
Sample records for aphids acyrthosiphon pisum

  1. Genome sequence of the pea aphid Acyrthosiphon pisum

    DEFF Research Database (Denmark)

    Richards, S.; Gibbs, R. A.; Gerardo, N. M.;


    Aphids are important agricultural pests and also biological models for studies of insect-plant interactions, symbiosis, virus vectoring, and the developmental causes of extreme phenotypic plasticity. Here we present the 464 Mb draft genome assembly of the pea aphid Acyrthosiphon pisum. This first...... published whole genome sequence of a basal hemimetabolous insect provides an outgroup to the multiple published genomes of holometabolous insects. Pea aphids are host-plant specialists, they can reproduce both sexually and asexually, and they have coevolved with an obligate bacterial symbiont. Here we...

  2. Respiratory metabolism of the pea aphid, Acyrthosiphon pisum (Hemipetra: Aphididae)

    Czech Academy of Sciences Publication Activity Database

    Sláma, Karel; Jedlička, Pavel


    Roč. 109, č. 4 (2012), s. 491-502. ISSN 1210-5759 R&D Projects: GA ČR GP522/09/P382 Institutional support: RVO:60077344 Keywords : Hemiptera * Aphididae * Acyrthosiphon pisum Subject RIV: ED - Physiology Impact factor: 0.918, year: 2012

  3. Neonicotinoid Binding, Toxicity and Expression of Nicotinic Acetylcholine Receptor Subunits in the Aphid Acyrthosiphon pisum


    Taillebois, Emiliane; Beloula, Abdelhamid; Quinchard, Sophie; Jaubert-Possamai, Stéphanie; Daguin, Antoine; Servent, Denis; Tagu, Denis; Thany, Steeve H.; Tricoire-Leignel, Helene


    Neonicotinoid insecticides act on nicotinic acetylcholine receptor and are particularly effective against sucking pests. They are widely used in crops protection to fight against aphids, which cause severe damage. In the present study we evaluated the susceptibility of the pea aphid Acyrthosiphon pisum to the commonly used neonicotinoid insecticides imidacloprid (IMI), thiamethoxam (TMX) and clothianidin (CLT). Binding studies on aphid membrane preparations revealed the existence of high and ...

  4. Diapause in the pea aphid (Acyrthosiphon pisum is a slowing but not a cessation of development

    Directory of Open Access Journals (Sweden)

    Sisk Geoffroy C


    Full Text Available Abstract Background Many insects undergo a period of arrested development, called diapause, to avoid seasonally recurring adverse conditions. Whilst the phenology and endocrinology of insect diapause have been well studied, there has been comparatively little research into the developmental details of diapause. We investigated developmental aspects of diapause in sexually-produced embryos of the pea aphid, Acyrthosiphon pisum. Results We found that early stages of embryogenesis progressed at a temperature-independent rate, characteristic of diapause, whereas later stages of embryogenesis progressed at a temperature-dependent rate. However, embryos maintained at very high temperatures during the temperature-independent stage showed severe developmental abnormalities. Under no temperature regime did embryos display a distinct resting stage. Rather, morphological development progressed slowly but continuously throughout embryogenesis. Conclusion Diapause in the pea aphid, and perhaps in many other insects, is a temperature-independent slowing but not a cessation of morphological development. This suggests that the mechanisms limiting developmental rate during diapause may be the same as those controlling developmental rate at other stages of growth.

  5. Neonicotinoid binding, toxicity and expression of nicotinic acetylcholine receptor subunits in the aphid Acyrthosiphon pisum.

    Directory of Open Access Journals (Sweden)

    Emiliane Taillebois

    Full Text Available Neonicotinoid insecticides act on nicotinic acetylcholine receptor and are particularly effective against sucking pests. They are widely used in crops protection to fight against aphids, which cause severe damage. In the present study we evaluated the susceptibility of the pea aphid Acyrthosiphon pisum to the commonly used neonicotinoid insecticides imidacloprid (IMI, thiamethoxam (TMX and clothianidin (CLT. Binding studies on aphid membrane preparations revealed the existence of high and low-affinity binding sites for [3H]-IMI (Kd of 0.16 ± 0.04 nM and 41.7 ± 5.9 nM and for the nicotinic antagonist [125I]-α-bungarotoxin (Kd of 0.008 ± 0.002 nM and 1.135 ± 0.213 nM. Competitive binding experiments demonstrated that TMX displayed a higher affinity than IMI for [125I]-α-bungarotoxin binding sites while CLT affinity was similar for both [125I]-α-bungarotoxin and [3H]-IMI binding sites. Interestingly, toxicological studies revealed that at 48 h, IMI (LC50 = 0.038 µg/ml and TMX (LC50 = 0.034 µg/ml were more toxic than CLT (LC50 = 0.118 µg/ml. The effect of TMX could be associated to its metabolite CLT as demonstrated by HPLC/MS analysis. In addition, we found that aphid larvae treated either with IMI, TMX or CLT showed a strong variation of nAChR subunit expression. Using semi-quantitative PCR experiments, we detected for all insecticides an increase of Apisumα10 and Apisumβ1 expressions levels, whereas Apisumβ2 expression decreased. Moreover, some other receptor subunits seemed to be differently regulated according to the insecticide used. Finally, we also demonstrated that nAChR subunit expression differed during pea aphid development. Altogether these results highlight species specificity that should be taken into account in pest management strategies.

  6. Evaluation of the susceptibility of the pea aphid, Acyrthosiphon pisum, to a selection of novel biorational insecticides using an artificial diet


    Sadeghi, Amin; Van Damme, Els; Smagghe, Guy


    An improved technique was developed to assay the toxicity of insecticides against aphids using an artificial diet. The susceptibility of the pea aphid Acyrthosiphon pisum (Harris) (Hemiptera: Aphidoidea) was determined for a selection of novel biorational insecticides, each representing a novel mode of action. Flonicamid, a novel systemic insecticide with selective activity as feeding blocker against sucking insects, showed high toxicity against first-instar A. pisum nymphs with an LC50 of 20...

  7. Functional characterization of the adipokinetic hormone in the pea aphid, Acyrthosiphon pisum

    Czech Academy of Sciences Publication Activity Database

    Jedlička, Pavel; Steinbauerová, V.; Šimek, Petr; Zahradníčková, Helena


    Roč. 162, č. 1 (2012), s. 51-58. ISSN 1095-6433 R&D Projects: GA ČR GP522/09/P382 Grant ostatní: European Union FP7(CZ) MOBITAG, GA 229518 Institutional research plan: CEZ:AV0Z50070508 Keywords : adipokinetic hormone * Acyrthosiphon pisum * neuropeptide Subject RIV: ED - Physiology Impact factor: 2.167, year: 2012

  8. Modification of Cry4Aa toward Improved Toxin Processing in the Gut of the Pea Aphid, Acyrthosiphon pisum.

    Directory of Open Access Journals (Sweden)

    Michael A Rausch

    Full Text Available Aphids are sap-sucking insects (order: Hemiptera that cause extensive damage to a wide range of agricultural crops. Our goal was to optimize a naturally occurring insecticidal crystalline (Cry toxins produced by the soil-dwelling bacterium Bacillus thuringiensis for use against the pea aphid, Acyrthosiphon pisum. On the basis that activation of the Cry4Aa toxin is a rate-limiting factor contributing to the relatively low aphicidal activity of this toxin, we introduced cathepsin L and cathepsin B cleavage sites into Cry4Aa for rapid activation in the aphid gut environment. Incubation of modified Cry4Aa and aphid proteases in vitro demonstrated enhanced processing of the toxin into the active form for some of the modified constructs relative to non-modified Cry4Aa. Aphids fed artificial diet with toxin at a final concentration of 125 μg/ml showed enhanced mortality after two days for one of the four modified constructs. Although only modest toxin improvement was achieved by use of this strategy, such specific toxin modifications designed to overcome factors that limit aphid toxicity could be applied toward managing aphid populations via transgenic plant resistance.

  9. Nicotinic Acetylcholine Receptor Gene Family of the Pea Aphid, Acyrthosiphon pisum

    Institute of Scientific and Technical Information of China (English)

    LIU Yi-peng; LIN Ke-jian; LIU Yang; GUI Fu-rong; WANG Gui-rong


    The nicotinic acetylcholine receptors (nAchRs) are cholinergic receptors that form ligand-gated ion channels by ifve subunits in insect and vertebrate nervous systems. The insect nAChR is the molecular target of a class of insecticides, neonicotinoids. Here, we identiifed and cloned 11 candidate nAChR subunit genes in Acyrthosiphon pisum using genome-based bioinformatics combined modern molecular techniques. Most A. pisum nAChRs including α1, α2, α3, α4, α6, α8, and β1 show highly sequence identities with the counterparts of other insects examined. Expression proifles analysis showed that all subunit genes were expressed in adult head. At least two subunits have alternative splicing that obviously increase A. pisum nicotinic receptor diversity. This study will be invaluable for exploring the molecular mechanisms of neonicotinoid-like insecticides in sucking pests, and for ultimately establishing the screening platform of novel insecticides.

  10. Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum

    Directory of Open Access Journals (Sweden)

    Leterme Nathalie


    Full Text Available Abstract Background Post-transcriptional regulation in eukaryotes can be operated through microRNA (miRNAs mediated gene silencing. MiRNAs are small (18-25 nucleotides non-coding RNAs that play crucial role in regulation of gene expression in eukaryotes. In insects, miRNAs have been shown to be involved in multiple mechanisms such as embryonic development, tissue differentiation, metamorphosis or circadian rhythm. Insect miRNAs have been identified in different species belonging to five orders: Coleoptera, Diptera, Hymenoptera, Lepidoptera and Orthoptera. Results We developed high throughput Solexa sequencing and bioinformatic analyses of the genome of the pea aphid Acyrthosiphon pisum in order to identify the first miRNAs from a hemipteran insect. By combining these methods we identified 149 miRNAs including 55 conserved and 94 new miRNAs. Moreover, we investigated the regulation of these miRNAs in different alternative morphs of the pea aphid by analysing the expression of miRNAs across the switch of reproduction mode. Pea aphid microRNA sequences have been posted to miRBase: Conclusions Our study has identified candidates as putative regulators involved in reproductive polyphenism in aphids and opens new avenues for further functional analyses.

  11. Stable isotope studies reveal pathways for the incorporation of non-essential amino acids in Acyrthosiphon pisum (pea aphids). (United States)

    Haribal, Meena; Jander, Georg


    Plant roots incorporate inorganic nitrogen into the amino acids glutamine, glutamic acid, asparagine and aspartic acid, which together serve as the primary metabolites of nitrogen transport to other tissues. Given the preponderance of these four amino acids, phloem sap is a nutritionally unbalanced diet for phloem-feeding insects. Therefore, aphids and other phloem feeders typically rely on microbial symbionts for the synthesis of essential amino acids. To investigate the metabolism of the four main transport amino acids by the pea aphid (Acyrthosiphon pisum), and its Buchnera aphidicola endosymbionts, aphids were fed defined diets with stable isotope-labeled glutamine, glutamic acid, asparagine or aspartic acid (U-(13)C, U-(15)N; U-(15)N; α-(15)N; or γ-(15)N). The metabolic fate of the dietary (15)N and (13)C was traced using gas chromatography-mass spectrometry (GC-MS). Nitrogen was the major contributor to the observed amino acid isotopomers with one additional unit mass (M+1). However, there was differential incorporation, with the amine nitrogen of asparagine being incorporated into other amino acids more efficiently than the amide nitrogen. Higher isotopomers (M+2, M+3 and M+4) indicated the incorporation of varying numbers of (13)C atoms into essential amino acids. GC-MS assays also showed that, even with an excess of dietary labeled glutamine, glutamic acid, asparagine or aspartic acid, the overall content of these amino acids in aphid bodies was mostly the product of catabolism of dietary amino acids and subsequent re-synthesis within the aphids. Thus, these predominant dietary amino acids are not passed directly to Buchnera endosymbionts for synthesis of essential amino acids, but are rather are produced de novo, most likely by endogenous aphid enzymes. PMID:26632455

  12. Identification of distinct quantitative trait loci associated with defence against the closely related aphids Acyrthosiphon pisum and A. kondoi in Medicago truncatula

    KAUST Repository

    Guo, Su-Min


    Aphids are a major family of plant insect pests. Medicago truncatula and Acyrthosiphon pisum (pea aphid, PA) are model species with a suite of resources available to help dissect the mechanism underlying plant-aphid interactions. A previous study focused on monogenic and relatively strong resistance in M. truncatula to PA and other aphid species. In this study a moderate resistance to PA was characterized in detail in the M. truncatula line A17 and compared with the highly susceptible line A20 and the more resistant line Jester. The results show that PA resistance in A17 involves both antibiosis and tolerance, and that resistance is phloem based. Quantitative trait locus (QTL) analysis using a recombinant inbred line (RIL) population (n=114) from a cross between A17 and A20 revealed that one locus, which co-segregated with AIN (Acyrthosiphon-induced necrosis) on chromosome 3, is responsible for the reduction of aphid biomass (indicator of antibiosis) for both PA and bluegreen aphid (BGA, A. kondoi), albeit to a lesser degree for PA than BGA. Interestingly, two independent loci on chromosomes 5 and 3 were identified for the plant biomass reduction (indicator of plant tolerance) by PA and BGA, respectively, demonstrating that the plant\\'s tolerance response to these two closely related aphid species is distinct. Together with previously identified major resistant (R) genes, the QTLs identified in this study are powerful tools to understand fully the spectrum of plant defence against sap-sucking insects and provide opportunities for breeders to generate effective and sustainable strategies for aphid control. 2012 The Author.

  13. Efficacy of different chemicals for the control of aphid (acyrthosiphon pisum) on guar (cymopisis tetragonolobus) crop

    International Nuclear Information System (INIS)

    An experiment was carried out to evaluate the efficacy of different chemicals far the control of aphid on guar crop at Adaptive Research Farm Karor during the three successive kharif seasons i.e. 2006-07 and 2008. The experiments were laid out in Randomized Complete Block Design with three replications and five treatments viz T1=control, T2 Bifenthrin at the rate 375 ml ha/sup -1/, T3=Primore 50PP at the rate 850 ml ha/sup -1/ T4=Furathiocrab at the rate 750 ml ha/sup -1/ and T5=Carbosulfan at the rate 1250 ml ha/sup -1/. All the treatments (T4) caused significant decrease in the Pest population as compared to the control. Treatment (T4) where Furathiocrab was applied at the rate. 750 ml ha/sup -1/ during the years 2006, 2007 and 2008 respectively. (author)

  14. Taxonomy Icon Data: pea aphid [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available pea aphid Acyrthosiphon pisum Arthropoda Acyrthosiphon_pisum_L.png Acyrthosiphon_pisum_NL.png Acyrthosip...hon_pisum_S.png Acyrthosiphon_pisum_NS.png http:...// ...

  15. Glutathione S-transferases of Aulacorthum solani and Acyrthosiphon pisum: partial purification and characterization.


    Francis, Frédéric; Haubruge, Eric; Gaspar, Charles; Dierickx, P. J.


    Glutathione S-transferases (GST) play an important role in the detoxification of many substances including allelochemicals from plants. Brassicaceae plants contain glucosinolates and emit volatile isothiocyanates which affect the GST system. A comparison of the GST of two aphid species, the generalist Aulacorthum solani found on Brassicaceae and the Fabaceae specialist Acyrthosiphon pisum, was made to try to explain their respective feeding behaviour. Differences of GST were determined among ...

  16. Glutathione S-transferases of Aulacorthum solani and Acyrthosiphon pisum: partial purification and characterization. (United States)

    Francis, F; Haubruge, E; Gaspar, C; Dierickx, P J


    Glutathione S-transferases (GST) play an important role in the detoxification of many substances including allelochemicals from plants. Brassicaceae plants contain glucosinolates and emit volatile isothiocyanates which affect the GST system. A comparison of the GST of two aphid species, the generalist Aulacorthum solani found on Brassicaceae and the Fabaceae specialist Acyrthosiphon pisum, was made to try to explain their respective feeding behaviour. Differences of GST were determined among the two aphid species based on purification by affinity chromatography, SDS-PAGE and on kinetic studies. Purification yields using an epoxy-activated Sepharose 6B column were highly different for the two aphid species (18% and 34% for A. solani and A. pisum, respectively). These variations were confirmed by SDS-PAGE. While only a 27-kDa band was observed for A. pisum, two bands of approximately 25-kDa were visualized for the generalist aphid, A. solani. Considering the kinetic results, differences of Km and Vmax were observed following the aphid species when a range of substrates (CDNB and DCNB) and GSH concentrations were tested. Studies on the detoxification enzymes of generalist and specialist herbivores would be undertaken to determine accurately the effect of the host plant on the organisms eating them, particularly in terms of biochemical and ecological advantages. PMID:11337260

  17. Acyrthosiphon pisum AQP2: a multifunctional insect aquaglyceroporin

    Czech Academy of Sciences Publication Activity Database

    Wallace, I. S.; Shakesby, A. J.; Hwang, J. H.; Choi, W. G.; Martínková, Natália; Douglas, A. E.; Roberts, D. M.


    Roč. 1818, č. 3 (2012), s. 627-635. ISSN 0005-2736 Institutional research plan: CEZ:AV0Z60930519 Keywords : aphid * Buchnera aphidicola * channel proteins * osmoregulation * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.389, year: 2012

  18. Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and Kelp fly virus.

    Directory of Open Access Journals (Sweden)

    Steven M Valles

    Full Text Available Solenopsis invicta virus 3 (SINV-3 is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the structural proteins map to both ORF2 and the 3' end of ORF1, downstream of the sequence that encodes the RNA-dependent RNA polymerase. The genome organization and structural protein expression strategy resemble those of Acyrthosiphon pisum virus (APV, an aphid virus. The capsid protein that is encoded by the 3' end of ORF1 in SINV-3 and APV is predicted to have a jelly-roll fold similar to the capsid proteins of picornaviruses and caliciviruses. The capsid-extension protein that is produced by frameshifting, includes the jelly-roll fold domain encoded by ORF1 as its N-terminus, while the C-terminus encoded by the 5' half of ORF2 has no clear homology with other viral structural proteins. A third protein, encoded by the 3' half of ORF2, is associated with purified virions at sub-stoichiometric ratios. Although the structural proteins can be translated from the genomic RNA, we show that SINV-3 also produces a subgenomic RNA encoding the structural proteins. Circumstantial evidence suggests that APV may also produce such a subgenomic RNA. Both SINV-3 and APV are unclassified picorna-like viruses distantly related to members of the order Picornavirales and the family Caliciviridae. Within this grouping, features of the genome organization and capsid domain structure of SINV-3 and APV appear more similar to caliciviruses, perhaps suggesting the basis for a "Calicivirales" order.

  19. Genetic Mapping of a Major Resistance Gene to Pea Aphid (Acyrthosipon pisum) in the Model Legume Medicago truncatula. (United States)

    Kamphuis, Lars G; Guo, Su-Min; Gao, Ling-Ling; Singh, Karam B


    Resistance to the Australian pea aphid (PA; Acyrthosiphon pisum) biotype in cultivar Jester of the model legume Medicago truncatula is mediated by a single dominant gene and is phloem-mediated. The genetic map position for this resistance gene, APR (Acyrthosiphon pisum resistance), is provided and shows that APR maps 39 centiMorgans (cM) distal of the A. kondoi resistance (AKR) locus, which mediates resistance to a closely related species of the same genus bluegreen aphid (A. kondoi). The APR region on chromosome 3 is dense in classical nucleotide binding site leucine-rich repeats (NLRs) and overlaps with the region harbouring the RAP1 gene which confers resistance to a European PA biotype in the accession Jemalong A17. Further screening of a core collection of M. truncatula accessions identified seven lines with strong resistance to PA. Allelism experiments showed that the single dominant resistance to PA in M. truncatula accessions SA10481 and SA1516 are allelic to SA10733, the donor of the APR locus in cultivar Jester. While it remains unclear whether there are multiple PA resistance genes in an R-gene cluster or the resistance loci identified in the other M. truncatula accessions are allelic to APR, the introgression of APR into current M. truncatula cultivars will provide more durable resistance to PA. PMID:27483247

  20. Optimization of Agroinfiltration in Pisum sativum Provides a New Tool for Studying the Salivary Protein Functions in the Pea Aphid Complex. (United States)

    Guy, Endrick; Boulain, Hélène; Aigu, Yoann; Le Pennec, Charlotte; Chawki, Khaoula; Morlière, Stéphanie; Schädel, Kristina; Kunert, Grit; Simon, Jean-Christophe; Sugio, Akiko


    Aphids are piercing-sucking insect pests and feed on phloem sap. During feeding, aphids inject a battery of salivary proteins into host plant. Some of these proteins function like effectors of microbial pathogens and influence the outcome of plant-aphid interactions. The pea aphid (Acyrthosiphon pisum) is the model aphid and encompasses multiple biotypes each specialized to one or a few legume species, providing an opportunity to investigate the underlying mechanisms of the compatibility between plants and aphid biotypes. We aim to identify the aphid factors that determine the compatibility with host plants, hence involved in the host plant specialization process, and hypothesize that salivary proteins are one of those factors. Agrobacterium-mediated transient gene expression is a powerful tool to perform functional analyses of effector (salivary) proteins in plants. However, the tool was not established for the legume species that A. pisum feeds on. Thus, we decided to optimize the method for legume plants to facilitate the functional analyses of A. pisum salivary proteins. We screened a range of cultivars of pea (Pisum sativum) and alfalfa (Medicago sativa). None of the M. sativa cultivars was suitable for agroinfiltration under the tested conditions; however, we established a protocol for efficient transient gene expression in two cultivars of P. sativum, ZP1109 and ZP1130, using A. tumefaciens AGL-1 strain and the pEAQ-HT-DEST1 vector. We confirmed that the genes are expressed from 3 to 10 days post-infiltration and that aphid lines of the pea adapted biotype fed and reproduced on these two cultivars while lines of alfalfa and clover biotypes did not. Thus, the pea biotype recognizes these two cultivars as typical pea plants. By using a combination of ZP1109 and an A. pisum line, we defined an agroinfiltration procedure to examine the effect of in planta expression of selected salivary proteins on A. pisum fitness and demonstrated that transient expression of

  1. Performances of survival, feeding behavior, and gene expression in aphids reveal their different fitness to host alteration


    Hong Lu; Pengcheng Yang; Yongyu Xu; Lan Luo; Junjie Zhu; Na Cui; Le Kang; Feng Cui


    Insect populations feeding on different plant species are under selection pressure to adapt to these differences. A study integrating elements of the ecology, behavior, and gene expression of aphids on different host plants has not yet been well-explored. The present study explores the relationship between host fitness and survival, feeding behavior, and salivary gland gene expression of a pea (Pisum sativum) host race of Acyrthosiphon pisum feeding on a common host Vicia faba and on three ge...

  2. Parasitic wasp responses to symbiont-based defense in aphids

    Directory of Open Access Journals (Sweden)

    Oliver Kerry M


    Full Text Available Abstract Background Recent findings indicate that several insect lineages receive protection against particular natural enemies through infection with heritable symbionts, but little is yet known about whether enemies are able to discriminate and respond to symbiont-based defense. The pea aphid, Acyrthosiphon pisum, receives protection against the parasitic wasp, Aphidius ervi, when infected with the bacterial symbiont Hamiltonella defensa and its associated bacteriophage APSE (Acyrthosiphon pisum secondary endosymbiont. Internally developing parasitoid wasps, such as A. ervi, use maternal and embryonic factors to create an environment suitable for developing wasps. If more than one parasitoid egg is deposited into a single aphid host (superparasitism, then additional complements of these factors may contribute to the successful development of the single parasitoid that emerges. Results We performed experiments to determine if superparasitism is a tactic allowing wasps to overcome symbiont-mediated defense. We found that the deposition of two eggs into symbiont-protected aphids significantly increased rates of successful parasitism relative to singly parasitized aphids. We then conducted behavioral assays to determine whether A. ervi selectively superparasitizes H. defensa-infected aphids. In choice tests, we found that A. ervi tends to deposit a single egg in uninfected aphids, but two or more eggs in H. defensa-infected aphids, indicating that oviposition choices may be largely determined by infection status. Finally, we identified differences in the quantity of the trans-β-farnesene, the major component of aphid alarm pheromone, between H. defensa-infected and uninfected aphids, which may form the basis for discrimination. Conclusions Here we show that the parasitic wasp A. ervi discriminates among symbiont-infected and uninfected aphids, and changes its oviposition behavior in a way that increases the likelihood of overcoming symbiont

  3. Do plant viruses facilitate their aphid vectors by inducing symptoms that alter behavior and performance? (United States)

    Hodge, Simon; Powell, Glen


    Aphids can respond both positively and negatively to virus-induced modifications of the shared host plant. It can be speculated that viruses dependent on aphids for their transmission might evolve to induce changes in the host plant that attract aphids and improve their performance, subsequently enhancing the success of the pathogen itself. We studied how pea aphids [Acyrthosiphon pisum (Harris)] responded to infection of tic beans (Vicia faba L.) by three viruses with varying degrees of dependence on this aphid for their transmission: pea enation mosaic virus (PEMV), bean yellow mosaic virus (BYMV), and broad bean mottle virus (BBMV). BYMV has a nonpersistent mode of transmission by aphids, whereas PEMV is transmitted in a circulative-persistent manner. BBMV is not aphid transmitted. When reared on plants infected by PEMV, no changes in aphid survival, growth, or reproductive performance were observed, whereas infection of beans by the other aphid-dependent virus, BYMV, actually caused a reduction in aphid survival in some assays. None of the viruses induced A. pisum to increase production of winged progeny, and aphids settled preferentially on leaf tissue from plants infected by all three viruses, the likely mechanism being visual responses to yellowing of foliage. Thus, in this system, the attractiveness of an infected host plant and its quality in terms of aphid growth and reproduction were not related to the pathogen's dependence on the aphid for transmission to new hosts. PMID:19161702

  4. A peptide that binds the pea aphid gut impedes entry of Pea enation mosaic virus into the aphid hemocoel

    International Nuclear Information System (INIS)

    Development of ways to block virus transmission by aphids could lead to novel and broad-spectrum means of controlling plant viruses. Viruses in the Luteoviridae enhanced are obligately transmitted by aphids in a persistent manner that requires virion accumulation in the aphid hemocoel. To enter the hemocoel, the virion must bind and traverse the aphid gut epithelium. By screening a phage display library, we identified a 12-residue gut binding peptide (GBP3.1) that binds to the midgut and hindgut of the pea aphid Acyrthosiphon pisum. Binding was confirmed by labeling the aphid gut with a GBP3.1-green fluorescent protein fusion. GBP3.1 reduced uptake of Pea enation mosaic virus (Luteoviridae) from the pea aphid gut into the hemocoel. GBP3.1 also bound to the gut epithelia of the green peach aphid and the soybean aphid. These results suggest a novel strategy for inhibiting plant virus transmission by at least three major aphid pest species.

  5. Taux de reproduction du puceron du pois (Acyrthosiphon pisum Harris) et teneur en acide médicagénique de la luzerne (Medicago sativa L)


    Bournoville, R


    Medicagenic acid, a major component of the saponin content of lucerne, has been reported by some authors as one of the possible mechanisms of resistance of lucerne to the pea aphid. We have measured the net reproductive rate of the pea aphid on 12 clones or hybrids of lucerne, derived from cultivars or lines of American (La, Res, Te) and French (12, 58, Eur) origins. The pea aphid performances were tested on plants growing under controlled conditions (temperature 20 °C, photophasis 16 h). Bef...

  6. A simple wax-embedding method for isolation of aphid hemolymph for detection of luteoviruses in the hemocoel. (United States)

    Liu, Sijun; Bonning, Bryony C; Allen Miller, W


    A protocol for isolating hemolymph from viruliferous aphids has been developed. This method uses warm melted wax to immobilize the aphid. Following removal of a hind leg, the hemolymph can be collected readily. Flushing with RNase-free water allows for collection of sufficient hemolymph for RNA extraction from individual aphids. The extracted RNA was successfully used for detection of barley yellow dwarf virus (BYDV) and pea enation mosaic virus (PEMV) from individual viruliferous Rhopalosiphum padi and Acyrthosiphon pisum aphids, respectively. A TaqMan real-time RT-PCR protocol for quantitation of PEMV in the hemolymph of individual aphids was developed. The wax-embedding hemolymph collection technique provides a useful tool for studying molecular interactions between persistent and circulative plant viruses and their insect vectors. PMID:16307802

  7. Identification of Critical Conditions for Immunostaining in the Pea Aphid Embryos: Increasing Tissue Permeability and Decreasing Background Staining. (United States)

    Lin, Gee-Way; Chang, Chun-che


    The pea aphid Acyrthosiphon pisum, with a sequenced genome and abundant phenotypic plasticity, has become an emerging model for genomic and developmental studies. Like other aphids, A. pisum propagate rapidly via parthenogenetic viviparous reproduction, where the embryos develop within egg chambers in an assembly-line fashion in the ovariole. Previously we have established a robust platform of whole-mount in situ hybridization allowing detection of mRNA expression in the aphid embryos. For analyzing the expression of protein, though, established protocols for immunostaining the ovarioles of asexual viviparous aphids did not produce satisfactory results. Here we report conditions optimized for increasing tissue permeability and decreasing background staining, both of which were problems when applying established approaches. Optimizations include: (1) incubation of proteinase K (1 µg/ml, 10 min), which was found essential for antibody penetration in mid- and late-stage aphid embryos; (2) replacement of normal goat serum/bovine serum albumin with a blocking reagent supplied by a Digoxigenin (DIG)-based buffer set and (3) application of methanol rather hydrogen peroxide (H2O2) for bleaching endogenous peroxidase; which significantly reduced the background staining in the aphid tissues. These critical conditions optimized for immunostaining will allow effective detection of gene products in the embryos of A. pisum and other aphids. PMID:26862939

  8. Aphid salivary proteases are capable of degrading sieve-tube proteins. (United States)

    Furch, Alexandra C U; van Bel, Aart J E; Will, Torsten


    Sieve tubes serve as transport conduits for photo-assimilates and other resources in angiosperms and are profitable targets for piercing-sucking insects such as aphids. Sieve-tube sap also contains significant amounts of proteins with diverse functions, for example in signalling, metabolism, and defence. The identification of salivary proteases in Acyrthosiphon pisum led to the hypothesis that aphids might be able to digest these proteins and by doing so suppress plant defence and access additional nitrogen sources. Here, the scarce knowledge of proteases in aphid saliva is briefly reviewed. In order to provide a better platform for discussion, we conducted a few tests on in vitro protease activity and degradation of sieve-tube sap proteins of Cucurbita maxima by watery saliva. Inhibition of protein degradation by EDTA indicates the presence of different types of proteases (e.g. metalloproteses) in saliva of A. pisum. Proteases in the watery saliva from Macrosiphum euphorbiae and A. pisum were able to degrade the most abundant phloem protein, which is phloem protein 1. Our results provide support for the breakdown of sieve-element proteins by aphid saliva in order to suppress/neutralize the defence responses of the plant and to make proteins of sieve-tube sap accessible as a nitrogen source, as is discussed in detail. Finally, we discuss whether glycosylation of sieve-element proteins and the presence of protease inhibitors may confer partial protection against the proteolytic activity of aphid saliva. PMID:25540441

  9. Winged Pea Aphids Can Modify Phototaxis in Different Development Stages to Assist Their Host Distribution. (United States)

    Zhang, Yi; Wang, Xing-Xing; Jing, Xiangfeng; Tian, Hong-Gang; Liu, Tong-Xian


    The pea aphid, Acyrthosiphon pisum (Harris) (Hemiptera: Aphididae), shows wing polyphenism (winged and wingless morphs) in its life cycle. The winged morph is adapted for dispersal; its two developmental adult stages (for dispersal and reproduction) are based on its breeding periods. The two morphs show different phototactic behavior and the winged can change its preference to light according to the developmental stages. To determine the mechanism and ecological functions of phototaxis for A. pisum, we first investigated the phototaxis of the two aphid morphs at different stages and analyzed the phototactic response to lights of different wavelengths; the correlation between alate fecundity and their phototactic behaviors were then studied. Finally, we focused on the possible functions of phototaxis in aphid host location and distribution in combination with gravitaxis behaviors. Negative phototaxis was found for breeding winged adults but all the other stages of both winged and wingless morphs showed positive phototaxis. The reactions of the aphids to different wavelengths were also different. Nymph production in winged adults showed negative correlation to phototaxis. The dopamine pathway was possibly involved in these behavior modifications. We speculated that winged adults can use light for dispersal in the early dispersal stage and for position holding in the breeding stage. Based on our results, we assume that light signals are important for aphid dispersal and distribution, and are also essential for the pea aphids to cope with environmental changes. PMID:27531980

  10. Enemy-free space promotes maintenance of host races in an aphid species. (United States)

    Vosteen, Ilka; Gershenzon, Jonathan; Kunert, Grit


    The enormous biodiversity of herbivorous insects may arise from ecological speciation via continuous host-plant switches. Whether such switches are successful depends on the trade-off between different selection pressures that act on herbivores. Decreased herbivore performance due to suboptimal nutrition might be compensated for by a reduced natural enemy pressure. As a consequence, an "enemy-free space" on a certain plant might facilitate host-plant switches and maintain biotypes. To test this hypothesis, we used the pea aphid (Acyrthosiphon pisum) complex, which consists of at least 11 genetically distinct host races that are native to specific legume host plants but can all develop on the universal host plant Vicia faba. Three A. pisum host races native to Trifolium pratense, Pisum sativum, and Medicago sativa were investigated in experiments on their respective host plants and on the universal host plant V. faba. We found that hoverflies preferred to oviposit on P. sativum and the universal host V. faba. Since feeding by hoverfly larvae suppressed aphid population growth on these host plants, the native hosts M. sativa and T. pratense provided enemy-free space for the respective A. pisum races. Mobile predators, such as ants and ladybird beetles, preferred Pisum race aphids on V. faba over P. sativum. Thus, all three of the native host plants studied supply enemy-free space for A. pisum compared to the universal host V. faba. Reducing encounters between aphid races on V. faba would reduce gene flow among them and could contribute to maintaining the host races. PMID:26520659

  11. Hoverfly preference for high honeydew amounts creates enemy-free space for aphids colonizing novel host plants. (United States)

    Vosteen, Ilka; Gershenzon, Jonathan; Kunert, Grit


    The existence of an enemy-free space can play an important role in aphid host race formation processes, but little is known about the mechanisms that create an area of low predation pressure on particular host plants. In this paper, we identify a mechanism generating lower predation pressure that promotes the maintenance of the different host races of the pea aphid (Acyrthosiphon pisum) complex, a well-studied model for ecological speciation. The pea aphid consists of at least 15 genetically distinct host races which are native to specific host plants of the legume family, but can all develop on the universal host plant Vicia faba. Previous work showed that hoverfly (Episyrphus balteatus) oviposition preferences contribute to the enemy-free space that helps to maintain the different pea aphid host races, and that higher amounts of honeydew are more attractive to ovipositing hoverflies. Here we demonstrated that aphid honeydew is produced in large amounts when aphid reproduction rate was highest, and is an important oviposition cue for hoverflies under field conditions. However, on less suitable host plants, where honeydew production is reduced, pea aphids enjoy lower predation rates. A reduction in enemy pressure can mitigate the performance disadvantages of aphids colonizing a novel host and probably plays an important role in pea aphid host race formation. PMID:27328648

  12. Species resistance of lucerne (Medicago sativa L.) to insects. Significance and concepts of programmes concerning aphids

    International Nuclear Information System (INIS)

    The significance of programmes concerning species resistance are discussed on hand of the relations between lucerne (Medicago sativa L.) and aphids. In the USA this method is utilized to combat the losses resulting from the accidental introduction of the plant louse. In Europe, intensified forage production justifies its use since it avoids pollution and reduces the cost of plant protection for the producer. The various stages of the programme are analyzed. The case of the pea aphids (Acyrthosiphon pisum Harris) is discussed specifically on hand of published literature and our own results. The first point must be an evaluation of the destruction caused by the pest. Subsequently adequate methods for mass rearing of the insect must be available. The conditioning of bean (Vicia faba L.) as host instead of A. pisum should be treated with reserve. Furthermore, trustworthy and reproducible tests are required. As far as we are concerned, we evaluate the net rate of reproduction of the aphids. The selection of lucerne strains of sufficiently high genetic resistance should make it possible to avoid problems arising from variability in aphid populations. Various examples are given of such modified resistance resulting from the selection of new biotypes. At present one can only make assumptions as to the causes of strain resistance to aphids in lucerne. In the case of M. sativa, selection programmes appear favoured by the great variability of the species

  13. Aphid wing induction and ecological costs of alarm pheromone emission under field conditions.

    Directory of Open Access Journals (Sweden)

    Eduardo Hatano

    Full Text Available The pea aphid, Acyrthosiphon pisum Harris, (Homoptera: Aphididae releases the volatile sesquiterpene (E-beta-farnesene (EBF when attacked by a predator, triggering escape responses in the aphid colony. Recently, it was shown that this alarm pheromone also mediates the production of the winged dispersal morph under laboratory conditions. The present work tested the wing-inducing effect of EBF under field conditions. Aphid colonies were exposed to two treatments (control and EBF and tested in two different environmental conditions (field and laboratory. As in previous experiments aphids produced higher proportion of winged morphs among their offspring when exposed to EBF in the laboratory but even under field conditions the proportion of winged offspring was higher after EBF application (6.84+/-0.98% compared to the hexane control (1.54+/-0.25%. In the field, the proportion of adult aphids found on the plant at the end of the experiment was lower in the EBF treatment (58.1+/-5.5% than in the control (66.9+/-4.6%, in contrast to the climate chamber test where the numbers of adult aphids found on the plant at the end of the experiment were, in both treatments, similar to the numbers put on the plant initially. Our results show that the role of EBF in aphid wing induction is also apparent under field conditions and they may indicate a potential cost of EBF emission. They also emphasize the importance of investigating the ecological role of induced defences under field conditions.

  14. Performances of survival, feeding behavior, and gene expression in aphids reveal their different fitness to host alteration. (United States)

    Lu, Hong; Yang, Pengcheng; Xu, Yongyu; Luo, Lan; Zhu, Junjie; Cui, Na; Kang, Le; Cui, Feng


    Insect populations feeding on different plant species are under selection pressure to adapt to these differences. A study integrating elements of the ecology, behavior, and gene expression of aphids on different host plants has not yet been well-explored. The present study explores the relationship between host fitness and survival, feeding behavior, and salivary gland gene expression of a pea (Pisum sativum) host race of Acyrthosiphon pisum feeding on a common host Vicia faba and on three genetically-related hosts (Vicia villosa, Medicago truncatula, and Medicago sativa). Life table data indicated that aphids on non-favored hosts exhibited small size, low reproduction rate, slow population increase and individual development, and long lifespan. Electrical penetration graph results showed that the aphids spent significantly less time in passive ingestion of phloem sap on all non-preferred host plants before acclimation. After a period of acclimation on M. truncatula and V. villosa, pea host race individuals showed improved feeding behavior. No individuals of the pea host race completed its life history on M. sativa. Interestingly, the number of host-specific differentially-expressed salivary gland genes was negatively correlated with the fitness of aphids on this host plant. This study provided important cues in host plant specialization in aphids. PMID:26758247

  15. To feed or not to feed: plant factors located in the epidermis, mesophyll, and sieve elements influence pea aphid's ability to feed on legume species.

    Directory of Open Access Journals (Sweden)

    Alexander Schwarzkopf

    Full Text Available The pea aphid (Acyrthosiphon pisum Harris, a legume specialist, encompasses at least 11 genetically distinct sympatric host races. Each host race shows a preference for a certain legume species. Six pea aphid clones from three host races were used to localize plant factors influencing aphid probing and feeding behavior on four legume species. Aphid performance was tested by measuring survival and growth. The location of plant factors influencing aphid probing and feeding was determined using the electrical penetration graph (EPG technique. Every aphid clone performed best on the plant species from which it was originally collected, as well as on Vicia faba. On other plant species, clones showed intermediate or poor performance. The most important plant factors influencing aphid probing and feeding behavior were localized in the epidermis and sieve elements. Repetitive puncturing of sieve elements might be relevant for establishing phloem feeding, since feeding periods appear nearly exclusively after these repetitive sieve element punctures. A combination of plant factors influences the behavior of pea aphid host races on different legume species and likely contributes to the maintenance of these races.

  16. Transcriptomic and proteomic analyses of seasonal photoperiodism in the pea aphid

    Directory of Open Access Journals (Sweden)

    Gauthier J-P


    Full Text Available Abstract Background Aphid adaptation to harsh winter conditions is illustrated by an alternation of their reproductive mode. Aphids detect photoperiod shortening by sensing the length of the night and switch from viviparous parthenogenesis in spring and summer, to oviparous sexual reproduction in autumn. The photoperiodic signal is transduced from the head to the reproductive tract to change the fate of the future oocytes from mitotic diploid embryogenesis to haploid formation of gametes. This process takes place in three consecutive generations due to viviparous parthenogenesis. To understand the molecular basis of the switch in the reproductive mode, transcriptomic and proteomic approaches were used to detect significantly regulated transcripts and polypeptides in the heads of the pea aphid Acyrthosiphon pisum. Results The transcriptomic profiles of the heads of the first generation were slightly affected by photoperiod shortening. This suggests that trans-generation signalling between the grand-mothers and the viviparous embryos they contain is not essential. By analogy, many of the genes and some of the proteins regulated in the heads of the second generation are implicated in visual functions, photoreception and cuticle structure. The modification of the cuticle could be accompanied by a down-regulation of the N-β-alanyldopamine pathway and desclerotization. In Drosophila, modification of the insulin pathway could cause a decrease of juvenile hormones in short-day reared aphids. Conclusion This work led to the construction of hypotheses for photoperiodic regulation of the switch of the reproductive mode in aphids.

  17. Serratia symbiotica from the aphid Cinara cedri: a missing link from facultative to obligate insect endosymbiont.

    Directory of Open Access Journals (Sweden)

    Araceli Lamelas


    Full Text Available The genome sequencing of Buchnera aphidicola BCc from the aphid Cinara cedri, which is the smallest known Buchnera genome, revealed that this bacterium had lost its symbiotic role, as it was not able to synthesize tryptophan and riboflavin. Moreover, the biosynthesis of tryptophan is shared with the endosymbiont Serratia symbiotica SCc, which coexists with B. aphidicola in this aphid. The whole-genome sequencing of S. symbiotica SCc reveals an endosymbiont in a stage of genome reduction that is closer to an obligate endosymbiont, such as B. aphidicola from Acyrthosiphon pisum, than to another S. symbiotica, which is a facultative endosymbiont in this aphid, and presents much less gene decay. The comparison between both S. symbiotica enables us to propose an evolutionary scenario of the transition from facultative to obligate endosymbiont. Metabolic inferences of B. aphidicola BCc and S. symbiotica SCc reveal that most of the functions carried out by B. aphidicola in A. pisum are now either conserved in B. aphidicola BCc or taken over by S. symbiotica. In addition, there are several cases of metabolic complementation giving functional stability to the whole consortium and evolutionary preservation of the actors involved.

  18. Proton-dependent glutamine uptake by aphid bacteriocyte amino acid transporter ApGLNT1. (United States)

    Price, Daniel R G; Wilson, Alex C C; Luetje, Charles W


    Aphids house large populations of the gammaproteobacterial symbiont Buchnera aphidicola in specialized bacteriocyte cells. The combined biosynthetic capability of the holobiont (Acyrthosiphon pisum and Buchnera) is sufficient for biosynthesis of all twenty protein coding amino acids, including amino acids that animals alone cannot synthesize; and that are present at low concentrations in A. pisum's plant phloem sap diet. Collaborative holobiont amino acid biosynthesis depends on glutamine import into bacteriocytes, which serves as a nitrogen-rich amino donor for biosynthesis of other amino acids. Recently, we characterized A. pisum glutamine transporter 1 (ApGLNT1), a member of the amino acid/auxin permease family, as the dominant bacteriocyte plasma membrane glutamine transporter. Here we show ApGLNT1 to be structurally and functionally related to mammalian proton-dependent amino acid transporters (PATs 1-4). Using functional expression in Xenopus laevis oocytes, combined with two-electrode voltage clamp electrophysiology we demonstrate that ApGLNT1 is electrogenic and that glutamine induces large inward currents. ApGLNT1 glutamine induced currents are dependent on external glutamine concentration, proton (H+) gradient across the membrane, and membrane potential. Based on these transport properties, ApGLNT1-mediated glutamine uptake into A. pisum bacteriocytes can be regulated by changes in either proton gradients across the plasma membrane or membrane potential. PMID:26028424

  19. Using the pea aphid Acrythociphon pisum as a tool for screening biological responses to chemicals and drugs

    Directory of Open Access Journals (Sweden)

    Ledger Terence


    Full Text Available Abstract Background Though the biological process of aphid feeding is well documented, no one to date has sought to apply it as a tool to screen the biological responses to chemicals and drugs, in ecotoxicology, genotoxicology and/or for interactions in the cascade of sequential molecular events of embryogenesis. Parthenogenetic insect species present the advantage of an anatomical system composed of multiple germarium/ovarioles in the same mother with all the intermediate maturation stages of embryos from oocyte to first instar larva birth. This could be used as an interesting model to visualize at which step drugs interact with the cell signalling pathway during the ordered developmental process. Findings We designed a simple test for screening drugs by investigating simultaneously zygote mitotic division, the progression of embryo development, cell differentiation at early developmental stages and finally organogenesis and population growth rate. We aimed to analyze the toxicology effects of compounds and/or their interference on cellular signalling by examining at which step of the cascade, from zygote to mature embryo, the developmental process is perturbed. We reasoned that a parthenogenetic founder insect, in which the ovarioles shelter numerous embryos at different developmental stages, would allow us to precisely pinpoint the step of embryogenesis in which chemicals act through specific molecular targets as the known ordered homeobox genes. Conclusion Using this method we report the results of a genotoxicological and demographic analysis of three compound models bearing in common a bromo group: one is integrated as a base analog in DNA synthesis, two others activate permanently kinases. We report that one compound (Br-du altered drastically embryogenesis, which argues in favor of this simple technique as a cheap first screening of chemicals or drugs to be used in a number of genotoxicology applications.

  20. Aphid thermal tolerance is governed by a point mutation in bacterial symbionts.

    Directory of Open Access Journals (Sweden)

    Helen E Dunbar


    Full Text Available Symbiosis is a ubiquitous phenomenon generating biological complexity, affecting adaptation, and expanding ecological capabilities. However, symbionts, which can be subject to genetic limitations such as clonality and genomic degradation, also impose constraints on hosts. A model of obligate symbiosis is that between aphids and the bacterium Buchnera aphidicola, which supplies essential nutrients. We report a mutation in Buchnera of the aphid Acyrthosiphon pisum that recurs in laboratory lines and occurs in field populations. This single nucleotide deletion affects a homopolymeric run within the heat-shock transcriptional promoter for ibpA, encoding a small heat-shock protein. This Buchnera mutation virtually eliminates the transcriptional response of ibpA to heat stress and lowers its expression even at cool or moderate temperatures. Furthermore, this symbiont mutation dramatically affects host fitness in a manner dependent on thermal environment. Following a short heat exposure as juveniles, aphids bearing short-allele symbionts produced few or no progeny and contained almost no Buchnera, in contrast to aphids bearing symbionts without the deletion. Conversely, under constant cool conditions, aphids containing symbionts with the short allele reproduced earlier and maintained higher reproductive rates. The short allele has appreciable frequencies in field populations (up to 20%, further supporting the view that lowering of ibpA expression improves host fitness under some conditions. This recurring Buchnera mutation governs thermal tolerance of aphid hosts. Other cases in which symbiont microevolution has a major effect on host ecological tolerance are likely to be widespread because of the high mutation rates of symbiotic bacteria and their crucial roles in host metabolism and development.

  1. Circulative Nonpropagative Aphid Transmission of Nanoviruses: an Oversimplified View (United States)

    Sicard, Anne; Zeddam, Jean-Louis; Yvon, Michel; Michalakis, Yannis; Gutiérrez, Serafin


    ABSTRACT Plant virus species of the family Nanoviridae have segmented genomes with the highest known number of segments encapsidated individually. They thus likely represent the most extreme case of the so-called multipartite, or multicomponent, viruses. All species of the family are believed to be transmitted in a circulative nonpropagative manner by aphid vectors, meaning that the virus simply crosses cellular barriers within the aphid body, from the gut to the salivary glands, without replicating or even expressing any of its genes. However, this assumption is largely based on analogy with the transmission of other plant viruses, such as geminiviruses or luteoviruses, and the details of the molecular and cellular interactions between aphids and nanoviruses are poorly investigated. When comparing the relative frequencies of the eight genome segments in populations of the species Faba bean necrotic stunt virus (FBNSV) (genus Nanovirus) within host plants and within aphid vectors fed on these plants, we unexpectedly found evidence of reproducible changes in the frequencies of some specific segments. We further show that these changes occur within the gut during early stages of the virus cycle in the aphid and not later, when the virus is translocated into the salivary glands. This peculiar observation, which was similarly confirmed in three aphid vector species, Acyrthosiphon pisum, Aphis craccivora, and Myzus persicae, calls for revisiting of the mechanisms of nanovirus transmission. It reveals an unexpected intimate interaction that may not fit the canonical circulative nonpropagative transmission. IMPORTANCE A specific mode of interaction between viruses and arthropod vectors has been extensively described in plant viruses in the three families Luteoviridae, Geminiviridae, and Nanoviridae, but never in arboviruses of animals. This so-called circulative nonpropagative transmission contrasts with the classical biological transmission of animal arboviruses in that

  2. Seasonal Changes in the Endosymbiotic Consortia of Aphids from the Genus Cinara. (United States)

    Martínez-Díaz, Vanesa; Latorre, Amparo; Gil, Rosario


    Buchnera aphidicola is the primary endosymbiont of aphids with which it maintains an obligate mutualistic symbiotic relationship. Insects also maintain facultative symbiotic relationships with secondary symbionts, and Serratia symbiotica is the most common in aphids. The presence of both symbionts in aphids of the subfamily Lachninae has been widely studied by our group. We examined two closely related aphids, Cinara tujafilina and C. cedri in the present study. Even though both B. aphidicola strains have similar genome sizes and gene contents, the genomes of the two S. symbiotica strains were markedly different. The SCc strain has the smallest genome known for this species, while SCt possesses a larger genome in an intermediate stage between the facultative S. symbiotica of Acyrthosiphon pisum (SAp) and the co-obligate S. symbiotica SCc.Aphids are vulnerable to high temperatures. Previous studies indicated that S. symbiotica SAp confers resistance to heat-shock stress. In order to clarify whether S. symbiotica strains from genus Cinara also play a role in heat stress protection, we performed a quantitative determination of the consortium Buchnera/Serratia from two geographically close populations, each of which belonged to the Cinara species examined, over two years in natural environments. We found no variation in the consortium from our C. cedri population, but a positive correlation between both endosymbiont densities and average daily temperatures in the C. tujafilina population. Even though S. symbiotica SCt may retain some protective role against heat stress, this does not appear to be due to the release of protective metabolites by cell lysis. PMID:27297891

  3. Young aphids avoid erroneous dropping when evading mammalian herbivores by combining input from two sensory modalities.

    Directory of Open Access Journals (Sweden)

    Moshe Gish

    Full Text Available Mammalian herbivores may incidentally ingest plant-dwelling insects while foraging. Adult pea aphids (Acyrthosiphon pisum avoid this danger by dropping off their host plant after sensing the herbivore's warm and humid breath and the vibrations it causes while feeding. Aphid nymphs may also drop (to escape insect enemies, but because of their slow movement, have a lower chance of finding a new plant. We compared dropping rates of first-instar nymphs with those of adults, after exposing pea aphids to different combinations of simulated mammalian breath and vibrations. We hypothesized that nymphs would compensate for the greater risk they face on the ground by interpreting more conservatively the mammalian herbivore cues they perceive. Most adults dropped in response to breath alone, but nymphs rarely did so. Breath stimulus accompanied by one concurrent vibrational stimulus, caused a minor rise in adult dropping rates. Adding a second vibration during breath had no additional effect on adults. The nymphs, however, relied on a combination of the two types of stimuli, with a threefold increase in dropping rates when the breath was accompanied by one vibration, and a further doubling of dropping rates when the second vibration was added. The age-specificity of the aphids' herbivore detection mechanism is probably an adaptation to the different cost of dropping for the different age groups. Relying on a combination of stimuli from two sensory modalities enables the vulnerable nymphs to avoid costly mistakes. Our findings emphasize the importance of the direct trophic effect of mammalian herbivory for plant-dwelling insects.

  4. Abundancia y riqueza específica de pulgones (Hemiptera: Aphididae y sus parasitoides en diferentes genotipos y estados fenologicos del garbanzo Species richness and abundance of aphids (Hemiptera: Aphididae and their parasitoids in different genotypes and at different growth stages of chickpea

    Directory of Open Access Journals (Sweden)

    V. E. Mazzuferi


    Full Text Available Los áfidos son insectos perjudiciales tanto por la succión de savia como por la transmisión de enfermedades. Los objetivos de este trabajo fueron conocer las especies de áfidos y sus parasitoides presentes en diferentes genotipos de garbanzo, calcular la incidencia del parasitismo e informar sobre las fluctuaciones poblacionales de pulgones y parasitoides en relación a los estados fenológicos del cultivo. El estudio se realizó durante 2006 y 2007 en San Marcos Sierras (Córdoba. Se evaluaron siete líneas y dos cultivares sembrados en un diseño en bloques completamente aleatorizados con tres repeticiones. Cada 15 días se colectaron manualmente áfidos y "momias" presentes en 10 plantas seleccionadas al azar, de cada genotipo y bloque. Se determinaron 13 especies de áfidos. En 2006 se observó mayor abundancia y riqueza de especies que en 2007. Las especies numéricamente dominantes fueron: Acyrthosiphon pisum y A. kondoi. Solamente cinco especies colonizaron el cultivo. El cultivar Chañaritos presentó la mayor abundancia de insectos en los dos años agrícolas, y los genotipos M60 y M75 mostraron la mayor riqueza de especies. En ambos años, los pulgones estuvieron presentes durante la etapa reproductiva del cultivo. Se registraron tres especies de parasitoides y se estimó un 35% de parasitismo total.Aphids may damage plants by sucking plant juices or by transmitting diseases. The aim of this study was to obtain further information about aphid species and their parasitoids in different genotypes of chickpea, calculate the incidence of parasitism and report on fluctuating populations (from aphids and parasitoid in relation to plant phenology. The study was undertaken during 2006 and 2007 in San Marcos Sierras (Cordoba. Seven lines and two cultivars of chickpea were evaluated. Crop plots were planted following a completely randomized design block with 3 replicates. Every two weeks different developmental stages of aphids and "mummies

  5. Glucosinolates from Host Plants Influence Growth of the Parasitic Plant Cuscuta gronovii and Its Susceptibility to Aphid Feeding. (United States)

    Smith, Jason D; Woldemariam, Melkamu G; Mescher, Mark C; Jander, Georg; De Moraes, Consuelo M


    Parasitic plants acquire diverse secondary metabolites from their hosts, including defense compounds that target insect herbivores. However, the ecological implications of this phenomenon, including the potential enhancement of parasite defenses, remain largely unexplored. We studied the translocation of glucosinolates from the brassicaceous host plant Arabidopsis (Arabidopsis thaliana) into parasitic dodder vines (Convolvulaceae; Cuscuta gronovii) and its effects on the parasite itself and on dodder-aphid interactions. Aliphatic and indole glucosinolates reached concentrations in parasite tissues higher than those observed in corresponding host tissues. Dodder growth was enhanced on cyp79B2 cyp79B3 hosts (without indole glucosinolates) but inhibited on atr1D hosts (with elevated indole glucosinolates) relative to wild-type hosts, which responded to parasitism with localized elevation of indole and aliphatic glucosinolates. These findings implicate indole glucosinolates in defense against parasitic plants. Rates of settling and survival on dodder vines by pea aphids (Acyrthosiphon pisum) were reduced significantly when dodder parasitized glucosinolate-producing hosts (wild type and atr1D) compared with glucosinolate-free hosts (cyp79B2 cyp79B3 myb28 myb29). However, settling and survival of green peach aphids (Myzus persicae) were not affected. M. persicae population growth was actually reduced on dodder parasitizing glucosinolate-free hosts compared with wild-type or atr1D hosts, even though stems of the former contain less glucosinolates and more amino acids. Strikingly, this effect was reversed when the aphids fed directly upon Arabidopsis, which indicates an interactive effect of parasite and host genotype on M. persicae that stems from host effects on dodder. Thus, our findings indicate that glucosinolates may have both direct and indirect effects on dodder-feeding herbivores. PMID:27482077

  6. Developmental origin and evolution of bacteriocytes in the aphid-Buchnera symbiosis.

    Directory of Open Access Journals (Sweden)

    Christian Braendle


    Full Text Available Symbiotic relationships between bacteria and insect hosts are common. Although the bacterial endosymbionts have been subjected to intense investigation, little is known of the host cells in which they reside, the bacteriocytes. We have studied the development and evolution of aphid bacteriocytes, the host cells that contain the endosymbiotic bacteria Buchnera aphidicola. We show that bacteriocytes of Acyrthosiphon pisum express several gene products (or their paralogues: Distal-less, Ultrabithorax/Abdominal-A, and Engrailed. Using these markers, we find that a subpopulation of the bacteriocytes is specified prior to the transmission of maternal bacteria to the embryo. In addition, we discovered that a second population of cells is recruited to the bacteriocyte fate later in development. We experimentally demonstrate that bacteriocyte induction and proliferation occur independently of B. aphidicola. Major features of bacteriocyte development, including the two-step recruitment of bacteriocytes, have been conserved in aphids for 80-150 million years. Furthermore, we have investigated two cases of evolutionary loss of bacterial symbionts: in one case, where novel extracellular, eukaryotic symbionts replaced the bacteria, the bacteriocyte is maintained; in another case, where symbionts are absent, the bacteriocytes are initiated but not maintained. The bacteriocyte represents an evolutionarily novel cell fate, which is developmentally determined independently of the bacteria. Three of five transcription factors we examined show novel expression patterns in bacteriocytes, suggesting that bacteriocytes may have evolved to express many additional transcription factors. The evolutionary transition to a symbiosis in which bacteria and an aphid cell form a functional unit, similar to the origin of plastids, has apparently involved extensive molecular adaptations on the part of the host cell.

  7. Analysis of new aphid lethal paralysis virus (ALPV) isolates suggests evolution of two ALPV species. (United States)

    Liu, Sijun; Vijayendran, Diveena; Carrillo-Tripp, Jimena; Miller, W Allen; Bonning, Bryony C


    Aphid lethal paralysis virus (ALPV; family Dicistroviridae) was first isolated from the bird cherry-oat aphid, Rhopalosiphum padi. ALPV-like virus sequences have been reported from many insects and insect predators. We identified a new isolate of ALPV (ALPV-AP) from the pea aphid, Acyrthosiphon pisum, and a new isolate (ALPV-DvV) from western corn rootworm, Diabrotica virgifera virgifera. ALPV-AP has an ssRNA genome of 9940 nt. Based on phylogenetic analysis, ALPV-AP was closely related to ALPV-AM, an ALPV isolate from honeybees, Apis mellifera, in Spain and Brookings, SD, USA. The distinct evolutionary branches suggested the existence of two lineages of the ALPV virus. One consisted of ALPV-AP and ALPV-AM, whilst all other isolates of ALPV grouped into the other lineage. The similarity of ALPV-AP and ALPV-AM was up to 88 % at the RNA level, compared with 78-79 % between ALPV-AP and other ALPV isolates. The sequence identity of proteins between ALPV-AP and ALPV-AM was 98-99 % for both ORF1 and ORF2, whilst only 85-87 % for ORF1 and 91-92 % for ORF2 between ALPV-AP and other ALPV isolates. Sequencing of RACE (rapid amplification of cDNA ends) products and cDNA clones of the virus genome revealed sequence variation in the 5' UTRs and in ORF1, indicating that ALPV may be under strong selection pressure, which could have important biological implications for ALPV host range and infectivity. Our results indicated that ALPV-like viruses infect insects in the order Coleoptera, in addition to the orders Hemiptera and Hymenoptera, and we propose that ALPV isolates be classified as two separate viral species. PMID:25170050

  8. Developmental Origin and Evolution of Bacteriocytes in the Aphid-Buchnera Symbiosis

    Directory of Open Access Journals (Sweden)

    Braendle Christian


    Full Text Available Symbiotic relationships between bacteria and insect hosts are common. Although the bacterial endosymbionts have been subjected to intense investigation, little is known of the host cells in which they reside, the bacteriocytes. We have studied the development and evolution of aphid bacteriocytes, the host cells that contain the endosymbiotic bacteria Buchnera aphidicola. We show that bacteriocytes of Acyrthosiphon pisum express several gene products (or their paralogues: Distal-less, Ultrabithorax/Abdominal-A, and Engrailed. Using these markers, we find that a subpopulation of the bacteriocytes is specified prior to the transmission of maternal bacteria to the embryo. In addition, we discovered that a second population of cells is recruited to the bacteriocyte fate later in development. We experimentally demonstrate that bacteriocyte induction and proliferation occur independently of B. aphidicola. Major features of bacteriocyte development, including the two-step recruitment of bacteriocytes, have been conserved in aphids for 80-150 million years. Furthermore, we have investigated two cases of evolutionary loss of bacterial symbionts: in one case, where novel extracellular, eukaryotic symbionts replaced the bacteria, the bacteriocyte is maintained; in another case, where symbionts are absent, the bacteriocytes are initiated but not maintained. The bacteriocyte represents an evolutionarily novel cell fate, which is developmentally determined independently of the bacteria. Three of five transcription factors we examined show novel expression patterns in bacteriocytes, suggesting that bacteriocytes may have evolved to express many additional transcription factors. The evolutionary transition to a symbiosis in which bacteria and an aphid cell form a functional unit, similar to the origin of plastids, has apparently involved extensive molecular adaptations on the part of the host cell.

  9. Monitoring of aphid flight activities in seed potato crops in Serbia

    Directory of Open Access Journals (Sweden)

    Andja Vucetic


    Full Text Available Aphid flight activities in seed potato fields have been studied by the yellow water traps. It is a good method for monitoring aphids as vectors of viruses, but this study also showed it is a suitable method for insect-diversity research. During the four-year studies, over 11.500 specimens were collected and a total of 107 different taxa of aphids were identified. The most abundant species were polyphagous species, such as: Acyrthosiphon pisum (Haris, Aphis fabae Scopoli, Aphis gossypii Glover and Brachycaudus helichrysi (Kaltenbach. The results of the studies show that diversity of aphids in different regions of Serbia is similar regardless of the altitude and the diversity of terrain. At most sites it ranged from 2 to 3. The highest value was recorded in Begeč, locality in northern part of Serbia, in year 2008, and it was 2.92. The maximum values of the Shannon-Weaver diversity index at all sites were recorded in the first weeks of the monitoring of aphid flight activities. Morisita-Horn similarity index shows no significant differences between sites regardless of altitudes. The sites are grouped by year, not by similarity of relief. In spite of these results, the Chi-square analysis showed highly significant difference in vector frequencies among seasons and sites with more pronounced differences for PVY. As a consequence of differences in vector frequencies, the vector pressure index in some regions was different also. The number of vectors and vector pressure index vary depending on the altitude of localities. At localities at altitudes under 1000 m, they were high. The highest index was at Kotraža, locality in central part of Serbia, in 2007, when PVY index exceeded the value of 180, while for PLRV it was 60. At high altitudes on mountain Golija, above 1100 m, the number of aphids was low, as well as the vector pressure index which indicates that these regions are suitable for producing virus-free seed potato.

  10. A genomic reappraisal of symbiotic function in the aphid/Buchnera symbiosis: reduced transporter sets and variable membrane organisations.

    Directory of Open Access Journals (Sweden)

    Hubert Charles

    Full Text Available Buchnera aphidicola is an obligate symbiotic bacterium that sustains the physiology of aphids by complementing their exclusive phloem sap diet. In this study, we reappraised the transport function of different Buchnera strains, from the aphids Acyrthosiphon pisum, Schizaphis graminum, Baizongia pistaciae and Cinara cedri, using the re-annotation of their transmembrane proteins coupled with an exploration of their metabolic networks. Although metabolic analyses revealed high interdependencies between the host and the bacteria, we demonstrate here that transport in Buchnera is assured by low transporter diversity, when compared to free-living bacteria, being mostly based on a few general transporters, some of which probably have lost their substrate specificity. Moreover, in the four strains studied, an astonishing lack of inner-membrane importers was observed. In Buchnera, the transport function has been shaped by the distinct selective constraints occurring in the Aphididae lineages. Buchnera from A. pisum and S. graminum have a three-membraned system and similar sets of transporters corresponding to most compound classes. Transmission electronic microscopic observations and confocal microscopic analysis of intracellular pH fields revealed that Buchnera does not show any of the typical structures and properties observed in integrated organelles. Buchnera from B. pistaciae seem to possess a unique double membrane system and has, accordingly, lost all of its outer-membrane integral proteins. Lastly, Buchnera from C. cedri revealed an extremely poor repertoire of transporters, with almost no ATP-driven active transport left, despite the clear persistence of the ancestral three-membraned system.

  11. Molecular Cloning, Expression Pattern and Polymorphisms of NADPH-Cytochrome P450 Reductase in the Bird Cherry-Oat Aphid Rhopalosiphum padi (L.) (United States)

    Zuo, Yayun; Li, Yuting


    NADPH–cytochrome P450 reductase (CPR) plays an important role in the cytochrome P450 (CYP)-mediated metabolism of endogenous and exogenous substrates. CPR has been found to be associated with insecticide metabolism and resistance in many insects. However, information regarding CPR in the bird cherry-oat aphid, Rhopalosiphum padi, is unavailable. In the current study, a full-length cDNA (2,476 bp) of CPR (RpCPR) encoding 681 amino acids was cloned from R. padi. Nucleotide sequence and deduced amino acid sequence analysis showed that RpCPR exhibits characteristics of classical CPRs and shares high identities with those of other insects, especially with the pea aphid, Acyrthosiphon pisum. The mRNA of RpCPR was expressed at all developmental stages, with the highest expression level found in the second instar and the lowest in adult. Expression levels of RpCPR in isoprocarb-resistant and imidacloprid-resistant strains were 3.74- and 3.53-fold higher, respectively, than that of a susceptible strain. RpCPR expression could also be induced by low concentrations (LC30) of isoprocarb and imidacloprid. Moreover, we sequenced the open reading frame (ORF) of RpCPR from 167 field samples collected in 11 geographical populations. Three hundred and thirty-four SNPs were detected, of which, 65 were found in more than two individuals. One hundred and ninety-four missense mutations were present in the amino acid sequence, of which, the P484S mutant had an allele frequency of 35.1%. The present results suggest that RpCPR may play an important role in the P450-mediated insecticide resistance of R. padi to isoprocarb and imidacloprid and possibly other insecticides. Meanwhile, RpCPRmaintains high genetic diversity in natural individuals, which provides the possibility of studying potential correlations between variants and certain special physiological characters. PMID:27124302

  12. Dicty_cDB: FC-BI13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available pisum, Pea Aphid Acyrthosiphon pisum cDNA clone WHAP-002_A12 5', mRNA sequence. 50 3e-04 2 CD036313 |CD036313.1 mgmt...015xA07f.b Mated culture Magnaporthe grisea cDNA clone mgmt015xA07 5', mR

  13. Crop association to improve biological control: case study on pea and wheat aphids


    Chevalier Mendes Lopes, Thomas; Bodson, Bernard; Francis, Frédéric


    Nowadays, strategies used to control aphids in fields of pea, Pisum sativum L., and wheat, Triticum aestivum L., still rely on synthetic insecticides which have negative effects on the environment and human health. This research focused on the development of sustainable alternative methods, with special emphasis on cultural practices and plant management systems. Increasing the diversity within crops may have several beneficial effects on pest control, creating attractive habitats for indigen...

  14. Aphid populations (Hemiptera: Aphidoidea depend of mulching in watermelon production in the Mediterranean region of Croatia

    Directory of Open Access Journals (Sweden)

    K. Zanic


    Full Text Available Winged morphs of aphids were investigated under field conditions during 2008, 2010 and 2011 in the Mediterranean region of Croatia. Field experiments were conducted to record aphid diversity and compare polyethylene black mulch to straw mulch and bare soil in terms of their attractiveness to aphid species in a watermelon crop. Aphids were collected weekly using yellow water metal traps from May to July. During the study, 44 species in 31 genera were detected; 36 species in 24 genera were identified in 2008, 18 species in 15 genera were identified in 2010, and 34 species in 25 genera were identified in 2011. The overall seasonal percentage composition showed that Aphis fabae Scopoli and Myzus persicae (Sulzer were consistently eudominant species, whereas Acyrtosiphon pisum (Harris was consistently dominant. Cabbage aphid Brevicoryne brassicae (L. was determined as the dominant species in 2008 and as eudominant species in 2011. Additionally, Macrosiphum rosae (L. was twice recorded as the dominant species, whereas Aphis gossipii Glover was dominant once, and Phorodon humuli (Schrank was eudominant once. Our study also demonstrated that mulching sporadically affected the abundance of individual species. The attractiveness of mulching for aphid species differed between the treatments. It was found that bare soil was attractive to A. pisum and M. rosae, black mulch was attractive to B. helichrysi and P. humuli, and straw mulch was attractive to four aphid species, of which two were eudominant, A. fabae and M. persicae. The presented species are mostly polyphagous, and their preference for certain mulches can be used in crop protection management.

  15. Arabidopsis thaliana—Aphid Interaction


    Louis, Joe; Singh, Vijay,; Shah, Jyoti


    Aphids are important pests of plants that use their stylets to tap into the sieve elements to consume phloem sap. Besides the removal of photosynthates, aphid infestation also alters source-sink patterns. Most aphids also vector viral diseases. In this chapter, we will summarize on recent significant findings in plant-aphid interaction, and how studies involving Arabidopsis thaliana and Myzus persicae (Sülzer), more commonly known as the green peach aphid (GPA), are beginning to provide impor...

  16. Drawing the line


    Saxon, Emma


    The pea aphid Acyrthosiphon pisum is an agriculturally important pest of leguminous plants including peas and broad beans. The widespread use of chemical pesticides impacts heavily on the environment, and increases pesticide-resistant pea aphid populations, so alternative strategies are being actively sought. Pseudomonas syringae bacteria are known to infect and kill the pea aphid, and offer a possible control strategy. In this study, the authors measured the effects of injecting P. syringae ...

  17. Dicty_cDB: SFJ609 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2 CD036313 |CD036313.1 mgmt015xA07f.b Mated culture Magnaporthe grisea cDNA clone mgmt015xA07 5', mRNA seque...ea Aphid Acyrthosiphon pisum cDNA clone WHAP-002_A12 5', mRNA sequence. 50 3e-04

  18. Effects of some Insecticides Applied in Sublethal Concentrations on the Survival and Longevity of Aphidius ervi (Haliday) (Hymenoptera: Aphidiidae) Adults Efecto de algunos Insecticidas Aplicados en Concentraciones Subletales en la Supervivencia y Longevidad de Adultos de Aphidius ervi (Haliday) (Hymenoptera: Aphidiidae)


    Jaime E. Araya; Manuel Araya; María Angélica Guerrero


    The effects of four insecticides (dimethoate, pirimicarb, imidacloprid, and spinosad) applied in an ST4 Potter tower at sublethal concentrations (50% of those recommended commercially for aphid control) were studied in the laboratory on aphidiid Aphidius ervi (Haliday) adults, an important parasitoid of the pea aphid Acyrthosiphon pisum (Harris). The most selective treatment on the hymenopteran was imidacloprid, followed in decreasing order by spinosad, pirimicarb, and finally dimethoate, whi...

  19. Ant larval demand reduces aphid colony growth rates in an ant-aphid interaction


    Cook, James M.; Leather, Simon R; Oliver, Tom H.


    Ants often form mutualistic interactions with aphids, soliciting honeydew in return for protective services. Under certain circumstances, however, ants will prey upon aphids. In addition, in the presence of ants aphids may increase the quantity or quality of honeydew produced, which is costly. Through these mechanisms, ant attendance can reduce aphid colony growth rates. However, it is unknown whether demand from within the ant colony can affect the ant-aphid interaction. In a factorial exper...

  20. Do aphid carcasses on the backs of larvae of green lacewing work as chemical mimicry against aphid-tending ants? (United States)

    Hayashi, Masayuki; Choh, Yasuyuki; Nakamuta, Kiyoshi; Nomura, Masashi


    Ants attack and exclude natural enemies of aphids in ant-aphid mutualisms. However, larvae of the green lacewing, Mallada desjardinsi, prey on the cowpea aphid, Aphis craccivora, without exclusion by aphid-tending ants. Lacewing larvae are protected from ants by carrying aphid carcasses on their backs. Here, we tested whether cuticular hydrocarbons (CHCs) of aphid carcasses affected the aggressiveness of aphid-tending ants. Aphid carcasses were washed with n-hexane to remove lipids. Lacewing larvae with washed aphid carcasses were attacked by aphid-tending ants more frequently than those with untreated aphid carcasses. We measured the aggressiveness of aphid-tending ants to lacewing larvae that were either carrying a piece of cotton wool (a dummy aphid carcass) treated with CHCs from aphids or lacewing larvae, or carrying aphid carcasses. The rates of attack by ants on lacewing larvae carrying CHCs of aphids or aphid carcasses were lower than that of attack on lacewing larvae with conspecific CHCs. Chemical analysis by gas chromatography/mass spectrometry showed similarity of CHCs between aphids and aphid carcasses. These results suggest that aphid carcasses on the backs of lacewing larvae function via chemical camouflage to limit attacks by aphid-tending ants. PMID:24894158

  1. Quantitation and localization of pospiviroids in aphids. (United States)

    Van Bogaert, N; De Jonghe, K; Van Damme, E J M; Maes, M; Smagghe, G


    In this paper, the potential role of aphids in viroid transmission was explored. Apterous aphids were fed on pospiviroid-infected plants and viroid targets in the aphids were consequently quantified through RT-qPCR and localized within the aphid body using fluorescence in situ hybridization (FISH). Based on the analytical sensitivity test, the limit of detection (LOD) was estimated at 1.69×10(6) viroid copies per individual aphid body. To localize the viroids in the aphids, a pospiviroid-generic Cy5-labelled probe was used and the fluorescent signal was determined by confocal microscopy. Viroids were clearly observed in the aphid's stylet and stomach, but not in the embryos. Viroids were detected in 29% of the aphids after a 24h feeding period, which suggests only a partial and low concentration viroid uptake by the aphid population including viroid concentrations under the LOD. However, these results show that viroids can be ingested by aphids while feeding on infected plants, thus potentially increasing the transmission risk. The combination of FISH and RT-qPCR provides reliable and fast localization and quantitation of viroid targets in individual aphids and thus constitutes a valuable tool in future epidemiological research. PMID:25455904

  2. Evidence for the establishment of aphid-eubacterium endosymbiosis in an ancestor of four aphid families.


    Munson, M. A.; Baumann, P.; Clark, M A; Baumann, L; Moran, N A; Voegtlin, D J; Campbell, B C


    Aphids (superfamily Aphidoidea) contain eubacterial endosymbionts localized within specialized cells (mycetocytes). The endosymbionts are essential for the survival of the aphid hosts. Sequence analyses of the 16S rRNAs from endosymbionts of 11 aphid species from seven tribes and four families have indicated that the endosymbionts are monophyletic. Furthermore, phylogenetic relationships within the symbiont clade parallel the relationships of the corresponding aphid hosts. Our findings sugges...

  3. AphidBase: A centralized bioinformatic resource for annotation of the pea aphid genome


    Legeai, Fabrice; Shigenobu, Shuji; Gauthier, Jean-Pierre; Colbourne, John; Rispe, Claude; Collin, Olivier; Richards, Stephen; Wilson, Alex C. C.; Tagu, Denis


    AphidBase is a centralized bioinformatic resource that was developed to facilitate community annotation of the pea aphid genome by the International Aphid Genomics Consortium (IAGC). The AphidBase Information System designed to organize and distribute genomic data and annotations for a large international community was constructed using open source software tools from the Generic Model Organism Database (GMOD). The system includes Apollo and GBrowse utilities as well as a wiki, blast search c...

  4. Altruistic defence behaviours in aphids

    Directory of Open Access Journals (Sweden)

    Brodeur Jacques


    Full Text Available Abstract Background Altruistic anti-predatory behaviours pose an evolutionary problem because they are costly to the actor and beneficial to the recipients. Altruistic behaviours can evolve through indirect fitness benefits when directed toward kin. The altruistic nature of anti-predatory behaviours is often difficult to establish because the actor can obtain direct fitness benefits, or the behaviour could result from selfish coercion by others, especially in eusocial animals. Non-eusocial parthenogenetically reproducing aphids form colonies of clone-mates, which are ideal to test the altruistic nature of anti-predatory defence behaviours. Many aphids release cornicle secretions when attacked by natural enemies such as parasitoids. These secretions contain an alarm pheromone that alerts neighbours (clone-mates of danger, thereby providing indirect fitness benefits to the actor. However, contact with cornicle secretions also hampers an attacker and could provide direct fitness to the actor. Results We tested the hypothesis that cornicle secretions are altruistic by assessing direct and indirect fitness consequences of smearing cornicle secretions onto an attacker, and by manipulating the number of clone-mates that could benefit from the behaviour. We observed parasitoids, Aphidius rhopalosiphi, foraging singly in patches of the cereal aphid Sitobion avenae of varied patch size (2, 6, and 12 aphids. Aphids that smeared parasitoids did not benefit from a reduced probability of parasitism, or increase the parasitoids' handling time. Smeared parasitoids, however, spent proportionately more time grooming and less time foraging, which resulted in a decreased host-encounter and oviposition rate within the host patch. In addition, individual smearing rate increased with the number of clone-mates in the colony. Conclusions Cornicle secretions of aphids were altruistic against parasitoids, as they provided no direct fitness benefits to secretion

  5. Aphid alarm pheromone as a cue for ants to locate aphid partners.

    Directory of Open Access Journals (Sweden)

    François J Verheggen

    Full Text Available The mutualistic relationships that occur between myrmecophilous aphids and ants are based on the rich food supply that honeydew represents for ants and on the protection they provide against aphid natural enemies. While aphid predators and parasitoids actively forage for oviposition sites by using aphid semiochemicals, scouts of aphid-tending ant species would also benefit from locating honeydew resources by orienting toward aphid pheromone sources. The present study aims to provide additional information on the use of Aphis fabae alarm pheromone, i.e. (E-β-farnesene (EβF, by ant scouts. The perception and behavioral impact of EβF on Lasius niger were investigated using electroantennography and two bio-assays measuring their attraction and orientation towards aphid semiochemicals. Pronounced electrical depolarizations were observed from L. niger scout antennae to stimulations of A. fabae alarm pheromone, while other sesquiterpenes elicited weak or no responses. L. niger scouts were significantly attracted toward EβF in a four-arm olfactometer, as well as in an two-choice bioassay. These laboratory results suggest for the first time that low amounts of aphid alarm pheromone can be used by L. niger scouts as a cue indicating the presence of aphid colonies and could therefore mediate the aphid-ant partnership in the field.

  6. Decomposition analysis of LTREs may facilitate the design of short-term ecotoxicological tests


    Hamda, Natnael T.; Jevtić, Dragan M.; Laskowski, Ryszard


    This study compared two methods, based on re-analyzed data from a partly published life table response experiment (LTRE), to help determine the optimal approach for designing ecotoxicological assessments. The 36-day LTRE data recorded the toxic effects of cadmium (Cd) and imidacloprid, alone and in combination, on the reproduction and survivorship of aphids (Acyrthosiphon pisum Harris). We used this data to construct an age-classified matrix model (six age classes, each 6 days long) to estima...

  7. Isolation and identification of culturable bacteria from honeydew of whitefly, Bemisia tabaci (G.) (Hemiptera: Aleyrodidae)


    Roopa H.K.; Rebijith K.B.; Asokan R.; Riaz Mahmood; Krishna Kumar N.K.


    Bemisia tabaci (G.) is an important pest and a vector of Gemini viruses infecting plants. During the process of feeding B. tabaci excretes honeydew which is rich in nutrients, and an excellent medium for microbial growth. Recent report proved that volatile emitted by the honeydew associated bacteria of aphid, Acyrthosiphon pisum Harris was involved in natural enemy calling. Thus understanding the honeydew associated bacteria is of paramount importance from the non-chemical method of insect pe...

  8. Einfluss des Gemengepartners Leindotter (Camelina sativa L.) auf Beikrautbesatz, Schädlingsbefall und Ertrag in Körnererbsen


    Ackermann, Kerstin; Saucke, Dr. Helmut


    The effect of mixed cropping semi-leafless peas with linseed dodder (Camelina sativa (L.) Crtz.) on weed development and pest incidence was investigated in small plot experiments in Northern Hessen, Germany, over two years. Mixed cropping peas together with linseed dodder had a significant suppressive effect on weed-coverage, in average 62 % efficacy in 2003 and 54 % in 2004, compared to mono cropped peas. The infestation level of pea aphid (Acyrthosiphon pisum) and the damage incidence of pe...

  9. Glucolipids of Zea mays and Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Morohashi, Y.; Bandurski, R.S.


    The glucolipids formed upon feeding (U--/sup 14/C)glucose to embryos of Zea mays were partially characterized with respect to: (a) metabolic turnover, (b) acid lability, (c) phosphorus content, (d) chromatographic properties, and (e) hydrolysis products. The chloroform--methanol-soluble-assimilated radioactivity was examined specifically for occurrence of a glycosylated prenol phosphate. With the extraction conditions used, no evidence was found for formation of a glucosylated prenol phosphate. Several, as yet unidentified, acid-labile glucolipids undergoing metabolic turnover were observed. Four diglycerides were characterized as hydrolysis products of a fraction that contained /sup 14/C-glucose and phosphorus, and was subject to metabolic turnover. Examination of the 1-butanol-soluble glucolipids from pea (Pisum sativum) seedlings also demonstrated anionic glucolipids, evidencing metabolic turnover but none with the properties of glucosylated prenol phosphate.

  10. Biosynthesis of the phytoalexin pisatin. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Preisig, C.L.; Bell, J.N.; Matthews, D.E.; VanEtten, H.D. (Cornell Univ., Ithaca, NY (USA)); Sun, Yuejin; Hrazdina, G. (Cornell Univ., Geneva, NY (USA))


    NADPH-dependent reduction of 2{prime},7-dihydroxy-4{prime},5{prime}-methylenedioxyisoflavone to the isoflavanone sophorol, a proposed intermediate step in pisatin biosynthesis, was detected in extracts of Pisum sativum. This isoflavone reductase activity was inducible by treatment of pea seedlings with CuCl{sub 2}. The timing of induction coincided with that of the 6a-hydroxymaackiain 3-O-methyltransferase, which catalyzes the terminal biosynthetic step. Neither enzyme was light inducible. Further NADPH-dependent metabolism of sophorol by extracts of CuCl{sub 2}-treated seedlings was also observed; three products were radiolabeled when ({sup 3}H)sophorol was the substrate, one of which is tentatively identified as maackiain.

  11. RNAi-mediated plant protection against aphids. (United States)

    Yu, Xiu-Dao; Liu, Zong-Cai; Huang, Si-Liang; Chen, Zhi-Qin; Sun, Yong-Wei; Duan, Peng-Fei; Ma, You-Zhi; Xia, Lan-Qin


    Aphids (Aphididae) are major agricultural pests that cause significant yield losses of crop plants each year by inflicting damage both through the direct effects of feeding and by vectoring harmful plant viruses. Expression of double-stranded RNA (dsRNA) directed against suitable insect target genes in transgenic plants has been shown to give protection against pests through plant-mediated RNA interference (RNAi). Thus, as a potential alternative and effective strategy for insect pest management in agricultural practice, plant-mediated RNAi for aphid control has received close attention in recent years. In this review, the mechanism of RNAi in insects and the so far explored effective RNAi target genes in aphids, their potential applications in the development of transgenic plants for aphid control and the major challenges in this regard are reviewed, and the future prospects of using plant-mediated RNAi for aphid control are discussed. This review is intended to be a helpful insight into the generation of aphid-resistant plants through plant-mediated RNAi strategy. © 2016 Society of Chemical Industry. PMID:26888776

  12. AphID (Lucid key) (United States)

    This peer-reviewed web site concentrates on the 66 adult alate and apterous aphids that are the world's most cosmopolitan and polyphagous species. The site includes fact sheets about the various aphids species, a glossary of terms helpful to the student, hundreds of photographs and illustrations, a...

  13. Aphids of the subfamily Lachninae of the Korean Peninsula

    Czech Academy of Sciences Publication Activity Database

    Havelka, Jan; Lee, S.; Holman, Jaroslav

    Rennes: SosterChaubet, 2001. s. 70. [Aphids in a New Millenium - International Symposium on Aphids /6./. 03.09.2001-07.09.2001, Rennes] Institutional research plan: CEZ:AV0Z5007907 Keywords : Lachninae Subject RIV: EG - Zoology

  14. Aphid-induced accumulation of trehalose in Arabidopsis thaliana is systemic and dependent upon aphid density. (United States)

    Hodge, Simon; Ward, Jane L; Beale, Michael H; Bennett, Mark; Mansfield, John W; Powell, Glen


    Trehalose is a disaccharide sugar that is now considered to be widely distributed among higher plants. Trehalose has been attributed a number of roles, including control of basic plant processes, such as photosynthesis, and conferring tolerance to abiotic stresses, such as desiccation and high salinity. Trehalose is also a common storage sugar used by insects. In this study, we used laboratory investigations to examine various aspects of trehalose dynamics in an aphid-host plant system (Arabidopsis and the peach potato aphid, Myzus persicae). Trehalose concentrations were measured by [1-H]-NMR. Myzus persicae reared on Arabidopsis, but not on black mustard or spring cabbage, contained considerable quantities of trehalose (5 % w/w dry matter). In Arabidopsis foliage, feeding by aphids induced a density-dependent accumulation of trehalose up to 5 mg g(-1) dry weight. Leaves that were not challenged directly by aphids also exhibited increased trehalose concentrations, indicating that this accumulation was systemic. Trehalose was measured at high concentrations in the phloem sap of plants challenged by aphids, suggesting that aphid feeding induced the plant to produce significant quantities of trehalose, which moved through the plant and into the aphids via the phloem sap. Trehalose was also excreted in the aphid honeydew. Further work is required to clarify whether this trehalose accumulation in Arabidopsis has a direct role or a signalling function in plant tolerance of, or resistance to, aphid feeding, and if a similar accumulation of this sugar occurs when other species or genotypes of aphids are reared on this host plant. PMID:23242075

  15. Seasonal Abundance of Aphids and Aphidophagous Insects in Pecan


    Ghulam Abbas; Dutcher, James D.; Haider Karar


    Seasonal occurrence of aphids and aphidophagous insects was monitored for six years (2006–2011) from full leaf expansion in May to leaf fall in October in “Desirable” variety pecan trees that were not treated with insecticides. Aphid outbreaks occurred two times per season, once in the spring and again in the late summer. Yellow pecan and blackmargined aphids exceeded the recommended treatment thresholds one time and black pecan aphids exceeded the recommended treatment levels three times ove...

  16. Drawing the line. (United States)

    Saxon, Emma


    The pea aphid Acyrthosiphon pisum is an agriculturally important pest of leguminous plants including peas and broad beans. The widespread use of chemical pesticides impacts heavily on the environment, and increases pesticide-resistant pea aphid populations, so alternative strategies are being actively sought. Pseudomonas syringae bacteria are known to infect and kill the pea aphid, and offer a possible control strategy. In this study, the authors measured the effects of injecting P. syringae on the survival of pea aphid populations at 24 and 48 hours. The pea aphid population was killed more rapidly (98 % after 24 hours) with a higher concentration of injected bacteria than in the control or with lower concentrations, indicating that a P. syringae-based control strategy may be a useful alternative to conventional pesticides. PMID:26438421

  17. Aphid-AutoEPG software for analysing electrically monitored feeding behaviour of aphids

    Directory of Open Access Journals (Sweden)

    Toni Prüfer


    Full Text Available Aphid-AutoEPG is a new software program, developed to acquire and automatically analyse electrical penetration graph (EPG signals used for monitoring plant penetration by aphids. Characteristically EPG signals include waveforms that allow one to study the effects of plants on the acquisition and transmission of viruses, plant protection substances on pests and identify the location of resistance in plants to aphids. The success of electrical monitoring arises from the fact that different species of aphids generate similar EPG patterns. But the visual analysis of EPG waveforms in recorded signals is very time consuming, which has greatly hampered the wider application of EPG technology. To overcome this Aphid-AutoEPG software was developed, which has been extensively tested using data files for several different species of aphids, M. persicae, A. frangulae gossypii, M. albifrons, S. avenae, B. brassicae and N. ribis-nigri. The results have also been compared with visual analyses using Stylet+ software. When used in combination with the user friendly correction options Aphid-AutoEPG is not only easy to use but can also result in a considerable saving in terms of time.

  18. Improvement of wheat for resistance to Russian Wheat Aphid

    International Nuclear Information System (INIS)

    Breeding for resistance against Russian wheat aphid in Kenya is reported. Results of six of the lines were found to have high to moderate resistance to Russian wheat aphid. Popular lines were susceptible in the greenhouse when subjected to aphid pressure but showed moderate susceptibility when screened under field conditions, indicating that in years or location with low aphid pressure farmers may still get a crop. However in areas of high aphid pressure or bad years they may lose their crop. Consequently, developing resistant/torerant varieties is urgent

  19. Partial aphid resistance in lettuce negatively affects parasitoids. (United States)

    Lanteigne, Marie-Eve; Brodeur, Jacques; Jenni, Sylvie; Boivin, Guy


    This study investigated the effects of partial plant resistance on the lettuce aphid Nasonovia ribisnigri (Mosley) (Hemiptera: Aphididae), a major pest of cultivated lettuce (Lactuca sativa L.), and one of its parasitoids, Aphidius ervi Haliday (Hymenoptera: Braconidae). Aphids were reared on susceptible (L. sativa variety Estival; S) or partially resistant (Lactuca serriola L. PI 491093; PR) lettuce, and next parasitized by A. ervi females. Fitness proxies were measured for both aphids and parasitoids. Developmental time to adult stage took longer for alate and apterous aphids (an average of 3.5 and 1.5 additional days, respectively) on PR than on S lettuce, and fecundity of alate aphids reared on PR lettuce was reduced by 37.8% relative to those reared on S lettuce. Size (tibia length) and weight of aphids reared on PR lettuce were lower than for aphids reared on S lettuce from the third and second instar onward, respectively. Parasitism of aphids reared on PR plants resulted in lower parasitoid offspring emergence (-49.9%), lower adult female (-30.3%) and male (-27.5%) weight, smaller adult female (-17.5%) and male (-11.9%) size, and lower female fecundity (37.8% fewer eggs) than when parasitoids developed from aphids reared on S plants. Our results demonstrate that partial aphid resistance in lettuce negatively affects both the second and third trophic levels. Host plant resistance in cultivated lettuce may therefore create an ecological sink for aphid parasitoids. PMID:25197882

  20. Symbiotic bacterium modifies aphid body color. (United States)

    Tsuchida, Tsutomu; Koga, Ryuichi; Horikawa, Mitsuyo; Tsunoda, Tetsuto; Maoka, Takashi; Matsumoto, Shogo; Simon, Jean-Christophe; Fukatsu, Takema


    Color variation within populations of the pea aphid influences relative susceptibility to predators and parasites. We have discovered that infection with a facultative endosymbiont of the genus Rickettsiella changes the insects' body color from red to green in natural populations. Approximately 8% of pea aphids collected in Western Europe carried the Rickettsiella infection. The infection increased amounts of blue-green polycyclic quinones, whereas it had less of an effect on yellow-red carotenoid pigments. The effect of the endosymbiont on body color is expected to influence prey-predator interactions, as well as interactions with other endosymbionts. PMID:21097935

  1. Pre-pupation behaviour of the aphid parasitoid Aphidius ervi (Haliday) and its consequences for pre-imaginal learning (United States)

    Gutiérrez-Ibáñez, Cristián; Villagra, Cristian A.; Niemeyer, Hermann M.


    Olfactory learning may occur at different stages of insect ontogeny. In parasitoid wasps, it has been mostly shown at adult emergence, whilst it remains controversial at pre-imaginal stages. We followed larval growth of the parasitoid wasp, Aphidius ervi Haliday, inside the host aphid, Acyrthosiphom pisum Harris, and characterised in detail the behaviour of third instar larvae. We found that just before cocoon spinning begins, the third instar larva bites a hole through the ventral side of the mummified aphid exoskeleton. We then evaluated whether this period of exposure to the external environment represented a sensitive stage for olfactory learning. In our first experiment, the third instar larvae were allowed to spin their cocoon on the host plant ( Vicia faba L.) surface or on a plastic plate covering the portion of the host plant exposed to the ventral opening. Recently emerged adults of the first group showed a preference for plant volatiles in a glass Y-olfactometer, whereas no preference was found in adults of the second group. In a second experiment, during the period in which the aphid carcass remains open or is being sealed by cocoon spinning, third instar larvae were exposed for 24 h to either vanilla odours or water vapours as control. In this experiment, half of the parasitoid larvae were later excised from the mummy to avoid further exposure to vanilla. Adult parasitoids exposed to vanilla during the larval ventral opening of the mummy showed a significant preference for vanilla odours in the olfactometer, regardless of excision from the mummy. The larval behaviour described and the results of the manipulations performed are discussed as evidences for the acquisition of olfactory memory during the larval stage and its persistence through metamorphosis.

  2. Pea (Pisum sp.) genetic resources, its analysis and exploration (United States)

    Pea is important temperate region pulse, with feed, fodder and vegetable uses. Originated and domesticated in Middle East and Mediterranean, it formed important dietary components of early civilizations. Although Pisum is a small genus with two or three species, it is very diverse and structured, r...

  3. Plant-Aphid Interactions Under Elevated CO2: Some Cues from Aphid Feeding Behavior. (United States)

    Sun, Yucheng; Guo, Huijuan; Ge, Feng


    Although the increasing concentration of atmospheric carbon dioxide (CO2) accelerates the accumulation of carbohydrates and increases the biomass and yield of C3 crop plants, it also reduces their nitrogen concentration. The consequent changes in primary and secondary metabolites affect the palatability of host plants and the feeding of herbivorous insects. Aphids are phloem feeders and are considered the only feeding guild that positively responds to elevated CO2. In this review, we consider how elevated CO2 modifies host defenses, nutrients, and water-use efficiency by altering concentrations of the phytohormones jasmonic acid, salicylic acid, ethylene, and abscisic acid. We will describe how these elevated CO2-induced changes in defenses, nutrients, and water statusfacilitate specific stages of aphid feeding, including penetration, phloem-feeding, and xylem absorption. We conclude that a better understanding of the effects of elevated CO2 on aphids and on aphid damage to crop plants will require research on the molecular aspects of the interaction between plant and aphid but also research on aphid interactions with their intra- and inter-specific competitors and with their natural enemies. PMID:27148325

  4. Effect of the inherent variation in the mineral concentration of alfalfa cultivars on aphid populations Efeito da variação inata da concentração de minerais em cultivares de alfafa (Medicago sativa em população de afídeos (Hemiptera: Aphididae

    Directory of Open Access Journals (Sweden)

    Alexandre de Almeida e Silva


    Full Text Available Plants have inherent variability of mineral content which affects their physiology and consequently the herbivorous insects feeding on them. Besides, insects need considerable amounts of potassium, phosphorus and magnesium in their diets, whereas little calcium, sodium and chloride are required. In this study, the inherent variation on mineral (Ca, S, Mg, N, P, K and also C:N ratio concentrations and aphid (Acyrthosiphon spp., Therioaphis maculata, Aphis craccivora populations on three alfalfa (Medicago sativa cultivars (P3; Crioula, the most widely cultivated in Brazil, and CUF 101, an aphid-resistant were studied between September/1997 and August/1998. A significant variation on mineral concentrations and aphid populations was observed among different sampling times and cultivars. The correlations between C:N ratio, Mg, N, P and S concentrations and aphid density variation suggest that the mineral status affects aphid population dynamics under field conditions.As plantas têm variação inata do conteúdo de minerais e seu estado nutricional afeta sua fisiologia cloretos. A variação inata na concentração de minerais (Ca, S, Mg, N, P, K e também a razão C:N e na população de afídeos (Acyrthosiphon spp., Therioaphis maculata, Aphis craccivora em três cultivares de alfafa (M. sativa - P3; Crioula, as mais cultivadas no Brasil, e CUF 101, resistente a afídeos - foi estudada entre setembro/1997 a agosto/1998 neste trabalho. A concentração de minerais e as populações de pulgões variaram significativamente entre os diferentes períodos de coleta e cultivares. As correlações encontradas entre as concentrações de Mg, N, P, S e a razão C:N e a variação no número de pulgões sugerem que os minerais da planta afetam a dinâmica populacional dos pulgões em campo.

  5. Aphid parasitoids (Hymenoptera, Braconidae, Aphidiinae) from Thailand

    Czech Academy of Sciences Publication Activity Database

    Starý, Petr; Rakhshani, E.; Tomanović, Ž.; Kavallieratos, N. G.; Sharkey, M.

    -, č. 2498 (2010), s. 47-52. ISSN 1175-5326 Grant ostatní: Ministry of Science of the Republic of Serbia(CS) 143006B; U. S. National Science Foundation(US) DEB 0542864 Institutional research plan: CEZ:AV0Z50070508 Keywords : aphids * parasitoids * biodiversity Subject RIV: EG - Zoology Impact factor: 0.853, year: 2010

  6. Evolving aphids: one genome-one organism insects or holobionts?

    Directory of Open Access Journals (Sweden)

    M Mandrioli


    Full Text Available Aphids have obligate mutualistic relationships with microorganisms that provide them with essential substances lacking in their diet, together with symbionts conferring them conditional adaptive advantages related, for instance, to the thermal tolerance and to the resistance to parasitoid wasps. The presence/absence of a secondary symbiont may have a relevant phenotypic effect so that aphid microbial symbionts constitute a sort of second genome with its own genetic inheritance. On the whole, genes important for aphid survival and reproduction are not uniquely present in the aphid nuclear and mitochondrial genomes, but also in the chromosomes of each symbiont. As a consequence, aphids should be viewed as holobionts with an extended genome (the hologenome including the host and its symbiotic microbiome. In this connection, the true unit of selection in evolution must be considered the aphid holobiont, in place of the single host as individual separated from its symbionts.

  7. Molecular sabotage of plant defense by aphid saliva


    Will, T; Tjallingii, W.F.; Thönnessen, A.; Bel,, T.


    Aphids, which constitute one of the most important groups of agricultural pests, ingest nutrients from sieve tubes, the photoassimilate transport conduits in plants. Aphids are able to successfully puncture sieve tubes with their piercing mouthparts (stylets) and ingest phloem sap without eliciting the sieve tubes' normal occlusion response to injury. Occlusion mechanisms are calcium-triggered and may be prevented by chemical constituents in aphid saliva injected into sieve tubes before and d...

  8. Antagonistic effects of soybean viruses on soybean aphid performance. (United States)

    Donaldson, Jack R; Gratton, Claudio


    Although there is long-standing recognition that pest complexes require different management approaches than individual pests, relatively little research has explored how pests interact. In particular, little is known of how herbivorous insects and plant pathogens interact when sharing the same host plant. The soybean aphid, Aphis glycines Mastumura, a recently introduced pest of soybean in the upper midwestern United States, and a complex of plant viruses vectored to soybean by insects have become a major concern for growers in the region. Given the abundance of soybean aphid and the increase in virus incidence in recent years, soybean aphids often use soybean infected by plant viral pathogens. We tested the hypothesis that soybean aphid performance is affected by virus infection of soybean plants. We conducted a series of field and laboratory experiments that examined how infection of soybeans with the common plant viruses, alfalfa mosaic, soybean mosaic, and bean pod mottle viruses, influenced soybean aphid performance. Soybean plants (in the field and laboratory) were hand inoculated with individual viruses, and aphids were allowed to colonize plants naturally in field experiments or added to the plants in clip-cages or within mesh bags in laboratory assays. In the field, aphid density on uninfected control soybean plants was nearly double that on infected plants. In laboratory assays, aphid population growth rates were on average 20% lower for aphids on virus infected compared with uninfected plants. Life table analyses showed that increased mortality on virus-infected plants likely explain differences in aphid population growth. Although there was some heterogeneity in the significance of treatment effects among different experiments, when independent experiments are taken together, there is on average an overall negative effect of these viruses on soybean aphids. PMID:17716484

  9. Crop association to improve aphid biological control


    Chevalier Mendes Lopes, Thomas; Bosquée, Emilie; Bodson, Bernard; Francis, Frédéric


    This research focused on the development of sustainable alternative methods to control aphids, giving special emphasis on cultural practices and plant management systems. Increasing the diversity within crops may have several beneficial effects on pest control, creating attractive habitats for indigenous beneficial fauna and simultaneously deterring pests (“push-pull” approach). In this field study, two wheat/pea associations (mixed cropping and strip cropping) where compared to monocultures ...

  10. Molecular sabotage of plant defense by aphid saliva

    NARCIS (Netherlands)

    Will, T.; Tjallingii, W.F.; Thönnessen, A.; Bel, van A.J.E.


    Aphids, which constitute one of the most important groups of agricultural pests, ingest nutrients from sieve tubes, the photoassimilate transport conduits in plants. Aphids are able to successfully puncture sieve tubes with their piercing mouthparts (stylets) and ingest phloem sap without eliciting

  11. New aphid (Aphidoidea) records for the Netherlands (1984-2005)

    NARCIS (Netherlands)

    Piron, P.G.M.


    Presented are 18 species.of aphids in combination with their food-plants found in The Netherlands from 1984 to 2005 not earlier described here. Among these are well-known species that are caught with the high suction trap andlor MOERICKE yellow water traps and aphids new for The Netherlands. The tax

  12. Seasonal Abundance of Aphids and Aphidophagous Insects in Pecan

    Directory of Open Access Journals (Sweden)

    Ghulam Abbas


    Full Text Available Seasonal occurrence of aphids and aphidophagous insects was monitored for six years (2006–2011 from full leaf expansion in May to leaf fall in October in “Desirable” variety pecan trees that were not treated with insecticides. Aphid outbreaks occurred two times per season, once in the spring and again in the late summer. Yellow pecan and blackmargined aphids exceeded the recommended treatment thresholds one time and black pecan aphids exceeded the recommended treatment levels three times over the six seasons. Increases in aphidophagous insect abundance coincided with aphid outbreaks in five of the six seasons. Among aphidophagous insects Harmonia axyridis and Olla v-nigrum were frequently collected in both the tree canopy and at the ground level, whereas, Coccinella septempunctata, Hippodamia convergens were rarely found in the tree canopy and commonly found at the ground level. Green lacewing abundance was higher in the ground level than in the tree canopy. Brown lacewings were more abundant in the tree canopy than at the ground level. Dolichopodid and syrphid fly abundance, at the ground level increased during peak aphid abundance in the tree canopy. Application of an aqueous solution of fermenting molasses to the pecan foliage during an aphid outbreak significantly increased the abundance of ladybeetles and lacewings and significantly reduced the abundance of yellow pecan, blackmargined and black pecan aphids.

  13. Soybean Aphid (Hemiptera: Aphididae) Affects Soybean Spectral Reflectance. (United States)

    Alves, Tavvs M; Macrae, Ian V; Koch, Robert L


    Soybean aphid, Aphis glycines Matsumura (Hemiptera: Aphididae), is the most economically important insect pest of soybean in the north central United States. Scouting-based integrated pest management (IPM) programs could become more efficient and more widely adopted by using plant spectral reflectance to estimate soybean aphid injury. Our objective was to determine whether plant spectral reflectance is affected by soybean aphid feeding. Field trials were conducted in 2013 and 2014 using caged plots. Early-, late-, and noninfested treatments were established to create a gradient of soybean aphid pressure. Whole-plant soybean aphid densities were recorded weekly. Measurements of plant spectral reflectance occurred on two sample dates per year. Simple linear regression models were used to test the effect of cumulative aphid-days (CAD) on plant spectral reflectance at 680 nm (RED) and 800 nm (NIR), normalized difference vegetation index (NDVI), and relative chlorophyll content. Data indicated that CAD had no effect on canopy-level RED reflectance, but CAD decreased canopy-level NIR reflectance and NDVI. Canopy- and leaf-level measurements typically indicated similar plant spectral response to increasing CAD. CAD generally had no effect on relative chlorophyll content. The present study provides the first documentation that remote sensing holds potential for detecting changes in plant spectral reflectance induced by soybean aphid. The use of plant spectral reflectance in soybean aphid management may assist future IPM programs to reduce sampling costs and prevent prophylactic insecticide sprays. PMID:26470392

  14. Aphids of the genus Macrosiphoniella of the Korean Peninsula

    Czech Academy of Sciences Publication Activity Database

    Holman, Jaroslav; Lee, S.; Havelka, Jan

    Rennes: SosterChaubet, 2001. s. 71. [Aphids in a New Millenium - International Symposium on Aphids /6./. 03.09.2001-07.09.2001, Rennes] Institutional research plan: CEZ:AV0Z5007907 Keywords : Korean peninsula Subject RIV: EG - Zoology

  15. Genome-wide association mapping of soybean aphid resistance traits (United States)

    Soybean aphid is the most damaging insect pest of soybean in the Upper Midwest and is primarily controlled by insecticides. Soybean aphid resistance (i.e., Rag genes) has been documented in some soybean lines at chromosomes 6, 7, 13, and 16, but more sources of resistance are needed. Genome-wide ass...

  16. Functional Characterization of Aphid Salivary Proteins and Their Role in Modulating Plant Defense


    Chaudhary, Ritu


    Aphids (Hemiptera: Aphididae) are among the most destructive agricultural pests that cause extensive economic losses to cultivated crops worldwide. Aphids feed on the phloem sap by using their specialized mouthparts known as stylets. While feeding, aphids secrete large quantities of saliva into the host cells both intercellularly and intracellularly. Aphid saliva is of two types: soluble and gelling saliva. Aphid saliva is presumed to contain a large number of proteins and some of them have b...

  17. GroEL from the endosymbiont Buchnera aphidicola betrays the aphid by triggering plant defense


    Chaudhary, Ritu; Atamian, Hagop S.; Shen, Zhouxin; Briggs, Steven P.; Kaloshian, Isgouhi


    Aphids are sap-feeding plant pests of great agricultural importance. Aphid saliva is known to modulate plant immune responses, but limited information exists about the composition of aphid saliva. By means of mass spectrometry, we identified 105 proteins in the saliva of the potato aphid Macrosiphum euphorbiae. Among these proteins were some originating from the proteobacterium Buchnera aphidicola, which lives endosymbiotically within bacteriocytes in the hemocoel of the aphid. We demonstrate...

  18. Tracking the global dispersal of a cosmopolitan insect pest, the peach potato aphid


    Kasprowicz Louise; Margaritopoulos John T; Malloch Gaynor L; Fenton Brian


    Abstract Background Global commerce and human transportation are responsible for the range expansion of various insect pests such as the plant sucking aphids. High resolution DNA markers provide the opportunity to examine the genetic structure of aphid populations, identify aphid genotypes and infer their evolutionary history and routes of expansion which is of value in developing management strategies. One of the most widespread aphid species is the peach-potato aphid Myzus persicae, which i...

  19. Gibberellin metabolism in chloroplasts of Pisum sativum L. var. Alaska

    International Nuclear Information System (INIS)

    Little is known about the metabolic control of gibberellin (GA) biosynthesis in higher plants. Recent studies have implicated chloroplasts in the metabolic control of GA metabolism in leaves. Thus chloroplasts from several higher plants have been shown to possess high levels of GA-like activity and appear to be able to localize certain GAs selectivity whilst allowing others to migrate into the cytoplasm. This paper evaluates the ability of chloroplasts to synthesize and interconvert GAs, in an in vitro system developed from plastids of Pisum sativum. The results of detailed analysis of the products are reported

  20. Inheritance of enlarged leaf mutations in pea (Pisum sativum L.)

    International Nuclear Information System (INIS)

    In the present study, two pea (Pisum sativum L.) mutants experimentally obtained after gamma irradiation of dry seeds are described. Both mutants were characterized by enlarged leaf size. The mutant 2/462 was shown to have semi-dominant inheritance pattern; 2/927 was sterile and inherited monogenic recessive. The induced mutations have pleiotropic effect, affecting morphological and reproductive traits. New mutants had similar phenotypes to previously named mutants latifolium (lat) and cabbage leaf (calf), but no allelism tests were made between the new and the previously reported mutants. Both mutant lines may be useful plant material for research on leaf development

  1. Genetic study of necrotic leaf pea (Pisum sativum L.) mutants

    International Nuclear Information System (INIS)

    Four pea (Pisum sativum L.) mutants characterized by necrotic leaves were isolated following mutagenesis. The mutants were shown to have single-gene recessive inheritance, characterized morphologically and for seed production. New mutants 1/704, 1/711M, XV/915 and 2/352 had similar phenotypes, respectively, to previously named mutants dgl (degenerating leaves), nec (necrosis), bls (brown leaf spots) and bls (brown leaf), but no allelism tests were made between the new and the previously reported mutants. Mutants 1/704 and 1/711M were shown to be non-allelic. The mutation in line 2/352 may be useful as a genetic marker

  2. Preacondicionamiento de la Semilla de Arveja (Pisum sativum L.)


    Henao Omar A; Marciales Bertha N; Medina Clara I; Lobo A. Mario


    En el Centro de Investigación "La selva ", de la Corporación Colombiana de Investigación Agropecuaria. CORPOICA, ubicado en Rionegro, Antioquia. a 2120 msnm, con una temperatura promedio de 17 °C y perteneciente a la formación ecológica Bosque Húmedo Montano Bajo, se llevó a cabo un estudio con la especie arveja (Pisum sativum L.), con el fin de evaluar el efecto del tratamiento de preacondicionamiento de las semillas, conocido como humedecimiento-secado, sobre la germinación, la emergencia y...

  3. Preacondicionamiento de la semilla de arveja (pisum sativum l.)


    Henao, Omar A; Marciales, Bertha N; Medina, Clara I; Lobo A., Mario


    En el Centro de Investigación "La selva ", de la Corporación Colombiana de Investigación Agropecuaria. CORPOICA, ubicado en Rionegro, Antioquia. a 2120 msnm, con una temperatura promedio de 17 °C y perteneciente a la formación ecológica Bosque Húmedo Montano Bajo, se llevó a cabo un estudio con la especie arveja (Pisum sativum L.), con el fin de evaluar el efecto del tratamiento de preacondicionamiento de las semillas, conocido como humedecimiento-secado, sobre la germinación, la emergencia y...

  4. Aphids (Hemiptera, Aphididae) on ornamental plants in greenhouses in Bulgaria. (United States)

    Yovkova, Mariya; Petrović-Obradović, Olivera; Tasheva-Terzieva, Elena; Pencheva, Aneliya


    Investigations on the species composition and host range of aphids on ornamental greenhouse plants in Bulgaria was conducted over a period of five years, from 2008 to 2012. Twenty greenhouses, growing ornamentals for landscaping, plant collections and other purposes were observed. They were located in the regions of Sofia, Plovdiv, Smolyan, Pavlikeni, Varna and Burgas. The total number of collected aphid samples was 279. Their composition included 33 aphid species and one subspecies from 13 genera and 5 subfamilies. Twenty-eight species were found to belong to subfamily Aphidinae. Almost 70 % of all recorded species were polyphagous. The most widespread aphid species was Myzus persicae, detected in 13 greenhouses all year round, followed by Aulacorthum solani (10 greenhouses) and Aphis gossypii (9 greenhouses). The widest host range was shown by Myzus persicae (43 hosts), Aulacorthum solani (32 hosts) and Aulacorthum circumflexum (23 hosts). The list of host plants includes 114 species from 95 genera and 58 families. The greatest variety of aphid species was detected on Hibiscus (9 species). Out of all aphid samples 12.9 % were collected on Hibiscus and 6.8 %, on Dendranthema. The greatest variety of aphid species was detected on Hibiscus (9 species). Periphyllus californiensis and Aphis (Aphis) fabae mordvilkoi are reported for the first time for Bulgaria. Furthermore, Aphis spiraecola has been found in new localities and has widened its host range in this country. PMID:24039530

  5. Aphids (Hemiptera, Aphididae on ornamental plants in greenhouses in Bulgaria

    Directory of Open Access Journals (Sweden)

    Mariya Yovkova


    Full Text Available Investigations on the species composition and host range of aphids on ornamental greenhouse plants in Bulgaria was conducted over a period of five years, from 2008 to 2012. Twenty greenhouses, growing ornamentals for landscaping, plant collections and other purposes were observed. They were located in the regions of Sofia, Plovdiv, Smolyan, Pavlikeni, Varna and Burgas. The total number of collected aphid samples was 279. Their composition included 33 aphid species and one subspecies from 13 genera and 5 subfamilies. Twenty-eight species were found to belong to subfamily Aphidinae. Almost 70 % of all recorded species were polyphagous. The most widespread aphid species was Myzus persicae, detected in 13 greenhouses all year round, followed by Aulacorthum solani (10 greenhouses and Aphis gossypii (9 greenhouses. The widest host range was shown by Myzus persicae (43 hosts, Aulacorthum solani (32 hosts and Aulacorthum circumflexum (23 hosts.The list of host plants includes 114 species from 95 genera and 58 families. The greatest variety of aphid species was detected on Hibiscus (9 species. Out of all aphid samples 12.9 % were collected on Hibiscus and 6.8 %, on Dendranthema. The greatest variety of aphid species was detected on Hibiscus (9 species.Periphyllus californiensis and Aphis (Aphis fabae mordvilkoi are reported for the first time for Bulgaria. Furthermore, Aphis spiraecola has been found in new localities and has widened its host range in this country.

  6. Multiple cues for winged morph production in an aphid metacommunity.

    Directory of Open Access Journals (Sweden)

    Mohsen Mehrparvar

    Full Text Available Environmental factors can lead individuals down different developmental pathways giving rise to distinct phenotypes (phenotypic plasticity. The production of winged or unwinged morphs in aphids is an example of two alternative developmental pathways. Dispersal is paramount in aphids that often have a metapopulation structure, where local subpopulations frequently go extinct, such as the specialized aphids on tansy (Tanacetum vulgare. We conducted various experiments to further understand the cues involved in the production of winged dispersal morphs by the two dominant species of the tansy aphid metacommunity, Metopeurum fuscoviride and Macrosiphoniella tanacetaria. We found that the ant-tended M. fuscoviride produced winged individuals predominantly at the beginning of the season while the untended M. tanacetaria produced winged individuals throughout the season. Winged mothers of both species produced winged offspring, although in both species winged offspring were mainly produced by unwinged females. Crowding and the presence of predators, effects already known to influence wing production in other aphid species, increased the percentage of winged offspring in M. tanacetaria, but not in M. fuscoviride. We find there are also other factors (i.e. temporal effects inducing the production of winged offspring for natural aphid populations. Our results show that the responses of each aphid species are due to multiple wing induction cues.

  7. Bacterial communities of two parthenogenetic aphid species cocolonizing two host plants across the Hawaiian Islands. (United States)

    Jones, Ryan T; Bressan, Alberto; Greenwell, April M; Fierer, Noah


    Aphids (Hemiptera: Aphididae) have been the focus of several studies with respect to their interactions with inherited symbionts, but bacterial communities of most aphid species are still poorly characterized. In this research, we used bar-coded pyrosequencing to characterize bacterial communities in aphids. Specifically, we examined the diversity of bacteria in two obligately parthenogenetic aphid species (the melon aphid, Aphis gossypii, and the cardamom aphid, Pentalonia caladii) cocolonizing two plant species (taro, Colocasia esculenta, and ginger, Alpinia purpurata) across four Hawaiian Islands (Hawaii, Kauai, Maui, and Oahu). Results from this study revealed that heritable symbionts dominated the bacterial communities for both aphid species. The bacterial communities differed significantly between the two species, and A. gossypii harbored a more diverse bacterial community than P. caladii. The bacterial communities also differed across aphid populations sampled from the different islands; however, communities did not differ between aphids collected from the two host plants. PMID:21965398

  8. Impact of Rag1 aphid resistant soybeans on Binodoxys communis (Hymenoptera: Braconidae), a parasitoid of soybean aphid (Hemiptera: Aphididae). (United States)

    Ghising, Kiran; Harmon, Jason P; Beauzay, Patrick B; Prischmann-Voldseth, Deirdre A; Helms, Ted C; Ode, Paul J; Knodel, Janet J


    Multiple strategies are being developed for pest management of the soybean aphid, Aphis glycines Matsumura; however, there has been little published research thus far to determine how such strategies may influence each other, thereby complicating their potential effectiveness. A susceptible soybean (Glycine max L.) variety without the Rag1 gene and a near isogenic resistant soybean variety with the Rag1 gene were evaluated in the laboratory for their effects on the fitness of the soybean aphid parasitoid, Binodoxys communis (Gahan). The presence or absence of the Rag1 gene was verified by quantifying soybean aphid growth. To test for fitness effects, parasitoids were allowed to attack soybean aphids on either a susceptible or resistant plant for 24 h and then aphids were kept on the same plant throughout parasitoid development. Parasitoid fitness was measured by mummy and adult parasitoid production, adult parasitoid emergence, development time, and adult size. Parasitoids that attacked soybean aphids on susceptible plants produced more mummies, more adult parasitoids, and had a higher emergence rate compared with those on resistant plants. Adult parasitoids that emerged from resistant plants took 1 d longer and were smaller compared with those from susceptible plants. This study suggests that biological control by B. communis may be compromised when host plant resistance is widely used for pest management of soybean aphids. PMID:22507000

  9. Biological control of tortricids and aphids in strawberries

    DEFF Research Database (Denmark)

    Sigsgaard, Lene; Enkegaard, Annie; Eilenberg, Jørgen;

    Cropping practice and biological control can contribute to reduced pesticide use in strawberries. Organic strawberries are less attacked by strawberry tortricid and buckwheat flower strips can augment its natural enemies. Against shallot aphid the two-spot ladybird is promising....

  10. New data about the Costa Rican aphid fauna (Hemiptera, Aphididae)


    Zamora Mejías, D.; Pérez Hidalgo, N.; W. Villalobos; Hanson, P


    Aphids were collected from 39 locations throughout Costa Rica, representing a wide altitudinal range, and from both crops and native plants. In total, 48 species of aphids were identified, associated with 62 families and 111 species of plants, many of these representing new host plant records. Aphis nasturtii Kaltenbach, 1843 is reported here for the first time in Central America and Trichosiphonaphis (Xenomyzus) polygoni (van der Goot, 1917) for the ...

  11. Artificial nighttime light changes aphid-parasitoid population dynamics


    Dirk Sanders; Rachel Kehoe; Katie Tiley; Jonathan Bennie; Dave Cruse; Davies, Thomas W; F J Frank van Veen; Gaston, Kevin J


    Artificial light at night (ALAN) is recognized as a widespread and increasingly important anthropogenic environmental pressure on wild species and their interactions. Understanding of how these impacts translate into changes in population dynamics of communities with multiple trophic levels is, however, severely lacking. In an outdoor mesocosm experiment we tested the effect of ALAN on the population dynamics of a plant-aphid-parasitoid community with one plant species, three aphid species an...

  12. Spontaneous electrical activity recorded from the aphid central nervous system


    Nguyen, Dan-Thanh T.; Blacker, Melissa J.; Goodchild, James A.


    Whilst many classes of insecticides target the insect central nervous system (CNS), their effects in the CNS of pest aphids have not been demonstrated. In this report, we describe an electrophysiological method for recording spontaneous neuronal activity from the giant willow aphid (Tuberolachnus salignus). Using extracellular recording electrodes and two analysis methods (threshold and template search), spontaneous spike activity was shown to exhibit sensitivity to the neuroexcitatory insect...

  13. Venomous protease of aphid soldier for colony defense


    Kutsukake, Mayako; Shibao, Harunobu; Nikoh, Naruo; Morioka, Mizue; Tamura, Tomohiro; Hoshino, Tamotsu; Ohgiya, Satoru; Fukatsu, Takema


    In social aphids, morphological, behavioral, and physiological differences between soldiers and normal insects are attributed to differences in gene expression between them, because they are clonal offspring parthenogenetically produced by the same mothers. By using cDNA subtraction, we identified a soldier-specific cysteine protease of the family cathepsin B in a social aphid, Tuberaphis styraci, with a second-instar soldier caste. The cathepsin B gene was specifically expressed in soldiers ...

  14. Stylet penetration behaviors of the cotton aphid Aphis gossypii on transgenic Bt cotton

    Institute of Scientific and Technical Information of China (English)

    Kun Xue; Xiao-Ying Wang; Cui-Hong Huang; Rong-Jiang Wang; Biao Liu; Feng-Ming Yan; Chong-Ren Xu


    Stylet penetration behaviors of cotton aphids Aphis gossypii Glover on a tmnsgenic cotton line "GK-12" expressing Bt toxic protein ofCry1A (Bt cotton) and a non-Bt conventional cotton line "Simian-3" (CK cotton) were recorded with the direct current electrical penetration graph (DC-EPG) technique. Cotton aphids reared on Bt cotton (abbreviated as Bt-aphids) and its parental non-Bt control line (CK-aphids) for more than 20 generations each, were used for recordings on two cotton lines. Among 47 selected parameters reflecting the activities of aphid stylets within plant tissues, there were eight parameters of CK-aphids showing significant differences between the performances of CK-aphids on Bt cotton and CK cotton, while for Bt-aphids, all the parameters were statistically equal between the performances on the two cotton lines. All parameters with significant differences indicated that CK-aphids could penetrate into Bt cotton more easily, but the phloem saps of Bt cotton were not as good as those of regular cotton for CK-aphids. Based on the present results, we concluded that there were some factors in Bt cotton affecting penetration behaviors of CK-aphids, but it just took several generations for CK-aphids to completely adapt Bt cotton, and Bt-aphids could feed on two cotton lines without difficulty.

  15. Aphid (Hemiptera: Aphididae) species composition and potential aphid vectors of plum pox virus in Pennsylvania peach orchards. (United States)

    Wallis, C M; Fleischer, S J; Luster, D; Gildow, F E


    Plum pox, an invasive disease recently identified in Pennsylvania stone fruit orchards, is caused by the aphid-transmitted Plum pox virus (genus Potyvirus, family Potyviridae, PPV). To identify potential vectors, we described the aphid species communities and the seasonal dynamics of the dominant aphid species within Pennsylvania peach orchards. Aphids were trapped weekly in 2002 and 2003 from mid-April through mid-November within two central Pennsylvania orchards by using yellow and green water pan traps. In total, 42 aphid species were identified from both orchards over 2 yr. Within orchards, actual species richness ranged from 24 to 30 species. The Abundance Based Coverage Estimator predicted species richness to range from 30 to 36 species, indicating that trap catches were identifying most aphid species expected to occur in the orchard. Three species, Rhopalosiphum maidis (Fitch), Aphis spiraecola Patch, and Myzus persicae (Sulzer), were consistently dominant across locations and years. Orchard-trapped populations of these three species peaked in a similar chronological sequence each year. As expected, trap color influenced the total number and distribution of the predominate species collected. However, the same dominant species occurred in both yellow and green traps. Based on the seasonal population dynamics reported here and on published vector efficacy studies, the most probable significant PPV vector was identified as A. spiraecola. If the PPV pathogen escapes current quarantine or if subsequent reintroductions of PPV occur, these data will be useful for developing plum pox management strategies. PMID:16334309


    Directory of Open Access Journals (Sweden)

    Muhammad Kaleem Sarwar


    Full Text Available Cotton aphid (Aphis gossypii is a key pest of cotton crop. The indiscriminate use of insecticides and pesticides during 1930’s and latter to control insects pests, developed resistance in cotton aphid against these chemicals resulting in outbreak of this pest. Cotton aphid has a major impact on quality and yield of cotton which emphasizes the need to manage this notorious pest. The main goal of this review is to highlight various strategies viz., biological, chemical and cultural control for cotton aphid management. The selection of suitable control strategy is made on by viewing the severity of cotton aphid outbreak. Furthermore, the role of transgenic crops in lowering cotton aphid population is also described. However, the preservation of the cotton aphid's natural enemies could be an ecologically sustainable method of maintaining the aphid population below threshold level.

  17. Grain yield losses in wheat by Russian wheat aphid diuraphis noxia (mordvilko)

    International Nuclear Information System (INIS)

    Eight wheat cultivars were sown at the Regional Agricultural Research Institute, Bahawalpur, Pakistan, to evaluate their response to Russian wheat aphid (RWA) Diuraphis noxia (Mordvilko). Significant variability was observed among cultivars with respect to aphid infestation and yield losses. Cultivar V-2707 was the least infested with the aphid (6.3 aphids/tiller) giving maximum grain yield (4638 kg/ha), with cultivar V-2047 the second best with 6.43 aphids/ tiller infestation and grain yield of 4206 kg/ha. Commercial cultivars (Inqlab-91 and Punjab-96) were heavily infested with 14.4 and 12.6 aphids/tiller, respectively, and yielded 2245 and 2490 kg/ha harvest, respectively. Aphid population increased up to the fourth week of March and then declined. Aphid infestation resulted in 3.96 to 7.36% yield loss. The cultivar V-2707 was later released for general cultivation, under the name of Punjab-1. (author)

  18. Aphidius gifuensis: a promising parasitoid for biological control of two important aphid species in sweet pepper

    NARCIS (Netherlands)

    Messelink, G.J.; Bloemhard, C.M.J.; Hoogerbrugge, H.; Schelt, van J.


    The parasitoid Aphidius gifuensis is able to parasitize both the green peach aphid Myzus persicae and the foxglove aphid Aulacorthum solani in sweet pepper. In a greenhouse experiment we showed that rates of parasitism on green peach aphids alone were equal to the commonly used Aphidius colemani, bu

  19. Cereal aphid colony turnover and persistence in winter wheat.

    Directory of Open Access Journals (Sweden)

    Linton Winder

    Full Text Available An understanding of spatial and temporal processes in agricultural ecosystems provides a basis for rational decision-making with regards to the management and husbandry of crops, supporting the implementation of integrated farming strategies. In this study we investigated the spatial and temporal distribution of aphid pests (Sitobion avenae and Metopolophium dirhodum within winter wheat fields. Using an intensive sampling programme we investigated distributions at both the small (single shoot and large (field scales. Within two fields, a grid with 82 locations was established (area 120 m by 168 m. At each location, 25 shoots were individually marked and aphid counts by observation conducted on 21 and 22 occasions as the crop matured, resulting in 43,050 and 45,100 counts being conducted in the two fields respectively. We quantified field scale spatial distributions, demonstrating that spatial pattern generally emerged, with temporal stability being both species- and field- dependent. We then measured turnover of colonies at the small (individual shoot and large (field scales by comparing consecutive pairs of sampling occasions. Four turnover categories were defined: Empty (no aphids recorded on either occasion; Colonised (aphids recorded on the second occasion but not the first; Extinction (aphids recorded on the first occasion but not the second; Stable (aphids recorded on both occasions. At the field scale, population stability soon established, but, at the small scale there was a consistently high proportion of unoccupied shoots with considerable colonisation and extinction and low stability. The redistribution of aphids within the crop at the local scale is a vulnerability which could be used to disrupt population development--by mediating exposure to ground-active natural enemies and by incurring a metabolic cost caused by the physiological demands to re-establish on a nearby host plant.

  20. Virulent Diuraphis noxia Aphids Over-Express Calcium Signaling Proteins to Overcome Defenses of Aphid-Resistant Wheat Plants.

    Directory of Open Access Journals (Sweden)

    Deepak K Sinha

    Full Text Available The Russian wheat aphid, Diuraphis noxia, an invasive phytotoxic pest of wheat, Triticum aestivum, and barley, Hordeum vulgare, causes huge economic losses in Africa, South America, and North America. Most acceptable and ecologically beneficial aphid management strategies include selection and breeding of D. noxia-resistant varieties, and numerous D. noxia resistance genes have been identified in T. aestivum and H. vulgare. North American D. noxia biotype 1 is avirulent to T. aestivum varieties possessing Dn4 or Dn7 genes, while biotype 2 is virulent to Dn4 and avirulent to Dn7. The current investigation utilized next-generation RNAseq technology to reveal that biotype 2 over expresses proteins involved in calcium signaling, which activates phosphoinositide (PI metabolism. Calcium signaling proteins comprised 36% of all transcripts identified in the two D. noxia biotypes. Depending on plant resistance gene-aphid biotype interaction, additional transcript groups included those involved in tissue growth; defense and stress response; zinc ion and related cofactor binding; and apoptosis. Activation of enzymes involved in PI metabolism by D. noxia biotype 2 aphids allows depletion of plant calcium that normally blocks aphid feeding sites in phloem sieve elements and enables successful, continuous feeding on plants resistant to avirulent biotype 1. Inhibition of the key enzyme phospholipase C significantly reduced biotype 2 salivation into phloem and phloem sap ingestion.

  1. Possible advantages of small differences in resistance to aphids

    International Nuclear Information System (INIS)

    Small differences in resistance are often available to plant breeders but their use presents practical difficulties, needing sensitive assessment techniques and careful evaluation in the field. Low levels of resistance to aphids in sugar beet, field beans and adult cereal plants were observed in the glasshouse. Field experiments with resistant beet showed reduction of aphid numbers and in some years of virus yellows infection. Breeding programmes in progress with sugar beet and field beans (V. faba) are based on selection amongst small differences of resistance to aphids. It is argued that low-level resistance can contribute significantly to the success of breeding for resistance, whether based on natural variation or on induced mutation. The time over which resistance remains useful in agriculture depends unpredictably on the evolutionary relationship between crop plants and their pests, but low levels of resistance should maintain their usefulness. (author)

  2. Aphid infestation affecting the biogeochemistry of European beech saplings (United States)

    Michalzik, B.; Levia, D. F., Jr.; Bischoff, S.; Näthe, K.


    Mass outbreaks of herbivore insects are known to perturb the functional properties of forests. However, it is less clear how endemic to moderate aboveground herbivory affects the vertical flow of nutrients from tree canopies to the soil. Here, we report on the effects of low to moderate infestation levels of the woolly beech aphid (Phyllaphis fagi L.) on the nutrient dynamics and hydrology of European beech (Fagus sylvatica L.). In a potted sapling experiment, we followed the vertical dynamics of nutrients via throughfall (TF), stemflow (SF) and litter leachates (LL) collected over ten weeks underneath infested and uninfested control trees. Aphid infestation amplifies the fluxes of K+, Mn2+ and particulate nitrogen (0.45μm control. In contrast, fluxes of NH4-N and SO4-S diminished during peaking aphid abundance by 26 and 16%, respectively. Differences in canopy-derived dissolved nitrogen and carbon compounds, sulfur (S), Ca2+, Mg2+, Na+ were aphid abundance on nutrient dynamics was most notable in TF and SF and diminished in LL.Aphid infestation greatly altered the SF fluxes of DOC, K+, Mn2+, DON and sulfur-species, which were significantly concentrated at the tree base by "funneling" the rainfall through the canopy biomass to the trunk. Normalized to one square meter, water and nutrient fluxes were amplified by a factor of up to 200 compared to TF.Imaging of leaf surfaces by scanning electron microscopy exhibited notable differences of the surface morphology and microbiology of control, lightly infested, and heavily infested leaves. This observation might point to an aphid-mediated alteration of the phyllosphere ecology triggering the microbial uptake of NH4-N and SO4-S and its transformation to particulate N by magnified biomass growth of the phyllosphere microflora, consequently changing the chemical partitioning and temporal availability of nitrogen.

  3. Fertility improvement in pea (Pisum sativum L.) autotetraploids -mutation breeding

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, H.; Mercykuty, V.C.; Srivastava, C.P. [Banaras Hindu Univ., Varanasi (India). Dept. of Genetics and Plant Breeding


    C{sub 2} seeds of autotetraploids (colchicine-induced) of two diverse genotypes, T 163 and 5064-S, of pea (Pisum sativum L.) and their corresponding diploids were irradiated with 10 kR gamma-ray. Autotetraploids showed a high seed-sterility as compared to diploids. Seed fertility increased in M{sub 2} as compared to M{sub 1}. Both quadrivalent and bivalent frequencies decreased in the M{sub 1} generation of autotetraploids in relation to their respective controls. However, a positive shift in the mean bivalent formation was noted at the cost of other configurations in C{sub 3}-M{sub 2} with respect to C{sub 2}-M{sub 1} and varied with the genotype. In the M{sub 2} generation of autotetraploids, the variability was relatively higher for the number of pods per plant and seed yield per plant. Although the mean values for pods per plant, number of seeds per pod and seed yield per plant remained more or less parallel in autotetraploids in M{sub 1} and M{sub 2} generations, there was an increase in the upper range limit probably due to micromutation for these characters in M{sub 2}. (author). 15 refs, 2 tabs.

  4. Processing Pisum sativum seed storage protein precursors in vitro

    Institute of Scientific and Technical Information of China (English)



    The profile of polypeptides separated by SDS-PAGE from seed of major crop species such as pea(Pisum sativum) is complex,resulting from cleavage (processing) of precursors expressed from multiple copies of genes encoding vicilin and legumin,the major storage globulins.Translation in vitro of mRNAs hybridselected from mid-maturation pea seed RNAs by defined vicilin and legumin cDNA clones provided precursor molecules that were cleaved in vitro by a cell-free protease extract obtained from similar stage seed;the derived polypeptides were of comparable sizes to those observed in vivo.The feasibility of transcribing mRNA in vitro from a cDNA clone and cleavage in vitro of the derived translation products was established for a legumin clone,providing a method for determining polypeptide products of an expressed sequence.This approach will also be useful for characterising cleavage site requirements since modifications an readily be introduced at the DNA level.

  5. Transient protein expression in three Pisum sativum (green pea) varieties. (United States)

    Green, Brian J; Fujiki, Masaaki; Mett, Valentina; Kaczmarczyk, Jon; Shamloul, Moneim; Musiychuk, Konstantin; Underkoffler, Susan; Yusibov, Vidadi; Mett, Vadim


    The expression of proteins in plants both transiently and via permanently transformed lines has been demonstrated by a number of groups. Transient plant expression systems, due to high expression levels and speed of production, show greater promise for the manufacturing of biopharmaceuticals when compared to permanent transformants. Expression vectors based on a tobacco mosaic virus (TMV) are the most commonly utilized and the primary plant used, Nicotiana benthamiana, has demonstrated the ability to express a wide range of proteins at levels amenable to purification. N. benthamiana has two limitations for its use; one is its relatively slow growth, and the other is its low biomass. To address these limitations we screened a number of legumes for transient protein expression. Using the alfalfa mosaic virus (AMV) and the cucumber mosaic virus (CMV) vectors, delivered via Agrobacterium, we were able to identify three Pisum sativum varieties that demonstrated protein expression transiently. Expression levels of 420 +/- 26.24 mg GFP/kgFW in the green pea variety speckled pea were achieved. We were also able to express three therapeutic proteins indicating promise for this system in the production of biopharmaceuticals. PMID:19156736

  6. Burdock fructooligosaccharide induces stomatal closure in Pisum sativum. (United States)

    Guo, Yanling; Guo, Moran; Zhao, Wenlu; Chen, Kaoshan; Zhang, Pengying


    Burdock fructooligosaccharide (BFO) isolated from the root tissue of Arctium lappa is a reserve carbohydrate that can induce resistance against a number of plant diseases. Stomatal closure is a part of plant innate immune response to restrict bacterial invasion. In this study, the effects of BFO on stomata movement in Pisum sativum and the possible mechanisms were studied with abscisic acid (ABA) as a positive control. The results showed that BFO could induce stomatal closure accompanied by ROS and NO production, as is the case with ABA. BFO-induced stomatal closure was inhibited by pre-treatment with L-NAME (N(G)-nitro-L-arginine methyl ester, hydrochloride; nitric oxide synthase inhibitor) and catalase (hydrogen peroxide scavenger). Exogenous catalase completely restricted BFO-induced production of ROS and NO in guard cells. In contrast, L-NAME prevented the rise in NO levels but only partially restricted the ROS production. These results indicate that BFO-induced stomatal closure is mediated by ROS and ROS-dependent NO production. PMID:23911508

  7. Review of the health benefits of peas (Pisum sativum L.). (United States)

    Dahl, Wendy J; Foster, Lauren M; Tyler, Robert T


    Pulses, including peas, have long been important components of the human diet due to their content of starch, protein and other nutrients. More recently, the health benefits other than nutrition associated with pulse consumption have attracted much interest. The focus of the present review paper is the demonstrated and potential health benefits associated with the consumption of peas, Pisum sativum L., specifically green and yellow cotyledon dry peas, also known as smooth peas or field peas. These health benefits derive mainly from the concentration and properties of starch, protein, fibre, vitamins, minerals and phytochemicals in peas. Fibre from the seed coat and the cell walls of the cotyledon contributes to gastrointestinal function and health, and reduces the digestibility of starch in peas. The intermediate amylose content of pea starch also contributes to its lower glycaemic index and reduced starch digestibility. Pea protein, when hydrolysed, may yield peptides with bioactivities, including angiotensin I-converting enzyme inhibitor activity and antioxidant activity. The vitamin and mineral contents of peas may play important roles in the prevention of deficiency-related diseases, specifically those related to deficiencies of Se or folate. Peas contain a variety of phytochemicals once thought of only as antinutritive factors. These include polyphenolics, in coloured seed coat types in particular, which may have antioxidant and anticarcinogenic activity, saponins which may exhibit hypocholesterolaemic and anticarcinogenic activity, and galactose oligosaccharides which may exert beneficial prebiotic effects in the large intestine. PMID:22916813

  8. Orange oil effect in the control of fennel aphid


    Ivanildo Cavalcanti de Albuquerque; Luciano de Medeiros Pereira Brito; Carlos Henrique de Brito; Edson Batista Lopes; Jacinto de Luna Batista


    In the properties where fennel is grown, in the states of Bahia, Sergipe, Pernambuco and Paraiba, at the Northeast of Brazil, a high rate of usage of pesticides in the crop, aiming to control the aphid Hyadaphis foeniculi. The purpose of this study was to evaluate the effect of orange oil Prev-Am (sodium tetraborohydrate decahydrate), in the control of H. foeniculi aphid of the fennel crop. The trial was conducted in a fennel field located in Lagoa Seca Experimental Station, belonging to the ...

  9. The endosymbiont Arsenophonus is widespread in soybean aphid, Aphis glycines, but does not provide protection from parasitoids or a fungal pathogen (United States)

    Aphids commonly harbor bacterial facultative symbionts that have a variety of effects upon their aphid hosts, including defense against hymenopteran parasitoids and fungal pathogens. The soybean aphid, Aphis glycines Matsumura (Hemiptera: Aphididae), is infected with the symbiont, Arsenophonus sp., ...

  10. First report of Pandora neoaphidis resting spore formation in vivo in aphid hosts

    DEFF Research Database (Denmark)

    Clara Scorsetti, Ana; Jensen, Annette Bruun; Lopez Lastra, Claudia;


    The entomopathogenic fungus Pandora neoaphidis is a recognized pathogen of aphids, causes natural epizootics in aphid populations, and interacts and competes with aphid predators and parasitoids. Survival of entomophthoralean fungi in periods of unsuitable weather conditions or lack of appropriat...

  11. Inventory and assessment of foliar natural enemies of the soybean aphid (Hemiptera: Aphididae) in South Dakota. (United States)

    Hesler, Louis S


    Soybean aphid (Aphis glycines Matsumura) (Hemiptera: Aphididae) is a major pest of soybean in northern production regions of North America, and insecticides have been the primary management approach while alternative methods are developed. Knowledge of arthropod natural enemies and their impact on soybean aphid is critical for developing biological control as a management tool. Soybean is a major field crop in South Dakota, but information about its natural enemies and their impact on soybean aphid is lacking. Thus, this study was conducted in field plots in eastern South Dakota during July and August of 2004 and 2005 to characterize foliar-dwelling, arthropod natural enemies of soybean aphid, and it used exclusion techniques to determine impact of natural enemies and ants (Hymenoptera: Formicidae) on soybean aphid densities. In open field plots, weekly soybean aphid densities reached a plateau of several hundred aphids per plant in 2004, and peaked at roughly 400 aphids per plant in 2005. Despite these densities, a relatively high frequency of aphid-infested plants lacked arthropod natural enemies. Lady beetles (Coleoptera: Coccinellidae) were most abundant, peaking at 90 and 52% of all natural enemies sampled in respective years, and Harmonia axyridis Pallas was the most abundant lady beetle. Green lacewings (Neuroptera: Chrysopidae) were abundant in 2005, due mainly to large numbers of their eggs. Abundances of arachnids and coccinellid larvae correlated with soybean aphid densities each year, and chrysopid egg abundance was correlated with aphid density in 2005. Three-week cage treatments of artificially infested soybean plants in 2004 showed that noncaged plants had fewer soybean aphids than caged plants, but abundance of soybean aphid did not differ among open cages and ones that provided partial or total exclusion of natural enemies. In 2005, plants within open cages had fewer soybean aphids than those within cages that excluded natural enemies, and aphid

  12. High susceptibility of Bt maize to aphids enhances the performance of parasitoids of lepidopteran pests.

    Directory of Open Access Journals (Sweden)

    Cristina A Faria

    Full Text Available Concerns about possible undesired environmental effects of transgenic crops have prompted numerous evaluations of such crops. So-called Bt crops receive particular attention because they carry bacteria-derived genes coding for insecticidal proteins that might negatively affect non-target arthropods. Here we show a remarkable positive effect of Bt maize on the performance of the corn leaf aphid Rhopalosiphum maidis, which in turn enhanced the performance of parasitic wasps that feed on aphid honeydew. Within five out of six pairs that were evaluated, transgenic maize lines were significantly more susceptible to aphids than their near-isogenic equivalents, with the remaining pair being equally susceptible. The aphids feed from the phloem sieve element content and analyses of this sap in selected maize lines revealed marginally, but significantly higher amino acid levels in Bt maize, which might partially explain the observed increased aphid performance. Larger colony densities of aphids on Bt plants resulted in an increased production of honeydew that can be used as food by beneficial insects. Indeed, Cotesia marginiventris, a parasitoid of lepidopteran pests, lived longer and parasitized more pest caterpillars in the presence of aphid-infested Bt maize than in the presence of aphid-infested isogenic maize. Hence, depending on aphid pest thresholds, the observed increased susceptibility of Bt maize to aphids may be either a welcome or an undesirable side effect.

  13. The intracellular location of nitrogen metabolism enzymes in Pisum arvense L. roots

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus


    Full Text Available The time course changes of nitrate assimilation enzymes and their distribution has been studied in Pisum arvense roots. The results indicate that nitrate reductase (EC and glutamine synthetase (EC are present in the soluble fraction, and nitrite reductase (EC and glutamate synthase (EC are localised in the plastids. The results show that the glutamine synthetase/glutamate synthase system is the major pathway of ammonium incorporation in NO3-supplied Pisum arvense roots and glutamate dehydrogenase plays a lesser role.

  14. The role of malate in the synthesis of glutamate in Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Genowefa Kubik-Dorosz


    Full Text Available The in vivo and in vitro activities of NADH-dependent glutamate synthase in excised Pisum arvense roots increased several-fold under the influence of malate while pyruvate oxaloacctate. citrate and succinate inhibited this entyme. The plastids isolated from Pisum arvense root,. ahen incubated with glutamine and α-ketoglutarate, released glutamate into the medium Malate clearly stimulated this process. Albizziin (25 mM completely reduced the presence of glutamate in the incubation mixture. These results indicate that reduced pyridine nucleotides arising in P. arvense root plastids during oxidation of malic acid may constitute the indispensable source of electrons for glutamic acid synthesis.

  15. Megasporocyte formation in Pisum sativum L. against the back ground of bud development

    Directory of Open Access Journals (Sweden)

    Wanda Wojciechowska


    Full Text Available Megasporocyte formation in Pisum sativum L. takes place at the stages of bud development, when the vexillum surpasses the lower androecium whorl slightly at the beginning, and markedly in further stages. Under the epidermis of an ovule, a multicellular archesporium is formed. Mitotic division of these cells gives rise to a two-layered parietal tissue and to a group of megaspore mother cells (MMCs. The tetrad is formed from one megasporocyte. In the bud development of Pisum sativum the carpel walls accrete to each other relatively early.

  16. Predator efficiency reconsidered for a ladybird-aphid system

    Czech Academy of Sciences Publication Activity Database

    Kindlmann, Pavel; Yasuda, H.; Kajita, Y.; Sato, S.; Dixon, Anthony F. G.


    Roč. 3, mar (2015), s. 27. ISSN 2296-701X R&D Projects: GA MŠk(CZ) LO1415; GA ČR GB14-36098G Institutional support: RVO:67179843 Keywords : biological control * generation time ratio * population dynamics * predator-prey systems * ladybirds * aphids Subject RIV: EH - Ecology, Behaviour

  17. Artificial nighttime light changes aphid-parasitoid population dynamics. (United States)

    Sanders, Dirk; Kehoe, Rachel; Tiley, Katie; Bennie, Jonathan; Cruse, Dave; Davies, Thomas W; Frank van Veen, F J; Gaston, Kevin J


    Artificial light at night (ALAN) is recognized as a widespread and increasingly important anthropogenic environmental pressure on wild species and their interactions. Understanding of how these impacts translate into changes in population dynamics of communities with multiple trophic levels is, however, severely lacking. In an outdoor mesocosm experiment we tested the effect of ALAN on the population dynamics of a plant-aphid-parasitoid community with one plant species, three aphid species and their specialist parasitoids. The light treatment reduced the abundance of two aphid species by 20% over five generations, most likely as a consequence of bottom-up effects, with reductions in bean plant biomass being observed. For the aphid Megoura viciae this effect was reversed under autumn conditions with the light treatment promoting continuous reproduction through asexuals. All three parasitoid species were negatively affected by the light treatment, through reduced host numbers and we discuss induced possible behavioural changes. These results suggest that, in addition to direct impacts on species behaviour, the impacts of ALAN can cascade through food webs with potentially far reaching effects on the wider ecosystem. PMID:26472251

  18. Genetic evaluation of two aphid resistant cowpea mutants in Kenya

    International Nuclear Information System (INIS)

    The aphid, Aphis craccivora Koch, is serious pest of cowpea, Vigna unguiculata (L.) Walp., in Africa. It feeds on young shoots by sucking sap, resulting in the stunting and killing of the plant. Several insecticides are effective against aphids, but resistant cultivars offer the most effective and cheapest means of control. Two aphid resistant mutants, ICV11 and ICV12, were developed from the M2 population of ICV1 seeds irradiated with 20 kR of gamma rays. Both mutants showed monogenic dominant inheritance of resistance. Crosses between these mutants and two other cultivars, ICV10 and TVu310, indicated that ICV11 and ICV12 contain another dominant resistance gene which is non-allelic to the resistance gene in ICV10 and TVu310. The genes were designated Racl (in ICV10 and TVu310) and Rac2 (in ICV11 and ICV12). Both antixenosis and antibiosis types of resistance mechanism were found to be operating in the mutant cultivars. The improved attributes of the mutant cultivars ICV11 and ICV12 were a high level of resistance to aphid, an increased pod length, an increased number of seeds per pod, a semi-erect plant type and higher grain yields. (author). 14 refs, 2 figs, 2 tabs

  19. A review of aphid parasitoids (Hym., Braconidae, Aphidiinae) of Turkey

    Czech Academy of Sciences Publication Activity Database

    El-Mali, M. U.; Starý, Petr; Sahbaz, A.; Zsemerci, F.


    Roč. 14, č. 2 (2004), 355-370. ISSN 1110-1768 R&D Projects: GA AV ČR(CZ) IBS5007102; GA AV ČR(CZ) IAA6007105 Institutional research plan: CEZ:AV0Z5007907 Keywords : review * aphid parasitoids * Turkey Subject RIV: EG - Zoology

  20. Is the response of aphids to alarm pheromone stable?

    Czech Academy of Sciences Publication Activity Database

    Thieme, T.; Dixon, Anthony F. G.


    Roč. 139, č. 10 (2015), s. 741-746. ISSN 0931-2048 R&D Projects: GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 Keywords : (E)-β-farnesene * dropping response * habituation * Leguminosae * pea aphid Subject RIV: EH - Ecology, Behaviour Impact factor: 1.650, year: 2014

  1. Associations of wheat with pea can reduce aphid infestations. (United States)

    Lopes, T; Bodson, B; Francis, F


    Increasing plant diversity within crops can be beneficial for pest control. In this field study, the effects of two wheat and pea associations (mixed cropping and strip cropping) on aphid populations were compared with pure stands of both crops by observations on tillers and plants. Pea was more susceptible to infestations than wheat. As expected, the density of aphid colonies was significantly higher in pure stands during the main occurrence periods, compared with associations. Additionally, flying beneficials, such as not only aphidophagous adult ladybirds but also parasitoid, hoverfly and lacewing species that feed on aphids at the larval stage, were monitored using yellow pan traps. At specific times of the sampling season, ladybirds and hoverflies were significantly more abundant in the pure stand of pea and wheat, respectively, compared with associations. Few parasitoids and lacewings were trapped. This study showed that increasing plant diversity within crops by associating cultivated species can reduce aphid infestations, since host plants are more difficult to locate. However, additional methods are needed to attract more efficiently adult beneficials into wheat and pea associations. PMID:26013274

  2. Ants farm subterranean aphids mostly in single clone groups

    DEFF Research Database (Denmark)

    Ivens, Aniek B.F.; Kronauer, Daniel Jan Christoph; Pen, Ido;


    while also benefitting the domesticated aphids as long as their clone-mates reproduce successfully. The cost-benefit logic of this type of polyculture husbandry has striking analogies with human farming practices based on slaughtering young animals for meat to maximize milk-production by a carefully...

  3. Pea (Pisum sativum L. in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Robert J. Redden


    Full Text Available Pea (Pisum sativum L. was the original model organism used in Mendel’s discovery (1866 of the laws of inheritance, making it the foundation of modern plant genetics. However, subsequent progress in pea genomics has lagged behind many other plant species. Although the size and repetitive nature of the pea genome has so far restricted its sequencing, comprehensive genomic and post genomic resources already exist. These include BAC libraries, several types of molecular marker sets, both transcriptome and proteome datasets and mutant populations for reverse genetics. The availability of the full genome sequences of three legume species has offered significant opportunities for genome wide comparison revealing synteny and co-linearity to pea. A combination of a candidate gene and colinearity approach has successfully led to the identification of genes underlying agronomically important traits including virus resistances and plant architecture. Some of this knowledge has already been applied to marker assisted selection (MAS programs, increasing precision and shortening the breeding cycle. Yet, complete translation of marker discovery to pea breeding is still to be achieved. Molecular analysis of pea collections has shown that although substantial variation is present within the cultivated genepool, wild material offers the possibility to incorporate novel traits that may have been inadvertently eliminated. Association mapping analysis of diverse pea germplasm promises to identify genetic variation related to desirable agronomic traits, which are historically difficult to breed for in a traditional manner. The availability of high throughput ‘omics’ methodologies offers great promise for the development of novel, highly accurate selective breeding tools for improved pea genotypes that are sustainable under current and future climates and farming systems.

  4. Dicty_cDB: Contig-U03538-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available pisum cDNA c... 34 1.00 2 ( CN750096 ) ApDT-V-B10 ApDT Acyrthosiphon pisum cDNA clone...n pisum cDNA c... 34 1.4 2 ( CN750378 ) ApDT-XIII-F3 ApDT Acyrthosiphon pisum cDNA clone...FF8CE06CM1 ID0AFF Acyrthosiphon pisum cDNA cl... 34 1.5 2 ( AC021590 ) Homo sapiens chromosome 8, clone RP11...5235 ) Oryza officinalis clone OO__Ba0021O07, *** SEQUEN... 38 9.5 4 ( DV746373 ) ID0AAG5DD01CM1 ID0AAG Acyrthosiphon...V743597 ) ID0AAG10CA10CM1 ID0AAG Acyrthosiphon pisum cDNA c... 34 9.8 2 >( BJ398173 ) Dictyostelium discoideum cDNA clone

  5. Studies on the relationship between cotton aphids feedding, excretion, absorption and ability of cotton varieties resisting aphids using radioactive tracer 14C

    International Nuclear Information System (INIS)

    The experments were conducted in 1980-1982. The aphids were placed on the plants after the cotton plants were exposed to 14CO2 under the sunlight for 1 hr. and then coverd with paper covering in the special photosynthesis chambers. The honey dew excreted by aphids was collected on the paper covering. Then the aphids and the paper coverings both put into scintillation liquid, and the radioactivity was determined. The results indicated that the aphids being different instars had different approximate rate of 14C absorption. 71.2% of total absorption was excreted in the form of honey dew; 28.8% of total absorption was taken by the aphid bodies (included milts) in the nymph stage, while 23.5% of total absorption was uptaken in the adult stage. The aphids feeding on the aphid-resistant cotton varieties (such as 'Junhai 1', 'Shanghai 605') had 23.5-26.7% approximate absorbing rate, whereas those on the aphid-sensitive cotton varieties (for example 'Uganda 2') had over 28.1% approximate absorbing rate. These results showed no difference from the results of field experiments

  6. Transcriptomic responses of the aphid Myzus persicae nicotianae Blackman (Hemiptera: Aphididae to insecticides: Analyses in the single Chilean clone of the tobacco aphid

    Directory of Open Access Journals (Sweden)

    Marco Cabrera-Brandt


    Full Text Available The tobacco aphid Myzus persicae nicotianae Blackman is a subspecies of the highly polyphagous and agricultural pest Myzus persicae (Sulzer. For its control, insecticide applications are widely used, but resistance to numerous molecules has been reported, displaying at least three insecticide resistance mechanisms, including: (i elevated carboxylesterases (E-Carb, (ii modification of the acetylcholinesterase (MACE, and (iii kdr and super-kdr insensitivity mutations. In Chile, populations of the tobacco aphid are characterized by the presence of a single predominant clone, which is also present in high proportions in other countries of the Americas. This aphid clone exhibits low levels of carboxylesterase activity and is kdr susceptible, but the MACE mechanism of insecticide resistance has not been studied. In order to characterize the tobacco aphid in terms of the MACE mechanism and to identify a preliminary group of aphid genes putatively involved in insecticide resistance, a cDNA microarray was used to study the transcriptomic responses when aphids are sprayed with a carbamate insecticide. The single Chilean clone of the tobacco aphid was characterized as MACE susceptible, but we found 38 transcripts significantly regulated by insecticide exposure (13 up- and 25 down-regulated genes. The expression of six of them was validated by qRT-PCR experiments at several time points (6, 12, 18, 24, 30, 36, and 42 h after insecticide application. This mutational and transcriptomic characterization of the tobacco aphid responding to insecticide spray opens new hypotheses in the understanding of the molecular mechanisms underlying insecticide resistance.

  7. A survey of aphid parasitoids (Hymenoptera: Braconidae: Aphidiinae) of Southeastern Europe and their aphid-plant associations

    Czech Academy of Sciences Publication Activity Database

    Kavallieratos, N. G.; Tomanovic, K.; Starý, Petr; Athanassiou, CH. G.; Sarlis, G. P.; Petrovic, O.; Niketic, M.; Veroniki, M. A.


    Roč. 39, č. 3 (2004), s. 527-563. ISSN 0003-6862 R&D Projects: GA AV ČR IAA6007106; GA AV ČR IBS5007102 Institutional research plan: CEZ:AV0Z5007907 Keywords : Aphidiinae * parasitoid-aphid-plant associations * faunistic complexes Subject RIV: EG - Zoology Impact factor: 0.448, year: 2004

  8. Expression of Monstera deliciosa agglutinin gene (mda) in tobacco confers resistance to peach-potato aphids. (United States)

    Kai, Guoyin; Ji, Qian; Lu, Yang; Qian, Zhongying; Cui, Lijie


    The aphid is one of the most serious pests that causes damage to crops worldwide. Lectins from Araceae plant had been proved useful to control the aphid. Herein, the full-length cDNA of Monstera deliciosa agglutinin (mda) gene was cloned and then introduced into tobacco and the influence of the expression of mda in transgenic tobacco against peach-potato aphids (Myzus persicae) was investigated. Among 92 regenerated plants, 59 positive tobacco lines were obtained. Real-time PCR assays and aphid bioassay test revealed that there is a positive correlation between the expression level of mda and the inhibitory effect on peach-potato aphids. The average anti-pests ability of mda transgenic tobacco was 74%, which was higher than that of other reported lectins from Araceae plant. These results indicated that MDA is one of promising insect resistance proteins selected for the control of peach-potato aphids. PMID:22660606

  9. Arabidopsis thaliana - Myzus persicae interaction: shaping the understanding of plant defense against phloem-feeding aphids

    Directory of Open Access Journals (Sweden)

    Joe eLouis


    Full Text Available The phloem provides a unique niche for several organisms. Aphids are a large group of Hemipteran insects that utilize stylets present in their mouthparts to pierce sieve elements and drink large volumes of phloem sap. In addition, many aphids also vector viral diseases. Myzus persicae, commonly known as the green peach aphid (GPA, is an important pest of a large variety of plants that includes Arabidopsis thaliana. This review summarizes recent studies that have exploited the compatible interaction between Arabidopsis and GPA to understand the molecular and physiological mechanisms utilized by plants to control aphid infestation, as well as genes and mechanisms that contribute to susceptibility. In addition, recent efforts to identify aphid-delivered elicitors of plant defenses and novel aphid salivary components that facilitate infestation are also discussed.

  10. Seasonal Phenology and Species Composition of the Aphid Fauna in a Northern Crop Production Area


    Sascha M Kirchner; Hiltunen, Lea; Thomas F Döring; Virtanen, Elina; Palohuhta, Jukka P.; Jari P T Valkonen


    Background The species diversity of aphids and seasonal timing of their flight activity can have significant impacts on crop production, as aphid species differ in their ability to transmit plant viruses and flight timing affects virus epidemiology. The aim of the study was to characterise the species composition and phenology of aphid fauna in Finland in one of the northernmost intensive crop production areas of the world (latitude 64°). Methodology/Principal Findings Flight activity was mon...

  11. What do spring migrants reveal about sex and host selection in the melon aphid?


    Thomas Sophie; Boissot Nathalie; Vanlerberghe-Masutti Flavie


    Abstract Background Host plants exert considerable selective pressure on aphids because the plants constitute their feeding, mating and oviposition sites. Therefore, host specialisation in aphids evolves through selection of the behavioural and chemical mechanisms of host-plant location and recognition, and through metabolic adaptation to the phloem content of the host plant. How these adaptive traits evolve in an aphid species depends on the complexity of the annual life cycle of that specie...



    Muhammad Kaleem Sarwar; Iqra Azam; Nadia Iram; Waheed Iqbal; Aqsad Rashda; Fakhra Anwer; Kiran Atta; Rafaqat Ali


    Cotton aphid (Aphis gossypii) is a key pest of cotton crop. The indiscriminate use of insecticides and pesticides during 1930’s and latter to control insects pests, developed resistance in cotton aphid against these chemicals resulting in outbreak of this pest. Cotton aphid has a major impact on quality and yield of cotton which emphasizes the need to manage this notorious pest. The main goal of this review is to highlight various strategies viz., biological, chemical and cultural control for...

  13. Comparative transcriptome analysis of Gossypium hirsutum L. in response to sap sucking insects: aphid and whitefly


    Dubey, Neeraj Kumar; Goel, Ridhi; Ranjan, Alok; Idris, Asif; Singh, Sunil Kumar; Bag, Sumit K; Chandrashekar, Krishnappa; Pandey, Kapil Deo; Singh, Pradhyumna Kumar; Sawant, Samir V.


    Background Cotton (Gossypium hirsutum L.) is a major fiber crop that is grown worldwide; it faces extensive damage from sap-sucking insects, including aphids and whiteflies. Genome-wide transcriptome analysis was performed to understand the molecular details of interaction between Gossypium hirsutum L. and sap-sucking pests, namely Aphis gossypii (Aphid) and Bemisia tabacci (Whiteflies). Roche’s GS-Titanium was used to sequence transcriptomes of cotton infested with aphids and whiteflies for ...

  14. Impact of fertilization and granular insecticides on the incidence of tobacco aphid, myzus persicae (sulz)

    International Nuclear Information System (INIS)

    Field studies were conducted on the control of tobacco aphid, Myzus persicase (Sulz) with four granular insecticides, viz, Furadan 3% G, Diazinon 5% g, Thiodan 5% g and Larsban 5% g, with and without NPK fertilization. The aphid population was significantly higher in the fertilized plots compared to the non-fertilized ones. All the four insecticides significantly reduced the aphids density compared to the check. Furada 3% gave best results for the control of this pest. (author)

  15. Aphid performance changes with plant defense mediated by Cucumber mosaic virus titer


    Shi, Xiaobin; Gao, Yang; Yan, Shuo; Tang, Xin; Zhou, Xuguo; Zhang, Deyong; Liu, Yong


    Background Cucumber mosaic virus (CMV) causes appreciable losses in vegetables, ornamentals and agricultural crops. The green peach aphid, Myzus persicae Sulzer (Aphididae) is one of the most efficient vectors for CMV. The transmission ecology of aphid-vectored CMV has been well investigated. However, the detailed description of the dynamic change in the plant-CMV-aphid interaction associated with plant defense and virus epidemics is not well known. Results In this report, we investigated the...

  16. In vitro interactions of the aphid endosymbiotic SymL chaperonin with barley yellow dwarf virus.


    Filichkin, S A; Brumfield, S; Filichkin, T P; Young, M.J.


    Barley yellow dwarf virus (BYDV)-vector relationships suggest that there are specific interactions between BYDV virions and the aphid's cellular components. However, little is known about vector factors that mediate virion recognition, cellular trafficking, and accumulation within the aphid. Symbionins are molecular chaperonins produced by intracellular endosymbiotic bacteria and are the most abundant proteins found in aphids. To elucidate the potential role of symbionins in BYDV transmission...

  17. New additions and invasive aphids for Turkey’s aphidofauna (Hemiptera: Aphidoidea)


    Şenol, Özhan; BEĞEN, Hayal AKYILDIRIM; Görür, Gazi; DEMİRTAŞ, Emin


    This study was carried out in order to determine aphid species in the Inner Western Anatolian Subregion of Turkey. Nineteen aphid species are reported as new to the Turkish aphid fauna. These species are Aphis eryngiiglomerata Bozhko, 1963; Aphis glareosae Bozhko, 1959; Capitophorus eniwanus Miyazaki, 1971; Chaitophorus indicus A.K. Ghosh, M.R. Ghosh & D.N. Raychaudhuri, 1970; Chaitophorus ramicola (Börner, 1949); Cinara indica Verma, 1970; Cinara juniperensis (Gillette & Palmer, 1925...

  18. New Additions and Invasive Aphids for Turkey’s Aphidofauna (Hemiptera: Aphidoidea)


    Şenol, Özhan; Akyıldırım, Hayal; Görür, Gazi; Demirtaş, Emin


    This study was carried out in order to determine aphid species in the Inner Western Anatolian Subregion of Turkey. Nineteen aphid species are reported as new to the Turkish aphid fauna. These species are Aphis eryngiiglomerata Bozhko, 1963; Aphis glareosae Bozhko, 1959; Capitophorus eniwanus Miyazaki, 1971; Chaitophorus indicus A.K. Ghosh, M.R. Ghosh & D.N. Raychaudhuri, 1970; Chaitophorus ramicola (Börner, 1949); Cinara indica Verma, 1970; Cinara juniperensis (Gillette & Palmer, 1925); Cinar...

  19. Species Diversity of Aphids (Homoptera: Aphididae) and Coccinellids in Apple Orchards of Urmia, Northwest of Iran


    Nouraddin Shayesteh; Masumeh Ziaee; Hossein Ranji


    Abundance and diversity of aphid and coccinellid species were monitored in apple orchards in Urmia during 2010 and 2011. In this study, eight aphid species were collected and identified in 2010 and nine were found in 2011, while only two coccinellid species were found in both years. In 2010, Aphis pomi (De. Geer) was the most abundant aphid (55.5%) followed by Dysaphis plantaginea (Passerini) (34%). However, in 2011, Eriosoma lanigerum (Hausmann) had the largest population (57%) in app...

  20. Physiological responses of pisum sativum plant to exogenous aba application under drought conditions

    International Nuclear Information System (INIS)

    This study was carried out to investigate the possibility of using foliar ABA application with different concentrations (50,100 and 150 meu g/L-1) in order to decrease the adverse effect of water-deficit stress. The main parameters of interest were; growth parameters; endogenous phytohormones, proline; pigments contents; number and shape of stomata; minerals concentrations; isozymes; and SDS -PAGE protein profile in Pisum sativum plant at 36 days under drought and ABA treatments. The results showed that ABA reduces the reduction in both fresh and dry weights shoot and root of Pisum induced by drought stress. Proline content was increased in response to drought and ABA treatments. Water-stress caused significant reduction in Chl. a, b, whereas application of ABA significantly increased in total chlorohpyll. Water stress significantly decreased IAA, GA concentrations and increased ABA level in leaves than these of the control. ABA treatment partially overcame the decrease in IAA and GA contents. Water stress and ABA increased the activity of (POD) and (ACP) enzymes in Pisum plants. Proteins profile of Pisum sativum in shoot revealed qualitative and quantitative changes, also appearance or disappearance of some bands. After 54 days the yield harvested and total carbohydrates and SDS -PAGE protein profile in seed were investigated. The data showed that total carbohydrates contents were significantly decreased in plant under drought and ABA partially alleviate the adverse effect of water-deficit stress. (author)

  1. Geographic pattern of genetic diversity in the genus Pisum, with inferences about pea domestication (United States)

    We have analysed genetic diversity of common pea (Pisum sativum L.) focusing on wild pea and exploiting biogeographic information. Phylogenetic markers (trnSG and ITS) along with 35,647 genome-wide DARTseq generated single nucleotide polymorphisms (SNPs) and PeaGene 13.2k SNP Illumina assays reveale...

  2. The intracellular localization of malate dehydrogenase isoenzymes in Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Genowefa Kubik-Dorosz


    Full Text Available Mitochondria and plastids were isolated from Pisum arvense root cells by sucrose density gradient centrifugation. The individual subcellular fractions so obtained were subjected to isoelectric focusing on cellulose acetate strips. Mitochondria and plastids each contained one NAD -malate dehydrogenase, while three isoenzymes were associated with the supernatant.

  3. Chromosome aberration assays in Pisum for the study of environmental mutagens. (United States)

    Grant, W F; Owens, E T


    From a literature survey, 117 chemicals are tabulated that have been assayed in 179 assays for their clastogenic effects in Pisum. Of the 117 chemicals that have been assayed, 65 are reported at giving a positive reaction (i.e. causing chromosome aberrations), 30 positive with a dose response, five borderline positive. Seventeen chemicals gave a negative response. Eighty-one percent of the chemicals gave a definite positive response. A c-mitotic effect was detected from treatment with 17 chemicals. In addition to the above tabulation of chemicals, 39 chemicals have been reported with an antimitotic effect. Thirteen assays have been recorded for five types of radiation, which with the exception of ultrasound reacted positively. The results of assays with 38 chemicals and/or radiations in combined treatments, as well as 15 chemicals and three types of radiations that induce somatic mutations are tabulated. The Pisum sativum (2n=14) bioassay has been shown to be a very good plant bioassay for assessing chromosome damage both in mitosis and meiosis for somatic mutations induced by chemicals, radiations, and environmental pollutants. For some chemicals, the Pisum assay is not as sensitive in assessing clastogenicity as the Allium assay, although this should be considered in relative terms. Pisum fulvum (2n=14) has been used in clastogenic studies also, but to a much lesser extent. PMID:11344039

  4. Effect of TDZ on plant regeneration from mature seeds in pea (Pisum sativum)

    NARCIS (Netherlands)

    Shan, Zhihui; Tzitzikas, E.; Raemakers, C.J.J.M.; Zhengqiang, M.; Visser, R.G.F.


    Pea (Pisum sativum L. cv. Espace) seeds directly cultured on thidiazuron (TDZ)-containing medium formed high numbers of shoots. The number of shoots per seedling depended on the concentration and duration of the TDZ treatment. The best treatment was 12-wk incubation on MS medium supplemented with 4

  5. Effect of exogenous flavonoids on nodulation of pea (Pisum sativum L.)

    Czech Academy of Sciences Publication Activity Database

    Novák, Karel; Chovanec, Pavel; Škrdleta, Vladimír; Kropáčová, M.; Lisá, Ludmila; Němcová, M.


    Roč. 53, č. 375 (2002), s. 1735-1745. ISSN 0022-0957 R&D Projects: GA ČR GA521/00/0937 Institutional research plan: CEZ:AV0Z5020903 Keywords : flavonoids * nod gene * pisum Subject RIV: EE - Microbiology, Virology Impact factor: 2.852, year: 2002

  6. Cultivar and Rhizobium Strain Effects on the Symbiotic Performance of Pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Skøt, Leif


    The symbiotic performance of four pea (Pisum sativum L.) cultivars in combination with each of four strains of Rhizobium leguminosarum was studied in growth chamber experiments in order to estimate the effects of cultivars, strains and cultivar × strain interaction on the variation in dry weight, N...

  7. Towards crystallization of the photosystem II reaction center from Pisum sativum

    Czech Academy of Sciences Publication Activity Database

    Kutá-Smatanová, Ivana; Šáchová, Marie; Vácha, František

    Heraklion : FESPP, 2002. s. 449. [13th Congress of the Federation of European Societies of Plant Physiology. 02.09.2002-06.09.2002, Hersonissos] R&D Projects: GA MŠk LN00A141; GA ČR GA206/00/D007 Keywords : photosystem II * Pisum sativum Subject RIV: ED - Physiology

  8. Pisum sativum L., 1753 - hrách setý

    Czech Academy of Sciences Publication Activity Database

    Kořínková, Dana

    Praha : ČSOP, 2006 - (Mlíkovský, J.; Stýblo, P.), s. 145-145 ISBN 80-86770-17-6 Grant ostatní: GA MŽP(CZ) SM/6/37/04 Institutional research plan: CEZ:AV0Z60050516 Keywords : Pisum sativum * distribution * invasibility Subject RIV: EF - Botanics

  9. Age-dependent variation in membrane lipid synthesis in leaves of garden pea (Pisum sativum L.)

    DEFF Research Database (Denmark)

    Hellgren, Lars; Sandelius, A.S.


    To study membrane lipid synthesis during the lifespan of a dicotyledon leaf, the second oldest leaf of 10-40-d-old plants of garden pea (Pisum sativum L.) was labelled with [1-C- 14]acetate and the distribution of radioactivity between the major membrane lipids was followed for 3 d. In the...

  10. Danish Rhizobium leguminosarum strains nodulating ‘Afghanistan’ pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Jensen, Erik Steen; Sørensen, Lasse Holst; Engvild, Kjeld Christensen


    A wild pea (Pisum sativum L.) native to Afghanistan normally known to be resisant to nodulation with European strains of Rhizobium leguminosarum was nodulated early and effectively in field soil in Denmark. Isolates from nodules formed effective nodules abundantly on 'Afghanistan' on reinfection...

  11. Characterization of Stowaway MITEs in pea (Pisum sativum L.) and identification of their potential master elements

    Czech Academy of Sciences Publication Activity Database

    Macas, Jiří; Koblížková, Andrea; Neumann, Pavel


    Roč. 48, - (2005), s. 831-839. ISSN 0831-2796 R&D Projects: GA ČR(CZ) GA521/03/0595; GA ČR(CZ) GA521/00/0655 Institutional research plan: CEZ:AV0Z50510513 Keywords : genome * Pisum sativum L. Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.070, year: 2005

  12. Danish Rhizobium leguminosarum strains nodulating ‘Afghanistan’ pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Jensen, Erik Steen; Sørensen, Lasse Holst; Engvild, Kjeld Christensen


    A wild pea (Pisum sativum L.) native to Afghanistan normally known to be resisant to nodulation with European strains of Rhizobium leguminosarum was nodulated early and effectively in field soil in Denmark. Isolates from nodules formed effective nodules abundantly on 'Afghanistan' on reinfection...... pattern with Rhizobium leguminosarum strains isolated from a modern pea variety cultivated in the same field....

  13. Aphids (Homoptera, Aphidodea inhabiting the trees Crataegus x media Bechst. in the urban green area. Part II. Domination and frequency of aphids, their enemies and the damage caused by aphids

    Directory of Open Access Journals (Sweden)

    Aneta Sławińska


    Full Text Available The studies were conducted in Lublin in the years 1999-2001 in two sites (street and park ones on the trees Crataegus x inedia Bechst. The purpose was to determine the domination and frequency of particular aphid species, their effect on the decorative character of plants as well as the occurrence of the aphidophagous in aphid colonies. It was found out that A. pomi was the dominating species in both sites. The decorative character of the studied trees was lowered by aphids A. pomi and aphids from the genus Dysaphis. Aphids from the genus Dysaphis also caused changes in the chemical composition of the injured plant parts. The presence of predatory arthropods was observed in aphid colonies occurring on hawthorn. The most numerous of these were the larvae of Syrphidae and Coccinellidae. The culture of parasitized aphids gave numerous flights of parasitoids and hyperparasitoids. Greater number of both predators and parasitoids of I and II grades were observed in the street site as compared to the park site.


    Institute of Scientific and Technical Information of China (English)

    MingGan; De-ChengDing; Xue-xiaMiao


    To evaluate the role of bacterial symbionts ( Buchnera spp. ) in the black bean aphids ( Aphis craccivora Koch), the aphids were treated with the antibiotic, rifampicin, to eliminate their intracellular symbiotic bacteria. Analysis of protein and amino acid concentration in 7-day-old of aposymbiotic aphids showed that the total protein content per mg fresh weight was significantly reduced by 29 %, but free amino acid titers were increased by 17% . The ratio of the essential amino acids was in general only around 20% essential amino acids in phloem sap of broad bean, whereas it was 44% and 37% in symbiotic and aposymbiotic aphids, respectively,suggesting that the composition of the free amino acids was unbalanced. For example, the essential amino acid,threonine represented 21. 6% of essential amino acids in symbiotic aphids, but it was only 16.7% in aposymbiotic aphids. Likewise, two nonessential amino acids, tyrosine and serine, represented 8.9% and 5.6% of total amino acids in symbiontic aphids, respectively, but they enhanced to 21.1% and 13.6% in aposymbiotic aphids. It seems likely that the elevated free amino acid concentration in aposymbiotic aphids was caused by the limited protein anabolism as the result of the unbalanced amino acid composition.

  15. Preacondicionamiento de la Semilla de Arveja (Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Henao Omar A


    Full Text Available En el Centro de Investigación "La selva ", de la Corporación Colombiana de Investigación Agropecuaria. CORPOICA, ubicado en Rionegro, Antioquia. a 2120 msnm, con una temperatura promedio de 17 °C y perteneciente a la formación ecológica Bosque Húmedo Montano Bajo, se llevó a cabo un estudio con la especie arveja (Pisum sativum L., con el fin de evaluar el efecto del tratamiento de preacondicionamiento de las semillas, conocido como humedecimiento-secado, sobre la germinación, la emergencia y el establecimiento de plantas. Adicionalmente se evaluó el procedimiento con diferentes concentraciones del fungicida sistémico benomyl, en comparación con agua destilada, buscándose reducir la pérdida de plantas durante el período de establecimiento del cultivo, y se midió el efecto de los tratamientos con y sin fungicida sobre el rendimiento, en comparación con plantas provenientes de semilla no preacondicionada. A nivel de laboratorio se encontró que el tratamiento que produjo mayor velocidad de germinación fué la imbibición hasta el 75% de peso de la semilla, con secado posterior hasta recobrar el peso inicial. Utilizando el tratamiento anterior, se halló que la adición de benomyl, en diferentes concentraciones, no afectó la velocidad de germinación ni la germinación total, incrementándose el porcentaje de plantas sanas obtenidas en comparación con el preacondicionamiento sin fungicida, con valores máximos al imbibir con una solución de benomyl al 0.1%. En el campo no se observó efecto de los tratamientos de preacondicionamiento con y sin fungicida sobre la velocidad de emergencia y la emergencia total, reduciendo los tratamientos con fungicida la incidencia de plantas muertas en forma sensible con una respuesta diferencial en rendimiento, por parte de las dos variedades estudiadas, al aplicar los diversos procedimientos de preacondicionamiento. Así, mientras que con el cultivar 'Small Sieve All Sweet ', no hubo efecto

  16. NDVI to Detect Sugarcane Aphid Injury to Grain Sorghum. (United States)

    Elliott, N C; Backoulou, G F; Brewer, M J; Giles, K L


    Multispectral remote sensing has potential to provide quick and inexpensive information on sugarcane aphid, Melanaphis sacchari (Zehntner), pest status in sorghum fields. We describe a study conducted to determine if injury caused by sugarcane aphid to sorghum plants in fields of grain sorghum could be detected using multispectral remote sensing from a fixed wing aircraft. A study was conducted in commercial grain sorghum fields in the Texas Gulf Coast region in June 2014. Twenty-six commercial grain sorghum fields were selected and rated for the level of injury to sorghum plants in the field caused by sugarcane aphid. Plant growth stage ranged from 5.0 (watery ripe) to 7.0 (hard dough) among fields; and plant injury rating from sugarcane aphid ranged from 1.0 (little or no injury) to 4.0 (>40% of plants displaying injury) among fields. The normalized differenced vegetation index (NDVI) is calculated from light reflectance in the red and near-infrared wavelength bands in multispectral imagery and is a common index of plant stress. High NDVI indicates low levels of stress and low NDVI indicates high stress. NDVI ranged from -0.07 to 0.26 among fields. The correlation between NDVI and plant injury rating was negative and significant, as was the correlation between NDVI and plant growth stage. The negative correlation of NDVI with injury rating indicated that plant stress increased with increasing plant injury. Reduced NDVI with increasing plant growth probably resulted from reduced photosynthetic activity in more mature plants. The correlation between plant injury rating and plant growth stage was positive and significant indicating that plant injury from sugarcane aphid increased as plants matured. The partial correlation of NDVI with plant injury rating was negative and significant indicating that NDVI decreased with increasing plant injury after adjusting for its association with plant growth stage. We demonstrated that remotely sensed imagery acquired from grain


    Kang, Xin-Le; Zhang, Meng; Wang, Kang; Qiao, Xian-Feng; Chen, Mao-Hua


    The ATP-binding cassette (ABC) transporters are important transmembrane proteins encoded by a supergene family. The majority of ABC proteins are primary active transporters that bind and hydrolyze ATP to mediate the efflux of a diverse range of substrates across lipid membranes. In this study, we cloned and characterized a putative multidrug resistance associated protein 1 (MRP1) from Rhopalosiphum padi encoded by ABCC1. Structural analysis showed that this protein has structural features typical of the ABC transporter family. Phylogenetic analysis indicated that the amino acid sequence was highly similar that of the corresponding protein from Acyrthosiphon pisum. Real-time quantitative polymerase chain reaction (PCR) analysis showed that ABCC1 was expressed throughout all R. padi developmental stages, with the highest level of expression in the fourth larval instar. We also examined ABCC1 expression in four different tissue types and found that it was most highly expressed in the midgut. Exposing R. padi to imidacloprid and chlorpyrifos increased ABCC1 expression. Furthermore, ABCC1 expression was higher in the imidacloprid-resistant (IR) and chlorpyrifos-resistant (CR) strains than in an insecticide-susceptible strain (SS) of R. padi. Exposing R. padi to verapamil in combination with insecticides significantly increased the toxicity of the insecticides. The respective synergy factor of CR and IR R. padi strain was 1.33 and 1.26, which was lower than that (2.72 and 1.64, respectively) of the SS. Our results clarify the biological function of ABCC1 in R. padi, particularly its role in insecticide resistance, and suggest novel strategies for pest management that use ABC transporter inhibitors to increase the effectiveness of insecticides. PMID:27110952

  18. NCBI nr-aa BLAST: CBRC-VPAC-01-0194 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available yltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ67332.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine... N-acyltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002923480.1 0.58 29% ... ...CBRC-VPAC-01-0194 ref|YP_002923480.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine N-ac

  19. UniProt search blastx result: AK288506 [KOME

    Lifescience Database Archive (English)

    Full Text Available .99.5) (NADH dehydrogenase I subunit G) (NDH-1 subunit G) - Buchnera aphidicola subsp. Acyrthosiphon pisum (Acyrthosiphon pisum symbiotic bacterium) 0 ... ...AK288506 J090042C01 P57257|NUOG_BUCAI NADH-quinone oxidoreductase subunit G (EC 1.6

  20. NCBI nr-aa BLAST: CBRC-VPAC-01-0381 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available yltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ67332.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine... N-acyltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002923480.1 0.76 28% ... ...CBRC-VPAC-01-0381 ref|YP_002923480.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine N-ac

  1. NCBI nr-aa BLAST: CBRC-TTRU-01-1371 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndent protein export [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ68339.1| twin-arginine... translocase subunit, sec-independent protein export [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002924487.1 0.89 24% ... ...CBRC-TTRU-01-1371 ref|YP_002924487.1| twin-arginine translocase subunit, sec-indepe

  2. UniProt search blastx result: AK288641 [KOME

    Lifescience Database Archive (English)

    Full Text Available .99.5) (NADH dehydrogenase I subunit L) (NDH-1 subunit L) - Buchnera aphidicola subsp. Acyrthosiphon pisum (Acyrthosiphon pisum symbiotic bacterium) 2.00E-51 ... ...AK288641 J090056C13 P57262|NUOL_BUCAI NADH-quinone oxidoreductase subunit L (EC 1.6

  3. NCBI nr-aa BLAST: CBRC-MDOM-11-0019 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available (LIV-II) (LIVCS family) [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ67379.1| branched...-chain amino acid transport system II (LIV-II) (LIVCS family) [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002923527.1 4.1 29% ...

  4. The Potato Aphid Salivary Effector Me47 Is a Glutathione-S-Transferase Involved in Modifying Plant Responses to Aphid Infestation (United States)

    Kettles, Graeme J.; Kaloshian, Isgouhi


    Polyphagous aphid pests cause considerable economic damage to crop plants, primarily through the depletion of photoassimilates and transfer of viruses. The potato aphid (Macrosiphum euphorbiae) is a notable pest of solanaceous crops, however, the molecular mechanisms that underpin the ability to colonize these hosts are unknown. It has recently been demonstrated that like other aphid species, M. euphorbiae injects a battery of salivary proteins into host plants during feeding. It is speculated that these proteins function in a manner analagous to secreted effectors from phytopathogenic bacteria, fungi and oomycetes. Here, we describe a novel aphid effector (Me47) which was identified from the potato aphid salivary secretome as a putative glutathione-S-transferase (GST). Expression of Me47 in Nicotiana benthamiana enhanced reproductive performance of green peach aphid (Myzus persicae). Similarly, delivery of Me47 into leaves of tomato (Solanum lycopersicum) by Pseudomonas spp. enhanced potato aphid fecundity. In contrast, delivery of Me47 into Arabidopsis thaliana reduced GPA reproductive performance, indicating that Me47 impacts the outcome of plant–aphid interactions differently depending on the host species. Delivery of Me47 by the non-pathogenic Pseudomonas fluorescens revealed that Me47 protein or activity triggers defense gene transcriptional upregulation in tomato but not Arabidopsis. Recombinant Me47 was purified and demonstrated to have GST activity against two specific isothiocyanates (ITCs), compounds implicated in herbivore defense. Whilst GSTs have previously been associated with development of aphid resistance to synthetic insecticides, the findings described here highlight a novel function as both an elicitor and suppressor of plant defense when delivered into host tissues.

  5. The Process of Aphid Egg-Laying and the Little Known Role of the Coccinellidae in Aphid Egg Destruction in Poland – Preliminary Results

    Directory of Open Access Journals (Sweden)

    Lubiarz Magdalena


    Full Text Available No detailed studies have been conducted in Poland with regard to aphid eggs or egg survival in particular. So far, no studies have been conducted concerning the role of ladybird beetles in reducing the number of aphid eggs in spring, before the development of leaves, and in autumn, after the leaves have been shed. At these times, other developmental stages of aphids are unavailable as food for the ladybirds. The paper presents the preliminary results of a three-year study on the process of aphid egg-laying (especially Chaetosiphon tetrarhodum, Macrosiphum rosae, Metopolophium dirhodum, and Maculolachnus submacula. The paper also deals with the little known role of ladybirds in aphid egg destruction. Research was conducted in Otrębusy (Western Mazovia, Poland, in the years 2008-2010, on the rugosa rose and on the dog rose. In the years 2011-2013, in Otrębusy, the occurrence of M. submacula was also observed on the ornamental grandiflora rose. Furthermore, in the years 2003-2004, observations were conducted on the pedunculate oak in Polesie National Park and in the town of Puławy (Lublin Region, Poland. The observations which took place in Puławy focused on egglaying of aphids representing the genera Phylloxera and Lachnus. The study investigated aphid oviposition sites. Data was collected on the number of aphid eggs noted on the studied plants. The study also showed, that sometimes winter eggs of aphids could provide nutrition for ladybirds. This was especially true in autumn when ladybird beetles were preparing for hibernation.

  6. The Potato Aphid Salivary Effector Me47 Is a Glutathione-S-Transferase Involved in Modifying Plant Responses to Aphid Infestation. (United States)

    Kettles, Graeme J; Kaloshian, Isgouhi


    Polyphagous aphid pests cause considerable economic damage to crop plants, primarily through the depletion of photoassimilates and transfer of viruses. The potato aphid (Macrosiphum euphorbiae) is a notable pest of solanaceous crops, however, the molecular mechanisms that underpin the ability to colonize these hosts are unknown. It has recently been demonstrated that like other aphid species, M. euphorbiae injects a battery of salivary proteins into host plants during feeding. It is speculated that these proteins function in a manner analagous to secreted effectors from phytopathogenic bacteria, fungi and oomycetes. Here, we describe a novel aphid effector (Me47) which was identified from the potato aphid salivary secretome as a putative glutathione-S-transferase (GST). Expression of Me47 in Nicotiana benthamiana enhanced reproductive performance of green peach aphid (Myzus persicae). Similarly, delivery of Me47 into leaves of tomato (Solanum lycopersicum) by Pseudomonas spp. enhanced potato aphid fecundity. In contrast, delivery of Me47 into Arabidopsis thaliana reduced GPA reproductive performance, indicating that Me47 impacts the outcome of plant-aphid interactions differently depending on the host species. Delivery of Me47 by the non-pathogenic Pseudomonas fluorescens revealed that Me47 protein or activity triggers defense gene transcriptional upregulation in tomato but not Arabidopsis. Recombinant Me47 was purified and demonstrated to have GST activity against two specific isothiocyanates (ITCs), compounds implicated in herbivore defense. Whilst GSTs have previously been associated with development of aphid resistance to synthetic insecticides, the findings described here highlight a novel function as both an elicitor and suppressor of plant defense when delivered into host tissues. PMID:27536306

  7. Host Plant Specialization in the Sugarcane Aphid Melanaphis sacchari.

    Directory of Open Access Journals (Sweden)

    Samuel Nibouche

    Full Text Available Most aphids are highly specialized on one or two related plant species and generalist species often include sympatric populations adapted to different host plants. Our aim was to test the hypothesis of the existence of host specialized lineages of the aphid Melanaphis sacchari in Reunion Island. To this end, we investigated the genetic diversity of the aphid and its association with host plants by analyzing the effect of wild sorghum Sorghum bicolor subsp. verticilliflorum or sugarcane as host plants on the genetic structuring of populations and by performing laboratory host transfer experiments to detect trade-offs in host use. Genotyping of 31 samples with 10 microsatellite loci enabled identification of 13 multilocus genotypes (MLG. Three of these, Ms11, Ms16 and Ms15, were the most frequent ones. The genetic structure of the populations was linked to the host plants. Ms11 and Ms16 were significantly more frequently observed on sugarcane, while Ms15 was almost exclusively collected in colonies on wild sorghum. Laboratory transfer experiments demonstrated the existence of fitness trade-offs. An Ms11 isofemale lineage performed better on sugarcane than on sorghum, whereas an Ms15 lineage developed very poorly on sugarcane, and two Ms16 lineages showed no significant difference in performances between both hosts. Both field and laboratory results support the existence of host plant specialization in M. sacchari in Reunion Island, despite low genetic differentiation. This study illustrates the ability of asexual aphid lineages to rapidly undergo adaptive changes including shifting from one host plant to another.

  8. Orange oil effect in the control of fennel aphid

    Directory of Open Access Journals (Sweden)

    Ivanildo Cavalcanti de Albuquerque


    Full Text Available In the properties where fennel is grown, in the states of Bahia, Sergipe, Pernambuco and Paraiba, at the Northeast of Brazil, a high rate of usage of pesticides in the crop, aiming to control the aphid Hyadaphis foeniculi. The purpose of this study was to evaluate the effect of orange oil Prev-Am (sodium tetraborohydrate decahydrate, in the control of H. foeniculi aphid of the fennel crop. The trial was conducted in a fennel field located in Lagoa Seca Experimental Station, belonging to the EMEPA-PB. Forty-eight hours after the product has been sprayed, one flower of the umbel was collected and removed her aphids, which were placed in a "petri" plate from 9cm in diameter. As a following step, the insects were counted as part of two groups, considering the number of insects dead and alive, being tabulated for later analysis. The data were subjected to analysis of variance, using the experimental design of randomized blocks composed of six treatments (doses of 0.3, 0.4, 0.5, 0.6, 0.7% of orange oil (Prev-am and pure water as check, with five repetitions. The data were submitted to the regression analysis. The orange oil (Prev-am controls effectively H. foeniculi at the concentration of 0.3%, increasing the control up to concentrations of 0.6 and 0.7%. The product does not kill ladybugs (Cycloneda sanguinea and can be used in programs for integrated pest management.Keywords: Foeniculum vulgare, aphid, vegetable oil, ladybug, umbel.

  9. Theoretical and experimental studies on behavioral syndromes in aphids


    Simon, Franz Wesley


    Individuals’ behaviors can be correlated across time and contexts, in a phenomenon now known as behavioral syndromes. Using an experimental approach, I demonstrate that genetically identical pea aphids are highly repeatable in multiple behavioral traits, however these behaviors are uncorrelated. Then using a state variable model I show that asymmetries in size can maintain a hierarchy between least and most bold individuals in foraging intensity across development. However, individuals tha...

  10. The genetic diversity and evolution of field pea (Pisum studied by high throughput retrotransposon based insertion polymorphism (RBIP marker analysis

    Directory of Open Access Journals (Sweden)

    Smýkal Petr


    Full Text Available Abstract Background The genetic diversity of crop species is the result of natural selection on the wild progenitor and human intervention by ancient and modern farmers and breeders. The genomes of modern cultivars, old cultivated landraces, ecotypes and wild relatives reflect the effects of these forces and provide insights into germplasm structural diversity, the geographical dimension to species diversity and the process of domestication of wild organisms. This issue is also of great practical importance for crop improvement because wild germplasm represents a rich potential source of useful under-exploited alleles or allele combinations. The aim of the present study was to analyse a major Pisum germplasm collection to gain a broad understanding of the diversity and evolution of Pisum and provide a new rational framework for designing germplasm core collections of the genus. Results 3020 Pisum germplasm samples from the John Innes Pisum germplasm collection were genotyped for 45 retrotransposon based insertion polymorphism (RBIP markers by the Tagged Array Marker (TAM method. The data set was stored in a purpose-built Germinate relational database and analysed by both principal coordinate analysis and a nested application of the Structure program which yielded substantially similar but complementary views of the diversity of the genus Pisum. Structure revealed three Groups (1-3 corresponding approximately to landrace, cultivar and wild Pisum respectively, which were resolved by nested Structure analysis into 14 Sub-Groups, many of which correlate with taxonomic sub-divisions of Pisum, domestication related phenotypic traits and/or restricted geographical locations. Genetic distances calculated between these Sub-Groups are broadly supported by principal coordinate analysis and these, together with the trait and geographical data, were used to infer a detailed model for the domestication of Pisum. Conclusions These data provide a clear picture

  11. The Process of Aphid Egg-Laying and the Little Known Role of the Coccinellidae in Aphid Egg Destruction in Poland – Preliminary Results


    Lubiarz Magdalena; Cichocka Elżbieta


    No detailed studies have been conducted in Poland with regard to aphid eggs or egg survival in particular. So far, no studies have been conducted concerning the role of ladybird beetles in reducing the number of aphid eggs in spring, before the development of leaves, and in autumn, after the leaves have been shed. At these times, other developmental stages of aphids are unavailable as food for the ladybirds. The paper presents the preliminary results of a three-year study on the process of ap...


    Directory of Open Access Journals (Sweden)

    Maltsev Ye. I.


    Full Text Available We investigated the positive impact of cultures cyanobacteria genus Nostoc Vaucher ex Bornet et Flahault on growth and development of higher plants as an example Pisum sativum L. All the Nostoc species have a positive effect on the viability, germination energy, and biometric characteristics of Pisum sativum. The greatest positive influence was registered for N. entophytum Born. et. Flah. and N. linckia (Roth Bornetet Flahault f. linckia.

  13. Aphidoletes aphidimyza oviposition behaviour when multiple aphid pests are present in the greenhouse (United States)

    The generalist aphid predator Aphidoletes aphidimyza was investigated for oviposition behaviour on the pest aphids Myzus persicae and Aulacorthum solani in greenhouse trials. Oviposition was significantly lower on A. solani than M. persicae. Myzus persicae were concentrated at the growing points of ...

  14. GroEL from the endosymbiont Buchnera aphidicola betrays the aphid by triggering plant defense. (United States)

    Chaudhary, Ritu; Atamian, Hagop S; Shen, Zhouxin; Briggs, Steven P; Kaloshian, Isgouhi


    Aphids are sap-feeding plant pests and harbor the endosymbiont Buchnera aphidicola, which is essential for their fecundity and survival. During plant penetration and feeding, aphids secrete saliva that contains proteins predicted to alter plant defenses and metabolism. Plants recognize microbe-associated molecular patterns and induce pattern-triggered immunity (PTI). No aphid-associated molecular pattern has yet been identified. By mass spectrometry, we identified in saliva from potato aphids (Macrosiphum euphorbiae) 105 proteins, some of which originated from Buchnera, including the chaperonin GroEL. Because GroEL is a widely conserved bacterial protein with an essential function, we tested its role in PTI. Applying or infiltrating GroEL onto Arabidopsis (Arabidopsis thaliana) leaves induced oxidative burst and expression of PTI early marker genes. These GroEL-induced defense responses required the known coreceptor BRASSINOSTEROID INSENSITIVE 1-ASSOCIATED RECEPTOR KINASE 1. In addition, in transgenic Arabidopsis plants, inducible expression of groEL activated PTI marker gene expression. Moreover, Arabidopsis plants expressing groEL displayed reduced fecundity of the green peach aphid (Myzus persicae), indicating enhanced resistance against aphids. Furthermore, delivery of GroEL into tomato (Solanum lycopersicum) or Arabidopsis through Pseudomonas fluorescens, engineered to express the type III secretion system, also reduced potato aphid and green peach aphid fecundity, respectively. Collectively our data indicate that GroEL is a molecular pattern that triggers PTI. PMID:24927572

  15. Soybean Aphid Infestation Induces Changes in Fatty Acid Metabolism in Soybean.

    Directory of Open Access Journals (Sweden)

    Charles Kanobe

    Full Text Available The soybean aphid (Aphis glycines Matsumura is one of the most important insect pests of soybeans in the North-central region of the US. It has been hypothesized that aphids avoid effective defenses by inhibition of jasmonate-regulated plant responses. Given the role fatty acids play in jasmonate-induced plant defenses, we analyzed the fatty acid profile of soybean leaves and seeds from aphid-infested plants. Aphid infestation reduced levels of polyunsaturated fatty acids in leaves with a concomitant increase in palmitic acid. In seeds, a reduction in polyunsaturated fatty acids was associated with an increase in stearic acid and oleic acid. Soybean plants challenged with the brown stem rot fungus or with soybean cyst nematodes did not present changes in fatty acid levels in leaves or seeds, indicating that the changes induced by aphids are not a general response to pests. One of the polyunsaturated fatty acids, linolenic acid, is the precursor of jasmonate; thus, these changes in fatty acid metabolism may be examples of "metabolic hijacking" by the aphid to avoid the induction of effective defenses. Based on the changes in fatty acid levels observed in seeds and leaves, we hypothesize that aphids potentially induce interference in the fatty acid desaturation pathway, likely reducing FAD2 and FAD6 activity that leads to a reduction in polyunsaturated fatty acids. Our data support the idea that aphids block jasmonate-dependent defenses by reduction of the hormone precursor.

  16. Life history and morphological plasticity of three biotypes of soybean aphid (Aphis glycines) (United States)

    The soybean aphid, Aphis glycines Matsumura (Hemiptera: Aphididae), is a pest of soybean, Glycine max (L.) Merr. (Fabaceae), from eastern Asia that was first reported in North America in 2000. The influence of temperature on plasticity of life history and morphological traits of the soybean aphid ha...

  17. The Effects of Aphid Traits on Parasitoid Host Use and Specialist Advantage (United States)

    Gagic, Vesna; Petrović-Obradović, Olivera; Fründ, Jochen; Kavallieratos, Nickolas G.; Athanassiou, Christos G.; Starý, Petr; Tomanović, Željko


    Specialization is a central concept in ecology and one of the fundamental properties of parasitoids. Highly specialized parasitoids tend to be more efficient in host-use compared to generalized parasitoids, presumably owing to the trade-off between host range and host-use efficiency. However, it remains unknown how parasitoid host specificity and host-use depends on host traits related to susceptibility to parasitoid attack. To address this question, we used data from a 13-year survey of interactions among 142 aphid and 75 parasitoid species in nine European countries. We found that only aphid traits related to local resource characteristics seem to influence the trade-off between host-range and efficiency: more specialized parasitoids had an apparent advantage (higher abundance on shared hosts) on aphids with sparse colonies, ant-attendance and without concealment, and this was more evident when host relatedness was included in calculation of parasitoid specificity. More traits influenced average assemblage specialization, which was highest in aphids that are monophagous, monoecious, large, highly mobile (easily drop from a plant), without myrmecophily, habitat specialists, inhabit non-agricultural habitats and have sparse colonies. Differences in aphid wax production did not influence parasitoid host specificity and host-use. Our study is the first step in identifying host traits important for aphid parasitoid host specificity and host-use and improves our understanding of bottom-up effects of aphid traits on aphid-parasitoid food web structure. PMID:27309729

  18. Relationships Between Aphids (Insecta: Homoptera: Aphididae) and Slugs (Gastropoda: Stylommatophora: Agriolimacidae) Pests of Legumes (Fabaceae: Lupinus). (United States)

    Kozłowski, Jan; Strażyński, Przemysław; Jaskulska, Monika; Kozłowska, Maria


    Lupin plants are frequently damaged by various herbivorous invertebrates. Significant among these are slugs and aphids, which sometimes attack the same plants. Relationships between aphids, slugs and food plant are very interesting. Grazing by these pests on young plants can lead to significant yield losses. There is evidence that the alkaloids present in some lupin plants may reduce grazing by slugs, aphids and other invertebrates. In laboratory study was analyzed the relationships between aphid Aphis craccivora and slug Deroceras reticulatum pests of legumes Lupinus angustifolius. It was found that the presence of aphids significantly reduced slug grazing on the plants. The lupin cultivars with high alkaloid content were found to be less heavily damaged by D. reticulatum, and the development of A. craccivora was found to be inhibited on such plants. PMID:27324580

  19. Reliable screening technique for evaluation of wild crucifers against mustard aphid Lipaphis erysimi (Kalt.). (United States)

    Singh, S P; Kumar, Sandeep; Singh, Y P; Singh, Ram


    Wild crucifers namely Arabidopsis thaliana, Brassica fruticulosa, B. rugosa, B. spinescens, B. tournefortii, Camelina sativa, Capsella bursa-pastoris, Crambe abysinnica, Cronopus didymus, Diplotaxis assurgens, D. gomez-campoi, D. muralis, D. siettiana, D. tenuisiliqua, Enatharocarpus lyratus, Lepidium sativum and Sinapis alba along with five cultivated Brassica species including B. rapa (BSH-1), B. juncea (Rohini), B. napus (GSC-6), B. carinata (DLSC-2) and Eruca sativa (T-27) were screened against mustard aphid Lipaphis erysimi (Kalt.) with a standardized technique under definite level of aphid pressure developed using specially designed cages. Observations have revealed that B. fruticulosa, B. spinescens, Camelina sativa, Crambe abysinnica and Lepidium sativum were resistant to mustard aphid L. erysimi with aphid infestation index (AII) ≤ 1. Capsella bursa-pastoris was highly susceptible to bean aphid, Aphis fabae during its vegetative stage (with 100% mortality). Other genotypes were found in the range of 'susceptible' to 'highly susceptible' with AII ranging 3-5. PMID:25651614

  20. Weather, cultivar and density-dependent processes influence on aphid in alfalfa Influência do clima, da cultivar e de processos dependentes da densidade sobre afídeos em alfafa

    Directory of Open Access Journals (Sweden)

    Alexandre de Almeida e Silva


    Full Text Available It is important to understand the effects of weather, insect density and plant cultivar on insect abundance to predict and prevent crop production loss. The present work investigated the influence of such factors on aphid in alfalfa during one year (short term. Data was collected from September/1997 to August/1998 at Canchin Farm (CCPSE-EMBRAPA, São Carlos, State of São Paulo, Brazil. Weather conditions had, in general, little effect on the variation of aphid populations, but Therioaphis maculata abundance was negatively correlated to humidity. Moreover, high maximum temperatures and low levels of rainfall possible favored T. maculata high abundance on Crioula and P3 cultivars. Therefore, appropriate management of this species is required during hot and dry periods. Population variation of Acyrthosiphon spp., T. maculata and Aphis craccivora seems to be regulated by density dependent processes. Resistant cultivar CUF 101 had a lower abundance of T. maculata and A. craccivora and a narrower population variation than the other cultivars and may reduce their abundance on field. Long-term studies on population dynamics including the effect of climatic conditions and density-dependent factors on plant quality will contribute to pest management in alfalfa fields.É importante entender os efeitos do clima, da densidade dos insetos e da cultivar sobre a abundância de insetos para se predizer e prevenir perdas na produção das culturas. O objetivo do presente trabalho foi analisar a influência desses fatores sobre afídeos em alfafa no período de um ano. Os dados foram coletados de setembro/1997 a agosto/1998 na Fazenda Canchin (CPPSE-EMBRAPA, São Carlos, São Paulo, Brasil. As condições climáticas, em geral, tiveram pequeno efeito sobre a variação populacional dos afídeos, mas a abundância de Therioaphis maculata esteve negativamente correlacionada à umidade. Além disso, as altas temperaturas máximas e os baixos níveis de precipita

  1. Impact of dyeing industry effluent on germination and growth of pea (Pisum sativum). (United States)

    Malaviya, Piyush; Hali, Rajesh; Sharma, Neeru


    Dye industry effluent was analyzed for physico-chemical characteristics and its impact on germination and growth behaviour of Pea (Pisum sativum). The 100% effluent showed high pH (10.3) and TDS (1088 mg l(-1)). The germination parameters included percent germination, delay index, speed of germination, peak value and germination period while growth parameters comprised of root and shoot length, root and shootweight, root-shoot ratio and number of stipules. The study showed the maximum values of positive germination parameters viz. speed of germination (7.85), peak value (3.28), germination index (123.87) and all growth parameters at 20% effluent concentration while the values of negative germination parameters viz. delay index (-0.14) and percent inhibition (-8.34) were found to be minimum at 20% effluent concentration. The study demonstrated that at lower concentrations the dyeing industry effluent caused a positive impact on germination and growth of Pisum sativum. PMID:23741804

  2. Linkages in Pisum L. Pt. 7. Locus for the sterile gene calf (cabbage leaf)

    International Nuclear Information System (INIS)

    The recessive, pleiotropic gene calf, artificially induced was described by Sharma in 1975. An identical mutant gene at the same locus was isolated in this research. Two lines were included in the Pisum gene bank - the type line for the gene calf - Wt 15873 and the representative line - Wt 16024. In linkage studies the representative line was crossed with tester lines bearing gene markers. Analyses of dihybrid segregation in F2 generations revealed linkages of the gene calf with chromosome 2 markers. Two isozymic markers helped to reveal the calf locus on chromosome 2 with the following order: Orp - Calf - K Pgm-p Fum. This is agriment with the current Pisum linkage map

  3. Parasitoid- and hyperparasitoid-mediated seasonal dynamics of the cabbage aphid (Hemiptera: Aphididae). (United States)

    Nematollahi, Mohammad Reza; Fathipour, Yaghoub; Talebi, Ali Asghar; Karimzadeh, Javad; Zalucki, Myron Philip


    The population dynamics of the cabbage aphid, Brevicoryne brassicae (L.), its parasitoid, Diaeretiella rapae McIntosh, and hyperparasitoids, Pachyneuron spp., were quantified under field conditions during 2011-2013, by examining synchronization, parasitoid: aphid ratio, possible effect of density on the finite rate of increase, and spatial coincidence. The rates of parasitism and hyperparasitism were based on rearing field-collected mummies and live parasitized aphids, and density of the aphid were estimated using heat extraction and subsampling techniques. Only one parasitoid, D. rapae (80% on average), and two hyperparasitoid species from the genus of Pachyneuron (6.5% on average), namely Pachyneuron aphidis (Bouché) and Pachyneuron groenlandicum (Holmgren), were reared from the aphid mummies. Significant Pearson's time lagged correlations for percentage parasitism versus aphid density and for percentage hyperparasitism versus mummy density indicated that 2-3 wk is needed for D. rapae and Pachyneuron spp. to show impact on their respective host's population. In early spring, the parasitoid: aphid ratio was low (0.11 on average) while aphid density was increasing. Based on Taylor's power law, D. rapae and Pachyneuron spp., as well as B. brassicae, had an aggregated distribution among canola plants. Moreover, a high degree of spatial overlap was found between D. rapae and B. brassicae and between Pachyneuron spp. and D. rapae. In general, the parasitoid had good spatial coincidence with its aphid host but because of a lack of parasitoid-host synchronization and low parasitoid: aphid ratio, impact on the host population was low. PMID:25479198

  4. Parasitization of commercially available parasitoid species against the lettuce aphid, Nasonovia ribisnigri (Hemiptera: Aphididae). (United States)

    Shrestha, G; Skovgård, H; Enkegaard, A


    The lettuce aphid, Nasonovia ribisnigri (Mosley), is an economically important pest of lettuce worldwide. Little documentation exists for the control efficacy of aphid parasitoids against N. ribisnigri. This laboratory study evaluated three commercially available parasitoid species: Aphidius colemani (Viereck), Lysiphlebus testaceipes (Cresson), and Aphelinus abdominalis (Dalman) for their mortality impact on N. ribisnigri. The green peach aphid Myzus persicae (Sulzer) was included as a reference aphid. The study showed that A. abdominalis successfully parasitized 39 and 13% of the offered N. ribisnigri and M. persicae, respectively, within a 24-h exposure period. In contrast, none of the lettuce aphids exposed to Ap. colemani or L. testaceipes were successfully parasitized, whereas 60 and 3.5% of M. persicae, respectively, were successfully parasitized within a 6-h exposure period. Lettuce aphid mortality due to incomplete parasitization was 26 and 31% when exposed to Ap. colemani and L. testaceipes, respectively, with corresponding values for M. persicae being 5 and 10%, respectively. Mortality as a result of incomplete parasitization when aphids were exposed to A. abdominalis was low for both aphid species. The total mortality inflicted by A. abdominalis within a 24-h exposure period was 51% for the lettuce aphids and significantly less (19%) for green peach aphids. In contrast, Ap. colemani inflicted a higher mortality in M. persicae (65%) compared with N. ribisnigri (26%) within a 6-h exposure period. L. testaceipes caused a greater mortality in N. ribisnigri as compared with M. persicae. This study concludes that A. abdominalis has the potential to be used against N. ribisnigri in inoculative biocontrol programs as compared with the other parasitoid species based on successful parasitization. PMID:25290653

  5. Weed Host Specificity of the Aphid, Aphis spiraecola: Developmental and Reproductive Performance of Aphids in Relation to Plant Growth and Leaf Chemicals of the Siam Weed, Chromolaena odorata


    Agarwala, B. K.; Das, Jhuma


    Density, distribution, and nutritional quality of plants are the causal basis of host plant selection in aphids. Nutritional qualities of a plant vary according to its growth stage and also in response to seasonal variation. How host plant growth stages shape aphid performance was studied in Aphis spiraecola Patch (Homoptera: Aphididae) on the perennial Siam weed, Chromolaena odorata (L.) King and Robinson (Asterales: Asteraceae). This plant species is the preferred host in the hot and humid ...

  6. Epigenetic Histone Marks of Extended Meta-Polycentric Centromeres of Lathyrus and Pisum Chromosomes


    Neumann, Pavel; Schubert, Veit; FUKOVÁ, Iva; Manning, Jasper E.; Houben, Andreas; Macas, Jiří


    Species of the legume genera Lathyrus and Pisum possess chromosomes that exhibit a unique structure of their centromeric regions, which is clearly apparent during metaphase by the formation of extended primary constrictions which span up to a third of the length of the chromosome. In addition, these species express two different variants of the CenH3 protein which are co-localized in multiple domains along the poleward surface of the primary constrictions. Here, we show that the constrictions...

  7. Long-Term Fungal Inhibition by Pisum sativum Flour Hydrolysate during Storage of Wheat Flour Bread


    Rizzello, Carlo Giuseppe; Lavecchia, Anna; Gramaglia, Valerio; Gobbetti, Marco


    In order to identify antifungal compounds from natural sources to be used as ingredients in the bakery industry, water/salt-soluble extracts (WSE) from different legume flour hydrolysates obtained by the use of a fungal protease were assayed against Penicillium roqueforti DPPMAF1. The agar diffusion assays allowed the selection of the pea (Pisum sativum) hydrolysate as the most active. As shown by the hyphal radial growth rate, the WSE had inhibitory activity towards several fungi isolated fr...

  8. Comportement agronomique d'une collection de pois (Pisum sativum L)


    M. BOUSLAMA; Rezgui, S.; Hannachi, C.; Mani, F.


    Agronomical Behaviour of a Pea Collection (Pisum sativum L.). This experience was achieved under greenhouse conditions. Twelve genotypes of pea were used (Asgrow, Jumbo, Lincoln, Merveille de Kelvedon, Purser, Rajai Torpe, Snajor Kosep, Korai,Wando, Rondo, local genotype, Major Kosep Korai and Surgevil). They were cultivated on peat during 5.5 months (from October to April). Some agronomical parameters were studied: resistance to diseases, (Powdery-mildew, mildew, top yellow virus, anthracnos...

  9. Sources of reducing equivalents for nitrite reductase in Pisum arvense roots


    Grażyna Kłobus


    Glucose-6-phosphate and NADP+ as well as malic acid and NADP+ present in the incubation mixture enhanced nitrite reductase (EC activity in Pisum arvense roots. This was manifested by a depression of the nitrite level in the tissues and an increased reduction of nitrites by plastids isolated from P. arvense roots. A marked stimulation of plastid malate dehydrogenase was also observed under the influence of nitrates present in the medium. These results suggest that pyridin nucleotides ...

  10. A single genetic locus in the phytopathogen Pantoea stewartii enables gut colonization and pathogenicity in an insect host. (United States)

    Stavrinides, John; No, Alexander; Ochman, Howard


    Aphids are typically exposed to a variety of epiphytic and phytopathogenic bacteria, many of which have entomopathogenic potential. Here we describe the interaction between Pantoea stewartii ssp. stewartii DC283 (DC283), an enteric phytopathogen and causal agent of Stewart's wilt, and the pea aphid, Acyrthosiphon pisum. When ingested by aphids, DC283 establishes and aggregates in the crop and gut, preventing honeydew flow and excretion, resulting in aphid death in 72 h. A mutagenesis screen identified a single locus, termed ucp1 (youcannot pass), whose disruption abolishes aphid pathogenicity. Moreover, the expression of ucp1 in Escherichia coli is sufficient to mediate the hindgut aggregation phenotype by this normally avirulent species. Ucp1 is related to six other proteins in the DC283 genome, each having a common N-terminal region and a divergent C-terminus, but only ucp1 has a role in pathogenicity. Based on predicted motifs and secondary structure, Ucp1 is a membrane-bound protein that functions in bacterial adhesion and promotes the formation of aggregates that are lethal to the insect host. These results illustrate that the enteric plant pathogenic bacteria have the capacity to exploit alternative non-plant hosts, and retain genetic determinants for colonizing the gut. PMID:19788413

  11. Conditional Reduction of Predation Risk Associated with a Facultative Symbiont in an Insect.

    Directory of Open Access Journals (Sweden)

    Sarah Polin

    Full Text Available Symbionts are widespread among eukaryotes and their impacts on the ecology and evolution of their hosts are meaningful. Most insects harbour obligate and facultative symbiotic bacteria that can influence their phenotype. In the pea aphid Acyrthosiphon pisum, an astounding symbiotic-mediated phenotype has been recently observed: when infected with the symbiotic bacteria Rickettsiella viridis, young red aphid larvae become greener at adulthood and even darker green when co-infected with Rickettsiella viridis and Hamiltonella defensa. As body colour affects the susceptibility towards natural enemies in aphids, the influence of the colour change due to these facultative symbionts on the host survival in presence of predators was tested. Our results suggested that the Rickettsiella viridis infection may impact positively host survival by reducing predation risk. Due to results from uninfected aphids (i.e., more green ones attacked, the main assumption is that this symbiotic infection would deter the predatory ladybird feeding by reducing the profitability of their hosts rather than decreasing host detection through body colour change. Aphids co-infected with Rickettsiella viridis and Hamiltonella defensa were, however, more exposed to predation suggesting an ecological cost associated with multiple infections. The underlying mechanisms and ecological consequences of these symbiotic effects are discussed.

  12. Effects of some Insecticides Applied in Sublethal Concentrations on the Survival and Longevity of Aphidius ervi (Haliday (Hymenoptera: Aphidiidae Adults Efecto de algunos Insecticidas Aplicados en Concentraciones Subletales en la Supervivencia y Longevidad de Adultos de Aphidius ervi (Haliday (Hymenoptera: Aphidiidae

    Directory of Open Access Journals (Sweden)

    Jaime E. Araya


    Full Text Available The effects of four insecticides (dimethoate, pirimicarb, imidacloprid, and spinosad applied in an ST4 Potter tower at sublethal concentrations (50% of those recommended commercially for aphid control were studied in the laboratory on aphidiid Aphidius ervi (Haliday adults, an important parasitoid of the pea aphid Acyrthosiphon pisum (Harris. The most selective treatment on the hymenopteran was imidacloprid, followed in decreasing order by spinosad, pirimicarb, and finally dimethoate, which quickly eliminated the parasitoid and thus its capacity to produce progeny. Three toxicity groups were distinguished in the study. The least damaging treatment to adults of A. ervi was imidacloprid, followed by a group of medium toxicity made up of spinosad and pirimicarb, and lastly dimethoate, which was extremely toxic to A. pisum.Se evaluaron en laboratorio los efectos de cuatro insecticidas (dimetoato, pirimicarb, imidacloprid, y spinosad aplicados en torre Potter ST4 en concentraciones subletales (50% de las dosis comerciales recomendadas para el control de áfidos sobre adultos del afídido Aphidius ervi Haliday, un importante parasitoide del pulgón de la arveja Acyrthosiphon pisum (Harris. El tratamiento más selectivo sobre el himenóptero fue imidacloprid, seguido en orden decreciente por spinosad, pirimicarb, y finalmente dimetoato, compuesto que eliminó rápidamente al parasitoide y su capacidad de producir descendencia. Se distinguieron tres grupos de toxicidad. El tratamiento menos dañino para los adultos de A. ervi fue imidacloprid; seguido por un grupo de selectividad media formado por spinosad y pirimicarb; y por último dimetoato, que fue extremadamente tóxico.

  13. Detoxification of Gramine by the Cereal Aphid Sitobion avenae


    Cai, Qing-Nian; Han, Ying; Cao, Ya-Zhong; Hu, Yuan; Zhao, Xin; Bi, Jian-Long


    Secondary metabolites play an important role in host plant resistance to insects, and insects, in turn, may develop mechanisms to counter plant resistance mechanisms. In this study, we investigated the toxicity of gramine to the cereal aphid Sitobion avenae and some enzymatic responses of S. avenae to this alkaloid. When S. avenae fed on an artificial diet containing gramine, mortality occurred in a dose-dependent manner. The LC50 of gramine was determined to be 1.248 mM. In response to grami...

  14. Yield response of brassica varieties/strains in relation to mustard aphid lipaphis erysimi (Kalt.)

    International Nuclear Information System (INIS)

    Nine brassica varieties/advanced lines were tested to find out the varietal comparison against mustard aphid Lipaphis erysimi (kalt.) in relation to aphid population. average number of branches/plant, average number of grains per pod and grain yield (kg/ha) during 2004-2006. Minimum aphid population was observed on promising cultivar P-20 during both years 2004-2005-06 which were 2005-06 which were 31 and 23 aphid/30 cm of apical inflorescence from randomly selected five plants respectively. This promising strain also proved significantly the highest yielder and gave 1633 kg. grains/ha (2004,05) and 817.5 kg grains/ha (2005-06) followed by SP-36 which showed aphid population 36 and 32.5 aphid/30 cm inflorescence having yield 1373 and 780 kg grains/ha during the both periods respectively under report. The other parameters viz. Average number of branches per plant and average no. of grains/pod remained non significant as far as aphid effect is concerned. (author)

  15. Nonrandom Distribution of Cabbage Aphids (Hemiptera: Aphididae) in Dryland Canola (Brassicales: Brassicaceae). (United States)

    Severtson, Dustin; Flower, Ken; Nansen, Christian


    Characterization of spatial distribution patterns of pests in large-scale agricultural fields is important because these patterns affect the sampling effort needed to accurately detect and estimate their population density. In this study, we conducted experimental releases of alate cabbage aphids (Brevicoryne brassicae L.) into centers of small plots of canola (Brassica napus L.), and their gradual spread over a 7-wk period was characterized. The small-plot experiment demonstrated gradient effects from plot centers and a nonrandom vertical distribution, with initial colonization occurring on the abaxial side of lower canopy leaves and, later, highest numbers of cabbage aphids occurring on racemes. We also conducted large-scale distribution analyses of cabbage aphid infestations in two commercial canola fields, using visual inspection and sweep net sampling. We used canola plant phenological and landscape features as explanatory variables of the spatial distribution of cabbage aphid counts. These large-scale experiments showed strong edge effects with negative associations between cabbage aphid counts and distance to crop edges, including tree lines and contour banks. Cabbage aphid distribution was more effectively displayed using logistic regression than ordinary regression, Spatial Analysis by Distance IndicEs, or both. Based on the study findings, a nonrandom or optimized inspection approach is proposed to focus monitoring efforts on canola plants within 20 m from field edges with particular attention to the abaxial side of lower-canopy leaves. Detection of advanced cabbage aphid infestations should target the racemes within 20 m from field edges. PMID:26313983

  16. Molecular interactions between wheat and cereal aphid (Sitobion avenae): analysis of changes to the wheat proteome. (United States)

    Ferry, Natalie; Stavroulakis, Stylianos; Guan, Wenzhu; Davison, Gillian M; Bell, Howard A; Weaver, Robert J; Down, Rachel E; Gatehouse, John A; Gatehouse, Angharad M R


    Aphids are major insect pests of cereal crops, acting as virus vectors as well as causing direct damage. The responses of wheat to infestation by cereal aphid (Sitobion avenae) were investigated in a proteomic analysis. Approximately, 500 protein spots were reproducibly detected in the extracts from leaves of wheat seedlings after extraction and 2-DE. Sixty-seven spots differed significantly between control and infested plants following 24 h of aphid feeding, with 27 and 11 up-regulated, and 8 and 21 down-regulated, in local or systemic tissues, respectively. After 8 days, 80 protein spots differed significantly between control and aphid treatments with 13 and 18 up-regulated and 27 and 22 down-regulated in local or systemic tissues, respectively. As positive controls, plants were treated with salicylic acid or methyl jasmonate; 81 and 37 differentially expressed protein spots, respectively, were identified for these treatments. Approximately, 50% of differentially expressed protein spots were identified by PMF, revealing that the majority of proteins altered by aphid infestation were involved in metabolic processes and photosynthesis. Other proteins identified were involved in signal transduction, stress and defence, antioxidant activity, regulatory processes, and hormone responses. Responses to aphid attack at the proteome level were broadly similar to basal non-specific defence and stress responses in wheat, with evidence of down-regulation of insect-specific defence mechanisms, in agreement with the observed lack of aphid resistance in commercial wheat lines. PMID:21500340

  17. Association between patterns in agricultural landscapes and the abundance of wheat aphids and their natural enemies

    Directory of Open Access Journals (Sweden)

    Jun-He Liu


    Full Text Available Effect of different landscape patterns on insect distribution and diversity was determined by studying wheat fields in complex and simple agricultural landscapes. We studied the influence of simple and complex agricultural landscapes on wheat aphids and their natural enemies in terms of the time of migration, abundance, population growth rate of the aphids and parasitoid abundance. The results indicate that the diversity of natural enemies is greater in the complex agricultural landscape and the effect of natural enemies on the abundance of wheat aphids was greater in the complex non-crop habitat. Wheat aphid hyperparasitoid populations differed in different agricultural landscapes with a greater number of parasites in complex agricultural landscapes. Resident times of predatory natural enemies differ in simple and complex agricultural landscapes. The number and types of predatory natural enemies are higher in complex than simple agricultural landscapes. Aphid population growth rates and the maximum population densities of wheat aphids differed significantly in simple and complex landscapes. Maximum population densities of different wheat aphids were very different in simple and complex landscape structures. The population growth rates and maximum population densities of the different predatory natural enemies and hyperparasitoids differed greatly.

  18. Differential expression of superoxide dismutase genes in aphid-stressed maize (Zea mays L. seedlings.

    Directory of Open Access Journals (Sweden)

    Hubert Sytykiewicz

    Full Text Available The aim of this study was to compare the expression patterns of superoxide dismutase genes (sod2, sod3.4, sod9 and sodB in seedling leaves of the Zea mays L. Tasty Sweet (susceptible and Ambrozja (relatively resistant cultivars infested with one of two hemipteran species, namely monophagous Sitobion avenae F. (grain aphid or oligophagous Rhopalosiphum padi L. (bird cherry-oat aphid. Secondarily, aphid-elicited alternations in the antioxidative capacity towards DPPH (1,1-diphenyl-2-picrylhydrazyl radical in insect-stressed plants were evaluated. Comprehensive comparison of expression profiles of the four sod genes showed that both insect species evoked significant upregulation of three genes sod2, sod3.4 and sod9. However, aphid infestation affected non-significant fluctuations in expression of sodB gene in seedlings of both maize genotypes. The highest levels of transcript accumulation occurred at 8 h (sod2 and sod3.4 or 24 h (sod9 post-infestation, and aphid-induced changes in the expression of sod genes were more dramatic in the Ambrozja cultivar than in the Tasty Sweet variety. Furthermore, bird cherry-oat aphid colonization had a more substantial impact on levels of DPPH radical scavenging activity in infested host seedlings than grain aphid colonization. Additionally, Ambrozja plants infested by either hemipteran species showed markedly lower antioxidative capacity compared with attacked Tasty Sweet plants.

  19. Host Plant Determines the Population Size of an Obligate Symbiont (Buchnera aphidicola) in Aphids. (United States)

    Zhang, Yuan-Chen; Cao, Wen-Jie; Zhong, Le-Rong; Godfray, H Charles J; Liu, Xiang-Dong


    Buchnera aphidicolais an obligate endosymbiont that provides aphids with several essential nutrients. Though much is known about aphid-Buchnerainteractions, the effect of the host plant onBuchnerapopulation size remains unclear. Here we used quantitative PCR (qPCR) techniques to explore the effects of the host plant onBuchneradensities in the cotton-melon aphid,Aphis gossypiiBuchneratiters were significantly higher in populations that had been reared on cucumber for over 10 years than in populations maintained on cotton for a similar length of time. Aphids collected in the wild from hibiscus and zucchini harbored moreBuchnerasymbionts than those collected from cucumber and cotton. The effect of aphid genotype on the population size ofBuchneradepended on the host plant upon which they fed. When aphids from populations maintained on cucumber or cotton were transferred to novel host plants, host survival andBuchnerapopulation size fluctuated markedly for the first two generations before becoming relatively stable in the third and later generations. Host plant extracts from cucumber, pumpkin, zucchini, and cowpea added to artificial diets led to a significant increase inBuchneratiters in the aphids from the population reared on cotton, while plant extracts from cotton and zucchini led to a decrease inBuchneratiters in the aphids reared on cucumber. Gossypol, a secondary metabolite from cotton, suppressedBuchnerapopulations in populations from both cotton and cucumber, while cucurbitacin from cucurbit plants led to higher densities. Together, the results suggest that host plants influenceBuchnerapopulation processes and that this may provide phenotypic plasticity in host plant use for clonal aphids. PMID:26850304

  20. Differential Life History Trait Associations of Aphids with Nonpersistent Viruses in Cucurbits. (United States)

    Angelella, G M; Egel, D S; Holland, J D; Nemacheck, J A; Williams, C E; Kaplan, I


    The diversity of vectors and fleeting nature of virus acquisition and transmission renders nonpersistent viruses a challenge to manage. We assessed the importance of noncolonizing versus colonizing vectors with a 2-yr survey of aphids and nonpersistent viruses on commercial pumpkin farms. We quantified aphid alightment using pan traps, while testing leaf samples with multiplex RT-PCR targeting cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and papaya ringspot virus (PRSV). Overall, we identified 53 aphid species (3,899 individuals), from which the melon aphid, Aphis gossypii Glover, a pumpkin-colonizing species, predominated (76 and 37% of samples in 2010 and 2011, respectively). CMV and ZYMV were not detected, but WMV and PRSV were prevalent, both regionally (WMV: 28/29 fields, PRSV: 21/29 fields) and within fields (infection rates = 69 and 55% for WMV in 2010 and 2011; 28 and 25% for PRSV in 2010 and 2011). However, early-season samples showed extremely low infection levels, suggesting cucurbit viruses are not seed-transmitted and implicating aphid activity as a causal factor driving virus spread. Interestingly, neither noncolonizer and colonizer alightment nor total aphid alightment were good predictors of virus presence, but community analyses revealed species-specific relationships. For example, cowpea aphid (Aphis craccivora Koch) and spotted alfalfa aphid (Therioaphis trifolii Monell f. maculata) were associated with PRSV infection, whereas the oleander aphid (Aphis nerii Bover de Fonscolombe) was associated with WMV spread within fields. These outcomes highlight the need for tailored management plans targeting key vectors of nonpersistent viruses in agricultural systems. PMID:26313961

  1. Changes in activity of lysine decarboxylase in winter triticale in response to grain aphid feeding. (United States)

    Sempruch, C; Leszczyński, B; Wójcicka, Agnieszka; Makosz, M; Matok, H; Chrzanowski, G


    Changes in lysine decarboxylase (LDC) activity caused by Sitobion avenae (F.) feeding on two winter triticale cultivars (cvs) were studied. The aphid fecundity and values of intrinsic rate of natural increase showed that cv Witon was less susceptible to S. avenae than cv Tornado. The grain aphid feeding on more susceptible triticale caused a decrease in the LDC activity, with exceptions of root tissues after two weeks of the feeding. In case of less susceptible cv Witon reduction of the LDC activity was observed only during initial period of S. avenae feeding. Later the aphid infestation induced activity of the LDC within tissues of cv Witon. PMID:21112841

  2. Aphid parasitoid (Hymenoptera:Braconidae: Aphidiinae) in wetland habitats in western Palearctic: key and associated aphid parasitoid guilds

    Czech Academy of Sciences Publication Activity Database

    Tomanović, Ž.; Starý, Petr; Kavallieratos, N. G.; Gagić, V.; Plećaš, M.; Janković, M.; Rakhshani, E.; Ćetković, A.; Petrović, A.


    Roč. 48, 1-2 (2012), s. 189-198. ISSN 0037-9271 Grant ostatní: The Ministry of Science and Technological Development of the Republic of Serbia (RS) 043001 Institutional research plan: CEZ:AV0Z50070508 Keywords : aphid parasitoids * tritrophic interactions * wetlands Subject RIV: EH - Ecology, Behaviour Impact factor: 0.529, year: 2012

  3. Kaolin particle films suppress many apple pests, disrupt natural enemies and promote woolly apple aphid

    NARCIS (Netherlands)

    Markó, V.; Blommers, L.H.M.; Bogya, S.; Helsen, H.H.M.


    Multiple applications of hydrophobic kaolin particle film in apple orchards suppressed numbers of blossom weevil (Anthonomus pomorum), brown leaf weevil (Phyllobius oblongus), attelabid weevil (Caenorhinus pauxillus), leafhoppers (Empoasca vitis and Zygina flammigera) and green apple aphid (Aphis po

  4. Characterisation and cross-amplification of polymorphic microsatellite loci in ant-associated root-aphids

    DEFF Research Database (Denmark)

    Ivens, A.B.F.; Kronauer, Daniel Jan Christoph; Boomsma, J.J.


    Twenty-six polymorphic microsatellite loci were developed for four species of ant-associated root-aphids: Geoica utricularia, Forda marginata, Tetraneura ulmi and Anoecia corni. We found up to 9 alleles per locus, with an average of 4.8. We also report polymorphic cross-amplification of eleven of...... these markers between different pairs of study species. Furthermore, we tested previously published aphid microsatellites and found one locus developed for Pemphigus bursarius to be polymorphic in G. utricularia. These microsatellite markers will be useful to study the population structure of aphids...... associated with the ant Lasius flavus and possibly other ants. Such studies are relevant because: 1. L. flavus mounds and their associated flora and fauna are often key components in protected temperate grasslands, and 2. L. flavus and its diverse community of root-aphids provide an interesting model system...

  5. Relations between protein production, protein quality and environmental factors in Pisum mutants

    International Nuclear Information System (INIS)

    The seed protein content of 138 radiation-induced Pisum mutants was determined. The variability of this genetically well-defined material agrees approximately with that of the world collection of Pisum sativum. Some environmental factors to a great extent influence the protein production of the mutants and the initial line. Therefore, it is necessary to consider the relations between the genetically controlled protein production and its dependence upon the environmental factors. This is especially evident if the protein situation of the same genotypes cultivated under the moderate climatic conditions of middle Europe is compared with the subtropical conditions of India. A generally firm correlation between seed size and protein content could not be found in material regarding 148 different mutants of our assortment. Therefore, the selection of small-grained mutants does not result in a selection of protein-rich genotypes in Pisum sativum. Considering all the criteria positively and negatively influencing the protein production, a positive situation could be found in some mutants, especially in the fasciated ones. Furthermore, an improvement of the protein quality could be reached by a genetically conditioned alteration of the globulin-albumin ratio leading to an increase of some essential amino acids such as methionine and lysine. The combined action of mutant genes results in unexpected changes of the protein quantity as well as the quality of the recombinants in relation to their parental mutants. The comparison of some essential amino acids of our useful mutants with those of the varieties of other genera of the Leguminosae shows certain trends of biochemical alterations realized during evolutionary development of the family. (author)

  6. Aphids (Homoptera, Aphidodea inhabiting the trees Crataegus x media Bechst. in the urban green area. Part I. The population dynamics

    Directory of Open Access Journals (Sweden)

    Bożena Jaśkiwicz


    Full Text Available The studies were conducted in the years 1999-2001 in the green areas of Lublin, on the trees of Crataegus x media Bechst. The purpose of the studies was to establish the species composition and the population dynamics of aphids inhabiting hawthorn in the street and park sites. The studies found out the presence of four aphid species on the examined trees, namely Aphis pomi De Geer, aphids from the genus Dysaphis Börn., Ovatus crataegarius (Walk. and Rhopalosiphum insertum (Walk.. More aphid species and bigger populations were found in the street site (A as compa red with the park site (B.The weather conditions (air temperatures of over 30°C and stormy rainfalls limited the population of all aphid species. On the other hand, a mild winter and a warm spring with the rainfalls within the norm caused that the number of aphids decreased considerably.

  7. Aphid effects on rhizosphere microorganisms and microfauna depend more on barley growth phase than on soil fertilization

    DEFF Research Database (Denmark)

    Madsen, Mette Vestergård; Strandmark, Lisa Bjørnlund; Christensen, Søren


    This paper gives the first reports on aphid effects on rhizosphere organisms as influenced by soil nutrient status and plant development. Barley plants grown in pots fertilized with N but without P (N), with N and P (NP), or not fertilized (0) were sampled in the early growth phase (day 25), 1 week...... before and 1 week after spike emergence. Aphids were added 16 days before sampling was carried out. In a separate experiment belowground respiration was measured on N and NP fertilized plant–soil systems with aphid treatments comparable to the first experiment. Aphids reduced numbers of rhizosphere....... Contrary to this, 1 week after spike emergence numbers of bacteria, fungal feeding nematodes and Protozoa were higher in rhizospheres of plants subjected to aphids probably because aphids enhanced root mortality and root decomposition. Protozoa and bacterial feeding nematodes were stimulated at different...

  8. Population dynamics of rose aphid Macrosiphum rosae L. on different cultivars of Rosa indica L. in Pakistan

    International Nuclear Information System (INIS)

    The research was carried out at the Pir Mehr Ali Shah-Arid Agriculture University, Rawalpindi research field area on rose plants for rose aphid populations during 2008-09. Data were recorded on weekly basis. Nymphs, winged and wingless adults were counted from leaves (upper, middle and lower leaves), buds and flowers by visual observation from tagged plants. Aphid populations start to develop in November and its population decline with decline in temperature in December. While its population started rising again at the end of February. Significantly more aphid populations were observed on Perfecta than other varieties; however, significantly few aphids were observed on Christan Diar. These studies revealed that farmers growing roses on a commercial scale should grow Christan Diar to avoid aphid attack. Maximum average number of aphid nymph, winged and wingeless adults on leaves, buds and flowers were 11.11, 4.97 and 10.13, respectively observed on Perfecta variety. (author)

  9. Tracking the global dispersal of a cosmopolitan insect pest, the peach potato aphid

    Directory of Open Access Journals (Sweden)

    Kasprowicz Louise


    Full Text Available Abstract Background Global commerce and human transportation are responsible for the range expansion of various insect pests such as the plant sucking aphids. High resolution DNA markers provide the opportunity to examine the genetic structure of aphid populations, identify aphid genotypes and infer their evolutionary history and routes of expansion which is of value in developing management strategies. One of the most widespread aphid species is the peach-potato aphid Myzus persicae, which is considered as a serious pest on various crops in many parts of the world. The present study examined the genetic variation of this aphid at a world scale and then related this to distribution patterns. In particular, 197 aphid parthenogenetic lineages from around the world were analysed with six microsatellite loci. Results Bayesian clustering and admixture analysis split the aphid genotypes into three genetic clusters: European M. persicae persicae, New Zealand M. persicae persicae and Global M. persicae nicotianae. This partition was supported by FST and genetic distance analyses. The results showed two further points, a possible connection between genotypes found in the UK and New Zealand and globalization of nicotianae associated with colonisation of regions where tobacco is not cultivated. In addition, we report the presence of geographically widespread clones and for the first time the presence of a nicotianae genotype in the Old and New World. Lastly, heterozygote deficiency was detected in some sexual and asexual populations. Conclusion The study revealed important genetic variation among the aphid populations we examined and this was partitioned according to region and host-plant. Clonal selection and gene flow between sexual and asexual lineages are important factors shaping the genetic structure of the aphid populations. In addition, the results reflected the globalization of two subspecies of M. persicae with successful clones being spread at

  10. Tracking the global dispersal of a cosmopolitan insect pest, the peach potato aphid (United States)

    Margaritopoulos, John T; Kasprowicz, Louise; Malloch, Gaynor L; Fenton, Brian


    Background Global commerce and human transportation are responsible for the range expansion of various insect pests such as the plant sucking aphids. High resolution DNA markers provide the opportunity to examine the genetic structure of aphid populations, identify aphid genotypes and infer their evolutionary history and routes of expansion which is of value in developing management strategies. One of the most widespread aphid species is the peach-potato aphid Myzus persicae, which is considered as a serious pest on various crops in many parts of the world. The present study examined the genetic variation of this aphid at a world scale and then related this to distribution patterns. In particular, 197 aphid parthenogenetic lineages from around the world were analysed with six microsatellite loci. Results Bayesian clustering and admixture analysis split the aphid genotypes into three genetic clusters: European M. persicae persicae, New Zealand M. persicae persicae and Global M. persicae nicotianae. This partition was supported by FST and genetic distance analyses. The results showed two further points, a possible connection between genotypes found in the UK and New Zealand and globalization of nicotianae associated with colonisation of regions where tobacco is not cultivated. In addition, we report the presence of geographically widespread clones and for the first time the presence of a nicotianae genotype in the Old and New World. Lastly, heterozygote deficiency was detected in some sexual and asexual populations. Conclusion The study revealed important genetic variation among the aphid populations we examined and this was partitioned according to region and host-plant. Clonal selection and gene flow between sexual and asexual lineages are important factors shaping the genetic structure of the aphid populations. In addition, the results reflected the globalization of two subspecies of M. persicae with successful clones being spread at various scales throughout the

  11. Reproduction and Population Dynamics as Biotypic Markers of Russian Wheat Aphid Diuraphis noxia (Kurdjumov)


    Watson Ngenya; Joyce Malinga; Isaiah Tabu; Emily Masinde


    Russian wheat aphid Diuraphis noxia (Kurdjumov) is widely established in wheat-growing countries where it causes significant economic losses. The development and use of Russian wheat aphid (RWA)-resistant wheat varieties has been constrained by the variation in resident RWA populations and the evolution of virulent biotypes. An experiment was set up at the Kenya Agricultural and Livestock Research Organization (KALRO), Njoro, to characterize RWA populations based on phenotypic characteristics...

  12. Local and systemic responses induced by aphids in Solanum tuberosum plants


    Dugravot, S.; Brunissen, L.; Létocart, E.; Tjallingii, W.F.; Vincent, C; Giordanengo, Ph.; Cherqui, A.


    The aphids Macrosiphum euphorbiae (Thomas) and Myzus persicae (Sulzer) (Homoptera: Aphididae) are serious pests of potato (Solanum tuberosum L.) (Solanaceae), notably in transmitting several plant viruses. Heterospecific interactions may occur between these two species as they are often seen at the same time on the same potato plant in the field. As aphid infestation is known to induce both local and systemic changes, we conducted experiments to determine the effect of previous infestation on...

  13. Resistance of Wild Solanum Accessions to Aphids and Other Potato Pests in Quebec Field Conditions


    Fréchette, B.; Bejan, M.; Lucas, É.; Giordanengo, P.; Vincent, C


    Two experiments were done to determine the susceptibility of six wild potato accessions to the aphids Macrosiphum euphorbiae (Thomas) (Hemiptera: Aphididae) and Myzus persicae (Sulzer). Densities of aphid colonies were compared between caged Solanum pinnatisectum Dunal (Solanales: Solanaceae), S. polyadenium Greenmam, S. tarijense Hawkes, S. infundibuliforme Philippi, S. oplocense Hawkes, and S. stoloniferum Schlechted and Bouché, and the commercially cultivated potato plant S. tuberosum L. c...

  14. Russian wheat aphid, Diuraphis noxia in the Czech Republic – cause of the significant population decrease

    Czech Academy of Sciences Publication Activity Database

    Havelka, Jan; Žurovcová, Martina; Rychlý, S.; Starý, Petr


    Roč. 138, č. 4 (2014), s. 273-280. ISSN 0931-2048 R&D Projects: GA ČR GA522/09/1940 Institutional support: RVO:60077344 Keywords : alien aphid species * anholocyclic populations * aphids overwintering mortality Subject RIV: EH - Ecology, Behaviour Impact factor: 1.650, year: 2014

  15. Selective and Irreversible Inhibitors of Aphid Acetylcholinesterases: Steps Toward Human-Safe Insecticides


    Yuan-Ping Pang; Singh, Sanjay K.; Yang Gao; T Leon Lassiter; MISHRA, Rajesh K.; Kun Yan Zhu; Stephen Brimijoin


    Aphids, among the most destructive insects to world agriculture, are mainly controlled by organophosphate insecticides that disable the catalytic serine residue of acetylcholinesterase (AChE). Because these agents also affect vertebrate AChEs, they are toxic to non-target species including humans and birds. We previously reported that a cysteine residue (Cys), found at the AChE active site in aphids and other insects but not mammals, might serve as a target for insect-selective pesticides. Ho...

  16. Expression Profiling of Selected Glutathione Transferase Genes in Zea mays (L.) Seedlings Infested with Cereal Aphids


    Hubert Sytykiewicz; Grzegorz Chrzanowski; Paweł Czerniewicz; Iwona Sprawka; Iwona Łukasik; Sylwia Goławska; Cezary Sempruch


    The purpose of this report was to evaluate the expression patterns of selected glutathione transferase genes (gst1, gst18, gst23 and gst24) in the tissues of two maize (Zea mays L.) varieties (relatively resistant Ambrozja and susceptible Tasty Sweet) that were colonized with oligophagous bird cherry-oat aphid (Rhopalosiphum padi L.) or monophagous grain aphid (Sitobion avenae L.). Simultaneously, insect-triggered generation of superoxide anion radicals (O2 •−) in infested Z. mays plants was ...

  17. Sugarcane Aphid (Hemiptera: Aphididae): Host Range and Sorghum Resistance Including Cross-Resistance From Greenbug Sources. (United States)

    Armstrong, J Scott; Rooney, William L; Peterson, Gary C; Villenueva, Raul T; Brewer, Michael J; Sekula-Ortiz, Danielle


    The graminous host range and sources of sorghum [Sorghum bicolor (L.) Moench.] plant resistance, including cross-resistance from greenbug, Schizaphis graminum (Rondani), were studied for the newly emerging sugarcane aphid, Melanaphis sacchari (Zehntner), in greenhouse no-choice experiments and field evaluations. The sugarcane aphid could not survive on field corn, Zea mays (L.), Teff grass, Eragrostis tef (Zucc.), proso millet, Panicum miliaceum L., barley, Hordeum vulgare L., and rye, Secale cereale L. Only sorghum genotypes served as hosts including Johnsongrass, Sorghum halepense (L.), a highly suitable noncrop host that generates high numbers of sugarcane aphid and maintains moderate phenotypic injury. The greenbug-resistant parental line RTx2783 that is resistant to greenbug biotypes C and E was resistant to sugarcane aphid in both greenhouse and field tests, while PI 55607 greenbug resistant to biotypes B, C, and E was highly susceptible. PI 55610 that is greenbug resistant to biotypes B, C, and E maintained moderate resistance to the sugarcane aphid, while greenbug-resistant PI 264453 was highly susceptible to sugarcane aphid. Two lines and two hybrids from the Texas A&M breeding program B11070, B11070, AB11055-WF1-CS1/RTx436, and AB11055-WF1-CS1/RTx437 were highly resistant to sugarcane aphid, as were parental types SC110, SC170, and South African lines Ent62/SADC, (Macia/TAM428)-LL9, (SV1*Sima/IS23250)-LG15. Tam428, a parental line that previously showed moderate resistance in South Africa and India, also showed moderate resistance in these evaluations. Overall, 9 of 20 parental sorghum entries tested for phenotypic damage in the field resulted in good resistance to the sugarcane aphid and should be utilized in breeding programs that develop agronomically acceptable sorghums for the southern regions of the United States. PMID:26470168

  18. Low Genetic Diversity in Melanaphis sacchari Aphid Populations at the Worldwide Scale


    Nibouche, Samuel; Fartek, Benjamin; Mississipi, Stelly; Delatte, Hélène; Reynaud, Bernard; Costet, Laurent


    Numerous studies have examined the genetic diversity and genetic structure of invading species, with contrasting results concerning the relative roles of genetic diversity and phenotypic plasticity in the success of introduced populations. Increasing evidence shows that asexual lineages of aphids are able to occupy a wide geographical and ecological range of habitats despite low genetic diversity. The anholocyclic aphid Melanaphis sacchari is a pest of sugarcane and sorghum which originated i...

  19. Species diversity and abundance of aphids and their natural enemies in a crop association


    Chevalier Mendes Lopes, Thomas; Hatt, Séverin; Starý, Petr; JAPOSHVILI, George; Francis, Frédéric


    Crop associations can be efficient to reduce aphid populations, by disrupting the visual and olfactory location of host plants. However, increasing the chemical and structural complexity of vegetation can also decrease the searching efficiency of predators and parasitoids, which are not always more abundant in complex habitats. Using attractive semiochemicals such as methyl salicylate (MeSA) combined with a crop association seems promising to maximise aphid control. We compared the abundances...

  20. Contribution to the Knowledge of the Orchard Aphid (Hemiptera: Aphididae) Fauna of Istanbul and Kahramanmaras


    Rakauskas, Rimantas; ASLAN, Mahmut Murat; IŞIKBER, Ali ARDA; Zaremba, Audrius; Bernotienė, Rasa


    ABSTRACT: This study presents the list of aphid species (Family Aphididae, 16 species of 9 genera altogether) collected from Kahramanmaraşand Istanbul Province in 2011, with the comments on their distribution. DNA extraction, PCR amplification and sequencing protocols used. Hyalopterus persikonus, Rhopalosiphum nymphaeae, Dysaphis (Pomaphis) reaumuri and Myzus (Myzus) varians are reported for the first time from the aphid fauna of Kahramanmaraş Province. Comments on the biological characters ...

  1. Growth, seed development and genetic analysis in wild type and Def mutant of Pisum sativum L


    Ayeh Kwadwo; Lee YeonKyeong; Ambrose Mike J; Hvoslef-Eide Anne


    Abstract Background The def mutant pea (Pisum sativum L) showed non-abscission of seeds from the funicule. Here we present data on seed development and growth pattern and their relationship in predicting this particular trait in wild type and mutant lines as well as the inheritance pattern of the def allele in F2 and F3 populations. Findings Pod length and seed fresh weight increase with fruit maturity and this may affect the abscission event in pea seeds. However, the seed position in either...

  2. Effect of sodium fluoride on phytase activity during germination of Pisum sativum L. seeds

    Energy Technology Data Exchange (ETDEWEB)

    Hauskrecht, I.


    The effects of fluoride ion, in concentrations varying from 0 to 4 mM F/sup -/, on phytase activity in the course of germination of Pisum sativum L. seeds and in the course of incubation in vitro are reported. The fluoride ion in 1 mM concentration cause a significant 80% decrease of the phytase activity in the incubation medium and a 24% decrease in the course of germination. The inhibition of phytase, as well as its synthesis, by fluoride ion during germination may influence the metabolism of phosphorus at the initial stage of ontogenesis.

  3. Nitrogen and phosphorus compounds in the aleurone grains of Iris pseudoacorus endosperm and Pisum sativum cotyledons

    Directory of Open Access Journals (Sweden)

    Ligia Konopska


    Full Text Available Aleurone grains from Iris pseudoacorus endosperm and Pisum sativum cotyledons were isolated partly according to Tombs's method (1967. Nitrogen compounds content was determined in them by Kjeldahl's micromethod, and in the particular fractions after Thiman and Laloraya (1960. Mainly protein N was detected in the aleurone grains, constituting 14.8 and 15.2 per cent of the dry mass of pea and Iris seeds, respectively. Moreover, phosphorus compounds were fractionated according to Holden and Pirie (1955. Analyses demonstrated the presence in aleurone grains of inorganic P, acid-soluble organophosphorus compounds, phospholipids and RNA.

  4. Phosphatidylinositol(4,5)bisphosphate and phosphatidylinositol(4)phosphate in plant tissues. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Irvine, R.F.; Letcher, A.J.; Lander, D.J. (Institute of Animal Physiology and Genetics Research, Cambridge (England)); Dawson, A.P. (Univ. of East Anglia, Norwich (England)); Musgrave, A. (Univ. of Amsterdam (Netherlands)); Drobak, B.K. (John Innes Institute, Norwich (England))


    Pea (Pisum sativum) leaf discs or swimming suspensions of Chlamydomonas eugametos were radiolabeled with ({sup 3}H)myo-inositol or ({sup 32}P)Pi and the lipids were extracted, deacylated, and their glycerol moieties removed. The resulting inositol trisphosphate and bisphosphate fractions were examined by periodate degradation, reduction and dephosphorylation, or by incubation with human red cell membranes. Their likely structures were identified as D-myo-inositol(1,4,5)trisphosphate and D-myo-inositol(1,4,)-bisphosphate. It is concluded that plants contain phosphatidylinositol(4)phosphate and phosphatidylinositol(4,5)bisphosphate; no other polyphosphoinositides were detected.

  5. Genetic study of pea (Pisum sativum L.) mutants with altered shape of the pod (moniliform pod)

    International Nuclear Information System (INIS)

    Mutants 1/39 and 2/179 were induced in pea cultivars Auralia and Borek after gamma-ray irradiation and temperature treatment of the seeds. The mutants were isolated in M2 generation and were characterized by altered shape of the pod. It was established that the mutants were allelic and resulted from mutation of a single recessive gene. The designation moniliform pod was proposed for the mutation type and the symbol mfp for the gene. Mutants are useful plant material for studying the genetics of the mutated trait, i.e. the shape of pod in peas (Pisum sativum L.)

  6. Age-dependent variation in membrane lipid synthesis in leaves of garden pea (Pisum sativum L.)

    DEFF Research Database (Denmark)

    Hellgren, Lars; Sandelius, A.S.


    To study membrane lipid synthesis during the lifespan of a dicotyledon leaf, the second oldest leaf of 10-40-d-old plants of garden pea (Pisum sativum L.) was labelled with [1-C- 14]acetate and the distribution of radioactivity between the major membrane lipids was followed for 3 d. In the...... of 18-26-d-old plants and in the youngest leaves, respectively. Thus, these results demonstrate that the distribution of newly synthesized fatty acids between acyl lipid synthesis in the chloroplast and extraplastidial membranes strongly varies with leaf age, as do the proportion utilized for sterol...

  7. Isolation and Characterization of Novel EST-Derived Genic Markers in Pisum sativum (Fabaceae

    Directory of Open Access Journals (Sweden)

    Shalu Jain


    Full Text Available Premise of the study: Novel markers were developed for pea (Pisum sativum from pea expressed sequence tags (ESTs having significant homology to Medicago truncatula gene sequences to investigate genetic diversity, linkage mapping, and cross-species transferability. Methods and Results: Seventy-seven EST-derived genic markers were developed through comparative mapping between M. truncatula and P. sativum in which 75 markers produced PCR products and 33 were polymorphic among 16 pea genotypes. Conclusions: The novel markers described here will be useful for future genetic studies of P. sativum; their amplification in lentil (Lens culinaris demonstrates their potential for use in closely related species.

  8. Analysis of nucleotide sequence of Pisum sativum chromosome-5-specific library

    Czech Academy of Sciences Publication Activity Database

    Wolko, L.; Vrána, Jan; Doležel, Jaroslav; Slomski, R.

    Poznan : Institute of Plant Genetics PAS, 2004 - (Sadowski, J.), s. 79-88 [International Workshop 'Understanding the Plant Genomeö. Poznan (PL), 02.06.2003-03.06.2003] R&D Projects: GA ČR GA521/03/0595 Grant ostatní: State Committee for Scientific Research (KBN)(PL) 5 P06A 015 19 Institutional research plan: CEZ:AV0Z5038910 Keywords : Pisum sativum * flow-sorted chromosomes * chromosome-5-specific DNA library Subject RIV: EB - Genetics ; Molecular Biology


    Directory of Open Access Journals (Sweden)

    Balaji Hajare and Avinash Ade1


    Full Text Available To confirm the location of the nitrogen fixing genes whether on the plasmids or on the genomic DNA the Rhizobial isolates isolated from pea (Pisum sativum were treated with acridine orange with various concentrations and fixed nitrogen was estimated from the media in which these rhizobia were grown. There was no significant difference in between the cured and non cured strains of the Rhizobium which proved that the nitrogen fixing genes are not plasmid borne but these are located on the genomic DNA.

  10. Molecular cloning, characterisation and mRNA expression of the ryanodine receptor from the peach-potato aphid, Myzus persicae


    Troczka, B.J.; Williams, A J; Bass, C; Williamson, M.S.; Field, L.M.; Davies, T.G.E.


    The peach potato aphid, Myzus persicae, is one of the most important agricultural pests of temperate climates. It is mainly controlled through the judicious application of insecticides; however, over time, aphids have developed resistance to many insecticidal classes. The recent introduction of synthetic diamide insecticides, with a novel mode of action, potentially offers new tools to control aphid populations. These diamides act on the ryanodine receptor (RyR), a large endoplasmic calcium r...

  11. Root Exudation by Aphid Leaf Infestation Recruits Root-Associated Paenibacillus spp. to Lead Plant Insect Susceptibility. (United States)

    Kim, Bora; Song, Geun Cheol; Ryu, Choong-Min


    Aphids are a large group of hemipteran pests that affect the physiology, growth, and development of plants by using piercing mouthparts to consume fluids from the host. Based an recent data, aphids modulate the microbiomes of plants and thereby affect the overall outcome of the biological interaction. However, in a few reports, aboveground aphids manipulate the metabolism of the host and facilitate infestations by rhizosphere bacteria (rhizobacteria). In this study, we evaluated whether aphids alter the plant resistance that is mediated by the bacterial community of the root system. The rhizobacteria were affected by aphid infestation of pepper, and a large population of gram-positive bacteria was detected. Notably, Paenibacillus spp. were the unique gram-positive bacteria to respond to changes induced by the aphids. Paenibacillus polymyxa E681 was used as a rhizobacterium model to assess the recruitment of bacteria to the rhizosphere by the phloem-sucking of aphids and to test the effect of P. polymyxa on the susceptibility of plants to aphids. The root exudates secreted from peppers infested with aphids increased the growth rate of P. polymyxa E681. The application of P. polymyxa E681 to pepper roots promoted the colonization of aphids within 2 days of inoculation. Collectively, our results suggest that aphid infestation modulated the root exudation, which led to the recruitment of rhizobacteria that manipulated the resistance of peppers to aphids. In this study, new information is provided on how the infestation of insects is facilitated through insect-derived modulation of plant resistance with the attraction of gram-positive rhizobacteria. PMID:26699743

  12. Richness and diversity of aphids (Homoptera, Aphididae) along an altitudinal gradient in the Serra do Mar, Paraná, Brazil


    Crisleide Maria Lazzarotto; Sonia Maria Noemberg Lázzari


    The lack of bioecological studies on aphids in regions with complex floristic and faunistic structure, such as the Atlantic Tropical Rain Forest, lead to the initiation of this research. The objectives were to determine species richness and diversity of aphids and to investigate the influence of altitude and environmental perturbations on aphid populations. The collections were made with yellow pan traps at 11 sites with altitudes from -10 m to 1000 m above sea level (a.s.l.), in the Serra do...

  13. Biological control of aphids in wheat and vegetable crops : a multi-approach case study in Shandong province (China)


    Chevalier Mendes Lopes, Thomas; Bosquée, Emilie; Chen, Julian; Yong, Liu; Bragard, Claude; Francis, Frédéric


    This multi-approach study was conducted in the Shandong province (China) to assess the effectiveness of different biological control methods against aphids in wheat and vegetable crops. Three approaches were tested: (1) wheat/oilseed rape and wheat/pea associations, (2) potatoes/peas association, and (3) E-β-farnesene (aphid alarm pheromone) releasers in squashes under plastic tunnels. Aphids and aphidophagous beneficials were monitored by observations on plants. Wheat associations and E-β-fa...

  14. Molecular and morphological identification of hymenoptran parasitoids from the pomegranate aphid, Aphis punicae in Razavi Khorasan province, Iran


    FARROKHZADEH, Hadi; Moravvej, Gholamhossein; Awal, Mehdi Modarres; Karimi, Javad


    Parasitoids play the positive role in aphids control management by keeping the population of aphids below the economic threshold. The pomegranate aphid, Aphis punicae is attacked by several parasitoids which mostly belong to Aphidiinae subfamily. The identification of parasitoids and hyperparasitoids is problematic due to their small size and ambiguous morphological characteristics. The analysis of molecular data of DNA sequences has been suggested as a complementary approach to the classical...

  15. A new approach for the identification of aphid vectors (Hemiptera: Aphididae) of potato virus Y. (United States)

    Pelletier, Y; Nie, X; Giguère, M A; Nanayakkara, U; Maw, E; Foottit, R


    Potato virus Y (PVY) is one of the most economically important viruses affecting potato crops worldwide. PVY can be transmitted from potato to potato by several aphid species, most of which do not colonize the potato crop. New methods including preservation of viral RNA on stylets of aphids collected from yellow pan trap samples, polymerase chain reaction detection of PVY from the stylets of one aphid, and aphid identification using DNA barcoding were used to identify possible PVY vectors from field samples. In total, 65 aphid taxa were identified from the samples that tested positive for PVY. Among those, 45 taxa had never been evaluated for their ability to transmit PVY, and 7 were previously labeled as nonvectors. These results demonstrated that the list of PVY vectors is likely longer than previously reported and that most (if not all) species of aphids could be considered as potential vectors. This premise has important implications in the management of PVY in seed potato production. PMID:23356053

  16. Expression profiling of selected glutathione transferase genes in Zea mays (L. seedlings infested with cereal aphids.

    Directory of Open Access Journals (Sweden)

    Hubert Sytykiewicz

    Full Text Available The purpose of this report was to evaluate the expression patterns of selected glutathione transferase genes (gst1, gst18, gst23 and gst24 in the tissues of two maize (Zea mays L. varieties (relatively resistant Ambrozja and susceptible Tasty Sweet that were colonized with oligophagous bird cherry-oat aphid (Rhopalosiphum padi L. or monophagous grain aphid (Sitobion avenae L.. Simultaneously, insect-triggered generation of superoxide anion radicals (O2•- in infested Z. mays plants was monitored. Quantified parameters were measured at 1, 2, 4, 8, 24, 48 and 72 h post-initial aphid infestation (hpi in relation to the non-infested control seedlings. Significant increases in gst transcript amounts were recorded in aphid-stressed plants in comparison to the control seedlings. Maximal enhancement in the expression of the gst genes in aphid-attacked maize plants was found at 8 hpi (gst23 or 24 hpi (gst1, gst18 and gst24 compared to the control. Investigated Z. mays cultivars formed excessive superoxide anion radicals in response to insect treatments, and the highest overproduction of O2•- was noted 4 or 8 h after infestation, depending on the aphid treatment and maize genotype. Importantly, the Ambrozja variety could be characterized as having more profound increments in the levels of gst transcript abundance and O2•- generation in comparison with the Tasty Sweet genotype.

  17. Expression profiling of selected glutathione transferase genes in Zea mays (L.) seedlings infested with cereal aphids. (United States)

    Sytykiewicz, Hubert; Chrzanowski, Grzegorz; Czerniewicz, Paweł; Sprawka, Iwona; Łukasik, Iwona; Goławska, Sylwia; Sempruch, Cezary


    The purpose of this report was to evaluate the expression patterns of selected glutathione transferase genes (gst1, gst18, gst23 and gst24) in the tissues of two maize (Zea mays L.) varieties (relatively resistant Ambrozja and susceptible Tasty Sweet) that were colonized with oligophagous bird cherry-oat aphid (Rhopalosiphum padi L.) or monophagous grain aphid (Sitobion avenae L.). Simultaneously, insect-triggered generation of superoxide anion radicals (O2•-) in infested Z. mays plants was monitored. Quantified parameters were measured at 1, 2, 4, 8, 24, 48 and 72 h post-initial aphid infestation (hpi) in relation to the non-infested control seedlings. Significant increases in gst transcript amounts were recorded in aphid-stressed plants in comparison to the control seedlings. Maximal enhancement in the expression of the gst genes in aphid-attacked maize plants was found at 8 hpi (gst23) or 24 hpi (gst1, gst18 and gst24) compared to the control. Investigated Z. mays cultivars formed excessive superoxide anion radicals in response to insect treatments, and the highest overproduction of O2•- was noted 4 or 8 h after infestation, depending on the aphid treatment and maize genotype. Importantly, the Ambrozja variety could be characterized as having more profound increments in the levels of gst transcript abundance and O2•- generation in comparison with the Tasty Sweet genotype. PMID:25365518

  18. In vitro interactions of the aphid endosymbiotic SymL chaperonin with barley yellow dwarf virus. (United States)

    Filichkin, S A; Brumfield, S; Filichkin, T P; Young, M J


    Barley yellow dwarf virus (BYDV)-vector relationships suggest that there are specific interactions between BYDV virions and the aphid's cellular components. However, little is known about vector factors that mediate virion recognition, cellular trafficking, and accumulation within the aphid. Symbionins are molecular chaperonins produced by intracellular endosymbiotic bacteria and are the most abundant proteins found in aphids. To elucidate the potential role of symbionins in BYDV transmission, we have isolated and characterized two new symbionin symL genes encoded by the endosymbionts which are harbored by the BYDV aphid vectors Rhopalosiphum padi and Sitobion avenae. Endosymbiont symL-encoded proteins have extensive homology with the pea aphid SymL and Escherichia coli GroEL chaperonin. Recombinant and native SymL proteins can be assembled into oligomeric complexes which are similar to the GroEL oligomer. R. padi SymL protein demonstrates an in vitro binding affinity for BYDV and its recombinant readthrough polypeptide. In contrast to the R. padi SymL, the closely related GroEL does not exhibit a significant binding affinity either for BYDV or for its recombinant readthrough polypeptide. Comparative sequence analysis between SymL and GroEL was used to identify potential SymL-BYDV binding sites. Affinity binding of SymL to BYDV in vitro suggests a potential involvement of endosymbiotic chaperonins in interactions with virions during their trafficking through the aphid. PMID:8985385

  19. Aphid Parasitoid Mothers Don't Always Know Best through the Whole Host Selection Process. (United States)

    Chesnais, Quentin; Ameline, Arnaud; Doury, Géraldine; Le Roux, Vincent; Couty, Aude


    Parasitoid host selection behaviour has been extensively studied in experimentally simplified tritrophic systems formed by one single food chain (one plant, one herbivore and one parasitoid species). The "Mother knows best" hypothesis predicts that the preference for a plant-host complex should be positively correlated with plant quality for offspring performance. We studied the host selection behaviour of the generalist endoparasitoid Aphidius matricariae towards the black bean aphid Aphis fabae in the intercrop system including Vicia faba as a focal plant and its companion plant Camelina sativa. Dual-choice laboratory bioassays revealed that parasitoid females preferred to orientate towards (1) the plant-aphid complex over the non-infested plant whatever the complex (2) the C. sativa-A. fabae complex over the V. faba-A. fabae complex. In dual choice attack rate bioassays, parasitoid females showed more interest towards the aphids on C. sativa but paradoxically chose to oviposit more in aphids on V. faba. Ultimately, parasitoids that had developed on the V. faba-A. fabae complex exhibited better fitness parameters. By demonstrating that parasitoid females were able to discriminate the aphid host that offered the highest fitness to their offspring but selected beforehand the least suitable plant-aphid complex, we provide key insight into the disruption in their host selection behaviour potentially triggered by diverse habitats. This suggests that the "Mother knows best" hypothesis could be thwarted by increasing the complexity of the studied systems. PMID:26270046

  20. Characterization of the natural enemy community attacking cotton aphid in the Bt cotton ecosystem in Northern China. (United States)

    Ali, Abid; Desneux, Nicolas; Lu, Yanhui; Liu, Bing; Wu, Kongming


    Planting Bt cotton in China since 1997 has led to important changes in the natural enemy communities occurring in cotton, however their specific effect on suppressing the cotton aphids (being notorious in conventional cotton ecosystem) has not been fully documented yet. We observed strong evidence for top-down control of the aphid population, e.g. the control efficiency of natural enemies on cotton aphid increased significantly in open field cages compared to exclusion cages, accounted for 60.2, 87.2 and 76.7% in 2011, 2012 and 2013 season, respectively. The cotton aphid populations peaked in early June to late July (early and middle growth stages) in open field cotton survey from 2011 to 2013. The population densities of cotton aphids and natural enemies were highest on middle growth stage while lowest densities were recorded on late stage for aphids and on early plant stage for natural enemies. Aphid parasitoids (Trioxys spp., Aphidius gifuensis), coccinellids and spiders were key natural enemies of cotton aphid. Briefly, natural enemies can suppress aphid population increase from early to middle plant growth stages by providing biocontrol services in Chinese Bt cotton. PMID:27075171

  1. Characterization of the natural enemy community attacking cotton aphid in the Bt cotton ecosystem in Northern China (United States)

    Ali, Abid; Desneux, Nicolas; Lu, Yanhui; Liu, Bing; Wu, Kongming


    Planting Bt cotton in China since 1997 has led to important changes in the natural enemy communities occurring in cotton, however their specific effect on suppressing the cotton aphids (being notorious in conventional cotton ecosystem) has not been fully documented yet. We observed strong evidence for top-down control of the aphid population, e.g. the control efficiency of natural enemies on cotton aphid increased significantly in open field cages compared to exclusion cages, accounted for 60.2, 87.2 and 76.7% in 2011, 2012 and 2013 season, respectively. The cotton aphid populations peaked in early June to late July (early and middle growth stages) in open field cotton survey from 2011 to 2013. The population densities of cotton aphids and natural enemies were highest on middle growth stage while lowest densities were recorded on late stage for aphids and on early plant stage for natural enemies. Aphid parasitoids (Trioxys spp., Aphidius gifuensis), coccinellids and spiders were key natural enemies of cotton aphid. Briefly, natural enemies can suppress aphid population increase from early to middle plant growth stages by providing biocontrol services in Chinese Bt cotton. PMID:27075171

  2. Assessment of patch quality by aphidophagous ladybirds: laboratory study on the minimum density of aphids required for oviposition

    Directory of Open Access Journals (Sweden)

    B. C. Das


    Full Text Available Many studies indicate that there is a density of aphids below which ladybirds are unlikely to lay eggs. This is adaptive as theory indicates that a certain minimum population density of aphids is required if hatchling larvae are to survive. The responses of gravid females of the two spot ladybird, Adalia bipunctata (L. (Coleoptera: Coccinellidae, recorded over a period of an hour, to colonies of 5 and 50 pea aphids on bean plants and similar plants each previously infested with the same number of aphids for 48 hours were determined. Proportionally more of the ladybirds on plants with 50 aphids or that were previously infested with the same number of aphids for 48 hours laid eggs and larger clusters of eggs, and were less active than those on plants that were infested with or had previously been infested with five aphids. That is, gravid females showed similar oviposition and activity responses to aphid abundance and different levels of honeydew contamination. This indicates that honeydew contamination may be an important cue used by ladybirds when locating and assessing the abundance of prey in aphid colonies.

  3. The effect of plant inbreeding and stoichiometry on interactions with herbivores in nature: Echinacea angustifolia and its specialist aphid.

    Directory of Open Access Journals (Sweden)

    Caroline E Ridley

    Full Text Available Fragmentation of once widespread communities may alter interspecific interactions by changing genetic composition of interacting populations as well as their abundances and spatial distributions. In a long-term study of a fragmented population of Echinacea angustifolia, a perennial plant native to the North American prairie, we investigated influences on its interaction with a specialist aphid and tending ants. We grew plant progeny of sib-matings (I, and of random pairings within (W and between (B seven remnants in a common field within 8 km of the source remnants. During the fifth growing season, we determined each plant's burden of aphids and ants, as well as its size and foliar elemental composition (C, N, P. We also assayed composition (C, N of aphids and ants. Early in the season, progeny from genotypic classes B and I were twice as likely to harbor aphids, and in greater abundance, than genotypic class W; aphid loads were inversely related to foliar concentration of P and positively related to leaf N and plant size. At the end of the season, aphid loads were indistinguishable among genotypic classes. Ant abundance tracked aphid abundance throughout the season but showed no direct relationship with plant traits. Through its potential to alter the genotypic composition of remnant populations of Echinacea, fragmentation can increase Echinacea's susceptibility to herbivory by its specialist aphid and, in turn, perturb the abundance and distribution of aphids.

  4. Aphids (Homoptera, Aphidodea) inhabiting the trees Crataegus x media Bechst. in the urban green area. Part I. The population dynamics


    Bożena Jaśkiwicz; Aneta Sławińska


    The studies were conducted in the years 1999-2001 in the green areas of Lublin, on the trees of Crataegus x media Bechst. The purpose of the studies was to establish the species composition and the population dynamics of aphids inhabiting hawthorn in the street and park sites. The studies found out the presence of four aphid species on the examined trees, namely Aphis pomi De Geer, aphids from the genus Dysaphis Börn., Ovatus crataegarius (Walk.) and Rhopalosiphum insertum (Walk.). More aphid...

  5. Evidence for specificity in symbiont-conferred protection against parasitoids. (United States)

    McLean, Ailsa H C; Godfray, H Charles J


    Many insects harbour facultative symbiotic bacteria, some of which have been shown to provide resistance against natural enemies. One of the best-known protective symbionts is Hamiltonella defensa, which in pea aphid (Acyrthosiphon pisum) confers resistance against attack by parasitoid wasps in the genus Aphidius (Braconidae).We asked (i) whether this symbiont also confers protection against a phylogenetically distant group of parasitoids (Aphelinidae) and (ii) whether there are consistent differences in the effects of bacteria found in pea aphid biotypes adapted to different host plants. We found that some H. defensa strains do provide protection against an aphelinid parasitoid Aphelinus abdominalis. Hamiltonella defensa from the Lotus biotype provided high resistance to A. abdominalis and moderate to low resistance to Aphidius ervi, while the reverse was seen from Medicago biotype isolates. Aphids from Ononis showed no evidence of symbiont-mediated protection against either wasp species and were relatively vulnerable to both. Our results may reflect the different selection pressures exerted by the parasitoid community on aphids feeding on different host plants, and could help explain the maintenance of genetic diversity in bacterial symbionts. PMID:26136451

  6. Water Stress Modulates Soybean Aphid Performance, Feeding Behavior, and Virus Transmission in Soybean (United States)

    Nachappa, Punya; Culkin, Christopher T.; Saya, Peter M.; Han, Jinlong; Nalam, Vamsi J.


    Little is known about how water stress including drought and flooding modifies the ability of plants to resist simultaneous attack by insect feeding and transmission of insect-vectored pathogen. We analyzed insect population growth, feeding behaviors, virus transmission, and plant amino acid profiles and defense gene expression to characterize mechanisms underlying the interaction between water stress, soybean aphid and aphid-transmitted, Soybean mosaic virus, on soybean plants. Population growth of non-viruliferous aphids was reduced under drought stress and saturation, likely because the aphids spent less time feeding from the sieve element on these plants compared to well-watered plants. Water stress did not impact population growth of viruliferous aphids. However, virus incidence and transmission rate was lowest under drought stress and highest under saturated conditions since viruliferous aphids took the greatest amount time to puncture cells and transmit the virus under saturated conditions and lowest time under drought stress. Petiole exudates from drought-stressed plants had the highest level of total free amino acids including asparagine and valine that are critical for aphid performance. Aphids did not benefit from improved phloem sap quality as indicated by their lower densities on drought-stressed plants. Saturation, on the other hand, resulted in low amino acid content compared to all of the other treatments. Drought and saturation had significant and opposing effects on expression of marker genes involved in abscisic acid (ABA) signaling. Drought alone significantly increased expression of ABA marker genes, which likely led to suppression of salicylic acid (SA)- and jasmonic acid (JA)-related genes. In contrast, ABA marker genes were down-regulated under saturation, while expression of SA- and JA-related genes was up-regulated. We propose that the apparent antagonism between ABA and SA/JA signaling pathways contributed to an increase in aphid

  7. Survival to parasitoids in an insect hosting defensive symbionts: a multivariate approach to polymorphic traits affecting host use by its natural enemy.

    Directory of Open Access Journals (Sweden)

    Emilie Bilodeau

    Full Text Available Insect parasitoids and their insect hosts represent a wide range of parasitic trophic relations that can be used to understand the evolution of biotic diversity on earth. Testing theories of coevolution between hosts and parasites is based on factors directly involved in host susceptibility and parasitoid virulence. We used controlled encounters with potential hosts of the Aphidius ervi wasp to elucidate behavioral and other phenotypic traits of host Acyrthosiphon pisum that most contribute to success or failure of parasitism. The host aphid is at an advanced stage of specialization on different crop plants, and exhibits intra-population polymorphism for traits of parasitoid avoidance and resistance based on clonal variation of color morph and anti-parasitoid bacterial symbionts. Randomly selected aphid clones from alfalfa and clover were matched in 5 minute encounters with wasps of two parasitoid lineages deriving from hosts of each plant biotype in a replicated transplant experimental design. In addition to crop plant affiliation (alfalfa, clover, aphid clones were characterized for color morph (green, pink, Hamiltonella defensa and Regiella insecticola symbionts, and frequently used behaviors in encounters with A. ervi wasps. A total of 12 explanatory variables were examined using redundancy analysis (RDA to predict host survival or failure to A. ervi parasitism. Aphid color was the best univariate predictor, but was poorly predictive in the RDA model. In contrast, aphid host plant and symbionts were not significant univariate predictors, but significant predictors in the multivariate model. Aphid susceptibility to wasp acceptance as reflected in host attacks and oviposition clearly differed from its suitability to parasitism and progeny development. Parasitoid progeny were three times more likely to survive on clover than alfalfa host aphids, which was compensated by behaviorally adjusting eggs invested per host. Strong variation of the

  8. Quantification of insecticide resistance in the tobacco-adapted form of the green peach aphid, Myzus persicae (Sulzer)(Hemiptera: Aphididae)


    Srigiriraju, Lakshmipathi


    The tobacco-adapted form of the green peach aphid, Myzus persicae (Sulzer), is one of the most important insect pests of tobacco in the United States and around the world. Insecticides play a major role in controlling the aphid on tobacco because natural enemies usually fail to maintain its populations below damaging levels. The aphid has a history of developing resistance to many insecticides. Therefore, baseline information on the aphidâ s susceptibility to imidacloprid and other insect...

  9. Calcium-calmodulin signalling is involved in light-induced acidification by epidermal leaf cells of pea, Pisum sativum L.

    NARCIS (Netherlands)

    Elzenga, JTM; Staal, M; Prins, HBA


    Pathways of signal transduction of red and blue light-dependent acidification by leaf epidermal cells were studied using epidermal strips of the Argenteum mutant of Pisum sativum. In these preparations the contribution of guard cells to the acidification is minimal. The hydroxypyridine nifedipine, a

  10. Boron, cobalt and molybdenum in the knottiness and production on pea (Pisum sativum L.) cv Bolero culture

    International Nuclear Information System (INIS)

    The test carried out to study the effect of Boron, Cobalt and Molybdenum on the knottiness and production of the pea (Pisum sativum L.)cv Bolero culture, in controlled conditions. The results showed that Boron didn't affect the knottiness and it increased the production, while, Cobalt and Molybdenum promoted significant increase in the knottiness and productivity. (author)

  11. Development of transgenic pea (Pisum sativum L.) lines for improved tolerance to insect pests and fungal pathogens

    Czech Academy of Sciences Publication Activity Database

    Griga, M.; Švábová, L.; Sehnal, František; Hanáček, P.; Reinöhl, V.; Horáček, J.

    České Budějovice : Biology Centre of Academy of Sciences of the Czech Republic, 2009 - (Sehnal, F.; Drobník, J.), s. 38-38 ISBN 978-80-86668-05-3 Institutional research plan: CEZ:AV0Z50070508 Keywords : Pisum sativum L. Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection

  12. Chromosome localization of novel satellite repeats identified in pea (Pisum sativum) by computer analysis of 454-sequencing data

    Czech Academy of Sciences Publication Activity Database

    Navrátilová, Alice; Macas, Jiří


    Roč. 15, Suppl. 2 (2007), s. 45. ISSN 0967-3849. [International Chromosome Conference /16./. 25.08.2007-29.08.2007, Amsterdam] Institutional research plan: CEZ:AV0Z50510513 Keywords : pea ( Pisum sativum ) * Chromosome localization Subject RIV: EB - Genetics ; Molecular Biology

  13. The ethylene response factor Pti5 contributes to potato aphid resistance in tomato independent of ethylene signalling. (United States)

    Wu, Chengjun; Avila, Carlos A; Goggin, Fiona L


    Ethylene response factors (ERFs) comprise a large family of transcription factors that regulate numerous biological processes including growth, development, and response to environmental stresses. Here, we report that Pti5, an ERF in tomato [Solanum lycopersicum (Linnaeus)] was transcriptionally upregulated in response to the potato aphid Macrosiphum euphorbiae (Thomas), and contributed to plant defences that limited the population growth of this phloem-feeding insect. Virus-induced gene silencing of Pti5 enhanced aphid population growth on tomato, both on an aphid-susceptible cultivar and on a near-isogenic genotype that carried the Mi-1.2 resistance (R) gene. These results indicate that Pti5 contributes to basal resistance in susceptible plants and also can synergize with other R gene-mediated defences to limit aphid survival and reproduction. Although Pti5 contains the ERF motif, induction of this gene by aphids was independent of ethylene, since the ACC deaminase (ACD) transgene, which inhibits ethylene synthesis, did not diminish the responsiveness of Pti5 to aphid infestation. Furthermore, experiments with inhibitors of ethylene synthesis revealed that Pti5 and ethylene have distinctly different roles in plant responses to aphids. Whereas Pti5 contributed to antibiotic plant defences that limited aphid survival and reproduction on both resistant (Mi-1.2+) and susceptible (Mi-1.2-) genotypes, ethylene signalling promoted aphid infestation on susceptible plants but contributed to antixenotic defences that deterred the early stages of aphid host selection on resistant plants. These findings suggest that the antixenotic defences that inhibit aphid settling and the antibiotic defences that depress fecundity and promote mortality are regulated through different signalling pathways. PMID:25504643

  14. Seasonal phenology and species composition of the aphid fauna in a northern crop production area.

    Directory of Open Access Journals (Sweden)

    Sascha M Kirchner

    Full Text Available BACKGROUND: The species diversity of aphids and seasonal timing of their flight activity can have significant impacts on crop production, as aphid species differ in their ability to transmit plant viruses and flight timing affects virus epidemiology. The aim of the study was to characterise the species composition and phenology of aphid fauna in Finland in one of the northernmost intensive crop production areas of the world (latitude 64°. METHODOLOGY/PRINCIPAL FINDINGS: Flight activity was monitored in four growing seasons (2007-010 using yellow pan traps (YPTs placed in 4-8 seed potato fields and a Rothamsted suction trap. A total of 58,528 winged aphids were obtained, identified to 83 taxa based on morphology, and 34 species were additionally characterised by DNA barcoding. Seasonal flight activity patterns analysed based on YPT catch fell into three main phenology clusters. Monoecious taxa showed early or middle-season flight activity and belonged to species living on shrubs/trees or herbaceous plants, respectively. Heteroecious taxa occurred over the entire potato growing season (ca. 90 days. Abundance of aphids followed a clear 3-year cycle based on suction trap data covering a decade. Rhopalosiphum padi occurring at the end of the potato growing season was the most abundant species. The flight activity of Aphis fabae, the main vector of Potato virus Y in the region, and Aphis gossypii peaked in the beginning of potato growing season. CONCLUSIONS/SIGNIFICANCE: Detailed information was obtained on phenology of a large number aphid species, of which many are agriculturally important pests acting as vectors of plant viruses. Aphis gossypii is known as a pest in greenhouses, but our study shows that it occurs also in the field, even far in the north. The novel information on aphid phenology and ecology has wide implications for prospective pest management, particularly in light of climate change.

  15. Fractionated extracts of Russian wheat aphid eliciting defense responses in wheat. (United States)

    Lapitan, Nora L V; Li, You-Chun; Peng, Junhua; Botha, Anna-Maria


    It is hypothesized that the interaction between aphids and plants follows a gene-for-gene model. The recent appearance of several new Russian wheat aphid, Diuraphis noxia (Kurdjumov) (Homoptera: Aphididae), biotypes in the United States and the differential response of wheat, Triticum aestivum L., genotypes containing different resistance genes also suggest a gene-for-gene interaction. However, aphid elicitors remain unknown. This study was conducted to identify fractionated Russian wheat aphid extracts capable of eliciting differential responses between resistant and susceptible wheat genotypes. We extracted whole soluble compounds and separated proteins and metabolites from two Russian wheat aphid biotypes (1 and 2), injected these extracts into seedlings of susceptible wheat Gamtoos (dn7) and resistant 94M370 (Dn7), and determined phenotypic and biochemical plant responses. Injections of whole extract or protein extract from both biotypes induced the typical susceptible symptom, leaf rolling, in the susceptible cultivar, but not in the resistant cultivar. Furthermore, multiple injections with protein extract from biotype 2 induced the development of chlorosis, head trapping, and stunting in susceptible wheat. Injection with metabolite, buffer, or chitin, did not produce any susceptible symptoms in either genotype. The protein extract from the two biotypes also induced significantly higher activities of three defense-response enzymes (catalase, peroxidase, and beta-glucanase) in 94M370 than in Gamtoos. These results indicate that a protein elicitor from the Russian wheat aphid is recognized by a plant receptor, and the recognition is mediated by the Dn7-gene product. The increased activities of defense-response enzymes in resistant plants after injection with the protein fraction suggest that defense response genes are induced after recognition of aphid elicitors by the plant. PMID:17598566

  16. Species Diversity of Aphids (Homoptera: Aphididae and Coccinellids in Apple Orchards of Urmia, Northwest of Iran

    Directory of Open Access Journals (Sweden)

    Nouraddin Shayesteh


    Full Text Available Abundance and diversity of aphid and coccinellid species were monitored in apple orchards in Urmia during 2010 and 2011. In this study, eight aphid species were collected and identified in 2010 and nine were found in 2011, while only two coccinellid species were found in both years. In 2010, Aphis pomi (De. Geer was the most abundant aphid (55.5% followed by Dysaphis plantaginea (Passerini (34%. However, in 2011, Eriosoma lanigerum (Hausmann had the largest population (57% in apple orchards followed by D. plantaginea (21.5% and A. pomi (18%. Generally, more aphids were collected in June and July of 2010. However, aphid’s population in 2011 was high from mid-May until early October. Shannon and Simpson diversity indices were measured. The Shannon and Simpson indices of aphids and coccinellids in 2011 were more than those in 2010. Simpson index of aphids in 2010 and 2011 were 0.573 and 0.594, respectively, indicating that the possibility of selecting two different species of aphids was 57% in 2010 and 59% for 2011. Normal 0 false false false EN-US X-NONE AR-SA /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:6.0pt; mso-para-margin-right:0cm; mso-para-margin-bottom:6.0pt; mso-para-margin-left:0cm; text-align:justify; line-height:200%; mso-pagination:widow-orphan; font-size:12.0pt; font-family:"Times New Roman","serif"; mso-bidi-font-family:"B Lotus";}

  17. Potential exposure of a classical biological control agent of the soybean aphid, Aphis glycines, on non-target aphids in North America (United States)

    In summer 2007, the Asian parasitoid Binodoxys communis (Hymenoptera: Braconidae) was released in North America for control of the exotic soybean aphid, Aphis glycines (Homoptera: Aphididae). Despite its comparatively narrow host range, releases of B. communis may still constitute a risk to native a...

  18. Weed host specificity of the aphid, Aphis spiraecola: developmental and reproductive performance of aphids in relation to plant growth and leaf chemicals of the Siam weed, Chromolaena odorata. (United States)

    Agarwala, B K; Das, Jhuma


    Density, distribution, and nutritional quality of plants are the causal basis of host plant selection in aphids. Nutritional qualities of a plant vary according to its growth stage and also in response to seasonal variation. How host plant growth stages shape aphid performance was studied in Aphis spiraecola Patch (Homoptera: Aphididae) on the perennial Siam weed, Chromolaena odorata (L.) King and Robinson (Asterales: Asteraceae). This plant species is the preferred host in the hot and humid tropical parts of northeast and southern India. Variations in developmental and reproductive performances in apterous viviparous female aphids were recorded in relation to differences in leaf chemicals in different growth stages of C. odorata. Aphids reproduced at higher rates in the vegetative stage of C. odorata when developmental time was shortest, and fecundity was higher in a longer reproductive time. Intrinsic rate of increase and net reproductive rate were also recorded to be higher in the vegetative stage of the weed host. In the vegetative stage, leaves contained higher quantity of proteins and nitrogen, which are vital for insect reproduction. Results of this study have demonstrated that A spiraecola showed synchronization of its developmental and reproductive performances to growth stages of C. odorata, which occur in high abundance in the study area. PMID:22950746

  19. Individual and population variation in invertebrates revealed by Inter-simple Sequence Repeats (ISSRs

    Directory of Open Access Journals (Sweden)

    Patrick Abbot


    Full Text Available PCR-based molecular markers are well suited for questions requiring large scale surveys of plant and animal populations. Inter-simple Sequence Repeats or ISSRs are analyzed by a recently developed technique based on the amplification of the regions between inverse-oriented microsatellite loci with oligonucleotides anchored in microsatellites themselves. ISSRs have shown much promise for the study of the population biology of plants, but have not yet been explored for similar studies of animals. The value of ISSRs is demonstrated for the study of animal species with low levels of within-population variation. Sets of primers are identified which reveal variation in two aphid species, Acyrthosiphon pisum and Pemphigus obesinymphae, in the yellow fever mosquito Aedes aegypti, and in a rotifer in the genus Philodina.

  20. Featured Organism: Reductive Evolution in Bacteria: Buchnera sp., Rickettsia Prowazekii and Mycobacterium Leprae

    Directory of Open Access Journals (Sweden)

    Jo Wixon


    Full Text Available Obligate intracellular bacteria commonly have much reduced genome sizes compared to their nearest free-living relatives. One reason for this is reductive evolution: the loss of genes rendered non-essential due to the intracellular habitat. This can occur because of the presence of orthologous genes in the host, combined with the ability of the bacteria to import the protein or metabolite products of the host genes. In this article we take a look at three such bacteria whose genomes have been fully sequenced. Buchnera is an endosymbiont of the pea aphid, Acyrthosiphon pisum, the relationship between these two organisms being so essential that neither can reproduce in the absence of the other. Rickettsia prowazekii is the causative agent of louse-borne typhus in humans and Mycobacterium leprae infection of humans leads to leprosy. Both of these human pathogens have fastidious growth requirements, which has made them very difficult to study.

  1. Analysis of the Gut Microbes of the Chinese White Wax Scale Ericerus pela and Molecular Detection of Rickettsia%白蜡虫肠道微生物分析及立克次氏体分子检测

    Institute of Scientific and Technical Information of China (English)

    徐冬丽; 刘魏魏; 胡艳红; 杨璞; 陈晓鸣


    To understand the diversity of the gut microbes of Chinese white wax scale Ericerus pela, 16S rDNA clone library was constructed to analyze the gut microbes of the female E. pela adults. The results showed that, the gut of E. pela contained abundant of Rickettsia. Gut microbes Arsenophonus and Variovorax were also been identified. And Rickettsia was the main bacteria in gut of E. pela. The phylogenetic analysis of the 16S rDNA showed that, the Rickettsia from E. pela has close relationship with that of pea aphid Acyrthosiphon pisum. PCR amplification was performed using the specific primers for Rickettsia to detect infection in 30 male and 30 female individuals. The result showed that, the infected male and female were 24 and 12 respectively.

  2. Dicty_cDB: VSB832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 32 0.74 2 dna update 2004. 2.21 Homology vs Protein Score E Sequences producing significant alignments: (bit...krillpnvlkkvrfpnrllgryvkrslvr*kyslqsn*np rn*lnninnnnslyffffkkkkiilnkirnifik Homology vs CSM-cDNA Sco...Q) /CSM/VH/VHA4-A/VHA423Q.Seq.d/ 36 0.27 own update 2003. 1. 8 Homology vs DNA Sco...ago truncatula clone mth2-9n11, complete sequence. 38 0.36 3 AC025417 |AC025417.4 Genomic sequence for Arabidopsi... bacteria of aphid. 32 0.49 2 AP001118 |AP001118.1 Buchnera aphidicola str. APS (Acyrthosiphon pisum) genomic

  3. Coupling genetics and proteomics to identify aphid proteins associated with vector-specific transmission of Polerovirus (Luteoviridae) (United States)

    Cereal yellow dwarf virus-RPV (CYDV-RPV) is transmitted specifically by the aphids Rhopalosiphum padi and Schizaphis graminum in a circulative nonpropagative manner. The high level of vector-specificity results from the vector aphids having the functional components of the receptor-mediated endocyto...

  4. 77 FR 46373 - Field Release of Aphelinus glycinis for the Biological Control of the Soybean Aphid in the... (United States)


    ... the Biological Control of the Soybean Aphid in the Continental United States; Availability of an... release of Aphelinus glycinis for the biological control of the soybean aphid, Aphis glycines, in the... million acres alone in 2003, resulting in decreased soybean yields and greatly increased control...

  5. Biological control of cotton aphid (Aphis gossypii Glover) in cotton (inter)cropping systems in China; a simulation study.

    NARCIS (Netherlands)

    Xia, J.


    Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on insecticides against the cotton aphid in the past

  6. Biological Control of Aphid Using Fungal Culture and Culture Filtrates of Beauveria bassiana. (United States)

    Kim, Jeong Jun; Jeong, Gayoung; Han, Ji Hee; Lee, Sangyeob


    Aphids are one of the most destructive pests in crop production such as pepper, cucumber, and eggplants. The importance of entomopathogenic fungi as alternative pest control agents is increasing. Conidia of entomopathogenic fungi are influenced by environmental conditions, such as temperature and relative humidity, and cause slow and fluctuating mortality. These factors have prevented wider application and use of biocontrol agents. For investigation of means of mitigation of such problems, we conducted bioassays with 47 fungal culture filtrates in order to evaluate the potential of secondary metabolites produced by entomopathogenic fungi for use in aphid control. Among 47 culture filtrates cultured potato dextrose broth, filtrate of Beauveria bassiana Bb08 showed the highest mortality (78%) against green peach aphid three days after treatments. Filtrate of Bb08 cultured in Adamek's medium showed higher toxicity as 100% to third instar nymphs of the aphid compared with seven other filtrates cultured in different broths amended with colloidal chitin or oil. The culture filtrates and fungal cultures from media amended with colloidal chitin or oil had lower control efficacies than filtrates without these additives in three different media. These results indicate that the fungal culture fluid or culture filtrate of B. bassiana Bb08 cultured in Adamek's medium has potential for development as a mycopesticide for aphid control. PMID:24493943

  7. Predation determines different selective pressure on pea aphid host races in a complex agricultural mosaic.

    Directory of Open Access Journals (Sweden)

    Adalbert Balog

    Full Text Available Field assessments were conducted to examine the interplay between host plant and predation in complex agricultural mosaic on pea aphid clover and alfalfa races. In one experiment, we examined the relative fitness on clover race (CR and alfalfa race (AR pea aphids on broad bean, red clover and alfalfa alone. But because clover is typically grown in a more complex agricultural mosaic with alfalfa and broad bean, a second experiment was conducted to assess the fitness consequences under predation in a more complex agricultural field setting that also included potential apparent competition with AR pea aphids. In a third experiment we tested for the effect of differential host race density on the fitness of the other host race mediated by a predator effect. CR pea aphids always had fitness losses when on broad bean (had lower fitness on broad bean relative to red clover and fitness benefits when on red clover (higher fitness on red clover relative to broad bean, whether or not in apparent competition with alfalfa race aphids on bean and alfalfa. AR suffered fitness loss on both alfalfa and bean in apparent competition with CR on clover. Therefore we can conclude that the predation rate between host races was highly asymmetrical. The complexity of the agricultural mosaic thus can influence prey selection by predators on different host plants. These may have evolutionary consequences through context dependent fitness benefits on particular host plants.

  8. Virulence of Hypocreales fungi to pecan aphids (Hemiptera: Aphididae) in the laboratory. (United States)

    Shapiro-Ilan, David I; Cottrell, Ted E; Jackson, Mark A; Wood, Bruce W


    There is need for efficacious biocontrol agents for aphids in commercial orchards. As a preliminary step to this end we determined the virulence of several Hypocreales fungi to pecan aphids. In the first experiment we tested the virulence of Isaria fumosorosea (ARSEF 3581) blastospores to three pecan aphids Monellia caryella, Melanocallis caryaefoliae, and Monelliopsis pecanis under laboratory conditions. Rates of 1x10(7) or 1x10(8) spores per ml were applied in 2 ml via a spray tower to 90 mm Petri dishes containing 10 aphids each. Mortality and mycosis were determined after 24, 48 and 72 h. Treatment effects were observed by 48 h post-application, and by 72 h the higher application rate caused >90% mortality and mycosis in M. caryella and M. caryaefoliae, whereas Metarhizium anisopliae (F52 strain). Results in Experiment 3 indicated the highest virulence in I. fumosorosea 3581 blastospores and M. anisopliae (F52) followed by I. fumosorosea (20874) conidia. The detection of pathogenicity to pecan aphids establishes the potential for commercial usage and additional study. Results reported here will narrow treatments to test in future greenhouse and field trials. PMID:18675272

  9. Ecological Study of Two Aphid Vectors of the Sugar-Beet Virus

    International Nuclear Information System (INIS)

    The dispersal of Myzus persicae Sulz and Aphis fabae Scop, labelled with 32P was studied from 1963 to 1965 in sugar-beet plots. The aphids were reared on beets infected with a virus causing severe yellowing and sprinkled with a solution containing 1 mCi of sodium orthophosphate (32P). Aphids which remained for 24 hours on these plants were significantly labelled, as were also their first-generation descendants. The activity of the insects was recorded by a gas-flow detector with a low background. The radioactive beets infected with the virus and laden with aphids were placed in the centre of the plots. After successively increasing dispersal times, the largest possible number of aphids was captured in each test, either manually or in traps. The co-ordinates and the precise identification of each labelled aphid were entered on charts, some of which are discussed by the authors. The experiments demonstrated the mobility of the aplerae, which were found at average distances of 6.5 and 7 metres for Myzus persicae and Aphis fabae, respectively. However, some apterae of both species were found at distances of over 15 metres after the same period. The role of the winged species as virus carries over short distances should not be underestimated. The active character of both apterae and winged species is emphasized. (author)

  10. Dicty_cDB: Contig-U06802-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2 map 4229098... 96 3e-16 1 ( CN760766 ) ID0AAA29BG03RM1 ApMS Acyrthosiphon pisum cDNA clo... 46 0.26 1 ( AC...1 ( CV844576 ) ID0ADD9DF11RM1 ID0ADD Acyrthosiphon pisum cDNA cl... 42 4.1 1 ( CV844350 ) ID0ADD9BA03RM1 ID0ADD Acyrthosiphon... pisum cDNA cl... 42 4.1 1 ( CV844286 ) ID0ADD9AC08RM1 ID0ADD Acyrthosiphon pisum cDNA cl...... 42 4.1 1 ( CV844220 ) ID0ADD8DE12RM1 ID0ADD Acyrthosiphon pisum cDNA cl... 42 4....1 1 ( CV844169 ) ID0ADD8DA08RM1 ID0ADD Acyrthosiphon pisum cDNA cl... 42 4.1 1 ( CV844153 ) ID0ADD8CH04RM1 ID0ADD Acyrthosiphon

  11. Photosynthesis and growth responses of pea Pisum sativum L. under heavy metals stress

    Institute of Scientific and Technical Information of China (English)

    Sabrine Hattab; Boutheina Dridi; Lassad Chouba; Mohamed Ben Kheder; Hamadi Bousetta


    The present work aims to study the physiological effects of cadmium (Cd) and copper (Cu) in pea (Pisum sativum).Pea plants were exposed to increasing doses of cadmium chloride (CdCl_2) and copper chloride (CuCl_2) for 20 d.The examined parameters,namely root and shoot lengths,the concentration of photosynthetic pigments and the rate of photosynthesis were affected by the treatments especially with high metals concentrations.The analysis of heavy metals accumulation shows that leaves significantly accumulate cadmium for all the tested concentrations.However,copper was significantly accumulated only with the highest tested dose.This may explain the higher inhibitory effects of cadmium on photosynthesis and growth in pea plants.These results are valuable for understanding the biological consequences of heavy metals contamination particularly in soils devoted to organic agriculture.

  12. Removal of chromium (III) and zinc(II) by using pods of pisum sativum (garden peas)

    International Nuclear Information System (INIS)

    The adsorption of Chromium(III) and Zinc(II) on ground pods of Pisum sativum (Garden peas) have been studied. The effects of adsorbent dose, pH, contact time and agitation speed on adsorption were studied. The study has revealed that pea pods have high metal removal efficiency. Cr(III) has been removed up to 80.92% and Zn(II) up to 75.11%. Adsorption equilibriums for both metals were developed, which were well described by the Langmuir and Freundlich isotherms. The maximum amounts of Cr(III) and Zn(II) adsorbed (Qmax), as evaluated by Langmuir isotherms were 1.88 mg and 1.45 mg per gram of pea pod's powder, respectively. It is anticipated that waste materials like pea pods can be used for removal of toxic metals like Cr(III) and Zn(II) from industrial effluents/waste waters. (author)

  13. Essential elements and cadmium and lead in fresh and canned peas (Pisum sativum L. )

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, A.; Williams, H.L.; Cooler, F.W.

    Sixteen essential elements along with cadmium and lead were determined in fresh and canned peas (Pisum sativum L.). Samples were taken during the canning process to determine where changes in element content occurred. The concentration of each sample was compared statistically to other samples taken at different stages of the process. Canned peas contained significantly lower concentrations of calcium, copper, iron, magnesium, manganese, phosphorus, potassium, silicon, and zinc than fresh peas. As sodium chloride was added during the canning process, higher concentrations of chloride and sodium were found in the canned product. A 100g serving of drained canned peas supplied less than 11% of the RDAs or of the estimated safe and adequate daily dietary intakes except chloride and sodium, ranged from 24-86%.

  14. Identification of the 64 kilodalton chloroplast stromal phosphoprotein as phosphoglucomutase. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Salvucci, M.E.; Drake, R.R.; Broadbent, K.P.; Haley, B.E. (Univ. of Kentucky, Lexington (USA)); Hanson, K.R.; McHale, N.A. (Connecticut Agricultural Experiment Station, New Haven, CT (USA))


    Phosphorylation of the 64 kilodalton stromal phosphoprotein by incubation of pea (Pisum sativum) chloroplast extracts with ({gamma}-{sup 32}P)ATP decreased in the presence of Glc-6-P and Glc-1,6-P{sub 2}, but was stimulated by glucose. Two-dimensional gel electrophoresis following incubation of intact chloroplasts and stromal extracts with ({gamma}-{sup 32}P)ATP, or incubation of stromal extracts and partially purified phosphoglucomutase (EC with ({sup 32}P)Glc-1-P showed that the identical 64 kilodalton polypeptide was labeled. A 62 kilodalton polypeptide was phosphorylated by incubation of tobacco (Nicotiana sylvestris) stromal extracts with either ({gamma}-{sup 32}P)ATP or ({sup 32}P)Glc-1-P. In contrast, an analogous polypeptide was not phosphorylated in extracts from a tobacco mutant deficient in plastid phosphoglucomutase activity. The results indicate that the 64 (or 62) kilodalton chloroplast stromal phosphoprotein is phosphoglucomutase.

  15. Crystallization and preliminary X-ray analysis of eukaryotic initiation factor 4E from Pisum sativum

    International Nuclear Information System (INIS)

    Crystals of N-terminally truncated eIF4E from pea were obtained and X-ray data were recorded in-house to a resolution of 2.2 Å. Crystals of an N-terminally truncated 20 kDa fragment of Pisum sativum eIF4E (ΔN-eIF4E) were grown by vapour diffusion. X-ray data were recorded to a resolution of 2.2 Å from a single crystal in-house. Indexing was consistent with primitive monoclinic symmetry and solvent-content estimations suggested that between four and nine copies of the eIF4E fragment were possible per crystallographic asymmetric unit. eIF4E is an essential component of the eukaryotic translation machinery and recent studies have shown that point mutations of plant eIF4Es can confer resistance to potyvirus infection

  16. Cultivar and Rhizobium Strain Effects on the Symbiotic Performance of Pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Skøt, Leif


    The symbiotic performance of four pea (Pisum sativum L.) cultivars in combination with each of four strains of Rhizobium leguminosarum was studied in growth chamber experiments in order to estimate the effects of cultivars, strains and cultivar × strain interaction on the variation in dry weight, N...... content and dry weight/N ratio. At harvest 63 days after planting, cultivars accounted for 75% of the variation in dry weight, while the Rhizobium strains accounted for 63% of the variation in N-content and 70% of the variation in dry weight/N ratio. Cultivar × strain interactions were statistically...... significant, but of minor quantitative importance, accounting for 5–15% of the total variation. Rhizobium strains also influenced the partitioning of N between reproductive and vegetative plant parts and between root and shoot biomass....

  17. Sources of reducing equivalents for nitrite reductase in Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus


    Full Text Available Glucose-6-phosphate and NADP+ as well as malic acid and NADP+ present in the incubation mixture enhanced nitrite reductase (EC activity in Pisum arvense roots. This was manifested by a depression of the nitrite level in the tissues and an increased reduction of nitrites by plastids isolated from P. arvense roots. A marked stimulation of plastid malate dehydrogenase was also observed under the influence of nitrates present in the medium. These results suggest that pyridin nucleotides utilised by NiR during nitrite reduction may be formed not only in processes of glucose-6-phosphate oxidation in the pentosephosphate cycle, but also of malic acid by NADP+-dependent malate dehydrogenase.

  18. Identification of top-down forces regulating cotton aphid population growth in transgenic Bt cotton in central China.

    Directory of Open Access Journals (Sweden)

    Peng Han

    Full Text Available The cotton aphid Aphis gossypii Glover is the main aphid pest in cotton fields in the Yangtze River Valley Cotton-planting Zone (YRZ in central China. Various natural enemies may attack the cotton aphid in Bt cotton fields but no studies have identified potential specific top-down forces that could help manage this pest in the YRZ in China. In order to identify possibilities for managing the cotton aphid, we monitored cotton aphid population dynamics and identified the effect of natural enemies on cotton aphid population growth using various exclusion cages in transgenic Cry1Ac (Bt+CpTI (Cowpea trypsin inhibitor cotton field in 2011. The aphid population growth in the open field (control was significantly lower than those protected or restricted from exposure to natural enemies in the various exclusion cage types tested. The ladybird predator Propylaea japonica Thunberg represented 65% of Coccinellidae predators, and other predators consisted mainly of syrphids (2.1% and spiders (1.5%. The aphid parasitoids Aphidiines represented 76.7% of the total count of the natural enemy guild (mainly Lysiphlebia japonica Ashmead and Binodoxys indicus Subba Rao & Sharma. Our results showed that P. japonica can effectively delay the establishment and subsequent population growth of aphids during the cotton growing season. Aphidiines could also reduce aphid density although their impact may be shadowed by the presence of coccinellids in the open field (likely both owing to resource competition and intraguild predation. The implications of these results are discussed in a framework of the compatibility of transgenic crops and top-down forces exerted by natural enemy guild.

  19. Epigenetic Histone Marks of Extended Meta-Polycentric Centromeres of Lathyrus and Pisum Chromosomes. (United States)

    Neumann, Pavel; Schubert, Veit; Fuková, Iva; Manning, Jasper E; Houben, Andreas; Macas, Jiří


    Species of the legume genera Lathyrus and Pisum possess chromosomes that exhibit a unique structure of their centromeric regions, which is clearly apparent during metaphase by the formation of extended primary constrictions which span up to a third of the length of the chromosome. In addition, these species express two different variants of the CenH3 protein which are co-localized in multiple domains along the poleward surface of the primary constrictions. Here, we show that the constrictions represent a distinct type of chromatin differing from the chromosome arms. In metaphase, histone phosphorylation patterns including H3S10ph, H3S28ph, and H3T3ph were observed along the entire constriction, in a way similar to holocentric chromosomes. On the other hand, distribution of phosphorylated H2AT120 was different from that previously reported from either, holocentric and monocentric chromosomes, occurring at chromatin surrounding but not overlapping CenH3 domains. Since some of these phosphorylations play a role in chromatid cohesion, it can be assumed that they facilitate correct chromosome segregation by ensuring that multiple separate CenH3 domains present on the same chromatid are oriented toward the same pole. The constrictions also displayed distinct patterns of histone methylation marks, being enriched in H3K9me2 and depleted in H3K4me3 and H3K27me2 compared to the chromosome arms. Super-resolution fluorescence microscopy revealed that although both CenH3 protein variants are present in all CenH3 domains detected on metaphase chromosomes, they are only partially co-localized while there are chromatin subdomains which are mostly made of only one CenH3 variant. Taken together, these data revealed specific features of extended primary constrictions of Lathyrus and Pisum and support the idea that they may represent an intermediate stage between monocentric and holocentric chromosomes. PMID:26973677

  20. Epigenetic histone marks of extended meta-polycentric centromeres of Lathyrus and Pisum chromosomes

    Directory of Open Access Journals (Sweden)

    Pavel eNeumann


    Full Text Available Species of the legume genera Lathyrus and Pisum possess chromosomes that exhibit a unique structure of their centromeric regions, which is clearly apparent during metaphase by the formation of extended primary constrictions which span up to a third of the length of the chromosome. In addition, these species express two different variants of the CenH3 protein which are co-localized in multiple domains along the poleward surface of the primary constrictions. Here we show that the constrictions represent a distinct type of chromatin differing from the chromosome arms. In metaphase, histone phosphorylation patterns including H3S10ph, H3S28ph and H3T3ph were observed along the entire constriction, in a way similar to holocentric chromosomes. On the other hand, distribution of phosphorylated H2AT120 was different from that previously reported from either, holocentric and monocentric chromosomes, occurring at chromatin surrounding but not overlapping CenH3 domains. Since some of these phosphorylations play a role in chromatid cohesion, it can be assumed that they facilitate correct chromosome segregation by ensuring that multiple separate CenH3 domains present on the same chromatid are oriented towards the same pole. The constrictions also displayed distinct patterns of histone methylation marks, being enriched in H3K9me2 and depleted in H3K4me3 and H3K27me2 compared to the chromosome arms. High resolution fluorescence microscopy revealed that although both CenH3 protein variants are present in all CenH3 domains detected on metaphase chromosomes, they are only partially co-localized while there are chromatin subdomains which are mostly made of only one CenH3 variant. Taken together, these data revealed specific features of extended primary constrictions of Lathyrus and Pisum and support the idea that they may represent an intermediate stage between monocentric and holocentric chromosomes.

  1. Comprehensive transcriptome analysis of the highly complex Pisum sativum genome using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Bräutigam Andrea


    Full Text Available Abstract Background The garden pea, Pisum sativum, is among the best-investigated legume plants and of significant agro-commercial relevance. Pisum sativum has a large and complex genome and accordingly few comprehensive genomic resources exist. Results We analyzed the pea transcriptome at the highest possible amount of accuracy by current technology. We used next generation sequencing with the Roche/454 platform and evaluated and compared a variety of approaches, including diverse tissue libraries, normalization, alternative sequencing technologies, saturation estimation and diverse assembly strategies. We generated libraries from flowers, leaves, cotyledons, epi- and hypocotyl, and etiolated and light treated etiolated seedlings, comprising a total of 450 megabases. Libraries were assembled into 324,428 unigenes in a first pass assembly. A second pass assembly reduced the amount to 81,449 unigenes but caused a significant number of chimeras. Analyses of the assemblies identified the assembly step as a major possibility for improvement. By recording frequencies of Arabidopsis orthologs hit by randomly drawn reads and fitting parameters of the saturation curve we concluded that sequencing was exhaustive. For leaf libraries we found normalization allows partial recovery of expression strength aside the desired effect of increased coverage. Based on theoretical and biological considerations we concluded that the sequence reads in the database tagged the vast majority of transcripts in the aerial tissues. A pathway representation analysis showed the merits of sampling multiple aerial tissues to increase the number of tagged genes. All results have been made available as a fully annotated database in fasta format. Conclusions We conclude that the approach taken resulted in a high quality - dataset which serves well as a first comprehensive reference set for the model legume pea. We suggest future deep sequencing transcriptome projects of species

  2. Factors contributing to the poor performance of a soybean aphid parasitoid Binodoxys communis (Hymenoptera: Braconidae) on an herbivore resistant soybean cultivar. (United States)

    Ballman, E S; Ghising, K; Prischmann-Voldseth, D A; Harmon, J P


    Host plant resistance and biological control are important components of integrated pest management programs. However, plants expressing resistance to herbivores may also have direct or indirect negative effects on natural enemies simultaneously providing pest suppression. Soybean aphids (Aphis glycines Matsumura) are invasive and serious pests of soybean (Glycine max L.) in the United States. Several soybean lines with aphid resistance have been identified, but the long-term impact of these resistant plants on soybean aphid biological control agents is uncertain. In a previous study, we reported that a soybean aphid parasitoid, Binodoxys communis (Gahan) had lower mummy production on resistant plants compared with a near isogenic susceptible soybean line, but the reason for this was unclear. Therefore, we examined three possible mechanisms to explain these findings: 1) resistant plants directly impact wasp emergence and longevity, 2) varying aphid density influences parasitism rates, and 3) resistant plants indirectly affect wasp development through reduced aphid longevity. We found that parasitoids in this study were not directly influenced by resistant cultivars, as there was no difference in wasp adult emergence or longevity between resistant and susceptible plants. There was also no significant effect of aphid density on mummy production over the range of aphid densities we tested. However, aphids on resistant plants had significantly shorter lifespans and were unable to survive long enough to develop into mummies compared with aphids on susceptible plants. We discuss these results and possible implications for integrating biological control and host plant resistance within soybean aphid integrated pest management programs. PMID:23321088


    Directory of Open Access Journals (Sweden)

    B. R. PATEL


    Full Text Available An investigation was carried out during 2008-09 to evaluate the different insecticides against aphid, Aphisgossypii Glover infesting isabgol (Plantago ovata crop under field condition at Sardarkrushinagar, S. D. A. U.,Dantiwada. The result of the field study revealed that, among all the chemical and botanical insecticides used,carbosulfan @ 0.05 per cent was found to be most effective by recording lowest population of aphid as per aphidindexing method (0.99 A. I. with the highest seed yield, 11.24 q/ha and neem oil @ 0.5 per cent was superiorthan other botanical recording (1.83 A. I. with a maximum 7.21 q/ha seed yield. Thus, from the overall resultsit can be concluded that the carbosulfan @ 0.05 and neem oil 0.5 per cent proved most effective for themanagement of aphid A. gossypii in isabgol crop.

  4. Selection of Nothofagus host trees by the aphids Neuquenaphis staryi and Neuquenaphis edwardsi. (United States)

    Russell, Graeme B; Faundez, Eric H; Niemeyer, Hermann M


    Leaf volatiles were collected from three Nothofagus species growing in close proximity in Los Ruiles National Reserve, Chile. The volatile preparation from leaves of No. alessandrii were attractive to the specialist aphid, Neuquenaphis staryi, but not to the generalist aphid, Ne. edwardsi, while the volatile preparations of No. dombeyi and No. glauca were attractive to Ne. edwardsi, but not to Ne. staryi. This reflects the pattern of aphid/host-plant associations. Alpha-Agarofuran was found to occur in all leaf volatile preparations and was shown by electroantennography and olfactometry to be attractive for both Neuquenaphis spp., suggesting it may be the Nothofagus host-recognition factor for Neuquenaphis. The factor(s) mediating Ne. stayi's specialization on No. alessandrii remain to be identified. PMID:15672667

  5. Wheat Nitrogen Fertilisation Effects on the Performance of the Cereal Aphid Metopolophium dirhodum

    Directory of Open Access Journals (Sweden)

    Alan F. J. Gash


    Full Text Available The effects of five rates of nitrogen fertiliser applications on the performance of the cereal aphid Metopolophium dirhodum on winter wheat, within the range of rates recommended for UK crops, were investigated over two seasons in field-grown crops and also on plants grown in the glasshouse. Longevity was unaffected by the level of fertilisation, but aphid intrinsic rate of increase and fecundity increased with each level applied. In the second field season, when a higher upper limit was used, many of these increases were significant. A previously unreported finding for this species was that there was a significant decrease in fecundity for the highest rate of fertilisation. Results for the glasshouse-reared aphids followed a similar pattern to those in the field, and overall they underline recent reports in the literature of the negative effects of high nutrient concentrations on the performance of herbivorous insects. The underlying reasons for these are discussed.

  6. Changes in large-scale climate alter spatial synchrony of aphid pests (United States)

    Sheppard, Lawrence W.; Bell, James R.; Harrington, Richard; Reuman, Daniel C.


    Spatial synchrony, the tendency of distant populations to fluctuate similarly, is a major concern in ecology. Except in special circumstances, researchers historically had difficulty identifying drivers of synchrony in field systems. Perhaps for this reason, the possibility that changes in large-scale climatic drivers may modify synchrony, thereby impacting ecosystems and human concerns, has been little examined. Here, we use wavelets to determine environmental drivers of phenological synchrony across Britain for 20 aphid species, most major crop pests. Consistently across species, changes in drivers produced large changes in aphid synchrony. Different drivers acted on different timescales: using a new wavelet analogue of the Moran theorem, we show that on long timescales (>4 years), 80% of synchrony in aphid first flights is due to synchrony in winter climate; but this explanation accounts for less short-timescale (populations, through altered Moran effects.

  7. Lysiphlebus orientalis (Hymenoptera, Braconidae), a new invasive aphid parasitoid in Europe - evidence from molecular markers. (United States)

    Petrović, Andjeljko; Mitrović, Milana; Starý, Petr; Petrović-Obradović, Olivera; Zikić, Vladimir; Tomanović, Zeljko; Vorburger, Christoph


    We report the occurrence of Lysiphlebus orientalis in Serbia, an aphid parasitoid from the Far East that is new to Europe and has the potential to become invasive. Our finding based on morphological characters is confirmed by analyses of mitochondrial cytochrome oxidase subunit I sequences. An increase in number and an expansion of the host range were observed during field studies over the past two years, and it is determined that the current host range encompasses nine aphid hosts on 12 different host plants, forming 13 tri-trophic associations. A host range determined for European populations of L. orientalis appears wider compared with that in its Far Eastern native habitats where Aphis glycines Mats. is the sole known host. Moreover, it overlaps considerably with the host ranges of European parasitoids that play an important role in the natural control of pest aphids. PMID:23448286

  8. Reproduction and dispersal in an ant-associated root aphid community

    DEFF Research Database (Denmark)

    Ivens, A.B.F.; Kronauer, Daniel Jan Christoph; Pen, I.;


    population viscosity is high and winged aphids rare, consistent with infrequent horizontal transmission between ant host colonies. The absence of the primary host shrub (Pistacia) may explain the absence of sex in three of the studied species, but elm trees (Ulmus) that are primary hosts of the fourth...... above ground, whereas dispersal constraints and dependence on ant-tending may differentially affect the costs and benefits of sex in subterranean aphids. Here, we studied reproductive mode and dispersal in a community of root aphids that are obligately associated with the ant Lasius flavus. We assessed...... the genetic population structure of four species (Geoica utricularia, Tetraneura ulmi, Forda marginata and Forda formicaria) in a Dutch population and found that all species reproduce predominantly if not exclusively asexually, so that populations consist of multiple clonal lineages. We show that...

  9. Characterisation of aphid myrosinase and degradation studies of glucosinolates. (United States)

    Francis, Frédéric; Lognay, Georges; Wathelet, Jean-Paul; Haubruge, Eric


    Myrosinase from Brevicoryne brassicae was purified by ammonium sulfate fractionation, dialysis, and chromatography on a DEAE column. The chromatography yielded a single peak and a 115.6-fold purification. Further FPLC gel filtration gave a single peak at 120 kDa. Denaturing SDS/PAGE of the protein revealed a single band at 60 kDa, indicating that the native B. brassicae myrosinase is a dimer. Kinetic parameters towards 8 glucosinolates were calculated. Strong differences of V(max) and K(m) were observed depending on the substrate. Degradation products of each glucosinolate were identified and quantified by GC-MS and GLC-FID, respectively. Using both crude aphid homogenates and purified myrosinase, two unique hydroxyglucosinolates, 3-butenyl- and benzyl-isothiocyanates were identified from progoitrin ((2S)-2-hydroxybut-3-enyl-glucosinolate) and sinalbin (4-hydroxybenzyl-glucosinolate) degradation respectively. Addition of ascorbic acid to the reaction mixtures containing sinalbin and progoitrin caused the production of hydroxylated degradation products usually associated with plant myrosinase metabolisation. The occurrence of the myrosinase system in B. brassicae is discussed in terms of similar allelochemical adaptation between the herbivore and its host plant. PMID:12125058

  10. Role of terpenes from aphid-infested potato on searching and oviposition behavior of Episyrphus balteatus

    Institute of Scientific and Technical Information of China (English)



    To cope with pathogen and insect attacks, plants develop different mechanismsof defence, in both direct (physical and chemical) and indirect ways (attractive volatiles toentomophagous beneficials). Plants are then able to express traits that facilitate "top-down"control of pests by attracting herbivore predators. Here we investigate the indirect defencemechanism of potato plants by analyzing the volatile patterns of both healthy and aphidinfested plants. Important changes in the emitted terpene pattern by the Myzus persicaeinfested host plant were observed. Using Solid Phase MicroExtraction (SPME) and GC-MS,the (E)-β-farnesene (EBF) appeared to be emitted by aphid-infested potato and not byhealthy plants. To assess the infochemical role of these volatile releases after aphid damageon the aphidophagous predators Episyrphus balteatus, the hoverfly foraging behavior wasassessed using the Observer 5.0 software (Noldus, Wageningen, The Netherlands). Aphidfree potato plants were also used as a control volatile source in the predator behavioral study.While aphid-infested plants induced efficient searching and acceptation behaviors leadingto egg-laying, no kairomonal effect of healthy potato plants was observed, leading to longerimmobility durations and shorter searching periods in the net cage. High oviposition rate ofE. balteatus was observed when aphid-infested potato was used (mean of 48.9 eggs perlaying and per female). On the other hand, no egg was produced by the hoverfly on healthyaphid-free plants. The E. balteatus foraging and reproductive behaviors according to thevolatile emission from aphid-infested plants are discussed in relation to the potential use ofactive infochemical molecules in integrated aphid pest management.

  11. Variation in resistance mechanisms to the green peach aphid among different Prunus persica commercial cultivars. (United States)

    Verdugo, J A; Méndez, T; Ortiz-Martínez, S A; Cumsille, R; Ramírez, C C


    ABSTRACT Peaches and nectarines are frequently attacked by the green peach aphid Myzus persicae (Sulzer), with significant negative impacts on fruit production. The genetic variability of resistance to this aphid among commercial cultivars of Prunus persica (L.) Batsch and Prunus persica variety nectarina was evaluated in this study. In total, 16 cultivars of P. persica were selected to evaluate the occurrence and population growth rate of M. persicae in commercial orchards, as well as in no-choice and probing behavior laboratory assays. The results showed variability between cultivars in resistance and susceptibility to M. persicae, with three cultivars exhibiting different signatures of resistance. The peach cultivar 'Elegant Lady' exhibited a low occurrence of aphids in the orchard, a low rate of growth, moderate leaf-rejection in a no-choice test and a higher number and longer period of salivation into sieve elements, suggesting resistance at the phloematic level. The nectarine cultivar 'August Red' also exhibited low aphid occurrence in the orchard, a low rate of growth, and resistance at the prephloem and phloem levels. Finally, the nectarine 'July Red-NS92' exhibited a low occurrence of aphids in the orchard, a higher number of rejections in no-choice assays and no ingestion of phloem during the probing behavior experiments, suggesting prephloematic resistance. The rest of the cultivars studied exhibited clear susceptibility. Hence, different resistance mechanisms are apparent among the studied cultivars. The information gathered in this study regarding the resistance to M. persicae may assist breeding programs aimed at increasing aphid resistance to peaches and nectarines. PMID:23156185

  12. Relationship between the abundance of aphids and their natural enemies in cereal fields and landscape composition

    Directory of Open Access Journals (Sweden)

    Diab Al Hassan


    Full Text Available We investigated, over the course of two years, the association between the abundance of aphids and their natural carabid enemies and landscape, which may help in the development of effective strategies for reducing the incidence of aphid outbreaks in agricultural crops. This was undertaken in 12 wheat and 12 maize fields each year in an agricultural landscape in western France. Our study area was characterized by hedgerows surrounding arable fields and permanent grassland. Some areas have not changed much for several decades, while field enlargement and removal of hedges occurred in some areas following agricultural intensification. This paper aims to determine if the abundance of aphids in crops (either directly, or indirectly via their natural enemies is associated with the landscape around fields and if so, is it dependent on the landscape scale considered. We observed that the abundance of aphids in fields was associated with landscape composition at a large scale (500 m and 800 m. There was a positive correlation between the abundance of aphids and the proportion of the area under woodland and grassland at these scales. There was a negative correlation between the abundance of carabids and the proportion of grassland and hedgerow around crop fields. The species richness of carabids was positively correlated with the proportion of hedgerows. We found that the abundance of aphids in wheat fields was negatively and in maize fields positively associated with the proportion under grass strips. At a large scale carabid abundance in both types of culture was positively correlated with the proportion under grass strips.

  13. Establishment of Lipolexis oregmae (Hymenoptera: Aphidiidae) in a classical biological control program directed against the brown citrus aphid (Homoptera: Aphididae) in Florida

    International Nuclear Information System (INIS)

    The parasitoid Lipolexis oregmae Gahan (introduced as L. scutellaris Mackauer) was imported from Guam, evaluated in quarantine, mass reared, and released into citrus groves in Florida in a classical biological control program directed against the brown citrus aphid, Toxoptera citricida Kirkaldy. Releases of 20,200, 12,100, and 1,260 adults of L. oregmae were made throughout Florida during 2000, 2001, and 2002, respectively. To determine if L. oregmae had successfully established, surveys were conducted throughout the state beginning in the summer of 2001 and continuing through the summer of 2003. Parasitism during 2001 and 2002 was evaluated by holding brown citrus aphids in the laboratory until parasitoid adults emerged. Lipolexis oregmae was found in 10 sites in 7 counties and 4 sites in 3 counties with parasitism rates ranging from 0.7 to 3.3% in 2001 and 2002, respectively. Laboratory tests indicated that high rates of mortality occurred if field-collected parasitized aphids were held in plastic bags, so a molecular assay was used that allowed immature L. oregmae to be detected within aphid hosts immediately after collection. The molecular assay was used in 2003 with the brown citrus aphids and with other aphid species collected from citrus, weeds, and vegetables near former release sites; immatures of L. oregmae were detected in black citrus aphids, cowpea aphids, spirea aphids, and melon aphids, as well as in the brown citrus aphid, in 4 of 8 counties sampled, with parasitism ranging from 2.0 to 12.9%, indicating that L. oregmae is established and widely distributed. Samples taken in Polk County during Oct 2005 indicated that L. oregmae has persisted. The ability of L. oregmae to parasitize other aphid species on citrus, and aphids on other host plants, enhances the ability of L. oregmae to persist when brown citrus aphid populations are low. (author)

  14. New invasive species of aphids (Hemiptera, Aphididae in Serbia and Montenegro

    Directory of Open Access Journals (Sweden)

    Petrović-Obradović Olivera


    Full Text Available Three new invasive species of aphids have been found in Serbia: Chaitophorus populifolli Essig, Myzocallis walshii (Monell and Trichosiphonaphis polygonifoliae (Shinji and two have been found in Montenegro: Aphis illinoisensis Shimer and Tinocallis kahawaluokalani (Kirkaldy. A. illinoisensis is a pest of the grapevine, T. polygonifoliae, feeds on a decorative shrub (Lonicera and the other three feed on trees (Populus, Quercus and Lagerostroemia. Three of the species are American aphids and two are of Asian origin. Their morphology, illustrated by original drawings and data on the biology and distribution are given. .

  15. First record of the adventive oriental aphid Schizaphis piricola (Matsumura, 1917 (Hemiptera, Aphididae in Europe

    Directory of Open Access Journals (Sweden)

    Nicolás Pérez-Hidalgo


    Full Text Available The oriental aphid Schizaphis piricola Matsumura, is recorded for the first time in Europe, on the ornamental pear tree Pyrus calleryana in landscaped areas in Madrid (Spain. Data on the morphology of the primary host (apterous and alate fundatrigeniae and fundatrices, and their biology and distribution are given. The keys for identifying species of Schizaphis (Schizaphis in the Iberian Peninsula are updated. Two species of aphids are also recorded for the first time on Pyrus calleryana: S. piricola and Aphis pomi.

  16. AphidAtlas: avancées récentes


    Bretaudeau, Anthony; Dameron, Olivier; Legeai, Fabrice; Rahbé, Yves


    AphidAtlas est une ressource informatique dédiée à la gestion des données anatomiques et développementales des pucerons (sur un plan d’organisation homologue des insectes). Ces informations anatomiques, morphologiques et de développement, représentées par un vocabulaire contrôlé et structuré (ontologie) sont construites pour relier les base génomiques comme AphidBase ( et les données -omiques (EST, RNA-Seq, microarrays, protéomique) produites par les biologistes. Ces...

  17. Comparative analysis of Solanum stoloniferum responses to probing by the green peach aphid Myzus persicae and the potato aphid Macrosiphum euphorbiae

    Institute of Scientific and Technical Information of China (English)

    Adriana E.Alvarez; Viviana G.Broglia; Anahí M.Alberti D'Amato; Doret Wouters; Edwin van der Vossen; Elisa Garzo; W.Fred Tjallingii


    Plants protect themselves against aphid attacks by species-specific defense mechanisms.Previously,we have shown that Solanum stoloniferum Schlechtd has resistance factors to Myzus persicae Sulzer (Homoptera:Aphididae) at the epidermal/mesophyll level that are not effective against Macrosiphum euphorbiae Thomas (Homoptera:Aphididae).Here,we compare the nymphal mortality,the pre-reproductive development time,and the probing behavior of M.persicae and M.euphorbiae on S.stoloniferum and Solanum tuberosum L.Furthermore,we analyze the changes in gene expression in S.stoloniferum 96 hours post infestation by either aphid species.Although the M.euphorbiae probing behavior shows that aphids encounter more probing constrains on phloem activities-longer probing and salivation time-on S.stoloniferum than on S.tuberosum,the aphids succeeded in reaching a sustained ingestion of phloem sap on both plants.Probing by M.persicae on S.stoloniferum plants resulted in limited feeding only.Survival of M.euphorbiae and M.persicae was affected on young leaves,but not on senescent leaves of S.stoloniferum.Infestation by M.euphorbiae changed the expression of more genes than M.persicae did.At the systemic level both aphids elicited a weak response.Infestation of S.stoloniferum plants with a large number ofM.persicae induced morphological changes in the leaves,leading to the development of pustules that were caused by disrupted vascular parenchyma and surrounding tissue.In contrast,an infestation by M.euphorbiae had no morphological effects.Both plant species can be regarded as good host for M.euphorbiae,whereas only S.tuberosum is a good host for Mo persicae and S.stoloniferum is not.Infestation of S.stoloniferum by M.persicae or M.euphorbiae changed the expression of a set of plant genes specific for each of the aphids as well as a set of common genes.

  18. The effect of inhibitors of plasma membrane H+ - ATPase and oxidoreductases on NH4+ uptake by Pisum arvense roots


    Genowefa Kubik-Dobosz; Aleksandra Turska; Halina Lekacz; Waldemar Karcz; Józef Buczek


    The effect of inhibitors of plasma membrane oxidoreductases (quinacrine and dicumarol) and H+-ATPase (dicyclohexylcarbodiimide and orthovanadate) on ammonium uptake by Pisum arvense seedlings and the activities of H+-ATPase and NADH-ferricyanide oxidoreductase was investigated. The uptake solution contained 50 µM NH4+. In I h experiments, quinacrine and dicumarol depressed strongly and irreversibly the rate of NH4+ uptake and markedly inhibited the activity of NADH-ferri-cyanide oxidoreductas...

  19. Sink-source interactions between a galling aphid and its narrowleaf cottonwood host: Within and between plant variation

    International Nuclear Information System (INIS)

    The authors examined within and between plant variation in the capacity of the leaf gallin aphid, Pemphigus betae, to manipulate the sink-source translocation patterns of its host, narrowleaf cottonwood (Populus angustifolia). Within a plant, a series of 14C-labeling experiments showed that P. betae actively manipulated host translocation patterns by acting as a strong sink and fed on assimilates produced in surrounding plant tissues serving as sources. Food resources drawn into the galled leaf from storage tissues in the stem and from surrounding leaves were a major resource for this herbivore in addition to resources from the galled leaf blade. Aphids compete for resources with natural plant sinks, such as developing fruits. In common gardens containing aphid resistant and aphid susceptible clones, I tested the hypothesis that aphid gall success on resistant trees is limited by competition between aphid-induced sinks and the plant's natural sinks, and that the intensity of intraplant competition was determined by the genetically determined architecture of the tree. Through bud removal, a resistant clone could be given the architecture of a susceptible clone. Aphid survival was increased two fold on architecturally modified resistant clones

  20. Bacterial symbionts, Buchnera, and starvation on wing dimorphism in English grain aphid, Sitobion avenae (F. (Homoptera: Aphididae

    Directory of Open Access Journals (Sweden)

    Fangmei eZhang


    Full Text Available Wing dimorphism in aphids can be affected by multiple cues, including both biotic (nutrition, crowding, interspecific interactions, the presence of natural enemies, maternal and transgenerational effects, and alarm pheromone and abiotic factors (temperature, humidity, and photoperiod. The majority of the phloem-feeding aphids carry Buchnera, an obligate symbiotic proteobacteria. Buchnera has a highly reduced genome size, but encode key enzymes in the tryptophan biosynthetic pathway and is crucial for nutritional balance, development and reproduction in aphids. In this study, we investigated the impact of two nutritional-based biotic factors, symbionts and starvation, on the wing dimorphism in the English grain aphid, Sitobion avenae, a devastating insect pest of cereal crops (e.g., wheat worldwide. Elimination of Buchnera using the antibiotic rifampicin significantly reduced the formation of winged morphs, body mass and fecundity in S. avenae. Furthermore, the absence of this primary endosymbiont may disrupt the nutrient acquisition in aphids and alter transgenerational phenotypic expression. Similarly, both survival rate and the formation of winged morphs were substantially reduced after neonatal (< 24h old offspring were starved for a period of time. The combined results shed light on the impact of two nutritional-based biotic factors on the phenotypic plasticity in aphids. A better understanding of the wing dimorphism in aphids will provide the theoretical basis for the prediction and integrated management of these phloem-feeding insect pests.

  1. Dynamic Maize Responses to Aphid Feeding Are Revealed by a Time Series of Transcriptomic and Metabolomic Assays. (United States)

    Tzin, Vered; Fernandez-Pozo, Noe; Richter, Annett; Schmelz, Eric A; Schoettner, Matthias; Schäfer, Martin; Ahern, Kevin R; Meihls, Lisa N; Kaur, Harleen; Huffaker, Alisa; Mori, Naoki; Degenhardt, Joerg; Mueller, Lukas A; Jander, Georg


    As a response to insect attack, maize (Zea mays) has inducible defenses that involve large changes in gene expression and metabolism. Piercing/sucking insects such as corn leaf aphid (Rhopalosiphum maidis) cause direct damage by acquiring phloem nutrients as well as indirect damage through the transmission of plant viruses. To elucidate the metabolic processes and gene expression changes involved in maize responses to aphid attack, leaves of inbred line B73 were infested with corn leaf aphids for 2 to 96 h. Analysis of infested maize leaves showed two distinct response phases, with the most significant transcriptional and metabolic changes occurring in the first few hours after the initiation of aphid feeding. After 4 d, both gene expression and metabolite profiles of aphid-infested maize reverted to being more similar to those of control plants. Although there was a predominant effect of salicylic acid regulation, gene expression changes also indicated prolonged induction of oxylipins, although not necessarily jasmonic acid, in aphid-infested maize. The role of specific metabolic pathways was confirmed using Dissociator transposon insertions in maize inbred line W22. Mutations in three benzoxazinoid biosynthesis genes, Bx1, Bx2, and Bx6, increased aphid reproduction. In contrast, progeny production was greatly decreased by a transposon insertion in the single W22 homolog of the previously uncharacterized B73 terpene synthases TPS2 and TPS3. Together, these results show that maize leaves shift to implementation of physical and chemical defenses within hours after the initiation of aphid feeding and that the production of specific metabolites can have major effects in maize-aphid interactions. PMID:26378100

  2. ClEST cluster :Cl_singleton1657 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1657 pumilio ... 2 Cimex lectularius nuclear gene 590 TGATGATGAAAGATCAGTACGCCAATTATGTCGT ... ATATGATACATCAAATAAATTATTTGAGA fw20025 1 PREDICTED: pumilio ... homolog 2-like isoform 1 [Acyrthosiphon pisum] XP_ ...

  3. ClEST cluster :Cl_singleton2448 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2448 probable gdp-fucose ... transporter-like Cimex lectularius nuclear gene 314 ACGAATT ... AAAGTTTTCCCTGTCA mb31096 1 PREDICTED: probable GDP-fucose ... transporter-like [Acyrthosiphon pisum] XP_00194993 ...

  4. ClEST cluster :Cl_singleton0942 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0942 tbc1 domain family ... member 4-like Cimex lectularius nuclear gene 488 GCATTCGTATT ... CCACCATAAAGGAGCAA fs16074 1 PREDICTED: TBC1 domain family ... member 4-like [Acyrthosiphon pisum] XP_001947975 6 ...

  5. ClEST cluster :Cl_singleton0904 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0904 male -specific lethal 3 homolog Cimex lectularius nuclear gene 394 CTCGCAGGTTGAG ... GAATTCGACTTGGGATAGATTCGTTACCG fs15038 1 PREDICTED: male -specific lethal 3 homolog [Acyrthosiphon pisum] XP ...

  6. ClEST cluster :Cl_singleton1313 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1313 27 kda hemolymph ... Cimex lectularius nuclear gene 441 CCATTACGGCCGGGGAGAGTGGAATGA ... GAGGTGTTGATGAAAGAAATAA fw05075 1 PREDICTED: 27 kDa hemolymph ... protein-like [Acyrthosiphon pisum] XP_001947666 2. ...

  7. ClEST cluster :Cl_singleton1124 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1124 glyceraldehyde-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 609 CTC ... TTTGAATTGTTA fs25045 1 PREDICTED: glyceraldehyde-3-phosphate ... dehydrogenase-like [Acyrthosiphon pisum] XP_001943 ...

  8. ClEST cluster :Cl_singleton1771 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1771 inorganic phosphate ... cotransporter Cimex lectularius nuclear gene 540 GGTTTTAAAA ... AGGTCCGATT fw23080 1 PREDICTED: putative inorganic phosphate ... cotransporter-like isoform 2 [Acyrthosiphon pisum] ...

  9. ClEST cluster :Cl_singleton1772 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1772 myosin heavy chain Cimex lectularius nuclear gene 539 GAGTCAGACTCGCTCCAGCTCCCTC ... AACAAAGAAA fw23081 1 PREDICTED: myosin heavy chain muscle ... isoform 1 [Acyrthosiphon pisum] XP_001952092 5.076 ...

  10. ClEST cluster :Cl_singleton1298 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1298 nadh dehydrogenase Cimex lectularius nuclear gene 236 GAGTTCTAAGTCGTCTGGTCCTGAA ... TTTGAAAA fw05041 1 NADH dehydrogenase [ubiquinone] iron -sulfur protein 5 [Acyrthosiphon pisum] NP_00115530 ...

  11. Parasitoids (Hymenoptera: Braconidae: Aphidiinae) attacking aphids feeding on solanaceae and cucurbitaceae crops in Southeastern Europe: Aphidiine-aphid-plant associations and key

    Czech Academy of Sciences Publication Activity Database

    Kavallieratos, N. G.; Tomanović, Ž.; Starý, Petr; Žikić, V.; Petrović-Obradović, O.


    Roč. 103, č. 2 (2010), s. 153-164. ISSN 0013-8746 R&D Projects: GA AV ČR IBS5007102 Grant ostatní: The Ministry of Science and Environment Protection(CS) 143006B Institutional research plan: CEZ:AV0Z50070508 Keywords : Aphidiinae * aphids * Solanaceae Subject RIV: EH - Ecology, Behaviour Impact factor: 1.031, year: 2010

  12. Ants farm subterranean aphids mostly in single clone groups - an example of prudent husbandry for carbohydrates and proteins?

    Directory of Open Access Journals (Sweden)

    Ivens Aniek BF


    Full Text Available Abstract Background Mutualistic interactions are wide-spread but the mechanisms underlying their evolutionary stability and ecological dynamics remain poorly understood. Cultivation mutualisms in which hosts consume symbionts occur in phylogenetically diverse groups, but often have symbiont monocultures for each host. This is consistent with the prediction that symbionts should avoid coexistence with other strains so that host services continue to benefit relatives, but it is less clear whether hosts should always favor monocultures and what mechanisms they might have to manipulate symbiont diversity. Few mutualisms have been studied in sufficient genetic detail to address these issues, so we decided to characterize symbiont diversity in the complex mutualism between multiple root aphid species and Lasius flavus ants. After showing elsewhere that three of these aphid species have low dispersal and mostly if not exclusively asexual reproduction, we here investigate aphid diversity within and between ant nest mounds. Results The three focal species (Geoica utricularia, Forda marginata and Tetraneura ulmi had considerable clonal diversity at the population level. Yet more than half of the ant mounds contained just a single aphid species, a significantly higher percentage than expected from a random distribution. Over 60% of these single-species mounds had a single aphid clone, and clones tended to persist across subsequent years. Whenever multiple species/clones co-occurred in the same mound, they were spatially separated with more than 95% of the aphid chambers containing individuals of a single clone. Conclusions L. flavus “husbandry” is characterized by low aphid “livestock” diversity per colony, especially at the nest-chamber level, but it lacks the exclusive monocultures known from other cultivation mutualisms. The ants appear to eat most of the early instar aphids, so that adult aphids are unlikely to face limited phloem resources and

  13. Tools for evaluating Lipolexis oregmae (Hymenoptera: Aphidiidae) in the field: Effects of host aphid and host plant on mummy location and color plus improved methods for obtaining adults

    International Nuclear Information System (INIS)

    Lipolexis oregmae Gahan was introduced into Florida in a classical biological control program directed against the brown citrus aphid, Toxoptera citricida (Kirkaldy), on citrus. Prior to evaluating distribution, host range, and potential nontarget effects of L. oregmae in Florida, we evaluated the role of other potential host aphids and host plants on mummy production and location. Under laboratory conditions, this parasitoid produced the most progeny on the target pest, the brown citrus aphid on citrus. This parasitoid, unlike the majority of aphidiids, did not produce mummies on any of the host plants tested when reared in black citrus aphid T. aurantii (Boyer de Fonscolombe) on grapefruit, spirea aphid Aphis spiraecola Patch on grapefruit and pittosporum, cowpea aphid A. craccivora Koch on grapefruit and cowpeas, or melon aphid A. gossypii Glover on grapefruit and cucumber. Thus, sampling for L. oregmae mummies of these host aphids and host plants must involve holding foliage in the laboratory until mummies are produced. This parasitoid requires high relative humidity to produce adults because no adults emerged when mummies were held in gelatin capsules, but high rates of emergence were observed when mummies were held on 1.5% agar plates. In addition, we compared the color of 6 aphid hosts and the color of mummies produced by L. oregmae when reared in them to determine if color of mummies could be used to identify L. oregmae . Mummy color varied between aphid hosts and tested host plants, and is not a useful tool for identifying L. oregmae for nontarget effects. (author)

  14. Effects of plant protease inhibitors, oryzacystatin I and soybean Bowman-Birk inhibitor, on the aphid Macrosiphum euphorbiae (Homoptera, Aphididae) and its parasitoid Aphelinus abdominalis (Hymenoptera, Aphelinidae). (United States)

    Azzouz, H; Cherqui, A; Campan, E D M; Rahbé, Y; Duport, G; Jouanin, L; Kaiser, L; Giordanengo, P


    Transgenic plants expressing protease inhibitors (PIs) have emerged in recent years as an alternative strategy for pest control. Beneficial insects such as parasitoids may therefore be exposed to these entomotoxins either via the host or by direct exposure to the plant itself. With the objective of assessing the effects of PIs towards aphid parasitoids, bioassays using soybean Bowman-Birk inhibitor (SbBBI) or oryzacystatin I (OCI) on artificial diet were performed on Macrosiphum euphorbiae-Aphelinus abdominalis system. OCI significantly reduced nymphal survival of the potato aphid M. euphorbiae and prevented aphids from reproducing. This negative effect was much more pronounced than with other aphid species. On the contrary, SbBBI did not affect nymphal viability but significantly altered adult demographic parameters. Enzymatic inhibition assays showed that digestive proteolytic activity of larvae and adults of Aphelinus abdominalis predominantly relies on serine proteases and especially on chymotrypsin-like activity. Immunoassays suggested that OCI bound to aphid proteins and accumulated in aphid tissues, whereas SbBBI remained unbound in the gut. Bioassays using M. euphorbiae reared on artificial diets supplemented with both OCI and SbBBI showed a fitness impairment of Aphelinus abdominalis that developed on intoxicated aphids. However, only SbBBI was detected in parasitoid larvae, while no PI could be detected in adult parasitoids that emerged from PI-intoxicated aphids. The potential impact of PI-expressing plants on aphid parasitoids and their combined efficiency for aphid control are discussed. PMID:15686649

  15. Metabolic Engineering of Plant-derived (E)-β-farnesene Synthase Genes for a Novel Type of Aphid-resistant Genetically Modified Crop Plants

    Institute of Scientific and Technical Information of China (English)

    Xiu-Dao Yu; John Pickett; You-Zhi Ma; Toby Bruce; Johnathan Napier; Huw D.Jones; Lan-Qin Xia


    Aphids are major agricultural pests that cause significant yield losses of crop plants each year.Excessive dependence on insecticides for long-term aphid control is undesirable because of the development of insecticide resistance,the potential negative effects on non-target organisms and environmental pollution.Transgenic crops engineered for resistance to aphids via a non-toxic mode of action could be an efficient alternative strategy.(E)-β-Farnesene (EβF) synthases catalyze the formation of EβF,which for many pest aphids is the main component of the alarm pheromone involved in the chemical communication within these species.EβF can also be synthesized by certain plants but is then normally contaminated with inhibitory compounds.Engineering of crop plants capable of synthesizing and emitting EβF could cause repulsion of aphids and also the attraction of natural enemies that use EβF as a foraging cue,thus minimizing aphid infestation.In this review,the effects of aphids on host plants,plants' defenses against aphid herbivory and the recruitment of natural enemies for aphid control in an agricultural setting are briefly introduced.Furthermore,the plant-derived EβF synthase genes cloned to date along with their potential roles in generating novel aphid resistance via genetically modified approaches are discussed.

  16. Response of Green Peach Aphids and Other Arthropods to Garlic Intercropped with Tobacco

    NARCIS (Netherlands)

    Lai, R.; You, M.; Lotz, L.A.P.; Vasseur, L.


    The green peach aphid, Myzus persicae (Sulzer), is an insect pest that causes extensive damage to tobacco (Nicotiana tabacum L.) in China. Field trials were conducted in 2008 and 2009 at Longyan in the Fujian Province (China) to evaluate the effects of garlic (Allium sativum L.) as a deterrent to gr

  17. Trade-Off Between Fitness Gain and Cost Determines Profitability of a Peach Aphid Parasitoid. (United States)

    Khatri, Diwas; He, Xiong Z; Wang, Qiao


    Aphidius colemani (Viereck) (Hymenoptera: Aphidiidae) is commercially produced and utilized for biological control of peach aphid Myzus persicae (Sulzer) (Hemiptera: Aphididae) on greenhouse crops in many countries. To provide knowledge for the evaluation of parasitoid-host interactions and development of effective mass rearing programs, we investigated how and why host age or size affected fitness gain in A. colemani We show that the parasitoid was significantly more likely to encounter larger hosts and that an encounter almost always triggered an attack attempt. However, the attack attempt did not proportionally translate into oviposition because larger aphids had greater ability to defend themselves and the parasitoid spent more time in handling larger aphids. The host age at parasitization had no effect on emergence rates and sex ratio of parasitoid progeny, suggesting that pupae and larvae have similar survival rate in hosts of different ages and/or the parasitoid females do not adjust sex allocation based on host size. When parasitizing mid-aged hosts, the parasitoid gained maximum fitness for their progeny in developmental period, body size, and parasitism. Taking all findings together, we suggest that parasitizing mid-aged green peach aphid nymphs is most profitable for A. colemani. PMID:27289084

  18. Changes in large-scale climate alter spatial synchrony of aphid pests (United States)

    Sheppard, Lawrence W.; Bell, James R.; Harrington, Richard; Reuman, Daniel C.


    Spatial synchrony, the tendency of distant populations to fluctuate similarly, is a major concern in ecology. Except in special circumstances, researchers historically had difficulty identifying drivers of synchrony in field systems. Perhaps for this reason, the possibility that changes in large-scale climatic drivers may modify synchrony, thereby impacting ecosystems and human concerns, has been little examined. Here, we use wavelets to determine environmental drivers of phenological synchrony across Britain for 20 aphid species, most major crop pests. Consistently across species, changes in drivers produced large changes in aphid synchrony. Different drivers acted on different timescales: using a new wavelet analogue of the Moran theorem, we show that on long timescales (>4 years), 80% of synchrony in aphid first flights is due to synchrony in winter climate; but this explanation accounts for less short-timescale (Changes in aphid synchrony over time also differed by timescale: long-timescale synchrony fell from before 1993 to after, caused by similar changes in winter climate; whereas short-timescale synchrony increased. Shifts in winter climate are attributable to the North Atlantic Oscillation, an important climatic phenomenon, so effects described here may influence other taxa. This study documents a new way that climatic changes influence populations, through altered Moran effects.

  19. Reconstructing the phylogeny of aphids (Hemiptera: Aphididae) using DNA of the obligate symbiont Buchnera aphidicola

    Czech Academy of Sciences Publication Activity Database

    Nováková, Eva; Hypša, Václav; Klein, J.; Foottit, R. G.; von Dohlen, C.D.; Moran, N. A.


    Roč. 68, č. 1 (2013), s. 42-54. ISSN 1055-7903 R&D Projects: GA ČR GD206/09/H026 Institutional support: RVO:60077344 Keywords : Aphid * Evolution * Buchnera * Phylogeny * Informative markers Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.018, year: 2013

  20. Characterization and genetic dissection of resistance to spotted alfalfa aphid (Therioaphis trifolii) in Medicago truncatula

    KAUST Repository

    Kamphuis, L. G.


    Aphids cause significant yield losses in agricultural crops worldwide. Medicago truncatula, a model legume, cultivated pasture species in Australia and close relative of alfalfa (Medicago sativa), was used to study the defence response against Therioaphis trifolii f. maculate [spotted alfalfa aphid (SAA)]. Aphid performance and plant damage were compared among three accessions. A20 is highly susceptible, A17 has moderate resistance, and Jester is strongly resistant. Subsequent analyses using A17 and A20, reciprocal F1s and an A17×A20 recombinant inbred line (RIL) population revealed that this moderate resistance is phloem mediated and involves antibiosis and tolerance but not antixenosis. Electrical penetration graph analysis also identified a novel waveform termed extended potential drop, which occurred following SAA infestation of M. truncatula. Genetic dissection using the RIL population revealed three quantitative trait loci on chromosomes 3, 6, and 7 involved in distinct modes of aphid defence including antibiosis and tolerance. An antibiosis locus resides on linkage group 3 (LG3) and is derived from A17, whereas a plant tolerance and antibiosis locus resides on LG6 and is derived from A20, which exhibits strong temporary tolerance. The loci identified reside in regions harbouring classical resistance genes, and introgression of these loci in current medic cultivars may help provide durable resistance to SAA, while elucidation of their molecular mechanisms may provide valuable insight into other aphid–plant interactions.

  1. Aphid parasitoids sampled by Malaise traps in the National parks of Thailand (Hymenoptera, Braconidae, Aphidiinae)

    Czech Academy of Sciences Publication Activity Database

    Starý, Petr; Sharkey, M.; Hutacharern, C.


    Roč. 41, 1-2 (2008), s. 37-43. ISSN 0049-3589 Grant ostatní: Framework of Research Funded by the NSF grant(US) DEB 0542864 Institutional research plan: CEZ:AV0Z50070508 Keywords : aphids * parasitoids * biodiversity Subject RIV: EH - Ecology, Behaviour

  2. Reproduction and Population Dynamics as Biotypic Markers of Russian Wheat Aphid Diuraphis noxia (Kurdjumov

    Directory of Open Access Journals (Sweden)

    Watson Ngenya


    Full Text Available Russian wheat aphid Diuraphis noxia (Kurdjumov is widely established in wheat-growing countries where it causes significant economic losses. The development and use of Russian wheat aphid (RWA-resistant wheat varieties has been constrained by the variation in resident RWA populations and the evolution of virulent biotypes. An experiment was set up at the Kenya Agricultural and Livestock Research Organization (KALRO, Njoro, to characterize RWA populations based on phenotypic characteristics of reproduction, development and population dynamics. RWA populations from the regions of Eldoret, Mau Narok and Njoro were used in the study. A factorial experiment was set up in randomized complete block design replicated eleven times. A single day-old nymph was placed on a new, fully-open leaf in a 0.5 cm-diameter clear plastic straw leaf cage and observed daily for its entire lifetime. The results showed that there were variations in aphid lifespan, reproductive longevity and aphid fecundity between populations, indicating that the phenotypic markers used to determine biotypes were good enough to show distinct biotypes among populations of the RWA in Kenya. Further, the study concluded that the use of phenotypic life and reproductive markers was a valid way of characterizing biotypes of RWA worldwide.

  3. Registration of 'Stoneham' spring feed barley resistant to Russian wheat aphid (United States)

    'Stoneham' (REG. No.; PI 641940) a Russian wheat aphid (RWA, Diuraphis noxia Kurdjumov)-resistant, spring, two-rowed, feed barley (Hordeum vulgare) tested as 97BX 27-132, was developed and released by the USDA-ARS, Stillwater, OK and Aberdeen, ID; Colorado State University; and the University of Neb...

  4. Biology and predatory potential of coccinella septempunctata linn. on schizaphis graminum aphid under controlled conditions

    International Nuclear Information System (INIS)

    The biology and predatory potential of Coccinella septempunctata (Linn.) were studied on aphid, Schizaphis graminum (Rondani) at three constant temperatures 20+-1 degree C, 25+-1 degree C and 30+-1 degree C in Insectary-Bio Control Laboratories, National Agricultural Research Centre (NARC), Islamabad. The results revealed that incubation period of C. septempunctata was 5.12, 3.62 and 3.20 days with 75.6%, 82.0% and 71.2% hatchability, respectively. The larval durations were 29.5, 15.9 and 8.1 days with predatory potential of 573.7, 575.0 and 667.8 aphids per larvae. The results indicated that with increasing temperature, develop-mental duration decreases significantly. The pupal developmental duration was 14.0, 9.2 and 5.2 days, respectively which are significantly different from each other. The adult male and female longevity were 44.7, 37.7, 30.0 and 60.3, 58.9 and 43.7 days. Fecundity rate of females were 123.5, 251.5 and 293.2 eggs per female, respectively. This indicates that adult male and female developmental duration, female fecundity rate were significantly different from each other at three constant temperatures. Maximum female and male predatory potential was 3262.8 and 2571.7 aphids at 25 +-1 degree C while minimum was 2276.8 and 1890.6 aphids, respectively. (author)

  5. Parasitoids and hyperparasitoids (Hymenoptera) on aphids (Hemiptera) infesting citrus in east Mediterranean region of Turkey

    Czech Academy of Sciences Publication Activity Database

    Satar, S.; Satar, G.; Karacaoglu, M.; Uygun, N.; Kavallieratos, N. G.; Starý, Petr; Athanassiou, CH. G.


    Roč. 14, article no. 178 (2014). ISSN 1536-2442 Grant ostatní: Turkish Scientific and Technical Research Council(TR) 105-0-581 Institutional support: RVO:60077344 Keywords : citrus * aphid * Aphidiinae Subject RIV: EH - Ecology, Behaviour Impact factor: 1.025, year: 2014

  6. Comparing growth patterns among field populations of cereal aphids reveals factors limiting their maximum abundance

    Czech Academy of Sciences Publication Activity Database

    Honěk, J.; Jarošík, Vojtěch; Dixon, A. F. G.


    Roč. 96, - (2006), s. 269-277. ISSN 0007-4853 R&D Projects: GA ČR(CZ) GA522/05/0765 Institutional research plan: CEZ:AV0Z60050516 Keywords : aphids * population dynamics * density-dependence Subject RIV: EF - Botanics Impact factor: 2.046, year: 2006

  7. Managing papaya ringspot virus: Impact of grass barriers on alate aphid immigration into papaya orchards (United States)

    Papaya ringspot virus, transmitted by alate aphids, is the most limiting factor of papaya production in the Caribbean region. Although there are transgenic papaya varieties that provide protection from this virus, these varieties are effective only in certain regions against certain strains of the v...

  8. Secretome of fungus-infected aphids documents high pathogen activity and weak host response

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Olsen, Peter B.;


    Discovery of novel secretome proteins contributes to the understanding of host-pathogen interactions. Here we report a rich diversity of secreted proteins from the interaction between grain aphids (host, insect order Hemiptera) and fungi of the order Entomophthorales (insect pathogens), made poss...

  9. Two-year oscillation cycle in abundance of soybean aphid in Indiana

    Czech Academy of Sciences Publication Activity Database

    Rhainds, M.; Yoo, H. J. S.; Kindlmann, Pavel; Voegtlin, D.; Castillo, D.; Rutledge, C.; Sadof, C.; Yaninek, S.; O'Neil, R. J.


    Roč. 12, č. 3 (2010), s. 251-257. ISSN 1461-9555 Institutional research plan: CEZ:AV0Z60870520 Keywords : Aphididae * Aphis glycines * autumn migration * Hemiptera * heteroecy * Rhamnus * seesaw effect * soybean aphid Subject RIV: EH - Ecology, Behaviour Impact factor: 1.484, year : 2010

  10. Effects of Insecticides on Strawberry Aphid Chaetosiphon fragaefolii (Cockerell) on Resistant and Susceptible Strawberry Genotypes


    Slobodan Milenković; Dejan Marčić; Pantelija Perić


    Strawberry aphid, Chaetosiphon fragaefolii (Cockerell), is the most important vector of strawberry virus. Breeding of genotypes resistant to this pest is an important preventive control measure, which can be compatible with rational insecticide application. The aim of the paper was to determine effects of dimethoate and deltamethrin on C. fragaefolii populations reared on two strawberry genotypes different in susceptibility: susceptible strawberry cultivar ...

  11. Enhancement of resistance to aphids by introducing the snowdrop lectin gene gna into maize plants

    Indian Academy of Sciences (India)

    Zhaoyu Wang; Kewei Zhang; Xiaofen Sun; Kexuan Tang; Juren Zhang


    In order to enhance the resistance to pests, transgenic maize (Zea mays L.) plants from elite inbred lines containing the gene encoding snowdrop lectin (Galanthus nivalis L. agglutinin; GNA) under control of a phloemspecific promoter were generated through the Agrobacterium tumefaciens-mediated method. The toxicity of GNA-expressing plants to aphids has also been studied. The independently derived plants were subjected to molecular analyses. Polymerase chain reaction (PCR) and Southern blot analyses confirmed that the gna gene was integrated into maize genome and inherited to the following generations. The typical Mendelian patterns of inheritance occurred in most cases. The level of GNA expression at 0.13%–0.28% of total soluble protein was observed in different transgenic plants. The progeny of nine GNA-expressing independent transformants that were derived separately from the elite inbred lines DH4866, DH9942, and 8902, were selected for examination of resistance to aphids. These plants synthesized GNA at levels above 0.22% total soluble protein, and enhanced resistance to aphids was demonstrated by exposing the plants to corn leaf aphid (Rhopalosiphum maidis Fitch) under greenhouse conditions. The nymph production was significantly reduced by 46.9% on GNA-expressing plants. Field evaluation of the transgenic plants supported the results from the inoculation trial. After a series of artificial self-crosses, some homozygous transgenic maize lines expressing GNA were obtained. In the present study, we have obtained new insect-resistant maize material for further breeding work.

  12. Aphid parasitoid species (Hymenoptera: Braconidae: Aphidiinae) of central submountains of Iran

    Czech Academy of Sciences Publication Activity Database

    Barahoei, H.; Rakhshani, E.; Madjdzadeh, S. M.; Alipour, A.; Taheri, S.; Nader, E.; Mistrovski Bogdanović, A.; Petrović-Obradović, O.; Starý, Petr; Kavallieratos, N. G.; Tomanović, Ž.


    Roč. 9, č. 1 (2013), s. 70-93. ISSN 1584-9074 Grant ostatní: Ministry of Education and Science of the Republic of Serbia (RS) III43001 Institutional research plan: CEZ:AV0Z50070508 Keywords : aphid parasitoids * tritrophic associations * biotypes Subject RIV: EH - Ecology, Behaviour Impact factor: 0.700, year: 2013

  13. Checklist of Aphidiine parasitoids (Hymenoptera: Braconidae) and their host aphid associations in Iran

    Czech Academy of Sciences Publication Activity Database

    Barahoei, H.; Rakhshani, E.; Nader, E.; Starý, Petr; Kavallieratos, N. G.; Tomanović, Ž.; Mehrparvar, M.


    Roč. 3, č. 2 (2014), s. 199-232. ISSN 2251-9041 Grant ostatní: University of Zabol(IR) 89-9198; Ministry of Education, Science and Technological Development of the Republic of Serbia (IR) III43001 Institutional support: RVO:60077344 Keywords : fauna * aphid parasitoids * host association

  14. The aphid Melanaphis sacchari and the weed Sorghum almum – Partners in crime (United States)

    Sugarcane yellow leaf virus (SCYLV), the causal agent of yellow leaf disease of sugarcane, is widespread in Florida and vectored by the aphid Melanaphis sacchari. Sugarcane was the only known natural host of SCYLV in the USA until 2015 when a new natural host was found for this virus in Florida: Sor...

  15. First survey on ecological host range of aphid pathogenic fungi (Phylum Entomophthoromycota) in Tunisia

    DEFF Research Database (Denmark)

    Ben Fekih, Ibtissem; Boukhris-Bouhachem, Sonia; Allagui, Mohamed Bechir;


    C. obscurus and N. fresenii were sporadically present on a limited number of aphid species. This study is the first survey on ecological host range of entomophthoralean fungi in Tunisia, and the first documentation of C. obscurus and N. fresenii to occur in Tunisia and Maghreb Region....

  16. Lysiphlebia japonica (Ashm.), a keystone aphid parasitoid in the Korean peninsula (Hymenoptera, Braconidae, Aphidiinae)

    Czech Academy of Sciences Publication Activity Database

    Starý, Petr; Havelka, Jan; Choi, J. Y.


    Roč. 5, č. 1 (2002), s. 135-137. ISSN 1326-6756 R&D Projects: GA AV ČR IBS5007102; GA MŠk ME 327 Institutional research plan: CEZ:AV0Z5007907 Keywords : aphid Subject RIV: EG - Zoology Impact factor: 0.495, year: 2002

  17. Evaluation of mirid predatory bugs and release strategy for aphid control in sweet pepper

    NARCIS (Netherlands)

    Messelink, G.J.; Bloemhard, C.M.J.; Hoogerbrugge, H.; Schelt, van J.; Ingegno, B.L.; Tavella, L.


    Zoophytophagous predators of the family Miridae (Heteroptera), which feed both on plant and prey, often maintain a close relationship with certain host plants. In this study, we aimed to select a suitable mirid predatory bug for aphid control in sweet pepper. Four species were compared: Macrolophus

  18. Relationship between the abundance of aphids and their natural enemies in cereal fields and landscape composition

    Czech Academy of Sciences Publication Activity Database

    Hassan, D. A.; Parisey, N.; Burel, F.; Plantegenest, M.; Kindlmann, Pavel; Butet, A.


    Roč. 2, č. 2 (2012), s. 89-101. ISSN 1805-0174 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : agroecosystems * landscape structure * crop pests * aphids * biological control * semi-natural habitats Subject RIV: EH - Ecology, Behaviour

  19. Fine genetic mapping of greenbug aphid resistance gene Gb3 in Aegilops tauschii (United States)

    The greenbug is a serious aphid pest of wheat and sorghum in the southern High Plains of the US. The greenbug resistant gene Gb3 originated from the goatgrass has shown consistent and durable resistance against prevailing greenbug biotypes in wheat fields for moer than 30 years. Our goal is to clone...

  20. Phenotypic plasticity in the response of aphids to host plant quality

    Czech Academy of Sciences Publication Activity Database

    Thieme, T.; Truberg, B.; Dixon, Anthony F. G.


    Roč. 4, č. 2 (2014), s. 92-96. ISSN 1805-0174 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : lupin * alkaloids * aphids * Macrosiphum albifrons * biological performance Subject RIV: EH - Ecology, Behaviour

  1. Reproduction and Population Dynamics as Biotypic Markers of Russian Wheat Aphid Diuraphis noxia (Kurdjumov). (United States)

    Ngenya, Watson; Malinga, Joyce; Tabu, Isaiah; Masinde, Emily


    Russian wheat aphid Diuraphis noxia (Kurdjumov) is widely established in wheat-growing countries where it causes significant economic losses. The development and use of Russian wheat aphid (RWA)-resistant wheat varieties has been constrained by the variation in resident RWA populations and the evolution of virulent biotypes. An experiment was set up at the Kenya Agricultural and Livestock Research Organization (KALRO), Njoro, to characterize RWA populations based on phenotypic characteristics of reproduction, development and population dynamics. RWA populations from the regions of Eldoret, Mau Narok and Njoro were used in the study. A factorial experiment was set up in randomized complete block design replicated eleven times. A single day-old nymph was placed on a new, fully-open leaf in a 0.5 cm-diameter clear plastic straw leaf cage and observed daily for its entire lifetime. The results showed that there were variations in aphid lifespan, reproductive longevity and aphid fecundity between populations, indicating that the phenotypic markers used to determine biotypes were good enough to show distinct biotypes among populations of the RWA in Kenya. Further, the study concluded that the use of phenotypic life and reproductive markers was a valid way of characterizing biotypes of RWA worldwide. PMID:27049398

  2. Tracking the role of alternative prey in soybean aphid predation by Orius insidiosus: a molecular approach (United States)

    The soybean aphid, Aphis glycines, is a pest of soybeans in Asia and in recent years has caused extensive damage to soybean crops in North America. Within these agroecosystems, generalist predators form an important component of the assemblage of natural enemies, and can exert significant pressure o...

  3. Evolutionary conservation of candidate osmoregulation genes in plant phloem sap-feeding insects. (United States)

    Jing, X; White, T A; Luan, J; Jiao, C; Fei, Z; Douglas, A E


    The high osmotic pressure generated by sugars in plant phloem sap is reduced in phloem-feeding aphids by sugar transformations and facilitated water flux in the gut. The genes mediating these osmoregulatory functions have been identified and validated empirically in the pea aphid Acyrthosiphon pisum: sucrase 1 (SUC1), a sucrase in glycoside hydrolase family 13 (GH13), and aquaporin 1 (AQP1), a member of the Drosophila integral protein (DRIP) family of aquaporins. Here, we describe molecular analysis of GH13 and AQP genes in phloem-feeding representatives of the four phloem-feeding groups: aphids (Myzus persicae), coccids (Planococcus citri), psyllids (Diaphorina citri, Bactericera cockerelli) and whiteflies (Bemisia tabaci MEAM1 and MED). A single candidate GH13-SUC gene and DRIP-AQP gene were identified in the genome/transcriptome of most insects tested by the criteria of sequence motif and gene expression in the gut. Exceptionally, the psyllid Ba. cockerelli transcriptome included a gut-expressed Pyrocoelia rufa integral protein (PRIP)-AQP, but has no DRIP-AQP transcripts, suggesting that PRIP-AQP is recruited for osmoregulatory function in this insect. This study indicates that phylogenetically related SUC and AQP genes may generally mediate osmoregulatory functions in these diverse phloem-feeding insects, and provides candidate genes for empirical validation and development as targets for osmotic disruption of pest species. PMID:26896054

  4. Wild tomato leaf extracts for spider mite and cowpea aphid control. (United States)

    Antonious, George F; Kamminga, Katherine; Snyder, John C


    Glandular trichomes on the leaves of wild tomato, L. hirsutum f. hirsutum Mull, also known as Solanum habrochaites (Solanaceae), synthesize and accumulate high levels of methyl ketones (MKs). L. hirsutum accession LA 407, having high concentration of MKs, was grown from seeds under greenhouse conditions. Four MKs (2-undecanone, 2-dodecanone, 2-tridecanone, and 2-pentadecanone) were screened for their toxicity to spider mites, Tetranychus urticae Koch and cowpea aphids, Aphis craccivora Koch. The objectives of this investigation were to: (1) develop a bioassay for testing MKs on spider mite and cowpea aphid mortality and (2) compare the efficacies of wild tomato leaf crude extracts and pure standard materials of MKs against spider mite and cowpea aphid mortality. Our results revealed that spider mites are most sensitive to 2-tridecanone (LC50 = 0.08 μmole cm(-2) of treated leaf surface) and least sensitive to 2-undecanone (LC50 = 1.5 μmole cm(-2) of treated leaf surface) 4 h after treatment. Similarly, 2-tridecanone caused greatest mortality (LC50 = 0.2 μmole cm(-2) of treated leaf surface), whereas 2-undecanone caused the lowest morality (LC50 = 0.48 μmole cm(-2) of treated surface) of cowpea aphid. We concluded that all MKs tested in this investigation are toxic to spider mites and aphids. 2-Tridecanone is more effective in killing mites and aphids compared to other MKs. Toxicity of crude extracts, prepared from the leaves of L. hirsutum accession LA 407, to spider mites and cowpea aphids revealed greater mortality compared to a combined mixture of MKs standard material (used at the same concentration as found on LA 407 leaves). This indicates that in addition to MKs, other unidentified compounds in LA 407 leaf extract also have pesticidal properties. Accordingly, leaf extracts of LA 407 could be explored in crop protection, and they might open a new area of MK formulations and discovery of biorational alternatives for pest control in agricultural fields. PMID

  5. Aboveground feeding by soybean aphid, Aphis glycines, affects soybean cyst nematode, Heterodera glycines, reproduction belowground.

    Directory of Open Access Journals (Sweden)

    Michael T McCarville

    Full Text Available Heterodera glycines is a cyst nematode that causes significant lost soybean yield in the U.S. Recent studies observed the aphid Aphis glycines and H. glycines interacting via their shared host, soybean, Glycine max. A greenhouse experiment was conducted to discern the effect of A. glycines feeding on H. glycines reproduction. An H. glycines-susceptible cultivar, Kenwood 94, and a resistant cultivar, Dekalb 27-52, were grown in H. glycines-infested soil for 30 and 60 d. Ten days after planting, plants were infested with either zero, five, or ten aphids. At 30 and 60 d, the number of H. glycines females and cysts (dead females and the number of eggs within were counted. In general, H. glycines were less abundant on the resistant than the susceptible cultivar, and H. glycines abundance increased from 30 to 60 d. At 30 d, 33% more H. glycines females and eggs were produced on the resistant cultivar in the ten-aphid treatment compared to the zero-aphid treatment. However, at 30 d the susceptible cultivar had 50% fewer H. glycines females and eggs when infested with ten aphids. At 60 d, numbers of H. glycines females and cysts and numbers of eggs on the resistant cultivar were unaffected by A. glycines feeding, while numbers of both were decreased by A. glycines on the susceptible cultivar. These results indicate that A. glycines feeding improves the quality of soybean as a host for H. glycines, but at higher herbivore population densities, this effect is offset by a decrease in resource quantity.

  6. Characterization and expression analysis of adipokinetic hormone and its receptor in eusocial aphid Pseudoregma bambucicola. (United States)

    Jedličková, Veronika; Jedlička, Pavel; Lee, How-Jing


    Aphids display an extraordinary phenotypic plasticity ranging from widespread reproductive and wing polyphenisms to the occurrence of sterile or subfertile soldier morphs restricted to eusocial species of the subfamilies Eriosomatinae and Hormaphidinae. Individual morphs are specialized by their behavior, anatomy, and physiology to perform different roles in aphid societies at different stages of the life cycle. The capacity of the insects to cope with environmental stressors is under the control of a group of neuropeptides of the adipokinetic hormone/red pigment-concentrating hormone family (AKH/RPCH) that bind to a specific receptor (AKHR). Here, we describe the molecular characteristics of AKH and AKHR in the eusocial aphid Pseudoregma bambucicola. The sequence of the bioactive AKH decapeptide and the intron position in P. bambucicola AKH preprohormone were found to be identical to those in a phylogenetically distant aphid Dreyfusia spp. (Adelgidae). We detected four transcript variants of AKHR that are translated into three protein isoforms. Further, we analyzed AKH/AKHR expression in different tissues and insects of different castes. In wingless females, a remarkable amount of AKH mRNA was only expressed in the heads. In contrast, AKHR transcript levels increased in the order gutaphids from both the primary and secondary hosts (Styrax suberifolia and Bambusa spp., respectively), the highest AKH expression levels were recorded in winged, migratory females and soldiers, whereas reduced levels were found in wingless, sedentary females that are functionally oriented to reproduction. The highest AKHR expression was found in soldiers in gall-dwelling populations, whereas in bamboo colonies the highest transcript level was detected in winged females. We propose a possible explanation for the correlation between AKH and AKHR transcript levels and task partitioning among individual forms in P. bambucicola colonies. PMID:26432101

  7. Resistance of Wheat Accessions to the English Grain Aphid Sitobion avenae. (United States)

    Hu, Xiang-Shun; Liu, Ying-Jie; Wang, Yu-Han; Wang, Zhe; Yu, Xin-Lin; Wang, Bo; Zhang, Gai-Sheng; Liu, Xiao-Feng; Hu, Zu-Qing; Zhao, Hui-Yan; Liu, Tong-Xian


    The English grain aphid, Sitobion avenae, is a major pest species of wheat crops; however, certain varieties may have stronger resistance to infestation than others. Here, we investigated 3 classical resistance mechanisms (antixenosis, antibiosis, and tolerance) by 14 wheat varieties/lines to S. avenae under laboratory and field conditions. Under laboratory conditions, alatae given the choice between 2 wheat varieties, strongly discriminated against certain varieties. Specifically, the 'Amigo' variety had the lowest palatability to S. avenae alatae of all varieties. 'Tm' (Triticum monococcum), 'Astron,' 'Xanthus,' 'Ww2730,' and 'Batis' varieties also had lower palatability than other varieties. Thus, these accessions may use antibiosis as the resistant mechanism. In contrast, under field conditions, there were no significant differences in the number of alatae detected on the 14 wheat varieties. One synthetic line (98-10-30, a cross between of Triticum aestivum (var. Chris) and Triticum turgidum (var. durum) hybridization) had low aphid numbers but high yield loss, indicating that it has high antibiosis, but poor tolerance. In comparison, 'Amigo,' 'Xiaoyan22,' and some '186Tm' samples had high aphid numbers but low yield loss rates, indicating they have low antibiosis, but good tolerance. Aphid population size and wheat yield loss rates greatly varied in different fields and years for '98-10-35,' 'Xiaoyan22,' 'Tp,' 'Tam200,' 'PI high,' and other '186Tm' samples, which were hybrid offspring of T. aestivum and wheat related species. Thus, these germplasm should be considered for use in future studies. Overall, S. avenae is best adapted to 'Xinong1376,' because it was the most palatable variety, with the greatest yield loss rates of all 14 wheat varieties. However, individual varieties/lines influenced aphid populations differently in different years. Therefore, we strongly recommend a combination of laboratory and long-term field experiments in targeted planting

  8. Qualitative analysis of aphid and primary parasitoid trophic relations of genus Alloxysta (Hymenoptera: Cynipoidea: Figitidae: Charipinae). (United States)

    Ferrer-Suay, Mar; Janković, Marina; Selfa, Jesús; Van Veen, F J Frank; Tomanović, Željko; Kos, Katarina; Rakhshani, Ehsan; Pujade-Villar, Juli


    Charipinae hyperparasitoids affect effectiveness of the primary parasitoids of aphids by decreasing their abundance and modifying their behavior. As a result, increase of aphid populations can cause severe yield losses in some crops. Therefore, ecological studies on the subfamily Charipinae have a great economical and biological importance. Host specificity of these hyperparasitoids is still under debate and for many Charipinae species very little is known about their trophic relations. Here, we give a comprehensive overview of the trophic relationships between the Charipinae species of the genus Alloxysta Förster and their aphid and primary parasitoids hosts, worldwide. Within this subfamily, Alloxysta arcuata (Kieffer), Alloxysta brevis (Thomson), Alloxysta fuscicornis (Hartig), and Alloxysta victrix (Westwood) are the most generalist species sharing many aphid hosts, while for primary parasitoid hosts these are A. arcuata, A. brevis, Alloxysta pleuralis (Cameron), and A. victrix. Alloxysta citripes (Thomson), Alloxysta halterata (Thomson), Alloxysta leunisii (Hartig), and Alloxysta ramulifera (Thomson) appear, up to now, as the most specialized in relation to the primary parasitoid hosts. Primary parasitoids of the genera Aphidius Nees, Lysiphlebus Förster, Praon Haliday, and Trioxys Haliday are the most common hosts for Alloxysta species, and the common host aphid species belong to the genera Aphis L., Uroleucon Mordvilko, Myzus Passerini, and Sitobion Mordvilko. Host range is analyzed for each Alloxysta species, as well as the extent of overlap between them. We used Jaccard's distance and a hierarchical cluster analysis to determine the host range dissimilarity. A permutation test has been applied to analyze if the host range dissimilarity is significantly different from what is expected by chance. We have calculated additional qualitative measures that complement well the Alloxysta niche overlap analysis and evaluated their host specificity using different

  9. Bacterial symbionts, Buchnera, and starvation on wing dimorphism in English grain aphid, Sitobion avenae (F.) (Homoptera: Aphididae) (United States)

    Wing dimorphism in aphids can be affected by multiple cues including both biotic (nutrition, crowding, interspecific interactions, the presence of natural enemies, maternal and transgenerational effects, and alarm pheromone) and abiotic factors (temperature, humidity, and photoperiod). Virtually al...

  10. Selective effects of the extract from Angelica archangelica L. against Harmonia axyridis (Pallas)—An important predator of aphids

    Czech Academy of Sciences Publication Activity Database

    Pavela, R.; Žabka, M.; Vrchotová, Naděžda; Tříska, Jan; Kazda, J.


    Roč. 51, NOV 2013 (2013), s. 87-92. ISSN 0926-6690 Institutional support: RVO:67179843 Keywords : Angelica archangelica * Harmonia axyridis * furanocoumarins * botanical insecticides * aphids Subject RIV: EH - Ecology, Behaviour Impact factor: 3.208, year: 2013

  11. Tritrophic associations and taxonomic notes on Lysiphlebus fabarum (Marshall (Hymenoptera: Braconidae: Aphidiinae, a keystone aphid parasitoid in Iran

    Directory of Open Access Journals (Sweden)

    Rakhshani Ehsan


    Full Text Available An investigation of host associations, distribution and types of reproduction (sexual, asexual of Lysiphlebus fabarum (Marshall across 20 provinces of Iran during 2006-2011 was undertaken. The parasitoid was reared from three groups of host aphids belonging to genera Aphis and Brachycaudus, and occasional host aphid genera. Aphis craccivora Koch was the most frequent host aphid for L. fabarum on various host plants, including economically important crops. The field sex ratio generally favored females, but in some cases, only thelytokous (uniparental populations were found. In those cases, the host was always an Aphis species. Specimens reared from Brachycaudus aphids were all biparental, indicating the presence of a sibling biological species. Overall analysis of diagnostic morphological characters in the forewing indicated intra-specific variability in forewing marginal setae as well as variations in length of the R1 vein. [Projekat Ministarstva nauke Republike Srbije, br. 43001

  12. Effect of exogenous supply of boron on nodule development in pea (pisum sativum L.)

    International Nuclear Information System (INIS)

    Exogenous supply of boron was evaluated on the seeds of Pisum sativum L. inoculated with Rhizobium leguminosarum and grown in aqua-culture. The liquid nutrition medium contained six boron concentrations (control, 1, 1.86, 2.86, 3.86, and 4.86 mg L/sup -1/ ). The results obtained from the present work showed that number of nodules, size of nodules and weight of boron treatment. Toxic effect of high concentration of boron (4.86 mg L/sup -1/ ) nodules exhibit great improvement in 2.86 mg L /sup-1/ was also recorded. There was significant reduction as compare to control in nodule weight, size and numbers. This fact becomes clear while observing the nodules growing in the boron free culture, which did not develop extensively. The comparison of the transverse sections of root-nodule area, from nutrient solutions with various boron concentrations showed that in the absence of boron, there was a considerable hypertrophy in cambial cells and a frequent disintegration of phloem and ground tissue along with xylem. The disintegration of the tissue seems to be linked with nodule bacteria. The nodular bacteria are considered to assume a parasitic habit in the absence of boron. (author)

  13. Profile and Functional Properties of Seed Proteins from Six Pea (Pisum sativum Genotypes

    Directory of Open Access Journals (Sweden)

    Nikola Ristic


    Full Text Available Extractability, extractable protein compositions, technological-functional properties of pea (Pisum sativum proteins from six genotypes grown in Serbia were investigated. Also, the relationship between these characteristics was presented. Investigated genotypes showed significant differences in storage protein content, composition and extractability. The ratio of vicilin:legumin concentrations, as well as the ratio of vicilin + convicilin: Legumin concentrations were positively correlated with extractability. Our data suggest that the higher level of vicilin and/or a lower level of legumin have a positive influence on protein extractability. The emulsion activity index (EAI was strongly and positively correlated with the solubility, while no significant correlation was found between emulsion stability (ESI and solubility, nor between foaming properties and solubility. No association was evident between ESI and EAI. A moderate positive correlation between emulsion stability and foam capacity was observed. Proteins from the investigated genotypes expressed significantly different emulsifying properties and foam capacity at different pH values, whereas low foam stability was detected. It appears that genotype has considerable influence on content, composition and technological-functional properties of pea bean proteins. This fact can be very useful for food scientists in efforts to improve the quality of peas and pea protein products.

  14. De Novo Assembly of the Pea (Pisum sativum L. Nodule Transcriptome

    Directory of Open Access Journals (Sweden)

    Vladimir A. Zhukov


    Full Text Available The large size and complexity of the garden pea (Pisum sativum L. genome hamper its sequencing and the discovery of pea gene resources. Although transcriptome sequencing provides extensive information about expressed genes, some tissue-specific transcripts can only be identified from particular organs under appropriate conditions. In this study, we performed RNA sequencing of polyadenylated transcripts from young pea nodules and root tips on an Illumina GAIIx system, followed by de novo transcriptome assembly using the Trinity program. We obtained more than 58,000 and 37,000 contigs from “Nodules” and “Root Tips” assemblies, respectively. The quality of the assemblies was assessed by comparison with pea expressed sequence tags and transcriptome sequencing project data available from NCBI website. The “Nodules” assembly was compared with the “Root Tips” assembly and with pea transcriptome sequencing data from projects indicating tissue specificity. As a result, approximately 13,000 nodule-specific contigs were found and annotated by alignment to known plant protein-coding sequences and by Gene Ontology searching. Of these, 581 sequences were found to possess full CDSs and could thus be considered as novel nodule-specific transcripts of pea. The information about pea nodule-specific gene sequences can be applied for gene-based markers creation, polymorphism studies, and real-time PCR.

  15. Nutritional assessment in vitro and in vivo of raw and extruded peas (Pisum sativum L.). (United States)

    Alonso, R; Grant, G; Dewey, P; Marzo, F


    The effects of extrusion cooking on the nutritional properties of Pisum sativum L. have been evaluated in vitro and in vivo. The treatment greatly elevated protein and starch digestibility in vitro. Also, the amounts of intact starch diminished while total free sugars increased. In addition, the levels of antinutritional factors, such as protease inhibitors and lectins, were greatly decreased. Concentrations of methionine and cystine were low in raw peas and were further reduced by extrusion treatment. The nutritional performance of rats fed extruded pea diets for 15 days was no better than that of rats given raw pea diet. This was due to the overriding effects of amino acid deficiencies in the diets. Weight gains by rats fed extruded pea diets supplemented with amino acids were, however, much higher than those achieved by rats fed supplemented raw pea diets. Food transformation index and protein efficiency ratio values were also greatly improved. Extrusion treatment did therefore significantly improve the nutritional quality of peas. PMID:10888538

  16. Gamma-ray induced mutations in Pisum arvense (L.s.s.)

    International Nuclear Information System (INIS)

    The subject of the studies was the progeny of seven lines of field pea, treated with gamma rays (at the doses of 1, 6, 12, 15, 50 kR) in the generations M2- M4. Of the total number of analysed 15630 plants 249 mutants have been isolated which constituted 1.59% of the total population. The mutation frequency was significantly different depending on the line under study and on the radiation dose. In the mutation spectrum lethal and semilethal mutations were prevalent. The cause of these phenomena were either chlorophyll aberrations or disturbances in the development, growth and morphology of plants. These mutations died in different periods of vegetation or did not come to flowering and died. A number of morphologic-developmental mutations have been isolated; their genotypes have been established, cytologically examined and characterized. Some of the isolated fertile mutations are similar to those obtained at other research centres (e.g., cirrhifolialis, viciaefolialis, fasciata), others seem to be original (eg. pumilio, celeriter crescens, gynaecei, multiplicis). It is necessary, however, to perform identification tests to introduce these mutations into the Pisum Genebank, the more so, as most of papers on mutations concerned edible and garden peas (P. sativum L.), and in our work we considered field forms (P. arvense L.s.s.). (author)

  17. Genotype-dependent patterns of accumulation of seed storage proteins in Pisum

    International Nuclear Information System (INIS)

    The storage proteins deposited in the protein bodies of mature cotyledons in Pisum sativum L. have been shown by crossed immunoelectrophoresis to comprise a series of four antigenically-distinct proteins or protein families related to vicilin, together with legumin and an additional, quantitatively minor, protein of distinctive polypeptide composition (designated Peak 6). These holoproteins appear during development in a similar sequence in three genotypes examined, but the quantitative representation of the legumins and Peak 6 relative to other components in mature seed differ between genotypes. The sequential appearance of immunologically specific storage proteins during development is reflected in the three distinctive phases of polypeptide accumulation evident between Day 10 after flower opening and seed maturity. Heterogeneity amongst the holoproteins of both the legumin and vicilin series was detected in mature seeds by cellulose acetate gel electrophoresis of protein body extracts. Multiple, electrophoretically distinct legumin and vicilin bands seen on such gels are inherited additively in F1 cotyledons from crosses between contrasting storage-protein phenotypes, without formation of new interaction products, and regardless of the direction of the cross. Differences between genotypes in the proportion of legumin contained in the total extractable cotyledonary protein are sufficient to indicate the importance of specific monitoring of legumin (or its homologues in other species) during breeding programmes aimed at increasing the sulphur-amino acid content of legume seed protein to improve its value for monogastric nutrition. (author)

  18. Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum

    International Nuclear Information System (INIS)

    The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress

  19. Genetic interaction and mapping studies on the leaflet development (lld) mutant in Pisum sativum

    Indian Academy of Sciences (India)

    Sushil Kumar; Raghvendra Kumar Mishra; Arvind Kumar; Swati Chaudhary; Vishakha Sharma; Renu Kumari


    In Pisum sativum, the completely penetrant leaflet development (lld) mutation is known to sporadically abort pinnae suborgans in the unipinnate compound leaf. Here, the frequency and morphology of abortion was studied in each of the leaf suborgans in 36 genotypes and in presence of auxin and gibberellin, and their antagonists. Various lld genotypes were constructed by multifariously recombining lld with a coch homeotic stipule mutation and with af, ins, mare, mfp, tl and uni-tac leaf morphology mutations. It was observed that the suborgans at all levels of pinna subdivisions underwent lld-led abortion events at different stages of development. As in leafblades, lld aborted the pinnae in leaf-like compound coch stipules. The lld mutation interacted with mfp synergistically and with other leaf mutations additively. The rod-shaped and trumpet-shaped aborted pea leaf suborgans mimicked the phenotype of aborted leaves in HD-ZIP-III-deficient Arabidopsis thaliana mutants. Suborganwise aborted morphologies in lld gnotypes were in agreement with basipetal differentiation of leaflets and acropetal differentiation in tendrils. Altogether, the observations suggested that LLD was the master regulator of pinna development. On the basis of molecular markers found linked to lld, its locus was positioned on the linkage group III of the P. sativum genetic map.

  20. Role of LLD, a new locus for leaflet/pinna morphogenesis in Pisum sativum

    Indian Academy of Sciences (India)

    Seema Prajapati; Sushil Kumar


    Properties of a mutant at the LLD (LEAF-LET DEVELOPMENT) locus in pea Pisum sativum L. are reported in this paper. Plants homozygous for the Mendelian recessive mutation lld bear leaves in which a few to many leaflets are incompletely developed. Opposite pinnae of rachis nodes often formed fused incompletely developed leaflets. The lld mutation was observed to abort pinna development at almost all morphogenetic stages. The lld mutation demonstrated high penetrance and low expressivity. The phenotypes of lld plants in tl, tac, tl tac, tl af and tl af tac backgrounds suggested that LLD function is involved in the separation of lateral adjacent blastozones differentiated on primary, secondary and tertiary rachides and lamina development in leaflets. The aborted development of tendrils and leaflets in lld mutants was related to deficiency in vascular tissue growth. The morphological and anatomical features of the leaflets formed on a tl lld double mutant permitted a model of basipetal leaflet development. The key steps of leaflet morphogenesis include origin of the lamina by splitting of a radially symmetrical growing pinna having abaxial outer surface, opposite to the vascular cylinder, through an invaginational groove, differentiation of adaxial surface along the outer boundary of split tissue in the groove and expansion of the lamina ridges so formed into lamina spans.

  1. Purification and properties of asparaginase from the testa of immature seeds of pea (Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Chagas Eliana P.


    Full Text Available A K+-dependent asparaginase (E.C. was purified 1328-fold from the testas of immature pea seeds (Pisum sativum L., var. Bolero and characterized. Antibodies raised against purified asparaginase cross-reacted with the putative asparaginase band in Western blot analyses of semi-purified extracts. However, for crude extracts of pea testas, a cross-reaction was obtained with at least four protein bands, one of which was asparaginase protein. Affinity-purified antibodies to the four strongest bands of crude extracts were fairly specific for the bands from which they were purified, suggesting a mixture of specific antibodies. The Mr of asparaginase was 69,000 by Sephacryl S200 chromatography and also by mobility on native PAGE relative to BSA. There was no evidence for dissociation into subunits on SDS-PAGE, suggesting a monomeric protein of Mr 69,000. Other properties include an apparent Km of 2.4 mM, pI between 4.5 and 5, and competitive inhibition by aspartate and glycine.

  2. Effect of Pisum sativum as protein supplement on buffalo milk production

    Directory of Open Access Journals (Sweden)

    C. Grassi


    Full Text Available A study was carried out at an organic buffalo dairy farm in order to investigate the effect of feeding protein peas (Pisum sativum L. as an alternative protein source for buffalo cow diets. Two concentrates were formulated to contain (as fed basis either 350 g/kg of soybean cake (SC or 450 g/kg of peas (PC as the main protein sources. The two concentrates were formulated to be almost isonitrogenous (on average crude protein 240 g/kg DM. Two groups of 10 buffalo cows were used in a 100-day lactation study (from 10 days in milk onwards. Cows were blocked into two groups according to lactation number and previous milk yield and were assigned to one of two dietary treatments: control group was offered in the milking parlour 3 kg of SC, while treatment group was offered the same quantity of PC. All cows were fed a total mixed ration containing 3 kg of SC. Daily milk yield was not affected by treatment, as well as, milk fat and protein percentages, somatic cell count, urea content and fatty acid composition.

  3. Phytochrome regulation of gibberellin metabolism in shoots of dwarf Pisum sativum L

    Energy Technology Data Exchange (ETDEWEB)

    Campell, B.R.


    To study the effect of light on the recessive dwarfing allele, le, of Pisum sativum L., etiolated, paclobutrazol treated LeLe (cv. Alaska) and lele (cv. Progress) pea seedlings were transferred to different light regimes. The growth response of both genotypes to applications of GA/sub 1/, GA/sub 20/, and steviol was measured over 48 hours using position transducers. Both genotypes responded to GA/sub 1/ under red irradiation and in darkness. The LeLe plants grew in response to steviol and GA/sub 20/ under red irradiation and in darkness. The lele plants responded to steviol and GA/sub 20/ in darkness, but showed a much smaller response when red irradiated. The red effect on lele plants was reversible by far-red irradiation. (/sup 3/H)GA/sub 20/ was applied to nana pea seedlings, homozygous for le, grown under different light regimes. Radioactive metabolites were later extracted from the shoots of the treated plants. Both the free acid and conjugate pools were analyzed by reversed phase HPLC, and some radioactive metabolites were tentatively identified by comparing their retention times to those of authentic (/sup 3/H)GAs.

  4. Evidence that the mature leaves contribute auxin to the immature tissues of pea (Pisum sativum L.). (United States)

    Jager, Corinne E; Symons, Gregory M; Glancy, Naomi E; Reid, James B; Ross, John J


    In plants such as the garden pea (Pisum sativum L.), it is widely thought that the auxin indole-3-acetic acid (IAA) is synthesised mainly in the immature tissues of the apical bud and then transported basipetally to other parts of the plant. Consistent with this belief are results showing that removal of the apical bud markedly reduces the IAA content in the stem. However, it has also been suggested that the mature leaves may synthesise substantial amounts of IAA, which enters the basipetal transport stream after being transported to the shoot apex in the phloem (Cambridge and Morris in Planta 99:583-588, 1996). To examine this theory, we defoliated pea plants and measured the effect on IAA content in the remaining shoot tissues. IAA levels were reduced in the internodes, and to a lesser extent in the apical bud, after defoliation, suggesting that mature leaves are indeed an important source of auxin for the shoot. Consistent with this idea, we have demonstrated that mature, fully expanded leaves are capable of de novo IAA synthesis. Furthermore, we report evidence for the presence of IAA in the phloem sap of pea. Together these results support those of Cambridge and Morris, suggesting that mature leaves are a source of the IAA in the basipetal transport stream. PMID:17308928

  5. Auxin effects on in vitro and in vivo protein phosphorylation in pea. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Gallagher, S.R.; Ray, P.M.


    Terminal 8mm sections from the third internode of dark grown 7 day old Pisum sativum cv Alaska seedlings were separated into membrane and soluble fractions. SDS gradient PAGE identified approximately 50 in vivo phosphorylated proteins and proved superior to 2-D SDS PAGE in terms of resolution and repeatability. Addition of indoleacetic acid (IAA), fusicoccin, or 2,4 dichlorophenoxyacetic acid to membranes resulted in no detectable change in the number or phosphorylation level of the labeled proteins during in vitro phosphorylation in the presence of submicromolar concentrations of calcium. Similar results were obtained with soluble proteins. In the absence of calcium, the level of in vitro protein phosphorylation was much less, but not auxin effects could be identified. Furthermore, treatment of the sections with IAA in vivo followed by cell fractionation and in vitro phosphorylation failed to identify auxin responsive proteins. Lastly, when sections were labeled with /sup 32/P inorganic phosphate in the presence of 17 uM IAA, no auxin specific changes were found in the level of phosphorylation or in the number of phosphorylated proteins. Auxin effects on phosphorylation are thus slight or below their detection limit.

  6. Genetic interaction and mapping studies on the leaflet development (lld) mutant in Pisum sativum. (United States)

    Kumar, Sushil; Mishra, Raghvendra Kumar; Kumar, Arvind; Chaudhary, Swati; Sharma, Vishakha; Kumari, Renu


    In Pisum sativum, the completely penetrant leaflet development (lld) mutation is known to sporadically abort pinnae suborgans in the unipinnate compound leaf. Here, the frequency and morphology of abortion was studied in each of the leaf suborgans in 36 genotypes and in presence of auxin and gibberellin, and their antagonists. Various lld genotypes were constructed by multifariously recombining lld with a coch homeotic stipule mutation and with af, ins, mare, mfp, tl and uni-tac leaf morphology mutations. It was observed that the suborgans at all levels of pinna subdivisions underwent lld-led abortion events at different stages of development. As in leafblades, lld aborted the pinnae in leaf-like compound coch stipules. The lld mutation interacted with mfp synergistically and with other leaf mutations additively. The rod-shaped and trumpet-shaped aborted pea leaf suborgans mimicked the phenotype of aborted leaves in HD-ZIP-III-deficient Arabidopsis thaliana mutants. Suborganwise aborted morphologies in lld gnotypes were in agreement with basipetal differentiation of leaflets and acropetal differentiation in tendrils. Altogether, the observations suggested that LLD was the master regulator of pinna development. On the basis of molecular markers found linked to lld, its locus was positioned on the linkage group III of the P. sativum genetic map. PMID:23271018

  7. Comportement agronomique d'une collection de pois (Pisum sativum L

    Directory of Open Access Journals (Sweden)

    Bouslama, M.


    Full Text Available Agronomical Behaviour of a Pea Collection (Pisum sativum L.. This experience was achieved under greenhouse conditions. Twelve genotypes of pea were used (Asgrow, Jumbo, Lincoln, Merveille de Kelvedon, Purser, Rajai Torpe, Snajor Kosep, Korai,Wando, Rondo, local genotype, Major Kosep Korai and Surgevil. They were cultivated on peat during 5.5 months (from October to April. Some agronomical parameters were studied: resistance to diseases, (Powdery-mildew, mildew, top yellow virus, anthracnose, browning, fresh matter, number of branches/plant, number of flowers/plant, number of pods/ plant and the yield of grains /plant. Results showed that only the genotype Purser is resistant to all diseases and Surgevil is sensitive only to the Top Yellow virus. The local genotype is sensitive to three frequent diseases (Powdery-mildew, mildew and Anthracnose. With regard to vegetative growth, the highest yield of fresh matter do not contribute towards a high fertility rate. In fact, only the genotypes having a weak yield of fresh matter (Snajor Kosep Korai, Asgrow, Major Kosep Korai, Rajai Torpe and Purser have the most important rate of fertility (> 30%. Within this group, the most important yield (> 9 g/plant is a result of high: number of pods/plant (7.5 to 21.6 and of grains/pod (2.8 to 4.92. Finally, genotype Purser should be retained for farmers and programs of genetic amelioration for its resistance to diseases and agronomical performances.

  8. Study of effect of AC and DC magnetic fields on growth of Pisum sativum seeds (United States)

    Bahar, Mahmood; Yasaie Mehrjardi, Yasaman; Sojoodi, Jaleh; Bayani, Hosien; Kazem Salem, Mohammad


    This paper concentrates on the effect of the AC and DC magnetic fields on plant growth. The effect of AC magnetic field with intensities of 2.25, 1.66 and 1.49 mT and DC magnetic field with intensities of 3.6, 2.41 and 2.05 mT in exposure durations of 2, 4, 6, 8, 10 and 12 min on two groups of dry and wet Pisum sativum seedlings was studied. In each experiment 10 seeds were used; the experiments were repeated three times for each group and there was a sham exposed group for comparison purposes. The light cycle was 12 h light/12 h darkness and the temperature was 25 ± 1° C. The index of growth is considered to be the root and stem elongation on the sixth day. It was observed that AC magnetic field has a positive effect on the growth in all durations and intensities. Moreover, it is highlighted that during the experiments, the mean growth of dry seedlings significantly increased by a factor of 11 in AC magnetic field with the lowest intensity of 1.49 mT (p effect on the growth of plants in comparison to DC magnetic fields.

  9. Development and Characterization of 37 Novel EST-SSR Markers in Pisum sativum (Fabaceae

    Directory of Open Access Journals (Sweden)

    Xiaofeng Zhuang


    Full Text Available Premise of the study: Simple sequence repeat markers were developed based on expressed sequence tags (EST-SSR and screened for polymorphism among 23 Pisum sativum individuals to assist development and refinement of pea linkage maps. In particular, the SSR markers were developed to assist in mapping of white mold disease resistance quantitative trait loci. Methods and Results: Primer pairs were designed for 46 SSRs identified in EST contiguous sequences assembled from a 454 pyrosequenced transcriptome of the pea cultivar, ‘LIFTER’. Thirty-seven SSR markers amplified PCR products, of which 11 (30% SSR markers produced polymorphism in 23 individuals, including parents of recombinant inbred lines, with two to four alleles. The observed and expected heterozygosities ranged from 0 to 0.43 and from 0.31 to 0.83, respectively. Conclusions: These EST-SSR markers for pea will be useful for refinement of pea linkage maps, and will likely be useful for comparative mapping of pea and as tools for marker-based pea breeding.

  10. Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Barranco-Medina, Sergio [Departamento de Bioquímica, Biología Molecular y Celular de Plantas, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, E-18008 Granada (Spain); López-Jaramillo, Francisco Javier, E-mail: [Instituto de Biotecnología, Campus Fuentenueva, Universidad de Granada, E-18071 Granada (Spain); Bernier-Villamor, Laura [Departamento de Bioquímica, Biología Molecular y Celular de Plantas, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, E-18008 Granada (Spain); Sevilla, Francisca [Departamento de Biología del Estrés y Patología Vegetal, Centro de Edafología y Biología Aplicada del Segura, Consejo Superior de Investigaciones Científicas, E-30080 Murcia (Spain); Lázaro, Juan-José [Departamento de Bioquímica, Biología Molecular y Celular de Plantas, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, E-18008 Granada (Spain)


    The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.

  11. Determination of the genotoxic effects of Trigonella foenum graecum L. extracts in stored Pisum sativum seeds

    Directory of Open Access Journals (Sweden)

    Fawzia, I. Mohamed


    Full Text Available This study was carried out to study the effect of Trigonella foenum graecum L extracts on mitotic, meiotic and cell cycle parameters in stored Pisum sativum seeds. The Trigonella foenum extracts induced a marked decrease in the mitotic index accompanied with considerable percentage of chromosomal aberrations. These abnormalities include stickiness, disturbed chromosomes, bridges and lagging chromosome. Cytophotometric measurements showed inhibition of cells in the Go/G1 phase at the expense of other phases of cell cycle (S-phase, G2-phase. The percentage of cells having 2C DNA content decreased gradually with increasing the concentrations, while those having 4C DNA increased. Trigonella foenum extracts not affected on PMCs. Of P. sativum plant after the seeds treated with 0.5-1% and storage for three months but, significant percentage of chromosome abnormalities observed in the PMCs of the plants treated with 2% Trigonella foenum extracts and storage for three months. Also, after storage for six months all treatments have significant effect on abnormalities of PMCs. In all the treatment, various abnormal cells were observed in mitotic and meiotic division. Aberrant cells observed according to concentration and time of storage of Trigonella foenum extracts.

  12. Phytochrome regulation of gibberellin metabolism in shoots of dwarf Pisum sativum L

    International Nuclear Information System (INIS)

    To study the effect of light on the recessive dwarfing allele, le, of Pisum sativum L., etiolated, paclobutrazol treated LeLe (cv. Alaska) and lele (cv. Progress) pea seedlings were transferred to different light regimes. The growth response of both genotypes to applications of GA1, GA20, and steviol was measured over 48 hours using position transducers. Both genotypes responded to GA1 under red irradiation and in darkness. The LeLe plants grew in response to steviol and GA20 under red irradiation and in darkness. The lele plants responded to steviol and GA20 in darkness, but showed a much smaller response when red irradiated. The red effect on lele plants was reversible by far-red irradiation. [3H]GA20 was applied to nana pea seedlings, homozygous for le, grown under different light regimes. Radioactive metabolites were later extracted from the shoots of the treated plants. Both the free acid and conjugate pools were analyzed by reversed phase HPLC, and some radioactive metabolites were tentatively identified by comparing their retention times to those of authentic [3H]GAs

  13. Regional tritrophic relationship patterns of five aphid parasitoid species (Hymenoptera: Braconidae: Aphidiinae) in agroecosystem-dominated landscapes of southeastern Europe. (United States)

    Tomanović, Zeljko; Kavallieratos, Nickolas G; Starý, Petr; Stanisavljević, Ljubisa Z; Cetković, Aleksandar; Stamenković, Srdjan; Jovanović, Slobodan; Athanassiou, Christos G


    A regional survey of the complex tritrophic associations (parasitoid-aphid-plant) of aphid parasitoids (Hymenoptera: Braconidae: Aphidiinae) was carried out to determine and explore the patterns of those associations in various types of environments. Here, we present trophic relationship patterns of the five aphid parasitoid species in crop and noncrop habitats in southeastern Europe, and we contrast them in a regional (Mediterranean [MED] versus continental [CNT]) context. In total, 79 aphid host taxa were identified in this survey. Forty-two of these were recorded from noncrop plants only, 21 from crop plants only, and 18 were present on both types of plants. This means that approximately 74% of all the parasitoid-aphid trophic interactions that support the persistence of the five selected parasitoids are entirely (54%) or partially (20%) associated with noncrop plants. The correspondence of parasitoid-aphid combinations among habitat/region combinations is very high and specific. Our results suggest that Mediterranean and continental regions are clearly distinguished by a contrasting pattern of trophic interactions in crop habitats, whereas the noncrop habitats contribute in lesser degree to these differences. For the crop/noncrop breakdown, the number of nonspecific interactions was larger than expected in crop habitats, whereas in noncrop habitats the abundance of partially specific and specific interactions was larger. The analysis of variance for the regional and habitat distribution of mean aphid host number per parasitoid was highly significant. When both regions were analyzed separately, the parasitoid/crop design showed significant parasitoid effects as well as interactions, whereas the habitat effect was not significant for the Mediterranean region and highly so for the continental region. This highly complex pattern suggests that the mean number of parasitized aphid species is not distributed among parasitoids, regions, and habitats in a similar manner

  14. Spatial organization of the glucosinolate-myrosinase system in brassica specialist aphids is similar to that of the host plant.


    Bridges, Matthew; Jones, Alexandra M. E.; Bones, Atle M.; Hodgson, Chris; Cole, Rosemary; Bartlet, Elspeth; Wallsgrove, Roger; Karapapa, Vassiliki K; Watts, Nigel; Rossiter, John T.


    Secondary metabolites are important in plant defence against pests and diseases. Similarly, insects can use plant secondary metabolites in defence and, in some cases, synthesize their own products. The paper describes how two specialist brassica feeders, Brevicoryne brassicae (cabbage aphid) and Lipaphis erysimi (turnip aphid) can sequester glucosinolates (thioglucosides) from their host plants, yet avoid the generation of toxic degradation products by compartmentalizing myrosinase (thiogluco...

  15. Effects of autumn kaolin treatments on the rosy apple aphid Dysaphis planaginea (Pass.) and possible modes of action.


    Bürgel, K.; Daniel, Claudia; Wyss, Eric


    Autumn applications of the repellent processed-kaolin particle film (Surround ® WP) might be an alternative to the insecticides commonly used in spring to control the rosy apple aphid, Dysaphis plantaginea (Pass.) (Hom., Aphididae). To assess the mode of action and the impact of kaolin on autumn forms of D. plantaginea, trials were conducted in field cages and in open-fields in autumn 2003. Choice and no-choice experiments in field cages showed that winged aphids landed in significantly lower...

  16. Development and characterization of Brassica juncea – fruticulosa introgression lines exhibiting resistance to mustard aphid (Lipaphis erysimi Kalt

    Directory of Open Access Journals (Sweden)

    Atri Chhaya


    Full Text Available Abstract Background Mustard aphid is a major pest of Brassica oilseeds. No source for aphid resistance is presently available in Brassica juncea . A wild crucifer, Brassica fruticulosa is known to be resistant to mustard aphid. An artificially synthesized amphiploid, AD-4 (B. fruticulosa × B. rapa var. brown sarson was developed for use as a bridge species to transfer fruticulosa resistance to B. juncea. Using the selfed backcross we could select a large number of lines with resistance to mustard aphid. This paper reports cytogenetic stability of introgression lines, molecular evidence for alien introgression and their reaction to mustard aphid infestation. Results Majority of introgression lines had expected euploid chromosome number(2n= 36, showed normal meiosis and high pollen grain fertility. Well-distributed and transferable simple-sequence repeats (SSR markers for all the 18 B. juncea chromosomes helped to characterize introgression events. Average proportions of recipient and donor genome in the substitution lines were 49.72 and 35.06%, respectively. Minimum alien parent genome presence (27.29% was observed in the introgression line, Ad3K-280 . Introgressed genotypes also varied for their resistance responses to mustard aphid infestations under artificial release conditions for two continuous seasons. Some of the test genotypes showed consistent resistant reaction. Conclusions B.juncea-fruticulosa introgression set may prove to be a very powerful breeding tool for aphid resistance related QTL/gene discovery and fine mapping of the desired genes/QTLs to facilitate marker assisted transfer of identified gene(s for mustard aphid resistance in the background of commercial mustard genotypes.

  17. Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids. (United States)

    Sytykiewicz, Hubert


    Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. PMID:27178208

  18. Alternaria toxin-induced resistance in rose plants against rose aphid (Macrosiphum rosivorum): effect of tenuazonic acid*


    Yang, Fa-zhong; Yang, Bin; Li, Bei-Bei; Xiao, Chun


    Many different types of toxins are produced by the fungus, Alternaria alternata (Fr.) Keissler. Little is known, however, regarding the influence of these toxins on insects. In this study, we investigated the toxin-induced inhibitory effects of the toxin produced by A. alternata on the rose aphid, Macrosiphum rosivorum, when the toxin was applied to leaves of the rose, Rosa chinensis. The results demonstrated that the purified crude toxin was non-harmful to rose plants and rose aphids, but ha...

  19. Localization, Concentration, and Transmission Efficiency of Banana bunchy top virus in Four Asexual Lineages of Pentalonia aphids


    Alberto Bressan; Shizu Watanabe; April M. Greenwell


    Banana bunchy top virus (BBTV) is the most destructive pathogenic virus of banana plants worldwide. The virus is transmitted in a circulative non-propagative manner by the banana aphid, Pentalonia nigronervosa Coquerel. In this work, we examined the localization, accumulation, and transmission efficiency of BBTV in four laboratory-established lineages of Pentalonia aphids derived from four different host plants: taro (Colocasia esculenta), heliconia (Heliconia spp.), red ginger (Alpinia purpu...

  20. Up-regulation of abscisic acid signaling pathway facilitates aphid xylem absorption and osmoregulation under drought stress. (United States)

    Guo, Huijuan; Sun, Yucheng; Peng, Xinhong; Wang, Qinyang; Harris, Marvin; Ge, Feng


    The activation of the abscisic acid (ABA) signaling pathway reduces water loss from plants challenged by drought stress. The effect of drought-induced ABA signaling on the defense and nutrition allocation of plants is largely unknown. We postulated that these changes can affect herbivorous insects. We studied the effects of drought on different feeding stages of pea aphids in the wild-type A17 of Medicago truncatula and ABA signaling pathway mutant sta-1. We examined the impact of drought on plant water status, induced plant defense signaling via the abscisic acid (ABA), jasmonic acid (JA), and salicylic acid (SA) pathways, and on the host nutritional quality in terms of leaf free amino acid content. During the penetration phase of aphid feeding, drought decreased epidermis/mesophyll resistance but increased mesophyll/phloem resistance of A17 but not sta-1 plants. Quantification of transcripts associated with ABA, JA and SA signaling indicated that the drought-induced up-regulation of ABA signaling decreased the SA-dependent defense but increased the JA-dependent defense in A17 plants. During the phloem-feeding phase, drought had little effect on the amino acid concentrations and the associated aphid phloem-feeding parameters in both plant genotypes. In the xylem absorption stage, drought decreased xylem absorption time of aphids in both genotypes because of decreased water potential. Nevertheless, the activation of the ABA signaling pathway increased water-use efficiency of A17 plants by decreasing the stomatal aperture and transpiration rate. In contrast, the water potential of sta-1 plants (unable to close stomata) was too low to support xylem absorption activity of aphids; the aphids on sta-1 plants had the highest hemolymph osmolarity and lowest abundance under drought conditions. Taken together this study illustrates the significance of cross-talk between biotic-abiotic signaling pathways in plant-aphid interaction, and reveals the mechanisms leading to alter

  1. Effect of sowing date and straw mulch on virus incidence and aphid infestation in organic faba-beans (Vicia faba L.)


    Saucke, H; Juergens, M.; Döring, Th. F.; Lesemann, D.E.; Fittje, S.; Vetten, H.-J.


    The effect of sowing date on aphid infestation and the incidence of aphid-transmitted viruses were investigated in organically managed, small-scale field experiments with two faba bean cultivars over 3 years (2002–04). As an additional factor, strawmulchwas applied in 2 of the 3 years shortly before the start of vector activity in May. Virus incidence was determined using enzyme-linked immunosorbent assay and immunoelectron microscopy. Aphid flight activity was monitored using standard yellow...

  2. Transgenic Expression of a Functional Fragment of Harpin Protein Hpa1 in Wheat Represses English Grain Aphid Infestation

    Institute of Scientific and Technical Information of China (English)

    XU Man-yu; ZHOU Ting; ZHAO Yan-ying; LI Jia-bao; XU Heng; DONG Han-song; ZHANG Chun-ling


    The harpin protein Hpa1 produced by the rice bacterial blight pathogen promotes plant growth and induces plant resistance to pathogens and insect pests. The region of 10-42 residues (Hpa110-42) in the Hpa1 sequence is critical as the isolated Hpa110-42 fragment is 1.3-7.5-fold more effective than the full length in inducing plant growth and resistance. Here we report that transgenic expression of Hpa110-42 in wheat induces resistance to English grain aphid, a dominant species of wheat aphids. Hpa110-42-induced resistance is effective to inhibit the aphid behavior in plant preference at the initial colonization stage and repress aphid performances in the reproduction, nymph growth, and instar development on transgenic plants. The resistance characters are correlated with enhanced expression of defense-regulatory genes (EIN2, PP2-A, and GSL10) and consistent with induced expression of defense response genes (Hel, PDF1.2, PR-1b, and PR-2b). As a result, aphid infestations are alleviated in transgenic plants. The level of Hpa110-42-induced resistance in regard to repression of aphid infestations is equivalent to the effect of chemical control provided by an insecticide. These results suggested that the defensive role of Hpa110-42 can be integrated into breeding germplasm of the agriculturally signiifcant crop with a great potential of the agricultural application.

  3. Species Composition and Distribution of Wheat Aphids and Their Parasitoids in Shiraz Region, and Seasonal Dynamics of the Dominant Species

    Directory of Open Access Journals (Sweden)

    M.S. Mossadegh


    Full Text Available In a study of aphids and their parasitoids in wheat fields of Shiraz region, the species composition, distribution and seasonal dynamics of the dominant species were monitored during 2004-5.Collections were made from 1-3 hectare fields in 10 locations within 50 Km radius around Shiraz city. Species density was estimated by counting individuals present on 40 winter wheat tillers taken at random along 2 transects 5 m apart in the fields. Eight aphid and 3 parasitoid species were identified through this survey. Rhopalosiphum padi (L. and Metopolophium dirhodum (Wlk. with relative abundances of 33.94 and 31.33%, Aphidius rhopalosipi De Stefani-Perez and Praon volucre (Hal. with relative abundances of 55.53 and 39.90%, were the dominant species of aphids and parasitoids, respectively. Seasonal dynamics of the above species were also studied in Badjgah, located 15 Km north of Shiraz city. Peak populations of the dominant aphids occurred between late May and first of June 2004-5, and those of parasitoids were seen 1-3 weeks later. A comparison between seasonal parasitism of the dominant parasitoids showed significant preferences of A. rhopalosiphi on R. padi, and P. volucre on M. dirhodum. Since the total parasitism of both wasps was nearly 30% of the two aphid hosts, attention should be paid to chemical control programs of wheat pests (such as Sunn pest so that it does not disturb the efficiency of the aphid parasitoids.

  4. Predation of the Peach Aphid Myzus persicae by the mirid Predator Macrolophus pygmaeus on Sweet Peppers: Effect of Prey and Predator Density

    Directory of Open Access Journals (Sweden)

    Lara De Backer


    Full Text Available Integrated Pest Management strategies are widely implemented in sweet peppers. Aphid biological control on sweet pepers includes curative applications of parasitoids and generalist predators, but with limited efficiency. Macrolophus pygmaeus is a zoophytophagous predator which has been reported to predate on aphids, but has traditionally been used to control other pests, including whiteflies. In this work, we evaluate the effectiveness of M. pygmaeus in controlling Myzus persicae (Homoptera: Aphididae by testing different combinations of aphid and predator densities in cage-experiments under greenhouse conditions. The impact of the presence of an alternative factitious prey (E. kuehniella eggs was also investigated. Macrolophus pygmaeus, at densities of four individuals/plant, caused rapid decline of newly established aphid populations. When aphid infestations were heavy, the mirid bug reduced the aphid numbers but did not fully eradicate aphid populations. The availability of a factitious prey did not influence M. pygmaeus predation on aphids. Based on our data, preventive application of M. pygmaeus, along with a supplementary food source , is recommended to control early infestations of aphids.

  5. Determination of 4-Chloroindole-3-Acetic Acid Methyl Ester in Lathyrus Vicia and Pisum by Gas Chromatography - Mass Spectrometry

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen; Egsgaard, Helge; Larsen, Elfinn


    4-Chloroindole-3-acetic acid methyl ester was identified unequivocally in Lathyrus latifolius L., Vicia faba L. and Pisum sativum L. by thin layer chromatography, gas chromatography and mass spectrometry. The gas chromatographic system was able to separate underivatized chloroindole-3-acetic acid...... methyl ester isomers. The quantitative determination of 4-chloroindole-3-acetic acid methyl ester in immature seeds of these three species was performed by gas chromatography – mass spectrometry using deuterium labelled 4-chloro-indole-3-acetic acid methyl ester as an internal standard. P. sativum...

  6. Convergence Caused Confusion: On the Systematics Of the Freshwater Gastropod Sulcospira pisum (Brot, 1868) (Cerithioidea, Pachychilidae)

    DEFF Research Database (Denmark)

    Koehler, Frank; Brinkmann, Nora; Glaubrecht, Matthias

    the family. It is tentatively placed within the genus Sulcospira, which is endemic to Java. We assume that a similar shell shape has evolved in both species of not closely related gastropods through convergence, which once more reveals that purely shell-based classifications are particularly...... present evidence that "Melania" pisum is not a thiarid species closely related to Balanocochlis glans (Busch, 1842), as has been supposed with respect to the very similar shells of both species. The species is transferred to the family Pachychilidae, because it shows various typical character states for...

  7. Effects of long-term reduced tillage on weed infestation of pea (Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Andrzej Woźniak


    Full Text Available The study evaluated weed infestation of pea (Pisum sativum L. cultivated under conditions of conventional (CT, reduced (RT and herbicide tillage (HT. It demonstrated the highest weed density per m2 in plots with the herbicide (HT and reduced (RT systems and significantly lower weed infestation in plots cultivated in the conventional system (CT. In addition, more weeds occurred at the third leaf stage (13/14 in BBCH scale than at the pod development stage (73/74 BBCH of pea. The highest biomass was produced by weeds in the herbicide system (HT, a lower one – in the reduced system (RT, and the lowest one – in the conventional system (CT. The air-dry weight of weeds depended also on pea development stage. At the pod development stage (73/74 BBCH, the air-dry weight of weeds was significantly higher than at the third leaf stage (13/14 BBCH. The tillage system was also observed to influence the species composition of weeds. This trait was also affected by the period of weed infestation assessment. At the third leaf stage of pea (13/14 BBCH, there occurred 26 weed species, including 24 annual ones. The most abundant species included: Chenopodium album L., Stellaria media (L. Vill., Capsella bursa-pastoris (L. Med., Matricaria inodora L., Thlaspi arvense L., and Fallopia convolvulus (L. A. Löve. At the pod development stage (73/74 BBCH, the pea crop was colonized by 24 weed species, including 3 perennial ones. At this stage the predominant species included: Avena fatua L., Amaranthus retroflexus L., Papaver rhoeas L., Echinochloa crus-galli (L. P.B., Matricaria inodora L., and Galeopsis tetrahit L.

  8. Biochemical and physiological detection of sulfur dioxide injury to pea plants (Pisum sativum)

    Energy Technology Data Exchange (ETDEWEB)

    Jaeger, H.J.; Klein, H.


    Biochemical and physlological experiments were conducted on pea plants (Pisum sativum) continuously exposed in growth chambers to SO/sub 2/ gas for 18 days. SO/sub 2/ gas concentrations were 0.1, 0.15, and 0.25 ppM. In plants exposed to 0.1 and 0.15 ppM it was clearly demonstrated that there was a greater accumulation of inorganic sulfur, a reduced buffer capacity of the cells relative to H-ions, and a stimulation of glutamate dehydrogenase activity. The only macroscopic symptom seen was slight chlorosis of the older leaves. There was only a slight decrease in fresh and dry weights of these plants compared to the control plants whereas in the group of plants exposed to 0.25 ppM SO/sub 2/ foliage necrosis was considerable. In addition, there was a marked reduction in the fresh and dry weights of the latter plants. However, the relationship among accumulated inorganic sulfur, reduced buffer capacity, and increased glutamate dehydrogenase activity as seen for the lower SO/sub 2/ concentrations was close. Accordingly, it might be possible to use these three parameters to diagnose SO/sub 2/ injury before any significant symptoms appear. In the case of severe SO/sub 2/ injury there was a marked increase in glutamine and ammonia concentrations suggesting that these factors in addition to the above could be used in diagnosing severe SO/sub 2/ injury. There was no significant difference between plants treated with 0.1 or 0.15 ppM SO/sub 2/ and control plants in the contents of K, Ca, P, and N fractions. Therefore, these factors would not be useful in the early detection of SO/sub 2/ injury.

  9. Effect of Rhizobium inoculation of seeds and foliar fertilization on productivity of Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Tadeusz Zając


    Full Text Available Pea (Pisum sativum L. is the second most important grain legume crop in the world which has a wide array of uses for human food and fodder. One of the major factors that determines the use of field pea is the yield potential of cultivars. Presently, pre-sowing inoculation of pea seeds and foliar application of microelement fertilizers are prospective solutions and may be reasonable agrotechnical options. This research was undertaken because of the potentially high productivity of the 'afila' morphotype in good wheat complex soils. The aim of the study was to determine the effect of vaccination with Rhizobium and foliar micronutrient fertilization on yield of the afila pea variety. The research was based on a two-year (2009–2010 controlled field experiment, conducted in four replicates and carried out on the experimental field of the Bayer company located in Modzurów, Silesian region. experimental field soil was Umbrisol – slightly degraded chernozem, formed from loess. Nitragina inoculant, as a source of symbiotic bacteria, was applied before sowing seeds. Green area index (GAI of the canopy, photosynthetically active radiation (PAR, and normalized difference vegetation index (NDVI were determined at characteristic growth stages. The presented results of this study on symbiotic nitrogen fixation by leguminous plants show that the combined application of Nitragina and Photrel was the best combination for productivity. Remote measurements of the pea canopy indexes indicated the formation of the optimum leaf area which effectively used photosynthetically active radiation. The use of Nitragina as a donor of effective Rhizobium for pea plants resulted in slightly higher GAI values and the optimization of PAR and NDVI. It is not recommended to use foliar fertilizers or Nitragina separately due to the slowing of pea productivity.

  10. Growth, seed development and genetic analysis in wild type and Def mutant of Pisum sativum L

    Directory of Open Access Journals (Sweden)

    Ayeh Kwadwo


    Full Text Available Abstract Background The def mutant pea (Pisum sativum L showed non-abscission of seeds from the funicule. Here we present data on seed development and growth pattern and their relationship in predicting this particular trait in wild type and mutant lines as well as the inheritance pattern of the def allele in F2 and F3 populations. Findings Pod length and seed fresh weight increase with fruit maturity and this may affect the abscission event in pea seeds. However, the seed position in either the distal and proximal ends of the pod did not show any difference. The growth factors of seed fresh weight (FW, width of funicles (WFN, seed width (SW and seed height (SH were highly correlated and their relationships were determined in both wild type and def mutant peas. The coefficient of determination R2 values for the relationship between WFN and FW, SW and SH and their various interactions were higher for the def dwarf type. Stepwise multiple regression analysis showed that variation of WFN was associated with SH and SW. Pearson's chi square analysis revealed that the inheritance and segregation of the Def locus in 3:1 ratio was significant in two F2 populations. Structural analysis of the F3 population was used to confirm the inheritance status of the Def locus in F2 heterozygote plants. Conclusions This study investigated the inheritance of the presence or absence of the Def allele, controlling the presence of an abscission zone (AZ or an abscission-less zone (ALZ forming in wild type and mutant lines respectively. The single major gene (Def controlling this phenotype was monogenic and def mutants were characterized and controlled by the homozygous recessive def allele that showed no palisade layers in the hilum region of the seed coat.

  11. Bean pod mottle virus: a new powerful tool for functional genomics studies in Pisum sativum. (United States)

    Meziadi, Chouaib; Blanchet, Sophie; Richard, Manon M S; Pilet-Nayel, Marie-Laure; Geffroy, Valérie; Pflieger, Stéphanie


    Pea (Pisum sativum L.) is an important legume worldwide. The importance of pea in arable rotations and nutritional value for both human and animal consumption have fostered sustained production and different studies to improve agronomic traits of interest. Moreover, complete sequencing of the pea genome is currently underway and will lead to the identification of a large number of genes potentially associated with important agronomic traits. Because stable genetic transformation is laborious for pea, virus-induced gene silencing (VIGS) appears as a powerful alternative technology for determining the function of unknown genes. In this work, we present a rapid and efficient viral inoculation method using DNA infectious plasmids of Bean pod mottle virus (BPMV)-derived VIGS vector. Six pea genotypes with important genes controlling biotic and/or abiotic stresses were found susceptible to BPMV carrying a GFP reporter gene and showed fluorescence in both shoots and roots. In a second step, we investigated 37 additional pea genotypes and found that 30 were susceptible to BPMV and only 7 were resistant. The capacity of BPMV to induce silencing of endogenes was investigated in the most susceptible genotype using two visual reporter genes: PsPDS and PsKORRIGAN1 (PsKOR1) encoding PHYTOENE DESATURASE and a 1,4-β-D-glucanase, respectively. The features of the 'one-step' BPMV-derived VIGS vector include (i) the ease of rub-inoculation, without any need for biolistic or agro-inoculation procedures, (ii) simple cost-effective procedure and (iii) noninterference of viral symptoms with silencing. These features make BPMV the most adapted VIGS vector in pea to make low- to high-throughput VIGS studies. PMID:26896301

  12. Roles for auxin during morphogenesis of the compound leaves of pea ( Pisum sativum). (United States)

    DeMason, Darleen A; Chawla, Rekha


    The goal of this study was to explore the impact of the plant growth regulator auxin on the development of compound leaves in pea. Wildtype ( WT) plantlets, as well as those of two leaf mutants, acacia ( tl) and tendrilled acacia ( uni-tac) of pea ( Pisum sativum L.), were grown on media containing the auxin-transport inhibitors 2,3,5-triiodobenzoic acid (TIBA), N-(1-naphthyl)phthalamic acid (NPA), or the auxin antagonist, p-chlorophenoxyisobutyric acid (PCIB). The resulting plantlets were carefully analyzed morphologically, by scanning electron microscopy and for Uni gene expression using quantitative reverse transcription-polymerase chain reaction. Auxin transport was measured in WT leaf parts using [(14)C]indole-3-acetic acid. Relative Uni gene expression was determined in shoot tips of a range of leaf-form mutants. Morphological abnormalities were observed for all genotypes examined. The terminal tendrils on WT plants were converted to leaflets, stubs or were aborted. The number of pinna pairs produced on leaves was reduced, with the distal forms being eliminated before the proximal ones. Some leaves were converted to simple, including tri-and bilobed, forms. These treatments phenocopy the uni-tac and unifoliata ( uni) mutants of pea. In the most extreme situations, leaf blades were completely lost leaving only a pair of stipules or scale leaves. Polar auxin transport was basipetal for all leaf parts. Uni gene expression in shoot tips was significantly reduced in 60 microM NPA and TIBA. Uni mRNA was more abundant in tl, af and af tl and reduced in the uni mutants compared to WT. These results indicate that an auxin gradient plays fundamental roles in controlling morphogenesis in the compound leaves of pea and specifically it: (i). is the driving force for leaf growth and pinna determination; (ii). is necessary for pinna initiation; and (iii). controls subsequent pinna development. PMID:12942326

  13. Cell wall yield properties of growing tissue: evaluation by in vivo stress relaxation. [Pisum sativus L

    Energy Technology Data Exchange (ETDEWEB)

    Cosgrove, D.J.


    Growing pea stem tissue, when isolated from an external supply of water, undergoes stress relaxation because of continued loosening of the cell wall. A theoretical analysis is presented to show that such stress relaxation should result in an exponential decrease in turgor pressure down to the yield threshold (Y), with a rate constant given by phi epsilon where phi is the metabolically maintained irreversible extensibility of the cell wall and epsilon is the volumetric elastic modulus of the cell. Stress relaxation was measured in pea (Pisum sativus L.) stem segments using the pressure microprobe technique. From the rate of stress relaxation, phi of segments pretreated with water was calculated to be 0.08 per megapascal per hour while that of auxin-pretreated tissue was 0.24 per megapascal per hour. These values agreed closely with estimates of phi made by a steady-state technique. The yield threshold (0.29 megapascal) was not affected by auxin. A theoretical analysis is also presented to show that the tissue hydraulic conductance may be estimated from the T/sub 1/2/ of tissue swelling. Experimentally, pea stems had a swelling T/sub 1/2/ of 2.0 minutes, corresponding to a relative hydraulic conductance of about 2.0 per megapascal per hour. This value is at least 8 times larger than phi. From these data and from computer modeling, it appears that the radial gradient in water potential which sustains water uptake in growing pea segments is small (0.04 megapascal). This means that hydraulic conductance does not substantially restrict growth. The results also demonstrate that the stimulation of growth by auxin can be entirely accounted for by the change in phi.

  14. Palladium uptake by Pisum sativum: partitioning and effects on growth and reproduction. (United States)

    Ronchini, Matteo; Cherchi, Laura; Cantamessa, Simone; Lanfranchi, Marco; Vianelli, Alberto; Gerola, Paolo; Berta, Graziella; Fumagalli, Alessandro


    Environmental palladium levels are increasing because of anthropogenic activities. The considerable mobility of the metal, due to solubilisation phenomena, and its known bioavailability may indicate interactions with higher organisms. The aim of the study was to determine the Pd uptake and distribution in the various organs of the higher plant Pisum sativum and the metal-induced effects on its growth and reproduction. P. sativum was grown in vermiculite with a modified Hoagland's solution of nutrients in the presence of Pd at concentrations ranging 0.10-25 mg/L. After 8-10 weeks in a controlled environment room, plants were harvested and dissected to isolate the roots, stems, leaves, pods and peas. The samples were analysed for Pd content using AAS and SEM-EDX. P. sativum absorbed Pd, supplied as K₂PdCl₄, beginning at seed germination and continuing throughout its life. Minimal doses (0.10-1.0 mg Pd/L) severely inhibited pea reproductive processes while showing a peculiar hormetic effect on root development. Pd concentrations ≥1 mg/L induced developmental delay, with late growth resumption, increased leaf biomass (up to 25%) and a 15-20% reduction of root mass. Unsuccessful repeated blossoming efforts led to misshapen pods and no seed production. Photosynthesis was also disrupted. The absorbed Pd (ca. 0.5 % of the supplied metal) was primarily fixed in the root, specifically in the cortex, reaching concentrations up to 200 μg/g. The metal moved through the stem (up to 1 μg/g) to the leaves (2 μg/g) and pods (0.3 μg/g). The presence of Pd in the pea fruits, together with established evidence of environmental Pd accumulation and bioavailability, suggests possible contamination of food plants and propagation in the food chain and must be the cause for concern. PMID:25639246

  15. Long-Term Fungal Inhibition by Pisum sativum Flour Hydrolysate during Storage of Wheat Flour Bread. (United States)

    Rizzello, Carlo Giuseppe; Lavecchia, Anna; Gramaglia, Valerio; Gobbetti, Marco


    In order to identify antifungal compounds from natural sources to be used as ingredients in the bakery industry, water/salt-soluble extracts (WSE) from different legume flour hydrolysates obtained by the use of a fungal protease were assayed against Penicillium roqueforti DPPMAF1. The agar diffusion assays allowed the selection of the pea (Pisum sativum) hydrolysate as the most active. As shown by the hyphal radial growth rate, the WSE had inhibitory activity towards several fungi isolated from bakeries. The MIC of the WSE was 9.0 mg/ml. Fungal inhibition was slightly affected by heating and variations in pH. The antifungal activity was attributed to three native proteins (pea defensins 1 and 2 and a nonspecific lipid transfer protein [nsLTP]) and a mixture of peptides released during hydrolysis. The three proteins have been reported previously as components of the defense system of the plant. Five peptides were purified from WSE and were identified as sequences encrypted in leginsulin A, vicilin, provicilin, and the nsLTP. To confirm antifungal activity, the peptides were chemically synthesized and tested. Freeze-dried WSE were used as ingredients in leavened baked goods. In particular, breads made by the addition of 1.6% (wt/wt) of the extract and fermented by baker's yeast or sourdough were characterized for their main chemical, structural, and sensory features, packed in polyethylene bags, stored at room temperature, and compared to controls prepared without pea hydrolysate. Artificially inoculated slices of a bread containing the WSE did not show contamination by fungi until at least 21 days of storage and behaved like the bread prepared with calcium propionate (0.3%, wt/wt). PMID:25862230

  16. Antioxidant enzymes regulate reactive oxygen species during pod elongation in Pisum sativum and Brassica chinensis. (United States)

    Liu, Nan; Lin, Zhifang; Guan, Lanlan; Gaughan, Gerald; Lin, Guizhu


    Previous research has focused on the involvement of reactive oxygen species (ROS) in cell wall loosening and cell extension in plant vegetative growth, but few studies have investigated ROS functions specifically in plant reproductive organs. In this study, ROS levels and antioxidant enzyme activities were assessed in Pisum sativum and Brassica chinensis pods at five developmental stages. In juvenile pods, the high levels of O2.- and .OH indicates that they had functions in cell wall loosening and cell elongation. In later developmental stages, high levels of .OH were also related to increases in cell wall thickness in lignified tissues. Throughout pod development, most of the O2.- was detected on plasma membranes of parenchyma cells and outer epidermis cells of the mesocarp, while most of the H2O2 was detected on plasma membranes of most cells throughout the mesocarp. This suggests that these sites are presumably the locations of ROS generation. The antioxidant enzymes superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) apparently contributed to ROS accumulation in pod wall tissues. Furthermore, specifically SOD and POD were found to be associated with pod growth through the regulation of ROS generation and transformation. Throughout pod development, O2.- decreases were associated with increased SOD activity, while changes in H2O2 accumulation were associated with changes in CAT and POD activities. Additionally, high POD activity may contribute to the generation of(.)OH in the early development of pods. It is concluded that the ROS are produced in different sites of plasma membranes with the regulation of antioxidant enzymes, and that substantial ROS generation and accumulation are evident in cell elongation and cell wall loosening in pod wall cells. PMID:24503564

  17. Aphids (Hemiptera: Aphidomorpha of the Botanic Garden of the Jagiellonian University, Kraków*

    Directory of Open Access Journals (Sweden)

    Starowicz Marzena


    Full Text Available The paper presents results of faunistic investigations of aphids (Aphidomorpha in the Botanic Garden of the Jagiellonian University, Kraków, in the Kraków – Wieluń Upland. During two seasons of research (2011, 2012 two aphid species from the family Adelgidae and 50 species from the family Aphididae, associated with 66 host plants were recorded. The following species – Eriosoma anncharlotteae Danielsson, 1979, Capitophorus elaeagni (Del Guercio, 1894, Rhopalosiphoninus (Neorhopalosiphoninus staphyleae staphyleae (Koch, 1854, Eulachnus brevipilosus Börner, 1940 and E. cembrae Börner, 1950 – are new for the Kraków – Wieluń Upland. Seven of the species recorded are regarded as alien to Poland.

  18. Tracing individual movements of aphids reveals preferential routes of population transfers in agroecosystems. (United States)

    Vialatte, Aude; Simon, Jean-Christophe; Dedryver, Charles-Antoine; Fabre, Frederic; Plantegenest, Manuel


    Agricultural pests are not restricted to crops, but often simultaneously or successively use different cultivated and uncultivated hosts. Nevertheless, the source-sink role of cultivated and uncultivated habitats in the life cycle of crop pests remains poorly understood. This is largely due to the difficulty of tracking displacements of small organisms in agricultural landscapes. We used stable-isotope ratios in order to infer the natal host plant of individuals of the English grain aphid Sitobion avenae colonizing wheat fields in autumn. We showed that among the numerous plant sources of S. avenae, maize, which has been intensively grown in western France since the 1960s, provided most aphids that attack wheat fields early in autumn. This study illustrates how insect pests respond to land-use changes within a relatively short period of time, rapidly acquiring a new host that in turn affected their population biology considerably by playing a pivotal role on their annual life cycle. PMID:16826984

  19. Demographic parameters of cotton aphid, Aphis gossypii Glover (Homoptera: Aphididae) on five cotton cultivars

    Institute of Scientific and Technical Information of China (English)



    Life table parameters of the cotton aphid, Aphis gossypii Glover, were estimated on five cotton cultivars ('Sealand' ,'Siokra' ,'Varamin' ,'Bakhtegan' and 'Sahel'). Demographic parameters of the cotton aphid were assessed at 27.5 ± 1 ℃, 65% ± 10% RH and a photoperiod of 14:10 (L: D)h. The shortest developmental time for the nymphal stages was 5.5 days on 'Siokra' and the longest was 6.1 days on 'Sealand'. The highest offspring per female was 29.6 on 'Sahel' and the lowest was 15.3 on 'Sealand'. The rm values varied from 0.272 on 'Sealand' to 0.382 (day-1) on 'Varamin'. Jackknife estimates of the A.gossypii parameters on these cultivars indicated the greatest developmental rate and fecundity on 'Varamin' and the poorest on 'Sealand' cultivar.

  20. Poisoning of Canada geese in Texas by parathion sprayed for control of Russian wheat aphid (United States)

    Flickinger, Edward L.; Juenger, Gary; Roffe, Thomas J.; Smith, Milton R.; Irwin, Roy J.


    Approximately 200 Canada geese (Branta canadensis) died at a playa lake in the Texas Panhandle shortly after a winter wheat field in the basin adjacent to the lake was treated with parathion to control newly invading Russian wheat aphids (Diuraphis noxia). No evidence of infectious disease was diagnosed during necropsies of geese. Brain ChE activities were depressed up to 77% below normal. Parathion residues in GI tract contents of geese ranged from 4 to 34 ppm. Based on this evidence, parathion was responsible for the goose mortalities. Parathion applications to winter wheat will undoubtedly increase if parathion is applied for control of both Russian wheat aphids and greenbugs (Schizaphis graminum). Geese may potentially be exposed to widespread applications of parathion from fall to spring, essentially their entire wintering period.

  1. Fitness Effects of Food Resources on the Polyphagous Aphid Parasitoid, Aphidius colemani Viereck (Hymenoptera: Braconidae: Aphidiinae) (United States)

    Charles, Jennifer J.; Paine, Timothy D.


    Conservation biological control involving the polyphagous aphid parasitoid, Aphidius colemani Viereck, may include provisioning resources from a variety of plant sources. The fitness of adult A. colemani was enhanced with the provision of food resources such as floral nectar from a range of both native and introduced plant species and aphid honeydew under laboratory conditions. However, enhanced fitness appeared to be species specific rather than associated with the whether the plant was a native or an introduced species. Parasitoid survival and fecundity were enhanced significantly in response to the availability of floral nectar and honeydew compared to the response to available extrafloral nectar. These positive effects on the parasitoid’s reproductive activity can improve the effectiveness of conservation biological control in nursery production systems because of the abundance and diversity of floral resources within typical production areas. Additionally, surrounding areas of invasive weeds and native vegetation could serve as both floral resources and honeydew food resources for A. colemani. PMID:26808191

  2. The entomopathogenic fungal endophytes Purpureocillium lilacinum (formerly Paecilomyces lilacinus and Beauveria bassiana negatively affect cotton aphid reproduction under both greenhouse and field conditions.

    Directory of Open Access Journals (Sweden)

    Diana Castillo Lopez

    Full Text Available The effects of two entomopathogenic fungal endophytes, Beauveria bassiana and Purpureocillium lilacinum (formerly Paecilomyces lilacinus, were assessed on the reproduction of cotton aphid, Aphis gossypii Glover (Homoptera:Aphididae, through in planta feeding trials. In replicate greenhouse and field trials, cotton plants (Gossypium hirsutum were inoculated as seed treatments with two concentrations of B. bassiana or P. lilacinum conidia. Positive colonization of cotton by the endophytes was confirmed through potato dextrose agar (PDA media plating and PCR analysis. Inoculation and colonization of cotton by either B. bassiana or P. lilacinum negatively affected aphid reproduction over periods of seven and 14 days in a series of greenhouse trials. Field trials were conducted in the summers of 2012 and 2013 in which cotton plants inoculated as seed treatments with B. bassiana and P. lilacinum were exposed to cotton aphids for 14 days. There was a significant overall effect of endophyte treatment on the number of cotton aphids per plant. Plants inoculated with B. bassiana had significantly lower numbers of aphids across both years. The number of aphids on plants inoculated with P. lilacinum exhibited a similar, but non-significant, reduction in numbers relative to control plants. We also tested the pathogenicity of both P. lilacinum and B. bassiana strains used in the experiments against cotton aphids in a survival experiment where 60% and 57% of treated aphids, respectively, died from infection over seven days versus 10% mortality among control insects. Our results demonstrate (i the successful establishment of P. lilacinum and B. bassiana as endophytes in cotton via seed inoculation, (ii subsequent negative effects of the presence of both target endophytes on cotton aphid reproduction using whole plant assays, and (iii that the P. lilacinum strain used is both endophytic and pathogenic to cotton aphids. Our results illustrate the potential of

  3. Analysis of carotenoid compounds in aphids by Raman imaging and mass spectrometry




    Authors: Pierre Brat, Jean Christophe Valmalette, Christian Mertz, George de Sousa, Aviv Dombrovsky, Maria Capovilla & Alain Robichon ### Abstract Carotenoids are compounds synthesized in plants, bacteria and fungi, closely associated to the chlorophyll to perform photosynthesis. A spectacular evolutionary achievement allowed the aphid to produce carotenoids obviously by lateral transfer of genes from fungi. We have recently documented that these molecules are involved in photo c...

  4. Pest control of aphids depends on landscape complexity and natural enemy interactions


    Martin, Emily A.; Reineking, Björn; Seo, Bumsuk; Steffan-Dewenter, Ingolf


    Aphids are a major concern in agricultural crops worldwide, and control by natural enemies is an essential component of the ecological intensification of agriculture. Although the complexity of agricultural landscapes is known to influence natural enemies of pests, few studies have measured the degree of pest control by different enemy guilds across gradients in landscape complexity. Here, we use multiple natural-enemy exclosures replicated in 18 fields across a gradient in landscape complexi...

  5. Evaluation of the aphid and aphidophagous beneficials diversity in a pea and potato association


    Bosquée, Emilie; Chevalier Mendes Lopes, Thomas; Serteyn, Laurent; Chen, Julian; Yong, Liu; Francis, Frédéric


    Crop associations can have beneficial effects on the control of insect pests. This study was conducted in the Shandong province (China) to assess the impact of potatoes and peas association on the populations of aphids and aphidophagous beneficials. Observations on potato plants and trapping were performed. During the season, the degree of infestation didn’t differ significantly between the association and the pure stand. However, the aphidophagous beneficials were more abundant in the associ...

  6. Nonrandom distribution of cabbage aphids (Hemiptera: Aphididae) in dryland canola (Brassicales: Brassicaceae)


    Severtson, D; Flower, K.; Nansen, C


    © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. Characterization of spatial distribution patterns of pests in large-scale agricultural fields is important because these patterns affect the sampling effort needed to accurately detect and estimate their population density. In this study, we conducted experimental releases of alate cabbage aphids (Brevicoryne brassicae L.) into centers of small plots of canola (Brassica...

  7. Cryptic diversity and habitat partitioning in an economically important aphid species complex. (United States)

    Savory, F R; Ramakrishnan, U


    Cardamom Bushy Dwarf Virus (CBDV) is an aphid-borne nanovirus which infects large cardamom, Amomum subulatum (Zingiberaceae family), in the Himalayan foothills of Northeast India, Nepal and Bhutan. Two aphid species have been reported to transmit CBDV, including Pentalonia nigronervosa and Micromyzus kalimpongensis (also described as Pentalonia kalimpongensis). However, P. nigronervosa was recently split into two species which exhibit different host plant affiliations. Whilst P. nigronervosa primarily feeds on banana plants, Pentaloniacaladii (previously considered a 'form' of P. nigronervosa) typically feeds on plants belonging to the Araceae, Heliconiaceae and Zingiberaceae families. This raises the possibility that CBDV vectors that were originally described as P. nigronervosa correspond to P. caladii. Accurate identification of vector species is important for understanding disease dynamics and for implementing management strategies. However, closely related species can be difficult to distinguish based on morphological characteristics. In this study, we used molecular markers (two mitochondrial loci and one nuclear locus) and Bayesian phylogenetic analyses to identify aphid specimens collected from 148 CBDV infected plants at a range of locations and elevations throughout Sikkim and the Darjeeling district of West Bengal (Northeast India). Our results revealed the presence of a diversity of lineages, comprising up to six distinct species in at least two related genera. These included the three species mentioned above, an unidentified Pentalonia species and two lineages belonging to an unknown genus. Surprisingly, P. caladii was only detected on a single infected plant, indicating that this species may not play an important role in CBDV transmission dynamics. Distinct elevation distributions were observed for the different species, demonstrating that the community composition of aphids which feed on large cardamom plants changes across an elevation gradient

  8. Rothamsted’s aphid-resistant wheat – a turning point for GMOs?


    Lynas Mark


    Abstract Rothamsted Research mounted a successful counter-campaign in response to a threat by environmental protesters to destroy their research project examining aphid-resistant genetically modified (GM) wheat. This involved the use of online media, petitions, and other tools, by which researchers engaged directly with media and the general public in defense of their work. Lessons are suggested for other researchers in the controversial field of GM plant breeding.

  9. Evolutionary Relationships of Three New Species of Enterobacteriaceae Living as Symbionts of Aphids and Other Insects


    Moran, Nancy A.; Russell, Jacob A; Koga, Ryuichi; Fukatsu, Takema


    Ecological studies on three bacterial lineages symbiotic in aphids have shown that they impose a variety of effects on their hosts, including resistance to parasitoids and tolerance to heat stress. Phylogenetic analyses of partial sequences of gyrB and recA are consistent with previous analyses limited to 16S rRNA gene sequences and yield improved confidence of the evolutionary relationships of these symbionts. All three symbionts are in the Enterobacteriaceae. One of the symbionts, here give...

  10. Could Behaviour and Not Physiological Thermal Tolerance Determine Winter Survival of Aphids in Cereal Fields?


    Alford, Lucy; Andrade, Thiago Oliveira; Georges, Romain; Burel, Françoise; van Baaren, Joan


    Traits of physiological thermotolerance are commonly measured in the laboratory as predictors of the field success of ectotherms at unfavourable temperatures (e.g. during harsh winters, heatwaves, or under conditions of predicted global warming). Due to being more complicated to measure, behavioural thermoregulation is less commonly studied, although both physiology and behaviour interact to explain the survival of ectotherms. The aphids Metopolophium dirhodum, Rhopalosiphum padi and Sitobion...

  11. Rothamsted’s aphid-resistant wheat – a turning point for GMOs?

    Directory of Open Access Journals (Sweden)

    Lynas Mark


    Full Text Available Abstract Rothamsted Research mounted a successful counter-campaign in response to a threat by environmental protesters to destroy their research project examining aphid-resistant genetically modified (GM wheat. This involved the use of online media, petitions, and other tools, by which researchers engaged directly with media and the general public in defense of their work. Lessons are suggested for other researchers in the controversial field of GM plant breeding.

  12. Adaptation of aphid stylectomy for analyses of proteins and mRNAs in barley phloem sap


    Gaupels, Frank; Buhtz, Anja; Knauer, Torsten; Deshmukh, Sachin; Waller, Frank; van Bel, Aart J. E.; Kogel, Karl-Heinz; Kehr, Julia


    Sieve tubes are transport conduits not only for photoassimilates but also for macromolecules and other compounds that are involved in sieve tube maintenance and systemic signalling. In order to gain sufficient amounts of pure phloem exudates from barley plants for analyses of the protein and mRNA composition, a previously described stylectomy set-up was optimized. Aphids were placed in sealed cages, which, immediately after microcauterization of the stylets, were flooded with water-saturated ...

  13. Aphids and their parasitoids (Hym., Braconidae: Aphidiinae) asociated with medicinal plants in Iran

    Czech Academy of Sciences Publication Activity Database

    Talebi, A. A.; Rakhshani, E.; Fathipour, Y.; Starý, Petr; Tomanović, Ž.; Rajabi-Mazhar, N.


    Roč. 3, č. 2 (2009), s. 205-219. ISSN 1995-0748 R&D Projects: GA AV ČR IBS5007102 Grant ostatní: University of Zabol(IR) No. 86-19; The Serbian Ministry of Science(CS) 143006 Institutional research plan: CEZ:AV0Z50070508 Keywords : medicinal plants * aphid parasitoids * Aphidiinae Subject RIV: EH - Ecology, Behaviour

  14. Norway spruce and spruce shoot aphid as indicators of traffic pollution

    Energy Technology Data Exchange (ETDEWEB)

    Viskari, E-L.; Koessi, S. [Kuopio Univ. (Finland). Dept. of Ecology and Environmental Science; Holopainen, J.K. [Kuopio Univ. (Finland). Dept. of Ecology and Environmental Science; Agricultural Research Centre, Plant Production Research, Jokioinen (Finland)


    Two-year-old Norway spruce (Picea abies (L.) Karst) seedlings were exposed to traffic emissions along roadsides with three different traffic densities and speed limits; highway, street and a quiet local road. The responses of the exposed seedlings as a host plant and those of spruce shoot aphid (Cinara pilicornis Hartig) were studied. The concentrations of soluble N and free amino acids, defence chemicals (total phenolics, monoterpenes) were analysed, and aphid growth and reproduction were studied. Along the highway, street and at the local road control site, the atmospheric concentrations of black carbon (BC) and oxides of N (NO{sub x}) were measured for 1 week during the experiment. The BC data indicate deposition of organic particulate compounds along the highway and street. The NO{sub x} concentrations along the highway and street showed great diurnal variation, but the average NO{sub x} concentrations were relatively low. Thus, no changes in N metabolism or growth of the exposed Norway spruce seedlings were found. Along the street, the concentrations of many individual free amino acids, such as proline, as well as total amino acid concentrations, were lower than at the associated control site. Correspondingly, there was also no increase in spruce shoot aphid mean relative growth rate. The aphid reproduction, however, increased along the highway and is suggested to be due to more conducive microclimatic conditions at the exposure site or lack of natural enemies. No changes in defence chemicals (total phenolics, monoterpenes) in relation to the traffic exposure were found. Instead, the microclimatic conditions (temperature, solar irradiation) seemed to affect the concentration of total phenolics. (Author)

  15. The origin and genetic differentiation of the socially parasitic aphid Tamalia inquilinus. (United States)

    Miller, Donald G; Lawson, Sarah P; Rinker, David C; Estby, Heather; Abbot, Patrick


    Social and brood parasitisms are nonconsumptive forms of parasitism involving the exploitation of the colonies or nests of a host. Such parasites are often related to their hosts and may evolve in various ecological contexts, causing evolutionary constraints and opportunities for both parasites and their hosts. In extreme cases, patterns of diversification between social parasites and their hosts can be coupled, such that diversity of one is correlated with or even shapes the diversity of the other. Aphids in the genus Tamalia induce galls on North American manzanita (Arctostaphylos) and related shrubs (Arbutoideae) and are parasitized by nongalling social parasites or inquilines in the same genus. We used RNA sequencing to identify and generate new gene sequences for Tamalia and performed maximum-likelihood, Bayesian and phylogeographic analyses to reconstruct the origins and patterns of diversity and host-associated differentiation in the genus. Our results indicate that the Tamalia inquilines are monophyletic and closely related to their gall-forming hosts on Arctostaphylos, supporting a previously proposed scenario for origins of these parasitic aphids. Unexpectedly, population structure and host-plant-associated differentiation were greater in the non-gall-inducing parasites than in their gall-inducing hosts. RNA-seq indicated contrasting patterns of gene expression between host aphids and parasites, and perhaps functional differences in host-plant relationships. Our results suggest a mode of speciation in which host plants drive within-guild diversification in insect hosts and their parasites. Shared host plants may be sufficient to promote the ecological diversification of a network of phytophagous insects and their parasites, as exemplified by Tamalia aphids. PMID:26460808

  16. Toxicity of Three Insecticides to Lysiphlebus fabarum, a Parasitoid of the Black Bean Aphid, Aphis fabae


    Sabahi, Qodratollah; Rasekh, Arash; Michaud, J.P.


    The toxicity of three insecticides to Lysiphlebus fabarum (Marshall) (Hymenoptera: Braconidae: Aphidiinae), a parasitoid of Aphis fabae Scopoli (Hemiptera: Aphididae), was investigated using IOBC/wprs protocols. Abamectin 1.8 EC, imidacloprid 350 SC, and pymetrozine 25 WP were tested under laboratory conditions at recommended field rates. Immature stages of the parasitoid were exposed to materials by briefly dipping mummified aphids into insecticide solutions/suspensions or water (controls). ...

  17. Distribution and diversity of wheat aphid parasitoids (Hymenoptera: Braconidae: Aphidiinae) in Iran

    Czech Academy of Sciences Publication Activity Database

    Rakhshani, E.; Tomanovic, Ž.; Starý, Petr; Talebi, A. A.; Kavallieratos, N. G.; Zamani, A. A.; Stamenković, S.


    Roč. 105, č. 5 (2008), s. 863-870. ISSN 1210-5759 R&D Projects: GA AV ČR IBS5007102 Grant ostatní: The Ministry of Science and Environmental Protection of the Republic of Serbia(CS) 143006B Institutional research plan: CEZ:AV0Z50070508 Keywords : cereal aphids * parasitoids * Aphidiinae Subject RIV: EG - Zoology Impact factor: 0.913, year: 2008

  18. Transcriptional regulation of sorghum defense determinants against a phloem-feeding aphid. (United States)

    Zhu-Salzman, Keyan; Salzman, Ron A; Ahn, Ji-Eun; Koiwa, Hisashi


    When attacked by a phloem-feeding greenbug aphid (Schizaphis graminum), sorghum (Sorghum bicolor) activates jasmonic acid (JA)- and salicylic acid (SA)-regulated genes, as well as genes outside known wounding and SA signaling pathways. A collection of 672 cDNAs was obtained by differential subtraction with cDNAs prepared from sorghum seedlings infested by greenbug aphids and those from uninfested seedlings. Subsequent expression profiling using DNA microarray and northern-blot analyses identified 82 transcript types from this collection responsive to greenbug feeding, methyl jasmonate (MeJA), or SA application. DNA sequencing analyses indicated that these encoded proteins functioning in direct defense, defense signaling, oxidative burst, secondary metabolism, abiotic stress, cell maintenance, and photosynthesis, as well as proteins of unknown function. In response to insect feeding, sorghum increased transcript abundance of numerous defense genes, with some SA-dependent pathogenesis-related genes responding to greenbug more strongly than to SA. In contrast, only weak induction of MeJA-regulated defense genes was observed after greenbug treatment. However, infestation tests confirmed that JA-regulated pathways were effective in plant defense against greenbugs. Activation of certain transcripts exclusively by greenbug infestation was observed, and may represent unique signal transduction events independent of JA- and SA-regulated pathways. Results indicate that plants coordinately regulate defense gene expression when attacked by phloem-feeding aphids, but also suggest that aphids are able to avoid triggering activation of some otherwise potentially effective plant defensive machinery, possibly through their particular mode of feeding. PMID:14701914

  19. Aphid-induced Defences in Chilli Affect Preferences of the Whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae)


    Saad, Khalid A.; M. N. Mohamad Roff; Hallett, Rebecca H.; Idris, A. B.


    The sweetpotato whitefly (WF), Bemisia tabaci, is a major pest that damages a wide range of vegetable crops in Malaysia. WF infestation is influenced by a variety of factors, including previous infestation of the host plant by other insect pests. This study investigated the effects of previous infestation of host chilli plants by the green peach aphid (Myzus persicae) on the olfactory behavioural response of B. tabaci, using free-choice bioassay with a Y-tube olfactometer. We analysed volatil...

  20. Feeding of Whitefly on Tobacco Decreases Aphid Performance via Increased Salicylate Signaling


    Zhao, Haipeng; Zhang, Xiaoying; Xue, Ming; Zhang, Xiao


    Background The feeding of Bemisia tabaci nymphs trigger the SA pathway in some plant species. A previous study showed that B. tabaci nymphs induced defense against aphids (Myzus persicae) in tobacco. However, the mechanism underlying this defense response is not well understood. Methodology/Principal Findings Here, the effect of activating the SA signaling pathway in tobacco plants through B. tabaci nymph infestation on subsequent M. persicae colonization is investigated. Performance assays s...

  1. Identification and characterization of resistance to cowpea aphid (Aphis craccivora Koch) in Medicago truncatula


    Kamphuis, Lars G.; Gao, Lingling; Singh, Karam B.


    Background Cowpea aphid (CPA; Aphis craccivora) is the most important insect pest of cowpea and also causes significant yield losses in other legume crops including alfalfa, beans, chickpea, lentils, lupins and peanuts. In many of these crops there is no natural genetic resistance to this sap-sucking insect or resistance genes have been overcome by newly emerged CPA biotypes. Results In this study, we screened a subset of the Medicago truncatula core collection of the South Australian Researc...

  2. Aphid parasitoids (Hymenoptera, Braconidae, Aphidiinae) and their associations related to biological control in Brazil

    Czech Academy of Sciences Publication Activity Database

    Starý, Petr; Sampaio, M. V.; Bueno, V. H. P.


    Roč. 51, č. 1 (2007), s. 107-118. ISSN 0085-5626 R&D Projects: GA AV ČR IBS5007102 Grant ostatní: FAO programmers(BR) TCP/BRA/8908 Institutional research plan: CEZ:AV0Z50070508 Keywords : aphid * host range * insect-plant interactions Subject RIV: EH - Ecology, Behaviour Impact factor: 0.432, year: 2007

  3. Preference and life history traits of Aphelinus abdominalis (Hymenoptera: Aphelinidae) when offered different development stages of the lettuce aphid Nasonovia ribisnigri (Hemiptera: Aphididae)

    DEFF Research Database (Denmark)

    Shrestha, Govinda; Skovgård, Henrik; Steenberg, Tove;


    stages of the lettuce aphid were exposed for parasitism compared with older developmental stages. This pattern was supported in the choice experiment where significantly more 2nd instar lettuce aphids were parasitised than alatoid 4th instars, with Manly’s preference index (mean ± SE) for the former...... %) were found across all host stages of the lettuce aphid....

  4. Aphid gel saliva: sheath structure, protein composition and secretory dependence on stylet-tip milieu.

    Directory of Open Access Journals (Sweden)

    Torsten Will

    Full Text Available In order to separate and analyze saliva types secreted during stylet propagation and feeding, aphids were fed on artificial diets. Gel saliva was deposited as chains of droplets onto Parafilm membranes covering the diets into which watery saliva was secreted. Saliva compounds collected from the diet fluid were separated by SDS-PAGE, while non-soluble gel saliva deposits were processed in a novel manner prior to protein separation by SDS-PAGE. Soluble (watery saliva and non-soluble (gel saliva protein fractions were significantly different. To test the effect of the stylet milieu on saliva secretion, aphids were fed on various diets. Hardening of gel saliva is strongly oxygen-dependent, probably owing to formation of sulfide bridges by oxidation of sulphydryl groups. Surface texture of gel saliva deposits is less pronounced under low-oxygen conditions and disappears in dithiothreitol containing diet. Using diets mimicking sieve-element sap and cell-wall fluid respectively showed that the soluble protein fraction was almost exclusively secreted in sieve elements while non-soluble fraction was preferentially secreted at cell wall conditions. This indicates that aphids are able to adapt salivary secretion in dependence of the stylet milieu.

  5. Piperitone-derived saturated lactones: synthesis and aphid behavior-modifying activity. (United States)

    Grudniewska, Aleksandra; Dancewicz, Katarzyna; Białońska, Agata; Wawrzeńczyk, Czesław; Gabryś, Beata


    Two racemic and two enantiomeric pairs of new saturated lactones with the p-menthane system were obtained. The lactones were synthesized from racemic and enantiomerically enriched cis- and trans-piperitols, which were obtained from piperitone. The structures of the compounds were confirmed by spectroscopic data. The antifeedant activity of piperitone to Myzus persicae was studied, and the biological consequences of structural modifications of piperitone, that is, lactonization and chiral center configuration, were examined as well. The behavioral responses of M. persicae to piperitone and piperitone-derived saturated lactones were investigated to reveal the biological background of their deterrent activity. Piperitone appeared rather neutral or weakly deterrent to aphids. The introduction of a lactone moiety into a piperitone molecule dramatically changed its biological activity. All piperitone-derived lactones evoked negative aphid responses. However, the deterrent activity of individual compounds varied in potency, the time of expression, and the duration of the effect, depending on the spatial structure of the lactone. Lactones (1R,3S,6R)-3-isopropyl-6-methyl-9-oxabicyclo[4.3.0]nonan-8-one and trans-3-isopropyl-6-methyl-9-oxabicyclo[4.3.0]nonan-8-one showed the broadest ranges and the highest potencies and durabilities of deterrent activity to M. persicae: they acted immediately after application, caused a cessation of probing before aphids reached phloem elements, and decreased the quality of phloem sap. PMID:23477664

  6. Avoiding incidental predation by mammalian herbivores: accurate detection and efficient response in aphids (United States)

    Gish, Moshe; Dafni, Amots; Inbar, Moshe


    Mammalian herbivores eat plants that may also provide food and shelter for insects. The direct trophic effect of the browsing and grazing of mammalian herbivory on insects, which is probably prevalent in terrestrial ecosystems, has been mostly neglected by ecologists. We examined how the aphid Uroleucon sonchi L. deals with the danger of incidental predation by mammalian herbivores. We found that most (76%) of the aphids in a colony survive the ingestion of the plant by a feeding herbivore. They do so by sensing the combination of heat and humidity in the herbivore's breath and immediately dropping off the plant in large numbers. Their ability to sense the herbivore's breath or their tendency to drop off the plant weakens as ambient temperature rises. This could indicate a limitation of the aphids' sensory system or an adaptation that enables them to avoid the hostile conditions on a hot ground. Once on the ground, U. sonchi is highly mobile and capable of locating a new host plant by advancing in a pattern that differs significantly from random movement. The accurate and efficient defense mechanism of U. sonchi emphasizes the significance of incidental predation as a danger to plant-dwelling invertebrates.

  7. Alterations in the nitrogen dynamics of European beech trees infested by the woolly beech aphid (United States)

    Levia, D. F.; Michalzik, B.


    Insects are a major stressor in wooded ecosystems, triggering profound changes in the hydrology, biogeochemistry, and net primary productivity of infested forests. The influence of woolly beech aphids (Phyllaphis fagi L.) on nitrogen cycling via throughfall, stemflow, and litter leachates is not well understood. Employing a combination of field sampling, X-ray photoelectron spectroscopy, and scanning electron microscopy, we examined and compared the alterations and partitioning of nitrogen (particulate, dissolved, organic, inorganic) between control (uninfested) and infested trees. Preliminary results suggest that the amount of nitrogen routed to the soil is much lower in throughfall and stemflow of infested trees than control trees. Preliminary X-ray photoelectron spectroscopy and scanning electron microscopy measurements on the abaxial surface of sample leaves have demonstrated that the surface microbiology and nitrogen chemistry of control, lightly infested, and heavily infested leaves are notably different. These observations suggest that the aphids alter the phyllosphere ecology to such an extent that they trigger nitrogen uptake by microbes on the leaf surface in the presence of easily available carbon from aphid excretions (i.e., honeydew). A better understanding of nitrogen cycling in stressed forests would advance theories of nitrogen cycling.

  8. Comparative analysis of mitochondrial genomes of five aphid species (Hemiptera: Aphididae and phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    Full Text Available Insect mitochondrial genomes (mitogenomes are of great interest in exploring molecular evolution, phylogenetics and population genetics. Only two mitogenomes have been previously released in the insect group Aphididae, which consists of about 5,000 known species including some agricultural, forestry and horticultural pests. Here we report the complete 16,317 bp mitogenome of Cavariella salicicola and two nearly complete mitogenomes of Aphis glycines and Pterocomma pilosum. We also present a first comparative analysis of mitochondrial genomes of aphids. Results showed that aphid mitogenomes share conserved genomic organization, nucleotide and amino acid composition, and codon usage features. All 37 genes usually present in animal mitogenomes were sequenced and annotated. The analysis of gene evolutionary rate revealed the lowest and highest rates for COI and ATP8, respectively. A unique repeat region exclusively in aphid mitogenomes, which included variable numbers of tandem repeats in a lineage-specific manner, was highlighted for the first time. This region may have a function as another origin of replication. Phylogenetic reconstructions based on protein-coding genes and the stem-loop structures of control regions confirmed a sister relationship between Cavariella and pterocommatines. Current evidence suggest that pterocommatines could be formally transferred into Macrosiphini. Our paper also offers methodological instructions for obtaining other Aphididae mitochondrial genomes.

  9. Low genetic diversity in Melanaphis sacchari aphid populations at the worldwide scale. (United States)

    Nibouche, Samuel; Fartek, Benjamin; Mississipi, Stelly; Delatte, Hélène; Reynaud, Bernard; Costet, Laurent


    Numerous studies have examined the genetic diversity and genetic structure of invading species, with contrasting results concerning the relative roles of genetic diversity and phenotypic plasticity in the success of introduced populations. Increasing evidence shows that asexual lineages of aphids are able to occupy a wide geographical and ecological range of habitats despite low genetic diversity. The anholocyclic aphid Melanaphis sacchari is a pest of sugarcane and sorghum which originated in the old world, was introduced into the Americas, and is now distributed worldwide. Our purpose was to assess the genetic diversity and structuring of populations of this species according to host and locality. We used 10 microsatellite markers to genotype 1333 individuals (57 samples, 42 localities, 15 countries) collected mainly on sugarcane or sorghum. Five multilocus lineages (MLL) were defined, grouping multilocus genotypes (MLG) differing by only a few mutations or scoring errors. Analysis of a 658 bp sequence of mitochondrial COI gene on 96 individuals revealed five haplotypes, with a mean divergence of only 0.19 %. The distribution of MLL appeared to be strongly influenced by geography but not by host plant. Each of the five MLL grouped individuals from (A) Africa, (B) Australia, (C) South America, the Caribbean and the Indian Ocean including East Africa, (D) USA, and (E) China. The MLL A and C, with a wide geographic distribution, matched the definition of superclone. Among aphids, M. sacchari has one of the lowest known rates of genetic diversity for such a wide geographical distribution. PMID:25148510

  10. Trophic interactions between rhizosphere bacteria and bacterial feeders influenced by phosphate and aphids in barley

    DEFF Research Database (Denmark)

    Strandmark, Lisa Bjørnlund; Mørk, Søren; Madsen, Mette Vestergård;


    The aim was to study the effects of P fertilization and leaf aphid attack on the trophic interactions of bacteria and bacterial feeders in the rhizospheres of barley plants. The density of protozoa peaked in the rhizospheres of plants fertilized with N and P, whereas nematodes peaked in the rhizo......The aim was to study the effects of P fertilization and leaf aphid attack on the trophic interactions of bacteria and bacterial feeders in the rhizospheres of barley plants. The density of protozoa peaked in the rhizospheres of plants fertilized with N and P, whereas nematodes peaked......-proteobacteria increased with P addition. To evaluate if differences in bacteria in terms of their quality as food could partly explain the observed differences in protozoan and nematode abundances, growth of the flagellate Cercomonas sp. was assessed with 935 bacteria isolated from the different treatments. This assay...... indicated that bacterial isolates were of higher food quality to Cercomonas sp. in NP than in N rhizospheres when plants were subjected to aphid attack. Bacteria of high and low food quality for Cercomonas sp., respectively, were fed to the nematode Caenorhabditis elegans and larval production examined. a...

  11. Effect of heavy metals on growth and heavy metal content of Allium porrum L. and Pisum sativum L

    Energy Technology Data Exchange (ETDEWEB)

    Gruenhage, L.; Jaeger, H.J.


    The effects of cadmium, lead, zinc and copper, singly and in combination, on yield, heavy metal content and the mineral composition of Allium porrum L. and Pisum sativum L. have been investigated. The Cd, Pb, Zn and Cu concentrations of shoots and roots of Allium porrum increased with increasing heavy metal contamination of soil. However, no visible symptoms of heavy metal toxicity were recognized. The dry matter production was reduced as a function of heavy metal concentration and combination. The mechanisms of combinations were mostly synergistic. The correlation between pollutant contents (nmol/shoot) and yield was higher than the correlation between heavy metal concentrations of soil or shoots (ppm) and yield. Results of regression analyses showed that the inhibition of copper translocation caused by Cd, Pb and Zn was responsible for the yield depressions. The antagonism between Cd and N-deficiency showed that the level of N-supply was without negative effects on yield depressions of Pisum sativum caused by Cd. In contrast to this, the N-form played an important role in Cd-toxicity as the synergism between Cd and NH4 illustrated. K-deficiency as well as acidic nutrient solution (pH=4) diminished the root/shoot-barrier for Cd and therefore Cd-translocation from roots to shoots increased. Concerning calcium, magnesium and iron the decrease of ion uptake caused by Cd was statistically significant higher than yield depression.

  12. Genetic diversity and population structure of Pisum sativum accessions for marker-trait association of lipid content

    Institute of Scientific and Technical Information of China (English)

    Sajjad; Ahmad; Simerjeet; Kaur; Neil; Dylan; Lamb-Palmer; Mark; Lefsrud; Jaswinder; Singh


    Field pea(Pisum sativum L.) is an important protein-rich pulse crop produced globally. Increasing the lipid content of Pisum seeds through conventional and contemporary molecular breeding tools may bring added value to the crop. However, knowledge about genetic diversity and lipid content in field pea is limited. An understanding of genetic diversity and population structure in diverse germplasm is important and a prerequisite for genetic dissection of complex characteristics and marker-trait associations. Fifty polymorphic microsatellite markers detecting a total of 207 alleles were used to obtain information on genetic diversity, population structure and marker-trait associations. Cluster analysis was performed using UPGMA to construct a dendrogram from a pairwise similarity matrix. Pea genotypes were divided into five major clusters. A model-based population structure analysis divided the pea accessions into four groups. Percentage lipid content in 35 diverse pea accessions was used to find potential associations with the SSR markers. Markers AD73, D21, and AA5 were significantly associated with lipid content using a mixed linear model(MLM) taking population structure(Q) and relative kinship(K) into account. The results of this preliminary study suggested that the population could be used for marker-trait association mapping studies.

  13. Genetic diversity and population structure of Pisum sativum accessions for marker-trait association of lipid content

    Directory of Open Access Journals (Sweden)

    Sajjad Ahmad


    Full Text Available Field pea (Pisum sativum L. is an important protein-rich pulse crop produced globally. Increasing the lipid content of Pisum seeds through conventional and contemporary molecular breeding tools may bring added value to the crop. However, knowledge about genetic diversity and lipid content in field pea is limited. An understanding of genetic diversity and population structure in diverse germplasm is important and a prerequisite for genetic dissection of complex characteristics and marker-trait associations. Fifty polymorphic microsatellite markers detecting a total of 207 alleles were used to obtain information on genetic diversity, population structure and marker-trait associations. Cluster analysis was performed using UPGMA to construct a dendrogram from a pairwise similarity matrix. Pea genotypes were divided into five major clusters. A model-based population structure analysis divided the pea accessions into four groups. Percentage lipid content in 35 diverse pea accessions was used to find potential associations with the SSR markers. Markers AD73, D21, and AA5 were significantly associated with lipid content using a mixed linear model (MLM taking population structure (Q and relative kinship (K into account. The results of this preliminary study suggested that the population could be used for marker-trait association mapping studies.

  14. Isoenzymes of superoxide dismutase in nodules of Phaseolus vulgaris L. , Pisum sativum L. , and Vigna unguiculata (L. ) Walp

    Energy Technology Data Exchange (ETDEWEB)

    Becana, M.; Paris, F.J.; Sandalio, L.M.; Del Rio, L.A. (IRNA, Salamanca (Spain) Unidad de Bioquimica Vegetal, Granada (Spain))


    The activity and isozymic composition of superoxide dismutase were determined in nodules of Phaseolus vulgaris L., Pisum sativum L., and Vigna unguiculata (L.) Walp. A Mn-SOD was present in Rhizobium and two in Bradyrhizobium and bacteroids. Nodule mitochondria from all three legume species had a single Mn-SOD with similar relative mobility, whereas the cytosol contained several CuZn-SODs: two in Phaseolus and Pisum, and four in Vigna. In the cytoplasm of V. unguiculata nodules, a Fe-containing SOD was also present, with an electrophoretic mobility between those of CuZn- and Mn-SODs, and an estimated molecular weight of 57,000. Total SOD activity of the soluble fraction of host cells, expressed on a nodule fresh weight basis, exceeded markedly that of bacteroids. Likewise, specific SOD activities of free-living bacteria were superior or equal to those of their symbiotic forms. Soluble extracts of bacteria and bacteroids did not show peroxidase activity, but the nodule cell cytoplasm contained diverse peroxidase isozymes which were readily distinguishable from leghemoglobin components by electrophoresis. Data indicated that peroxidases and leghemoglobins did not significantly interfere with SOD localization on gels. Treatment with chloroform-ethanol scarcely affected the isozymic pattern of SODs and peroxidases, and had limited success in the removal of leghemoglobin.

  15. Female-induced increase of host-plant volatiles enhance specific attraction of aphid male Dysaphis plantaginea (Homoptera: Aphididae) to the sex pheromone

    NARCIS (Netherlands)

    Tol, van R.W.H.M.; Helsen, H.H.M.; Griepink, F.C.; Kogel, de W.J.


    All aphid species studied so far share the same sex pheromone components, nepetalactol and nepetalactone. Variation by different enantiomers and blends of the two components released by different aphid species are limited and can only partially explain species-specific attraction of males to females

  16. Resistance of Wheat Accessions to the English Grain Aphid Sitobion avenae (United States)

    Hu, Xiang-Shun; Liu, Ying-Jie; Wang, Yu-Han; Wang, Zhe; Yu, Xin-lin; Wang, Bo; Zhang, Gai-Sheng; Liu, Xiao-Feng; Hu, Zu-Qing; Zhao, Hui-Yan; Liu, Tong-Xian


    The English grain aphid, Sitobion avenae, is a major pest species of wheat crops; however, certain varieties may have stronger resistance to infestation than others. Here, we investigated 3 classical resistance mechanisms (antixenosis, antibiosis, and tolerance) by 14 wheat varieties/lines to S. avenae under laboratory and field conditions. Under laboratory conditions, alatae given the choice between 2 wheat varieties, strongly discriminated against certain varieties. Specifically, the ‘Amigo’ variety had the lowest palatability to S. avenae alatae of all varieties. ‘Tm’ (Triticum monococcum), ‘Astron,’ ‘Xanthus,’ ‘Ww2730,’ and ‘Batis’ varieties also had lower palatability than other varieties. Thus, these accessions may use antibiosis as the resistant mechanism. In contrast, under field conditions, there were no significant differences in the number of alatae detected on the 14 wheat varieties. One synthetic line (98-10-30, a cross between of Triticum aestivum (var. Chris) and Triticum turgidum (var. durum) hybridization) had low aphid numbers but high yield loss, indicating that it has high antibiosis, but poor tolerance. In comparison, ‘Amigo,’ ‘Xiaoyan22,’ and some ‘186Tm’ samples had high aphid numbers but low yield loss rates, indicating they have low antibiosis, but good tolerance. Aphid population size and wheat yield loss rates greatly varied in different fields and years for ‘98-10-35,’ ‘Xiaoyan22,’ ‘Tp,’ ‘Tam200,’ ‘PI high,’ and other ‘186Tm’ samples, which were hybrid offspring of T. aestivum and wheat related species. Thus, these germplasm should be considered for use in future studies. Overall, S. avenae is best adapted to ‘Xinong1376,’ because it was the most palatable variety, with the greatest yield loss rates of all 14 wheat varieties. However, individual varieties/lines influenced aphid populations differently in different years. Therefore, we strongly recommend a combination of

  17. Induced mutations for resistance to aphid (Aphis craccivora Koch) in cowpea

    International Nuclear Information System (INIS)

    Aphid is a major insect pest of cowpea and causes heavy yield losses throughout the world. Two mutants, ICV11 and ICV12, resistant to aphids were developed from the M3 generation of ICV1 seeds irradiated with 20 kR of gamma rays. These mutants are true breeding and have a high level of seedling resistance to aphids under screenhouse conditions. The mutants have a high level of antibiosis, causing the death of the pest. They have improved plant type (semi-erect) and longer pod size (20 cm), with 19 seeds, compared with ICV1, which has a pod size of 14 cm with 13 seeds. However, the mutants are late in flowering and maturity compared with the control ICV1. Grain yields of mutants under 'unspread' field conditions are rather low, but they could give higher yields if planted early or protected from other insects using insecticides. The genetics of resistance of mutants was studied in crosses with the susceptible ICV1 and other resistant cultivars. Five day old seedlings were infested with ten aphids per plant in the screenhouse. The reactions of the F1, F2 and BC1 (F1 back-crossed to the susceptible parent ICV1) populations from the crosses of the resistant mutant ICV11 with ICV1 revealed that resistance was governed by a single dominant gene. Analyses of the allelic relationship of the gene for resistance in ICV11 were undertaken in the F1 and F2 populations from the crosses of ICV11 with other resistant cultivars TVu310 and ICV10. Results indicated that the single dominant genes of TVu310 and ICV10 are the same and allelic, while the single dominant gene of the mutant cultivar ICV11 is non-allelic to, and independent of, the resistance genes of TVu310 and ICV10. The dominant gene of TVu310 and ICV10 is designated as Ac1, while the dominant gene of ICV11 is designated as Ac2. Use of resistance genes in breeding for aphid resistance is discussed. (author). 19 refs, 3 figs, 9 tabs

  18. Evaluation of expression stability of candidate references genes among green and yellow pea cultivars (Pisum sativum L.) subjected to abiotic and biotic stress (United States)

    Dry pea (Pisum sativum) is grown as human and animal feed throughout the world. Large yield losses in pea due to biotic and abiotic stresses compel an improved understanding of mechanisms of stress tolerance and genetic determinants conditioning these tolerances. The availability of stably expressed...

  19. Repetitive DNA in the pea (Pisum sativum L.) genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula

    Czech Academy of Sciences Publication Activity Database

    Macas, Jiří; Neumann, Pavel; Navrátilová, Alice


    Roč. 8, č. 1 (2007), s. 427. ISSN 1471-2164 R&D Projects: GA AV ČR IAA500960702; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50510513 Keywords : DNA * Pisum sativum L. Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.180, year: 2007

  20. Batch Scale Removal of an Organic Pollutant Amaranth Dye from Aqueous Solution using Pisum sativum Peels and Arachis hypogaea Shells as Adsorbents

    International Nuclear Information System (INIS)

    The goal of this study was to utilize low cost and environmentally friendly adsorbents for batch scale removal of Amaranth dye from aqueous medium. Peels of Pisum sativum (Pea) and Arachis hypogaea (Peanut) were utilized to investigate their dye removing capacity. The optimized adsorption conditions for Pisum sativum (P.S.P) and Arachis hypogaea (A.H.S) were: adsorbent dose; 0.6 and 0.4 g, contact time; 45 and 10 minutes, pH; 2.0 for both, agitation speed; 150 and 100 rpm and temperature; 60 and 50 degree C for P.S.P and A.H.S respectively. The adsorption data well suited to Langmuir isotherm. Maximum adsorption capacities were found to be 144.93 and 10.53 mg/g for P.S.P and A.H.S respectively. Feasibility of the process was indicated by negative values of thermodynamic parameters delta G/sup 0/ for both adsorbents. Kinetic studies indicated that adsorption of Amaranth dye from aqueous medium by Pisum sativum peels and Arachis hypogaea shells followed pseudo-seconder order kinetics. It was concluded that Pisum sativum peels are more effective adsorbent for removal of Amaranth from aqueous solution as compared to Arachis hypogaea shells. (author)

  1. Varietals resistance and susceptibility in mustard (brassica campestris l.) genotypes against aphid myzus persicae (sulzer) (homoptera: aphididae)

    International Nuclear Information System (INIS)

    The exploitation of resistant cultivars is an imperative, simple, practical and flexible way to cope with insect pests incidence. Thirty genotypes of mustard (Brassica campestris L.) were tested for their resistance and susceptibility to aphid Myzus persicae (Sulzer) exposed under natural field conditions. Data on pest tolerance of genotypes were judged by quantitative traits such as number of aphids on each infested plant and mean dry weight of seeds per genotype. Studies observed the discrepancy in overall rates of pest invasion and seed yield contained by trailed mustard genotypes. Agati sarson (P), S-9-S-97-100/45 and S-9-S-97-100/45 were the least damaged genotypes showing their moderate resistance. Amongst other genotypes, MM-I/01-5, MM-I285 and MM-I/01-6 were the most damaged showing oversensitive response. Although the majority of genotypes were found vulnerable to pest, Agati sarson (P) and S-9-S-97-100/45 due to their lowest hypersensitive response toward aphid contamination and increased pods yield could be used for the development of essential resistance in mustard plant. A marked mode of damage inflicted by aphid on the crop was noticed and the abiotic factors contributing variations in aphid infestation levels during both growing seasons were determined. Knowledge about the host plant resistance investigated can facilitate growers to choose the most appropriate cultivars as pest control strategy. (author)

  2. Early generation selection for aphid resistance and seed yield in Indian mustard (Brassica juncea L. Czern and Coss

    Directory of Open Access Journals (Sweden)

    Madhorao D. Katre, Ram Babu Raman, S. P. Sinhamahapatra, Kale Vinod Ashok, P. M. Mohapatra


    Full Text Available Single plant selection in F2 progeny was effective when the performance of the selected F2 single plant families werecompared with the respective bulk progenies. The mean first infestation scores for aphids of all the families weresignificantly lower than the respective bulk progenies. Selected single plant progenies also recorded higher mean values forimportant traits related to aphid infestation. Seed yield per plant showed significantly positive genotypic correlation withheight up to first branch, number of siliqua on branches, total number of siliqua per plant and 100 seed weight. Firstinfestation score for aphids showed significantly negative correlations with length of main raceme, number of primary andsecondary branches. Second infestation score showed significantly negative correlation with length of main raceme andnumber of primary branches but showed significantly positive correlation with first aphid infestation score. The resultsuggested that lines with higher aphid resistance and higher seed yield could be selected from the progenies, if selection ispracticed for shorter plant height, more number of primary branches, higher number of seeds per siliqua and 100 seed weightalong with lower infestation scores.

  3. Screening low fire blight susceptible Crataegus species for host suitability to hawthorn leaf-curling aphids (Dysaphis spp.). (United States)

    Bribosia, E; Bylemans, D; Van Impe, G; Migon, M


    The group of hawthorn leaf-curling aphids (Dysaphis spp.) hosted by the common hawthorn Crataegus monogyna Jacq. may play an important role in the biological control of the rosy apple aphid, Dysaphis plantaginea (Passerini), by increasing reproduction opportunities for the indigenous hymenopteran parasitoid Ephedrus persicae Froggatt. Unfortunately, most fruitgrowers hesitate to introduce the common hawthorn in their orchards because they fear fire blight infections which may be transmitted by this highly susceptible hawthron species. This potential hazard led us to investigate the suitability to leaf-curling aphids of alternative Crataegus species. As representative for these closely-related aphids, the species Dysaphis apiifolia petroselini (Börner) was used in the trials. Ten Crataegus species characterized by their very low susceptibility to fire blight were examined from two angles. Firstly, aphid sexuals were introduced in autumn onto the different species to verify whether egg laying could take place. Secondly, the development of fundatrices and gall formation were followed the next spring. Although eggs and mature fundatrices could be obtained on almost all species, no fundatrice-hosting galls were recorded in spring. The possible causes of these negative results with respect to the geographical origin of the particular Crataegus species involved in this work are discussed. PMID:12696414

  4. Migration and population genetics of the grain aphid Macrosiphum miscanti (Takahashi) in relation to the geographic distance and gene flow

    Institute of Scientific and Technical Information of China (English)

    GUO Wei; SHEN Zuorui; LI Zhihong; GAO Lingwang


    The population genetics of the grain aphid Macrosiphum miscanti (Takahashi) is analyzed by microsatellite markers.Samples collected from 15 locations in China have been examined at 5 polymorphic microsatellite loci. Overall, genetic diversity displays a relation between the migration and gene flow in the grain aphid: a free and frequent gene flow is found in the eastern populations, and gene isolation occurs in the two western populations, especially Datong population and Guiyang population. The natural barriers may present an insurmountable obstacle preventing gene flow and aphid migration. However, a spatial genetic differentiation between populations is correlated with their geographical separation, indicating the geographic differentiation may play an important role in shaping the genetic structure of M. miscanti populations. In addition, most populations of grain aphids are out of Hardy-Weinberg equilibrium and there is heterozygote deficit. Based on F statistics, the average genetic differentiation among different geographical populations is relatively low. It seems that the long distance migration of the grain aphid may enhance gene flow and decrease genetic differentiation among different populations.

  5. Laboratory and semi-field evaluation of Beauveria bassiana (Ascomycota: Hypocreales) against the lettuce aphid, Nasonovia ribisnigri (Hemiptera: Aphididae)

    DEFF Research Database (Denmark)

    Shrestha, Govinda; Enkegaard, Annie; Steenberg, Tove


    The lettuce aphid, Nasonovia ribisnigri (Mosley), is an economically important pest of lettuce worldwide. The entomopathogenic fungus Beauveria bassiana strain GHA has recently been reported as a potential biocontrol candidate for use against the lettuce aphid. This study provides information on...... the mortality inflicted by B. bassiana when applied against different life stages of the lettuce aphid under laboratory conditions and how fungus infection affects the aphid fecundity. In addition, temporal changes in persistence of fungus inoculum applied to foliage of young lettuce plants under semi......-field conditions was analysed. Immature life stages were generally the least susceptible to fungal infection and the susceptibility of all stages was dose-dependent, with the highest mortality occurring at the highest dose. B. bassiana significantly affected the rate of nymph production by the lettuce aphid, with...

  6. Exposure to bacterial signals does not alter pea aphids' survival upon a second challenge or investment in production of winged offspring.

    Directory of Open Access Journals (Sweden)

    Bas ter Braak

    Full Text Available Pea aphids have an obligate nutritional symbiosis with the bacteria Buchneraaphidicola and frequently also harbor one or more facultative symbionts. Aphids are also susceptible to bacterial pathogen infections, and it has been suggested that aphids have a limited immune response towards such pathogen infections compared to other, more well-studied insects. However, aphids do possess at least some of the genes known to be involved in bacterial immune responses in other insects, and immune-competent hemocytes. One possibility is that immune priming with microbial elicitors could stimulate immune protection against subsequent bacterial infections, as has been observed in several other insect systems. To address this hypothesis we challenged aphids with bacterial immune elicitors twenty-four hours prior to live bacterial pathogen infections and then compared their survival rates to aphids that were not pre-exposed to bacterial signals. Using two aphid genotypes, we found no evidence for immune protection conferred by immune priming during infections with either Serratia marcescens or with Escherichia coli. Immune priming was not altered by the presence of facultative, beneficial symbionts in the aphids. In the absence of inducible immune protection, aphids may allocate energy towards other defense traits, including production of offspring with wings that could escape deteriorating conditions. To test this, we monitored the ratio of winged to unwinged offspring produced by adult mothers of a single clone that had been exposed to bacterial immune elicitors, to live E. coli infections or to no challenge. We found no correlation between immune challenge and winged offspring production, suggesting that this mechanism of defense, which functions upon exposure to fungal pathogens, is not central to aphid responses to bacterial infections.

  7. Influence of selected plant amines on probing behaviour of bird cherry-oat aphid (Rhopalosiphum padi L.). (United States)

    Sempruch, C; Goławska, S; Osiński, P; Leszczyński, B; Czerniewicz, P; Sytykiewicz, H; Matok, H


    The study aimed to quantify the influence of common plant polyamines and tyramine on probing behaviour in the bird cherry-oat aphid (Rhopalosiphum padi L.). Electrical penetration graphs (DC) were used to monitor the probing and feeding behaviour of R. padi exposed to the amines agmatine, cadaverine, putrescine, spermidine, spermine and tyramine. The study results showed that the analyzed amines tended to shorten the stylet activity of aphids in the gels (as indicated by the g-C pattern), prolong the duration of non-probing behaviour (g-np pattern) and decrease salivation into the gels (g-E1pattern) and ingestion from the gels (g-G pattern). The 10 mM concentration of the studied amines, especially cadaverine, reduced or completely inhibited aphid ingestion. The obtained results demonstrate that plant amines participate in plant defence responses to R. padi through disturbance of its probing behaviour and the intensity of such effects is concentration dependent. PMID:26898153

  8. Alternaria toxin-induced resistance in rose plants against rose aphid (Macrosiphum rosivorum): effect of tenuazonic acid. (United States)

    Yang, Fa-zhong; Yang, Bin; Li, Bei-bei; Xiao, Chun


    Many different types of toxins are produced by the fungus, Alternaria alternata (Fr.) Keissler. Little is known, however, regarding the influence of these toxins on insects. In this study, we investigated the toxin-induced inhibitory effects of the toxin produced by A. alternata on the rose aphid, Macrosiphum rosivorum, when the toxin was applied to leaves of the rose, Rosa chinensis. The results demonstrated that the purified crude toxin was non-harmful to rose plants and rose aphids, but had an intensive inhibitory effect on the multiplication of aphids. The inhibitory index against rose aphids reached 87.99% when rose plants were sprayed with the toxin solution at a low concentration. Further results from bioassays with aphids and high performance liquid chromatography (HPLC) analyses demonstrated that tenuazonic acid (TeA) was one of the most important resistance-related active components in the crude toxin. The content of TeA was 0.1199% in the crude toxin under the HPLC method. Similar to the crude toxin, the inhibitory index of pure TeA reached 83.60% 15 d after the rose plants were sprayed with pure TeA solution at the lower concentration of 0.060 μg/ml, while the contents of residual TeA on the surface and in the inner portion of the rose plants were only 0.04 and 0.00 ng/g fresh weight of TeA-treated rose twigs, respectively, 7 d after the treatment. Our results show that TeA, an active component in the A. alternata toxin, can induce the indirect plant-mediated responses in rose plants to intensively enhance the plant's resistances against rose aphids, and the results are very helpful to understand the plant-mediated interaction between fungi and insects on their shared host plants. PMID:25845360

  9. Expression of an (E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation


    Xiudao Yu; Yongjun Zhang; Youzhi Ma; Zhaoshi Xu; Genping Wang; Lanqin Xia


    Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E)-β-farnesene (EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piper...

  10. Increased population of the aphid Aphis pomi at a motorway. Part 3. The effect of exhaust gases. [Crataegus spp

    Energy Technology Data Exchange (ETDEWEB)

    Braun, S.; Flueckiger, W.


    The effect of motorway air pollution on the infestation of Crataegus spp. by Aphis pomi was examined using chambers with ambient and filtered air. In the chamber with ambient air the aphid population increased to up to 4.4 times the aphid number in the chamber with filtered air. Analysis of a phloem exudate revealed a significant increase in glutamine relative to the sugar content in the plants grown in the polluted air. Some substantial changes in phenolic compounds were also recorded. The results indicate that air pollution around motorways can alter the host plant-parasite relationship to increase the susceptibility of the plant.

  11. Effect of pre-sowing magnetic field treatment to garden pea (pisum sativum l.) seed on germination and seedling growth

    International Nuclear Information System (INIS)

    The seeds of garden pea ( Pisum sativum L. cv. climax) were exposed to full-wave rectified sumusoidal non-uniform magnetic fields of strength 60 mT, 120 mT and 180 mT for 5, 10 and 15 min prior to sowing. The magnetically treated seeds were sown according to the protocol of International Seed Testing Association (ISTA). Magnetically treated seed showed significant increase in germination. The emergence index, final emergence index and vigor index increased by 86.43%, 13.21% and 204.60%, respectively. It was found that exposure of 5 min for magnetic field strengths of 60 mT and 180 mT significantly enhanced the germination parameters of the pea and these treatments can be used practically to accelerate the germination in garden pea. (author)

  12. The influence of rate and time of nitrate supply on nitrogen fixation and yield in pea (Pisum sativum L.)

    DEFF Research Database (Denmark)

    Jensen, Erik Steen


    The influence of nitrate N supply on dry matter production, N content and symbiotic nitrogen fixation in soil-grown pea (Pisum sativum L.) was studied in a pot experiment by means of15N fertilizer dilution. In pea receiving no fertilizer N symbiotic nitrogen fixation, soil and seed-borne N...... contributed with 82, 13 and 5% of total plant N, respectively. The supply of low rates of nitrate fertilizer at sowing (“starter N”) increased the vegetative dry matter production, but not the seed yield significantly. Nitrogen fixation was not significantly decreased by the lower rates of nitrate but higher...... rates supplied at sowing reduced the nitrogen fixation considerably. Applying nitrate N at the flat pod growth stage increased the yield of seed dry matter and N about 30% compared to pea receiving no nitrate fertilizer. Symbiotic nitrogen fixation was reduced only about 11%, compared with unfertilized...

  13. Genotype-environmental interaction and stability analysis of some yield components in field peas (Pisum Sativum L.)

    International Nuclear Information System (INIS)

    Genotype-environment interaction and assessment of the adaptation of the genotypes to a range of environments is presented. Some of the yield components (number of pods/plant, number of seeds/plant and seed weight/plant) were analysed by means of statistical techniques in three cultivars Auralia, Borek and Virtus and six mutant lines of field peas (Pisum sativurn L.). Differences in response to the environment were found among genotypes for the characters studied; a large proportion of these interactions was accounted for by linear regression. Using two stability parameters, regression coefficient (bi) and stability variance (erf), only one genotype cv Auralia could be considered widely adapted to seed weight/plant. Other stable genotypes were identified as suitable for poor/or favourable environmental conditions. The importance of genotype-environment interactions in breeding strategies is discussed

  14. Response of root fungi in Pisum sativum to plant and soil environmental factors

    DEFF Research Database (Denmark)

    Yu, Lingling

    , Pisum sativum was used as a model crop to study fungal community structure associated with roots under different environmental conditions. Three individual experiments were conducted in order to study root-associated fungal community structure in relation to root-internal factors in terms of plant...... analysis, analysis of variance (ANOVA) was used in the measurement of plant growth parameters and relative abundance of root-associated fungi, and principle component analysis (PCA) was used to examine the response of communities of root fungi to the plant and soil environmental factors. vi The three...... studies showed that root-associated fungal communities were highly diverse and significantly influenced by plant and soil environmental factors, and results supported the hypotheses that the relative abundance of dominant fungal groups differed between healthy and diseased plants, altered according to...

  15. Organic fertilization alters the community composition of root associated fungi in Pisum sativum

    DEFF Research Database (Denmark)

    Yu, L.; Nicolaisen, M.; Ravnskov, S.;


    Organic fertilization is well known to affect individual functional groups of root associated fungi such as arbuscular mycorrhizal (AM) fungi and root pathogens, but limited information is available on the effect of organic fertilization at the fungal community composition level. The main objective...... of the present study was to examine the response of communities of root associated fungi in Pisum sativum to Protamylasse, an organic fertilizer used in pea production. Plants were grown in pots with field soil amended with four different levels of Protamylasse. 454 pyrosequencing was employed to...... examine diversity of root associated fungi and revealed in total 164 non-singleton operational taxonomic units (OTUs). Principle component analysis (PCA) showed response of fungal community structure of the 15 most abundant OTUs to the four fertilization levels. Obligate biotrophic fungi such as the AM...

  16. Differential changes in size distribution of xyloglucan in the cell walls of gravitropically responding Pisum sativum epicotyls (United States)

    Talbott, L. D.; Pickard, B. G.


    Growth-related change in the size distribution of hemicellulosic wall polymers during the gravitropic curvature response of intact pea (Pisum sativum L. cv Alaska) epicotyls was examined by gel-filtration chromatography. The gravitropic response was characterized by the appearance of curvature 20 to 30 min after horizontal placement, with 35 degrees of curvature attained by 80 min. Correlated with the onset of curvature, on the upper side of the epicotyl, there was a conspicuous transient increase in the abundance of relatively large hemicellulosic xyloglucan polymers, similar to increases previously found under conditions where diminished wall extensibility was expected. On the lower side there was a moderate, slower, and longer-term increase in abundance of small xyloglucan, similar to changes previously found in connection with auxin-stimulated growth responses. Both shifts occurred primarily in the epidermis. They appear to represent two coordinated physiological mechanisms contributing to differential growth.

  17. The effect of inhibitors of plasma membrane H+ - ATPase and oxidoreductases on NH4+ uptake by Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Genowefa Kubik-Dobosz


    Full Text Available The effect of inhibitors of plasma membrane oxidoreductases (quinacrine and dicumarol and H+-ATPase (dicyclohexylcarbodiimide and orthovanadate on ammonium uptake by Pisum arvense seedlings and the activities of H+-ATPase and NADH-ferricyanide oxidoreductase was investigated. The uptake solution contained 50 µM NH4+. In I h experiments, quinacrine and dicumarol depressed strongly and irreversibly the rate of NH4+ uptake and markedly inhibited the activity of NADH-ferri-cyanide oxidoreductase in the plasma membrane vesicles prepared from root cells. Simultaneously, sodium orthovanadate inhibited the activity of plasma membrane H+-ATPase increased the rate of NH4+ uptake. Dicyclohexylcarbodiimide inhibited H+-ATPase activity and increased efflux of NH4+ from roots to ambient solution. The results indicate on the lack of direct connection between uptake rate of 50 µM NH4+ and H+-ATPase activity, and suggest that membrane redox systems play a predominant role in this process.

  18. Callose deposition during gravitropism of Zea mays and Pisum sativum and its inhibition by 2-deoxy-D-glucose (United States)

    Jaffe, M. J.; Leopold, A. C.


    In etiolated corn (Zea mays L.) and etiolated pea (Pisum sativum L.) seedlings, a gravitropic stimulation induces the deposition of callose. In the corn coleoptiles this occurs within 5 min of gravity stimulation, and prior to the beginning of curvature. Both gravitropic curvature and callose deposition reach their maxima by 12 h. Within the first 2 h more callose is deposited on the upper (concave) side, but after 2-3 h, this deposition pattern is reversed. An inhibitor of protein glycosylation, 2-deoxy-D-glucose (DDG), inhibits callose production and considerably retards gravitropic bending in both species of plants. Mannose can relieve the inhibition of gravitropic bending by DDG. The pea mutant "Ageotropum", which does not respond to gravity when etiolated, also fails to produce callose in response to a gravitic stimulus. These correlations indicate that callose deposition may be a biochemical component of gravitropism in plant shoots.

  19. Dynamics of nonpersistent aphid-borne viruses in lettuce crops covered with UV-absorbing nets. (United States)

    Legarrea, S; Betancourt, M; Plaza, M; Fraile, A; García-Arenal, F; Fereres, A


    Aphid-transmitted viruses frequently cause severe epidemics in lettuce grown under Mediterranean climates. Spatio-temporal dynamics of aphid-transmitted viruses and its vector were studied on lettuce (Lactuca sativa L.) grown under tunnels covered by two types of nets: a commercial UV-absorbing net (Bionet) and a Standard net. A group of plants infected by Cucumber mosaic virus (CMV, family Bromoviridae, genus Cucumovirus) and Lettuce mosaic virus (LMV, family Potyviridae, genus Potyvirus) was transplanted in each plot. The same virus-infected source plants were artificially infested by the aphid Macrosiphum euphorbiae (Thomas). Secondary spread of insects was weekly monitored and plants were sampled for the detection of viruses every two weeks. In 2008, the infection rate of both CMV and LMV were lower under the Bionet than under the Standard cover, probably due to the lower population density and lower dispersal rate achieved by M. euphorbiae. However, during spring of 2009, significant differences in the rate of infection between the two covers were only found for LMV six weeks after transplant. The spatial distribution of the viruses analysed by SADIE methodology was "at random", and it was not associated to the spatial pattern of the vector. The results obtained are discussed analyzing the wide range of interactions that occurred among UV-radiation, host plant, viruses, insect vector and environmental conditions. Our results show that UV-absorbing nets can be recommended as a component of an integrated disease management program to reduce secondary spread of lettuce viruses, although not as a control measure on its own. PMID:22226944

  20. Transgenerational shifts in reproduction hormesis in green peach aphid exposed to low concentrations of imidacloprid.

    Directory of Open Access Journals (Sweden)

    Murali-Mohan Ayyanath

    Full Text Available Hormesis is a biphasic phenomenon that in toxicology is characterized by low-dose stimulation and high-dose inhibition. It has been observed in a wide range of organisms in response to many chemical stressors, including insects exposed to pesticides, with potential repercussions for agriculture and pest management. To address questions related to the nature of the dose-response and potential consequences on biological fitness, we examined transgenerational hormesis in the green peach aphid, Myzus persicae, when exposed to sublethal concentrations of the insecticide imidacloprid. A hormetic response in the form of increased reproduction was consistently observed and a model previously developed to test for hormesis adequately fit some of our data. However, the nature of the dose-response differed within and across generations depending upon the duration and mode of exposure. Decreased reproduction in intermediate generations confirmed that fitness tradeoffs were a consequence of the hormetic response. However, recovery to levels of reproduction equal to that of controls in subsequent generations and significantly greater total reproduction after four generations suggested that biological fitness was increased by exposure to low concentrations of the insecticide, even when insects were continuously exposed to the stressor. This was especially evident in a greenhouse experiment where the instantaneous rate of population increase almost doubled and total aphid production more than quadrupled when aphids were exposed to potato plants systemically treated with low amounts of imidacloprid. Our results show that although fitness tradeoffs do occur with hormetic responses, this does not necessarily compromise overall biological fitness.


    Directory of Open Access Journals (Sweden)

    N Jemimah


    Full Text Available Safflower (Carthamus tinctorius L. is one of the important oilseed crops in the world. The crop has been traditionally grown for its flowers as a source of dye for colouring food and fabrics. Safflower oil has highest content of linoleic acid (75%. India with an area of 2.71 lakh ha, production of 1.71 lakh tonnes of seed and average productivity of 632 kg/ha is the leading producer of safflower in the world (DOR, 2011. A total of 101 pests are known to attack safflower at different stages of crop growth and development (Singh et al., 1996. Amongst the various pests, the aphid Uroleucon compositae Theobald, badly affects the crop growth and yield. Nymphs as well as adults suck the cell sap from the lower surface of the leaves and tender shoots and impair the vitality of the plants. Besides sucking the sap from the plants, the aphids also excrete honeydew which attracts a black sooty mould that adversely affects the photosynthesis. Seed and oil content losses due to this pest to an extent of 20 to 80 per cent have been reported from different parts of the country (Singh et al., 2000. Control of safflower aphid has been achieved by using different insecticides. Recently, the emphasis is being given on ecological basis of control based on suitable integrated pest management strategies. Seasonal incidence helps in planning need based application of insecticides as it clearly reveals the insect peak activity as well as insect free periods during crop growth. To achieve satisfactory suppression of this destructive pest, manipulating the sowing time, testing and evaluation of newer insecticides are necessary. The available literature related to the present study has been reviewed under the following heads.

  2. Homeopathic Preparations to Control the Rosy Apple Aphid (Dysaphis plantaginea Pass.

    Directory of Open Access Journals (Sweden)

    Eric Wyss


    Full Text Available A laboratory model system with the rosy apple aphid (Dysaphis plantaginea Pass. on apple seedlings was developed to study the effects of homeopathic preparations on this apple pest. The assessment included the substance Lycopodium clavatum and a nosode of the rosy apple aphid. Each preparation was applied on the substrate surface as aqueous solution of granules (6c, 15c, or 30c. Controls were aqueous solutions of placebo granules or pure water. In eight independent, randomized, and blinded experiments under standardized conditions in growth chambers, the development of aphids on treated and untreated apple seedlings was observed over 17 days, each. Six experiments were determined to assess the effects of a strict therapeutic treatment; two experiments were designed to determine the effects of a combined preventative and therapeutic treatment. After application of the preparations, the number of juvenile offspring and the damage on apple seedlings were assessed after 7 and 17 days, respectively. In addition, after 17 days, the seedling weight was measured. In the final evaluation of the six strictly therapeutic trials after 17 days, the number of juvenile offspring was reduced after application of L. clavatum 15c (-17%, p = 0.002 and nosode 6c (-14%, p = 0.02 compared to the pure water control. No significant effects were observed for leaf damage or fresh weight for any application. In the two experiments with combined preventative and therapeutic treatment, no significant effects were observed in any measured parameter. Homeopathic remedies may be effective in plant-pest systems. The magnitude of observed effects seems to be larger than in models with healthy plants, which renders plant-pest systems promising candidates for homeopathic basic research. For successful application in agriculture, however, the effect is not yet sufficient. This calls for further optimization concerning homeopathic remedy selection, potency level, dosage, and

  3. RNA interference against gut osmoregulatory genes in phloem-feeding insects. (United States)

    Tzin, Vered; Yang, Xiaowei; Jing, Xiangfeng; Zhang, Kai; Jander, Georg; Douglas, Angela E


    In planta RNAi (i.e. plants engineered to synthesize active RNAi molecules) has great potential as a strategy to control insect crop pests. This study investigated the impact of RNAi against osmoregulatory genes expressed in the gut of two phloem-feeding species, the green peach aphid Myzus persicae and the potato/tomato psyllid Bactericera cockerelli. The target genes comprising candidate gut sucrase, aquaporin and sugar transporter genes were identified by mining insect genomic and transcriptomic datasets for genes orthologous to empirically-tested osmoregulatory genes of the pea aphid Acyrthosiphon pisum. Insects feeding on plants with RNAi against the target genes exhibited elevated hemolymph osmotic pressure (a predicted effect of perturbed osmotic function) and some reduction in performance, especially offspring production in M. persicae and mortality in B. cockerelli, associated with up to 50% reduction in mean expression of the target genes. The effects were particularly pronounced for insects treated with RNAi against multiple osmoregulatory genes, i.e. combinatorial RNAi, suggesting that the partial silencing of multiple genes with related roles can yield greater functional impairment than RNAi against a single gene. These results demonstrate the potential of RNAi against osmoregulatory genes, but further advances to improve the efficacy of RNAi in phloem-feeding insects are required to achieve effective pest control. PMID:26071792

  4. The X Chromosome of Hemipteran Insects: Conservation, Dosage Compensation and Sex-Biased Expression. (United States)

    Pal, Arka; Vicoso, Beatriz


    Insects of the order Hemiptera (true bugs) use a wide range of mechanisms of sex determination, including genetic sex determination, paternal genome elimination, and haplodiploidy. Genetic sex determination, the prevalent mode, is generally controlled by a pair of XY sex chromosomes or by an XX/X0 system, but different configurations that include additional sex chromosomes are also present. Although this diversity of sex determining systems has been extensively studied at the cytogenetic level, only the X chromosome of the model pea aphid Acyrthosiphon pisum has been analyzed at the genomic level, and little is known about X chromosome biology in the rest of the order.In this study, we take advantage of published DNA- and RNA-seq data from three additional Hemiptera species to perform a comparative analysis of the gene content and expression of the X chromosome throughout this clade. We find that, despite showing evidence of dosage compensation, the X chromosomes of these species show female-biased expression, and a deficit of male-biased genes, in direct contrast to the pea aphid X. We further detect an excess of shared gene content between these very distant species, suggesting that despite the diversity of sex determining systems, the same chromosomal element is used as the X throughout a large portion of the order. PMID:26556591

  5. The conformational stability and biophysical properties of the eukaryotic thioredoxins of Pisum sativum are not family-conserved.

    Directory of Open Access Journals (Sweden)

    David Aguado-Llera

    Full Text Available Thioredoxins (TRXs are ubiquitous proteins involved in redox processes. About forty genes encode TRX or TRX-related proteins in plants, grouped in different families according to their subcellular localization. For instance, the h-type TRXs are located in cytoplasm or mitochondria, whereas f-type TRXs have a plastidial origin, although both types of proteins have an eukaryotic origin as opposed to other TRXs. Herein, we study the conformational and the biophysical features of TRXh1, TRXh2 and TRXf from Pisum sativum. The modelled structures of the three proteins show the well-known TRX fold. While sharing similar pH-denaturations features, the chemical and thermal stabilities are different, being PsTRXh1 (Pisum sativum thioredoxin h1 the most stable isoform; moreover, the three proteins follow a three-state denaturation model, during the chemical-denaturations. These differences in the thermal- and chemical-denaturations result from changes, in a broad sense, of the several ASAs (accessible surface areas of the proteins. Thus, although a strong relationship can be found between the primary amino acid sequence and the structure among TRXs, that between the residue sequence and the conformational stability and biophysical properties is not. We discuss how these differences in the biophysical properties of TRXs determine their unique functions in pea, and we show how residues involved in the biophysical features described (pH-titrations, dimerizations and chemical-denaturations belong to regions involved in interaction with other proteins. Our results suggest that the sequence demands of protein-protein function are relatively rigid, with different protein-binding pockets (some in common for each of the three proteins, but the demands of structure and conformational stability per se (as long as there is a maintained core, are less so.

  6. Contrasting effects of codling moth exclusion netting on the natural control of the rosy apple aphid


    Simon, Sylvaine; Fleury, Amandine; Alaphilippe, Aude; Dib, Hazem; Capowiez, Yvan


    Exclusion netting is developing in Southern France against Cydia pomonella, a major pest of apple. Most insecticides and therefore side-effects on natural enemies (NE) are avoided in netted orchards. Conversely, nets can also exclude some NE and/or modify their access to prey in the tree canopy. The effect of nets on the beneficial complex associated to the rosy apple aphid (RAA) was studied in experimental and commercial orchards in 2009 and 2012 in South-Eastern France. RAA infestation was ...

  7. Use of ionizing radiation for cut flowers disinfestation. 2. Aphids irradiation (Homoptera: Aphididae)

    International Nuclear Information System (INIS)

    Cut flowers and ornamental plants exportation require the same disinfestation cares as foods do. The 300 Gy minimum dose of ionizing radiation has been considered to the quarentine treatment against mites and insects other than fruit flies. This dose seems to be enough to guarantee the insect sterilization. Aphids in many developmental phases were irradiated in a cobalt-60 Gamma cell source with doses up to 900 Gy. Insect survival was not modified by irradiation, but the individual number of F1 generation from irradiated insects presented an evident reduction in relation to the control ones. (author). 5 refs, 2 figs, 1 tabs

  8. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)


    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  9. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  10. Elucidating the resistance response of irradiated banana cv. Lakatan to banana bunchy top virus (BBTV) infection transmitted by the banana aphid Pentalonia nigronervosa Coquerol

    International Nuclear Information System (INIS)

    Development of banana bunchy top virus (BBTV)-resistant banana variety Lakatan through gamma-irradiation had been successfully done as part of integrated management strategies against the disease. Ten irradiated Lakatan lines exhibited resistance to BBTV. Resistance of these lines was evaluated based on symptomatology and host-virus relationship. Insect colony development on Lakatan banana irradiated lines was monitored by artificially inoculating viruliferous banana aphids, Pentalonia nigronervosa, and counting the resulting number of aphids per plant at weekly intervals. Resistance to virus multiplication of Lakatan irradiated lines was characterized by quantifying the virus titer through Enzyme-Linked Immunosorbent Assay (ELISA). Results showed that not all lines were suitable as hosts in establishing aphid population. The reaction of the mutant lines to the vector and the pathogen varied to some extent. Disease incidence in some cases was correlated with aphid preference. Disease incidence was significantly higher (50%) on lines that were preferred by aphids and lower (50%) in those that were not colonized. Some mutant lines with very low aphid colony count, however showed high BBTV incidence. Variability in the results could be affected by other factors such as the developmental stage of the plant and prevailing environmental conditions during the conduct of the experiment. Virus titer was also reduced on these mutant lines, thus reduced virus multiplication. Non-irradiated (control) Lakatan banana had comparably high population of aphids, high disease incidence, and high virus titer

  11. The Biology of the Red and Green Morphs of the Tobacco Aphid, Myzus Persicae Nicotianae (Blackman on Flue-Cured Tobacco

    Directory of Open Access Journals (Sweden)

    Masukwedza Rhoda


    Full Text Available The tobacco aphid, Myzus persicae nicotianae is an economically important pest of tobacco. Damage is through direct injury by sucking sap of infested plants as well as reduction of the quality of the leaf by leaving honey-dew which encourages the subsequent growth of sooty-mould. In addition to this, aphids also transmit economically important virus diseases such as the bushy-top virus, the alfalfa mosaic virus and the potato virus-Y. Before 2002, the main colour form of the tobacco aphid in Zimbabwe was green. However, during the 2003/2004 tobacco season, concerns were raised where red forms of the tobacco aphid were observed to be more prevalent than the green form. During the 2004/2005 tobacco season, green forms of the tobacco aphid could only be found with difficulty. In intensive research spanning three years, the days to adulthood, days to 1st nymph, nymphs/day, longevity, fecundity and survival of the red morph were compared to that of the green aphid. Across all years, days to adulthood were the same for the two forms. The red morph produced more nymphs/day than the green morph. Longevity was similar but fecundity was 1½ to 2 times higher for the red morph than the green aphid. The red morph survived longer than the green aphid. These parameters combined to give the red morph of the tobacco aphid a greater reproductive potential and rate of population increase over the green morph thereby partly explaining the sudden increase in this pest in the recent past.

  12. Leaf surface factors of transgenic Bt cotton associated with the feeding behaviors of cotton aphids: A case study on non-target effects

    Institute of Scientific and Technical Information of China (English)

    XUE Kun; DENG Su; WANG RongJiang; YAN FengMing; XU ChongRen


    The present paper reports case study results of the risk assessment of transgenic Bt cotton on a non-target pest, cotton aphid, Aphis gossypii. Several types of techniques, i.e., electrical penetration graph (EPG), light and electron microscopy, bioessays and chemical analysis, were applied to investigate physical and chemical leaf factors of 2 transgenic Bt cotton lines(GK12 and GK19) and their parental non-Bt cotton line (Simian3) associated with searching and feeding behaviors of cotton aphids on leaves or leaf extracts of cotton plants. EPG results showed that there were some differences among behaviors of cotton aphids on 2 Bt cotton and 1 non-Bt cotton lines. Cotton aphids performed similarly to leaf surface extracts from 3 cotton lines; and leaf surface chemicals, mainly volatiles and waxes,were almost identical in the components and concentrations among the cotton lines. However, three cotton lines were quite different from each other in the densities of certain kinds of covering trichomes.Therefore, the relationships between the physical characteristics and the searching behaviors of cotton aphids on the three cotton lines were constructed as the regression equations. Glandular trichomes and covering trichomes with 5 branches Influenced the cotton aphids' searching behaviors effectively;and other trichomes with other branches affected aphids in varying ways. These results demonstrated that leaf surface physical factors of transgenic Bt cotton lines different from their parental non-Bt line could affect the penetration behaviors of non-target cotton aphids. Cotton aphids penetrate and feed more easily on two Bt cotton lines than on the non-Bt cotton line.

  13. Resistance and susceptibility of alfalfa (Medicago sativa L.) cultivars to the aphid Therioaphis maculata (Homoptera:Aphididae): insect biology and cultivar evaluation

    Institute of Scientific and Technical Information of China (English)



    Biology of the aphid Therioaphis maculata was studied on alfalfa (Medicago sativa L.), including four resistant (Mesa-Sirsa, CUF101, Baker and Lahontan) and two susceptible (ARC and Caliverde) alfalfa cultivars, and one of the most cropped Brazilian cultivars, Crioula. Under controlled conditions, antibiosis (i.e., reduced longevity, fecundity and increased mortality of the aphid) was observed mainly on the resistant alfalfa cultivars,except on Lahontan. Crioula seemed to be tolerant to aphids. Present data support geographic limitation usage of cultivars, and we suggest Baker and Mesa-Sirsa as sources of antibiosis,and provide biological information of a tropical T. maculata biotype on alfalfa.

  14. The Biology of the Red and Green Morphs of the Tobacco Aphid, Myzus Persicae Nicotianae (Blackman) on Flue-Cured Tobacco


    Masukwedza Rhoda; Mazarura Upenyu and Chinwada Peter; Dimbi Susan


    The tobacco aphid, Myzus persicae nicotianae is an economically important pest of tobacco. Damage is through direct injury by sucking sap of infested plants as well as reduction of the quality of the leaf by leaving honey-dew which encourages the subsequent growth of sooty-mould. In addition to this, aphids also transmit economically important virus diseases such as the bushy-top virus, the alfalfa mosaic virus and the potato virus-Y. Before 2002, the main colour form of the tobacco aphid in...

  15. The Biology of the Red and Green Morphs of the Tobacco Aphid, Myzus Persicae Nicotianae (Blackman) on Flue-Cured Tobacco


    Masukwedza Rhoda; Mazarura Upenyu; Chinwada Peter; Dimbi Susan


    The tobacco aphid, Myzus persicae nicotianae is an economically important pest of tobacco. Damage is through direct injury by sucking sap of infested plants as well as reduction of the quality of the leaf by leaving honey-dew which encourages the subsequent growth of sooty-mould. In addition to this, aphids also transmit economically important virus diseases such as the bushy-top virus, the alfalfa mosaic virus and the potato virus-Y. Before 2002, the main colour form of the tobacco aphid in ...

  16. Molecular cloning, characterisation and mRNA expression of the ryanodine receptor from the peach-potato aphid, Myzus persicae. (United States)

    Troczka, B J; Williams, A J; Bass, C; Williamson, M S; Field, L M; Davies, T G E


    The peach potato aphid, Myzus persicae, is one of the most important agricultural pests of temperate climates. It is mainly controlled through the judicious application of insecticides; however, over time, aphids have developed resistance to many insecticidal classes. The recent introduction of synthetic diamide insecticides, with a novel mode of action, potentially offers new tools to control aphid populations. These diamides act on the ryanodine receptor (RyR), a large endoplasmic calcium release channel. In this study we have cloned cDNAs encoding the complete open reading frame of the RyR from M. persicae. The open reading frame is 15,306 base pairs long and encodes a protein of 5101 amino acids. The aphid RyR shares many of the features of other insect and vertebrate RyRs, including a highly conserved transmembrane region. However, unlike the other RyRs characterised to date, the M. persicae channel does not display alternative splicing at any stage of its developmental cycle, so it cannot generate functional variants of the channel. PMID:25447916

  17. Projection pursuit nonparametric regression applied to field counts of the aphid Macrosiphum euphorbiae (Homoptera: Aphididae) on tomato crops in greenhouses. (United States)

    Boll, R; Lapchin, L


    The number of plants that sampling requires in aphid population studies often exceeds one hundred. Thus, only quick and nondestructive methods can be used to sample this pest in a reasonable time interval. We propose a visual method for estimating the density of the aphid Macrosiphum euphorbiae (Thomas) on tomato plants reared in greenhouses. After approximately 1min of visual observation plants can be assigned to abundance classes, the boundaries of which are roughly the powers of square root 10. Precise counts were collected simultaneously on sets of reference plants from the same greenhouse. Projection pursuit nonparametric regression was then used to provide unbiased estimates of aphid densities from the abundance classes and several easily gathered explanatory variables. The robustness of the method was evaluated by testing the models on the complementary data sets from plants in which the aphid densities were precisely counted. In both single and twin-row cultural conditions, for the reference and complementary data sets, the order of magnitude of the error was less than one class rank per plant. The investigation time was reduced by approximately 10-fold compared with the exact counting method. This easy-to-teach field method could be useful in large-scale population surveys and for optimizing integrated pest management strategies. PMID:12020032

  18. Shallot Aphids, Myzus ascalonicus, in Strawberry: Biocontrol Potential of Three Predators and Three Parasitoids

    DEFF Research Database (Denmark)

    Enkegaard, Annie; Sigsgaard, Lene; Kristensen, Kristian


    their daily predation capacity (32.0 ± 6.3) on strawberry plants. About 60% of already ovipositing A. bipunctata refrained from laying any eggs on the first day after transfer to set-ups with combinations of shallot or peach-potato aphids, Myzus persicae (Sulzer) (Homoptera: Aphididae), and strawberry...

  19. Localization, Concentration, and Transmission Efficiency of Banana bunchy top virus in Four Asexual Lineages of Pentalonia aphids

    Directory of Open Access Journals (Sweden)

    Alberto Bressan


    Full Text Available Banana bunchy top virus (BBTV is the most destructive pathogenic virus of banana plants worldwide. The virus is transmitted in a circulative non-propagative manner by the banana aphid, Pentalonia nigronervosa Coquerel. In this work, we examined the localization, accumulation, and transmission efficiency of BBTV in four laboratory-established lineages of Pentalonia aphids derived from four different host plants: taro (Colocasia esculenta, heliconia (Heliconia spp., red ginger (Alpinia purpurata, and banana (Musa sp.. Mitochondrial sequencing identified three and one lineages as Pentalonia caladii van der Goot, a recently proposed species, and P. nigronervosa, respectively. Microsatellite analysis separated the aphid lineages into four distinct genotypes. The transmission of BBTV was tested using leaf disk and whole-plant assays, both of which showed that all four lineages are competent vectors of BBTV, although the P. caladii from heliconia transmitted BBTV to the leaf disks at a significantly lower rate than did P. nigronervosa. The concentration of BBTV in dissected guts, haemolymph, and salivary glands was quantified by real-time PCR. The BBTV titer reached similar concentrations in the guts, haemolymph, and salivary glands of aphids from all four lineages tested. Furthermore, immunofluorescence assays showed that BBTV antigens localized to the anterior midguts and the principal salivary glands, demonstrating a similar pattern of translocations across the four lineages. The results reported in this study showed for the first time that P. caladii is a competent vector of BBTV.

  20. Localization, concentration, and transmission efficiency of Banana bunchy top virus in four asexual lineages of Pentalonia aphids. (United States)

    Watanabe, Shizu; Greenwell, April M; Bressan, Alberto


    Banana bunchy top virus (BBTV) is the most destructive pathogenic virus of banana plants worldwide. The virus is transmitted in a circulative non-propagative manner by the banana aphid, Pentalonia nigronervosa Coquerel. In this work, we examined the localization, accumulation, and transmission efficiency of BBTV in four laboratory-established lineages of Pentalonia aphids derived from four different host plants: taro (Colocasia esculenta), heliconia (Heliconia spp.), red ginger (Alpinia purpurata), and banana (Musa sp.). Mitochondrial sequencing identified three and one lineages as Pentalonia caladii van der Goot, a recently proposed species, and P. nigronervosa, respectively. Microsatellite analysis separated the aphid lineages into four distinct genotypes. The transmission of BBTV was tested using leaf disk and whole-plant assays, both of which showed that all four lineages are competent vectors of BBTV, although the P. caladii from heliconia transmitted BBTV to the leaf disks at a significantly lower rate than did P. nigronervosa. The concentration of BBTV in dissected guts, haemolymph, and salivary glands was quantified by real-time PCR. The BBTV titer reached similar concentrations in the guts, haemolymph, and salivary glands of aphids from all four lineages tested. Furthermore, immunofluorescence assays showed that BBTV antigens localized to the anterior midguts and the principal salivary glands, demonstrating a similar pattern of translocations across the four lineages. The results reported in this study showed for the first time that P. caladii is a competent vector of BBTV. PMID:23435241