover, we demonstrated that nifedipine treatment reduced mRNA levels of pro-oxidative/nitrosative (iNOS and gp91(phox/p47(phox NOX2 subunits and pro-apoptotic (Bax genes in mdx diaphragm muscles and lowered serum creatine kinase (CK levels. In addition, nifedipine treatment increased muscle strength assessed by the inverted grip-hanging test and exercise tolerance measured with forced swimming test in mdx mice. We hypothesize that nifedipine reduces basal ATP release, thereby decreasing purinergic receptor activation, which in turn reduces [Ca(2+]r in mdx skeletal muscle cells. The results in this work open new

  12. Thymosin beta 4 prevents oxidative stress by targeting antioxidant and anti-apoptotic genes in cardiac fibroblasts.

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar

    Full Text Available RATIONALE: Thymosin beta-4 (Tβ4 is a ubiquitous protein with diverse functions relating to cell proliferation and differentiation that promotes wound healing and modulates inflammatory responses. The effecter molecules targeted by Tβ4 for cardiac protection remains unknown. The purpose of this study is to determine the molecules targeted by Tβ4 that mediate cardio-protection under oxidative stress. METHODS: Rat neonatal fibroblasts cells were exposed to hydrogen peroxide (H(2O(2 in presence and absence of Tβ4 and expression of antioxidant, apoptotic and pro-fibrotic genes was evaluated by quantitative real-time PCR and western blotting. Reactive oxygen species (ROS levels were estimated by DCF-DA using fluorescent microscopy and fluorimetry. Selected antioxidant and antiapoptotic genes were silenced by siRNA transfections in cardiac fibroblasts and the effect of Tβ4 on H(2O(2-induced profibrotic events was evaluated. RESULTS: Pre-treatment with Tβ4 resulted in reduction of the intracellular ROS levels induced by H(2O(2 in the cardiac fibroblasts. This was associated with an increased expression of antioxidant enzymes Cu/Zn superoxide dismutase (SOD and catalase and reduction of Bax/Bcl(2 ratio. Tβ4 treatment reduced the expression of pro-fibrotic genes [connective tissue growth factor (CTGF, collagen type-1 (Col-I and collagen type-3 (Col-III] in the cardiac fibroblasts. Silencing of Cu/Zn-SOD and catalase gene triggered apoptotic cell death in the cardiac fibroblasts, which was prevented by treatment with Tβ4. CONCLUSION: This is the first report that exhibits the targeted molecules modulated by Tβ4 under oxidative stress utilizing the cardiac fibroblasts. Tβ4 treatment prevented the profibrotic gene expression in the in vitro settings. Our findings indicate that Tβ4 selectively targets and upregulates catalase, Cu/Zn-SOD and Bcl(2, thereby, preventing H(2O(2-induced profibrotic changes in the myocardium. Further studies are

  13. Self-consciousness and binge eating in college women : an escape from rumination?

    NARCIS (Netherlands)

    Dalley, Simon; Donofrio, Stacey

    2014-01-01

    Background: Binge-eating is a highly distressing symptom that has been found to co-occur with other symptoms of eating disorders such as bulimia nervosa. One perspective of binge eating is that it is an attempt to escape high levels of aversive self-consciousness. A primary aim of this study is to e

  14. Pleiotropic effects of hemagglutinin amino acid substitutions of H5 influenza escape mutants

    Energy Technology Data Exchange (ETDEWEB)

    Rudneva, Irina A.; Timofeeva, Tatiana A.; Ignatieva, Anna V.; Shilov, Aleksandr A.; Krylov, Petr S. [D.I. Ivanovsky Institute of Virology, 123098 Moscow (Russian Federation); Ilyushina, Natalia A., E-mail: Natalia.Ilyushina@fda.hhs.gov [FDA CDER, 29 Lincoln Drive, Bethesda, MD 20892 (United States); Kaverin, Nikolai V., E-mail: nik.kaverin@gmail.com [D.I. Ivanovsky Institute of Virology, 123098 Moscow (Russian Federation)

    2013-12-15

    In the present study we assessed pleiotropic characteristics of the antibody-selected mutations. We examined pH optimum of fusion, temperatures of HA heat inactivation, and in vitro and in vivo replication kinetics of the previously obtained influenza H5 escape mutants. Our results showed that HA1 N142K mutation significantly lowered the pH of fusion optimum. Mutations of the escape mutants located in the HA lateral loop significantly affected H5 HA thermostability (P<0.05). HA changes at positions 131, 144, 145, and 156 and substitutions at positions 131, 142, 145, and 156 affected the replicative ability of H5 escape mutants in vitro and in vivo, respectively. Overall, a co-variation between antigenic specificity and different HA phenotypic properties has been demonstrated. We believe that the monitoring of pleiotropic effects of the HA mutations found in H5 escape mutants is essential for accurate prediction of mutants with pandemic potential. - Highlights: • HA1 N142K mutation significantly lowered the pH of fusion optimum. • Mutations located in the HA lateral loop significantly affected H5 HA thermostability. • HA changes at positions 131, 142, 144, 145, and 156 affected the replicative ability of H5 mutants. • Acquisition of glycosylation site could lead to the emergence of multiple pleiotropic effects.

  15. Co-lethality studied as an asset against viral drug escape: the HIV protease case

    Directory of Open Access Journals (Sweden)

    Ollivier Emmanuelle

    2010-06-01

    Full Text Available Abstract Background Co-lethality, or synthetic lethality is the documented genetic situation where two, separately non-lethal mutations, become lethal when combined in one genome. Each mutation is called a "synthetic lethal" (SL or a co-lethal. Like invariant positions, SL sets (SL linked couples are choice targets for drug design against fast-escaping RNA viruses: mutational viral escape by loss of affinity to the drug may induce (synthetic lethality. Results From an amino acid sequence alignment of the HIV protease, we detected the potential SL couples, potential SL sets, and invariant positions. From the 3D structure of the same protein we focused on the ones that were close to each other and accessible on the protein surface, to possibly bind putative drugs. We aligned 24,155 HIV protease amino acid sequences and identified 290 potential SL couples and 25 invariant positions. After applying the distance and accessibility filter, three candidate drug design targets of respectively 7 (under the flap, 4 (in the cantilever and 5 (in the fulcrum amino acid positions were found. Conclusions These three replication-critical targets, located outside of the active site, are key to our anti-escape strategy. Indeed, biological evidence shows that 2/3 of those target positions perform essential biological functions. Their mutational variations to escape antiviral medication could be lethal, thus limiting the apparition of drug-resistant strains. Reviewers This article was reviewed by Arcady Mushegian, Shamil Sunyaev and Claus Wilke.

  16. Improving the effectiveness of escape windows in directed Norway lobster Nephrops norvegicus trawl fisheries

    DEFF Research Database (Denmark)

    Madsen, Niels; Holst, René; Frandsen, Rikke

    2012-01-01

    A substantial improvement in the bycatch selectivity of Norway lobster Nephrops norvegicus trawls is required, particularly with respect to cod Gadus morhua , whose stocks are at low levels in several areas. Conventional escape windows are not adequate to properly release cod and other bycatch sp...

  17. Escape from Harm’s Way: The Experiences of Southeast Asian Elders and their Families

    Directory of Open Access Journals (Sweden)

    Daniel F. Detzner

    2009-01-01

    Full Text Available This study uses a life history approach to understand the lived experiences of 40 Southeast Asian elderly refugees who fled from their home countries and resettled in the United States in the late 1970’s and 1980’s. The focus is concentrated on the elders’ narratives of escape. Their experiences are consolidated into motivational elements leading to flight; six dichotomous dimensions of the leave taking; and complicating factors affecting the escape. The results indicate that escapes: (a are motivated by a multiplicity of overlapping factors; (b appear to have an impact on health after resettlement; and (c are complex events where the same generational cohort fleeing from the same conflict, during the same time period, may arrive in the same destination with very different levels of distress. This study aims to develop a framework for understanding the escape narratives of elderly refugees as a way to understand the nature and sources of individual, family, and community distress that often hinders successful integration of refugee populations.

  18. Increased transcapillary escape rate of albumin in type 1 (insulin-dependent) diabetic patients with microalbuminuria

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, B

    1986-01-01

    The transcapillary escape rate, intravascular mass and outflux of albumin were measured in 75 Type 1 (insulin-dependent) diabetic patients. The groups were defined as: group 1: normal urinary albumin excretion, less than 30 mg/24 h (n = 21); group 2: microalbuminuria, 30-300 mg/24 h (n = 36); group...

  19. The interaction between Aegean back-arc extension and Anatolia escape since Middle Miocene

    NARCIS (Netherlands)

    Philippon, M.; Brun, J.-P.; Gueydan, F.; Sokoutis, D.

    2014-01-01

    The Aegean domain is a key area for understanding the processes of back-arc extension. Observed deformation pattern and present day kinematics result from the interaction between the southward retreat of the Hellenic trench and the westward escape of Anatolia. Lithosphere-scale analogue models were

  20. Escape from Management Hell: 12 Tales of Horror, Humor, and Heroism.

    Science.gov (United States)

    Gilbreath, Robert D.

    This book offers a set of stories in which corporate executives demonstrate the folly and futility of their own business practices. In the stories, 12 executives are trying to escape from a hell of their own making. The tales provide insights into the management woes with which people at all levels deal on a daily basis. Topics include: the…

  1. Queer(y)ing and Recrafting Agency: Moving Away from a Model of Coercion versus Escape

    Science.gov (United States)

    Gowlett, Christina

    2014-01-01

    This paper applies a Butlerian-inspired "queer(y)ing" methodology to disrupt the utility of agency being framed within the binary of escape and coercion. In particular, it uses Butler's concept of performative resignification to analyse how Simon, a 16-year-old white male student, maneouvres his way through the social conventions of…

  2. The effects of differential negative reinforcement of other behavior and noncontingent escape on compliance.

    OpenAIRE

    Kodak, Tiffany; Miltenberger, Raymond G; Romaniuk, Cathryn

    2003-01-01

    The present study evaluated the effects of noncontingent escape and differential negative reinforcement of other behavior in reducing problem behaviors and increasing compliance in 2 children with disabilities. Results showed that both methods reduced problem behavior and increased compliance for both children.

  3. The use of noncontingent escape to reduce disruptive behaviors in children with speech delays.

    OpenAIRE

    Coleman, C. L.; Holmes, P A

    1998-01-01

    Noncontingent escape (NCE) was used to reduce disruptive behavior in 3 children during regularly scheduled speech therapy sessions. Results showed rapid decreases in disruptive behavior and accompanying increases in compliance across children. Findings suggest that speech therapists with little expertise in behavior analysis can effectively implement NCE.

  4. Queer(y)ing and Recrafting Agency: Moving Away from a Model of Coercion versus Escape

    Science.gov (United States)

    Gowlett, Christina

    2014-01-01

    This paper applies a Butlerian-inspired "queer(y)ing" methodology to disrupt the utility of agency being framed within the binary of escape and coercion. In particular, it uses Butler's concept of performative resignification to analyse how Simon, a 16-year-old white male student, maneouvres his way through the social conventions of…

  5. Assessment of mortality of Antarctic krill (Euphausia superba) escaping from a trawl

    DEFF Research Database (Denmark)

    Krafft, Bjørn A.; Krag, Ludvig Ahm

    2015-01-01

    The overall purpose of this study was to estimate the mortality of Antarctic krill (Euphausia superba) that escape from the most common mesh size used for codends (16mm) in the current commercial fishery. The experiment was carried out off the South Orkney Islands (60°35′S, 45°30′W) using a covered...

  6. Slow Down or Speed Up? Lowering Periapsis versus Escaping from a Circular Orbit

    Science.gov (United States)

    Blanco, Philip

    2017-01-01

    Paul Hewitt's "Figuring Physics" in the Feb. 2016 issue asked whether it would take a larger velocity change to stop a satellite in a circular orbit or to cause it to escape. An extension of this problem asks: What "minimum" velocity change is required to crash a satellite into the planet, and how does that compare with the…

  7. Escape fraction of ionizing photons during reionization: effects due to supernova feedback and runaway OB stars

    CERN Document Server

    Kimm, Taysun

    2014-01-01

    The fraction of hydrogen ionizing photons escaping from galaxies into the intergalactic medium is a critical ingredient in the theory of reionization. We use two zoomed-in, high-resolution (4 pc), cosmological radiation hydrodynamic simulations with adaptive mesh refinement to investigate the impact of two physical mechanisms (supernova feedback and runaway OB stars) on the escape fraction (f_esc) at the epoch of reionization (z>7). We implement a new, physically motivated supernova feedback model that can approximate the Sedov solutions at all (from the free expansion to snowplow) stages. We find that there is a significant time delay of about ten million years between the peak of star formation and that of escape fraction, due to the time required for the build-up and subsequent destruction of the star-forming cloud by supernova feedback. Consequently, the photon number-weighted mean escape fraction for dwarf galaxies in halos of mass 10^8-10^10.5 Msun is found to be ~11%, although instantaneous values of f...

  8. Feedback-regulated escape of LyC photons from mini-haloes during reionisation

    CERN Document Server

    Kimm, Taysun; Haehnelt, Martin; Rosdahl, Joakim; Devriendt, Julien; Slyz, Adrianne

    2016-01-01

    Reionisation in the early Universe is likely driven by dwarf galaxies. Using cosmological, zoom-in, radiation-hydrodynamic simulations, we study the escape of Lyman continuum (LyC) photons from mini-haloes with $M_{\\rm halo} \\le 10^8\\,M_\\odot$. Our simulations include a new thermo-turbulent star formation model, non-equilibrium chemistry, and relevant stellar feedback processes (photoionisation by young massive stars, radiation pressure, and mechanical supernova explosions). We find that the photon number-weighted mean escape fraction in mini-haloes is higher ($\\sim20$-$40\\%$) than that in atomic-cooling haloes, although the instantaneous fraction in individual haloes varies significantly. The escape fraction from Pop III stars is found to be significant ($\\ge10\\%$) only when the mass is greater than $\\sim$100\\,\\msun. Because star formation is stochastic and dominated by a few gas clumps, the escape fraction is generally determined by radiation feedback (heating due to photo-ionisation), rather than supernova...

  9. Using Stimulus Fading without Escape Extinction to Increase Compliance with Toothbrushing in Children with Autism

    Science.gov (United States)

    Bishop, Michele R.; Kenzer, Amy L.; Coffman, Christine M.; Tarbox, Courtney M.; Tarbox, Jonathan; Lanagan, Taira M.

    2013-01-01

    Routine toothbrushing is an essential part of good oral hygiene. This study investigated the use of stimulus fading without escape extinction to increase compliance with toothbrushing with three children with autism spectrum disorder (ASD). A 30-step stimulus fading hierarchy was implemented; gradually increasing the proximity of the toothbrush to…

  10. Hot Oxygen and Carbon Escape from the Early Atmosphere of Mars

    Science.gov (United States)

    Amerstorfer, U.; Gröller, H.; Lichtenegger, H.; Lammer, H.; Tian, F.

    2015-12-01

    Nowadays, the atmosphere of Mars is commonly assumed to be much different than in the early times of its evolution. Especially, the escape of water and carbon dioxide is thought to have formed its shape during millions of years. Also the Sun emitted a higher EUV flux in former times, influencing the particle environment around Mars.We study the escape of oxygen and carbon from the early Martian atmosphere for different EUV fluxes with a Monte-Carlo model. We consider different possible sources of hot oxygen and carbon atoms in the thermosphere, e.g. dissociative recombination of O2+ , CO+ and CO2+ , photodissociation of O2 and CO, and other reactions like charge transfer. From the calculated production rate profiles we can get insights into the importance of the different source reactions. The resulting energy distribution functions at the exobase level are used to study the exospheric densities and the escape of hot oxygen and carbon. We discuss the escape rates of those atoms and the importance of different source processes compared to the present situation at Mars.This work receives funding from the Austrian Science Fund (FWF): P 24247.

  11. Molecular pathology of mismatch repair deficient tumours with emphasis on immune escape mechanisms

    NARCIS (Netherlands)

    Dierssen, Jan Willem Frederik

    2010-01-01

    This thesis describes molecular methods to distinguish separate colon tumour entities. Furthermore, it shows that distinct immune escape mechanisms, in particular distinct mechanisms of corrupting the HLA system, are operational in subsets of colon tumours. The apparent necessity of some colon tumou

  12. Optogenetics Based Rat-Robot Control: Optical Stimulation Encodes "Stop" and "Escape" Commands.

    Science.gov (United States)

    Chen, SiCong; Zhou, Hong; Guo, SongChao; Zhang, JiaCheng; Qu, Yi; Feng, ZhouYan; Xu, KeDi; Zheng, XiaoXiang

    2015-08-01

    Electric brain stimulation is frequently used in bio-robot control. However, one possible limitation of electric stimulation is the resultant wide range of influences that may lead to unexpected side-effects. Although there has been prior research done towards optogenetics based brain activation, there has not been much development regarding the comparisons between electric and optical methods of brain activation. In this study, we first encode "Stop" and "Escape" commands by optical stimulation in the dorsal periaqueductal grey (dPAG). The rats behavioral comparisons are then noted down under these two methods. The dPAG neural activity recorded during optical stimulation suggests rate and temporal coding mechanisms in behavioral control. The behavioral comparisons show that rats exhibit anxiety under the "Stop" command conveyed through both optical and electric methods. However, rats are able to recover more quickly from freezing only under optical "Stop" command. Under "Escape" commands, also conveyed through optical means, the rat would move with lessened urgency but the results are more stable. Moreover, c-Fos study shows the optical stimulation activates restricted range in midbrain: the optical stimulation affected only dPAG and its downstreams but electric stimulation activates both the upstream and downstream circuits, in which the glutamatergic neurons are largely occupied and play important role in "Stop" and "Escape" behavior controls. We conclude that optical stimulation is more suited for encoding "Stop" and "Escape" commands for rat-robot control.

  13. Stellar wind interaction and pick-up ion escape of the Kepler-11 "super-Earths"

    CERN Document Server

    Kislyakova, K G; Odert, P; Erkaev, N V; Lammer, H; üftinger, T L; Holmström, M; Khodachenko, M L; üdel, M G

    2013-01-01

    We study the interactions between stellar wind and the extended hydrogen-dominated upper atmospheres of planets and the resulting escape of planetary pick-up ions from the 5 "super-Earths" in the compact Kepler-11 system and compare the escape rates with the efficiency of the thermal escape of neutral hydrogen atoms. Assuming the stellar wind of Kepler-11 is similar to the solar wind, we use a polytropic 1D hydrodynamic wind model to estimate the wind properties at the planetary orbits. We apply a Direct Simulation Monte Carlo Model to model the hydrogen coronae and the stellar wind plasma interaction around Kepler-11b-f within a realistic expected heating efficiency range of 15-40%. The same model is used to estimate the ion pick-up escape from the XUV heated and hydrodynamically extended upper atmospheres of Kepler-11b-f. From the interaction model we study the influence of possible magnetic moments, calculate the charge exchange and photoionization production rates of planetary ions and estimate the loss r...

  14. Cytotoxicity and apoptotic effects of nickel oxide nanoparticles in cultured HeLa cells

    Directory of Open Access Journals (Sweden)

    Kezban Ada

    2010-04-01

    Full Text Available The aim of this study was to observe the cytotoxicity and apoptotic effects of nickel oxide nanoparticles on humancervix epithelioid carcinoma cell line (HeLa. Nickel oxide precursors were synthesized by an nickel sulphate-excess ureareaction in boiling aqueous solution. The synthesized NiO nanoparticles (<200 nm were investigated by X-ray diffractionanalysis and transmission electron microscopy techniques. For cytotoxicity experiments, HeLa cells were incubated in50-500 μg/mL NiO for 2, 6, 12 and 16 hours. The viable cells were counted with a haemacytometer using light microscopy.The cytotoxicity was observed low in 50-200 μg/mL concentration for 16 h, but high in 400-500 μg/mL concentration for2-6 h. HeLa cells' cytoplasm membrane was lysed and detached from the well surface in 400 μg/mL concentration NiOnanoparticles. Double staining and M30 immunostaining were performed to quantify the number of apoptotic cells in cultureon the basis of apoptotic cell nuclei scores. The apoptotic effect was observed 20% for 16 h incubation.

  15. The c-Myc Transactivation Domain Is a Direct Modulator of Apoptotic versus Proliferative Signals

    Science.gov (United States)

    Chang, David W.; Claassen, Gisela F.; Hann, Stephen R.; Cole, Michael D.

    2000-01-01

    We have assayed the oncogenic, proliferative, and apoptotic activities of the frequent mutations that occur in the c-myc gene in Burkitt's lymphomas. Some alleles have a modest (50 to 60%) increase in transforming activity; however, the most frequent Burkitt's lymphoma allele (T58I) had an unexpected substantial decrease in transforming activity (85%). All alleles restored the proliferation function of c-Myc in cells that grow slowly due to a c-myc knockout. There was discordance for some alleles between apoptotic and oncogenic activities, but only the T58A allele had elevated transforming activity with a concomitant reduced apoptotic potential. We discovered a novel missense mutation, MycS71F, that had a very low apoptotic activity compared to wild-type Myc, yet this mutation has never been found in lymphomas, suggesting that there is no strong selection for antiapoptotic c-Myc alleles. MycS71F also induced very low levels of cytochrome c release from mitochondria, suggesting a mechanism of action for this mutation. Phosphopeptide mapping provided a biochemical basis for the dramatically different biological activities of the transformation-defective T58I and transformation-enhanced T58A c-Myc alleles. Furthermore, the antiapoptotic survival factor insulin-like growth factor 1 was found to suppress phosphorylation of T58, suggesting that the c-Myc transactivation domain is a direct target of survival signals. PMID:10825194

  16. Reversal of Apoptotic Resistance by Lycium barbarum Glycopeptide 3 in Aged T Cells

    Institute of Scientific and Technical Information of China (English)

    LONG-GUO YUAN; HONG-BIN DENG; LI-HUI CHEN; DIAN-DONG LI; QI-YANG HE

    2008-01-01

    Objective To study whether Lycium barbarian glycopeptide 3 (LBGP3) affects T cell apeptosis in aged mice. Methods LBGP3 was purified with DEAE cellulose and Sephadex columns. Apoptotic "sub-Gl peak" was detected by flow cytometry and DNA ladder was resolved by agarose gel electrophoresis. Levels of IFN-γ, and IL-10 were measured with specific kits and mRNA expression was detected by RT-PCR. Apoptosis-related proteins of FLIP, FasL, and Bcl-2 were determined by Western blotting. Resdts LBGP3 was purified from Fructus Lycii water extracts and identified as a 41 kD glycopeptide.Treatment with 200 μg/mL LBGP3 increased the apoptotic rate of T cells from aged mice and showed a similar DNA ladder pattern to that in young T ceils. The reversal of apoptotic resistance was involved in down-regulating the expression of Bcl-2 and FLIP, and up-regulating the expression of FasL. Conclusion Lycium barbarum glycopeptide 3 reverses apoptotic resistance of aged T cells by modulating the expression of apoptosis-related molecules.

  17. Anti-apoptotic signaling and failure of apoptosis in the ischemic rat hippocampus

    DEFF Research Database (Denmark)

    Müller, Georg Johannes; Lassmann, Hans; Johansen, Flemming Fryd

    2007-01-01

    Several anti-apoptotic proteins are induced in CA1 neurons after transient forebrain ischemia (TFI), but fail to protect the majority of these cells from demise. Correlating cell death morphologies (apoptosis-like and necrosis-like death) with immunohistochemistry (IHC), we investigated whether a...

  18. Boolean model of Yeast Apoptosis as a tool to study yeast and human apoptotic regulations

    Directory of Open Access Journals (Sweden)

    Laleh eKazemzadeh

    2012-12-01

    Full Text Available Programmed cell death (PCD is an essential cellular mechanism that is evolutionary conserved, mediated through various pathways and acts by integrating different stimuli. Many diseases such as neurodegenerative diseases and cancers are found to be caused by, or associated with, regulations in the cell death pathways. Yeast Saccharomyces cerevisiae, is a unicellular eukaryotic organism that shares with human cells components and pathways of the PCD and is therefore used as a model organism. Boolean modelling is becoming promising approach to capture qualitative behaviour and describe essential properties of such complex networks. Here we present large literature-based and to our knowledge first Boolean model that combines pathways leading to apoptosis (a type of PCD in yeast. Analysis of the yeast model confirmed experimental findings of anti-apoptotic role of Bir1p and pro-apoptotic role of Stm1p and revealed activation of the stress protein kinase Hog proposing the maximal level of activation upon heat stress. In addition we extended the yeast model and created an in silico humanized yeast in which human pro- and anti-apoptotic regulators Bcl-2 family and Valosin-contain protein (VCP are included in the model. We showed that accumulation of Bax in in silico humanized yeast shows apoptotic markers and that VCP is essential target of Akt Signaling. The presented Boolean model provides comprehensive description of yeast apoptosis network behaviour. Extended model of humanized yeast gives new insights of how complex human disease like neurodegenration can initially be tested.

  19. Antiproliferative and pro-apoptotic effects of Uncaria tomentosa in human medullary thyroid carcinoma cells.

    Science.gov (United States)

    Rinner, Beate; Li, Zeng Xia; Haas, Helga; Siegl, Veronika; Sturm, Sonja; Stuppner, Hermann; Pfragner, Roswitha

    2009-11-01

    Medullary thyroid carcinoma (MTC), a rare calcitonin-producing tumor, is derived from parafollicular C-cells of the thyroid and is characterized by constitutive Bcl-2 overexpression. The tumor is relatively insensitive to radiation therapy as well as conventional chemotherapy. To date, the only curative treatment is the early and complete surgical removal of all neoplastic tissue. In this study, the antiproliferative and pro-apoptotic effects of fractions obtained from Uncaria tomentosa (Willd.) DC, commonly known as uña de gato or cat's claw were investigated. Cell growth of MTC cells as well as enzymatic activity of mitochondrial dehydrogenase was markedly inhibited after treatment with different fractions of the plant. Furthermore, there was an increase in the expressions of caspase-3 and -7 and poly(ADP-ribose) polymerase (PARP) fraction, while bcl-2 overexpression remained constant. In particular, the alkaloids isopterpodine and pteropodine of U. tomentosa exhibited a significant pro-apoptotic effect on MTC cells, whereas the alkaloid-poor fraction inhibited cell proliferation but did not show any pro-apoptotic effects. These promising results indicate the growth-restraining and apoptotic potential of plant extracts against neuroendocrine tumors, which may add to existing therapies for cancer.

  20. Different Sensitivities to Apoptotic Induction by Camptothecin between Normal and Senescent Lens Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    Haike Guo; Haiying Jin; Liya Wang; Hongyang Zhang; Xin Yang

    2002-01-01

    Purpose: To investigate whether normal and senescent lens epithelial cells have different defense abilities to apoptotic induction factor in vitro.Methods: Rabbit lens epithelial cells were cultured, passed. When reaching confluence, cells from the first and seventh passage were stained by x-gal staining to detect cell senescence. Cell apoptosis was detected by TUNEL(Roche).10μmol/L camptothecin was used to induce cell apoptosis from the lens epithelial cells of the first and seventh passage to distinguish different sensitivities to apoptotic induction factor between normal and senescent cells.Results: The senescent cells (41.17% ± 5.24% ) were detected in the lens epithelial cell culture of the seventh passage, which are higher than those of the first passage (0.98% ±0. 39% ). There was no apoptotic cell detected in the cell cultures undisturbed. Exposure of the first passage cells to camptothecin resulted in death of approximately 23.87% ± 3.45% of the cells during a 36 hour exposure period. In contrast, significantly more lens epithelial cells died through the apoptosis (38.29% ±4. 01% ) from the seventh passage.Conclusion: Senescent cells increased with cell passage. Senescence lens epithelial cells do not undergo apoptosis if they were not disturbed. But the vulnerabilities to apoptotic induction between health and senescence cells were different.

  1. Modulation of apoptotic pathways of macrophages by surface-functionalized multi-walled carbon nanotubes.

    Directory of Open Access Journals (Sweden)

    Yuanqin Jiang

    Full Text Available Biomedical applications of carbon nanotubes (CNTs often involve improving their hydrophilicity and dispersion in biological media by modifying them through noncovalent or covalent functionalization. However, the potential adverse effects of surface-functionalized CNTs have not been well characterized. In this study, we functionalized multi-walled CNTs (MWCNTs via carboxylation, to produce MWCNTs-COOH, and via poly (ethylene glycol linking, to produce MWCNTs-PEG. We used these functionalized MWCNTs to study the effect of surface functionalization on MWCNTs-induced toxicity to macrophages, and elucidate the underlying mechanisms of action. Our results revealed that MWCNTs-PEG were less cytotoxic and were associated with less apoptotic cell death of macrophages than MWCNTs-COOH. Additionally, MWCNTs-PEG induced less generation of reactive oxygen species (ROS involving less activation of NADPH oxidase compared with MWCNTs-COOH, as evidenced by membrane translocation of p47(phox and p67(phox in macrophages. The less cytotoxic and apoptotic effect of MWCNTs-PEG compared with MWCNTs-COOH resulted from the lower cellular uptake of MWCNTs-PEG, which resulted in less activation of oxidative stress-responsive pathways, such as p38 mitogen-activated protein kinases (MAPK and nuclear factor (NF-κB. These results demonstrate that surface functionalization of CNTs may alter ROS-mediated cytotoxic and apoptotic response by modulating apoptotic signaling pathways. Our study thus provides new insights into the molecular basis for the surface properties affecting CNTs toxicity.

  2. Apoptotic neurons induce proliferative responses of progenitor cells in the postnatal neocortex.

    Science.gov (United States)

    Petrenko, Volodymyr; Mihhailova, Jevgenia; Salmon, Patrick; Kiss, Jozsef Z

    2015-11-01

    Apoptotic cell death is the leading cause of neuronal loss after neonatal brain injury. Little is known about the intrinsic capacity of the immature cerebral cortex for replacing dead cells. Here we test the hypothesis that neuronal apoptosis is able to trigger compensatory proliferation in surrounding cells. In order to establish a "pure" apoptotic cell death model and to avoid the confounding effects of broken blood-brain barrier and inflammatory reactions, we used a diphtheria toxin (DT) and diphtheria toxin receptor (DTR) system to induce ablation of layer IV neurons in the rodent somatosensory cortex during the early postnatal period. We found that DT-triggered apoptosis is a slowly progressing event lasting about for 7 days. While dying cells expressed the morphological features of apoptosis, we could not detect immunoreactivity for activated caspase-3 in these cells. Microglia activation and proliferation represented the earliest cellular responses to apoptotic cell death. In addition, we found that induced apoptosis triggered a massive proliferation of undifferentiated progenitor cell pool including Sox2 as well as NG2 cells. The default differentiation pattern of proliferating progenitors appears to be the glial phenotype; we could not find evidence for newly generated neurons in response to apoptotic neuronal death. These results suggest that mitotically active progenitor populations are intrinsically capable to contribute to the repair process of injured cortical tissue and may represent a potential target for neuronal replacement strategies.

  3. Gingerol sensitizes TRAIL-induced apoptotic cell death of glioblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Hee, E-mail: leedneo@gmail.com [Departments of Surgery and Pharmacology and Cell Biology, School of Medicine, University of Pittsburgh, Pittsburgh, PA (United States); Kim, Dong-Wook [Department of Microbiology, Immunology, and Cancer Biology, University of VA (United States); Jung, Chang-Hwa [Division of Metabolism and Functionality Research, Korea Food Research Institute (Korea, Republic of); Lee, Yong J. [Departments of Surgery and Pharmacology and Cell Biology, School of Medicine, University of Pittsburgh, Pittsburgh, PA (United States); Park, Daeho, E-mail: daehopark@gist.ac.kr [School of Life Sciences, Gwangju Institute of Science and Technology, Gwangju 500-712 (Korea, Republic of)

    2014-09-15

    Glioblastoma multiforme (GBM) is the most lethal and aggressive astrocytoma of primary brain tumors in adults. Although there are many clinical trials to induce the cell death of glioblastoma cells, most glioblastoma cells have been reported to be resistant to TRAIL-induced apoptosis. Here, we showed that gingerol as a major component of ginger can induce TRAIL-mediated apoptosis of glioblastoma. Gingerol increased death receptor (DR) 5 levels in a p53-dependent manner. Furthermore, gingerol decreased the expression level of anti-apoptotic proteins (survivin, c-FLIP, Bcl-2, and XIAP) and increased pro-apoptotic protein, Bax and truncate Bid, by generating reactive oxygen species (ROS). We also found that the sensitizing effects of gingerol in TRAIL-induced cell death were blocked by scavenging ROS or overexpressing anti-apoptotic protein (Bcl-2). Therefore, we showed the functions of gingerol as a sensitizing agent to induce cell death of TRAIL-resistant glioblastoma cells. This study gives rise to the possibility of applying gingerol as an anti-tumor agent that can be used for the purpose of combination treatment with TRAIL in TRAIL-resistant glioblastoma tumor therapy. - Highlights: • Most GBM cells have been reported to be resistant to TRAIL-induced apoptosis. • Gingerol enhances the expression level of anti-apoptotic proteins by ROS. • Gingerol enhances TRAIL-induced apoptosis through actions on the ROS–Bcl2 pathway.

  4. Regulation of MAP kinase-dependent apoptotic pathway: implication of reactive oxygen and nitrogen species.

    Science.gov (United States)

    Sumbayev, Vadim V; Yasinska, Inna M

    2005-04-15

    Mitogen-activated protein (MAP) kinase signaling cascades are multi-functional signaling networks that influence cell growth, differentiation, apoptosis, and cellular responses to stress. Apoptosis signal-regulating kinase 1 (ASK1) is a MAP kinase kinase kinase that triggers apoptogenic kinase cascade leading to the phosphorylation/activation of c-Jun N-terminal kinases and p38-MAP kinase, which are responsible for inducing apoptotic cell death. This pathway plays a pivotal role in transduction of signals from different apoptotic stimuli. In the present review, we summarized the recent evidence concerning MAP kinase-dependent apoptotic pathway and its regulation in the mammalian cells and organism in vivo. We have shown that the key messengers of regulation of this pathway are the reactive oxygen and nitrogen species. The role of protein oxidation and S-nitrosation in induction of apoptotic cell death via ASK1 is discussed. Also we have outlined other recently discovered signal transduction processes involved in the regulation of ASK1 activity and downstream pathway.

  5. Expression of defender against apoptotic death (DAD-1) in iris and dianthus petals

    NARCIS (Netherlands)

    Kop, van der D.A.M.; Ruys, G.; Dees, D.; Schoot, van der C.; Boer, de A.D.; Doorn, van W.G.

    2003-01-01

    The gene defender against apoptotic death (DAD-1) prevents programmed cell death in animal cells. We investigated the expression pattern of DAD-1 in petals of iris (Iris x hollandica cv. Blue Magic) and carnation (Dianthus caryophyllus cv. Etarro). DAD-1 expression in Iris petals was strongly reduce

  6. Modulation of Apoptotic Signaling by the Hepatitis B Virus X Protein

    Directory of Open Access Journals (Sweden)

    Michael J. Bouchard

    2012-11-01

    Full Text Available Worldwide, an estimated 350 million people are chronically infected with the Hepatitis B Virus (HBV; chronic infection with HBV is associated with the development of severe liver diseases including hepatitis and cirrhosis. Individuals who are chronically infected with HBV also have a significantly higher risk of developing hepatocellular carcinoma (HCC than uninfected individuals. The HBV X protein (HBx is a key regulatory HBV protein that is important for HBV replication, and likely plays a cofactor role in the development of HCC in chronically HBV-infected individuals. Although some of the functions of HBx that may contribute to the development of HCC have been characterized, many HBx activities, and their putative roles during the development of HBV-associated HCC, remain incompletely understood. HBx is a multifunctional protein that localizes to the cytoplasm, nucleus, and mitochondria of HBV‑infected hepatocytes. HBx regulates numerous cellular signal transduction pathways and transcription factors as well as cell cycle progression and apoptosis. In this review, we will summarize reports in which the impact of HBx expression on cellular apoptotic pathways has been analyzed. Although various effects of HBx on apoptotic pathways have been observed in different model systems, studies of HBx activities in biologically relevant hepatocyte systems have begun to clarify apoptotic effects of HBx and suggest mechanisms that could link HBx modulation of apoptotic pathways to the development of HBV-associated HCC.

  7. Inhibition of Citrinin-Induced Apoptotic Biochemical Signaling in Human Hepatoma G2 Cells by Resveratrol

    Directory of Open Access Journals (Sweden)

    Chia-Chi Chen

    2009-07-01

    Full Text Available The mycotoxin citrinin (CTN, a natural contaminant in foodstuffs and animal feeds, exerts cytotoxic and genotoxic effects on various mammalian cells. CTN causes cell injury, including apoptosis, but its precise regulatory mechanisms of action are currently unclear. Resveratrol, a member of the phytoalexin family found in grapes and other dietary plants, possesses antioxidant and anti-tumor properties. In the present study, we examined the effects of resveratrol on apoptotic biochemical events in Hep G2 cells induced by CTN. Resveratrol inhibited CTN-induced ROS generation, activation of JNK, loss of mitochondrial membrane potential (MMP, as well as activation of caspase-9, caspase-3 and PAK2. Moreover, resveratrol and the ROS scavengers, NAC and α-tocopherol, abolished CTN-stimulated intracellular oxidative stress and apoptosis. Active JNK was required for CTN-induced mitochondria-dependent apoptotic biochemical changes, including loss of MMP, and activation of caspases and PAK2. Activation of PAK2 was essential for apoptosis triggered by CTN. These results collectively demonstrate that CTN stimulates ROS generation and JNK activation for mitochondria-dependent apoptotic signaling in Hep G2 cells, and these apoptotic biochemical events are blocked by pretreatment with resveratrol, which exerts antioxidant effects.

  8. Boolean Model of Yeast Apoptosis as a Tool to Study Yeast and Human Apoptotic Regulations

    Science.gov (United States)

    Kazemzadeh, Laleh; Cvijovic, Marija; Petranovic, Dina

    2012-01-01

    Programmed cell death (PCD) is an essential cellular mechanism that is evolutionary conserved, mediated through various pathways and acts by integrating different stimuli. Many diseases such as neurodegenerative diseases and cancers are found to be caused by, or associated with, regulations in the cell death pathways. Yeast Saccharomyces cerevisiae, is a unicellular eukaryotic organism that shares with human cells components and pathways of the PCD and is therefore used as a model organism. Boolean modeling is becoming promising approach to capture qualitative behavior and describe essential properties of such complex networks. Here we present large literature-based and to our knowledge first Boolean model that combines pathways leading to apoptosis (a type of PCD) in yeast. Analysis of the yeast model confirmed experimental findings of anti-apoptotic role of Bir1p and pro-apoptotic role of Stm1p and revealed activation of the stress protein kinase Hog proposing the maximal level of activation upon heat stress. In addition we extended the yeast model and created an in silico humanized yeast in which human pro- and anti-apoptotic regulators Bcl-2 family and Valosin-contain protein (VCP) are included in the model. We showed that accumulation of Bax in silico humanized yeast shows apoptotic markers and that VCP is essential target of Akt Signaling. The presented Boolean model provides comprehensive description of yeast apoptosis network behavior. Extended model of humanized yeast gives new insights of how complex human disease like neurodegeneration can initially be tested. PMID:23233838

  9. Role of BK channels in the apoptotic volume decrease in native eel intestinal cells

    DEFF Research Database (Denmark)

    Lionetto, Maria Giulia; Giordano, Maria Elena; Calisi, Antonio

    2010-01-01

    of these channels in the Apoptotic Volume Decrease (AVD) of isolated eel enterocytes, and the possible interaction between BK channels and the progression of apoptosis. The detection of apoptosis was performed by confocal microscopy and annexin V and propidium iodide labelling; cell volume changes were monitored...

  10. The calcimimetic R-568 induces apoptotic cell death in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Cheng Guangming

    2009-07-01

    Full Text Available Abstract Background Increased serum level of parathyroid hormone (PTH was found in metastatic prostate cancers. Calcimimetic R-568 was reported to reduce PTH expression, to suppress cell proliferation and to induce apoptosis in parathyroid cells. In this study, we investigated the effect of R-568 on cellular survival of prostate cancer cells. Methods Prostate cancer cell lines LNCaP and PC-3 were used in this study. Cellular survival was determined with MTT, trypan blue exclusion and fluorescent Live/Death assays. Western blot assay was utilized to assess apoptotic events induced by R-568 treatment. JC-1 staining was used to evaluate mitochondrial membrane potential. Results In cultured prostate cancer LNCaP and PC-3 cells, R-568 treatment significantly reduced cellular survival in a dose- and time-dependent manner. R-568-induced cell death was an apoptotic event, as evidenced by caspase-3 processing and PARP cleavage, as well as JC-1 color change in mitochondria. Knocking down calcium sensing receptor (CaSR significantly reduced R-568-induced cytotoxicity. Enforced expression of Bcl-xL gene abolished R-568-induced cell death, while loss of Bcl-xL expression led to increased cell death in R-568-treated LNCaP cells,. Conclusion Taken together, our data demonstrated that calcimimetic R-568 triggers an intrinsic mitochondria-related apoptotic pathway, which is dependent on the CaSR and is modulated by Bcl-xL anti-apoptotic pathway.

  11. Staphylococcus aureus alpha-toxin-induced cell death : predominant necrosis despite apoptotic caspase activation

    NARCIS (Netherlands)

    Essmann, F; Bantel, H; Totzke, G; Engels, I H; Sinha, B; Schulze-Osthoff, K; Jänicke, R U

    2003-01-01

    Recent data suggest that alpha-toxin, the major hemolysin of Staphylococcus aureus, induces cell death via the classical apoptotic pathway. Here we demonstrate, however, that although zVAD-fmk or overexpression of Bcl-2 completely abrogated caspase activation and internucleosomal DNA fragmentation,

  12. Hydrodynamics of C-Start Escape Responses of Fish as Studied with Simple Physical Models.

    Science.gov (United States)

    Witt, William C; Wen, Li; Lauder, George V

    2015-10-01

    One of the most-studied unsteady locomotor behaviors exhibited by fishes is the c-start escape response. Although the kinematics of these responses have been studied extensively and two well-defined kinematic stages have been documented, only a few studies have focused on hydrodynamic patterns generated by fishes executing escape behaviors. Previous work has shown that escape responses by bluegill sunfish generate three distinct vortex rings, each with central orthogonal jet flows, and here we extend this conclusion to two other species: stickleback and mosquitofish. Jet #1 is formed by the tail during Stage 1, and moves in the same direction as Stage-2 movement of the fish, thereby reducing final escape-velocity but also rotating the fish. Jet #2, in contrast, moves approximately opposite to the final direction of the fish's motion and contains the bulk of the total fluid-momentum powering the escape response. Jet #3 forms during Stage 2 in the mid-body region and moves in a direction approximately perpendicular to jets 1 and 2, across the direction of movement of the body. In this study, we used a mechanical controller to impulsively move passively flexible plastic panels of three different stiffnesses in heave, pitch, and heave + pitch motions to study the effects of stiffness on unsteady hydrodynamics of escape. We were able to produce kinematics very similar to those of fish c-starts and also to reproduce the 3-jet hydrodynamic pattern of the c-start using a panel of medium flexural stiffness and the combined heave + pitch motion. This medium-stiffness panel matched the measured stiffness of the near-tail region of fish bodies. This motion also produced positive power when the panel straightened during stage 2 of the escape response. More flexible and stiffer panels resulted in non-biological kinematics and patterns of flow for all motions. The use of simple flexible models with a mechanical controller and program of fish-like motion is a promising approach

  13. Optimal escape from potential wells-patterns of regular and chaotic bifurcation

    Science.gov (United States)

    Stewart, H. B.; Thompson, J. M. T.; Ueda, Y.; Lansbury, A. N.

    The patterns of bifurcation governing the escape of periodically forced oscillations from a potential well over a smooth potential barrier are studied by numerical simulation. Both the generic asymmetric single-well cubic potential and the symmetric twin-well potential Duffing oscillator are surveyed by varying three parameters: forcing frequency, forcing amplitude, and damping coefficient. The close relationship between optimal escape and nonlinear resonance within the well is confirmed over a wide range of damping. Subtle but significant differences are observed at higher damping ratios. The possibility of indeterminate outcomes of jumps to and from resonance near optimal escape is cmppletely suppressed above a critical level of the damping ratio (about 0.12 for the asymmetric single-well oscillator). Coincidentally, at almost the same level of damping, the optimal escape condition becomes distinct from the apex in the (ω, F) plane of the bistable regime; this corresponds to the appearance of chaotic attractors which subsume both resonant and non-resonant motions within one well. At higher damping levels, further changes occur involving conversions from chaotic-saddle to regular-saddle bifurcations. These changes in optimal escape phenomena correspond to codimension three bifurcations at exceptional points in the space of three parameters. These bifurcations are described in terms of homoclinic and heteroclinic structures of invariant manifolds, and changes in accessible boundary orbits. The same sequence of codimension three bifurcations is observed in both the twin-well Duffing oscillator and the asymmetric single-well escape equation. Within the codimension three bifurcation patterns governing escape, one particular codimension two global bifurcation involves a chaotic attractor explosion, or interior crisis, compounded with a blue sky catastrophe or boundary crisis of the exploded attractor. This codimension two bifurcation has structure containing a form of

  14. 76 FR 26957 - Special Conditions: Boeing, Model 747-8 Series Airplanes; Door 1 Extendable Length Escape Slide

    Science.gov (United States)

    2011-05-10

    ...; Door 1 Extendable Length Escape Slide AGENCY: Federal Aviation Administration (FAA), DOT. ACTION... extendable length escape slide. The applicable airworthiness regulations do not contain adequate or... unusual design features: The 747-8 design offers seating capacity on two separate decks, the main...

  15. Comparing Effective Treatments for Attention-Maintained and Escape- Maintained Behaviors in Children with Behavior Disorders: Brief Review and Analysis

    OpenAIRE

    Lauren Worcester; T. F. McLaughlin

    2013-01-01

    This literature review compares treatment for attention-maintainedversus escape maintained aberrant behavior in children with behavior disorders. Specifically, studies utilizing time out procedures, differential reinforcement procedures, noncontingent reinforcement, and functional communication training are discussed. It was found that these are effective treatments for attention-maintained behaviors; while escape extinction, positive and negative reinforcement, functional communication trai...

  16. 77 FR 50165 - Escape and Evacuation Plans for Surface Coal Mines, Surface Facilities and Surface Work Areas of...

    Science.gov (United States)

    2012-08-20

    ... Administration. Title: Escape and Evacuation Plans for Surface Coal Mines, Surface Facilities ] and Surface Work... Safety and Health Administration Escape and Evacuation Plans for Surface Coal Mines, Surface Facilities and Surface Work Areas of Underground Coal Mines AGENCY: Mine Safety and Health Administration,...

  17. Energetic Particle Diagnostics for Transport Analysis 3.Escaping Fast Ion Diagnostics for the Fast Particle Transport Analysis

    Science.gov (United States)

    Isobe, Mitsutaka; Shinohara, Kouji

    Escaping energetic ion diagnostics in magnetically confined plasma experiments are described in this lecture note. Experimental results from escaping energetic ion diagnostics in TFTR, JFT-2M, CHS and W7-AS are shown. In addition to mechanism of energetic ion loss from a viewpoint of particle orbit, effect of MHD activity on energetic particle transport is reviewed.

  18. HIV-1 resistance to neutralizing antibodies: Determination of antibody concentrations leading to escape mutant evolution.

    Science.gov (United States)

    Magnus, Carsten; Reh, Lucia; Trkola, Alexandra

    2016-06-15

    Broadly neutralizing antibodies against human immunodeficiency virus type 1 (HIV-1) are considered vital components of novel therapeutics and blueprints for vaccine research. Yet escape to even the most potent of these antibodies is imminent in natural infection. Measures to define antibody efficacy and prevent mutant selection are thus urgently needed. Here, we derive a mathematical framework to predict the concentration ranges for which antibody escape variants can outcompete their viral ancestors, referred to as mutant selection window (MSW). When determining the MSW, we focus on the differential efficacy of neutralizing antibodies against HIV-1 in two canonical infection routes, free-virus infection and cell-cell transmission. The latter has proven highly effective in vitro suggesting its importance for both in vivo spread as well as for escaping targeted intervention strategies. We observed a range of MSW patterns that highlight the potential of mutants to arise in both transmission pathways and over wide concentration ranges. Most importantly, we found that only when the arising mutant has both, residual sensitivity to the neutralizing antibody and reduced infectivity compared to the parental virus, antibody dosing outside of the MSW to restrict mutant selection is possible. Emergence of mutants that provide complete escape and have no considerable fitness loss cannot be prevented by adjusting antibody doses. The latter may in part explain the ubiquitous resistance to neutralizing antibodies observed in natural infection and antibody treatment. Based on our findings, combinations of antibodies targeting different epitopes should be favored for antibody-based interventions as this may render complete resistance less likely to occur and also increase chances that multiple escapes result in severe fitness loss of the virus making longer-term antibody treatment more feasible.

  19. Changing the habitat: the evolution of intercorrelated traits to escape from predators.

    Science.gov (United States)

    Mikolajewski, D J; Scharnweber, K; Jiang, B; Leicht, S; Mauersberger, R; Johansson, F

    2016-07-01

    Burst escape speed is an effective and widely used behaviour for evading predators, with burst escape speed relying on several different morphological features. However, we know little about how behavioural and underlying morphological attributes change in concert as a response to changes in selective predation regime. We studied intercorrelated trait differentiation of body shape and burst-swim-mediating morphology in response to a habitat shift-related reduction in burst escape speed using larvae of the dragonfly genus Leucorrhinia. Species in this genus underwent a well-known habitat shift from predatory fish lakes (fish lakes) to predatory fish-free lakes dominated by large predatory dragonflies (dragonfly lakes) accompanied by relaxed selection on escape burst speed. Results revealed that species from fish lakes that possess faster burst speed have evolved a suite of functionally intercorrelated traits, expressing a wider abdomen, a higher abdominal muscles mass and a larger branchial chamber compared with species from dragonfly lakes. In contrast, populations within species did not show significant differences in muscle mass and branchial chamber size between lake types in three of the species. High multicollinearity among variables suggests that traits have evolved in concert rather than independently when Leucorrhinia shifted from fish lakes to dragonfly lakes. Thus, relaxed selection on burst escape speed in dragonfly-lake species resulted in a correlated reduction of abdominal muscles and a smaller branchial chamber, likely to save production and/or maintenance costs. Our results highlight the importance of studying integrated behavioural and morphological traits to fully understand the evolution of complex phenotypes.

  20. Oxygen escape from the Earth during geomagnetic reversals: Implications to mass extinction

    Science.gov (United States)

    Wei, Yong; Pu, Zuyin; Zong, Qiugang; Wan, Weixing; Ren, Zhipeng; Fraenz, Markus; Dubinin, Eduard; Tian, Feng; Shi, Quanqi; Fu, Suiyan; Hong, Minghua

    2014-05-01

    The evolution of life is affected by variations of atmospheric oxygen level and geomagnetic field intensity. Oxygen can escape into interplanetary space as ions after gaining momentum from solar wind, but Earth's strong dipole field reduces the momentum transfer efficiency and the ion outflow rate, except for the time of geomagnetic polarity reversals when the field is significantly weakened in strength and becomes Mars-like in morphology. The newest databases available for the Phanerozoic era illustrate that the reversal rate increased and the atmospheric oxygen level decreased when the marine diversity showed a gradual pattern of mass extinctions lasting millions of years. We propose that accumulated oxygen escape during an interval of increased reversal rate could have led to the catastrophic drop of oxygen level, which is known to be a cause of mass extinction. We simulated the oxygen ion escape rate for the Triassic-Jurassic event, using a modified Martian ion escape model with an input of quiet solar wind inferred from Sun-like stars. The results show that geomagnetic reversal could enhance the oxygen escape rate by 3-4 orders only if the magnetic field was extremely weak, even without consideration of space weather effects. This suggests that our hypothesis could be a possible explanation of a correlation between geomagnetic reversals and mass extinction. Therefore, if this causal relation indeed exists, it should be a "many-to-one" scenario rather the previously considered "one-to-one", and planetary magnetic field should be much more important than previously thought for planetary habitability.

  1. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States.

    Directory of Open Access Journals (Sweden)

    Angela B Brueggemann

    2007-11-01

    Full Text Available The heptavalent pneumococcal conjugate vaccine (PCV7 was introduced in the United States (US in 2000 and has significantly reduced invasive pneumococcal disease; however, the incidence of nonvaccine serotype invasive disease, particularly due to serotype 19A, has increased. The serotype 19A increase can be explained in part by expansion of a genotype that has been circulating in the US prior to vaccine implementation (and other countries since at least 1990, but also by the emergence of a novel "vaccine escape recombinant" pneumococcal strain. This strain has a genotype that previously was only associated with vaccine serotype 4, but now expresses a nonvaccine serotype 19A capsule. Based on prior evidence for capsular switching by recombination at the capsular locus, the genetic event that resulted in this novel serotype/genotype combination might be identifiable from the DNA sequence of individual pneumococcal strains. Therefore, the aim of this study was to characterise the putative recombinational event(s at the capsular locus that resulted in the change from a vaccine to a nonvaccine capsular type. Sequencing the capsular locus flanking regions of 51 vaccine escape (progeny, recipient, and putative donor pneumococci revealed a 39 kb recombinational fragment, which included the capsular locus, flanking regions, and two adjacent penicillin-binding proteins, and thus resulted in a capsular switch and penicillin nonsusceptibility in a single genetic event. Since 2003, 37 such vaccine escape strains have been detected, some of which had evolved further. Furthermore, two new types of serotype 19A vaccine escape strains emerged in 2005. To our knowledge, this is the first time a single recombinational event has been documented in vivo that resulted in both a change of serotype and penicillin nonsusceptibility. Vaccine escape by genetic recombination at the capsular locus has the potential to reduce PCV7 effectiveness in the longer term.

  2. A convergent and essential interneuron pathway for Mauthner-cell-mediated escapes.

    Science.gov (United States)

    Lacoste, Alix M B; Schoppik, David; Robson, Drew N; Haesemeyer, Martin; Portugues, Ruben; Li, Jennifer M; Randlett, Owen; Wee, Caroline L; Engert, Florian; Schier, Alexander F

    2015-06-01

    The Mauthner cell (M-cell) is a command-like neuron in teleost fish whose firing in response to aversive stimuli is correlated with short-latency escapes [1-3]. M-cells have been proposed as evolutionary ancestors of startle response neurons of the mammalian reticular formation [4], and studies of this circuit have uncovered important principles in neurobiology that generalize to more complex vertebrate models [3]. The main excitatory input was thought to originate from multisensory afferents synapsing directly onto the M-cell dendrites [3]. Here, we describe an additional, convergent pathway that is essential for the M-cell-mediated startle behavior in larval zebrafish. It is composed of excitatory interneurons called spiral fiber neurons, which project to the M-cell axon hillock. By in vivo calcium imaging, we found that spiral fiber neurons are active in response to aversive stimuli capable of eliciting escapes. Like M-cell ablations, bilateral ablations of spiral fiber neurons largely eliminate short-latency escapes. Unilateral spiral fiber neuron ablations shift the directionality of escapes and indicate that spiral fiber neurons excite the M-cell in a lateralized manner. Their optogenetic activation increases the probability of short-latency escapes, supporting the notion that spiral fiber neurons help activate M-cell-mediated startle behavior. These results reveal that spiral fiber neurons are essential for the function of the M-cell in response to sensory cues and suggest that convergent excitatory inputs that differ in their input location and timing ensure reliable activation of the M-cell, a feedforward excitatory motif that may extend to other neural circuits.

  3. G-CSF protects motoneurons against axotomy-induced apoptotic death in neonatal mice

    Directory of Open Access Journals (Sweden)

    Pitzer Claudia

    2010-02-01

    Full Text Available Abstract Background Granulocyte colony stimulating factor (G-CSF is a growth factor essential for generation of neutrophilic granulocytes. Apart from this hematopoietic function, we have recently uncovered potent neuroprotective and regenerative properties of G-CSF in the central nervous system (CNS. The G-CSF receptor and G-CSF itself are expressed in α motoneurons, G-CSF protects motoneurons, and improves outcome in the SOD1(G93A transgenic mouse model for amyotrophic lateral sclerosis (ALS. In vitro, G-CSF acts anti-apoptotically on motoneuronal cells. Due to the pleiotrophic effects of G-CSF and the complexity of the SOD1 transgenic ALS models it was however not possible to clearly distinguish between directly mediated anti-apoptotic and indirectly protective effects on motoneurons. Here we studied whether G-CSF is able to protect motoneurons from purely apoptotic cell death induced by a monocausal paradigm, neonatal sciatic nerve axotomy. Results We performed sciatic nerve axotomy in neonatal mice overexpressing G-CSF in the CNS and found that G-CSF transgenic mice displayed significantly higher numbers of surviving lumbar motoneurons 4 days following axotomy than their littermate controls. Also, surviving motoneurons in G-CSF overexpressing animals were larger, suggesting additional trophic effects of this growth factor. Conclusions In this model of pure apoptotic cell death the protective effects of G-CSF indicate direct actions of G-CSF on motoneurons in vivo. This shows that G-CSF exerts potent anti-apoptotic activities towards motoneurons in vivo and suggests that the protection offered by G-CSF in ALS mouse models is due to its direct neuroprotective activity.

  4. Pro‑apoptotic effects of pycnogenol on HT1080 human fibrosarcoma cells.

    Science.gov (United States)

    Harati, Kamran; Slodnik, Pawel; Chromik, Ansgar Michael; Behr, Björn; Goertz, Ole; Hirsch, Tobias; Kapalschinski, Nicolai; Klein-Hitpass, Ludger; Kolbenschlag, Jonas; Uhl, Waldemar; Lehnhardt, Marcus; Daigeler, Adrien

    2015-04-01

    Complete surgical resection with clear margins remains the mainstay of therapy for localised fibrosarcomas. Nevertheless, metastatic fibrosarcomas still represent a therapeutic dilemma. Commonly used chemotherapeutic agents like doxorubicin have proven to be effective in pycnogenol and its constituents on human fibrosarcoma cells (HT1080). Ten healthy subjects (six females, four males, mean age 24.8 ± 6 years) received a single dose of 300 mg pycnogenol orally. Blood plasma samples were obtained before and 6 h after intake of pycnogenol. HT1080 cells were treated with these plasma samples. Additionally, HT1080 were incubated separately with catechin, epicatechin and taxifolin that are known as the main constituents of pycnogenol. Vital, apoptotic and necrotic cells were quantified using flow cytometric analysis. Gene expression was analyzed by RNA microarray. The results showed that single application of taxifolin, catechin and epicatechin reduced cell viability of HT1080 cells only moderately. A single dose of 300 mg pycnogenol given to 10 healthy adults produced plasma samples that led to significant apoptotic cell death ex vivo whereas pycnogenol-negative serum displayed no apoptotic activity. Microarray analysis revealed remarkable expression changes induced by pycnogenol in a variety of genes, which are involved in different apoptotic pathways of cancer cells [Janus kinase 1 (JAK1), DUSP1, RHOA, laminin γ1 (LAMC1), fibronectin 1 (FN1), catenin α1 (CTNNA1), ITGB1]. In conclusion, metabolised pycnogenol induces apoptosis in human fibrosarcoma cells. Pycnogenol exhibits its pro-apoptotic activity as a mixture and is more effective than its main constituents catechin, epicatechin and taxifolin indicating that the metabolised components interact synergistically. These results provide experimental support for in vivo trials assessing the effect of the pine bark extract pycnogenol.

  5. New insights into the apoptotic process in mollusks: characterization of caspase genes in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Alejandro Romero

    Full Text Available Apoptosis is an essential biological process in the development and maintenance of immune system homeostasis. Caspase proteins constitute the core of the apoptotic machinery and can be categorized as either initiators or effectors of apoptosis. Although the genes encoding caspase proteins have been described in vertebrates and in almost all invertebrate phyla, there are few reports describing the initiator and executioner caspases or the modulation of their expression by different stimuli in different apoptotic pathways in bivalves. In the present work, we characterized two initiator and four executioner caspases in the mussel Mytilus galloprovincialis. Both initiators and executioners showed structural features that make them different from other caspase proteins already described. Evaluation of the genes' tissue expression patterns revealed extremely high expression levels within the gland and gills, where the apoptotic process is highly active due to the clearance of damaged cells. Hemocytes also showed high expression values, probably due to of the role of apoptosis in the defense against pathogens. To understand the mechanisms of caspase gene regulation, hemocytes were treated with UV-light, environmental pollutants and pathogen-associated molecular patterns (PAMPs and apoptosis was evaluated by microscopy, flow cytometry and qPCR techniques. Our results suggest that the apoptotic process could be tightly regulated in bivalve mollusks by overexpression/suppression of caspase genes; additionally, there is evidence of caspase-specific responses to pathogens and pollutants. The apoptotic process in mollusks has a similar complexity to that of vertebrates, but presents unique features that may be related to recurrent exposure to environmental changes, pollutants and pathogens imposed by their sedentary nature.

  6. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutated (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.

  7. Proteinase 3 on apoptotic cells disrupts immune silencing in autoimmune vasculitis

    Science.gov (United States)

    Millet, Arnaud; Martin, Katherine R.; Bonnefoy, Francis; Saas, Philippe; Mocek, Julie; Alkan, Manal; Terrier, Benjamin; Kerstein, Anja; Tamassia, Nicola; Satyanarayanan, Senthil Kumaran; Ariel, Amiram; Ribeil, Jean-Antoine; Guillevin, Loïc; Cassatella, Marco A.; Mueller, Antje; Thieblemont, Nathalie; Lamprecht, Peter; Mouthon, Luc; Perruche, Sylvain; Witko-Sarsat, Véronique

    2015-01-01

    Granulomatosis with polyangiitis (GPA) is a systemic necrotizing vasculitis that is associated with granulomatous inflammation and the presence of anti-neutrophil cytoplasmic antibodies (ANCAs) directed against proteinase 3 (PR3). We previously determined that PR3 on the surface of apoptotic neutrophils interferes with induction of antiinflammatory mechanisms following phagocytosis of these cells by macrophages. Here, we demonstrate that enzymatically active membrane-associated PR3 on apoptotic cells triggered secretion of inflammatory cytokines, including granulocyte CSF (G-CSF) and chemokines. This response required the IL-1R1/MyD88 signaling pathway and was dependent on the synthesis of NO, as macrophages from animals lacking these pathways did not exhibit a PR3-associated proinflammatory response. The PR3-induced microenvironment facilitated recruitment of inflammatory cells, such as macrophages, plasmacytoid DCs (pDCs), and neutrophils, which were observed in close proximity within granulomatous lesions in the lungs of GPA patients. In different murine models of apoptotic cell injection, the PR3-induced microenvironment instructed pDC-driven Th9/Th2 cell generation. Concomitant injection of anti-PR3 ANCAs with PR3-expressing apoptotic cells induced a Th17 response, revealing a GPA-specific mechanism of immune polarization. Accordingly, circulating CD4+ T cells from GPA patients had a skewed distribution of Th9/Th2/Th17. These results reveal that PR3 disrupts immune silencing associated with clearance of apoptotic neutrophils and provide insight into how PR3 and PR3-targeting ANCAs promote GPA pathophysiology. PMID:26436651

  8. Abl kinase inhibits the engulfment of apoptotic [corrected] cells in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Michael E Hurwitz

    2009-04-01

    Full Text Available The engulfment of apoptotic cells is required for normal metazoan development and tissue remodeling. In Caenorhabditis elegans, two parallel and partially redundant conserved pathways act in cell-corpse engulfment. One pathway includes the adaptor protein CED-2 CrkII and the small GTPase CED-10 Rac, and acts to rearrange the cytoskeleton of the engulfing cell. The other pathway includes the receptor tyrosine kinase CED-1 and might recruit membranes to extend the surface of the engulfing cell. Although many components required for engulfment have been identified, little is known about inhibition of engulfment. The tyrosine kinase Abl regulates the actin cytoskeleton in mammals and Drosophila in multiple ways. For example, Abl inhibits cell migration via phosphorylation of CrkII. We tested whether ABL-1, the C. elegans ortholog of Abl, inhibits the CED-2 CrkII-dependent engulfment of apoptotic cells. Our genetic studies indicate that ABL-1 inhibits apoptotic cell engulfment, but not through CED-2 CrkII, and instead acts in parallel to the two known engulfment pathways. The CED-10 Rac pathway is also required for proper migration of the distal tip cells (DTCs during the development of the C. elegans gonad. The loss of ABL-1 function partially restores normal DTC migration in the CED-10 Rac pathway mutants. We found that ABI-1 the C. elegans homolog of mammalian Abi (Abl interactor proteins, is required for engulfment of apoptotic cells and proper DTC migration. Like Abl, Abi proteins are cytoskeletal regulators. ABI-1 acts in parallel to the two known engulfment pathways, likely downstream of ABL-1. ABL-1 and ABI-1 interact physically in vitro. We propose that ABL-1 opposes the engulfment of apoptotic cells by inhibiting ABI-1 via a pathway that is distinct from the two known engulfment pathways.

  9. Relationship between apoptotic markers in semen from fertile men and demographic, hormonal and seminal characteristics

    Institute of Scientific and Technical Information of China (English)

    Ina O Specht; Marcello Spanò; Karin S Hougaard; Gian C Manicardi; Davide Bizzaro; Gunnar Toft; Aleksander Giwercman; Jens-Peter E Bonde

    2012-01-01

    Apoptosis in the testis has two putative roles during normal spermatogenesis; limitation of the germ ceil population to numbers that can be supported by the Sertoli cells,and,possibly,selective depletion of meiotic and postmeiotic abnormal germ cells.We investigated the demographic and biological correlates of the pro-apoptotic marker Fas and the anti-apoptotic marker Bcl-xL in sperm cells of fertile men.Six hundred and four men from Greenland,Poland and Ukraine were consecutively enrolled during their pregnant wife's antenatal visits.Semen analysis was performed as recommended by the World Health Organization.Immunofluorescence coupled to flow cytometry was utilized for detection of apoptotic markers in the sperm cell.DNA damage was assessed by flow cytometry using both the sperm chromatin structure assay (SCSA) and the terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay.The percentage of Fas-positive sperm cells was higher in men with high total sperm count (P<O.01),more motile sperms (P=O.04) and fewer sperm head defects (P=O.05).These associations were consistent within and across study regions.Furthermore,testosterone,follicle-stimulating hormone (FSH) and sexual hormone-binding globulin (SHBG) were significantly negatively correlated with Fas within and across regions as well.The data indicated no association between the anti-apoptotic Bcl-xL marker and semen or personal characteristics.The finding of Fas-positive sperm cells associated with better semen quality in a cohort of spouses of pregnant women seems different from previous data obtained in infertile men and warrants further investigation to clarifv the biological significance of sperm apoptotic markers.

  10. Impact of alginate-producing Pseudomonas aeruginosa on alveolar macrophage apoptotic cell clearance.

    Science.gov (United States)

    McCaslin, Charles A; Petrusca, Daniela N; Poirier, Christophe; Serban, Karina A; Anderson, Gregory G; Petrache, Irina

    2015-01-01

    Pseudomonas aeruginosa infection is a hallmark of lung disease in cystic fibrosis. Acute infection with P. aeruginosa profoundly inhibits alveolar macrophage clearance of apoptotic cells (efferocytosis) via direct effect of virulence factors. During chronic infection, P. aeruginosa evades host defense by decreased virulence, which includes the production or, in the case of mucoidy, overproduction of alginate. The impact of alginate on innate immunity, in particular on macrophage clearance of apoptotic cells is not known. We hypothesized that P. aeruginosa strains that exhibit reduced virulence impair macrophage clearance of apoptotic cells and we investigated if the polysaccharide alginate produced by mucoid P. aeruginosa is sufficient to inhibit alveolar macrophage efferocytosis. Rat alveolar or human peripheral blood monocyte (THP-1)-derived macrophage cell lines were exposed in vitro to exogenous alginate or to wild type or alginate-overproducing mucoid P. aeruginosa prior to challenge with apoptotic human Jurkat T-lymphocytes. The importance of LPS contamination and that of structural integrity of alginate polymers was tested using alginate of different purities and alginate lyase, respectively. Alginate inhibited alveolar macrophage efferocytosis in a dose- and time-dependent manner. This effect was augmented but not exclusively attributed to lipopolysaccharide (LPS) present in alginates. Alginate-producing P. aeruginosa inhibited macrophage efferocytosis by more than 50%. A mannuronic-specific alginate lyase did not restore efferocytosis inhibited by exogenous guluronic-rich marine alginate, but had a marked beneficial effect on efferocytosis of alveolar macrophages exposed to mucoid P. aeruginosa. Despite decreased virulence, mucoid P. aeruginosa may contribute to chronic airway inflammation through significant inhibition of alveolar clearance of apoptotic cells and debris. The mechanism by which mucoid bacteria inhibit efferocytosis may involve alginate

  11. Treating Wastewater With Immobilized Enzymes

    Science.gov (United States)

    Jolly, Clifford D.

    1991-01-01

    Experiments show enzymes are immobilized on supporting materials to make biocatalyst beds for treatment of wastewater. With suitable combination of enzymes, concentrations of various inorganic and organic contaminants, including ammonia and urea, reduced significantly.

  12. Mycobacterium tuberculosis blocks annexin-1 crosslinking and thus apoptotic envelope completion on infected cells to maintain virulence

    Science.gov (United States)

    Gan, Huixian; Lee, Jinhee; Ren, Fucheng; Chen, Minjian; Kornfeld, Hardy; Remold, Heinz G.

    2017-01-01

    Macrophages infected with attenuated Mycobacterium tuberculosis strain H37Ra become apoptotic, limiting bacterial replication and facilitating antigen presentation. Here, we demonstrate that cells infected with H37Ra became apoptotic after formation of an apoptotic envelope on their surface was complete. This process required exposure of phosphatidylserine on the cell surface followed by deposition of the phospholipid-binding protein annexin-1 and then transglutaminase-mediated crosslinking of annexin-1 via its N-terminal domain. In macrophages infected with virulent strain H37Rv, in contrast, the N-terminal domain of annexin-1 was removed by proteolysis thus preventing completion of the apoptotic envelope, which results in macrophage death by necrosis. Host defense of virulent Mycobacterium tuberculosis thus occurs by failure to form the apoptotic envelope, which leads to macrophage necrosis and dissemination of infection in the lung. PMID:18794848

  13. The general circulation of Titan and the topside escape rates of N2, CH4, and H2

    Science.gov (United States)

    Bell, J. M.; Waite, J. H.; Magee, B. A.; Gell, D.; Westlake, J. H.; Mandt, K. E.

    2009-12-01

    The general circulation of the atmosphere can have a significant impact on the escape of species from the upper atmospheres of planets (cf. Hartle and Mayer [1976]). Recently, Bell et al. [2009] used a one-dimensional (1-D) model to constrain mass loss rates from Titan’s upper atmosphere for both CH4 and H2. We report on the impacts of the 3-D circulation of Titan on the estimated escape fluxes of nitrogen, methane, and hydrogen. We present two scenarios for CH4 escape from Titan’s upper atmosphere: (1) a hydrodynamic escape scenario (Strobel [2009]) and (2) a low escape scenario (Bell et al [2009]). The composition, dynamics, and energetics of these two configurations will be discussed within the context of recent INMS measurements in the thermosphere and recent magnetospheric carbon ion measurements.

  14. Escape of HIV-1-infected dendritic cells from TRAIL-mediated NK cell cytotoxicity during NK-DC cross-talk--a pivotal role of HMGB1.

    Directory of Open Access Journals (Sweden)

    Marie-Thérèse Melki

    2010-04-01

    Full Text Available Early stages of Human Immunodeficiency Virus-1 (HIV-1 infection are associated with local recruitment and activation of important effectors of innate immunity, i.e. natural killer (NK cells and dendritic cells (DCs. Immature DCs (iDCs capture HIV-1 through specific receptors and can disseminate the infection to lymphoid tissues following their migration, which is associated to a maturation process. This process is dependent on NK cells, whose role is to keep in check the quality and the quantity of DCs undergoing maturation. If DC maturation is inappropriate, NK cells will kill them ("editing process" at sites of tissue inflammation, thus optimizing the adaptive immunity. In the context of a viral infection, NK-dependent killing of infected-DCs is a crucial event required for early elimination of infected target cells. Here, we report that NK-mediated editing of iDCs is impaired if DCs are infected with HIV-1. We first addressed the question of the mechanisms involved in iDC editing, and we show that cognate NK-iDC interaction triggers apoptosis via the TNF-related apoptosis-inducing ligand (TRAIL-Death Receptor 4 (DR4 pathway and not via the perforin pathway. Nevertheless, once infected with HIV-1, DC(HIV become resistant to NK-induced TRAIL-mediated apoptosis. This resistance occurs despite normal amounts of TRAIL released by NK cells and comparable DR4 expression on DC(HIV. The escape of DC(HIV from NK killing is due to the upregulation of two anti-apoptotic molecules, the cellular-Flice like inhibitory protein (c-FLIP and the cellular inhibitor of apoptosis 2 (c-IAP2, induced by NK-DC(HIV cognate interaction. High-mobility group box 1 (HMGB1, an alarmin and a key mediator of NK-DC cross-talk, was found to play a pivotal role in NK-dependent upregulation of c-FLIP and c-IAP2 in DC(HIV. Finally, we demonstrate that restoration of DC(HIV susceptibility to NK-induced TRAIL killing can be obtained either by silencing c-FLIP and c-IAP2 by specific

  15. SATB1 Mediates Long-Range Chromatin Interactions: A Dual Regulator of Anti-Apoptotic BCL2 and Pro-Apoptotic NOXA Genes.

    Science.gov (United States)

    Yang, Yin; Wang, Zongdan; Sun, Luan; Shao, Lipei; Yang, Nan; Yu, Dawei; Zhang, Xin; Han, Xiao; Sun, Yujie

    2015-01-01

    Aberrant expression of special AT-rich binding protein 1 (SATB1), a global genomic organizer, has been associated with various cancers, which raises the question of how higher-order chromatin structure contributes to carcinogenesis. Disruption of apoptosis is one of the hallmarks of cancer. We previously demonstrated that SATB1 mediated specific long-range chromosomal interactions between the mbr enhancer located within 3'-UTR of the BCL2 gene and the promoter to regulate BCL2 expression during early apoptosis. In the present study, we used chromosome conformation capture (3C) assays and molecular analyses to further investigate the function of the SATB1-mediated higher-order chromatin structure in co-regulation of the anti-apoptotic BCL2 gene and the pro-apoptotic NOXA gene located 3.4Mb downstream on Chromosome 18. We demonstrated that the mbr enhancer spatially juxtaposed the promoters of BCL2 and NOXA genes through SATB1-mediated chromatin-loop in Jurkat cells. Decreased SATB1 levels switched the mbr-BCL2 loop to mbr-NOXA loop, and thus changed expression of these two genes. The SATB1-mediated dynamic switch of the chromatin loop structures was essential for the cooperative expression of the BCL2 and NOXA genes in apoptosis. Notably, the role of SATB1 was specific, since inhibition of SATB1 degradation by caspase-6 inhibitor or caspase-6-resistant SATB1 mutant reversed expression of BCL-2 and NOXA in response to apoptotic stimulation. This study reveals the critical role of SATB1-organized higher-order chromatin structure in regulating the dynamic equilibrium of apoptosis-controlling genes with antagonistic functions and suggests that aberrant SATB1 expression might contribute to cancer development by disrupting the co-regulated genes in apoptosis pathways.

  16. Endoplasmic Reticulum Stress Induces the Early Appearance of Pro-apoptotic and Anti-apoptotic Proteins in Neurons of Five Familial Alzheimer's Disease Mice

    Institute of Scientific and Technical Information of China (English)

    Hui Shen; Xiao-Dong Pan; Jing Zhang; Yu-Qi Zeng; Meng Zhou; Lu-Meng Yang; Bing Ye

    2016-01-01

    Background:Amyloid β (Aβ) deposits and the endoplasmic reticulum stress (ERS) are both well established in the development and progression ofAlzheimer's disease (AD).However,the mechanism and role of Aβ-induced ERS in AD-associated pathological progression remain to be elucidated.Methods:The five familial AD (5 ×FAD) mice and wild-type (WT) mice aged 2,7,and 12 months were used in the present study.Morris water maze test was used to evaluate their cognitive performance.Immunofluorescence and Western blot analyses were used to examine the dynamic changes of pro-apoptotic (CCAAT/enhancer-binding protein homologous protein [CHOP] and cleaved caspase-12) and anti-apoptotic factors (chaperone glucose-regulated protein [GRP] 78 and endoplasmic reticulum-associated protein degradation-associated ubiquitin ligase synovial apoptosis inhibitor 1 [SYVN1]) in the ERS-associated unfolded protein response (UPR) pathway.Results:Compared with age-matched WT mice,5 ×FAD mice showed higher cleaved caspase-3,lower neuron-positive staining at the age of 12 months,but earlier cognitive deficit at the age of 7 months (all P < 0.05).Interestingly,for 2-month-old 5×FAD mice,the related proteins involved in the ERS-associated UPR pathway,including CHOP,cleaved caspase-12,GRP 78,and SYVN1,were significantly increased when compared with those in age-matched WT mice (all P < 0.05).Moreover,ERS occurred mainly in neurons,not in astrocytes.Conclusions:These findings suggest that compared with those of age-matched WT mice,ERS-associated pro-apoptotic and anti-apoptoticproteins are upregulated in 2-month-old 5×FAD mice,consistent with intracellular Aβ aggregation in neurons.

  17. The Catalytic Function of Enzymes.

    Science.gov (United States)

    Splittgerber, Allan G.

    1985-01-01

    Discusses: structure of the enzyme molecule; active site; reaction mechanism; transition state; factors affecting enzyme reaction rates, concentration of enzyme; concentration of substrate; product concentration; temperature effects and pH effects; factors causing a lowering of activation energy; proximity and orientation effects; substrate strain…

  18. c-Myc dependent expression of pro-apoptotic Bim renders HER2-overexpressing breast cancer cells dependent on anti-apoptotic Mcl-1

    Directory of Open Access Journals (Sweden)

    Jézéquel Pascal

    2011-09-01

    Full Text Available Abstract Background Anti-apoptotic signals induced downstream of HER2 are known to contribute to the resistance to current treatments of breast cancer cells that overexpress this member of the EGFR family. Whether or not some of these signals are also involved in tumor maintenance by counteracting constitutive death signals is much less understood. To address this, we investigated what role anti- and pro-apoptotic Bcl-2 family members, key regulators of cancer cell survival, might play in the viability of HER2 overexpressing breast cancer cells. Methods We used cell lines as an in vitro model of HER2-overexpressing cells in order to evaluate how anti-apoptotic Bcl-2, Bcl-xL and Mcl-1, and pro-apoptotic Puma and Bim impact on their survival, and to investigate how the constitutive expression of these proteins is regulated. Expression of the proteins of interest was confirmed using lysates from HER2-overexpressing tumors and through analysis of publicly available RNA expression data. Results We show that the depletion of Mcl-1 is sufficient to induce apoptosis in HER2-overexpressing breast cancer cells. This Mcl-1 dependence is due to Bim expression and it directly results from oncogenic signaling, as depletion of the oncoprotein c-Myc, which occupies regions of the Bim promoter as evaluated in ChIP assays, decreases Bim levels and mitigates Mcl-1 dependence. Consistently, a reduction of c-Myc expression by inhibition of mTORC1 activity abrogates occupancy of the Bim promoter by c-Myc, decreases Bim expression and promotes tolerance to Mcl-1 depletion. Western blot analysis confirms that naïve HER2-overexpressing tumors constitutively express detectable levels of Mcl-1 and Bim, while expression data hint on enrichment for Mcl-1 transcripts in these tumors. Conclusions This work establishes that, in HER2-overexpressing tumors, it is necessary, and maybe sufficient, to therapeutically impact on the Mcl-1/Bim balance for efficient induction of

  19. Kinetic Measurements for Enzyme Immobilization.

    Science.gov (United States)

    Cooney, Michael J

    2017-01-01

    Enzyme kinetics is the study of the chemical reactions that are catalyzed by enzymes, with a focus on their reaction rates. The study of an enzyme's kinetics considers the various stages of activity, reveals the catalytic mechanism of this enzyme, correlates its value to assay conditions, and describes how a drug or a poison might inhibit the enzyme. Victor Henri initially reported that enzyme reactions were initiated by a bond between the enzyme and the substrate. By 1910, Michaelis and Menten were advancing their work by studying the kinetics of an enzyme saccharase which catalyzes the hydrolysis of sucrose into glucose and fructose. They published their analysis and ever since the Michaelis-Menten equation has been used as the standard to describe the kinetics of many enzymes. Unfortunately, soluble enzymes must generally be immobilized to be reused for long times in industrial reactors. In addition, other critical enzyme properties have to be improved like stability, activity, inhibition by reaction products, and selectivity towards nonnatural substrates. Immobilization is by far the chosen process to achieve these goals.Although the Michaelis-Menten approach has been regularly adapted to the analysis of immobilized enzyme activity, its applicability to the immobilized state is limited by the barriers the immobilization matrix places upon the measurement of compounds that are used to model enzyme kinetics. That being said, the estimated value of the Michaelis-Menten coefficients (e.g., V max, K M) can be used to evaluate effects of immobilization on enzyme activity in the immobilized state when applied in a controlled manner. In this review enzyme activity and kinetics are discussed in the context of the immobilized state, and a few novel protocols are presented that address some of the unique constraints imposed by the immobilization barrier.

  20. HLA-associated immune escape pathways in HIV-1 subtype B Gag, Pol and Nef proteins.

    Directory of Open Access Journals (Sweden)

    Zabrina L Brumme

    Full Text Available BACKGROUND: Despite the extensive genetic diversity of HIV-1, viral evolution in response to immune selective pressures follows broadly predictable mutational patterns. Sites and pathways of Human Leukocyte-Antigen (HLA-associated polymorphisms in HIV-1 have been identified through the analysis of population-level data, but the full extent of immune escape pathways remains incompletely characterized. Here, in the largest analysis of HIV-1 subtype B sequences undertaken to date, we identify HLA-associated polymorphisms in the three HIV-1 proteins most commonly considered in cellular-based vaccine strategies. Results are organized into protein-wide escape maps illustrating the sites and pathways of HLA-driven viral evolution. METHODOLOGY/PRINCIPAL FINDINGS: HLA-associated polymorphisms were identified in HIV-1 Gag, Pol and Nef in a multicenter cohort of >1500 chronically subtype-B infected, treatment-naïve individuals from established cohorts in Canada, the USA and Western Australia. At q< or =0.05, 282 codons commonly mutating under HLA-associated immune pressures were identified in these three proteins. The greatest density of associations was observed in Nef (where close to 40% of codons exhibited a significant HLA association, followed by Gag then Pol (where approximately 15-20% of codons exhibited HLA associations, confirming the extensive impact of immune selection on HIV evolution and diversity. Analysis of HIV codon covariation patterns identified over 2000 codon-codon interactions at q< or =0.05, illustrating the dense and complex networks of linked escape and secondary/compensatory mutations. CONCLUSIONS/SIGNIFICANCE: The immune escape maps and associated data are intended to serve as a user-friendly guide to the locations of common escape mutations and covarying codons in HIV-1 subtype B, and as a resource facilitating the systematic identification and classification of immune escape mutations. These resources should facilitate