Turbulent Fluid Motion 6: Turbulence, Nonlinear Dynamics, and Deterministic Chaos

Science.gov (United States)

Deissler, Robert G.

1996-01-01

Several turbulent and nonturbulent solutions of the Navier-Stokes equations are obtained. The unaveraged equations are used numerically in conjunction with tools and concepts from nonlinear dynamics, including time series, phase portraits, Poincare sections, Liapunov exponents, power spectra, and strange attractors. Initially neighboring solutions for a low-Reynolds-number fully developed turbulence are compared. The turbulence is sustained by a nonrandom time-independent external force. The solutions, on the average, separate exponentially with time, having a positive Liapunov exponent. Thus, the turbulence is characterized as chaotic. In a search for solutions which contrast with the turbulent ones, the Reynolds number (or strength of the forcing) is reduced. Several qualitatively different flows are noted. These are, respectively, fully chaotic, complex periodic, weakly chaotic, simple periodic, and fixed-point. Of these, we classify only the fully chaotic flows as turbulent. Those flows have both a positive Liapunov exponent and Poincare sections without pattern. By contrast, the weakly chaotic flows, although having positive Liapunov exponents, have some pattern in their Poincare sections. The fixed-point and periodic flows are nonturbulent, since turbulence, as generally understood, is both time-dependent and aperiodic.

Sustained turbulence and magnetic energy in non-rotating shear flows

DEFF Research Database (Denmark)

Nauman, Farrukh; Blackman, Eric G.

2017-01-01

From numerical simulations, we show that non-rotating magnetohydrodynamic shear flows are unstable to finite amplitude velocity perturbations and become turbulent, leading to the growth and sustenance of magnetic energy, including large scale fields. This supports the concept that sustained...... magnetic energy from turbulence is independent of the driving mechanism for large enough magnetic Reynolds numbers....

THE DECAY OF A WEAK LARGE-SCALE MAGNETIC FIELD IN TWO-DIMENSIONAL TURBULENCE

Energy Technology Data Exchange (ETDEWEB)

Kondić, Todor; Hughes, David W.; Tobias, Steven M., E-mail: t.kondic@leeds.ac.uk [Department of Applied Mathematics, University of Leeds, Leeds LS2 9JT (United Kingdom)

2016-06-01

We investigate the decay of a large-scale magnetic field in the context of incompressible, two-dimensional magnetohydrodynamic turbulence. It is well established that a very weak mean field, of strength significantly below equipartition value, induces a small-scale field strong enough to inhibit the process of turbulent magnetic diffusion. In light of ever-increasing computer power, we revisit this problem to investigate fluids and magnetic Reynolds numbers that were previously inaccessible. Furthermore, by exploiting the relation between the turbulent diffusion of the magnetic potential and that of the magnetic field, we are able to calculate the turbulent magnetic diffusivity extremely accurately through the imposition of a uniform mean magnetic field. We confirm the strong dependence of the turbulent diffusivity on the product of the magnetic Reynolds number and the energy of the large-scale magnetic field. We compare our findings with various theoretical descriptions of this process.

Self-similar solutions for poloidal magnetic field in turbulent jet

International Nuclear Information System (INIS)

Komissarov, S.S.; Ovchinnikov, I.L.

1990-01-01

Evolution of a large-scale magnetic field in a turbulent extragalactic source radio jets is considered. Self-similar solutions for a weak poloidal magnetic field transported by turbulent jet of incompressible fluid are found. It is shown that the radial profiles of the solutions are the eigenfunctions of a linear differential operator. In all the solutions, the strength of a large-scale field decreases more rapidly than that of a small-scale turbulent field. This can be understood as a decay of a large-scale field in the turbulent jet

Fluid model of the magnetic presheath in a turbulent plasma

International Nuclear Information System (INIS)

Stanojevic, M; Duhovnik, J; Jelic, N; Kendl, A; Kuhn, S

2005-01-01

A fluid model of the magnetic presheath in a turbulent boundary plasma is presented. Turbulent transport corrections of the classical three-dimensional fluid transport equations, which can be used to study magnetic presheaths in various geometries, are derived by means of the ensemble averaging procedure from the statistical theory of plasma turbulence. Then, the magnetic presheath in front of an infinite plane surface is analysed in detail. The linearized planar magnetic presheath equations are applied to the plasma-presheath-magnetic-presheath boundary (i.e. the magnetic presheath edge), whereas the original non-linear planar magnetic presheath equations are used for the entire magnetic presheath, allowing for various sets of experimentally relevant free model parameters to be applied. Important new results of this study are, among others, new expressions for the fluid Bohm criterion at the Debye sheath edge and for the ion flux density perpendicular to the wall. These new results, which exhibit corrections due to the turbulent charged particle transport, can qualitatively explain the fact that whenever the angle between the magnetic field and the wall is very small (i.e. several degrees) or zero, electric currents, measured by Langmuir probes in the boundary regions of nuclear fusion devices and in various low-temperature plasmas, are anomalously enhanced in comparison with those expected or predicted by other theoretical models

Hall MHD Stability and Turbulence in Magnetically Accelerated Plasmas

Energy Technology Data Exchange (ETDEWEB)

H. R. Strauss

2012-11-27

The object of the research was to develop theory and carry out simulations of the Z pinch and plasma opening switch (POS), and compare with experimental results. In the case of the Z pinch, there was experimental evidence of ion kinetic energy greatly in excess of the ion thermal energy. It was thought that this was perhaps due to fine scale turbulence. The simulations showed that the ion energy was predominantly laminar, not turbulent. Preliminary studies of a new Z pinch experiment with an axial magnetic field were carried out. The axial magnetic is relevant to magneto - inertial fusion. These studies indicate the axial magnetic field makes the Z pinch more turbulent. Results were also obtained on Hall magnetohydrodynamic instability of the POS.

Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.

Science.gov (United States)

Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L

2012-01-02

We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.

Simulation of aperiodic bipedal sprinting.

Science.gov (United States)

Celik, Huseyin; Piazza, Stephen J

2013-08-01

Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.

Science.gov (United States)

Lin, Chenxi; Povinelli, Michelle L

2011-09-12

We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

Modification of Turbulence Structures in a Channel Flow by Uniform Magnetic Fluxes

Science.gov (United States)

Lee, D.; Choi, H.; Kim, J.

1997-11-01

Effects of electromagnetic forcing on the near-wall turbulence are investigated by applying a uniform magnetic flux in a turbulent channel flow in the streamwise and spanwise directions, respectively. The base flow is a fully developed turbulent channel flow and the direct numerical simulation technique is used. The electromagnetic force induced from the magnetic fluxes reduces the intensity of the wall-layer structures and thus drag is significantly reduced. The wall-normal and spanwise velocity fluctuations and the Reynolds shear stress decrease with the increased magnetic flux in both directions. The streamwise velocity fluctuations increase with the streamwise magnetic flux, whereas they decrease with the spanwise magnetic flux. It is also shown that the spanwise magnetic flux is much more effective than the streamwise magnetic flux in reducing the skin-friction drag. Instantaneous Lorentz force vectors show that the flow motions by the near-wall vortices are directly inhibited by the spanwise magnetic flux, while they are less effectively inhibited by the streamwise magnetic flux. Other turbulence statistics that reveal the effects of the applied magnetic forcing will be presented. ^* Supported by KOSEF Contract No. 965-1008-003-2 and ONR Grant No. N00014-95-1-0352.

Three-dimensional density and compressible magnetic structure in solar wind turbulence

Science.gov (United States)

Roberts, Owen W.; Narita, Yasuhito; Escoubet, C.-Philippe

2018-03-01

The three-dimensional structure of both compressible and incompressible components of turbulence is investigated at proton characteristic scales in the solar wind. Measurements of the three-dimensional structure are typically difficult, since the majority of measurements are performed by a single spacecraft. However, the Cluster mission consisting of four spacecraft in a tetrahedral formation allows for a fully three-dimensional investigation of turbulence. Incompressible turbulence is investigated by using the three vector components of the magnetic field. Meanwhile compressible turbulence is investigated by considering the magnitude of the magnetic field as a proxy for the compressible fluctuations and electron density data deduced from spacecraft potential. Application of the multi-point signal resonator technique to intervals of fast and slow wind shows that both compressible and incompressible turbulence are anisotropic with respect to the mean magnetic field direction P⟂ ≫ P∥ and are sensitive to the value of the plasma beta (β; ratio of thermal to magnetic pressure) and the wind type. Moreover, the incompressible fluctuations of the fast and slow solar wind are revealed to be different with enhancements along the background magnetic field direction present in the fast wind intervals. The differences in the fast and slow wind and the implications for the presence of different wave modes in the plasma are discussed.

The Uncertainty of Local Background Magnetic Field Orientation in Anisotropic Plasma Turbulence

Energy Technology Data Exchange (ETDEWEB)

Gerick, F.; Saur, J.; Papen, M. von, E-mail: felix.gerick@uni-koeln.de [Institute of Geophysics and Meteorology, University of Cologne, Cologne (Germany)

2017-07-01

In order to resolve and characterize anisotropy in turbulent plasma flows, a proper estimation of the background magnetic field is crucially important. Various approaches to calculating the background magnetic field, ranging from local to globally averaged fields, are commonly used in the analysis of turbulent data. We investigate how the uncertainty in the orientation of a scale-dependent background magnetic field influences the ability to resolve anisotropy. Therefore, we introduce a quantitative measure, the angle uncertainty, that characterizes the uncertainty of the orientation of the background magnetic field that turbulent structures are exposed to. The angle uncertainty can be used as a condition to estimate the ability to resolve anisotropy with certain accuracy. We apply our description to resolve the spectral anisotropy in fast solar wind data. We show that, if the angle uncertainty grows too large, the power of the turbulent fluctuations is attributed to false local magnetic field angles, which may lead to an incorrect estimation of the spectral indices. In our results, an apparent robustness of the spectral anisotropy to false local magnetic field angles is observed, which can be explained by a stronger increase of power for lower frequencies when the scale of the local magnetic field is increased. The frequency-dependent angle uncertainty is a measure that can be applied to any turbulent system.

The Uncertainty of Local Background Magnetic Field Orientation in Anisotropic Plasma Turbulence

International Nuclear Information System (INIS)

Gerick, F.; Saur, J.; Papen, M. von

2017-01-01

In order to resolve and characterize anisotropy in turbulent plasma flows, a proper estimation of the background magnetic field is crucially important. Various approaches to calculating the background magnetic field, ranging from local to globally averaged fields, are commonly used in the analysis of turbulent data. We investigate how the uncertainty in the orientation of a scale-dependent background magnetic field influences the ability to resolve anisotropy. Therefore, we introduce a quantitative measure, the angle uncertainty, that characterizes the uncertainty of the orientation of the background magnetic field that turbulent structures are exposed to. The angle uncertainty can be used as a condition to estimate the ability to resolve anisotropy with certain accuracy. We apply our description to resolve the spectral anisotropy in fast solar wind data. We show that, if the angle uncertainty grows too large, the power of the turbulent fluctuations is attributed to false local magnetic field angles, which may lead to an incorrect estimation of the spectral indices. In our results, an apparent robustness of the spectral anisotropy to false local magnetic field angles is observed, which can be explained by a stronger increase of power for lower frequencies when the scale of the local magnetic field is increased. The frequency-dependent angle uncertainty is a measure that can be applied to any turbulent system.

Influence of pinches on magnetic reconnection in turbulent space plasmas

Science.gov (United States)

Olshevsky, Vyacheslav; Lapenta, Giovanni; Markidis, Stefano; Divin, Andrey

A generally accepted scenario of magnetic reconnection in space plasmas is the breakage of magnetic field lines in X-points. In laboratory, reconnection is widely studied in pinches, current channels embedded into twisted magnetic fields. No model of magnetic reconnection in space plasmas considers both null-points and pinches as peers. We have performed a particle-in-cell simulation of magnetic reconnection in a three-dimensional configuration where null-points are present nitially, and Z-pinches are formed during the simulation. The X-points are relatively stable, and no substantial energy dissipation is associated with them. On contrary, turbulent magnetic reconnection in the pinches causes the magnetic energy to decay at a rate of approximately 1.5 percent per ion gyro period. Current channels and twisted magnetic fields are ubiquitous in turbulent space plasmas, so pinches can be responsible for the observed high magnetic reconnection rates.

Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams

Science.gov (United States)

Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović

2017-08-01

We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.

Development of Turbulent Magnetic Reconnection in a Magnetic Island

International Nuclear Information System (INIS)

Huang, Can; Lu, Quanming; Wang, Rongsheng; Wu, Mingyu; Lu, San; Wang, Shui; Guo, Fan

2017-01-01

In this paper, with two-dimensional particle-in-cell simulations, we report that the electron Kelvin–Helmholtz instability is unstable in the current layer associated with a large-scale magnetic island, which is formed in multiple X-line guide field reconnections. The current sheet is fragmented into many small current sheets with widths down to the order of the electron inertial length. Secondary magnetic reconnection then occurs in these fragmented current sheets, which leads to a turbulent state. The electrons are highly energized in such a process.

Electrostatic turbulence in strongly magnetized plasmas

International Nuclear Information System (INIS)

Nielsen, A.H.

1993-01-01

Turbulence in plasmas has been investigated experimentally and numerically. On the experimental side the turbulent nature of the Kelvin-Helmholtz instability has been studied in a single-ended Q-machine. The development of coherent structures in the background of the turbulent flow has been demonstrated and the capability of structures of transporting plasma across the magnetic field-lines is explained in detail. The numerical investigations are divided into two parts: Numerical simulations of the dynamics from the Q-machine experiments using spectral methods to solve the two-dimensional Navier-Stokes equations in a cylindrical geometry. A numerical study of the Eulerian-Lagrangian transformation in a two-dimensional flow. Here the flow is made up by a large number of structures, where each individual structure is convected by the superposed flow field of all the others. (au) (33 ills., 67 refs.)

Self-similar solutions for toroidal magnetic fields in a turbulent jet

International Nuclear Information System (INIS)

Komissarov, S.S.; Ovchinnikov, I.L.

1989-01-01

Self-similar solutions for weak toroidal magnetic fields transported by a turbulent jet of incompressible fluid are obtained. It is shown that radial profiles of the self-similar solutions form a discrete spectrum of eigenfunctions of a linear differential operator. The strong depatures from the magnetic flux conservation law, used frequently in turbulent jet models for extragalactic radio sources, are found

Electron magnetic reconnection without ion coupling in Earth's turbulent magnetosheath

Science.gov (United States)

Phan, T. D.; Eastwood, J. P.; Shay, M. A.; Drake, J. F.; Sonnerup, B. U. Ö.; Fujimoto, M.; Cassak, P. A.; Øieroset, M.; Burch, J. L.; Torbert, R. B.; Rager, A. C.; Dorelli, J. C.; Gershman, D. J.; Pollock, C.; Pyakurel, P. S.; Haggerty, C. C.; Khotyaintsev, Y.; Lavraud, B.; Saito, Y.; Oka, M.; Ergun, R. E.; Retino, A.; Le Contel, O.; Argall, M. R.; Giles, B. L.; Moore, T. E.; Wilder, F. D.; Strangeway, R. J.; Russell, C. T.; Lindqvist, P. A.; Magnes, W.

2018-05-01

Magnetic reconnection in current sheets is a magnetic-to-particle energy conversion process that is fundamental to many space and laboratory plasma systems. In the standard model of reconnection, this process occurs in a minuscule electron-scale diffusion region1,2. On larger scales, ions couple to the newly reconnected magnetic-field lines and are ejected away from the diffusion region in the form of bi-directional ion jets at the ion Alfvén speed3-5. Much of the energy conversion occurs in spatially extended ion exhausts downstream of the diffusion region6. In turbulent plasmas, which contain a large number of small-scale current sheets, reconnection has long been suggested to have a major role in the dissipation of turbulent energy at kinetic scales7-11. However, evidence for reconnection plasma jetting in small-scale turbulent plasmas has so far been lacking. Here we report observations made in Earth's turbulent magnetosheath region (downstream of the bow shock) of an electron-scale current sheet in which diverging bi-directional super-ion-Alfvénic electron jets, parallel electric fields and enhanced magnetic-to-particle energy conversion were detected. Contrary to the standard model of reconnection, the thin reconnecting current sheet was not embedded in a wider ion-scale current layer and no ion jets were detected. Observations of this and other similar, but unidirectional, electron jet events without signatures of ion reconnection reveal a form of reconnection that can drive turbulent energy transfer and dissipation in electron-scale current sheets without ion coupling.

Turbulent amplification of magnetic fields in laboratory laser-produced shock waves

International Nuclear Information System (INIS)

Meinecke, J.; Doyle, H.W.; Bell, A.R.; Schekochihin, A.A.; Miniati, F.; Bingham, R.; Koenig, M.; Pelka, A.; Ravasio, A.; Yurchak, R.

2014-01-01

X-ray and radio observations of the supernova remnant Cassiopeia A reveal the presence of magnetic fields about 100 times stronger than those in the surrounding interstellar medium. Field coincident with the outer shock probably arises through a nonlinear feedback process involving cosmic rays. The origin of the large magnetic field in the interior of the remnant is less clear but it is presumably stretched and amplified by turbulent motions. Turbulence may be generated by hydrodynamic instability at the contact discontinuity between the supernova ejecta and the circumstellar gas. However, optical observations of Cassiopeia A indicate that the ejecta are interacting with a highly inhomogeneous, dense circumstellar cloud bank formed before the supernova explosion. Here we investigate the possibility that turbulent amplification is induced when the outer shock overtakes dense clumps in the ambient medium. We report laboratory experiments that indicate the magnetic field is amplified when the shock interacts with a plastic grid. We show that our experimental results can explain the observed synchrotron emission in the interior of the remnant. The experiment also provides a laboratory example of magnetic field amplification by turbulence in plasmas, a physical process thought to occur in many astrophysical phenomena. (authors)

Electromotive force and large-scale magnetic dynamo in a turbulent flow with a mean shear.

Science.gov (United States)

Rogachevskii, Igor; Kleeorin, Nathan

2003-09-01

An effect of sheared large-scale motions on a mean electromotive force in a nonrotating turbulent flow of a conducting fluid is studied. It is demonstrated that in a homogeneous divergence-free turbulent flow the alpha effect does not exist, however a mean magnetic field can be generated even in a nonrotating turbulence with an imposed mean velocity shear due to a "shear-current" effect. A mean velocity shear results in an anisotropy of turbulent magnetic diffusion. A contribution to the electromotive force related to the symmetric parts of the gradient tensor of the mean magnetic field (the kappa effect) is found in nonrotating turbulent flows with a mean shear. The kappa effect and turbulent magnetic diffusion reduce the growth rate of the mean magnetic field. It is shown that a mean magnetic field can be generated when the exponent of the energy spectrum of the background turbulence (without the mean velocity shear) is less than 2. The shear-current effect was studied using two different methods: the tau approximation (the Orszag third-order closure procedure) and the stochastic calculus (the path integral representation of the solution of the induction equation, Feynman-Kac formula, and Cameron-Martin-Girsanov theorem). Astrophysical applications of the obtained results are discussed.

Convection causes enhanced magnetic turbulence in accretion disks in outburst

Energy Technology Data Exchange (ETDEWEB)

Hirose, Shigenobu [Department of Mathematical Science and Advanced Technology, JAMSTEC, Yokohama, Kanagawa 236-0001 (Japan); Blaes, Omer; Coleman, Matthew S. B. [Department of Physics, University of California, Santa Barbara, CA 93106 (United States); Krolik, Julian H. [Department of Physics and Astronomy, Johns Hopkins University, Baltimore, MD 21218 (United States); Sano, Takayoshi, E-mail: shirose@jamstec.go.jp [Institute of Laser Engineering, Osaka University, Suita, Osaka 565-0871 (Japan)

2014-05-20

We present the results of local, vertically stratified, radiation magnetohydrodynamic (MHD) shearing box simulations of magneto-rotational instability (MRI) turbulence appropriate for the hydrogen ionizing regime of dwarf nova and soft X-ray transient outbursts. We incorporate the frequency-integrated opacities and equation of state for this regime, but neglect non-ideal MHD effects and surface irradiation, and do not impose net vertical magnetic flux. We find two stable thermal equilibrium tracks in the effective temperature versus surface mass density plane, in qualitative agreement with the S-curve picture of the standard disk instability model. We find that the large opacity at temperatures near 10{sup 4} K, a corollary of the hydrogen ionization transition, triggers strong, intermittent thermal convection on the upper stable branch. This convection strengthens the magnetic turbulent dynamo and greatly enhances the time-averaged value of the stress to thermal pressure ratio α, possibly by generating vertical magnetic field that may seed the axisymmetric MRI, and by increasing cooling so that the pressure does not rise in proportion to the turbulent dissipation. These enhanced stress to pressure ratios may alleviate the order of magnitude discrepancy between the α-values observationally inferred in the outburst state and those that have been measured from previous local numerical simulations of magnetorotational turbulence that lack net vertical magnetic flux.

Magnetic turbulent electron transport in a reversed field pinch

International Nuclear Information System (INIS)

Schoenberg, K.; Moses, R.

1990-01-01

A model of magnetic turbulent electron transport is presented. The model, based on the thermal conduction theory of Rechester and Rosenbluth, entails a Boltzmann description of electron dynamics in the long mean-free-path limit and quantitatively describes the salient features of superthermal electron measurements in the RFP edge plasma. Included are predictions of the mean superthermal electron energy, current density, and power flux asymmetry. A discussion of the transport model, the assumptions implicit in the model, and the relevance of this work to more general issue of magnetic turbulent transport in toroidal systems is presented. 32 refs., 3 figs

A method to identify aperiodic disturbances in the ionosphere

Science.gov (United States)

Wang, J.-S.; Chen, Z.; Huang, C.-M.

2014-05-01

In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

First measurement of the magnetic turbulence induced Reynolds stress in a tokamak

International Nuclear Information System (INIS)

Xu Guosheng; Wan Baonian; Song Mei

2003-01-01

Reynolds stress component due to magnetic turbulence was first measured in the plasma edge region of the HT-7 superconducting tokamak using an insertable magnetic probe. A radial gradient of magnetic Reynolds stress was observed to be close to the velocity shear layer location; however, in this experiment its contribution to driving the poloidal flows is small compared to the electrostatic component. The electron heat transport driven by magnetic turbulence is quite small and cannot account for the total energy transport at the plasma edge

Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices

Directory of Open Access Journals (Sweden)

Enrique Maciá

2015-05-01

Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.

The response of filamentary and spherical clouds to the turbulence and magnetic field

Science.gov (United States)

Gholipour, Mahmoud

2018-05-01

Recent observations have revealed that there is a power-law relation between magnetic field and density in molecular clouds. Furthermore, turbulence has been observed in some regions of molecular clouds and the velocity dispersion resulting from the turbulence is found to correlate with to the cloud density. Relating to these observations, in this study, we model filamentary and spherical clouds in magnetohydrostatic equilibrium in two quiescent and turbulent regions. The proposed equations are expected to represent the impact of magnetic field and turbulence on the cloud structure and the relation of cloud mass with shape. The Virial theorem is applied to consider the cloud evolution leading to important conditions for equilibrium of the cloud over its lifetime. The obtained results indicate that under the same conditions of the magnetic field and turbulence, each shape presents different responses. The possible ways for the formation of massive cores or coreless clouds in some regions as well as the formation of massive stars or low-mass stars can be discussed based on the results of this study. It should be mentioned that the shape of the clouds plays an important role in the formation of the protostellar clouds as well as their structure and evolution. This role is due to the effects of magnetic fields and turbulence.

Turbulence, transport and confinement: from tokamaks to star magnetism

International Nuclear Information System (INIS)

Strugarek, Antoine

2012-01-01

This thesis is part of the general study of self-organization in hot and magnetized plasmas. We focus our work on two specific objects: stars and tokamaks. We use first principle numerical simulations to study turbulence, transport and confinement in these plasmas. The first part of this thesis introduces the main characteristics of stellar and tokamak plasmas. The reasons for studying them together are properly detailed. The second part is focused on stellar aspects. We study the interactions between the 3D turbulent motions in the solar convection zone with an internal magnetic field in the tachocline (the transition region between the instable and stable zones in the Sun). The tachocline is a very thin layer (less than five percent of the solar radius) that acts as a transport barrier of angular momentum. We show that such an internal magnetic field is not likely to explain the observed thickness of the tachocline and we give some insights on how to find alternative mechanisms to constrain it. We also explore the effect of the environment of star on its structure. We develop a methodology to study the influence of stellar wind and of the magnetic coupling of a star with its orbiting planets. We use the same methodology to analyse the magnetic interaction between a stellar wind and a planetary magnetosphere that acts as a transport barrier of matter. Then, the third part is dedicated to fusion oriented research. We present a numerical investigation on the experimental mechanisms that lead to the development of transport barriers in the plasma. These barriers are particularly important for the design of high performance fusion devices. The creation of transport barriers is obtained in turbulent first principle simulations for the very first time. The collaboration between the two scientific teams lead to the results presented in the fourth part of this thesis. An original spectral method is developed to analyse the saturation of stellar convective dynamos and of

Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

Directory of Open Access Journals (Sweden)

Liu Xue

2011-01-01

Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

Turbulence and intermittent transport at the boundary of magnetized plasmas

DEFF Research Database (Denmark)

Garcia, O.E.; Naulin, V.; Nielsen, A.H.

2005-01-01

Numerical fluid simulations of interchange turbulence for geometry and parameters relevant to the boundary region of magnetically confined plasmas are shown to result in intermittent transport qualitatively similar to recent experimental measurements. The two-dimensional simulation domain features...... a forcing region with spatially localized sources of particles and heat outside which losses due to the motion along open magnetic-field lines dominate, corresponding to the edge region and the scrape-off layer, respectively. Turbulent states reveal intermittent eruptions of hot plasma from the edge region...... fluctuation wave forms and transport statistics are also in a good agreement with those derived from the experiments. Associated with the turbulence bursts are relaxation oscillations in the particle and heat confinements as well as in the kinetic energy of the sheared poloidal flows. The formation of blob...

The role of magnetic turbulence in astrophysical jet launching and cosmic ray transport

International Nuclear Information System (INIS)

Casse, Fabien

2001-01-01

The first part of my thesis shows how Keplerian discs can launch MHD jets, under some conditions. The key points of this first part are the adding of viscosity inside the disc and a relevant energy equation, In particular, I have shown both analytically and numerically that the angular momentum transport is constrained by the MHD turbulence properties. I have also shown that one must take into account a relevant energy equation in order to have a more realistic description of jets observed in the Universe. Moreover, some energy turbulent transport mechanisms cannot be described in a simple MHD approach. In order to better understand the interaction between a turbulent magnetic field and charged particles, I have undertaken a study dealing with spatial and angular diffusion of hadrons with a chaotic magnetic field generated by a magnetic turbulence. In this study, it clearly appears that the spatial diffusion coefficient along the mean magnetic field extrapolate the results of quasi-linear theory for weak turbulence. At the opposite, in the inertial range, the spatial diffusion coefficient across the mean magnetic field is inconsistent with such a theory. Indeed the spatial diffusion coefficient across the mean magnetic field has a behaviour that can be interpreted as a chaotic diffusion regime as the one predicted by Rechester and Rosenbluth. Moreover, outside this range, the behaviours of all spatial diffusion coefficients are different of those expected in the framework of quasi-linear theory. At last, it has been found that a Bohm diffusion regime never occurs whatever the magnetic chaos. (author) [fr

MMS Observation of Magnetic Reconnection in the Turbulent Magnetosheath

Science.gov (United States)

Vörös, Z.; Yordanova, E.; Varsani, A.; Genestreti, K. J.; Khotyaintsev, Yu. V.; Li, W.; Graham, D. B.; Norgren, C.; Nakamura, R.; Narita, Y.; Plaschke, F.; Magnes, W.; Baumjohann, W.; Fischer, D.; Vaivads, A.; Eriksson, E.; Lindqvist, P.-A.; Marklund, G.; Ergun, R. E.; Leitner, M.; Leubner, M. P.; Strangeway, R. J.; Le Contel, O.; Pollock, C.; Giles, B. J.; Torbert, R. B.; Burch, J. L.; Avanov, L. A.; Dorelli, J. C.; Gershman, D. J.; Paterson, W. R.; Lavraud, B.; Saito, Y.

2017-11-01

In this paper we use the full armament of the MMS (Magnetospheric Multiscale) spacecraft to study magnetic reconnection in the turbulent magnetosheath downstream of a quasi-parallel bow shock. Contrarily to the magnetopause and magnetotail cases, only a few observations of reconnection in the magnetosheath have been reported. The case study in this paper presents, for the first time, both fluid-scale and kinetic-scale signatures of an ongoing reconnection in the turbulent magnetosheath. The spacecraft are crossing the reconnection inflow and outflow regions and the ion diffusion region (IDR). Inside the reconnection outflows D shape ion distributions are observed. Inside the IDR mixing of ion populations, crescent-like velocity distributions and ion accelerations are observed. One of the spacecraft skims the outer region of the electron diffusion region, where parallel electric fields, energy dissipation/conversion, electron pressure tensor agyrotropy, electron temperature anisotropy, and electron accelerations are observed. Some of the difficulties of the observations of magnetic reconnection in turbulent plasma are also outlined.

SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

Energy Technology Data Exchange (ETDEWEB)

Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)

2015-01-10

Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.

SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

International Nuclear Information System (INIS)

Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

2015-01-01

Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

DIRECT OBSERVATION OF THE TURBULENT emf AND TRANSPORT OF MAGNETIC FIELD IN A LIQUID SODIUM EXPERIMENT

Energy Technology Data Exchange (ETDEWEB)

Rahbarnia, Kian; Brown, Benjamin P.; Clark, Mike M.; Kaplan, Elliot J.; Nornberg, Mark D.; Rasmus, Alex M.; Taylor, Nicholas Zane; Forest, Cary B. [Department of Physics, University of Wisconsin-Madison, 1150 University Ave, Madison, WI 53706 (United States); Jenko, Frank; Limone, Angelo [Max-Planck-Institut fuer Plasmaphysik (IPP), EURATOM Association, D-85748 Garching (Germany); Pinton, Jean-Francois; Plihon, Nicolas; Verhille, Gautier, E-mail: kian.rahbarnia@ipp.mpg.de [Laboratoire de Physique de l' Ecole Normale Superieure de Lyon, CNRS and Universite de Lyon, F-69364 Lyon (France)

2012-11-10

For the first time, we have directly measured the transport of a vector magnetic field by isotropic turbulence in a high Reynolds number liquid metal flow. In analogy with direct measurements of the turbulent Reynolds stress (turbulent viscosity) that governs momentum transport, we have measured the turbulent electromotive force (emf) by simultaneously measuring three components of velocity and magnetic fields, and computed the correlations that lead to mean-field current generation. Furthermore, we show that this turbulent emf tends to oppose and cancel out the local current, acting to increase the effective resistivity of the medium, i.e., it acts as an enhanced magnetic diffusivity. This has important implications for turbulent transport in astrophysical objects, particularly in dynamos and accretion disks.

DIRECT OBSERVATION OF THE TURBULENT emf AND TRANSPORT OF MAGNETIC FIELD IN A LIQUID SODIUM EXPERIMENT

International Nuclear Information System (INIS)

Rahbarnia, Kian; Brown, Benjamin P.; Clark, Mike M.; Kaplan, Elliot J.; Nornberg, Mark D.; Rasmus, Alex M.; Taylor, Nicholas Zane; Forest, Cary B.; Jenko, Frank; Limone, Angelo; Pinton, Jean-François; Plihon, Nicolas; Verhille, Gautier

2012-01-01

For the first time, we have directly measured the transport of a vector magnetic field by isotropic turbulence in a high Reynolds number liquid metal flow. In analogy with direct measurements of the turbulent Reynolds stress (turbulent viscosity) that governs momentum transport, we have measured the turbulent electromotive force (emf) by simultaneously measuring three components of velocity and magnetic fields, and computed the correlations that lead to mean-field current generation. Furthermore, we show that this turbulent emf tends to oppose and cancel out the local current, acting to increase the effective resistivity of the medium, i.e., it acts as an enhanced magnetic diffusivity. This has important implications for turbulent transport in astrophysical objects, particularly in dynamos and accretion disks.

Turbulence simulations of blob formation and radial propagation in toroidally magnetized plasmas

DEFF Research Database (Denmark)

Garcia, O.E.; Naulin, V.; Nielsen, A.H.

2006-01-01

the presence of long- range correlations in the particle density fluctuations. Finally, conditional statistics of the particle flux demonstrates the intermittency of the turbulent plasma transport and the quasi-periodic apparency of blob structures due to bursting in the global turbulence level....... of particles and heat, which is coupled to a scrape-off layer with linear damping terms for all dependent variables corresponding to transport along open magnetic field lines. The formation of blob structures is related to profile variations caused by bursting in the global turbulence level, which is due...... to a dynamical regulation by self- sustained differential rotation of the plasma layer. Radial propagation of the blob structures follows from a vertical charge polarization due to magnetic guiding centre drifts in the toroidally magnetized plasma. Statistical analysis of the particle density, radial electric...

Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

International Nuclear Information System (INIS)

Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

2004-01-01

An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells

Turbulence and transport of passive scalar in magnetohydrodynamic channel flows with different orientations of magnetic field

International Nuclear Information System (INIS)

Dey, Prasanta K.; Zikanov, Oleg

2012-01-01

Highlights: ► Turbulent passive scalar transport in an MHD flow in a channel is studied using DNS. ► Magnetic fields of wall-normal, spanwise, and streamwise orientations are considered. ► Magnetic fields suppress turbulent transport and modifies scalar distribution. ► The effect is particularly strong at wall-normal and spanwise magnetic fields. ► Decrease of Nusselt number is approximated by a linear function of magnetic interaction parameter. - Abstract: DNS of turbulent flow and passive scalar transport in a channel are conducted for the situation when the fluid is electrically conducting (for example, a liquid metal) and the flow is affected by an imposed magnetic field. The cases of wall-normal, spanwise, and streamwise orientation of the magnetic field are considered. As main results, we find that the magnetic fields, especially those in the wall-normal and spanwise directions, significantly reduce the turbulent scalar transport and modify the properties of the scalar distribution.

MMS Observations of Ion-Scale Magnetic Island in the Magnetosheath Turbulent Plasma

Science.gov (United States)

Huang, S. Y.; Sahraoui, F.; Retino, A.; Contel, O. Le; Yuan, Z. G.; Chasapis, A.; Aunai, N.; Breuillard, H.; Deng, X. H.; Zhou, M.;

GENESIS OF INTERPLANETARY INTERMITTENT TURBULENCE: A CASE STUDY OF ROPE–ROPE MAGNETIC RECONNECTION

Energy Technology Data Exchange (ETDEWEB)

Chian, Abraham C.-L.; Loew, Murray H. [Department of Biomedical Engineering, George Washington University, Washington, DC 20052 (United States); Feng, Heng Q. [Institute of Space Physics, Luoyang Normal University, Luoyang (China); Hu, Qiang [Department of Space Science and CSPAR, University of Alabama in Huntsville, Huntsville, AL 35805 (United States); Miranda, Rodrigo A. [UnB-Gama Campus, and Plasma Physics Laboratory, Institute of Physics, University of Brasília (UnB), Brasília DF 70910-900 (Brazil); Muñoz, Pablo R. [Department of Physics and Astronomy, University of La Serena, Av. Juan Cisternas 1200, La Serena (Chile); Sibeck, David G. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Wu, De J., E-mail: abraham.chian@gmail.com [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

2016-12-01

In a recent paper, the relation between current sheet, magnetic reconnection, and turbulence at the leading edge of an interplanetary coronal mass ejection was studied. We report here the observation of magnetic reconnection at the interface region of two interplanetary magnetic flux ropes. The front and rear boundary layers of three interplanetary magnetic flux ropes are identified, and the structures of magnetic flux ropes are reconstructed by the Grad–Shafranov method. A quantitative analysis of the reconnection condition and the degree of intermittency reveals that rope–rope magnetic reconnection is the most likely site for genesis of interplanetary intermittency turbulence in this event. The dynamic pressure pulse resulting from this reconnection triggers the onset of a geomagnetic storm.

Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

Science.gov (United States)

Kumar, Pawan; Parmananda, P.

2018-04-01

Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

Recent Progress on the magnetic turbulence experiment at the Bryn Mawr Plasma Laboratory

Science.gov (United States)

Schaffner, D. A.; Cartagena-Sanchez, C. A.; Johnson, H. K.; Fahim, L. E.; Fiedler-Kawaguchi, C.; Douglas-Mann, E.

2017-10-01

Recent progress is reported on the construction, implementation and testing of the magnetic turbulence experiment at the Bryn Mawr Plasma Laboratory (BMPL). The experiment at the BMPL consists of an ( 300 μs) long coaxial plasma gun discharge that injects magnetic helicity into a flux-conserving chamber in a process akin to sustained slow-formation of spheromaks. A 24cm by 2m cylindrical chamber has been constructed with a high density axial port array to enable detailed simultaneous spatial measurements of magnetic and plasma fluctuations. Careful positioning of the magnetic structure produced by the three separately pulsed coils (one internal, two external) are preformed to optimize for continuous injection of turbulent magnetized plasma. High frequency calibration of magnetic probes is also underway using a power amplifier.

Turbulent transport of impurities in a magnetized plasma; Transport turbulent d'impuretes dans un plasma magnetise

Energy Technology Data Exchange (ETDEWEB)

Dubuit, N

2006-10-15

This work deals with the transport of impurities in magnetically confined thermonuclear plasmas. The accumulation of impurities in the core of the plasma would imply dramatic losses of energy that may lead to the extinction of the plasma. On the opposite, the injection of impurities in the plasma edge is considered as an efficient means to extract heat without damaging the first wall. The balance between these 2 contradictory constraints requires an accurate knowledge of the impurity transport inside the plasma. The effect of turbulence, the main transport mechanism for impurities is therefore a major issue. In this work, the complete formula of a turbulent flow of impurities for a given fluctuation spectrum has been inferred. The origin and features of the main accumulation processes have been identified. The main effect comes from the compressibility of the electrical shift speed in a plane perpendicular to the magnetic field. This compressibility appears to be linked to the curvature of the magnetic field. A less important effect is a thermal-diffusion process that is inversely proportional to the number of charges and then disappears for most type of impurities except the lightest. This effect implies an impurity flux proportional to the temperature gradient and its direction can change according to the average speed of fluctuations. A new version of the turbulence code TRB has been developed. This new version allows the constraints of the turbulence not by the gradients but by the flux which is more realistic. The importance of the processes described above has been confirmed by a comparison between calculation and experimental data from Tore-supra and the Jet tokamak. The prevailing role of the curvature of the magnetic field in the transport impurity is highlighted. (A.C.)

Magnetic reconnection in the presence of externally driven and self-generated turbulence

International Nuclear Information System (INIS)

Karimabadi, H.; Lazarian, A.

2013-01-01

Magnetic reconnection is an important process that violates flux freezing and induces change of magnetic field topology in conducting fluids and, as a consequence, converts magnetic field energy into particle energy. It is thought to be operative in laboratory, heliophysical, and astrophysical plasmas. These environments exhibit wide variations in collisionality, ranging from collisionless in the Earth's magnetosphere to highly collisional in molecular clouds. A common feature among these plasmas is, however, the presence of turbulence. We review the present understanding of the effects of turbulence on the reconnection rate, discussing both how strong pre-existing turbulence modifies Sweet-Parker reconnection and how turbulence may develop as a result of reconnection itself. In steady state, reconnection rate is proportional to the aspect ratio of the diffusion region. Thus, two general MHD classes of models for fast reconnection have been proposed, differing on whether they keep the aspect ratio finite by increasing the width due to turbulent broadening or shortening the length of the diffusion layer due to plasmoid instability. One of the consequences of the plasmoid instability model is the possibility that the current sheet thins down to collisionless scales where kinetic effects become dominant. As a result, kinetic effects may be of importance for many astrophysical applications which were considered to be in the realm of MHD. Whether pre-existing turbulence can significantly modify the transition to the kinetic regime is not currently known. Although most studies of turbulent reconnection have been based on MHD, recent advances in kinetic simulations are enabling 3D studies of turbulence and reconnection in the collisionless regime. A summary of these recent works, highlighting similarities and differences with the MHD models of turbulent reconnection, as well as comparison with in situ observations in the magnetosphere and in the solar wind, are presented

Driving magnetic turbulence using flux ropes in a moderate guide field linear system

Science.gov (United States)

Brookhart, Matthew I.; Stemo, Aaron; Waleffe, Roger; Forest, Cary B.

2017-12-01

We present a series of experiments on novel, line-tied plasma geometries as a study of the generation of chaos and turbulence in line-tied systems. Plasma production and the injection scale for magnetic energy is provided by spatially discrete plasma guns that inject both plasma and current. The guns represent a technique for controlling the injection scale of magnetic energy. A two-dimensional (2-D) array of magnetic probes provides spatially resolved time histories of the magnetic fluctuations at a single cross-section of the experimental cylinder, allowing simultaneous spatial measurements of chaotic and turbulent behaviour. The first experiment shows chaotic fluctuations and self-organization in a hollow-current line-tied screw pinch. These dynamics is modulated primarily by the applied magnetic field and weakly by the plasma current and safety factor. The second experiment analyses the interactions of multiple line-tied flux ropes. The flux ropes all exhibit chaotic behaviour, and under certain conditions develop an inverse cascade to larger scales and a turbulent inertial range with magnetic energy ( ) related to perpendicular wave number ( \\bot $ ) as \\bot -2.5\\pm 0.5$ .

Numerical simulations of the decay of primordial magnetic turbulence

International Nuclear Information System (INIS)

Kahniashvili, Tina; Brandenburg, Axel; Tevzadze, Alexander G.; Ratra, Bharat

2010-01-01

We perform direct numerical simulations of forced and freely decaying 3D magnetohydrodynamic turbulence in order to model magnetic field evolution during cosmological phase transitions in the early Universe. Our approach assumes the existence of a magnetic field generated either by a process during inflation or shortly thereafter, or by bubble collisions during a phase transition. We show that the final configuration of the magnetic field depends on the initial conditions, while the velocity field is nearly independent of initial conditions.

Anomalous particle diffusion and Levy random walk of magnetic field lines in three-dimensional solar wind turbulence

International Nuclear Information System (INIS)

Zimbardo, Gaetano

2005-01-01

Plasma transport in the presence of turbulence depends on a variety of parameters such as the fluctuation level, δB/B 0 , the ratio between the particle Larmor radius and the turbulence correlation length, and the turbulence anisotropy. In this paper, we present the results of numerical simulations of plasma and magnetic field line transport in the case of anisotropic magnetic turbulence, for parameter values close to those of the solar wind. We assume a uniform background magnetic field B 0 = B 0 e z and a Fourier representation for magnetic fluctuations, which includes wavectors oblique with respect to B 0 . The energy density spectrum is a power law, and in k space it is described by the correlation lengths l x , l y , l z , which quantify the anisotropy of turbulence. For magnetic field lines, transport perpendicular to the background field depends on the Kubo number R (δB/B 0 ) (l z /l x ). For small Kubo numbers, R 0 , or the ratio l z /l x , we find first a quasilinear regime and then a percolative regime, both corresponding to Gaussian diffusion. For particles, we find that transport parallel and perpendicular to the background magnetic field depends heavily on the turbulence anisotropy and on the particle Larmor radius. For turbulence levels typical of the solar wind, δB/B 0 ≅ 0.5-1, when the ratio between the particle Larmor radius and the turbulence correlation lengths is small, anomalous regimes are found in the case l z /l x ≤ 1, with a Levy random walk (superdiffusion) along the magnetic field and subdiffusion in the perpendicular directions. Conversely, for l z /l x > 1 normal Gaussian diffusion is found. A possible expression for generalized double diffusion is discussed

TURBULENCE AND DYNAMO IN GALAXY CLUSTER MEDIUM: IMPLICATIONS ON THE ORIGIN OF CLUSTER MAGNETIC FIELDS

International Nuclear Information System (INIS)

Xu Hao; Collins, David C.; Norman, Michael L.; Li Hui; Li Shengtai

2009-01-01

We present self-consistent cosmological magnetohydrodynamic (MHD) simulations that simultaneously follow the formation of a galaxy cluster and the magnetic field ejection by an active galactic nucleus (AGN). We find that the magnetic fields ejected by the AGNs, though initially distributed in relatively small volumes, can be transported throughout the cluster and be further amplified by the intracluster medium (ICM) turbulence during the cluster formation process. The ICM turbulence is shown to be generated and sustained by the frequent mergers of smaller halos. Furthermore, a cluster-wide dynamo process is shown to exist in the ICM and amplify the magnetic field energy and flux. The total magnetic energy in the cluster can reach ∼10 61 erg while micro Gauss (μG) fields can distribute over ∼ Mpc scales throughout the whole cluster. This finding shows that magnetic fields from AGNs, being further amplified by the ICM turbulence through small-scale dynamo processes, can be the origin of cluster-wide magnetic fields.

Ion and impurity transport in turbulent, anisotropic magnetic fields

International Nuclear Information System (INIS)

Negrea, M; Petrisor, I; Isliker, H; Vogiannou, A; Vlahos, L; Weyssow, B

2011-01-01

We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

Ion and impurity transport in turbulent, anisotropic magnetic fields

Energy Technology Data Exchange (ETDEWEB)

Negrea, M; Petrisor, I [Department of Physics, Association Euratom-MEdC, Romania, University of Craiova, A.I. Cuza str. 13, Craiova (Romania); Isliker, H; Vogiannou, A; Vlahos, L [Section of Astrophysics, Astronomy and Mechanics, Department of Physics, University of Thessaloniki, Association Euratom-Hellenic Republic, 541 24 Thessaloniki (Greece); Weyssow, B [Physique Statistique-Plasmas, Association Euratom-Etat Belge, Universite Libre de Bruxelles, Campus Plaine, Bd. du Triomphe, 1050 Bruxelles (Belgium)

2011-08-15

We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

Ion and impurity transport in turbulent, anisotropic magnetic fields

Science.gov (United States)

Negrea, M.; Petrisor, I.; Isliker, H.; Vogiannou, A.; Vlahos, L.; Weyssow, B.

2011-08-01

We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

Optimization of magnetic amplification by flow constraints in turbulent liquid sodium

International Nuclear Information System (INIS)

Nornberg, M. D.; Taylor, N. Z.; Forest, C. B.; Rahbarnia, K.; Kaplan, E.

2014-01-01

Direct measurements of the vector turbulent emf in a driven two-vortex flow of liquid sodium were performed in the Madison Dynamo Experiment [K. Rahbarnia et al., Astrophys. J. 759, 80 (2012)]. The measured turbulent emf is anti-parallel with the mean current and is almost entirely described by an enhanced resistivity, which increases the threshold for a kinematic dynamo. We have demonstrated that this enhanced resistivity can be mitigated by eliminating the largest-scale eddies through the introduction of baffles. By tailoring the flow to reduce large-scale components and control the helical pitch, we have reduced the power required to drive the impellers, doubled the magnetic flux generated by differential rotation, and increased the decay time of externally applied magnetic fields. Despite these improvements, the flows remain sub-critical to the dynamo instability due to the reemergence of turbulent fluctuations at high flow speeds

Anomalous particle diffusion and Levy random walk of magnetic field lines in three dimensional solar wind turbulence

International Nuclear Information System (INIS)

Zimbardo, G.

2005-01-01

Plasma transport in the presence of turbulence depends on a variety of parameters like the fluctuation level ? B/B0, the ratio between the particle Larmor radius and the turbulence correlation lengths, and the turbulence anisotropy. In this presentation, we review the results of numerical simulations of plasma and magnetic field line transport in the case of anisotropic magnetic turbulence, for parameter values close to those of the solar wind. We assume a uniform background magnetic field B0 = B0ez and a Fourier representation for magnetic fluctuations, with wavectors forming any angle with respect to B0. The energy density spectrum is a power law, and in k space the constant amplitude surfaces are ellipsoids, described by the correlation lengths lx, ly, lz, which quantify the anisotropy of turbulence. For magnetic field lines, we find that transport perpendicular to the background field depends on the Kubo number R = ? B B0 lz lx . For small Kubo numbers, R ? 1, we find anomalous, non Gaussian transport regimes (both sub and superdiffusive) which can be described as a Levy random walk. Increasing the Kubo number, i.e., the fluctuation level ? B/B0 and/or the ratio lz/lx, we find first a quasilinear and then a percolative regime, both corresponding to Gaussian diffusion. For particles, we find that transport parallel and perpendicular to the background magnetic field heavily depends on the turbulence anisotropy and on the particle Larmor radius. For turbulence levels typical of the solar wind, ? B/B0 ? 0.5 ?1, when the ratio between the particle Larmor radius and the turbulence correlation lengths is small, anomalous regimes are found in the case lz/lx ? 1, with Levy random walk (superdiffusion) along the magnetic field and subdiffusion in the perpendicular directions. Conversely, for lz/lx > 1 normal, Gaussian diffusion is found. Increasing the ratio between the particle Larmor radius and the turbulence correlation lengths, the parallel superdiffusion is

Formation of spectrum of accelerated particles and the hydromagnetic turbulence in the variable magnetic field

International Nuclear Information System (INIS)

Savane, Y. Sy; Diaby, I.; Faza Barry, M.; Lomonossov, V.

2002-11-01

We study the acceleration of charged particles by the variable magnetic field. The study is based on the determination of spectrum of accelerated particles and the spectrum of hydro magnetic turbulence. We plan the self-consistent system of equation and we also find out the solution of the system for the spectrum of particles and hydro magnetic turbulence with the conditions of effective acceleration in the cosmic space of solar system. (author)

Cosmic-Ray Propagation in Turbulent Spiral Magnetic Fields Associated with Young Stellar Objects

Science.gov (United States)

Fatuzzo, Marco; Adams, Fred C.

2018-04-01

External cosmic rays impinging upon circumstellar disks associated with young stellar objects provide an important source of ionization, and, as such, play an important role in disk evolution and planet formation. However, these incoming cosmic rays are affected by a variety of physical processes internal to stellar/disk systems, including modulation by turbulent magnetic fields. Globally, these fields naturally provide both a funneling effect, where cosmic rays from larger volumes are focused into the disk region, and a magnetic mirroring effect, where cosmic rays are repelled due to the increasing field strength. This paper considers cosmic-ray propagation in the presence of a turbulent spiral magnetic field, analogous to that produced by the solar wind. The interaction of this wind with the interstellar medium defines a transition radius, analogous to the heliopause, which provides the outer boundary to this problem. We construct a new coordinate system where one coordinate follows the spiral magnetic field lines and consider magnetic perturbations to the field in the perpendicular directions. The presence of magnetic turbulence replaces the mirroring points with a distribution of values and moves the mean location outward. Our results thus help quantify the degree to which cosmic-ray fluxes are reduced in circumstellar disks by the presence of magnetic field structures that are shaped by stellar winds. The new coordinate system constructed herein should also be useful in other astronomical applications.

Band structures and localization properties of aperiodic layered phononic crystals

Energy Technology Data Exchange (ETDEWEB)

Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

2012-03-15

The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

International Nuclear Information System (INIS)

Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

2013-01-01

We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

Effects of anisotropies in turbulent magnetic diffusion in mean-field solar dynamo models

Energy Technology Data Exchange (ETDEWEB)

Pipin, V. V. [Institute of Solar-Terrestrial Physics, Russian Academy of Sciences, Irkutsk 664033 (Russian Federation); Kosovichev, A. G. [Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305 (United States)

2014-04-10

We study how anisotropies of turbulent diffusion affect the evolution of large-scale magnetic fields and the dynamo process on the Sun. The effect of anisotropy is calculated in a mean-field magnetohydrodynamics framework assuming that triple correlations provide relaxation to the turbulent electromotive force (so-called the 'minimal τ-approximation'). We examine two types of mean-field dynamo models: the well-known benchmark flux-transport model and a distributed-dynamo model with a subsurface rotational shear layer. For both models, we investigate effects of the double- and triple-cell meridional circulation, recently suggested by helioseismology and numerical simulations. To characterize the anisotropy effects, we introduce a parameter of anisotropy as a ratio of the radial and horizontal intensities of turbulent mixing. It is found that the anisotropy affects the distribution of magnetic fields inside the convection zone. The concentration of the magnetic flux near the bottom and top boundaries of the convection zone is greater when the anisotropy is stronger. It is shown that the critical dynamo number and the dynamo period approach to constant values for large values of the anisotropy parameter. The anisotropy reduces the overlap of toroidal magnetic fields generated in subsequent dynamo cycles, in the time-latitude 'butterfly' diagram. If we assume that sunspots are formed in the vicinity of the subsurface shear layer, then the distributed dynamo model with the anisotropic diffusivity satisfies the observational constraints from helioseismology and is consistent with the value of effective turbulent diffusion estimated from the dynamics of surface magnetic fields.

The nonlinear coupling between gyroradius scale turbulence and mesoscale magnetic islands in fusion plasmas

International Nuclear Information System (INIS)

Hornsby, W. A.; Peeters, A. G.; Snodin, A. P.; Casson, F. J.; Camenen, Y.; Szepesi, G.; Siccinio, M.; Poli, E.

2010-01-01

The interaction between small scale turbulence (of the order of the ion Larmor radius) and mesoscale magnetic islands is investigated within the gyrokinetic framework. Turbulence, driven by background temperature and density gradients, over nonlinear mode coupling, pumps energy into long wavelength modes, and can result in an electrostatic vortex mode that coincides with the magnetic island. The strength of the vortex is strongly enhanced by the modified plasma flow response connected with the change in topology, and the transport it generates can compete with the parallel motion along the perturbed magnetic field. Despite the stabilizing effect of sheared plasma flows in and around the island, the net effect of the island is a degradation of the confinement. When density and temperature gradients inside the island are below the threshold for turbulence generation, turbulent fluctuations still persist through turbulence convection and spreading. The latter mechanisms then generate a finite transport flux and, consequently, a finite pressure gradient in the island. A finite radial temperature gradient inside the island is also shown to persist due to the trapped particles, which do not move along the field around the island. In the low collisionality regime, the finite gradient in the trapped population leads to the generation of a bootstrap current, which reduces the neoclassical drive.

Numerical simulation of turbulent Taylor-Couette flow between conducting cylinders in an axial magnetic field at low magnetic Reynolds number

Science.gov (United States)

Leng, Xueyuan; Kolesnikov, Yurii B.; Krasnov, Dmitry; Li, Benwen

2018-01-01

The effect of an axial homogeneous magnetic field on the turbulence in the Taylor-Couette flow confined between two infinitely long conducting cylinders is studied by the direct numerical simulation using a periodic boundary condition in the axial direction. The inner cylinder is rotating, and the outer one is fixed. We consider the case when the magnetic Reynolds number Rem ≪ 1, i.e., the influence of the induced magnetic field on the flow is negligible that is typical for industry and laboratory study of liquid metals. Relevance of the present study is based on the similarity of flow characteristics at moderate and high magnetic field for the cases with periodic and end-wall conditions at the large flow aspect ratio, as proven in the earlier studies. Two sets of Reynolds numbers 4000 and 8000 with several Hartmann numbers varying from 0 to 120 are employed. The results show that the mean radial induced electrical current, resulting from the interaction of axial magnetic field with the mean flow, leads to the transformation of the mean flow and the modification of the turbulent structure. The effect of turbulence suppression is dominating at a strong magnetic field, but before reaching the complete laminarization, we capture the appearance of the hairpin-like structures in the flow.

Large-scale vortices in compressible turbulent medium with the magnetic field

Science.gov (United States)

Gvaramadze, V. V.; Dimitrov, B. G.

1990-08-01

An averaged equation which describes the large scale vortices and Alfven waves generation in a compressible helical turbulent medium with a constant magnetic field is presented. The presence of the magnetic field leads to anisotropization of the vortex generation. Possible applications of the anisotropic vortex dynamo effect are accretion disks of compact objects.

Impact of magnetic shear modification on confinement and turbulent fluctuations in LHD plasmas

International Nuclear Information System (INIS)

Fukuda, T.; Tamura, N.; Ida, K.

2008-10-01

For the comprehensive understandings of transport phenomena in toroidal confinement systems and improvement of the predictive capability of burning plasmas in ITER, the impact of magnetic shear has been extensively investigated in the Large Helical Device (LHD) for comparison with tokamaks. Consequently, it was heuristically documented that the pronounced effect of magnetic shear, which has been hitherto considered to be ubiquitous and strongly impacts the core transport in the tokamak experiments, is not quite obvious. Namely, the kinetic profiles respond little under extensive modification of the magnetic shear in the core, although the local transport analysis indicates the sign of improvement in confinement transiently when the magnetic shear is reduced. It was thereby concluded that the magnetic shear in the core strongly influences the MHD activity, but it may only be one of the necessary conditions for the transport reduction, and some other crucial knobs, such as the density gradient or T e /T i ratio, would have to be simultaneously controlled. The low wavenumber turbulence seems to be suppressed under the weak shear, and the turbulent fluctuation intensity behaves in a consistent manner as a whole, following the conventional paradigm accumulated in the negative shear experiments in tokamaks. However, vigorous dynamics of turbulent fluctuations have occasionally been observed under the magnetic shear modification, which respond in much faster time scale than the characteristic time scale for either the magnetic diffusion or the profile evolution. (author)

FAST MAGNETIC FIELD AMPLIFICATION IN THE EARLY UNIVERSE: GROWTH OF COLLISIONLESS PLASMA INSTABILITIES IN TURBULENT MEDIA

Energy Technology Data Exchange (ETDEWEB)

Falceta-Gonçalves, D. [SUPA, School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews, Fife KY16 9SS (United Kingdom); Kowal, G. [Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, Rua Arlindo Bettio, 1000, São Paulo, SP 03828-000 (Brazil)

2015-07-20

In this work we report on a numerical study of the cosmic magnetic field amplification due to collisionless plasma instabilities. The collisionless magnetohydrodynamic equations derived account for the pressure anisotropy that leads, in specific conditions, to the firehose and mirror instabilities. We study the time evolution of seed fields in turbulence under the influence of such instabilities. An approximate analytical time evolution of the magnetic field is provided. The numerical simulations and the analytical predictions are compared. We found that (i) amplification of the magnetic field was efficient in firehose-unstable turbulent regimes, but not in the mirror-unstable models; (ii) the growth rate of the magnetic energy density is much faster than the turbulent dynamo; and (iii) the efficient amplification occurs at small scales. The analytical prediction for the correlation between the growth timescales and pressure anisotropy is confirmed by the numerical simulations. These results reinforce the idea that pressure anisotropies—driven naturally in a turbulent collisionless medium, e.g., the intergalactic medium, could efficiently amplify the magnetic field in the early universe (post-recombination era), previous to the collapse of the first large-scale gravitational structures. This mechanism, though fast for the small-scale fields (∼kpc scales), is unable to provide relatively strong magnetic fields at large scales. Other mechanisms that were not accounted for here (e.g., collisional turbulence once instabilities are quenched, velocity shear, or gravitationally induced inflows of gas into galaxies and clusters) could operate afterward to build up large-scale coherent field structures in the long time evolution.

Non-Gaussianity and cross-scale coupling in interplanetary magnetic field turbulence during a rope-rope magnetic reconnection event

Science.gov (United States)

Miranda, Rodrigo A.; Schelin, Adriane B.; Chian, Abraham C.-L.; Ferreira, José L.

2018-03-01

In a recent paper (Chian et al., 2016) it was shown that magnetic reconnection at the interface region between two magnetic flux ropes is responsible for the genesis of interplanetary intermittent turbulence. The normalized third-order moment (skewness) and the normalized fourth-order moment (kurtosis) display a quadratic relation with a parabolic shape that is commonly observed in observational data from turbulence in fluids and plasmas, and is linked to non-Gaussian fluctuations due to coherent structures. In this paper we perform a detailed study of the relation between the skewness and the kurtosis of the modulus of the magnetic field |B| during a triple interplanetary magnetic flux rope event. In addition, we investigate the skewness-kurtosis relation of two-point differences of |B| for the same event. The parabolic relation displays scale dependence and is found to be enhanced during magnetic reconnection, rendering support for the generation of non-Gaussian coherent structures via rope-rope magnetic reconnection. Our results also indicate that a direct coupling between the scales of magnetic flux ropes and the scales within the inertial subrange occurs in the solar wind.

Aperiodicity Correction for Rotor Tip Vortex Measurements

Science.gov (United States)

Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

2011-01-01

The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

Energy partition, scale by scale, in magnetic Archimedes Coriolis weak wave turbulence.

Science.gov (United States)

Salhi, A; Baklouti, F S; Godeferd, F; Lehner, T; Cambon, C

2017-02-01

Magnetic Archimedes Coriolis (MAC) waves are omnipresent in several geophysical and astrophysical flows such as the solar tachocline. In the present study, we use linear spectral theory (LST) and investigate the energy partition, scale by scale, in MAC weak wave turbulence for a Boussinesq fluid. At the scale k^{-1}, the maximal frequencies of magnetic (Alfvén) waves, gravity (Archimedes) waves, and inertial (Coriolis) waves are, respectively, V_{A}k,N, and f. By using the induction potential scalar, which is a Lagrangian invariant for a diffusionless Boussinesq fluid [Salhi et al., Phys. Rev. E 85, 026301 (2012)PLEEE81539-375510.1103/PhysRevE.85.026301], we derive a dispersion relation for the three-dimensional MAC waves, generalizing previous ones including that of f-plane MHD "shallow water" waves [Schecter et al., Astrophys. J. 551, L185 (2001)AJLEEY0004-637X10.1086/320027]. A solution for the Fourier amplitude of perturbation fields (velocity, magnetic field, and density) is derived analytically considering a diffusive fluid for which both the magnetic and thermal Prandtl numbers are one. The radial spectrum of kinetic, S_{κ}(k,t), magnetic, S_{m}(k,t), and potential, S_{p}(k,t), energies is determined considering initial isotropic conditions. For magnetic Coriolis (MC) weak wave turbulence, it is shown that, at large scales such that V_{A}k/f≪1, the Alfvén ratio S_{κ}(k,t)/S_{m}(k,t) behaves like k^{-2} if the rotation axis is aligned with the magnetic field, in agreement with previous direct numerical simulations [Favier et al., Geophys. Astrophys. Fluid Dyn. (2012)] and like k^{-1} if the rotation axis is perpendicular to the magnetic field. At small scales, such that V_{A}k/f≫1, there is an equipartition of energy between magnetic and kinetic components. For magnetic Archimedes weak wave turbulence, it is demonstrated that, at large scales, such that (V_{A}k/N≪1), there is an equipartition of energy between magnetic and potential components

Electrostatic instabilities and turbulence in a toroidal magnetized plasma

International Nuclear Information System (INIS)

Poli, F. M.

2007-06-01

This Thesis aims at characterizing the linear properties of electrostatic drift instabilities arising in a toroidal plasma and the mechanisms leading to their development into turbulence. The experiments are performed on the TORoidal Plasma EXperiment (TORPEX) at CRPP-EPFL, Lausanne. The first part of the Thesis focuses on the identification of the nature of the instabilities observed in TORPEX, using a set of electrostatic probes, designed and built for this purpose. The global features of fluctuations, analyzed for different values of control parameters such as the magnetic field, the neutral gas pressure and the injected microwave power, are qualitatively similar in different experimental scenarios. The maximum of fluctuations is observed on the low field side, where the pressure gradient and the gradient of the magnetic field are co-linear, indicating that the curvature of the magnetic field lines has an important role in the destabilization of the waves. The power spectrum is dominated by electrostatic fluctuations with frequencies much lower than the ion cyclotron frequency. Taking advantage of the extended diagnostics coverage, the spectral properties of fluctuations are measured over the whole poloidal cross-section. Both drift and interchange instabilities develop and propagate on TORPEX, with the stability of both being affected by the curvature of the magnetic field. It is shown that modes of different nature are driven at separate locations over the plasma cross-section and that the wavenumber and frequency spectra, narrow at the location where the instabilities are generated, broaden during convection, suggesting an increase in the degree of turbulence. The transition from coherent to turbulent spectral features and the role of nonlinear coupling between modes in the development of turbulence are treated in the second part of this work. It is found that nonlinear mode-mode coupling is responsible for the redistribution of spectral energy from the

Internal magnetic turbulence measurement in plasma by cross polarization scattering

Energy Technology Data Exchange (ETDEWEB)

Zou, X L; Colas, L; Paume, M; Chareau, J M; Laurent, L; Devynck, P; Gresillon, D

1994-09-01

For the first time, the internal magnetic turbulence is measured by a new cross polarization scattering diagnostic in Tore Supra tokamak. The principle of this experiment is presented. It is based on the polarization change or mode conversion of the e.m. wave scattering by magnetic fluctuations. The role of different physical processes on the signal formation are investigated. From the Observation, a rough estimate for the relative magnetic fluctuations of about 10{sup -4} is obtained. A strong correlation of the measured signal with additional heating is observed. (author). 14 refs., 4 figs.

Instabilities, turbulence and transport in a magnetized plasma

International Nuclear Information System (INIS)

Garbet, X.

2001-06-01

The purpose of this work is to introduce the main processes that occur in a magnetized plasma. During the last 2 decades, the understanding of turbulence has made great progress but analytical formulas and simulations are far to produce reliable predictions. The values of transport coefficients in a tokamak plasma exceed by far those predicted by the theory of collisional transport. This phenomenon is called abnormal transport and might be due to plasma fluctuations. An estimation of turbulent fluxes derived from the levels of fluctuations, is proposed. A flow description of plasma allows the understanding of most micro-instabilities. The ballooning representation deals with instabilities in a toric geometry. 3 factors play an important role to stabilize plasmas: density pinch, magnetic shear and speed shear. The flow model of plasma gives an erroneous value for the stability threshold, this is due to a bad description of the resonant interaction between wave and particle. As for dynamics, flow models can be improved by adding dissipative terms so that the linear response nears the kinetic response. The kinetic approach is more accurate but is complex because of the great number of dimensions involved. (A.C.)

Instabilities responsible for magnetic turbulence in laboratory rotating plasma

International Nuclear Information System (INIS)

Mikhailovskii, A.B.; Lominadze, J.G.; Churikov, A.P.; Erokhin, N.N.; Pustovitov, V.D.; Konovalov, S.V.

2008-01-01

Instabilities responsible for magnetic turbulence in laboratory rotating plasma are investigated. It is shown that the plasma compressibility gives a new driving mechanism in addition to the known Velikhov effect due to the negative rotation frequency gradient. This new mechanism is related to the perpendicular plasma pressure gradient, while the density gradient gives an additional drive depending also on the pressure gradient. It is shown that these new effects can manifest themselves even in the absence of the equilibrium magnetic field, which corresponds to nonmagnetic instabilities

Turbulent Dynamo Amplification of Magnetic Fields in Laser-Produced Plasmas: Simulations and Experiments

Science.gov (United States)

Tzeferacos, P.; Rigby, A.; Bott, A.; Bell, A.; Bingham, R.; Casner, A.; Cattaneo, F.; Churazov, E.; Forest, C.; Katz, J.; Koenig, M.; Li, C.-K.; Meinecke, J.; Petrasso, R.; Park, H.-S.; Remington, B.; Ross, J.; Ryutov, D.; Ryu, D.; Reville, B.; Miniati, F.; Schekochihin, A.; Froula, D.; Lamb, D.; Gregori, G.

2017-10-01

The universe is permeated by magnetic fields, with strengths ranging from a femtogauss in the voids between the filaments of galaxy clusters to several teragauss in black holes and neutron stars. The standard model for cosmological magnetic fields is the nonlinear amplification of seed fields via turbulent dynamo. We have conceived experiments to demonstrate and study the turbulent dynamo mechanism in the laboratory. Here, we describe the design of these experiments through large-scale 3D FLASH simulations on the Mira supercomputer at ANL, and the laser-driven experiments we conducted with the OMEGA laser at LLE. Our results indicate that turbulence is capable of rapidly amplifying seed fields to near equipartition with the turbulent fluid motions. This work was supported in part from the ERC (FP7/2007-2013, No. 256973 and 247039), and the U.S. DOE, Contract No. B591485 to LLNL, FWP 57789 to ANL, Grant No. DE-NA0002724 and DE-SC0016566 to the University of Chicago, and DE-AC02-06CH11357 to ANL.

Anomalous growth and dissipation of the magnetic field in a turbulent flow with stretches

Energy Technology Data Exchange (ETDEWEB)

Gvaramadze, V V; Lominadze, J G; Ruzmaikin, A A; Sokolov, D D

1987-04-01

The magnetic field evolution in helical turbulence with stretches is investigated. It is shown that heavy concentrations of the magnetic field appear under definite conditions. The results are consistent with numerical experiments.

Anomalous growth and dissipation of the magnetic field in a turbulent flow with stretches

International Nuclear Information System (INIS)

Gvaramadze, V.V.; Lominadze, J.G.; Ruzmaikin, A.A.; Sokolov, D.D.

1987-01-01

The magnetic field evolution in helical turbulence with stretches is investigated. It is shown that heavy concentrations of the magnetic field appear under definite conditions. The results are consistent with numerical experiments

Energy Transfer and Dual Cascade in Kinetic Magnetized Plasma Turbulence

International Nuclear Information System (INIS)

Plunk, G. G.; Tatsuno, T.

2011-01-01

The question of how nonlinear interactions redistribute the energy of fluctuations across available degrees of freedom is of fundamental importance in the study of turbulence and transport in magnetized weakly collisional plasmas, ranging from space settings to fusion devices. In this Letter, we present a theory for the dual cascade found in such plasmas, which predicts a range of new behavior that distinguishes this cascade from that of neutral fluid turbulence. These phenomena are explained in terms of the constrained nature of spectral transfer in nonlinear gyrokinetics. Accompanying this theory are the first observations of these phenomena, obtained via direct numerical simulations using the gyrokinetic code AstroGK. The basic mechanisms that are found provide a framework for understanding the turbulent energy transfer that couples scales both locally and nonlocally.

Energy Transfer and Dual Cascade in Kinetic Magnetized Plasma Turbulence

Science.gov (United States)

Plunk, G. G.; Tatsuno, T.

2011-04-01

The question of how nonlinear interactions redistribute the energy of fluctuations across available degrees of freedom is of fundamental importance in the study of turbulence and transport in magnetized weakly collisional plasmas, ranging from space settings to fusion devices. In this Letter, we present a theory for the dual cascade found in such plasmas, which predicts a range of new behavior that distinguishes this cascade from that of neutral fluid turbulence. These phenomena are explained in terms of the constrained nature of spectral transfer in nonlinear gyrokinetics. Accompanying this theory are the first observations of these phenomena, obtained via direct numerical simulations using the gyrokinetic code AstroGK. The basic mechanisms that are found provide a framework for understanding the turbulent energy transfer that couples scales both locally and nonlocally.

Anisotropic Behaviour of Magnetic Power Spectra in Solar Wind Turbulence.

Science.gov (United States)

Banerjee, S.; Saur, J.; Gerick, F.; von Papen, M.

2017-12-01

Introduction:High altitude fast solar wind turbulence (SWT) shows different spectral properties as a function of the angle between the flow direction and the scale dependent mean magnetic field (Horbury et al., PRL, 2008). The average magnetic power contained in the near perpendicular direction (80º-90º) was found to be approximately 5 times larger than the average power in the parallel direction (0º- 10º). In addition, the parallel power spectra was found to give a steeper (-2) power law than the perpendicular power spectral density (PSD) which followed a near Kolmogorov slope (-5/3). Similar anisotropic behaviour has also been observed (Chen et al., MNRAS, 2011) for slow solar wind (SSW), but using a different method exploiting multi-spacecraft data of Cluster. Purpose:In the current study, using Ulysses data, we investigate (i) the anisotropic behaviour of near ecliptic slow solar wind using the same methodology (described below) as that of Horbury et al. (2008) and (ii) the dependence of the anisotropic behaviour of SWT as a function of the heliospheric latitude.Method:We apply the wavelet method to calculate the turbulent power spectra of the magnetic field fluctuations parallel and perpendicular to the local mean magnetic field (LMF). According to Horbury et al., LMF for a given scale (or size) is obtained using an envelope of the envelope of that size. Results:(i) SSW intervals always show near -5/3 perpendicular spectra. Unlike the fast solar wind (FSW) intervals, for SSW, we often find intervals where power parallel to the mean field is not observed. For a few intervals with sufficient power in parallel direction, slow wind turbulence also exhibit -2 parallel spectra similar to FSW.(ii) The behaviours of parallel and perpendicular power spectra are found to be independent of the heliospheric latitude. Conclusion:In the current study we do not find significant influence of the heliospheric latitude on the spectral slopes of parallel and perpendicular

Interaction of supra-thermal ions with turbulence in a magnetized toroidal plasma

International Nuclear Information System (INIS)

Plyushchev, G.

2009-01-01

This thesis addresses the interaction of a supra-thermal ion beam with turbulence in the simple magnetized toroidal plasma of TORPEX. The first part of the Thesis deals with the ohmic assisted discharges on TORPEX. The aim of these discharges is the investigation of the open to closed magnetic field line transition. The relevant magnetic diagnostics were developed. Ohmic assisted discharges with a maximum plasma current up to 1 kA are routinely obtained. The equilibrium conditions on the vacuum magnetic field configuration were investigated. In the second part of the Thesis, the design of the fast ion source and detector are discussed. The accelerating electric field needed for the fast ion source was optimized. The fast ion source was constructed and commissioned. To detect the fast ions a specially designed gridded energy analyzer was used. The electron energy distribution function was obtained to demonstrate the efficiency of the detector. The experiments with the fast ion beam were conducted in different plasma regions of TORPEX. In the third part of the Thesis, numerical simulations are used to interpret the measured fast ion beam behavior. It is shown that a simple single particle equation of motion explains the beam behavior in the experiments in the absence of plasma. To explain the fast ion beam experiments with the plasma a turbulent electric field must be used. The model that takes into account this turbulent electrical field qualitatively explains the shape of the fast ion current density profile in the different plasma regions of TORPEX. The vertically elongated fast ion current density profiles are explained by a spread in the fast ion velocity distribution. The theoretically predicted radial fast ion beam spreading due to the turbulent electric field was observed in the experiment. (author)

Relationship between velocity gradients and magnetic turbulence in the solar wind

International Nuclear Information System (INIS)

Garrett, H.B.

1974-01-01

The correlations among the time derivative of the solar-wind velocity, the magnitude of the interplanetary magnetic field (IMF), and the IMF turbulence level are examined to test the idea that interaction between two colliding solar-wind streams can generate turbulence in the solar wind and the IMF. Data obtained by Explorer 33 on the solar wind and IMF are described, and the analysis techniques are outlined. The results indicate that the IMF turbulence level, as measured by the variance, is correlated with the existence of positive velocity gradients in the solar wind. It is noted that while the variance is an increasing function of the field magnitude, it is also independently correlated with the solar-wind velocity gradient

Saturation of the turbulent dynamo.

Science.gov (United States)

Schober, J; Schleicher, D R G; Federrath, C; Bovino, S; Klessen, R S

2015-08-01

The origin of strong magnetic fields in the Universe can be explained by amplifying weak seed fields via turbulent motions on small spatial scales and subsequently transporting the magnetic energy to larger scales. This process is known as the turbulent dynamo and depends on the properties of turbulence, i.e., on the hydrodynamical Reynolds number and the compressibility of the gas, and on the magnetic diffusivity. While we know the growth rate of the magnetic energy in the linear regime, the saturation level, i.e., the ratio of magnetic energy to turbulent kinetic energy that can be reached, is not known from analytical calculations. In this paper we present a scale-dependent saturation model based on an effective turbulent resistivity which is determined by the turnover time scale of turbulent eddies and the magnetic energy density. The magnetic resistivity increases compared to the Spitzer value and the effective scale on which the magnetic energy spectrum is at its maximum moves to larger spatial scales. This process ends when the peak reaches a characteristic wave number k☆ which is determined by the critical magnetic Reynolds number. The saturation level of the dynamo also depends on the type of turbulence and differs for the limits of large and small magnetic Prandtl numbers Pm. With our model we find saturation levels between 43.8% and 1.3% for Pm≫1 and between 2.43% and 0.135% for Pm≪1, where the higher values refer to incompressible turbulence and the lower ones to highly compressible turbulence.

Anomalous diffusion and Levy random walk of magnetic field lines in three dimensional turbulence

International Nuclear Information System (INIS)

Zimbardo, G.; Veltri, P.; Basile, G.; Principato, S.

1995-01-01

The transport of magnetic field lines is studied numerically where three dimensional (3-D) magnetic fluctuations, with a power law spectrum, and periodic over the simulation box are superimposed on an average uniform magnetic field. The weak and the strong turbulence regime, δB∼B 0 , are investigated. In the weak turbulence case, magnetic flux tubes are separated from each other by percolating layers in which field lines undergo a chaotic motion. In this regime the field lines may exhibit Levy, rather than Gaussian, random walk, changing from Levy flights to trapped motion. The anomalous diffusion laws left-angle Δx 2 i right-angle ∝s α with α>1 and α<1, are obtained for a number of cases, and the non-Gaussian character of the field line random walk is pointed out by computing the kurtosis. Increasing the fluctuation level, and, therefore stochasticity, normal diffusion (α congruent 1) is recovered and the kurtoses reach their Gaussian value. However, the numerical results show that neither the quasi-linear theory nor the two dimensional percolation theory can be safely extrapolated to the considered 3-D strong turbulence regime. copyright 1995 American Institute of Physics

Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

Energy Technology Data Exchange (ETDEWEB)

Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

2017-10-01

For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

Helicity--vorticity turbulent pumping of magnetic fields in the solar dynamo

OpenAIRE

Pipin, V. V.

2012-01-01

The interaction of helical convective motions and differential rotation in the solar convection zone results in turbulent drift of a large-scale magnetic field. We discuss the pumping mechanism and its impact on the solar dynamo.

Plasma turbulence calculations on supercomputers

International Nuclear Information System (INIS)

Carreras, B.A.; Charlton, L.A.; Dominguez, N.; Drake, J.B.; Garcia, L.; Leboeuf, J.N.; Lee, D.K.; Lynch, V.E.; Sidikman, K.

1991-01-01

Although the single-particle picture of magnetic confinement is helpful in understanding some basic physics of plasma confinement, it does not give a full description. Collective effects dominate plasma behavior. Any analysis of plasma confinement requires a self-consistent treatment of the particles and fields. The general picture is further complicated because the plasma, in general, is turbulent. The study of fluid turbulence is a rather complex field by itself. In addition to the difficulties of classical fluid turbulence, plasma turbulence studies face the problems caused by the induced magnetic turbulence, which couples field by itself. In addition to the difficulties of classical fluid turbulence, plasma turbulence studies face the problems caused by the induced magnetic turbulence, which couples back to the fluid. Since the fluid is not a perfect conductor, this turbulence can lead to changes in the topology of the magnetic field structure, causing the magnetic field lines to wander radially. Because the plasma fluid flows along field lines, they carry the particles with them, and this enhances the losses caused by collisions. The changes in topology are critical for the plasma confinement. The study of plasma turbulence and the concomitant transport is a challenging problem. Because of the importance of solving the plasma turbulence problem for controlled thermonuclear research, the high complexity of the problem, and the necessity of attacking the problem with supercomputers, the study of plasma turbulence in magnetic confinement devices is a Grand Challenge problem

Stochastic field-line wandering in magnetic turbulence with shear. I. Quasi-linear theory

Energy Technology Data Exchange (ETDEWEB)

Shalchi, A. [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); Negrea, M.; Petrisor, I. [Department of Physics, University of Craiova, Association Euratom-MEdC, 13A.I.Cuza Str, 200585 Craiova (Romania)

2016-07-15

We investigate the random walk of magnetic field lines in magnetic turbulence with shear. In the first part of the series, we develop a quasi-linear theory in order to compute the diffusion coefficient of magnetic field lines. We derive general formulas for the diffusion coefficients in the different directions of space. We like to emphasize that we expect that quasi-linear theory is only valid if the so-called Kubo number is small. We consider two turbulence models as examples, namely, a noisy slab model as well as a Gaussian decorrelation model. For both models we compute the field line diffusion coefficients and we show how they depend on the aforementioned Kubo number as well as a shear parameter. It is demonstrated that the shear effect reduces all field line diffusion coefficients.

Stochastic field-line wandering in magnetic turbulence with shear. I. Quasi-linear theory

International Nuclear Information System (INIS)

Shalchi, A.; Negrea, M.; Petrisor, I.

2016-01-01

We investigate the random walk of magnetic field lines in magnetic turbulence with shear. In the first part of the series, we develop a quasi-linear theory in order to compute the diffusion coefficient of magnetic field lines. We derive general formulas for the diffusion coefficients in the different directions of space. We like to emphasize that we expect that quasi-linear theory is only valid if the so-called Kubo number is small. We consider two turbulence models as examples, namely, a noisy slab model as well as a Gaussian decorrelation model. For both models we compute the field line diffusion coefficients and we show how they depend on the aforementioned Kubo number as well as a shear parameter. It is demonstrated that the shear effect reduces all field line diffusion coefficients.

Blazar Variability from Turbulence in Jets Launched by Magnetically Arrested Accretion Flows

International Nuclear Information System (INIS)

Riordan, Michael O’; Pe’er, Asaf; McKinney, Jonathan C.

2017-01-01

Blazars show variability on timescales ranging from minutes to years, the former being comparable to and in some cases even shorter than the light-crossing time of the central black hole. The observed γ -ray light curves can be described by a power-law power density spectrum (PDS), with a similar index for both BL Lacs and flat-spectrum radio quasars. We show that this variability can be produced by turbulence in relativistic jets launched by magnetically arrested accretion flows (MADs). We perform radiative transport calculations on the turbulent, highly magnetized jet launching region of a MAD with a rapidly rotating supermassive black hole. The resulting synchrotron and synchrotron self-Compton emission, originating from close to the black hole horizon, is highly variable. This variability is characterized by PDS, which is remarkably similar to the observed power-law spectrum at frequencies less than a few per day. Furthermore, turbulence in the jet launching region naturally produces fluctuations in the plasma on scales much smaller than the horizon radius. We speculate that similar turbulent processes, operating in the jet at large radii (and therefore a high bulk Lorentz factor), are responsible for blazar variability over many decades in frequency, including on minute timescales.

Blazar Variability from Turbulence in Jets Launched by Magnetically Arrested Accretion Flows

Energy Technology Data Exchange (ETDEWEB)

Riordan, Michael O’; Pe’er, Asaf [Physics Department, University College Cork, Cork (Ireland); McKinney, Jonathan C., E-mail: michael_oriordan@umail.ucc.ie [Department of Physics and Joint Space-Science Institute, University of Maryland, College Park, MD 20742 (United States)

2017-07-10

Blazars show variability on timescales ranging from minutes to years, the former being comparable to and in some cases even shorter than the light-crossing time of the central black hole. The observed γ -ray light curves can be described by a power-law power density spectrum (PDS), with a similar index for both BL Lacs and flat-spectrum radio quasars. We show that this variability can be produced by turbulence in relativistic jets launched by magnetically arrested accretion flows (MADs). We perform radiative transport calculations on the turbulent, highly magnetized jet launching region of a MAD with a rapidly rotating supermassive black hole. The resulting synchrotron and synchrotron self-Compton emission, originating from close to the black hole horizon, is highly variable. This variability is characterized by PDS, which is remarkably similar to the observed power-law spectrum at frequencies less than a few per day. Furthermore, turbulence in the jet launching region naturally produces fluctuations in the plasma on scales much smaller than the horizon radius. We speculate that similar turbulent processes, operating in the jet at large radii (and therefore a high bulk Lorentz factor), are responsible for blazar variability over many decades in frequency, including on minute timescales.

Nonlinear Simulations of Trapped Electron Mode Turbulence in Low Magnetic Shear Stellarators

Science.gov (United States)

Faber, B. J.; Pueschel, M. J.; Terry, P. W.; Hegna, C. C.

2017-10-01

Optimized stellarators, like the Helically Symmetric eXperiment (HSX), often operate with small global magnetic shear to avoid low-order rational surfaces and magnetic islands. Nonlinear, flux-tube gyrokinetic simulations of density-gradient-driven Trapped Electron Mode (TEM) turbulence in HSX shows two distinct spectral fluctuation regions: long-wavelength slab-like TEMs localized by global magnetic shear that extend along field lines and short-wavelength TEMs localized by local magnetic shear to a single helical bad curvature region. The slab-like TEMs require computational domains significantly larger than one poloidal turn and are computationally expensive, making turbulent optimization studies challenging. A computationally more efficient, zero-average-magnetic-shear approximation is shown to sufficiently describe the relevant nonlinear physics and replicate finite-shear computations, and can be exploited in quasilinear models based on linear gyrokinetics as a feasible optimization tool. TEM quasilinear heat fluxes are computed with the zero-shear approximation and compared to experimentally-relevant nonlinear gyrokinetic TEM heat fluxes for HSX. Research supported by U.S. DoE Grants DE-FG02-99ER54546, DE-FG02-93ER54222 and DE-FG02-89ER53291.

Transport of solar electrons in the turbulent interplanetary magnetic field

Energy Technology Data Exchange (ETDEWEB)

Ablaßmayer, J.; Tautz, R. C., E-mail: robert.c.tautz@gmail.com [Zentrum für Astronomie und Astrophysik, Technische Universität Berlin, Hardenbergstraße 36, D-10623 Berlin (Germany); Dresing, N., E-mail: dresing@physik.uni-kiel.de [Institut für Experimentelle und Angewandte Physik, Christian-Albrechts-Universität zu Kiel, Leibnizstraße 11, D-24118 Kiel (Germany)

2016-01-15

The turbulent transport of solar energetic electrons in the interplanetary magnetic field is investigated by means of a test-particle Monte-Carlo simulation. The magnetic fields are modeled as a combination of the Parker field and a turbulent component. In combination with the direct calculation of diffusion coefficients via the mean-square displacements, this approach allows one to analyze the effect of the initial ballistic transport phase. In that sense, the model complements the main other approach in which a transport equation is solved. The major advancement is that, by recording the flux of particles arriving at virtual detectors, intensity and anisotropy-time profiles can be obtained. Observational indications for a longitudinal asymmetry can thus be explained by tracing the diffusive spread of the particle distribution. The approach may be of future help for the systematic interpretation of observations for instance by the solar terrestrial relations observatory (STEREO) and advanced composition explorer (ACE) spacecrafts.

The role of the sheath in magnetized plasma turbulence and flows

International Nuclear Information System (INIS)

Loizu, J.

2013-01-01

Controlled nuclear fusion could provide our society with a clean, safe, and virtually inexhaustible source of electric power production. The tokamak has proven to be capable of producing large amounts of fusion reactions by conning magnetically the fusion fuel at sufficiently high density and temperature, thus in the plasma state. Because of turbulence, however, high temperature plasma reaches the outermost region of the tokamak, the Scrape-Off Layer (SOL), which features open magnetic field lines that channel particles and heat into a dedicated region of the vacuum vessel. The plasma dynamics in the SOL is crucial in determining the performance of tokamak devices, and constitutes one of the greatest uncertainties in the success of the fusion program. In the last few years, the development of numerical codes based on reduced fluid models has provided a tool to study turbulence in open field line configurations. In particular, the GBS (Global Braginskii Solver) code has been developed at CRPP and is used to perform global, three-dimensional, full-n, flux-driven simulations of plasma turbulence in open field lines. Reaching predictive capabilities is an outstanding challenge that involves a proper treatment of the plasma-wall interactions at the end of the field lines, to well describe the particle and energy losses. This involves the study of plasma sheaths, namely the layers forming at the interface between plasmas and solid surfaces, where the drift and quasi neutrality approximations break down. This is an investigation of general interest, as sheaths are present in all laboratory plasmas. This thesis presents progress in the understanding of plasma sheaths and their coupling with the turbulence in the main plasma. A kinetic code is developed to study the magnetized plasma-wall transition region and derive a complete set of analytical boundary conditions that supply the sheath physics to fluid codes. These boundary conditions are implemented in the GBS code and

Turbulent stress measurements with phase-contrast magnetic resonance through tilted slices

Energy Technology Data Exchange (ETDEWEB)

MacKenzie, Jordan; Soederberg, Daniel; Lundell, Fredrik [Linne FLOW Centre, KTH Mechanics, Stockholm (Sweden); Swerin, Agne [SP Technical Research Institute of Sweden-Chemistry, Materials and Surfaces, Stockholm (Sweden); KTH Royal Institute of Technology, Surface and Corrosion Science, Stockholm (Sweden)

2017-05-15

Aiming at turbulent measurements in opaque suspensions, a simplistic methodology for measuring the turbulent stresses with phase-contrast magnetic resonance velocimetry is described. The method relies on flow-compensated and flow-encoding protocols with the flow encoding gradient normal to the slice. The experimental data is compared with direct numerical simulations (DNS), both directly but also, more importantly, after spatial averaging of the DNS data that resembles the measurement and data treatment of the experimental data. The results show that the most important MRI data (streamwise velocity, streamwise variance and Reynolds shear stress) is reliable up to at least anti r = 0.75 without any correction, paving the way for dearly needed turbulence and stress measurements in opaque suspensions. (orig.)

Suppression of AGN-driven Turbulence by Magnetic Fields in a Magnetohydrodynamic Model of the Intracluster Medium

Science.gov (United States)

Bambic, Christopher J.; Morsony, Brian J.; Reynolds, Christopher S.

2018-04-01

We investigate the role of active galactic nucleus (AGN) feedback in turbulent heating of galaxy clusters. Specifically, we analyze the production of turbulence by g-modes generated by the supersonic expansion and buoyant rise of AGN-driven bubbles. Previous work that neglects magnetic fields has shown that this process is inefficient, with less than 1% of the injected energy ending up in turbulence. This inefficiency primarily arises because the bubbles are shredded apart by hydrodynamic instabilities before they can excite sufficiently strong g-modes. Using a plane-parallel model of the intracluster medium (ICM) and 3D ideal magnetohydrodynamics (MHD) simulations, we examine the role of a large-scale magnetic field that is able to drape around these rising bubbles, preserving them from hydrodynamic instabilities. We find that while magnetic draping appears better able to preserve AGN-driven bubbles, the driving of g-modes and the resulting production of turbulence is still inefficient. The magnetic tension force prevents g-modes from transitioning into the nonlinear regime, suppressing turbulence in our model ICM. Our work highlights the ways in which ideal MHD is an insufficient description for the cluster feedback process, and we discuss future work such as the inclusion of anisotropic viscosity as a means of simulating high β plasma kinetic effects. These results suggest the hypothesis that other mechanisms of heating the ICM plasma such as sound waves or cosmic rays may be responsible for the observed feedback in galaxy clusters.

Suppression of turbulent resistivity in turbulent Couette flow

Science.gov (United States)

Si, Jiahe; Colgate, Stirling A.; Sonnenfeld, Richard G.; Nornberg, Mark D.; Li, Hui; Colgate, Arthur S.; Westpfahl, David J.; Romero, Van D.; Martinic, Joe

2015-07-01

Turbulent transport in rapidly rotating shear flow very efficiently transports angular momentum, a critical feature of instabilities responsible both for the dynamics of accretion disks and the turbulent power dissipation in a centrifuge. Turbulent mixing can efficiently transport other quantities like heat and even magnetic flux by enhanced diffusion. This enhancement is particularly evident in homogeneous, isotropic turbulent flows of liquid metals. In the New Mexico dynamo experiment, the effective resistivity is measured using both differential rotation and pulsed magnetic field decay to demonstrate that at very high Reynolds number rotating shear flow can be described entirely by mean flow induction with very little contribution from correlated velocity fluctuations.

Suppression of turbulent resistivity in turbulent Couette flow

Energy Technology Data Exchange (ETDEWEB)

Si, Jiahe, E-mail: jsi@nmt.edu; Sonnenfeld, Richard G.; Colgate, Arthur S.; Westpfahl, David J.; Romero, Van D.; Martinic, Joe [New Mexico Institute of Mining and Technology, Socorro, New Mexico 87801 (United States); Colgate, Stirling A.; Li, Hui [Los Alamos National Laboratory, Los Alamos, New Mexico 87544 (United States); Nornberg, Mark D. [University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States)

2015-07-15

Turbulent transport in rapidly rotating shear flow very efficiently transports angular momentum, a critical feature of instabilities responsible both for the dynamics of accretion disks and the turbulent power dissipation in a centrifuge. Turbulent mixing can efficiently transport other quantities like heat and even magnetic flux by enhanced diffusion. This enhancement is particularly evident in homogeneous, isotropic turbulent flows of liquid metals. In the New Mexico dynamo experiment, the effective resistivity is measured using both differential rotation and pulsed magnetic field decay to demonstrate that at very high Reynolds number rotating shear flow can be described entirely by mean flow induction with very little contribution from correlated velocity fluctuations.

Suppression of turbulent resistivity in turbulent Couette flow

International Nuclear Information System (INIS)

Si, Jiahe; Sonnenfeld, Richard G.; Colgate, Arthur S.; Westpfahl, David J.; Romero, Van D.; Martinic, Joe; Colgate, Stirling A.; Li, Hui; Nornberg, Mark D.

2015-01-01

Turbulent transport in rapidly rotating shear flow very efficiently transports angular momentum, a critical feature of instabilities responsible both for the dynamics of accretion disks and the turbulent power dissipation in a centrifuge. Turbulent mixing can efficiently transport other quantities like heat and even magnetic flux by enhanced diffusion. This enhancement is particularly evident in homogeneous, isotropic turbulent flows of liquid metals. In the New Mexico dynamo experiment, the effective resistivity is measured using both differential rotation and pulsed magnetic field decay to demonstrate that at very high Reynolds number rotating shear flow can be described entirely by mean flow induction with very little contribution from correlated velocity fluctuations

An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Spatio-temporal structure of turbulent Reynolds stress zonal flow drive in 3D magnetic configuration

International Nuclear Information System (INIS)

Schmid, B; Ramisch, M; Manz, P; Stroth, U

2017-01-01

The poloidal dependence of the zonal flow drive and the underlying Reynolds stress structure are studied at the stellarator experiment TJ-K by means of a poloidal Langmuir-probe array. This gives the unique possibility to study the locality of the Reynolds stress in a complex toroidal magnetic geometry. It is found that the Reynolds stress is not homogeneously distributed along the flux surface but has a strong poloidal asymmetry where it is concentrated on the outboard side with a maximum above the midplane. The average tilt of the turbulent structures is thereby reflected in the anisotropy of the bivariant velocity distribution. Using a conditional averaging technique the temporal dynamics reveal that the zonal flow drive is also maximal in this particular region. The results suggest an influence of the magnetic field line curvature, which controls the underlying plasma turbulence. The findings are a basis for further comparison with turbulence simulations in 3D geometry and demonstrate the need for a global characterisation of plasma turbulence. (paper)

Determination of the properties of magnetic turbulence in radio sources

International Nuclear Information System (INIS)

Spangler, S.R.

1983-01-01

We have considered the transport of polarized synchrotron radiation in a source possessing a highly irregular magnetic field, as proposed by Laing. The transport equation has been solved in a special case, relating the observable correlation functions in the Stokes parameters Q and U to the correlation functions of magnetic field and plasma density in the source. A rough application of our results to observations of the radio galaxy 3C 166 indicates that the turbulent scale length may be a few percent of the lobe size

Density effects on tokamak edge turbulence and transport with magnetic X-points

International Nuclear Information System (INIS)

Xu, X.Q.; Cohen, R.H.; Nevins, W.M.; Rognlien, T.D.; Ryutov, D.D.; Umansky, M.V.; Pearlstein, L.D.; Bulmer, R.H.; Russell, D.A.; Myra, J.R.; D'Ippolito, D.A.; Greenwald, M.; Snyder, P.B.; Mahdavi, M.A.

2005-01-01

Results are presented from the 3D electromagnetic turbulence code BOUT, the 2D transport code UEDGE, and theoretical analysis of boundary turbulence and transport in a real divertor-plasma geometry and its relationship to the density limit. Key results include: (1) a transition of the boundary turbulence from resistive X-point to resistive-ballooning as a critical plasma density is exceeded; (2) formation of an X-point MARFE in 2D UEDGE transport simulations for increasing outboard radial transport as found by BOUT for increasing density; (3) identification of convective transport by localized plasma 'blobs' in the SOL at high density during neutral fueling, and decorrelation of turbulence between the midplane and the divertor leg due to strong X-point magnetic shear; (4) a new divertor-leg instability driven at high plasma beta by a radial tilt of the divertor plate. (author)

THE ROLE OF TURBULENT MAGNETIC RECONNECTION IN THE FORMATION OF ROTATIONALLY SUPPORTED PROTOSTELLAR DISKS

Energy Technology Data Exchange (ETDEWEB)

Santos-Lima, R.; De Gouveia Dal Pino, E. M. [Instituto de Astronomia, Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo, R. do Matao, 1226, Sao Paulo, SP 05508-090 (Brazil); Lazarian, A. [Department of Astronomy, University of Wisconsin, Madison, WI 53706 (United States)

2012-03-01

The formation of protostellar disks out of molecular cloud cores is still not fully understood. Under ideal MHD conditions, the removal of angular momentum from the disk progenitor by the typically embedded magnetic field may prevent the formation of a rotationally supported disk during the main protostellar accretion phase of low-mass stars. This has been known as the magnetic braking problem and the most investigated mechanism to alleviate this problem and help remove the excess of magnetic flux during the star formation process, the so-called ambipolar diffusion (AD), has been shown to be not sufficient to weaken the magnetic braking at least at this stage of the disk formation. In this work, motivated by recent progress in the understanding of magnetic reconnection in turbulent environments, we appeal to the diffusion of magnetic field mediated by magnetic reconnection as an alternative mechanism for removing magnetic flux. We investigate numerically this mechanism during the later phases of the protostellar disk formation and show its high efficiency. By means of fully three-dimensional MHD simulations, we show that the diffusivity arising from turbulent magnetic reconnection is able to transport magnetic flux to the outskirts of the disk progenitor at timescales compatible with the collapse, allowing the formation of a rotationally supported disk around the protostar of dimensions {approx}100 AU, with a nearly Keplerian profile in the early accretion phase. Since MHD turbulence is expected to be present in protostellar disks, this is a natural mechanism for removing magnetic flux excess and allowing the formation of these disks. This mechanism dismisses the necessity of postulating a hypothetical increase of the ohmic resistivity as discussed in the literature. Together with our earlier work which showed that magnetic flux removal from molecular cloud cores is very efficient, this work calls for reconsidering the relative role of AD in the processes of star

Kinetic-Scale Magnetic Turbulence and Finite Larmor Radius Effects at Mercury

Science.gov (United States)

Uritsky, V. M.; Slavin, J. A.; Khazanov, G. V.; Donovan, E. F.; Boardsen, S. A.; Anderson, B. J.; Korth, H.

2011-01-01

We use a nonstationary generalization of the higher-order structure function technique to investigate statistical properties of the magnetic field fluctuations recorded by MESSENGER spacecraft during its first flyby (01/14/2008) through the near-Mercury space environment, with the emphasis on key boundary regions participating in the solar wind - magnetosphere interaction. Our analysis shows, for the first time, that kinetic-scale fluctuations play a significant role in the Mercury's magnetosphere up to the largest resolvable timescale (approx.20 s) imposed by the signal nonstationariry, suggesting that turbulence at this plane I is largely controlled by finite Larmor radius effects. In particular, we report the presence of a highly turbulent and extended foreshock system filled with packets of ULF oscillations, broad-band intermittent fluctuations in the magnetosheath, ion-kinetic turbulence in the central plasma sheet of Mercury's magnetotail, and kinetic-scale fluctuations in the inner current sheet encountered at the outbound (dawn-side) magnetopause. Overall, our measurements indicate that the Hermean magnetosphere, as well as the surrounding region, are strongly affected by non-MHD effects introduced by finite sizes of cyclotron orbits of the constituting ion species. Physical mechanisms of these effects and their potentially critical impact on the structure and dynamics of Mercury's magnetic field remain to be understood.

Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell

Science.gov (United States)

Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.

2016-08-01

In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

Instabilities, turbulence and transport in a magnetized plasma; Instabilites, turbulence et transport dans un plasma magnetise

Energy Technology Data Exchange (ETDEWEB)

Garbet, X

2001-06-01

The purpose of this work is to introduce the main processes that occur in a magnetized plasma. During the last 2 decades, the understanding of turbulence has made great progress but analytical formulas and simulations are far to produce reliable predictions. The values of transport coefficients in a tokamak plasma exceed by far those predicted by the theory of collisional transport. This phenomenon is called abnormal transport and might be due to plasma fluctuations. An estimation of turbulent fluxes derived from the levels of fluctuations, is proposed. A flow description of plasma allows the understanding of most micro-instabilities. The ballooning representation deals with instabilities in a toric geometry. 3 factors play an important role to stabilize plasmas: density pinch, magnetic shear and speed shear. The flow model of plasma gives an erroneous value for the stability threshold, this is due to a bad description of the resonant interaction between wave and particle. As for dynamics, flow models can be improved by adding dissipative terms so that the linear response nears the kinetic response. The kinetic approach is more accurate but is complex because of the great number of dimensions involved. (A.C.)

Turbulent Magnetic Relaxation in Pulsar Wind Nebulae

Science.gov (United States)

Zrake, Jonathan; Arons, Jonathan

2017-09-01

We present a model for magnetic energy dissipation in a pulsar wind nebula. A better understanding of this process is required to assess the likelihood that certain astrophysical transients may be powered by the spin-down of a “millisecond magnetar.” Examples include superluminous supernovae, gamma-ray bursts, and anticipated electromagnetic counterparts to gravitational wave detections of binary neutron star coalescence. Our model leverages recent progress in the theory of turbulent magnetic relaxation to specify a dissipative closure of the stationary magnetohydrodynamic (MHD) wind equations, yielding predictions of the magnetic energy dissipation rate throughout the nebula. Synchrotron losses are self-consistently treated. To demonstrate the model’s efficacy, we show that it can reproduce many features of the Crab Nebula, including its expansion speed, radiative efficiency, peak photon energy, and mean magnetic field strength. Unlike ideal MHD models of the Crab (which lead to the so-called σ-problem), our model accounts for the transition from ultra to weakly magnetized plasma flow and for the associated heating of relativistic electrons. We discuss how the predicted heating rates may be utilized to improve upon models of particle transport and acceleration in pulsar wind nebulae. We also discuss implications for the Crab Nebula’s γ-ray flares, and point out potential modifications to models of astrophysical transients invoking the spin-down of a millisecond magnetar.

Turbulent Magnetic Relaxation in Pulsar Wind Nebulae

Energy Technology Data Exchange (ETDEWEB)

Zrake, Jonathan [Kavli Institute for Particle Astrophysics and Cosmology, Stanford University, SLAC National Accelerator Laboratory, Menlo Park, CA 94025 (United States); Arons, Jonathan [Astronomy Department and Theoretical Astrophysics Center, University of California, Berkeley, 601 Campbell Hall, Berkeley, CA 94720 (United States)

2017-09-20

We present a model for magnetic energy dissipation in a pulsar wind nebula. A better understanding of this process is required to assess the likelihood that certain astrophysical transients may be powered by the spin-down of a “millisecond magnetar.” Examples include superluminous supernovae, gamma-ray bursts, and anticipated electromagnetic counterparts to gravitational wave detections of binary neutron star coalescence. Our model leverages recent progress in the theory of turbulent magnetic relaxation to specify a dissipative closure of the stationary magnetohydrodynamic (MHD) wind equations, yielding predictions of the magnetic energy dissipation rate throughout the nebula. Synchrotron losses are self-consistently treated. To demonstrate the model’s efficacy, we show that it can reproduce many features of the Crab Nebula, including its expansion speed, radiative efficiency, peak photon energy, and mean magnetic field strength. Unlike ideal MHD models of the Crab (which lead to the so-called σ -problem), our model accounts for the transition from ultra to weakly magnetized plasma flow and for the associated heating of relativistic electrons. We discuss how the predicted heating rates may be utilized to improve upon models of particle transport and acceleration in pulsar wind nebulae. We also discuss implications for the Crab Nebula’s γ -ray flares, and point out potential modifications to models of astrophysical transients invoking the spin-down of a millisecond magnetar.

Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

DEFF Research Database (Denmark)

Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina

2016-01-01

Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control

Science.gov (United States)

Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

Effects of ExB velocity shear and magnetic shear on turbulence and transport in magnetic confinement devices

International Nuclear Information System (INIS)

Burrell, K.H.

1996-11-01

One of the scientific success stories of fusion research over the past decade is the development of the ExB shear stabilization model to explain the formation of transport barriers in magnetic confinement devices. This model was originally developed to explain the transport barrier formed at the plasma edge in tokamaks after the L (low) to H (high) transition. This concept has the universality needed to explain the edge transport barriers seen in limiter and divertor tokamaks, stellarators, and mirror machines. More recently, this model has been applied to explain the further confinement improvement from H (high)-mode to VH (very high)-mode seen in some tokamaks, where the edge transport barrier becomes wider. Most recently, this paradigm has been applied to the core transport barriers formed in plasmas with negative or low magnetic shear in the plasma core. These examples of confinement improvement are of considerable physical interest; it is not often that a system self-organizes to a higher energy state with reduced turbulence and transport when an additional source of free energy is applied to it. The transport decrease that is associated with ExB velocity shear effects also has significant practical consequences for fusion research. The fundamental physics involved in transport reduction is the effect of ExB shear on the growth, radial extent and phase correlation of turbulent eddies in the plasma. The same fundamental transport reduction process can be operational in various portions of the plasma because there are a number ways to change the radial electric field Er. An important theme in this area is the synergistic effect of ExB velocity shear and magnetic shear. Although the ExB velocity shear appears to have an effect on broader classes of microturbulence, magnetic shear can mitigate some potentially harmful effects of ExB velocity shear and facilitate turbulence stabilization

Recent developments in plasma turbulence and turbulent transport

Energy Technology Data Exchange (ETDEWEB)

Terry, P.W. [Univ. of Wisconsin, Madison, WI (United States)

1997-09-22

This report contains viewgraphs of recent developments in plasma turbulence and turbulent transport. Localized nonlinear structures occur under a variety of circumstances in turbulent, magnetically confined plasmas, arising in both kinetic and fluid descriptions, i.e., in either wave-particle or three-wave coupling interactions. These structures are non wavelike. They cannot be incorporated in the collective wave response, but interact with collective modes through their shielding by the plasma dielectric. These structures are predicted to modify turbulence-driven transport in a way that in consistent with, or in some cases are confirmed by recent experimental observations. In kinetic theory, non wavelike structures are localized perturbations of phase space density. There are two types of structures. Holes are self-trapped, while clumps have a self-potential that is too weak to resist deformation and mixing by ambient potential fluctuations. Clumps remain correlated in turbulence if their spatial extent is smaller than the correlation length of the scattering fields. In magnetic turbulence, clumps travel along stochastic magnetic fields, shielded by the plasma dielectric. A drag on the clump macro-particle is exerted by the shielding, inducing emission into the collective response. The emission in turn damps back on the particle distribution via Landau dampling. The exchange of energy between clumps and particles, as mediated by the collective mode, imposes constraints on transport. For a turbulent spectrum whose mean wavenumber along the equilibrium magnetic field is nonzero, the electron thermal flux is proportional to the ion thermal velocity. Conventional predictions (which account only for collective modes) are larger by the square root of the ion to electron mass ratio. Recent measurements are consistent with the small flux. In fluid plasma,s localized coherent structures can occur as intense vortices.

Time-dependent transport of energetic particles in magnetic turbulence: computer simulations versus analytical theory

Science.gov (United States)

Arendt, V.; Shalchi, A.

2018-06-01

We explore numerically the transport of energetic particles in a turbulent magnetic field configuration. A test-particle code is employed to compute running diffusion coefficients as well as particle distribution functions in the different directions of space. Our numerical findings are compared with models commonly used in diffusion theory such as Gaussian distribution functions and solutions of the cosmic ray Fokker-Planck equation. Furthermore, we compare the running diffusion coefficients across the mean magnetic field with solutions obtained from the time-dependent version of the unified non-linear transport theory. In most cases we find that particle distribution functions are indeed of Gaussian form as long as a two-component turbulence model is employed. For turbulence setups with reduced dimensionality, however, the Gaussian distribution can no longer be obtained. It is also shown that the unified non-linear transport theory agrees with simulated perpendicular diffusion coefficients as long as the pure two-dimensional model is excluded.

Magnetospheric Multiscale Observations of Electron Vortex Magnetic Hole in the Turbulent Magnetosheath Plasma

Energy Technology Data Exchange (ETDEWEB)

Huang, S. Y.; Yuan, Z. G.; Wang, D. D.; Yu, X. D. [School of Electronic Information, Wuhan University, Wuhan (China); Sahraoui, F.; Contel, O. Le [Laboratoire de Physique des Plasmas, CNRS-Ecole Polytechnique-UPMC, Palaiseau (France); He, J. S. [School of Earth and Space Sciences, Peking University, Beijing (China); Zhao, J. S. [Key Laboratory of Planetary Sciences, Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing (China); Deng, X. H.; Pang, Y.; Li, H. M. [Institute of Space Science and Technology, Nanchang University, Nanchang (China); Zhou, M. [Department of Physics and Astronomy, University of California, Los Angeles, CA (United States); Fu, H. S.; Yang, J. [School of Space and Environment, Beihang University, Beijing (China); Shi, Q. Q. [Shandong Provincial Key Laboratory of Optical Astronomy and Solar-Terrestrial Environment, Institute of Space Sciences, Shandong University, Weihai (China); Lavraud, B. [Institut de Recherche and Astrophysique et Planétologie, Université de Toulouse (UPS), Toulouse (France); Pollock, C. J.; Giles, B. L. [NASA, Goddard Space Flight Center, Greenbelt, MD (United States); Torbert, R. B. [University of New Hampshire, Durham, NH (United States); Russell, C. T., E-mail: shiyonghuang@whu.edu.cn [Department of Earth, Planetary and Space Sciences, University of California, Los Angeles, CA (United States); and others

2017-02-20

We report on the observations of an electron vortex magnetic hole corresponding to a new type of coherent structure in the turbulent magnetosheath plasma using the Magnetospheric Multiscale mission data. The magnetic hole is characterized by a magnetic depression, a density peak, a total electron temperature increase (with a parallel temperature decrease but a perpendicular temperature increase), and strong currents carried by the electrons. The current has a dip in the core region and a peak in the outer region of the magnetic hole. The estimated size of the magnetic hole is about 0.23 ρ {sub i} (∼30 ρ {sub e}) in the quasi-circular cross-section perpendicular to its axis, where ρ {sub i} and ρ {sub e} are respectively the proton and electron gyroradius. There are no clear enhancements seen in high-energy electron fluxes. However, there is an enhancement in the perpendicular electron fluxes at 90° pitch angle inside the magnetic hole, implying that the electrons are trapped within it. The variations of the electron velocity components V {sub em} and V {sub en} suggest that an electron vortex is formed by trapping electrons inside the magnetic hole in the cross-section in the M – N plane. These observations demonstrate the existence of a new type of coherent structures behaving as an electron vortex magnetic hole in turbulent space plasmas as predicted by recent kinetic simulations.

Turbulence measurements in fusion plasmas

International Nuclear Information System (INIS)

Conway, G D

2008-01-01

Turbulence measurements in magnetically confined toroidal plasmas have a long history and relevance due to the detrimental role of turbulence induced transport on particle, energy, impurity and momentum confinement. The turbulence-the microscopic random fluctuations in particle density, temperature, potential and magnetic field-is generally driven by radial gradients in the plasma density and temperature. The correlation between the turbulence properties and global confinement, via enhanced diffusion, convection and direct conduction, is now well documented. Theory, together with recent measurements, also indicates that non-linear interactions within the turbulence generate large scale zonal flows and geodesic oscillations, which can feed back onto the turbulence and equilibrium profiles creating a complex interdependence. An overview of the current status and understanding of plasma turbulence measurements in the closed flux surface region of magnetic confinement fusion devices is presented, highlighting some recent developments and outstanding problems.

Magnetic field line random walk in two-dimensional dynamical turbulence

Science.gov (United States)

Wang, J. F.; Qin, G.; Ma, Q. M.; Song, T.; Yuan, S. B.

2017-08-01

The field line random walk (FLRW) of magnetic turbulence is one of the important topics in plasma physics and astrophysics. In this article, by using the field line tracing method, the mean square displacement (MSD) of FLRW is calculated on all possible length scales for pure two-dimensional turbulence with the damping dynamical model. We demonstrate that in order to describe FLRW with the damping dynamical model, a new dimensionless quantity R is needed to be introduced. On different length scales, dimensionless MSD shows different relationships with the dimensionless quantity R. Although the temporal effect affects the MSD of FLRW and even changes regimes of FLRW, it does not affect the relationship between the dimensionless MSD and dimensionless quantity R on all possible length scales.

Non-commutative Chern numbers for generic aperiodic discrete systems

Science.gov (United States)

Bourne, Chris; Prodan, Emil

2018-06-01

The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

Topological aperiodicity for product systems over semigroups of Ore type

DEFF Research Database (Denmark)

Kwasniewski, Bartosz; Szymanski, Wojciech

2016-01-01

aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

Numerical investigation of kinetic turbulence in relativistic pair plasmas - I. Turbulence statistics

Science.gov (United States)

Zhdankin, Vladimir; Uzdensky, Dmitri A.; Werner, Gregory R.; Begelman, Mitchell C.

2018-02-01

We describe results from particle-in-cell simulations of driven turbulence in collisionless, magnetized, relativistic pair plasma. This physical regime provides a simple setting for investigating the basic properties of kinetic turbulence and is relevant for high-energy astrophysical systems such as pulsar wind nebulae and astrophysical jets. In this paper, we investigate the statistics of turbulent fluctuations in simulations on lattices of up to 10243 cells and containing up to 2 × 1011 particles. Due to the absence of a cooling mechanism in our simulations, turbulent energy dissipation reduces the magnetization parameter to order unity within a few dynamical times, causing turbulent motions to become sub-relativistic. In the developed stage, our results agree with predictions from magnetohydrodynamic turbulence phenomenology at inertial-range scales, including a power-law magnetic energy spectrum with index near -5/3, scale-dependent anisotropy of fluctuations described by critical balance, lognormal distributions for particle density and internal energy density (related by a 4/3 adiabatic index, as predicted for an ultra-relativistic ideal gas), and the presence of intermittency. We also present possible signatures of a kinetic cascade by measuring power-law spectra for the magnetic, electric and density fluctuations at sub-Larmor scales.

Transition to magnetorotational turbulence in Taylor–Couette flow with imposed azimuthal magnetic field

International Nuclear Information System (INIS)

A Guseva; Avila, M; Willis, A P; Hollerbach, R

2015-01-01

The magnetorotational instability (MRI) is thought to be a powerful source of turbulence and momentum transport in astrophysical accretion discs, but obtaining observational evidence of its operation is challenging. Recently, laboratory experiments of Taylor–Couette flow with externally imposed axial and azimuthal magnetic fields have revealed the kinematic and dynamic properties of the MRI close to the instability onset. While good agreement was found with linear stability analyses, little is known about the transition to turbulence and transport properties of the MRI. We here report on a numerical investigation of the MRI with an imposed azimuthal magnetic field. We show that the laminar Taylor–Couette flow becomes unstable to a wave rotating in the azimuthal direction and standing in the axial direction via a supercritical Hopf bifurcation. Subsequently, the flow features a catastrophic transition to spatio-temporal defects which is mediated by a subcritical subharmonic Hopf bifurcation. Our results are in qualitative agreement with the PROMISE experiment and dramatically extend their realizable parameter range. We find that as the Reynolds number increases defects accumulate and grow into turbulence, yet the momentum transport scales weakly. (paper)

Coherent structures and turbulence evolution in magnetized non-neutral plasmas

Science.gov (United States)

Romé, M.; Chen, S.; Maero, G.

2018-01-01

The evolution of turbulence of a magnetized pure electron plasma confined in a Penning-Malmberg trap is investigated by means of a two-dimensional particle-in-cell numerical code. The transverse plasma dynamics is studied both in the case of free evolution and under the influence of non-axisymmetric, multipolar radio-frequency drives applied on the circular conducting boundary. In the latter case the radio-frequency fields are chosen in the frequency range of the low-order azimuthal (diocotron) modes of the plasma in order to investigate their effect on the insurgence of azimuthal instabilities and the formation and evolution of coherent structures, possibly preventing the relaxation to a fully-developed turbulent state. Different initial density distributions (rings and spirals) are considered, so that evolutions characterized by different levels of turbulence and intermittency are obtained. The time evolution of integral and spectral quantities of interest are computed using a multiresolution analysis based on a wavelet decomposition of density maps. Qualitative features of turbulent relaxation are found to be similar in conditions of both free and forced evolution, but the analysis allows one to highlight fine details of the flow beyond the self-similarity turbulence properties, so that the influence of the initial conditions and the effect of the external forcing can be distinguished. In particular, the presence of small inhomogeneities in the initial density configuration turns out to lead to quite different final states, especially in the presence of competing unstable diocotron modes characterized by similar growth rates.

Magnetic Helicities and Dynamo Action in Magneto-rotational Turbulence

Energy Technology Data Exchange (ETDEWEB)

Bodo, G.; Rossi, P. [INAF/Osservatorio Astrofisico di Torino, Strada Osservatorio 20, I-10025 Pino Torinese (Italy); Cattaneo, F. [Department of Astronomy and Astrophysics, The University of Chicago, 5640 S. Ellis Avenue, Chicago IL 60637 (United States); Mignone, A., E-mail: bodo@oato.inaf.it [Dipartimento di Fisica, Università degli Studi di Torino, Via Pietro Giuria 1, 10125 Torino (Italy)

2017-07-10

We examine the relationship between magnetic flux generation, taken as an indicator of large-scale dynamo action, and magnetic helicity, computed as an integral over the dynamo volume, in a simple dynamo. We consider dynamo action driven by magneto-rotational turbulence (MRT) within the shearing-box approximation. We consider magnetically open boundary conditions that allow a flux of helicity in or out of the computational domain. We circumvent the problem of the lack of gauge invariance in open domains by choosing a particular gauge—the winding gauge—that provides a natural interpretation in terms of the average winding number of pairwise field lines. We use this gauge precisely to define and measure the helicity and the helicity flux for several realizations of dynamo action. We find in these cases that the system as a whole does not break reflectional symmetry and that the total helicity remains small even in cases when substantial magnetic flux is generated. We find no particular connection between the generation of magnetic flux and the helicity or the helicity flux through the boundaries. We suggest that this result may be due to the essentially nonlinear nature of the dynamo processes in MRT.

MAGNETIC QUENCHING OF TURBULENT DIFFUSIVITY: RECONCILING MIXING-LENGTH THEORY ESTIMATES WITH KINEMATIC DYNAMO MODELS OF THE SOLAR CYCLE

International Nuclear Information System (INIS)

Munoz-Jaramillo, Andres; Martens, Petrus C. H.; Nandy, Dibyendu

2011-01-01

The turbulent magnetic diffusivity in the solar convection zone is one of the most poorly constrained ingredients of mean-field dynamo models. This lack of constraint has previously led to controversy regarding the most appropriate set of parameters, as different assumptions on the value of turbulent diffusivity lead to radically different solar cycle predictions. Typically, the dynamo community uses double-step diffusivity profiles characterized by low values of diffusivity in the bulk of the convection zone. However, these low diffusivity values are not consistent with theoretical estimates based on mixing-length theory, which suggest much higher values for turbulent diffusivity. To make matters worse, kinematic dynamo simulations cannot yield sustainable magnetic cycles using these theoretical estimates. In this work, we show that magnetic cycles become viable if we combine the theoretically estimated diffusivity profile with magnetic quenching of the diffusivity. Furthermore, we find that the main features of this solution can be reproduced by a dynamo simulation using a prescribed (kinematic) diffusivity profile that is based on the spatiotemporal geometric average of the dynamically quenched diffusivity. This bridges the gap between dynamically quenched and kinematic dynamo models, supporting their usage as viable tools for understanding the solar magnetic cycle.

Confinement and Isotropization of Galactic Cosmic Rays by Molecular-Cloud Magnetic Mirrors When Turbulent Scattering Is Weak

International Nuclear Information System (INIS)

Chandran, Benjamin D. G.

2000-01-01

Theoretical studies of magnetohydrodynamic (MHD) turbulence and observations of solar wind fluctuations suggest that MHD turbulence in the interstellar medium is anisotropic at small scales, with smooth variations along the background magnetic field and sharp variations perpendicular to the background field. Turbulence with this anisotropy is inefficient at scattering cosmic rays, and thus the scattering rate ν may be smaller than has been traditionally assumed in diffusion models of Galactic cosmic-ray propagation, at least for cosmic-ray energies E above 1011-1012 eV at which self-confinement is not possible. In this paper, it is shown that Galactic cosmic rays can be effectively confined through magnetic reflection by molecular clouds, even when turbulent scattering is weak. Elmegreen's quasi-fractal model of molecular-cloud structure is used to argue that a typical magnetic field line passes through a molecular cloud complex once every ∼300 pc. Once inside the complex, the field line will in most cases be focused into one or more dense clumps in which the magnetic field can be much stronger than the average field in the intercloud medium (ICM). Cosmic rays following field lines into cloud complexes are most often magnetically reflected back into the ICM, since strong-field regions act as magnetic mirrors. For a broad range of cosmic-ray energies, a cosmic ray initially following some particular field line separates from that field line sufficiently slowly that the cosmic ray can be trapped between neighboring cloud complexes for long periods of time. The suppression of cosmic-ray diffusion due to magnetic trapping is calculated in this paper with the use of phenomenological arguments, asymptotic analysis, and Monte Carlo particle simulations. Formulas for the coefficient of diffusion perpendicular to the Galactic disk are derived for several different parameter regimes within the E-ν plane. In one of these parameter regimes in which scattering is weak, it

Diffuse scattering from periodic and aperiodic crystals

International Nuclear Information System (INIS)

Frey, F.

1997-01-01

A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

Plasma turbulence in tokamaks

Energy Technology Data Exchange (ETDEWEB)

Caldas, Ibere L.; Heller, M.V.A.P.; Brasilio, Z.A. [Sao Paulo Univ., SP, RJ (Brazil). Inst. de Fisica

1997-12-31

Full text. In this work we summarize the results from experiments on electrostatic and magnetic fluctuations in tokamak plasmas. Spectral analyses show that these fluctuations are turbulent, having a broad spectrum of wavectors and a broad spectrum of frequencies at each wavector. The electrostatic turbulence induces unexpected anomalous particle transport that deteriorates the plasma confinement. The relationship of these fluctuations to the current state of plasma theory is still unclear. Furthermore, we describe also attempts to control this plasma turbulence with external magnetic perturbations that create chaotic magnetic configurations. Accordingly, the magnetic field lines may become chaotic and then induce a Lagrangian diffusion. Moreover, to discuss nonlinear coupling and intermittency, we present results obtained by using numerical techniques as bi spectral and wavelet analyses. (author)

ION KINETIC ENERGY CONSERVATION AND MAGNETIC FIELD STRENGTH CONSTANCY IN MULTI-FLUID SOLAR WIND ALFVÉNIC TURBULENCE

Energy Technology Data Exchange (ETDEWEB)

Matteini, L.; Horbury, T. S.; Schwartz, S. J. [The Blackett Laboratory, Imperial College London, SW7 2AZ (United Kingdom); Pantellini, F. [LESIA, Observatoire de Paris, CNRS, UPMC, Universit Paris-Diderot, 5 Place Jules Janssen, F-92195 Meudon (France); Velli, M. [Department of Earth, Planetary, and Space Sciences, UCLA, California (United States)

2015-03-20

We investigate the properties of plasma fluid motion in the large-amplitude, low-frequency fluctuations of highly Alfvénic fast solar wind. We show that protons locally conserve total kinetic energy when observed from an effective frame of reference comoving with the fluctuations. For typical properties of the fast wind, this frame can be reasonably identified by alpha particles which, due to their drift with respect to protons at about the Alfvén speed along the magnetic field, do not partake in the fluid low-frequency fluctuations. Using their velocity to transform the proton velocity into the frame of Alfvénic turbulence, we demonstrate that the resulting plasma motion is characterized by a constant absolute value of the velocity, zero electric fields, and aligned velocity and magnetic field vectors as expected for unidirectional Alfvénic fluctuations in equilibrium. We propose that this constraint, via the correlation between velocity and magnetic field in Alfvénic turbulence, is the origin of the observed constancy of the magnetic field; while the constant velocity corresponding to constant energy can only be observed in the frame of the fluctuations, the corresponding constant total magnetic field, invariant for Galilean transformations, remains the observational signature in the spacecraft frame of the constant total energy in the Alfvén turbulence frame.

Kinetic theory of instabilities responsible for magnetic turbulence in laboratory rotating plasma

International Nuclear Information System (INIS)

Mikhailovskii, A.B.; Lominadze, J.G.; Churikov, A.P.; Pustovitov, V.D.; Erokhin, N.N.; Konovalov, S.V.

2008-01-01

The problem of instabilities responsible for magnetic turbulence in collisionless laboratory rotating plasma is investigated. It is shown that the standard mechanism of driving the magnetorotational instability (MRI), due to negative rotation frequency gradient, disappears in such a plasma. Instead of it, a new driving mechanism due to plasma pressure gradient is predicted

Near-to far-field transformation in the aperiodic Fourier modal method

NARCIS (Netherlands)

Rook, R.; Pisarenco, M.; Setija, I.D.

2013-01-01

This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

Directory of Open Access Journals (Sweden)

Xuefeng Li

2014-04-01

Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

Turbulence-driven anisotropic electron tail generation during magnetic reconnection

Science.gov (United States)

DuBois, A. M.; Scherer, A.; Almagri, A. F.; Anderson, J. K.; Pandya, M. D.; Sarff, J. S.

2018-05-01

Magnetic reconnection (MR) plays an important role in particle transport, energization, and acceleration in space, astrophysical, and laboratory plasmas. In the Madison Symmetric Torus reversed field pinch, discrete MR events release large amounts of energy from the equilibrium magnetic field, a fraction of which is transferred to electrons and ions. Previous experiments revealed an anisotropic electron tail that favors the perpendicular direction and is symmetric in the parallel. New profile measurements of x-ray emission show that the tail distribution is localized near the magnetic axis, consistent modeling of the bremsstrahlung emission. The tail appears first near the magnetic axis and then spreads radially, and the dynamics in the anisotropy and diffusion are discussed. The data presented imply that the electron tail formation likely results from a turbulent wave-particle interaction and provides evidence that high energy electrons are escaping the core-localized region through pitch angle scattering into the parallel direction, followed by stochastic parallel transport to the plasma edge. New measurements also show a strong correlation between high energy x-ray measurements and tearing mode dynamics, suggesting that the coupling between core and edge tearing modes is essential for energetic electron tail formation.

Electron acceleration by turbulent plasmoid reconnection

Science.gov (United States)

Zhou, X.; Büchner, J.; Widmer, F.; Muñoz, P. A.

2018-04-01

In space and astrophysical plasmas, like in planetary magnetospheres, as that of Mercury, energetic electrons are often found near current sheets, which hint at electron acceleration by magnetic reconnection. Unfortunately, electron acceleration by reconnection is not well understood yet, in particular, acceleration by turbulent plasmoid reconnection. We have investigated electron acceleration by turbulent plasmoid reconnection, described by MHD simulations, via test particle calculations. In order to avoid resolving all relevant turbulence scales down to the dissipation scales, a mean-field turbulence model is used to describe the turbulence of sub-grid scales and their effects via a turbulent electromotive force (EMF). The mean-field model describes the turbulent EMF as a function of the mean values of current density, vorticity, magnetic field as well as of the energy, cross-helicity, and residual helicity of the turbulence. We found that, mainly around X-points of turbulent reconnection, strongly enhanced localized EMFs most efficiently accelerated electrons and caused the formation of power-law spectra. Magnetic-field-aligned EMFs, caused by the turbulence, dominate the electron acceleration process. Scaling the acceleration processes to parameters of the Hermean magnetotail, electron energies up to 60 keV can be reached by turbulent plasmoid reconnection through the thermal plasma.

Investigation of turbulent structures in the edge of magnetized plasmas

International Nuclear Information System (INIS)

Nold, Bernhard

2012-01-01

Rising energy cost and progressing climate change will exacerbate existing and give birth to new conflicts. Energy savings and the development of new technologies can counteract the reasons for these conflicts. Beside renewable energy sources, nuclear fusion can help to meet this challenge. To build future fusion power plants smaller and more efficient, the magnetic confinement must be improved and the load on plasma facing components reduced. To this end, better understanding is required of turbulent transport processes in magnetized plasmas. Within the frame of the present work, the properties and dynamics of turbulent density structures (''blobs'') have been investigated, as well as their interaction with shear flows. Langmuir-probe measurements have been conducted in the tokamak ASDEX Upgrade and in the stellarator TJ-K, and compared with GEMR plasma turbulence simulations. It has been shown, that blobs are generated at the last closed flux surface (LCFS) of ASDEX Upgrade. They propagate perpendicular to the magnetic field lines in the radial and poloidal directions. The poloidal E x B-drift depends on the radial variation of the plasma potential. The latter is given by the electron temperature profile in front of the electrically conducting wall. Experimental results show, that this can lead to a shear layer inside the scrape-off layer (SOL) of a divertor tokamak due to inhomogeneous connection lengths to the wall. Blobs can hardly cross such a shear layer unchanged. This investigation shows how blobs can exchange particles and energy across a shear layer without changing their shapes and velocities substantially. However, the dynamics of the structures are different between both sides of the shear layer. Parallel drift-wave dynamics are dominant on the plasma core side, i.e. density and potential of the blobs are in phase. Outside of the shear layer, the interchange mechanism dominates due to shorter parallel connection lengths to the wall. The poloidal

Stochastic field-line wandering in magnetic turbulence with shear. II. Decorrelation trajectory method

Science.gov (United States)

Negrea, M.; Petrisor, I.; Shalchi, A.

2017-11-01

We study the diffusion of magnetic field lines in turbulence with magnetic shear. In the first part of the series, we developed a quasi-linear theory for this type of scenario. In this article, we employ the so-called DeCorrelation Trajectory method in order to compute the diffusion coefficients of stochastic magnetic field lines. The magnetic field configuration used here contains fluctuating terms which are described by the dimensionless functions bi(X, Y, Z), i = (x, y) and they are assumed to be Gaussian processes and are perpendicular with respect to the main magnetic field B0. Furthermore, there is also a z-component of the magnetic field depending on radial coordinate x (representing the gradient of the magnetic field) and a poloidal average component. We calculate the diffusion coefficients for magnetic field lines for different values of the magnetic Kubo number K, the dimensionless inhomogeneous magnetic parallel and perpendicular Kubo numbers KB∥, KB⊥ , as well as Ka v=bya vKB∥/KB⊥ .

Reversed magnetic shear suppression of electron-scale turbulence on NSTX

Science.gov (United States)

Yuh, Howard Y.; Levinton, F. M.; Bell, R. E.; Hosea, J. C.; Kaye, S. M.; Leblanc, B. P.; Mazzucato, E.; Smith, D. R.; Domier, C. W.; Luhmann, N. C.; Park, H. K.

2009-11-01

Electron thermal internal transport barriers (e-ITBs) are observed in reversed (negative) magnetic shear NSTX discharges^1. These e-ITBs can be created with either neutral beam heating or High Harmonic Fast Wave (HHFW) RF heating. The e-ITB location occurs at the location of minimum magnetic shear determined by Motional Stark Effect (MSE) constrained equilibria. Statistical studies show a threshold condition in magnetic shear for e-ITB formation. High-k fluctuation measurements at electron turbulence wavenumbers^3 have been made under several different transport regimes, including a bursty regime that limits temperature gradients at intermediate magnetic shear. The growth rate of fluctuations has been calculated immediately following a change in the local magnetic shear, resulting in electron temperature gradient relaxation. Linear gyrokinetic simulation results for NSTX show that while measured electron temperature gradients exceed critical linear thresholds for ETG instability, growth rates can remain low under reversed shear conditions up to high electron temperatures gradients. ^1H. Yuh, et. al., PoP 16, 056120 ^2D.R. Smith, E. Mazzucato et al., RSI 75, 3840 ^3E. Mazzucato, D.R. Smith et al., PRL 101, 075001

Tearing instabilities in turbulence

International Nuclear Information System (INIS)

Ishizawa, A.; Nakajima, N.

2009-01-01

Full text: Effects of micro-turbulence on tearing instabilities are investigated by numerically solving a reduced set of two-fluid equations. Micro-turbulence excites both large-scale and small-scale Fourier modes through energy transfer due to nonlinear mode coupling. The energy transfer to large scale mode does not directly excite tearing instability but it gives an initiation of tearing instability. When tearing instability starts to grow, the excited small scale mode plays an important role. The mixing of magnetic flux by micro-turbulence is the dominant factor of non-ideal MHD effect at the resonant surface and it gives rise to magnetic reconnection which causes tearing instability. Tearing instabilities were investigated against static equilibrium or flowing equilibrium so far. On the other hand, the recent progress of computer power allows us to investigate interactions between turbulence and coherent modes such as tearing instabilities in magnetically confined plasmas by means of direct numerical simulations. In order to investigate effects of turbulence on tearing instabilities we consider a situation that tearing mode is destabilized in a quasi-equilibrium including micro-turbulence. We choose an initial equilibrium that is unstable against kinetic ballooning modes and tearing instabilities. Tearing instabilities are current driven modes and thus they are unstable for large scale Fourier modes. On the other hand kinetic ballooning modes are unstable for poloidal Fourier modes that are characterized by ion Larmor radius. The energy of kinetic ballooning modes spreads over wave number space through nonlinear Fourier mode coupling. We present that micro-turbulence affects tearing instabilities in two different ways by three-dimensional numerical simulation of a reduced set of two-fluid equations. One is caused by energy transfer to large scale modes, the other is caused by energy transfer to small scale modes. The former is the excitation of initial

Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

DEFF Research Database (Denmark)

Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

2013-01-01

This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

Effects of Turbulent Magnetic Fields on the Transport and Acceleration of Energetic Charged Particles: Numerical Simulations with Application to Heliospheric Physics

Science.gov (United States)

Guo, Fan

2012-11-01

Turbulent magnetic fields are ubiquitous in space physics and astrophysics. The influence of magnetic turbulence on the motions of charged particles contains the essential physics of the transport and acceleration of energetic charged particles in the heliosphere, which is to be explored in this thesis. After a brief introduction on the energetic charged particles and magnetic fields in the heliosphere, the rest of this dissertation focuses on three specific topics: 1. the transport of energetic charged particles in the inner heliosphere, 2. the acceleration of ions at collisionless shocks, and 3. the acceleration of electrons at collisionless shocks. We utilize various numerical techniques to study these topics. In Chapter 2 we study the propagation of charged particles in turbulent magnetic fields similar to the propagation of solar energetic particles in the inner heliosphere. The trajectories of energetic charged particles in the turbulent magnetic field are numerically integrated. The turbulence model includes a Kolmogorov-like magnetic field power spectrum containing a broad range of scales from those that lead to large-scale field-line random walk to small scales leading to resonant pitch-angle scattering of energetic particles. We show that small-scale variations in particle intensities (the so-called "dropouts") and velocity dispersions observed by spacecraft can be reproduced using this method. Our study gives a new constraint on the error of "onset analysis", which is a technique commonly used to infer information about the initial release of energetic particles. We also find that the dropouts are rarely produced in the simulations using the so-called "two-component" magnetic turbulence model (Matthaeus et al., 1990). The result questions the validity of this model in studying particle transport. In the first part of Chapter 3 we study the acceleration of ions in the existence of turbulent magnetic fields. We use 3-D self-consistent hybrid simulations

Hybrid Optical-Magnetic Traps for Studies of 2D Quantum Turbulence in Bose-Einstein Condensates

Science.gov (United States)

Myers, Jessica Ann

Turbulence appears in most natural and man-made flows. However, the analysis of turbulence is particularly difficult. Links between microscopic fluid dynamics and statistical signatures of turbulence appear unobtainable from the postulates of fluid dynamics making turbulence one of the most important unsolved theoretical problems in physics. Two-dimensional quantum turbulence (2DQT), an emerging field of study, involves turbulence in two-dimensional (2D) flows in superfluids, such as Bose-Einstein condensates (BECs). In 2D superfluids, a turbulent state can be characterized by a disordered distribution of numerous vortex cores. The question of how to effectively and efficiently generate turbulent states in superfluids is a fundamental question in the field of quantum turbulence. Therefore, experimental studies of vortex nucleation and the onset of turbulence in a superfluid are important for achieving a deeper understanding of the overall problem of turbulence. My PhD dissertation involves the study of vortex nucleation and the onset of turbulence in quasi-2D BECs. First, I discuss experimental apparatus advancements that now enable BECs to be created in a hybrid optical-magnetic trap, an atom trapping configuration conducive to 2DQT experiments. Next, I discuss the design and construction of a quantum vortex microscope and initial vortex detection tests. Finally, I present the first experiments aimed at studying 2DQT carried out in the updated apparatus. Thermal counterflow in superfluid helium, in which the normal and superfluid components flow in opposite directions, is known to create turbulence in the superfluid. However, this phenomenon has not been simulated or studied in dilute-gas BECs as a possible vortex nucleation method. In this dissertation, I present preliminary data from the first experiments aimed at understanding thermal counterflow turbulence in dilute-gas BECs.

Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control

Science.gov (United States)

Wang, Pengfei; Jin, Wei; Su, Huan

2018-04-01

This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

Hydromagnetic turbulence in the direct interaction approximation

International Nuclear Information System (INIS)

Nagarajan, S.

1975-01-01

The dissertation is concerned with the nature of turbulence in a medium with large electrical conductivity. Three distinct though inter-related questions are asked. Firstly, the evolution of a weak, random initial magnetic field in a highly conducting, isotropically turbulent fluid is discussed. This was first discussed in the paper 'Growth of Turbulent Magnetic Fields' by Kraichnan and Nagargian. The Physics of Fluids, volume 10, number 4, 1967. Secondly, the direct interaction approximation for hydromagnetic turbulence maintained by stationary, isotropic, random stirring forces is formulated in the wave-number-frequency domain. Thirdly, the dynamical evolution of a weak, random, magnetic excitation in a turbulent electrically conducting fluid is examined under varying kinematic conditions. (G.T.H.)

Particle Trapping and Dropouts in Magnetic Turbulence in a Spherical Geometry

Science.gov (United States)

Tooprakai, P.; Ruffolo, D.; Matthaeus, W. H.; Chuychai, P.

2006-12-01

The observed dropouts of solar energetic particles from impulsive solar events (i.e., the inhomogeneity and sharp gradients in particle density) indicate the partial filamentation of magnetic connection from small regions of the corona to Earth orbit. This can be understood in terms of persistent trapping of field lines due to small- scale topological structures in the solar wind. We further explore how this turbulence structure should be manifest in particle observations, by evaluating particle trajectories obtained from the Newton-Lorentz equations. By adapting a two-component model of turbulence to spherical geometry, we include the adiabatic focusing of particles. The 2D magnetic field is generated by either 1) a 2D fast Fourier transform, a valid approximation over a small angular region, or 2) a spherical harmonic series with ℓ up to 2000. Dropout features at 1 AU are clearly indicated for low-energy particles, but these features are washed out for E >~ 100 MeV. Different time-intensity profiles are found at locations at 1 AU that are distinct with regard to the small-scale topology. Partially supported by the Thailand Research Fund, the Rachadapisek Sompoj Fund of Chulalongkorn University, and NASA Grant NNG05GG83G.

Electromotive force in strongly compressible magnetohydrodynamic turbulence

Science.gov (United States)

Yokoi, N.

2017-12-01

Variable density fluid turbulence is ubiquitous in geo-fluids, not to mention in astrophysics. Depending on the source of density variation, variable density fluid turbulence may be divided into two categories: the weak compressible (entropy mode) turbulence for slow flow and the strong compressible (acoustic mode) turbulence for fast flow. In the strong compressible turbulence, the pressure fluctuation induces a strong density fluctuation ρ ', which is represented by the density variance ( denotes the ensemble average). The turbulent effect on the large-scale magnetic-field B induction is represented by the turbulent electromotive force (EMF) (u': velocity fluctuation, b': magnetic-field fluctuation). In the usual treatment in the dynamo theory, the expression for the EMF has been obtained in the framework of incompressible or weak compressible turbulence, where only the variation of the mean density , if any, is taken into account. We see from the equation of the density fluctuation ρ', the density variance is generated by the large mean density variation ∂ coupled with the turbulent mass flux . This means that in the region where the mean density steeply changes, the density variance effect becomes relevant for the magnetic field evolution. This situation is typically the case for phenomena associated with shocks and compositional discontinuities. With the aid of the analytical theory of inhomogeneous compressible magnetohydrodynamic (MHD) turbulence, the expression for the turbulent electromotive force is investigated. It is shown that, among others, an obliqueness (misalignment) between the mean density gradient ∂ and the mean magnetic field B may contribute to the EMF as ≈χ B×∂ with the turbulent transport coefficient χ proportional to the density variance (χ ). This density variance effect is expected to strongly affect the EMF near the interface, and changes the transport properties of turbulence. In the case of an interface under the MHD slow

Magnetic field profiles during turbulent heating in a toroidal hydrogen plasma

International Nuclear Information System (INIS)

Kalfsbeek, H.W.

1978-12-01

A description is given of the measurements of both poloidal and toroidal magnetic field components as functions of radius and time in a small turbulently heated tokamak. These measurements have been carried out with an array of miniature pick-up coils, enclosed in a quartz tube which is inserted into the plasma. The electric fields inside the plasma, as well as the parallel resistivity profiles are deduced from the measured magnetic fields. The ohmically dissipated energy is determined from the field distributions and compared with the total input energy. The experimental results are compared with the outcome of a numerical model. The consistency with information obtained from other diagnostic measurements is checked. (Auth.)

Fundamental Statistical Descriptions of Plasma Turbulence in Magnetic Fields

Energy Technology Data Exchange (ETDEWEB)

John A. Krommes

2001-02-16

A pedagogical review of the historical development and current status (as of early 2000) of systematic statistical theories of plasma turbulence is undertaken. Emphasis is on conceptual foundations and methodology, not practical applications. Particular attention is paid to equations and formalism appropriate to strongly magnetized, fully ionized plasmas. Extensive reference to the literature on neutral-fluid turbulence is made, but the unique properties and problems of plasmas are emphasized throughout. Discussions are given of quasilinear theory, weak-turbulence theory, resonance-broadening theory, and the clump algorithm. Those are developed independently, then shown to be special cases of the direct-interaction approximation (DIA), which provides a central focus for the article. Various methods of renormalized perturbation theory are described, then unified with the aid of the generating-functional formalism of Martin, Siggia, and Rose. A general expression for the renormalized dielectric function is deduced and discussed in detail. Modern approaches such as decimation and PDF methods are described. Derivations of DIA-based Markovian closures are discussed. The eddy-damped quasinormal Markovian closure is shown to be nonrealizable in the presence of waves, and a new realizable Markovian closure is presented. The test-field model and a realizable modification thereof are also summarized. Numerical solutions of various closures for some plasma-physics paradigms are reviewed. The variational approach to bounds on transport is developed. Miscellaneous topics include Onsager symmetries for turbulence, the interpretation of entropy balances for both kinetic and fluid descriptions, self-organized criticality, statistical interactions between disparate scales, and the roles of both mean and random shear. Appendices are provided on Fourier transform conventions, dimensional and scaling analysis, the derivations of nonlinear gyrokinetic and gyrofluid equations

Fundamental Statistical Descriptions of Plasma Turbulence in Magnetic Fields

International Nuclear Information System (INIS)

Krommes, John A.

2001-01-01

A pedagogical review of the historical development and current status (as of early 2000) of systematic statistical theories of plasma turbulence is undertaken. Emphasis is on conceptual foundations and methodology, not practical applications. Particular attention is paid to equations and formalism appropriate to strongly magnetized, fully ionized plasmas. Extensive reference to the literature on neutral-fluid turbulence is made, but the unique properties and problems of plasmas are emphasized throughout. Discussions are given of quasilinear theory, weak-turbulence theory, resonance-broadening theory, and the clump algorithm. Those are developed independently, then shown to be special cases of the direct-interaction approximation (DIA), which provides a central focus for the article. Various methods of renormalized perturbation theory are described, then unified with the aid of the generating-functional formalism of Martin, Siggia, and Rose. A general expression for the renormalized dielectric function is deduced and discussed in detail. Modern approaches such as decimation and PDF methods are described. Derivations of DIA-based Markovian closures are discussed. The eddy-damped quasinormal Markovian closure is shown to be nonrealizable in the presence of waves, and a new realizable Markovian closure is presented. The test-field model and a realizable modification thereof are also summarized. Numerical solutions of various closures for some plasma-physics paradigms are reviewed. The variational approach to bounds on transport is developed. Miscellaneous topics include Onsager symmetries for turbulence, the interpretation of entropy balances for both kinetic and fluid descriptions, self-organized criticality, statistical interactions between disparate scales, and the roles of both mean and random shear. Appendices are provided on Fourier transform conventions, dimensional and scaling analysis, the derivations of nonlinear gyrokinetic and gyrofluid equations

Turbulent magnetohydrodynamics in liquid metals

International Nuclear Information System (INIS)

Berhanu, Michael

2008-01-01

In electrically conducting fluids, the electromagnetic field is coupled with the fluid motion by induction effects. We studied different magnetohydrodynamic phenomena, using two experiments involving turbulent flows of liquid metal. The first mid-sized uses gallium. The second, using sodium, is conducted within the VKS (Von Karman Sodium) collaboration. It has led to the observation of the dynamo effect, namely converting a part of the kinetic energy of the fluid into magnetic energy. We have shown that, depending on forcing conditions, a statistically stationary dynamo, or dynamical regimes of magnetic field can be generated. In particular, polarity reversals similar to those of Earth's magnetic field were observed. Meanwhile, experiment with Gallium has been developed to study the effects of electromagnetic induction by turbulent flows in a more homogeneous and isotropic configuration than in the VKS experiment. Using data from these two experiments, we studied the advection of magnetic field by a turbulent flow and the induced fluctuations. The development of probes measuring electrical potential difference allowed us to further highlight the magnetic braking of a turbulent flow of Gallium by Lorentz force. This mechanism is involved in the saturation of the dynamo instability. (author) [fr

Disruption of Alfvénic turbulence by magnetic reconnection in a collisionless plasma

Science.gov (United States)

Mallet, Alfred; Schekochihin, Alexander A.; Chandran, Benjamin D. G.

2017-12-01

We calculate the disruption scale \\text{D}$ at which sheet-like structures in dynamically aligned Alfvénic turbulence are destroyed by the onset of magnetic reconnection in a low- collisionless plasma. The scaling of \\text{D}$ depends on the order of the statistics being considered, with more intense structures being disrupted at larger scales. The disruption scale for the structures that dominate the energy spectrum is \\text{D}\\sim L\\bot 1/9(de\\unicode[STIX]{x1D70C}s)4/9$ , where e$ is the electron inertial scale, s$ is the ion sound scale and \\bot $ is the outer scale of the turbulence. When e$ and s/L\\bot $ are sufficiently small, the scale \\text{D}$ is larger than s$ and there is a break in the energy spectrum at \\text{D}$ , rather than at s$ . We propose that the fluctuations produced by the disruption are circularised flux ropes, which may have already been observed in the solar wind. We predict the relationship between the amplitude and radius of these structures and quantify the importance of the disruption process to the cascade in terms of the filling fraction of undisrupted structures and the fractional reduction of the energy contained in them at the ion sound scale s$ . Both of these fractions depend strongly on e$ , with the disrupted structures becoming more important at lower e$ . Finally, we predict that the energy spectrum between \\text{D}$ and s$ is steeper than \\bot -3$ , when this range exists. Such a steep `transition range' is sometimes observed in short intervals of solar-wind turbulence. The onset of collisionless magnetic reconnection may therefore significantly affect the nature of plasma turbulence around the ion gyroscale.

Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates

Science.gov (United States)

Yu, Yisheng

This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances

Science.gov (United States)

Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong

2017-11-01

Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

Scaling, Intermittency and Decay of MHD Turbulence

International Nuclear Information System (INIS)

Lazarian, A.; Cho, Jungyeon

2005-01-01

We discuss a few recent developments that are important for understanding of MHD turbulence. First, MHD turbulence is not so messy as it is usually believed. In fact, the notion of strong non-linear coupling of compressible and incompressible motions along MHD cascade is not tenable. Alfven, slow and fast modes of MHD turbulence follow their own cascades and exhibit degrees of anisotropy consistent with theoretical expectations. Second, the fast decay of turbulence is not related to the compressibility of fluid. Rates of decay of compressible and incompressible motions are very similar. Third, viscosity by neutrals does not suppress MHD turbulence in a partially ionized gas. Instead, MHD turbulence develops magnetic cascade at scales below the scale at which neutrals damp ordinary hydrodynamic motions. Forth, density statistics does not exhibit the universality that the velocity and magnetic field do. For instance, at small Mach numbers the density is anisotropic, but it gets isotropic at high Mach numbers. Fifth, the intermittency of magnetic field and velocity are different. Both depend on whether the measurements are done in a local system of reference oriented along the local magnetic field or in the global system of reference related to the mean magnetic field

Intrinsic Turbulence Stabilization in a Stellarator

Directory of Open Access Journals (Sweden)

P. Xanthopoulos

2016-06-01

Full Text Available The magnetic surfaces of modern stellarators are characterized by complex, carefully optimized shaping and exhibit locally compressed regions of strong turbulence drive. Massively parallel computer simulations of plasma turbulence reveal, however, that stellarators also possess two intrinsic mechanisms to mitigate the effect of this drive. In the regime where the length scale of the turbulence is very small compared to the equilibrium scale set by the variation of the magnetic field, the strongest fluctuations form narrow bandlike structures on the magnetic surfaces. Thanks to this localization, the average transport through the surface is significantly smaller than that predicted at locations of peak turbulence. This feature results in a numerically observed upshift of the onset of turbulence on the surface towards higher ion temperature gradients as compared with the prediction from the most unstable regions. In a second regime lacking scale separation, the localization is lost and the fluctuations spread out on the magnetic surface. Nonetheless, stabilization persists through the suppression of the large eddies (relative to the equilibrium scale, leading to a reduced stiffness for the heat flux dependence on the ion temperature gradient. These fundamental differences with tokamak turbulence are exemplified for the QUASAR stellarator [G. H. Neilson et al., IEEE Trans. Plasma Sci. 42, 489 (2014].

2D turbulence structure observed by a fast framing camera system in linear magnetized device PANTA

International Nuclear Information System (INIS)

Ohdachi, Satoshi; Inagaki, S.; Kobayashi, T.; Goto, M.

2015-01-01

Mesoscale structure, such as the zonal flow and the streamer plays important role in the drift-wave turbulence. The interaction of the mesoscale structure and the turbulence is not only interesting phenomena but also a key to understand the turbulence driven transport in the magnetically confined plasmas. In the cylindrical magnetized device, PANTA, the interaction of the streamer and the drift wave has been found by the bi-spectrum analysis of the turbulence. In order to study the mesoscale physics directly, the 2D turbulence is studied by a fast-framing visible camera system view from a window located at the end plate of the device. The parameters of the plasma is the following; Te∼3eV, n ∼ 1x10 19 m -3 , Ti∼0.3eV, B=900G, Neutral pressure P n =0.8 mTorr, a∼ 6cm, L=4m, Helicon source (7MHz, 3kW). Fluctuating component of the visible image is decomposed by the Fourier-Bessel expansion method. Several rotating mode is observed simultaneously. From the images, m = 1 (f∼0.7 kHz) and m = 2, 3 (f∼-3.4 kHz) components which rotate in the opposite direction can be easily distinguished. Though the modes rotate constantly in most time, there appear periods where the radially complicated node structure is formed (for example, m=3 component, t = 142.5∼6 in the figure) and coherent mode structures are disturbed. Then, a new rotating period is started again with different phase of the initial rotation until the next event happens. The typical time interval of the event is 0.5 to 1.0 times of the one rotation of the slow m = 1 mode. The wave-wave interaction might be interrupted occasionally. Detailed analysis of the turbulence using imaging technique will be discussed. (author)

Turbulence in the solar wind

CERN Document Server

Bruno, Roberto

2016-01-01

This book provides an overview of solar wind turbulence from both the theoretical and observational perspective. It argues that the interplanetary medium offers the best opportunity to directly study turbulent fluctuations in collisionless plasmas. In fact, during expansion, the solar wind evolves towards a state characterized by large-amplitude fluctuations in all observed parameters, which resembles, at least at large scales, the well-known hydrodynamic turbulence. This text starts with historical references to past observations and experiments on turbulent flows. It then introduces the Navier-Stokes equations for a magnetized plasma whose low-frequency turbulence evolution is described within the framework of the MHD approximation. It also considers the scaling of plasma and magnetic field fluctuations and the study of nonlinear energy cascades within the same framework. It reports observations of turbulence in the ecliptic and at high latitude, treating Alfvénic and compressive fluctuations separately in...

Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

DEFF Research Database (Denmark)

Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

2014-01-01

in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

DEFF Research Database (Denmark)

Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde

2014-01-01

and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

Aspects of the statistical theory of stochastic magnetic fields: test particle transport and turbulent collisionless tearing mode

International Nuclear Information System (INIS)

Kleva, R.G.

1980-01-01

The first part of this work is concerned with test particle transport in a stochastic magnetic field. In the absence of collisions, the test particle self-diffusion coefficient is given by D = D/sub m/ V (in the zero gyroradius limit), where D/sub m/ is the magnetic diffusion coefficient due to a given spectrum of magnetic fluctuations and V is the particle velocity along a field line. The effect of collisions, either classical or turbulent, on this result is considered. The second part of this work is concerned with the evolution of the collisionless tearing mode in the presence of a stochastic magnetic field. A statistical closure approximation, obtained from the DIA by neglecting a mode-coupling term, is used to derive a nonlinear dispersion relation. For L 0 < L/sub K/ the dominant nonlinear effect is shown to be a turbulent broadening of the perturbed current layer. Saturation occurs when the perturbed current layer broadens to the point where Δ' = 0, where Δ' is the jump in the logarithmic derivative of the vector potential across the perturbed current layer

Optimization of the Magnetic Field Structure for Sustained Plasma Gun Helicity Injection for Magnetic Turbulence Studies at the Bryn Mawr Plasma Laboratory

Science.gov (United States)

Cartagena-Sanchez, C. A.; Schaffner, D. A.; Johnson, H. K.; Fahim, L. E.

2017-10-01

A long-pulsed magnetic coaxial plasma gun is being implemented and characterized at the Bryn Mawr Plasma Laboratory (BMPL). A cold cathode discharged between the cylindrical electrodes generates and launches plasma into a 24cm diameter, 2m long chamber. Three separately pulsed magnetic coils are carefully positioned to generate radial magnetic field between the electrodes at the gun edge in order to provide stuffing field. Magnetic helicity is continuously injected into the flux-conserving vacuum chamber in a process akin to sustained slow-formation of spheromaks. The aim of this source, however, is to supply long pulses of turbulent magnetized plasma for measurement rather than for sustained spheromak production. The work shown here details the optimization of the magnetic field structure for this sustained helicity injection.

Combinations of response-reinforcer relations in periodic and aperiodic schedules.

Science.gov (United States)

Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E

2013-03-01

Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

Suppressing Electron Turbulence and Triggering Internal Transport Barriers with Reversed Magnetic Shear in the National Spherical Torus Experiment

Science.gov (United States)

Peterson, Jayson Luc

2011-10-01

Observations in the National Spherical Torus Experiment (NSTX) have found electron temperature gradients that greatly exceed the linear threshold for the onset for electron temperature gradient-driven (ETG) turbulence. These discharges, deemed electron internal transport barriers (e-ITBs), coincide with a reversal in the shear of the magnetic field and with a reduction in electron-scale density fluctuations, qualitatively consistent with earlier gyrokinetic predictions. To investigate this phenomenon further, we numerically model electron turbulence in NSTX reversed-shear plasmas using the gyrokinetic turbulence code GYRO. These first-of-a-kind nonlinear gyrokinetic simulations of NSTX e-ITBs confirm that reversing the magnetic shear can allow the plasma to reach electron temperature gradients well beyond the critical gradient for the linear onset of instability. This effect is very strong, with the nonlinear threshold for significant transport approaching three times the linear critical gradient in some cases, in contrast with moderate shear cases, which can drive significant ETG turbulence at much lower gradients. In addition to the experimental implications of this upshifted nonlinear critical gradient, we explore the behavior of ETG turbulence during reversed shear discharges. This work is supported by the SciDAC Center for the Study of Plasma Microturbulence, DOE Contract DE-AC02-09CH11466, and used the resources of NCCS at ORNL and NERSC at LBNL. M. Ono et al., Nucl. Fusion 40, 557 (2000).

Generation of a Magnetic Field by Dynamo Action in a Turbulent Flow of Liquid Sodium

International Nuclear Information System (INIS)

Monchaux, R.; Chiffaudel, A.; Daviaud, F.; Dubrulle, B.; Gasquet, C.; Marie, L.; Ravelet, F.; Berhanu, M.; Fauve, S.; Mordant, N.; Petrelis, F.; Bourgoin, M.; Moulin, M.; Odier, Ph.; Pinton, J.-F.; Volk, R.

2007-01-01

We report the observation of dynamo action in the von Karman sodium experiment, i.e., the generation of a magnetic field by a strongly turbulent swirling flow of liquid sodium. Both mean and fluctuating parts of the field are studied. The dynamo threshold corresponds to a magnetic Reynolds number R m ∼30. A mean magnetic field of the order of 40 G is observed 30% above threshold at the flow lateral boundary. The rms fluctuations are larger than the corresponding mean value for two of the components. The scaling of the mean square magnetic field is compared to a prediction previously made for high Reynolds number flows

Statistical properties of turbulence in a toroidal magnetized ECR plasma

International Nuclear Information System (INIS)

Yu Yi; Lu Ronghua; Wang Zhijiang; Wen Yizhi; Yu Changxuan; Wan Shude; Liu, Wandong

2008-01-01

The statistical analyses of fluctuation data measured by electrostatic-probe arrays clearly show that the self-organized criticality (SOC) avalanches are not the dominant behaviors in a toroidal ECR plasma in the SMT (Simple Magnetic Torus) mode of KT-5D device. The f -1 index region in the auto-correlation spectra of the floating potential V f and the ion saturation current I s , which is a fingerprint of a SOC system, ranges only in a narrow frequency band. By investigating the Hurst exponents at increasingly coarse grained time series, we find that at a time scale of τ>100 μs, there exists no or a very weak long-range correlation over two decades in τ. The difference between the PDFs of I s and V f clearly shows a more global nature of the latter. The transport flux induced by the turbulence suggests that the natural intermittency of turbulent transport maybe independent of the avalanche induced by near criticality. The drift instability is dominant in a SMT plasma generated by means of ECR discharges

ANISOTROPIC INTERMITTENCY OF MAGNETOHYDRODYNAMIC TURBULENCE

International Nuclear Information System (INIS)

Osman, K. T.; Kiyani, K. H.; Chapman, S. C.; Hnat, B.

2014-01-01

A higher-order multiscale analysis of spatial anisotropy in inertial range magnetohydrodynamic turbulence is presented using measurements from the STEREO spacecraft in fast ambient solar wind. We show for the first time that, when measuring parallel to the local magnetic field direction, the full statistical signature of the magnetic and Elsässer field fluctuations is that of a non-Gaussian globally scale-invariant process. This is distinct from the classic multiexponent statistics observed when the local magnetic field is perpendicular to the flow direction. These observations are interpreted as evidence for the weakness, or absence, of a parallel magnetofluid turbulence energy cascade. As such, these results present strong observational constraints on the statistical nature of intermittency in turbulent plasmas

Advection of long lived density blobs in the turbulent state of a simple magnetized torus plasma

International Nuclear Information System (INIS)

Barni, R; Riccardi, C

2009-01-01

The turbulent regime of a simple magnetized toroidal plasma column has been studied in the plasma device Thorello. The detection and the study of the spatio-temporal evolution of structures have been performed by means of conditional sampling techniques as well as other statistical tools. As a result the evidence of plasma blob formation and expulsion from the edge of the main plasma column has been obtained. The relation between structure phenomenology and statistical characteristics of the turbulent regime has been investigated. The motion of the density structures in the edge region of our device does not look ballistic but rather driven by the overall potential profile established in the turbulent state. Potential fluctuations are strongly anti-correlated with density structures, located in the same position and somewhat more extended. They provide a shallow potential well with a flat bottom and quite sharp edges surrounding and co-moving with the blobs. Blob lifetime exceeds the residence time associated with the overall E x B drift field. Then such persistent structures provide a means for a net convection of the charged particles to the limiter, across the magnetic field and beyond the edge region of the plasma.

Can a metaphor of physics contribute to MEG neuroscience research? Intermittent turbulent eddies in brain magnetic fields

International Nuclear Information System (INIS)

Mandell, Arnold J.

2013-01-01

A common manifestation of nonlinear mathematical and experimental neurobiological dynamical systems in transition, intermittence, is currently being attended by concepts from physics such as turbulent eddy and the avalanche of critical systems. Do these concepts constitute an enticing poetry of dynamical universality or do these metaphors from physics generate more specific novel and relevant concepts and experiments in the neurosciences? Using six graphics and ten measures derived from the ergodic theory of dynamical systems, we study the magnetoencephalic, MEG, records of taskless, “resting” human subjects to find consistent evidence for turbulent (chaotic) dynamics marked by intermittent turbulent eddies. This brings up an apparent discrepancy via the juxtaposition of the superposition characteristics of magnetic fields and the non-superposition properties of turbulent flow. Treating this apparent inconsistency as an existent duality, we propose a physical model for how that might be the case. This leaves open the question: has the physical metaphor, turbulent eddy, contributed to a scientific understanding of the human resting MEG?

Investigation of aperiodic W/C multi-layer mirror for X-ray optics

International Nuclear Information System (INIS)

Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan

2011-01-01

Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

International Nuclear Information System (INIS)

Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

2011-01-01

The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

A dynamics investigation into edge plasma turbulence

International Nuclear Information System (INIS)

Thomsen, H.

2002-08-01

The present experimental work investigates plasma turbulence in the edge region of magnetized high-temperature plasmas. A main topic is the turbulent dynamics parallel to the magnetic field, where hitherto only a small data basis existed, especially for very long scale lengths in the order of ten of meters. A second point of special interest is the coupling of the dynamics parallel and perpendicular to the magnetic field. This anisotropic turbulent dynamics is investigated by two different approaches. Firstly, spatially and temporally high-resolution measurements of fluctuating plasma parameters are investigated by means of two-point correlation analysis. Secondly, the propagation of signals externally imposed into the turbulent plasma background is studied. For both approaches, Langmuir probe arrays were utilized for diagnostic purposes. (orig.)

Turbulent resistivity driven by the magnetorotational instability

Science.gov (United States)

Fromang, S.; Stone, J. M.

2009-11-01

Aims: We measure the turbulent resistivity in the nonlinear regime of the MRI, and evaluate the turbulent magnetic Prandtl number. Methods: We perform a set of numerical simulations with the Eulerian finite volume codes Athena and Ramses in the framework of the shearing box model. We consider models including explicit dissipation coefficients and magnetic field topologies such that the net magnetic flux threading the box in both the vertical and azimuthal directions vanishes. Results: We first demonstrate good agreement between the two codes by comparing the properties of the turbulent states in simulations having identical microscopic diffusion coefficients (viscosity and resistivity). We find the properties of the turbulence do not change when the box size is increased in the radial direction, provided it is elongated in the azimuthal direction. To measure the turbulent resistivity in the disk, we impose a fixed electromotive force on the flow and measure the amplitude of the saturated magnetic field that results. We obtain a turbulent resistivity that is in rough agreement with mean field theories like the Second Order Smoothing Approximation. The numerical value translates into a turbulent magnetic Prandtl number Pmt of order unity. Pmt appears to be an increasing function of the forcing we impose. It also becomes smaller as the box size is increased in the radial direction, in good agreement with previous results obtained in very large boxes. Conclusions: Our results are in general agreement with other recently published papers studying the same problem but using different methodology. Thus, our conclusion that Pmt is of order unity appears robust.

Drift wave turbulence in low-β plasmas

DEFF Research Database (Denmark)

Mikkelsen, Torben; Larsen, Søren Ejling; Pécseli, Hans

1983-01-01

Experimental investigations of strong turbulence associated with the radial density gradient of a rotating magnetized plasma column are reported. The experiment is designed to make Taylor's hypothesis effective, in order to allow a simple interpretation of measured frequency spectra in terms of w...... spectrum is demonstrated. Some aspects of the relative diffusion of a test-cloud of charged particles released in the turbulent field are discussed.......Experimental investigations of strong turbulence associated with the radial density gradient of a rotating magnetized plasma column are reported. The experiment is designed to make Taylor's hypothesis effective, in order to allow a simple interpretation of measured frequency spectra in terms...... of wavenumber spectra. The spectral index of the turbulent potential fluctuations is determined and the variation of the spectral intensity is investigated for varying magnetic fields. The results compare favourably with theoretical predictions. The importance of distinguishing subranges in the turbulent...

Magnetic Reconnection as a Driver for a Sub-ion-scale Cascade in Plasma Turbulence

Czech Academy of Sciences Publication Activity Database

Franci, L.; Cerri, S.S.; Califano, F.; Landi, S.; Papini, E.; Verdini, A.; Matteini, L.; Jenko, F.; Hellinger, Petr

2017-01-01

Roč. 850, č. 1 (2017), L16/1-L16/6 ISSN 2041-8205 R&D Projects: GA ČR GA15-10057S Institutional support: RVO:67985815 Keywords : magnetic reconnection * solar wind * turbulence Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics OBOR OECD: Astronomy (including astrophysics,space science) Impact factor: 5.522, year: 2016

A PROPOSED PARADIGM FOR SOLAR CYCLE DYNAMICS MEDIATED VIA TURBULENT PUMPING OF MAGNETIC FLUX IN BABCOCK–LEIGHTON-TYPE SOLAR DYNAMOS

Energy Technology Data Exchange (ETDEWEB)

Hazra, Soumitra; Nandy, Dibyendu [Department of Physical Sciences, Indian Institute of Science Education and Research, Kolkata (India)

2016-11-20

At present, the Babcock–Leighton flux transport solar dynamo models appear to be the most promising models for explaining diverse observational aspects of the sunspot cycle. The success of these flux transport dynamo models is largely dependent upon a single-cell meridional circulation with a deep equatorward component at the base of the Sun’s convection zone. However, recent observations suggest that the meridional flow may in fact be very shallow (confined to the top 10% of the Sun) and more complex than previously thought. Taken together, these observations raise serious concerns on the validity of the flux transport paradigm. By accounting for the turbulent pumping of magnetic flux, as evidenced in magnetohydrodynamic simulations of solar convection, we demonstrate that flux transport dynamo models can generate solar-like magnetic cycles even if the meridional flow is shallow. Solar-like periodic reversals are recovered even when meridional circulation is altogether absent. However, in this case, the solar surface magnetic field dynamics does not extend all the way to the polar regions. Very importantly, our results demonstrate that the Parker–Yoshimura sign rule for dynamo wave propagation can be circumvented in Babcock–Leighton dynamo models by the latitudinal component of turbulent pumping, which can generate equatorward propagating sunspot belts in the absence of a deep, equatorward meridional flow. We also show that variations in turbulent pumping coefficients can modulate the solar cycle amplitude and periodicity. Our results suggest the viability of an alternate magnetic flux transport paradigm—mediated via turbulent pumping—for sustaining solar-stellar dynamo action.

A PROPOSED PARADIGM FOR SOLAR CYCLE DYNAMICS MEDIATED VIA TURBULENT PUMPING OF MAGNETIC FLUX IN BABCOCK–LEIGHTON-TYPE SOLAR DYNAMOS

International Nuclear Information System (INIS)

Hazra, Soumitra; Nandy, Dibyendu

2016-01-01

At present, the Babcock–Leighton flux transport solar dynamo models appear to be the most promising models for explaining diverse observational aspects of the sunspot cycle. The success of these flux transport dynamo models is largely dependent upon a single-cell meridional circulation with a deep equatorward component at the base of the Sun’s convection zone. However, recent observations suggest that the meridional flow may in fact be very shallow (confined to the top 10% of the Sun) and more complex than previously thought. Taken together, these observations raise serious concerns on the validity of the flux transport paradigm. By accounting for the turbulent pumping of magnetic flux, as evidenced in magnetohydrodynamic simulations of solar convection, we demonstrate that flux transport dynamo models can generate solar-like magnetic cycles even if the meridional flow is shallow. Solar-like periodic reversals are recovered even when meridional circulation is altogether absent. However, in this case, the solar surface magnetic field dynamics does not extend all the way to the polar regions. Very importantly, our results demonstrate that the Parker–Yoshimura sign rule for dynamo wave propagation can be circumvented in Babcock–Leighton dynamo models by the latitudinal component of turbulent pumping, which can generate equatorward propagating sunspot belts in the absence of a deep, equatorward meridional flow. We also show that variations in turbulent pumping coefficients can modulate the solar cycle amplitude and periodicity. Our results suggest the viability of an alternate magnetic flux transport paradigm—mediated via turbulent pumping—for sustaining solar-stellar dynamo action.

Shape control in wafer-based aperiodic 3D nanostructures

International Nuclear Information System (INIS)

Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen

2014-01-01

Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

Evidence for equivalence of diffusion processes of passive scalar and magnetic fields in anisotropic Navier-Stokes turbulence.

Science.gov (United States)

Jurčišinová, E; Jurčišin, M

2017-05-01

The influence of the uniaxial small-scale anisotropy on the kinematic magnetohydrodynamic turbulence is investigated by using the field theoretic renormalization group technique in the one-loop approximation of a perturbation theory. The infrared stable fixed point of the renormalization group equations, which drives the scaling properties of the model in the inertial range, is investigated as the function of the anisotropy parameters and it is shown that, at least at the one-loop level of approximation, the diffusion processes of the weak passive magnetic field in the anisotropically driven kinematic magnetohydrodynamic turbulence are completely equivalent to the corresponding diffusion processes of passively advected scalar fields in the anisotropic Navier-Stokes turbulent environments.

Strong Turbulence in Low-beta Plasmas

DEFF Research Database (Denmark)

Tchen, C. M.; Pécseli, Hans; Larsen, Søren Ejling

1980-01-01

An investigation of the spectral structure of turbulence in a plasma confined by a strong homogeneous magnetic field was made by means of a fluid description. The turbulent spectrum is divided into subranges. Mean gradients of velocity and density excite turbulent motions, and govern the production......-cathode reflex arc, Stellarator, Zeta discharge, ionospheric plasmas, and auroral plasma turbulence....

Turbulent Liquid Metal Dynamo Experiments

International Nuclear Information System (INIS)

Forest, Cary

2007-01-01

The self-generation of magnetic fields in planets and stars--the dynamo effect--is a long-standing problem of magnetohydrodynamics and plasma physics. Until recently, research on the self-excitation process has been primarily theoretical. In this talk, I will begin with a tutorial on how magnetic fields are generated in planets and stars, describing the 'Standard Model' of self-excitation known as the alpha-omega dynamo. In this model, axisymmetric differential rotation can produce the majority of the magnetic field, but some non-axisymmetric, turbulence driven currents are also necessary. Understanding the conversion of turbulent kinetic energy in the fluid motion into electrical currents and thus magnetic fields, is a major challenge for both experiments and theory at this time. I will then report on recent results from a 1 meter diameter, spherical, liquid sodium dynamo experiment at the University of Wisconsin, in which the first clear evidence for these turbulence driven currents has been observed.

Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

Science.gov (United States)

Kato, N.

2017-12-01

Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

The structure and statistics of interstellar turbulence

International Nuclear Information System (INIS)

Kritsuk, A G; Norman, M L; Ustyugov, S D

2017-01-01

We explore the structure and statistics of multiphase, magnetized ISM turbulence in the local Milky Way by means of driven periodic box numerical MHD simulations. Using the higher order-accurate piecewise-parabolic method on a local stencil (PPML), we carry out a small parameter survey varying the mean magnetic field strength and density while fixing the rms velocity to observed values. We quantify numerous characteristics of the transient and steady-state turbulence, including its thermodynamics and phase structure, kinetic and magnetic energy power spectra, structure functions, and distribution functions of density, column density, pressure, and magnetic field strength. The simulations reproduce many observables of the local ISM, including molecular clouds, such as the ratio of turbulent to mean magnetic field at 100 pc scale, the mass and volume fractions of thermally stable Hi, the lognormal distribution of column densities, the mass-weighted distribution of thermal pressure, and the linewidth-size relationship for molecular clouds. Our models predict the shape of magnetic field probability density functions (PDFs), which are strongly non-Gaussian, and the relative alignment of magnetic field and density structures. Finally, our models show how the observed low rates of star formation per free-fall time are controlled by the multiphase thermodynamics and large-scale turbulence. (paper)

Effect of Resonant Magnetic Perturbations on secondary structures in Drift-Wave turbulence

Science.gov (United States)

Leconte, Michael

2011-10-01

In this work, we study the effects of RMPs on turbulence, flows and confinement, in the framework of two paradigmatic models, resistive ballooning and resistive drift waves. For resistive ballooning turbulence, we use 3D global numerical simulations, including RMP fields and (externally-imposed) sheared rotation profile. Without RMPs, relaxation oscillations of the pressure profile occur. With RMPs, results show that long-lived convection cells are generated by the combined effects of pressure modulation and toroidal curvature coupling. These modify the global structure of the turbulence and eliminate relaxation oscillations. This effect is due mainly to a modification of the pressure profile linked to the presence of residual magnetic island chains. Hence convection-cell generation increases for increasing δBr/B0. For RMP effect on zonal flows in drift wave turbulence, we extend the Hasegawa-Wakatani model to include RMP fields. The effect of the RMPs is to induce a linear coupling between the zonal electric field and the zonal density gradient, which drives the system to a state of electron radial force balance for large δBr/B0. Both the vorticity flux (Reynolds stress), and particle flux are modulated. We derive an extended predator prey model which couples zonal potential and density dynamics to the evolution of turbulence intensity. This model has both turbulence drive and RMP amplitude as control parameters, and predicts a novel type of transport bifurcation in the presence of RMPs. We find a novel set of system states that are similar to the Hmode-like state of the standard predator-prey model, but for which the power threshold is now a function of the RMP strength. For small RMP amplitude and low collisionality, both the ambient turbulence and zonal flow energy increase with δBr/B0. For larger RMP strength, the turbulence energy increases, but the energy of zonal flows decreases with δBr/B0, corresponding to a damping of zonal flows. At high

Astrophysical Gyrokinetics: Kinetic and Fluid Turbulent Cascades In Magnetized Weakly Collisional Plasmas

International Nuclear Information System (INIS)

Schekochihin, A.A.; Cowley, S.C.; Dorland, W.; Hammett, G.W.; Howes, G.G.; Quataert, E.; Tatsuno, T.

2009-01-01

This paper presents a theoretical framework for understanding plasma turbulence in astrophysical plasmas. It is motivated by observations of electromagnetic and density fluctuations in the solar wind, interstellar medium and galaxy clusters, as well as by models of particle heating in accretion disks. All of these plasmas and many others have turbulent motions at weakly collisional and collisionless scales. The paper focuses on turbulence in a strong mean magnetic field. The key assumptions are that the turbulent fluctuations are small compared to the mean field, spatially anisotropic with respect to it and that their frequency is low compared to the ion cyclotron frequency. The turbulence is assumed to be forced at some system-specific outer scale. The energy injected at this scale has to be dissipated into heat, which ultimately cannot be accomplished without collisions. A kinetic cascade develops that brings the energy to collisional scales both in space and velocity. The nature of the kinetic cascade in various scale ranges depends on the physics of plasma fluctuations that exist there. There are four special scales that separate physically distinct regimes: the electron and ion gyroscales, the mean free path and the electron diffusion scale. In each of the scale ranges separated by these scales, the fully kinetic problem is systematically reduced to a more physically transparent and computationally tractable system of equations, which are derived in a rigorous way. In the 'inertial range' above the ion gyroscale, the kinetic cascade separates into two parts: a cascade of Alfvenic fluctuations and a passive cascade of density and magnetic-field strength fluctuations. The former are governed by the Reduced Magnetohydrodynamic (RMHD) equations at both the collisional and collisionless scales; the latter obey a linear kinetic equation along the (moving) field lines associated with the Alfvenic component (in the collisional limit, these compressive fluctuations

Turbulence of high-beta plasma

International Nuclear Information System (INIS)

Khvesyuk, V.I.; Chirkov, A.Y.

1999-01-01

Principals of numerical modelling of turbulence in high-beta plasma (β > 0.1) are discussed. Creation of transport model for axial symmetric nonuniform confining magnetic field is considered. Numerical model of plasma turbulence in FRC is presented. The physical and mathematical models are formulated from nonuniform axial symmetric high-beta plasma. It is shown that influence of waves arise under this plasma conditions lead to chaotic motion of charged particles across magnetic field. (author)

Dissipation range turbulent cascades in plasmas

International Nuclear Information System (INIS)

Terry, P. W.; Almagri, A. F.; Forest, C. B.; Nornberg, M. D.; Rahbarnia, K.; Sarff, J. S.; Fiksel, G.; Hatch, D. R.; Jenko, F.; Prager, S. C.; Ren, Y.

2012-01-01

Dissipation range cascades in plasma turbulence are described and spectra are formulated from the scaled attenuation in wavenumber space of the spectral energy transfer rate. This yields spectra characterized by the product of a power law and exponential fall-off, applicable to all scales. Spectral indices of the power law and exponential fall-off depend on the scaling of the dissipation, the strength of the nonlinearity, and nonlocal effects when dissipation rates of multiple fluctuation fields are different. The theory is used to derive spectra for MHD turbulence with magnetic Prandtl number greater than unity, extending previous work. The theory is also applied to generic plasma turbulence by considering the spectrum from damping with arbitrary wavenumber scaling. The latter is relevant to ion temperature gradient turbulence modeled by gyrokinetics. The spectrum in this case has an exponential component that becomes weaker at small scale, giving a power law asymptotically. Results from the theory are compared to three very different types of turbulence. These include the magnetic plasma turbulence of the Madison Symmetric Torus, the MHD turbulence of liquid metal in the Madison Dynamo Experiment, and gyrokinetic simulation of ion temperature gradient turbulence.

Inertial range spectrum of field-aligned whistler turbulence

DEFF Research Database (Denmark)

Dwivedi, Navin Kumar; Singh, Shobhana

2017-01-01

the background magnetic field is exploited to derive the inertial range scaling laws corresponding to the electric field and magnetic field fluctuations. The model is based on the concept of Iroshnikov-Kraichnan inertial range magnetohydrodynamic turbulence. The present phenomenological turbulence scaling model...

Turbulent equipartitions in two dimensional drift convection

International Nuclear Information System (INIS)

Isichenko, M.B.; Yankov, V.V.

1995-01-01

Unlike the thermodynamic equipartition of energy in conservative systems, turbulent equipartitions (TEP) describe strongly non-equilibrium systems such as turbulent plasmas. In turbulent systems, energy is no longer a good invariant, but one can utilize the conservation of other quantities, such as adiabatic invariants, frozen-in magnetic flux, entropy, or combination thereof, in order to derive new, turbulent quasi-equilibria. These TEP equilibria assume various forms, but in general they sustain spatially inhomogeneous distributions of the usual thermodynamic quantities such as density or temperature. This mechanism explains the effects of particle and energy pinch in tokamaks. The analysis of the relaxed states caused by turbulent mixing is based on the existence of Lagrangian invariants (quantities constant along fluid-particle or other orbits). A turbulent equipartition corresponds to the spatially uniform distribution of relevant Lagrangian invariants. The existence of such turbulent equilibria is demonstrated in the simple model of two dimensional electrostatically turbulent plasma in an inhomogeneous magnetic field. The turbulence is prescribed, and the turbulent transport is assumed to be much stronger than the classical collisional transport. The simplicity of the model makes it possible to derive the equations describing the relaxation to the TEP state in several limits

Spatial structure of ion-scale plasma turbulence

Directory of Open Access Journals (Sweden)

Yasuhito eNarita

2014-03-01

Full Text Available Spatial structure of small-scale plasma turbulence is studied under different conditions of plasma parameter beta directly in the three-dimensional wave vector domain. Two independent approaches are taken: observations of turbulent magnetic field fluctuations in the solar wind measured by four Cluster spacecraft, and direct numerical simulations of plasma turbulence using the hybrid code AIKEF, both resolving turbulence on the ion kinetic scales. The two methods provide independently evidence of wave vector anisotropy as a function of beta. Wave vector anisotropy is characterized primarily by an extension of the energy spectrum in the direction perpendicular to the large-scale magnetic field. The spectrum is strongly anisotropic at lower values of beta, and is more isotropic at higher values of beta. Cluster magnetic field data analysis also provides evidence of axial asymmetry of the spectrum in the directions around the large-scale field. Anisotropy is interpreted as filament formation as plasma evolves into turbulence. Axial asymmetry is interpreted as the effect of radial expansion of the solar wind from the corona.

Disappearance of Anisotropic Intermittency in Large-amplitude MHD Turbulence and Its Comparison with Small-amplitude MHD Turbulence

Science.gov (United States)

Yang, Liping; Zhang, Lei; He, Jiansen; Tu, Chuanyi; Li, Shengtai; Wang, Xin; Wang, Linghua

2018-03-01

Multi-order structure functions in the solar wind are reported to display a monofractal scaling when sampled parallel to the local magnetic field and a multifractal scaling when measured perpendicularly. Whether and to what extent will the scaling anisotropy be weakened by the enhancement of turbulence amplitude relative to the background magnetic strength? In this study, based on two runs of the magnetohydrodynamic (MHD) turbulence simulation with different relative levels of turbulence amplitude, we investigate and compare the scaling of multi-order magnetic structure functions and magnetic probability distribution functions (PDFs) as well as their dependence on the direction of the local field. The numerical results show that for the case of large-amplitude MHD turbulence, the multi-order structure functions display a multifractal scaling at all angles to the local magnetic field, with PDFs deviating significantly from the Gaussian distribution and a flatness larger than 3 at all angles. In contrast, for the case of small-amplitude MHD turbulence, the multi-order structure functions and PDFs have different features in the quasi-parallel and quasi-perpendicular directions: a monofractal scaling and Gaussian-like distribution in the former, and a conversion of a monofractal scaling and Gaussian-like distribution into a multifractal scaling and non-Gaussian tail distribution in the latter. These results hint that when intermittencies are abundant and intense, the multifractal scaling in the structure functions can appear even if it is in the quasi-parallel direction; otherwise, the monofractal scaling in the structure functions remains even if it is in the quasi-perpendicular direction.

Wavenumber spectrum of whistler turbulence: Particle-in-cell simulation

International Nuclear Information System (INIS)

Saito, S.; Gary, S. Peter; Narita, Y.

2010-01-01

The forward cascade of decaying whistler turbulence is studied in low beta plasma to understand essential properties of the energy spectrum at electron scales, by using a two-dimensional electromagnetic particle-in-cell (PIC) simulation. This simulation demonstrates turbulence in which the energy cascade rate is greater than the dissipation rate at the electron inertial length. The PIC simulation shows that the magnetic energy spectrum of forward-cascaded whistler turbulence at electron inertial scales is anisotropic and develops a very steep power-law spectrum which is consistent with recent solar wind observations. A comparison of the simulated spectrum with that predicted by a phenomenological turbulence scaling model suggests that the energy cascade at the electron inertial scale depends on both magnetic fluctuations and electron velocity fluctuations, as well as on the whistler dispersion relation. Thus, not only kinetic Alfven turbulence but also whistler turbulence may explain recent solar wind observations of very steep magnetic spectra at short scales.

Hydraulic concentration of magnetic fields in the solar photosphere. I - Turbulent pumping

Science.gov (United States)

Parker, E. N.

1974-01-01

Observations suggest that most of the magnetic flux through the solar photosphere is concentrated in vertical filaments in the supergranule boundaries. Each filament appears to contain about 3 times 10 to the 18-th power maxwells, in the form of a field of 500 gauss or more, over a diameter of 700 km or less. The magnetic energy density in the filaments is 100 times the observed kinetic energy density of the observed supergranule motions, but comparable to the kinetic energy density of the granules. Force-free field configurations cannot duplicate the observational numbers, nor can such cooling effects as are believed responsible for the intense fields in sunspot umbrae. We point out a simple hydraulic mechanism (turbulent pumping) that appears to account for the observed concentration of fields.

An empirical investigation of compressibility in magnetohydrodynamic turbulence

International Nuclear Information System (INIS)

Spangler, Steven R.; Spitler, Laura G.

2004-01-01

The density fluctuations which occur in magnetohydrodynamic (MHD) turbulence are an important diagnostic of the turbulent dynamics, and serve as the basis of astrophysical remote sensing measurements. This paper is concerned with the relation between density fluctuations and fluctuations of the magnetic field and velocity. The approach is empirical, utilizing spacecraft observations of slow solar wind turbulence. Sixty-six data intervals of 1 h duration were chosen, in which the solar wind speed was less than 450 km/s, and in which the fluctuations in density and vector magnetic field appeared to be approximately stationary. The parameters of interest were the root-mean-square fluctuations of density and magnetic field, normalized by the respective mean values, ε N ≡ 2 > 0.5 /n 0 and ε B ≡ 2 > 0.5 /B 0 , respectively, where n 0 and B 0 are the mean plasma number density and magnetic field strength. The conclusions of this study are as follows: (1) Consistent with previous investigations, the dependence of the normalized density fluctuation on the normalized magnetic field fluctuation is found to be between linear (ε N =ε B ) and quadratic (ε N =ε B 2 ). (2) The value of R≡ε N /ε B shows a wide range from 4; the median value is 0.46 and the mean is 0.72. (3) Typical normalized fluctuation amplitudes (ε N and ε B ) for records of one hour length (maximum scale size of ≅1.6x10 6 km) are 0.03-0.08 for the density, and 0.04-0.21 for the magnetic field. (4) For most intervals, the magnitude of the perpendicular (to the large scale magnetic field) magnetic field fluctuations exceeds that of the parallel fluctuations by a factor of 3-4. This indicates that the turbulent magnetic field fluctuations are primarily transverse fluctuations. The implications of these results for theories of MHD turbulence, and for the remote sensing of turbulent plasmas such as the corona, the near-Sun solar wind, and the interstellar medium, are discussed

Optimized emission in nanorod arrays through quasi-aperiodic inverse design.

Science.gov (United States)

Anderson, P Duke; Povinelli, Michelle L

2015-06-01

We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

Characterisation of edge turbulence in relation to edge magnetic field configuration in L-mode plasmas in the Mega Amp Spherical Tokamak.

Science.gov (United States)

Dewhurst, J.; Hnat, B.; Dudson, B.; Dendy, R. O.; Counsell, G. F.; Kirk, A.

2007-12-01

Almost all astrophysical and magnetically confined fusion plasmas are turbulent. Here, we examine ion saturation current (Isat) measurements of edge plasma turbulence for three MAST L-mode plasmas that differ primarily in their edge magnetic field configurations. First, absolute moments of the coarse grained data are examined to obtain accurate values of scaling exponents. The dual scaling behaviour is identified in all samples, with the temporal scale τ ≍ 40-60 μs separating the two regimes. Strong universality is then identified in the functional form of the probability density function (PDF) for Isat fluctuations, which is well approximated by the Fréchet distribution on temporal scales τ ≤ 40μs. For temporal scales τ > 40μs, the PDFs appear to converge to the Gumbel distribution, which has been previously identified as a universal feature of many other complex phenomena. The optimal fitting parameters k=1.15 for Fréchet and a=1.35 for Gumbel provide a simple quantitative characterisation of the full spectrum of fluctuations. We conclude that, to good approximation, the properties of the edge turbulence are independent of the edge magnetic field configuration.

Magnetic Reconnection in MHD and Kinetic Turbulence

Science.gov (United States)

Loureiro, Nuno; Boldyrev, Stanislav

2017-10-01

Recent works have revisited the current understanding of Alfvénic turbulence to account for the role of magnetic reconnection. Theoretical arguments suggest that reconnection inevitably becomes important in the inertial range, at the scale where it becomes faster than the eddy turnover time. This leads to a transition to a new sub-inertial interval, suggesting a route to energy dissipation that is fundamentally different from that envisioned in the usual Kolmogorov-like phenomenology. These concepts can be extended to collisionless plasmas, where reconnection is enabled by electron inertia rather than resistivity. Although several different cases must then be considered, a common result is that the energy spectrum exhibits a scaling with the perpendicular wave number that scales between k⊥- 8 / 3 and k⊥- 3 , in favourable agreement with many numerical results and observations. Work supported by NSF-DOE Partnership in Basic Plasma Science and Engineering, Award No. DE-SC0016215, and by NSF CAREER Award No. 1654168 (NFL); and by NSF Grant NSF AGS- 1261659 and by the Vilas Associates Award of UWM (SB).

Energy partitioning constraints at kinetic scales in low-β turbulence

Science.gov (United States)

Gershman, Daniel J.; F.-Viñas, Adolfo; Dorelli, John C.; Goldstein, Melvyn L.; Shuster, Jason; Avanov, Levon A.; Boardsen, Scott A.; Stawarz, Julia E.; Schwartz, Steven J.; Schiff, Conrad; Lavraud, Benoit; Saito, Yoshifumi; Paterson, William R.; Giles, Barbara L.; Pollock, Craig J.; Strangeway, Robert J.; Russell, Christopher T.; Torbert, Roy B.; Moore, Thomas E.; Burch, James L.

2018-02-01

Turbulence is a fundamental physical process through which energy injected into a system at large scales cascades to smaller scales. In collisionless plasmas, turbulence provides a critical mechanism for dissipating electromagnetic energy. Here, we present observations of plasma fluctuations in low-β turbulence using data from NASA's Magnetospheric Multiscale mission in Earth's magnetosheath. We provide constraints on the partitioning of turbulent energy density in the fluid, ion-kinetic, and electron-kinetic ranges. Magnetic field fluctuations dominated the energy density spectrum throughout the fluid and ion-kinetic ranges, consistent with previous observations of turbulence in similar plasma regimes. However, at scales shorter than the electron inertial length, fluctuation power in electron kinetic energy significantly exceeded that of the magnetic field, resulting in an electron-motion-regulated cascade at small scales. This dominance is highly relevant for the study of turbulence in highly magnetized laboratory and astrophysical plasmas.

Turbulence and particle acceleration

International Nuclear Information System (INIS)

Scott, J.S.

1975-01-01

A model for the production of high energy particles in the supernova remnant Cas A is considered. The ordered expansion of the fast moving knots produce turbulent cells in the ambient interstellar medium. The turbulent cells act as magnetic scattering centers and charged particles are accelerated to large energies by the second order Fermi mechanism. Model predictions are shown to be consistent with the observed shape and time dependence of the radio spectrum, and with the scale size of magnetic field irregularities. Assuming a galactic supernova rate at 1/50 yr -1 , this mechanism is capable of producing the observed galactic cosmic ray flux and spectrum below 10 16 eV/nucleon. Several observed features of galactic cosmic rays are shown to be consistent with model predictions. A model for the objects known as radio tall galaxies is also presented. Independent blobs of magnetized plasma emerging from an active radio galaxy into an intracluster medium become turbulent due to Rayleigh--Taylor and Kelvin--Helmholz instabilities. The turbulence produces both in situ betatron and 2nd order Fermi accelerations. Predictions of the dependence of spectral index and flux on distance along the tail match observations well. Fitting provides values of physical parameters in the blobs. The relevance of this method of particle acceleration for the problem of the origin of x-ray emission in clusters of galaxies is discussed

Turbulence optimisation in stellarator experiments

Energy Technology Data Exchange (ETDEWEB)

Proll, Josefine H.E. [Max-Planck/Princeton Center for Plasma Physics (Germany); Max-Planck-Institut fuer Plasmaphysik, Wendelsteinstr. 1, 17491 Greifswald (Germany); Faber, Benjamin J. [HSX Plasma Laboratory, University of Wisconsin-Madison, Madison, WI 53706 (United States); Helander, Per; Xanthopoulos, Pavlos [Max-Planck/Princeton Center for Plasma Physics (Germany); Lazerson, Samuel A.; Mynick, Harry E. [Plasma Physics Laboratory, Princeton University, P.O. Box 451 Princeton, New Jersey 08543-0451 (United States)

2015-05-01

Stellarators, the twisted siblings of the axisymmetric fusion experiments called tokamaks, have historically suffered from confining the heat of the plasma insufficiently compared with tokamaks and were therefore considered to be less promising candidates for a fusion reactor. This has changed, however, with the advent of stellarators in which the laminar transport is reduced to levels below that of tokamaks by shaping the magnetic field accordingly. As in tokamaks, the turbulent transport remains as the now dominant transport channel. Recent analytical theory suggests that the large configuration space of stellarators allows for an additional optimisation of the magnetic field to also reduce the turbulent transport. In this talk, the idea behind the turbulence optimisation is explained. We also present how an optimised equilibrium is obtained and how it might differ from the equilibrium field of an already existing device, and we compare experimental turbulence measurements in different configurations of the HSX stellarator in order to test the optimisation procedure.

Aperiodic linear networked control considering variable channel delays: application to robots coordination.

Science.gov (United States)

Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

2015-05-27

One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

Directory of Open Access Journals (Sweden)

Carlos Santos

2015-05-01

Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

Achieving fast reconnection in resistive MHD models via turbulent means

Directory of Open Access Journals (Sweden)

G. Lapenta

2012-04-01

Full Text Available Astrophysical fluids are generally turbulent and this preexisting turbulence must be taken into account for models of magnetic reconnection in astrophysical, solar or heliospheric environments. In addition, reconnection itself induces turbulence which provides an important feedback on the reconnection process. In this paper we discuss both the theoretical model and numerical evidence that magnetic reconnection becomes fast in the approximation of resistive MHD. We consider the relation between the Lazarian and Vishniac turbulent reconnection theory and Lapenta's numerical experiments testifying of the spontaneous onset of turbulent reconnection in systems which are initially laminar.

The spatio-temporal structure of electrostatic turbulence in the WEGA stellarator

International Nuclear Information System (INIS)

Marsen, Stefan

2008-03-01

The main object of this work is to provide a detailed characterisation of electrostatic turbulence in WEGA and to identify the underlying instability mechanism driving turbulence. The spatio-temporal structure of turbulence is studied using multiple Langmuir probes providing a sufficiently high spatial and temporal resolution. Turbulence in WEGA is dominated by drift wave dynamics. The phase shift between density and potential fluctuations is close to zero, fluctuations are mainly driven by the density gradient, and the phase velocity of turbulent structures points in the direction of the electron diamagnetic drift. The structure of turbulence is studied mainly in the plasma edge region inside the last closed flux surface. WEGA can be operated in two regimes differing in the magnetic field strength by almost one order of magnitude (57 mT and 500 mT, respectively). At 57 mT large structures with a poloidal extent comparable to the machine dimensions are observed, whereas at 500 mT turbulent structures are much smaller. The poloidal structure size scales nearly linearly with the inverse magnetic field strength. This scaling may be argued to be related to the drift wave dispersion scale, ρ s =√(m i k B T e )/(qB). However, the structure size remains unchanged when the ion mass is changed by using different discharge gases. Inside the last closed flux surface the poloidal E x B drift in WEGA is negligible. The three-dimensional structure is studied in detail using probes which are toroidally separated but aligned along connecting magnetic field lines. A small but finite parallel wavenumber is found. The ratio between the average parallel and perpendicular wavenumber is in the order of anti κ parallel / anti κ θ ∼ 10 -2 . The parallel phase velocity of turbulent structures is in-between the ion sound velocity and the Alfven velocity. In the parallel dynamics a fundamental difference between the two operational regimes at different magnetic field strength is

Plasma Turbulence in Earth's Magnetotail Observed by the Magnetospheric Multiscale Mission

Science.gov (United States)

Mackler, D. A.; Avanov, L. A.; Boardsen, S. A.; Pollock, C. J.

2017-12-01

Magnetic reconnection, a process in which the magnetic topology undergoes multi-scale changes, is a significant mechanism for particle energization as well as energy dissipation. Reconnection is observed to occur in thin current sheets generated between two regions of magnetized plasma merging with a non-zero shear angle. Within a thinning current sheet, the dominant scale size approaches first the ion and then electron kinetic scale. The plasma becomes demagnetized, field lines transform, then once again the plasma becomes frozen-in. The reconnection process accelerates particles, leading to heated jets of plasma. Turbulence is another fundamental process in collision less plasmas. Despite decades of turbulence studies, an essential science question remains as to how turbulent energy dissipates at small scales by heating and accelerating particles. Turbulence in both plasmas and fluids has a fundamental property in that it follows an energy cascade into smaller scales. Energy introduced into a fluid or plasma can cause large scale motion, introducing vorticity, which merge and interact to make increasingly smaller eddies. It has been hypothesized that turbulent energy in magnetized plasmas may be dissipated by magnetic reconnection, just as viscosity dissipates energy in neutral fluid turbulence. The focus of this study is to use the new high temporal resolution suite of instruments on board the Magnetospheric MultiScale (MMS) mission to explore this hypothesis. An observable feature of the energy cascade in a turbulent magnetized plasma is its similarity to classical hydrodynamics in that the Power Spectral Density (PSD) of turbulent fluctuations follows a Kolmogorov-like power law (Image-5/3). We use highly accurate (0.1 nT) Flux Gate Magnetometer (FGM) data to derive the PSD as a function of frequency in the magnetic fluctuations. Given that we are able to confirm the turbulent nature of the flow field; we apply the method of Partial Variance of Increments (PVI

MULTIFLUID MAGNETOHYDRODYNAMIC TURBULENT DECAY

International Nuclear Information System (INIS)

Downes, T. P.; O'Sullivan, S.

2011-01-01

It is generally believed that turbulence has a significant impact on the dynamics and evolution of molecular clouds and the star formation that occurs within them. Non-ideal magnetohydrodynamic (MHD) effects are known to influence the nature of this turbulence. We present the results of a suite of 512 3 resolution simulations of the decay of initially super-Alfvenic and supersonic fully multifluid MHD turbulence. We find that ambipolar diffusion increases the rate of decay of the turbulence while the Hall effect has virtually no impact. The decay of the kinetic energy can be fitted as a power law in time and the exponent is found to be -1.34 for fully multifluid MHD turbulence. The power spectra of density, velocity, and magnetic field are all steepened significantly by the inclusion of non-ideal terms. The dominant reason for this steepening is ambipolar diffusion with the Hall effect again playing a minimal role except at short length scales where it creates extra structure in the magnetic field. Interestingly we find that, at least at these resolutions, the majority of the physics of multifluid turbulence can be captured by simply introducing fixed (in time and space) resistive terms into the induction equation without the need for a full multifluid MHD treatment. The velocity dispersion is also examined and, in common with previously published results, it is found not to be power law in nature.

Spectral properties of electromagnetic turbulence in plasmas

Directory of Open Access Journals (Sweden)

D. Shaikh

2009-03-01

Full Text Available We report on the nonlinear turbulent processes associated with electromagnetic waves in plasmas. We focus on low-frequency (in comparison with the electron gyrofrequency nonlinearly interacting electron whistlers and nonlinearly interacting Hall-magnetohydrodynamic (H-MHD fluctuations in a magnetized plasma. Nonlinear whistler mode turbulence study in a magnetized plasma involves incompressible electrons and immobile ions. Two-dimensional turbulent interactions and subsequent energy cascades are critically influenced by the electron whisters that behave distinctly for scales smaller and larger than the electron skin depth. It is found that in whistler mode turbulence there results a dual cascade primarily due to the forward spectral migration of energy that coexists with a backward spectral transfer of mean squared magnetic potential. Finally, inclusion of the ion dynamics, resulting from a two fluid description of the H-MHD plasma, leads to several interesting results that are typically observed in the solar wind plasma. Particularly in the solar wind, the high-time-resolution databases identify a spectral break at the end of the MHD inertial range spectrum that corresponds to a high-frequency regime. In the latter, turbulent cascades cannot be explained by the usual MHD model and a finite frequency effect (in comparison with the ion gyrofrequency arising from the ion inertia is essentially included to discern the dynamics of the smaller length scales (in comparison with the ion skin depth. This leads to a nonlinear H-MHD model, which is presented in this paper. With the help of our 3-D H-MHD code, we find that the characteristic turbulent interactions in the high-frequency regime evolve typically on kinetic-Alfvén time-scales. The turbulent fluctuation associated with kinetic-Alfvén interactions are compressive and anisotropic and possess equipartition of the kinetic and magnetic energies.

TRIAM-1 turbulent heating experiment

Energy Technology Data Exchange (ETDEWEB)

Nakamura, Yukio; Hiraki, Naoji; Nakamura, Kazuo; Kikuchi, Mitsuru; Nagao, Akihiro [Kyushu Univ., Fukuoka (Japan). Research Inst. for Applied Mechanics

1983-02-01

The experimental studies on the containment of high temperature plasma and turbulent heating using the tokamak device with strong magnetic field (TRIAM-1) started in 1977 have achieved much results up to fiscal 1979, and the anticipated objectives were almost attained. The results of these studies were summarized in the ''Report of the results of strong magnetic field tokamak TRIAM-1 experiment''. In this report, the results obtained by the second stage project of the TRIAM-1 project are summarized. The second stage was the two-year project for fiscal 1980 and 81. In the second stage project, by the complete preparation of measuring instrument and the improvement of the experimental setup, the carefully planned experiment on turbulent heating was performed, in particular, the clarification of the mechanism of turbulent heating was the central theme. As the important results obtained, the detection of ion sound waves at the time of turbulent heating, the formation of high energy ions by wave-particle interaction and the clarification of the process of their energy relaxation, and the verification of the effectiveness of double pulse turbulent heating are enumerated.

TRIAM-1 turbulent heating experiment

International Nuclear Information System (INIS)

Nakamura, Yukio; Hiraki, Naoji; Nakamura, Kazuo; Kikuchi, Mitsuru; Nagao, Akihiro

1983-01-01

The experimental studies on the containment of high temperature plasma and turbulent heating using the tokamak device with strong magnetic field (TRIAM-1) started in 1977 have achieved much results up to fiscal 1979, and the anticipated objectives were almost attained. The results of these studies were summarized in the ''Report of the results of strong magnetic field tokamak TRIAM-1 experiment''. In this report, the results obtained by the second stage project of the TRIAM-1 project are summarized. The second stage was the two-year project for fiscal 1980 and 81. In the second stage project, by the complete preparation of measuring instrument and the improvement of the experimental setup, the carefully planned experiment on turbulent heating was performed, in particular, the clarification of the mechanism of turbulent heating was the central theme. As the important results obtained, the detection of ion sound waves at the time of turbulent heating, the formation of high energy ions by waveparticle interaction and the clarification of the process of their energy relaxation, and the verification of the effectiveness of double pulse turbulent heating are enumerated. (Kako, I.)

Statistical Mechanics of Turbulent Dynamos

Science.gov (United States)

Shebalin, John V.

2014-01-01

Incompressible magnetohydrodynamic (MHD) turbulence and magnetic dynamos, which occur in magnetofluids with large fluid and magnetic Reynolds numbers, will be discussed. When Reynolds numbers are large and energy decays slowly, the distribution of energy with respect to length scale becomes quasi-stationary and MHD turbulence can be described statistically. In the limit of infinite Reynolds numbers, viscosity and resistivity become zero and if these values are used in the MHD equations ab initio, a model system called ideal MHD turbulence results. This model system is typically confined in simple geometries with some form of homogeneous boundary conditions, allowing for velocity and magnetic field to be represented by orthogonal function expansions. One advantage to this is that the coefficients of the expansions form a set of nonlinearly interacting variables whose behavior can be described by equilibrium statistical mechanics, i.e., by a canonical ensemble theory based on the global invariants (energy, cross helicity and magnetic helicity) of ideal MHD turbulence. Another advantage is that truncated expansions provide a finite dynamical system whose time evolution can be numerically simulated to test the predictions of the associated statistical mechanics. If ensemble predictions are the same as time averages, then the system is said to be ergodic; if not, the system is nonergodic. Although it had been implicitly assumed in the early days of ideal MHD statistical theory development that these finite dynamical systems were ergodic, numerical simulations provided sufficient evidence that they were, in fact, nonergodic. Specifically, while canonical ensemble theory predicted that expansion coefficients would be (i) zero-mean random variables with (ii) energy that decreased with length scale, it was found that although (ii) was correct, (i) was not and the expected ergodicity was broken. The exact cause of this broken ergodicity was explained, after much

On the inverse transfer of (non-)helical magnetic energy in a decaying magnetohydrodynamic turbulence

Science.gov (United States)

Park, Kiwan

2017-12-01

In our conventional understanding, large-scale magnetic fields are thought to originate from an inverse cascade in the presence of magnetic helicity, differential rotation or a magneto-rotational instability. However, as recent simulations have given strong indications that an inverse cascade (transfer) may occur even in the absence of magnetic helicity, the physical origin of this inverse cascade is still not fully understood. We here present two simulations of freely decaying helical and non-helical magnetohydrodynamic (MHD) turbulence. We verified the inverse transfer of helical and non-helical magnetic fields in both cases, but we found the underlying physical principles to be fundamentally different. In the former case, the helical magnetic component leads to an inverse cascade of magnetic energy. We derived a semi-analytic formula for the evolution of large-scale magnetic field using α coefficient and compared it with the simulation data. But in the latter case, the α effect, including other conventional dynamo theories, is not suitable to describe the inverse transfer of non-helical magnetic energy. To obtain a better understanding of the physics at work here, we introduced a 'field structure model' based on the magnetic induction equation in the presence of inhomogeneities. This model illustrates how the curl of the electromotive force leads to the build up of a large-scale magnetic field without the requirement of magnetic helicity. And we applied a quasi-normal approximation to the inverse transfer of magnetic energy.

Hyper-resistivity produced by tearing mode turbulence

International Nuclear Information System (INIS)

Strauss, H.R.

1986-01-01

Tearing mode turbulence produces a hyper-resistivity or effective anomalous electron viscosity. The hyper-resistivity is calculated for the mean magnetic field quasilinearly, and for long-wavelength modes using the direct interaction approximation. The hyper-resistivity accounts for current relaxation in reversed-field pinch experiments, and gives a magnetic fluctuation sealing of S -1 /sup // 3 . It causes enhanced tearing mode growth rates in the turbulent phase of tokamak disruptions. In astrophysics, it limits magnetic energy growth due to the dynamo effect, and may explain rapid reconnection phenomena such as solar flares

A non-local shell model of hydrodynamic and magnetohydrodynamic turbulence

Energy Technology Data Exchange (ETDEWEB)

Plunian, F [Laboratoire de Geophysique Interne et Tectonophysique, CNRS, Universite Joseph Fourier, Maison des Geosciences, BP 53, 38041 Grenoble Cedex 9 (France); Stepanov, R [Institute of Continuous Media Mechanics, Korolyov 1, 614013 Perm (Russian Federation)

2007-08-15

We derive a new shell model of magnetohydrodynamic (MHD) turbulence in which the energy transfers are not necessarily local. Like the original MHD equations, the model conserves the total energy, magnetic helicity, cross-helicity and volume in phase space (Liouville's theorem) apart from the effects of external forcing, viscous dissipation and magnetic diffusion. The model of hydrodynamic (HD) turbulence is derived from the MHD model setting the magnetic field to zero. In that case the conserved quantities are the kinetic energy and the kinetic helicity. In addition to a statistically stationary state with a Kolmogorov spectrum, the HD model exhibits multiscaling. The anomalous scaling exponents are found to depend on a free parameter {alpha} that measures the non-locality degree of the model. In freely decaying turbulence, the infra-red spectrum also depends on {alpha}. Comparison with theory suggests using {alpha} = -5/2. In MHD turbulence, we investigate the fully developed turbulent dynamo for a wide range of magnetic Prandtl numbers in both kinematic and dynamic cases. Both local and non-local energy transfers are clearly identified.

Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate.

Science.gov (United States)

Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J

2008-05-01

We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

Effects of flow shear and Alfven waves on two-dimensional magnetohydrodynamic turbulence

International Nuclear Information System (INIS)

Douglas, Jamie; Kim, Eun-jin; Thyagaraja, A.

2008-01-01

The suppression of turbulent transport by large scale mean shear flows and uniform magnetic fields is investigated in two-dimensional magnetohydrodynamic turbulence driven by a small-scale forcing with finite correlation time. By numerical integration the turbulent magnetic diffusivity D T is shown to be significantly quenched, with a scaling D T ∝B -2 Ω 0 -5/4 , which is much more severe than in the case of a short or delta correlated forcing typified by white noise, studied in E. Kim and B. Dubrulle [Phys. Plasmas 8, 813 (2001)]. Here B and Ω 0 are magnetic field strength and flow shear rate, respectively. The forcing with finite correlation time also leads to much stronger suppression of momentum transport through the cancellation of the Reynolds stress by the Maxwell stress with a positive small value of turbulent viscosity, ν T >0. While fluctuating kinetic and magnetic energies are unaffected by the magnetic field just as in the case of a delta correlated forcing, they are much more severely quenched by flow shear than in that of a delta correlated forcing. Underlying physical mechanisms for the reduction of turbulent transport and turbulence level by flow shear and magnetic field are discussed

The roles of turbulence on plasma heating

International Nuclear Information System (INIS)

Kawamura, Takaichi; Kawabe, Takaya.

1976-06-01

In this paper, the characteristic features of the turbulent heating are reviewed, which is considered to be one of the strong candidates of the further heating method in fusion reactor systems, referring to the works in the Institute of Plasma Physics, Nagoya University. The roles of turbulence in plasma heating including toroidal plasma heating are discussed from several points of view. The relation between the heating rate of plasma particles and the thermalization (randomization) frequency is theoretically investigated and the role of plasma turbulence in the fast thermalization is shown. The experimental results on fluctuation and heating of electrons and ions in turbulently heated plasmas are presented. The influence of turbulence, which is responsible for the particle heating, on the diffusion across the confinement magnetic field is considered for the application in the toroidal plasmas. It is pointed out that the turbulent fields in the fast turbulent heating give only a minor effect to the loss of particles across the magnetic field. It can be said that the enhanced fluctuation in turbulent plasma gives its field energy to the plasma particles while it can play the role of the fast thermalization of the ordered motion of particles that is produced in the plasma by some acceleration process. (Kato, T.)

Electrostatic and magnetic measurements of turbulence and transport in Extrap T2

International Nuclear Information System (INIS)

Moeller, A.; Sallander, E.

1999-01-01

Langmuir probe and magnetic pick-up coil measurements are used to study edge turbulence in the Extrap T2 reversed field pinch. Magnetic fluctuations resonant outside the toroidal field reversal surface are observed where previously only fluctuations in the spectra of potential and electron density and temperature have been measured. Results are presented which imply that these fluctuations are coupled to and also correlated to the internally resonant tearing mode fluctuations. Evidence of coupling between low-frequency (<100 kHz) and high-frequency fluctuations is also presented. The normalized floating potential fluctuations are seen to increase with the edge electron temperature. This causes an increase of the potential and density fluctuation driven transport with the temperature which is faster than linear. These results, in combination, are consistent with a picture where internally resonant fluctuations couple to edge fluctuations through radial heat conduction from the stochastic core to the edge. (author)

Electrostatic and magnetic measurements of turbulence and transport in Extrap T2

Science.gov (United States)

Möller, Anders; Sallander, Eva

1999-10-01

Langmuir probe and magnetic pick-up coil measurements are used to study edge turbulence in the Extrap T2 reversed field pinch. Magnetic fluctuations resonant outside the toroidal field reversal surface are observed where previously only fluctuations in the spectra of potential and electron density and temperature have been measured. Results are presented which imply that these fluctuations are coupled to and also correlated to the internally resonant tearing mode fluctuations. Evidence of coupling between low-frequency (<100 kHz) and high-frequency fluctuations is also presented. The normalized floating potential fluctuations are seen to increase with the edge electron temperature. This causes an increase of the potential and density fluctuation driven transport with the temperature which is faster than linear. These results, in combination, are consistent with a picture where internally resonant fluctuations couple to edge fluctuations through radial heat conduction from the stochastic core to the edge.

The spatio-temporal structure of electrostatic turbulence in the WEGA stellarator

Energy Technology Data Exchange (ETDEWEB)

Marsen, Stefan

2008-03-15

The main object of this work is to provide a detailed characterisation of electrostatic turbulence in WEGA and to identify the underlying instability mechanism driving turbulence. The spatio-temporal structure of turbulence is studied using multiple Langmuir probes providing a sufficiently high spatial and temporal resolution. Turbulence in WEGA is dominated by drift wave dynamics. The phase shift between density and potential fluctuations is close to zero, fluctuations are mainly driven by the density gradient, and the phase velocity of turbulent structures points in the direction of the electron diamagnetic drift. The structure of turbulence is studied mainly in the plasma edge region inside the last closed flux surface. WEGA can be operated in two regimes differing in the magnetic field strength by almost one order of magnitude (57 mT and 500 mT, respectively). At 57 mT large structures with a poloidal extent comparable to the machine dimensions are observed, whereas at 500 mT turbulent structures are much smaller. The poloidal structure size scales nearly linearly with the inverse magnetic field strength. This scaling may be argued to be related to the drift wave dispersion scale, {rho}{sub s}={radical}(m{sub i}k{sub B}T{sub e})/(qB). However, the structure size remains unchanged when the ion mass is changed by using different discharge gases. Inside the last closed flux surface the poloidal E x B drift in WEGA is negligible. The three-dimensional structure is studied in detail using probes which are toroidally separated but aligned along connecting magnetic field lines. A small but finite parallel wavenumber is found. The ratio between the average parallel and perpendicular wavenumber is in the order of anti {kappa} {sub parallel} / anti {kappa}{sub {theta}} {approx} 10{sup -2}. The parallel phase velocity of turbulent structures is in-between the ion sound velocity and the Alfven velocity. In the parallel dynamics a fundamental difference between the two

Turbulence and transport in a magnetized argon plasma

International Nuclear Information System (INIS)

Pots, B.F.M.

1979-01-01

An experimental study on turbulence and transport in the highly ionized argon plasma of a hollow cathode discharge is described. In order to determine the plasma parameters three standard diagnostics have been used, whilst two diagnostics have been developed to study the plasma turbulence. (Auth.)

Limits on the ions temperature anisotropy in turbulent intracluster medium

Energy Technology Data Exchange (ETDEWEB)

Santos-Lima, R. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Potsdam Univ. (Germany). Inst. fuer Physik und Astronomie; Univ. de Sao Paulo (Brazil). Inst. de Astronomia, Geofisica e Ciencias Atmosfericas; Yan, H. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Potsdam Univ. (Germany). Inst. fuer Physik und Astronomie; Gouveia Dal Pino, E.M. de [Univ. de Sao Paulo (Brazil). Inst. de Astronomia, Geofisica e Ciencias Atmosfericas; Lazarian, A. [Wisconsin Univ., Madison, WI (United States). Dept. of Astronomy

2016-05-15

Turbulence in the weakly collisional intracluster medium of galaxies (ICM) is able to generate strong thermal velocity anisotropies in the ions (with respect to the local magnetic field direction), if the magnetic moment of the particles is conserved in the absence of Coulomb collisions. In this scenario, the anisotropic pressure magnetohydrodynamic (AMHD) turbulence shows a very different statistical behaviour from the standard MHD one and is unable to amplify seed magnetic fields, in disagreement with previous cosmological MHD simulations which are successful to explain the observed magnetic fields in the ICM. On the other hand, temperature anisotropies can also drive plasma instabilities which can relax the anisotropy. This work aims to compare the relaxation rate with the growth rate of the anisotropies driven by the turbulence. We employ quasilinear theory to estimate the ions scattering rate due to the parallel firehose, mirror, and ion-cyclotron instabilities, for a set of plasma parameters resulting from AMHD simulations of the turbulent ICM. We show that the ICM turbulence can sustain only anisotropy levels very close to the instabilities thresholds. We argue that the AMHD model which bounds the anisotropies at the marginal stability levels can describe the Alfvenic turbulence cascade in the ICM.

Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender

Science.gov (United States)

Skuk, Verena G.; Schweinberger, Stefan R.

2014-01-01

Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

Radiation-disorder and aperiodicity in irradiated ceramics

International Nuclear Information System (INIS)

Hobbs, L.W.

1992-01-01

This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

BOOK REVIEW: Plasma and Fluid Turbulence: Theory and Modelling

Science.gov (United States)

Yoshizawa, A.; Itoh, S. I.; Itoh, K.

2003-03-01

The area of turbulence has been covered by many books over the years. This has, of course, mainly been fluid turbulence, while the area of plasma turbulence has been treated much less. This book by Yoshizawa et al covers both plasma and fluid turbulence, in a way that does justice to both areas at the same time as cross-disciplinary aspects are illuminated. The book should be useful to physicists working in both areas partly because it examines fundamental aspects in a pedagogical way, partly because it is up to date and partly because of the cross-disciplinary aspects which enrich both areas. It is written as an advanced textbook. The reader should have previous knowledge of at least one of the areas and also some background in statistical physics. The book starts with the very important and highly up to date area of structure formation which is relevant both to fluids and plasmas. Here, pipe flow of fluids is treated as an introduction to the area, then follows discussion of the generation of magnetic fields by turbulent motion in stellar objects and stucture formation in plasmas confined by a magnetic field. Also the concept of bifurcation is introduced. This part builds up knowledge from the simple fluid case to the problems of magnetic confinement of plasmas in a very pedagogical way. It continues by introducing the fundamentals of fluid turbulence. This is done very systematically and concepts useful for industrial applications like the K-e method and several ways of heuristic modelling are introduced. Also the two dimensional vortex equation, which is also relevant to magnetized plasmas is introduced. In chapter 5 the statistical theory of turbulence is treated. It starts with a very nice and easy to understand example of renormalization of a simple nonlinear equation where the exact solution is known. It introduces the method of partial renormalization, Greens functions and the direct interaction approximation (DIA). The book then continues with an

Decay of Solar Wind Turbulence behind Interplanetary Shocks

Energy Technology Data Exchange (ETDEWEB)

Pitňa, Alexander; Šafránková, Jana; Němeček, Zdeněk [Charles University, Faculty of Mathematics and Physics, V Holesovickach 2, Prague, CZ-18000 (Czech Republic); Franci, Luca, E-mail: offelius@gmail.com [Dipartimento di Fisica e Astronomia, Universita degli Studi di Firenze, I-50125 Firenze (Italy)

2017-07-20

We investigate the decay of magnetic and kinetic energies behind IP shocks with motivation to find a relaxation time when downstream turbulence reaches a usual solar wind value. We start with a case study that introduces computation techniques and quantifies a contribution of kinetic fluctuations to the general energy balance. This part of the study is based on high-time (31 ms) resolution plasma data provided by the Spektr-R spacecraft. On the other hand, a statistical part is based on 92 s Wind plasma and magnetic data and its results confirm theoretically established decay laws for kinetic and magnetic energies. We observe the power-law behavior of the energy decay profiles and we estimated the power-law exponents of both kinetic and magnetic energy decay rates as −1.2. We found that the decay of MHD turbulence does not start immediately after the IP shock ramp and we suggest that the proper decay of turbulence begins when a contribution of the kinetic processes becomes negligible. We support this suggestion with a detailed analysis of the decay of turbulence at the kinetic scale.

Decay of Solar Wind Turbulence behind Interplanetary Shocks

International Nuclear Information System (INIS)

Pitňa, Alexander; Šafránková, Jana; Němeček, Zdeněk; Franci, Luca

2017-01-01

We investigate the decay of magnetic and kinetic energies behind IP shocks with motivation to find a relaxation time when downstream turbulence reaches a usual solar wind value. We start with a case study that introduces computation techniques and quantifies a contribution of kinetic fluctuations to the general energy balance. This part of the study is based on high-time (31 ms) resolution plasma data provided by the Spektr-R spacecraft. On the other hand, a statistical part is based on 92 s Wind plasma and magnetic data and its results confirm theoretically established decay laws for kinetic and magnetic energies. We observe the power-law behavior of the energy decay profiles and we estimated the power-law exponents of both kinetic and magnetic energy decay rates as −1.2. We found that the decay of MHD turbulence does not start immediately after the IP shock ramp and we suggest that the proper decay of turbulence begins when a contribution of the kinetic processes becomes negligible. We support this suggestion with a detailed analysis of the decay of turbulence at the kinetic scale.

MHD turbulent dynamo in astrophysics: Theory and numerical simulation

Science.gov (United States)

Chou, Hongsong

2001-10-01

This thesis treats the physics of dynamo effects through theoretical modeling of magnetohydrodynamic (MHD) systems and direct numerical simulations of MHD turbulence. After a brief introduction to astrophysical dynamo research in Chapter 1, the following issues in developing dynamic models of dynamo theory are addressed: In Chapter 2, nonlinearity that arises from the back reaction of magnetic field on velocity field is considered in a new model for the dynamo α-effect. The dependence of α-coefficient on magnetic Reynolds number, kinetic Reynolds number, magnetic Prandtl number and statistical properties of MHD turbulence is studied. In Chapter 3, the time-dependence of magnetic helicity dynamics and its influence on dynamo effects are studied with a theoretical model and 3D direct numerical simulations. The applicability of and the connection between different dynamo models are also discussed. In Chapter 4, processes of magnetic field amplification by turbulence are numerically simulated with a 3D Fourier spectral method. The initial seed magnetic field can be a large-scale field, a small-scale magnetic impulse, and a combination of these two. Other issues, such as dynamo processes due to helical Alfvénic waves and the implication and validity of the Zeldovich relation, are also addressed in Appendix B and Chapters 4 & 5, respectively. Main conclusions and future work are presented in Chapter 5. Applications of these studies are intended for astrophysical magnetic field generation through turbulent dynamo processes, especially when nonlinearity plays central role. In studying the physics of MHD turbulent dynamo processes, the following tools are developed: (1)A double Fourier transform in both space and time for the linearized MHD equations (Chapter 2 and Appendices A & B). (2)A Fourier spectral numerical method for direct simulation of 3D incompressible MHD equations (Appendix C).

Coherent vortical structures in two-dimensional plasma turbulence

DEFF Research Database (Denmark)

Pécseli, H.L.; Coutsias, E.A.; Huld, T.

1992-01-01

A laboratory experiment was carried out in order to study the nonlinear saturated stage of the cross-field electrostatic Kelvin-Helmholtz instability in a strongly magnetized plasma. The presence of large vortex-like structures in a background of wide-band turbulent fluctuations was demonstrated...... simulations. The importance of the large scale structures for the turbulent plasma transport across magnetic field lines was analyzed in detail....

Turbulence in a Global Magnetohydrodynamic Simulation of the Earth's Magnetosphere during Northward and Southward Interplanetary Magnetic Field

Science.gov (United States)

El-Alaoui, M.; Richard, R. L.; Ashour-Abdalla, M.; Walker, R. J.; Goldstein, M. L.

2012-01-01

We report the results of MHD simulations of Earth's magnetosphere for idealized steady solar wind plasma and interplanetary magnetic field (IMF) conditions. The simulations feature purely northward and southward magnetic fields and were designed to study turbulence in the magnetotail plasma sheet. We found that the power spectral densities (PSDs) for both northward and southward IMF had the characteristics of turbulent flow. In both cases, the PSDs showed the three scale ranges expected from theory: the energy-containing scale, the inertial range, and the dissipative range. The results were generally consistent with in-situ observations and theoretical predictions. While the two cases studied, northward and southward IMF, had some similar characteristics, there were significant differences as well. For southward IMF, localized reconnection was the main energy source for the turbulence. For northward IMF, remnant reconnection contributed to driving the turbulence. Boundary waves may also have contributed. In both cases, the PSD slopes had spatial distributions in the dissipative range that reflected the pattern of resistive dissipation. For southward IMF there was a trend toward steeper slopes in the dissipative range with distance down the tail. For northward IMF there was a marked dusk-dawn asymmetry with steeper slopes on the dusk side of the tail. The inertial scale PSDs had a dusk-dawn symmetry during the northward IMF interval with steeper slopes on the dawn side. This asymmetry was not found in the distribution of inertial range slopes for southward IMF. The inertial range PSD slopes were clustered around values close to the theoretical expectation for both northward and southward IMF. In the dissipative range, however, the slopes were broadly distributed and the median values were significantly different, consistent with a different distribution of resistivity.

Steady State Turbulent Transport in Magnetic Fusion Plasmas

International Nuclear Information System (INIS)

Lee, W.W.; Ethier, S.; Kolesnikov, R.; Wang, W.X.; Tang, W.M.

2007-01-01

For more than a decade, the study of microturbulence, driven by ion temperature gradient (ITG) drift instabilities in tokamak devices, has been an active area of research in magnetic fusion science for both experimentalists and theorists alike. One of the important impetus for this avenue of research was the discovery of the radial streamers associated the ITG modes in the early nineties using a Particle-In-Cell (PIC) code. Since then, ITG simulations based on the codes with increasing realism have become possible with the dramatic increase in computing power. The notable examples were the demonstration of the importance of nonlinearly generated zonal flows in regulating ion thermal transport and the transition from Bohm to GyroBoham scaling with increased device size. In this paper, we will describe another interesting nonlinear physical process associated with the parallel acceleration of the ions, that is found to play an important role for the steady state turbulent transport. Its discovery is again through the use of the modern massively parallel supercomputers

The roles of turbulence on plasma heating

International Nuclear Information System (INIS)

Kawamura, Takaichi; Kawabe, Takaya

1976-01-01

The relation between the heating rate of plasma particles and the thermalization frequency is established, and the important role of plasma turbulence in the fast thermalization process is underlined. This relation can be applied not only in the case of high current turbulent heating but also when turbulent phenomena occur with other heating means. The experimental results on ion and electron heating during the Mach II experiment are presented. The role of turbulence on particle losses accross the magnetic field is analyzed

Turbulence Heating ObserveR - satellite mission proposal

NARCIS (Netherlands)

Vaivads, A.; Retinò, A.; J. Soucek; Yu.V. Khotyaintsev; F. Valentini (Francesco); C.P. Escoubet; O. Alexandrova; M. André; S.D. Bale; M. Balikhin; D. Burgess; E. Camporeale (Enrico); D. Caprioli; C.H.K. Chen; E. Clacey; C.M. Cully; J. De Keyser; J.P. Eastwood; A.N. Fazakerley; S. Eriksson; M.L. Goldstein; D.B. Graham; S. Haaland; M. Hoshino; H. Ji; H. Karimabadi; H. Kucharek; B. Lavraud; F. Marcucci; W.H. Matthaeus; T.E. Moore; R. Nakamura; Y. Narita; Z. Nemecek; C. Norgren; H. Opgenoorth; M. Palmroth; D. Perrone; J.-L. Pinçon; P. Rathsman; H. Rothkaehl; F. Sahraoui; S. Servidio; L. Sorriso-Valvo; R. Vainio; Z. Vörös; R.F. Wimmer-Schweingruber

2016-01-01

textabstractThe Universe is permeated by hot, turbulent, magnetized plasmas. Turbulent plasma is a major constituent of active galactic nuclei, supernova remnants, the intergalactic and interstellar medium, the solar corona, the solar wind and the Earth’s magnetosphere, just to mention a few

Asymmetry in the convective energy fluxes due to electrostatic and magnetic fluctuations in magnetized plasmas

International Nuclear Information System (INIS)

Smolyakov, A.I.; Hirose, A.

1993-01-01

The structure of the energy balance equation for a magnetically confined plasma in the presence of electromagnetic fluctuations is investigated by using the drift kinetic equation. The convective energy fluxes, one caused by E x B electrostatic turbulence and the other by shear-Alfven type magnetic turbulence, are asymmetric: For low frequency electrostatic turbulence, the convective energy flux has a unique numerical factor 3/2, while the convective energy flux induced by magnetic turbulence has a numerical factor 5/2. As expected, in the drift approximation, turbulent heating by the longitudinal electric field is the only anomalous source term in the total energy balance equation. (Author)

Experimental investigations of structure and dynamics of drift-wave turbulence in stellarator geometry

International Nuclear Information System (INIS)

Birkenmeier, Gregor

2012-01-01

For more than 60 years, fusion scientists try to confine a plasma by means of external magnetic fields in order to achieve appropriately high densities and temperatures for the ignition of nuclear fusion. Despite of great progress in the design of confinement concepts, which are considered for the confinement of burning plasmas in the near future, theoretical plasma physics promises further confinement improvements using novel magnetic field geometries. Therefor, the key is the minimization of turbulent transport by choosing appropiate magnetic field geometries, which necessitates a fundamental understanding of the influence of magnetic field geometry on plasma turbulence. There are several theoretical works on turbulent plasma dynamics in three-dimensional geometries, but only a few experimental studies for validation of the theoretical results exist. Hence, the present work aims at providing experimental data for comparison with theory and to gain insights into the interplay between drift-wave turbulence and magnetic field geometry. By means of two multi-probe arrays, local density and potential fluctuations are measured in low-temperature plasmas at 128 positions on a single flux surface of the stellarator TJ-K with high temporal resolution. Using methods of statistical timeseries analysis structure sizes and dynamic properties of the drift-wave turbulence in TJ-K are determined. Thereby, it is shown that the size of turbulent structures perpendicular to the magnetic field is reduced in regions of high absolute local magnetic shear. In addition, a poloidal displacement with respect to the magnetic field lines and a complex propagation pattern of parallelly extended turbulent structures is found. Also, poloidal profiles of turbulent transport are calculated from the probe data. The maximum transport is found to be poloidally localized in a region of negative normal curvature (unfavourable curvature). In addition, the results point to an influence of geodesic

Theory of self-sustained turbulence in confined plasmas

International Nuclear Information System (INIS)

Itoh, K.; Itoh, S.-I.; Fukuyama, A.; Yagi, M.

1996-01-01

This article reviews some aspects of recent theoretical activities in Japan on the problem of turbulent transport in confined plasmas. The method of self-sustained turbulence is discussed. The process of the renormalization is shown and the turbulent Prandtl number is introduced. Nonlinear destabilization by the electron momentum diffusion is explained. The nonlinear eigenmode equation is derived for the dressed-test-mode for the inhomogeneous plasma in the shear magnetic field. The eigenvalue equation is solved, and the least stable mode determines the anomalous transport coefficient. The formula of the thermal conductivity is presented for the system of bad average magnetic curvature (current diffusive interchange mode (CDIM) turbulence) and that for the average good magnetic curvature (current diffusive ballooning mode (CDBM) turbulence). The transport coefficient, scale length of fluctuations and fluctuation level are shown to be an increasing function of the pressure gradient. Verification by use of the nonlinear simulation is shown. The bifurcation of the electric field and improved confinement are addressed, in order to explain the H-mode physics. The improved confinement and dynamics such as ELMs are explained. Application to the transport analysis of tokamaks is also presented, including explanations of the L-mode confinement, internal transport barrier, and the role of the current profile control

Mirror Instability in the Turbulent Solar Wind

Energy Technology Data Exchange (ETDEWEB)

Hellinger, Petr [Astronomical Institute, CAS, Bocni II/1401,CZ-14100 Prague (Czech Republic); Landi, Simone; Verdini, Andrea; Franci, Luca [Dipartimento di Fisica e Astronomia, Università degli Studi di Firenze Largo E. Fermi 2, I-50125 Firenze (Italy); Matteini, Lorenzo, E-mail: petr.hellinger@asu.cas.cz [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom)

2017-04-01

The relationship between a decaying strong turbulence and the mirror instability in a slowly expanding plasma is investigated using two-dimensional hybrid expanding box simulations. We impose an initial ambient magnetic field perpendicular to the simulation box, and we start with a spectrum of large-scale, linearly polarized, random-phase Alfvénic fluctuations that have energy equipartition between kinetic and magnetic fluctuations and a vanishing correlation between the two fields. A turbulent cascade rapidly develops, magnetic field fluctuations exhibit a Kolmogorov-like power-law spectrum at large scales and a steeper spectrum at sub-ion scales. The imposed expansion (taking a strictly transverse ambient magnetic field) leads to the generation of an important perpendicular proton temperature anisotropy that eventually drives the mirror instability. This instability generates large-amplitude, nonpropagating, compressible, pressure-balanced magnetic structures in a form of magnetic enhancements/humps that reduce the perpendicular temperature anisotropy.

Large-Eddy-Simulation of turbulent magnetohydrodynamic flows

Directory of Open Access Journals (Sweden)

Woelck Johannes

2017-01-01

Full Text Available A magnetohydrodynamic turbulent channel flow under the influence of a wallnormal magnetic field is investigated using the Large-Eddy-Simulation technique and k-equation subgrid-scale-model. Therefore, the new solver MHDpisoFoam is implemented in the OpenFOAM CFD-Code. The temporal decay of an initial turbulent field for different magnetic parameters is investigated. The rms values of the averaged velocity fluctuations show a similar, trend for each coordinate direction. 80% of the fluctuations are damped out in the range between 0 < Ha < < 75 at Re = 6675. The trend can be approximated via an exponential of the form exp(−a·Ha, where a is a scaling parameter. At higher Hartmann numbers the fluctuations decrease in an almost linear way. Therefore, the results of this study show that it may be possible to construct a general law for the turbulence damping due to action of magnetic fields.

Magnetostrophic balance as the optimal state for turbulent magnetoconvection.

Science.gov (United States)

King, Eric M; Aurnou, Jonathan M

2015-01-27

The magnetic fields of Earth and other planets are generated by turbulent convection in the vast oceans of liquid metal within them. Although direct observation is not possible, this liquid metal circulation is thought to be dominated by the controlling influences of planetary rotation and magnetic fields through the Coriolis and Lorentz forces. Theory famously predicts that planetary dynamo systems naturally settle into the so-called magnetostrophic state, where the Coriolis and Lorentz forces partially cancel, and convection is optimally efficient. Although this magnetostrophic theory correctly predicts the strength of Earth's magnetic field, no laboratory experiments have reached the magnetostrophic regime in turbulent liquid metal convection. Furthermore, computational dynamo simulations have as yet failed to produce a magnetostrophic dynamo, which has led some to question the existence of the magnetostrophic state. Here, we present results from the first, to our knowledge, turbulent, magnetostrophic convection experiments using the liquid metal gallium. We find that turbulent convection in the magnetostrophic regime is, in fact, maximally efficient. The experimental results clarify these previously disparate results, suggesting that the dynamically optimal magnetostrophic state is the natural expression of turbulent planetary dynamo systems.

A possible origin of viscosity in Keplerian accretion disks due to secondary perturbation: Turbulent transport without magnetic fields

International Nuclear Information System (INIS)

Mukhopadhyay, Banibrata; Saha, Kanak

2011-01-01

The origin of hydrodynamic turbulence in rotating shear flow is a long standing puzzle. Resolving it is especially important in astrophysics when the flow's angular momentum profile is Keplerian which forms an accretion disk having negligible molecular viscosity. Hence, any viscosity in such systems must be due to turbulence, arguably governed by magnetorotational instability, especially when temperature T > or approx. 10 5 . However, such disks around quiescent cataclysmic variables, protoplanetary and star-forming disks, and the outer regions of disks in active galactic nuclei are practically neutral in charge because of their low temperature, and thus are not expected to be coupled with magnetic fields enough to generate any transport due to the magnetorotational instability. This flow is similar to plane Couette flow including the Coriolis force, at least locally. What drives their turbulence and then transport, when such flows do not exhibit any unstable mode under linear hydrodynamic perturbation? We demonstrate that the three-dimensional secondary disturbance to the primarily perturbed flow that triggers elliptical instability may generate significant turbulent viscosity in the range 0.0001 ∼ t ∼< 0.1, which can explain transport in accretion flows.

Effects of q-profile structure on turbulence spreading: A fluctuation intensity transport analysis

Energy Technology Data Exchange (ETDEWEB)

Yi, S.; Kwon, J. M. [National Fusion Research Institute, Eoeun-dong, Yuseong-gu, Daejeon 305-333 (Korea, Republic of); Diamond, P. H. [National Fusion Research Institute, Eoeun-dong, Yuseong-gu, Daejeon 305-333 (Korea, Republic of); Center for Astrophysics and Space Sciences and Department of Physics, University of California San Diego, La Jolla, California 92093-0429 (United States); Hahm, T. S. [Department of Nuclear Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of)

2014-09-15

This paper studies effects of q-profile structure on turbulence spreading. It reports results of numerical experiments using global gyrokinetic simulations. We examine propagation of turbulence, triggered by an identical linear instability in a source region, into an adjacent, linearly stable region with variable q-profile. The numerical experiments are designed so as to separate the physics of turbulence spreading from that of linear stability. The strength of turbulence spreading is measured by the penetration depth of turbulence. Dynamics of spreading are elucidated by fluctuation intensity balance analysis, using a model intensity evolution equation which retains nonlinear diffusion and damping, and linear growth. It is found that turbulence spreading is strongly affected by magnetic shear s, but is hardly altered by the safety factor q itself. There is an optimal range of modest magnetic shear which maximizes turbulence spreading. For high to modest shear values, the spreading is enhanced by the increase of the mode correlation length with decreasing magnetic shear. However, the efficiency of spreading drops for sufficiently low magnetic shear even though the mode correlation length is comparable to that for the case of optimal magnetic shear. The reduction of spreading is attributed to the increase in time required for the requisite nonlinear mode-mode interactions. The effect of increased interaction time dominates that of increased mode correlation length. Our findings of the reduction of spreading and the increase in interaction time at weak magnetic shear are consistent with the well-known benefit of weak or reversed magnetic shear for core confinement enhancement. Weak shear is shown to promote locality, as well as stability.

VERTICAL STRUCTURE OF A SUPERNOVA-DRIVEN TURBULENT, MAGNETIZED INTERSTELLAR MEDIUM

International Nuclear Information System (INIS)

Hill, Alex S.; Matthew Haffner, L.; Ryan Joung, M.; Mac Low, Mordecai-Mark; Benjamin, Robert A.; Klingenberg, Christian; Waagan, Knut

2012-01-01

Stellar feedback drives the circulation of matter from the disk to the halo of galaxies. We perform three-dimensional magnetohydrodynamic simulations of a vertical column of the interstellar medium with initial conditions typical of the solar circle in which supernovae drive turbulence and determine the vertical stratification of the medium. The simulations were run using a stable, positivity-preserving scheme for ideal MHD implemented in the FLASH code. We find that the majority (≈90%) of the mass is contained in thermally stable temperature regimes of cold molecular and atomic gas at T 4.2 K, with strong peaks in probability distribution functions of temperature in both the cold and warm regimes. The 200-10 4.2 K gas fills 50%-60% of the volume near the plane, with hotter gas associated with supernova remnants (30%-40%) and cold clouds ( 5 K) gas accounts for most of the mass and volume, while hot gas dominates at |z| > 3 kpc. The magnetic field in our models has no significant impact on the scale heights of gas in each temperature regime; the magnetic tension force is approximately equal to and opposite the magnetic pressure, so the addition of the field does not significantly affect the vertical support of the gas. The addition of a magnetic field does reduce the fraction of gas in the cold ( 4 K) gas. However, our models lack rotational shear and thus have no large-scale dynamo, which reduces the role of the field in the models compared to reality. The supernovae drive oscillations in the vertical distribution of halo gas, with the period of the oscillations ranging from ≈30 Myr in the T 6 K gas, in line with predictions by Walters and Cox.

Energetics of turbulent transport processes in tokamaks

International Nuclear Information System (INIS)

Haas, F.A.; Thyagaraja, A.

1987-01-01

The effect of electromagnetic turbulence on electrons and ions under Tokamak conditions is considered using a kinetic description. Taking the magnetic fluctuation spectrum as given, the density fluctuation spectrum is self-consistently calculated taking account of quasi-neutrality. The calculation is valid for arbitrary collisionality and appropriate to low frequencies typical of experiment. In addition to the usual enhancement of the radial electron energy transport, it is found that the turbulent fluctuations can heat the plasma at rates comparable to ordinary ohmic heating under well-defined conditions. Interestingly, electromagnetic turbulence appears to imply only an insignificant correction to the toroidal resistance of the plasma as estimated from Spitzer resistivity. The scalings of anomalous transport, fluctuations and heating with temperature and plasma volume are investigated. The assumption that the magnetic fluctuation spectrum of the turbulence is invariant under a wide range of conditions is shown to result in interesting consequences for JET-like plasmas. (author)

Research on magnetohydrodynamic turbulent behavior. Development of the turbulence model using large eddy simulation. FY15 report of the JNC cooperative research scheme on the nuclear fuel cycle

International Nuclear Information System (INIS)

Tanahashi, Takahiko; Miyoshi, Ichiro; Ara, Kuniaki; Ohira, Hiroaki

2004-08-01

Investigation of magnetohydrodynamic (MHD) turbulent model with Large Eddy Simulation (LES) method was started in FY15 to evaluate MHD turbulent behavior on the conditions of high Reynolds numbers and high magnetic Reynolds numbers. In FY15, the proposed Subgrid Scale (SGS) model for magnetic fields generated by direct current was formulated with GSMAC-FEM (Generalized Simplified Marker and Cell method for Finite Element Method) and the characteristic behavior of MHD turbulence studied theoretically. A Direct Numerical Simulation (DNS) method was also developed to verify the theoretical study and construct and advanced SGS model. The last purpose of this study is to analyze the realistic Electromagnetic Pump. In order to understand basic concept, analyses of small-scale Electromagnetic Pump was started with A-φ method. The following results were obtained from these studies: (1) Homogeneous turbulent flows in a conducting fluid which were exposed to uniform magnetic fields were examined through the Direct Numerical Simulation and the characteristics of energy distribution were shown in the MHD turbulence at low magnetic Reynolds numbers. (2) For the analysis of the realistic Electromagnetic Pump, the parallel scheme based on GSMAC-FEM was constructed. Effectiveness of the scheme for large-scale calculation was shown through the benchmark problem, three dimensional cavity flow. (3) A new Balancing Tensor Diffusivity (BTD) formulation for the magnetic fields was proposed in this study and the proposed SGS model in previous study was formulated with GSMAC-FEM. The FEM scheme for MHD turbulence at high magnetic Reynolds number was verified through homogeneous MHD turbulence. (4) An A-φ method formulated with GSMAC-FEM was applied to the analysis of small-scale Electromagnetic pump. The basic concepts for the analysis with B method were obtained through the results. (author)

Magnetic intermittency of solar wind turbulence in the dissipation range

Science.gov (United States)

Pei, Zhongtian; He, Jiansen; Tu, Chuanyi; Marsch, Eckart; Wang, Linghua

2016-04-01

The feature, nature, and fate of intermittency in the dissipation range are an interesting topic in the solar wind turbulence. We calculate the distribution of flatness for the magnetic field fluctuations as a functionof angle and scale. The flatness distribution shows a "butterfly" pattern, with two wings located at angles parallel/anti-parallel to local mean magnetic field direction and main body located at angles perpendicular to local B0. This "butterfly" pattern illustrates that the flatness profile in (anti-) parallel direction approaches to the maximum value at larger scale and drops faster than that in perpendicular direction. The contours for probability distribution functions at different scales illustrate a "vase" pattern, more clear in parallel direction, which confirms the scale-variation of flatness and indicates the intermittency generation and dissipation. The angular distribution of structure function in the dissipation range shows an anisotropic pattern. The quasi-mono-fractal scaling of structure function in the dissipation range is also illustrated and investigated with the mathematical model for inhomogeneous cascading (extended p-model). Different from the inertial range, the extended p-model for the dissipation range results in approximate uniform fragmentation measure. However, more complete mathematicaland physical model involving both non-uniform cascading and dissipation is needed. The nature of intermittency may be strong structures or large amplitude fluctuations, which may be tested with magnetic helicity. In one case study, we find the heating effect in terms of entropy for large amplitude fluctuations seems to be more obvious than strong structures.

Dynamic structure in self-sustained turbulence

International Nuclear Information System (INIS)

Itoh, K.; Itoh, S.; Yagi, M.; Fukuyama, A.

1995-06-01

Dynamical equation for the self-sustained and pressure-driven turbulence in toroidal plasmas is derived. The growth rate of the dressed-test mode, which belongs to the subcritical turbulence, is obtained as a function of the turbulent transport coefficient. In the limit of the low fluctuation level, the mode has the feature of the nonlinear instability and shows the explosive growth. The growth rate vanishes when the driven transport reaches to the stationarily-turbulent level. The stationary solution is thermodynamically stable. The characteristic time, by which the stationary and self-sustained turbulence is established, scales with the ion-sound transit time and is accelerated by the bad magnetic curvature. Influences of the pressure gradient as well as the radial electric field inhomogeneity are quantified. (author)

Intrinsic torque reversals induced by magnetic shear effects on the turbulence spectrum in tokamak plasmas

Energy Technology Data Exchange (ETDEWEB)

Lu, Z. X.; Tynan, G. [Center for Energy Research and Department of Mechanical and Aerospace Engineering, University of California at San Diego, San Diego, California 92093 (United States); Center for Momentum Transport and Flow Organization and Center for Astrophysics and Space Science, University of California, San Diego, California 92093 (United States); Wang, W. X.; Ethier, S. [Princeton Plasma Physics Laboratory, Princeton, New Jersey 08540 (United States); Diamond, P. H. [Center for Momentum Transport and Flow Organization and Center for Astrophysics and Space Science, University of California, San Diego, California 92093 (United States); Gao, C.; Rice, J. [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

2015-05-15

Intrinsic torque, which can be generated by turbulent stresses, can induce toroidal rotation in a tokamak plasma at rest without direct momentum injection. Reversals in intrinsic torque have been inferred from the observation of toroidal velocity changes in recent lower hybrid current drive (LHCD) experiments. This work focuses on understanding the cause of LHCD-induced intrinsic torque reversal using gyrokinetic simulations and theoretical analyses. A new mechanism for the intrinsic torque reversal linked to magnetic shear (s{sup ^}) effects on the turbulence spectrum is identified. This reversal is a consequence of the ballooning structure at weak s{sup ^}. Based on realistic profiles from the Alcator C-Mod LHCD experiments, simulations demonstrate that the intrinsic torque reverses for weak s{sup ^} discharges and that the value of s{sup ^}{sub crit} is consistent with the experimental results s{sup ^}{sub crit}{sup exp}≈0.2∼0.3 [Rice et al., Phys. Rev. Lett. 111, 125003 (2013)]. The consideration of this intrinsic torque feature in our work is important for the understanding of rotation profile generation at weak s{sup ^} and its consequent impact on macro-instability stabilization and micro-turbulence reduction, which is crucial for ITER. It is also relevant to internal transport barrier formation at negative or weakly positive s{sup ^}.

THE TURBULENT DYNAMO IN HIGHLY COMPRESSIBLE SUPERSONIC PLASMAS

Energy Technology Data Exchange (ETDEWEB)

Federrath, Christoph [Research School of Astronomy and Astrophysics, The Australian National University, Canberra, ACT 2611 (Australia); Schober, Jennifer [Universität Heidelberg, Zentrum für Astronomie, Institut für Theoretische Astrophysik, Albert-Ueberle-Strasse 2, D-69120 Heidelberg (Germany); Bovino, Stefano; Schleicher, Dominik R. G., E-mail: christoph.federrath@anu.edu.au [Institut für Astrophysik, Georg-August-Universität Göttingen, Friedrich-Hund-Platz 1, D-37077 Göttingen (Germany)

2014-12-20

The turbulent dynamo may explain the origin of cosmic magnetism. While the exponential amplification of magnetic fields has been studied for incompressible gases, little is known about dynamo action in highly compressible, supersonic plasmas, such as the interstellar medium of galaxies and the early universe. Here we perform the first quantitative comparison of theoretical models of the dynamo growth rate and saturation level with three-dimensional magnetohydrodynamical simulations of supersonic turbulence with grid resolutions of up to 1024{sup 3} cells. We obtain numerical convergence and find that dynamo action occurs for both low and high magnetic Prandtl numbers Pm = ν/η = 0.1-10 (the ratio of viscous to magnetic dissipation), which had so far only been seen for Pm ≥ 1 in supersonic turbulence. We measure the critical magnetic Reynolds number, Rm{sub crit}=129{sub −31}{sup +43}, showing that the compressible dynamo is almost as efficient as in incompressible gas. Considering the physical conditions of the present and early universe, we conclude that magnetic fields need to be taken into account during structure formation from the early to the present cosmic ages, because they suppress gas fragmentation and drive powerful jets and outflows, both greatly affecting the initial mass function of stars.

Effects of anisotropic turbulent thermal diffusion on spherical magnetoconvection in the Earth's core

Science.gov (United States)

Ivers, D. J.; Phillips, C. G.

2018-03-01

We re-consider the plate-like model of turbulence in the Earth's core, proposed by Braginsky and Meytlis (1990), and show that it is plausible for core parameters not only in polar regions but extends to mid- and low-latitudes where rotation and gravity are not parallel, except in a very thin equatorial layer. In this model the turbulence is highly anisotropic with preferred directions imposed by the Earth's rotation and the magnetic field. Current geodynamo computations effectively model sub-grid scale turbulence by using isotropic viscous and thermal diffusion values significantly greater than the molecular values of the Earth's core. We consider a local turbulent dynamo model for the Earth's core in which the mean magnetic field, velocity and temperature satisfy the Boussinesq induction, momentum and heat equations with an isotropic turbulent Ekman number and Roberts number. The anisotropy is modelled only in the thermal diffusion tensor with the Earth's rotation and magnetic field as preferred directions. Nonlocal organising effects of gravity and rotation (but not aspect ratio in the Earth's core) such as an inverse cascade and nonlocal transport are assumed to occur at longer length scales, which computations may accurately capture with sufficient resolution. To investigate the implications of this anisotropy for the proposed turbulent dynamo model we investigate the linear instability of turbulent magnetoconvection on length scales longer than the background turbulence in a rotating sphere with electrically insulating exterior for no-slip and isothermal boundary conditions. The equations are linearised about an axisymmetric basic state with a conductive temperature, azimuthal magnetic field and differential rotation. The basic state temperature is a function of the anisotropy and the spherical radius. Elsasser numbers in the range 1-20 and turbulent Roberts numbers 0.01-1 are considered for both equatorial symmetries of the magnetic basic state. It is found

Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization

Science.gov (United States)

du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe

2018-02-01

The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

Magnetic field amplification and evolution in turbulent collisionless magnetohydrodynamics: An application to the intracluster medium

Energy Technology Data Exchange (ETDEWEB)

Santos-Lima, R.; De Gouveia Dal Pino, E. M.; Kowal, G. [Instituto de Astronomia, Geofísica e Ciências Atmosféricas, Universidade de São Paulo, R. do Matão, 1226, São Paulo, SP 05508-090 (Brazil); Falceta-Gonçalves, D. [Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, Rua Arlindo Bettio, 1000, São Paulo, SP 03828-000 (Brazil); Lazarian, A. [Department of Astronomy, University of Wisconsin, Madison, WI 53706 (United States); Nakwacki, M. S. [Instituto de Astronomía y Física del Espacio (IAFE), CONICET (Argentina)

2014-02-01

The amplification of magnetic fields (MFs) in the intracluster medium (ICM) is attributed to turbulent dynamo (TD) action, which is generally derived in the collisional-MHD framework. However, this assumption is poorly justified a priori, since in the ICM the ion mean free path between collisions is of the order of the dynamical scales, thus requiring a collisionless MHD description. The present study uses an anisotropic plasma pressure that brings the plasma within a parametric space where collisionless instabilities take place. In this model, a relaxation term of the pressure anisotropy simulates the feedback of the mirror and firehose instabilities, in consistency with empirical studies. Our three-dimensional numerical simulations of forced transonic turbulence, aiming the modeling of the turbulent ICM, were performed for different initial values of the MF intensity and different relaxation rates of the pressure anisotropy. We found that in the high-β plasma regime corresponding to the ICM conditions, a fast anisotropy relaxation rate gives results that are similar to the collisional-MHD model, as far as the statistical properties of the turbulence are concerned. Also, the TD amplification of seed MFs was found to be similar to the collisional-MHD model. The simulations that do not employ the anisotropy relaxation deviate significantly from the collisional-MHD results and show more power at the small-scale fluctuations of both density and velocity as a result of the action of the instabilities. For these simulations, the large-scale fluctuations in the MF are mostly suppressed and the TD fails in amplifying seed MFs.

Turbulent transport in low-beta plasmas

DEFF Research Database (Denmark)

Nielsen, A.H.; Pécseli, H.L.; Juul Rasmussen, J.

1996-01-01

Low-frequency electrostatic fluctuations are studied experimentally in a low-P plasma, with particular attention to their importance for the anomalous plasma transport across magnetic field lines. The presence of large coherent structures in a turbulent background at the edge of the plasma column...... is demonstrated by a statistical analysis. The importance of these structures for the turbulent transport is investigated. The study is extended by a multichannel conditional analysis to illustrate detailed properties and parameter dependences of the turbulent transport. (C) 1996 American Institute of Physics....

Turbulence near the wall in tokamaks

International Nuclear Information System (INIS)

Nedospasov, A.V.

1989-01-01

Causes of plasma turbulence in the shadow of poloidal limiter of tokamak are discussed. Current to limiter along the magnetic field plays the determining role. In this case the plasma on the external surrounding of torr is unstable relatively to channeled perturbations. Conditions of strong and weak recycling in limiter are considered. It is shown that in case of strong recycling, the amplitude and scale of turbulence pulsations and turbulent temperature conductivity of the plasma can be determined by low temperature of electrons near the limiter surface

Effects of Magnetic and Kinetic Helicities on the Growth of Magnetic Fields in Laminar and Turbulent Flows by Helical Fourier Decomposition

Energy Technology Data Exchange (ETDEWEB)

Linkmann, Moritz; Sahoo, Ganapati; Biferale, Luca [Department of Physics and INFN, University of Rome Tor Vergata, Via della Ricerca Scientifica 1, I-00133 Rome (Italy); McKay, Mairi; Berera, Arjun [School of Physics and Astronomy, University of Edinburgh, Peter Guthrie Tait Road, EH9 3FD, Edinburgh (United Kingdom)

2017-02-10

We present a numerical and analytical study of incompressible homogeneous conducting fluids using a helical Fourier representation. We analytically study both small- and large-scale dynamo properties, as well as the inverse cascade of magnetic helicity, in the most general minimal subset of interacting velocity and magnetic fields on a closed Fourier triad. We mainly focus on the dependency of magnetic field growth as a function of the distribution of kinetic and magnetic helicities among the three interacting wavenumbers. By combining direct numerical simulations of the full magnetohydrodynamics equations with the helical Fourier decomposition, we numerically confirm that in the kinematic dynamo regime the system develops a large-scale magnetic helicity with opposite sign compared to the small-scale kinetic helicity, a sort of triad-by-triad α -effect in Fourier space. Concerning the small-scale perturbations, we predict theoretically and confirm numerically that the largest instability is achived for the magnetic component with the same helicity of the flow, in agreement with the Stretch–Twist–Fold mechanism. Vice versa, in the presence of Lorentz feedback on the velocity, we find that the inverse cascade of magnetic helicity is mostly local if magnetic and kinetic helicities have opposite signs, while it is more nonlocal and more intense if they have the same sign, as predicted by the analytical approach. Our analytical and numerical results further demonstrate the potential of the helical Fourier decomposition to elucidate the entangled dynamics of magnetic and kinetic helicities both in fully developed turbulence and in laminar flows.

Mapping closure for probability distribution function in low frequency magnetized plasma turbulence

International Nuclear Information System (INIS)

Das, A.; Kaw, P.

1995-01-01

Recent numerical studies on the Hasegawa--Mima equation and its variants describing low frequency magnetized plasma turbulence indicate that the potential fluctuations have a Gaussian character whereas the vorticity exhibits non-Gaussian features. A theoretical interpretation for this observation using the recently developed mapping closure technique [Chen, Chen, and Kraichnan, Phys. Rev. Lett. 63, 2657 (1989)] has been provided here. It has been shown that non-Gaussian statistics for the vorticity arises because of a competition between nonlinear straining and diffusive damping whereas the Gaussianity of the statistics of φ arises because the only significant nonlinearity is associated with divergence free convection, which produces no strain terms. copyright 1995 American Institute of Physics

Turbulent effective absorptivity and refractivity

International Nuclear Information System (INIS)

Rax, J.M.

1984-09-01

The problem of wave propagation in a turbulent magnetized plasma is investigated. Considering small scale, low frequency density fluctuations we solve the Maxwell equations and show that the eikonal approximation remains valid with an effective refractivity and an effective absorptivity taking into account the energy diffusion due to the turbulent motion. Then the result is applied to the problem of lower hybrid waves scattering by drift waves density fluctuations in tokamaks

GMC Collisions as Triggers of Star Formation. II. 3D Turbulent, Magnetized Simulations

Energy Technology Data Exchange (ETDEWEB)

Wu, Benjamin; Tan, Jonathan C. [Department of Physics, University of Florida, Gainesville, FL 32611 (United States); Nakamura, Fumitaka [National Astronomical Observatory, Mitaka, Tokyo 181-8588 (Japan); Loo, Sven Van [School of Physics and Astronomy, University of Leeds (United Kingdom); Christie, Duncan [Department of Astronomy, University of Florida, Gainesville, FL 32611 (United States); Collins, David [Department of Physics, Florida State University, Tallahassee, FL 32306-4350 (United States)

2017-02-01

We investigate giant molecular cloud collisions and their ability to induce gravitational instability and thus star formation. This mechanism may be a major driver of star formation activity in galactic disks. We carry out a series of 3D, magnetohydrodynamics (MHD), adaptive mesh refinement simulations to study how cloud collisions trigger formation of dense filaments and clumps. Heating and cooling functions are implemented based on photo-dissociation region models that span the atomic-to-molecular transition and can return detailed diagnostic information. The clouds are initialized with supersonic turbulence and a range of magnetic field strengths and orientations. Collisions at various velocities and impact parameters are investigated. Comparing and contrasting colliding and non-colliding cases, we characterize morphologies of dense gas, magnetic field structure, cloud kinematic signatures, and cloud dynamics. We present key observational diagnostics of cloud collisions, especially: relative orientations between magnetic fields and density structures, like filaments; {sup 13}CO( J = 2-1), {sup 13}CO( J = 3-2), and {sup 12}CO( J = 8-7) integrated intensity maps and spectra; and cloud virial parameters. We compare these results to observed Galactic clouds.

Turbulent Transport in a Three-dimensional Solar Wind

Energy Technology Data Exchange (ETDEWEB)

Shiota, D. [Institute for Space-Earth Environmental Research, Nagoya University, Nagoya, Aichi 464-8601 (Japan); Zank, G. P.; Adhikari, L.; Hunana, P. [Center for Space Plasma and Aeronomic Research (CSPAR), Department of Space Science, University of Alabama in Huntsville, Huntsville, AL 35805 (United States); Telloni, D. [INAF—Astrophysical Observatory of Torino, Via Osservatorio 20, I-10025 Pino Torinese (Italy); Bruno, R., E-mail: shiota@isee.nagoya-u.ac.jp [INAF-IAPS Istituto di Astrofisica e Planetologia Spaziali, Via del Fosso del Cavaliere 100, I-00133 Roma (Italy)

2017-03-01

Turbulence in the solar wind can play essential roles in the heating of coronal and solar wind plasma and the acceleration of the solar wind and energetic particles. Turbulence sources are not well understood and thought to be partly enhanced by interaction with the large-scale inhomogeneity of the solar wind and the interplanetary magnetic field and/or transported from the solar corona. To investigate the interaction with background inhomogeneity and the turbulence sources, we have developed a new 3D MHD model that includes the transport and dissipation of turbulence using the theoretical model of Zank et al. We solve for the temporal and spatial evolution of three moments or variables, the energy in the forward and backward fluctuating modes and the residual energy and their three corresponding correlation lengths. The transport model is coupled to our 3D model of the inhomogeneous solar wind. We present results of the coupled solar wind-turbulence model assuming a simple tilted dipole magnetic configuration that mimics solar minimum conditions, together with several comparative intermediate cases. By considering eight possible solar wind and turbulence source configurations, we show that the large-scale solar wind and IMF inhomogeneity and the strength of the turbulence sources significantly affect the distribution of turbulence in the heliosphere within 6 au. We compare the predicted turbulence distribution results from a complete solar minimum model with in situ measurements made by the Helios and Ulysses spacecraft, finding that the synthetic profiles of the turbulence intensities show reasonable agreement with observations.

Suprathermal ion transport in turbulent magnetized plasmas

International Nuclear Information System (INIS)

Bovet, A. D.

2015-01-01

Suprathermal ions, which have an energy greater than the quasi-Maxwellian background plasma temperature, are present in many laboratory and astrophysical plasmas. In fusion devices, they are generated by the fusion reactions and auxiliary heating. Controlling their transport is essential for the success of future fusion devices that could provide a clean, safe and abundant source of electric power to our society. In space, suprathermal ions include energetic solar particles and cosmic rays. The understanding of the acceleration and transport mechanisms of these particles is still incomplete. Basic plasma devices allow detailed measurements that are not accessible in astrophysical and fusion plasmas, due to the difficulty to access the former and the high temperatures of the latter. The basic toroidal device TORPEX offers an easy access for diagnostics, well characterized plasma scenarios and validated numerical simulations of its turbulence dynamics, making it the ideal platform for the investigation of suprathermal ion transport. This Thesis presents three-dimensional measurements of a suprathermal ion beam injected in turbulent TORPEX plasmas. The combination of uniquely resolved measurements and first principle numerical simulations reveals the general non-diffusive nature of the suprathermal ion transport. A precise characterization of their transport regime shows that, depending on their energies, suprathermal ions can experience either a super diffusive transport or a subdiffusive transport in the same background turbulence. The transport character is determined by the interaction of the suprathermal ion orbits with the turbulent plasma structures, which in turn depends on the ratio between the ion energy and the background plasma temperature. Time-resolved measurements reveal a clear difference in the intermittency of suprathermal ions time-traces depending on the transport regime they experience. Conditionally averaged measurements uncover the influence of

Improved model of quasi-particle turbulence (with applications to Alfven and drift wave turbulence)

International Nuclear Information System (INIS)

Mendonca, J. T.; Hizanidis, K.

2011-01-01

We consider the classical problem of wave stability and dispersion in a turbulent plasma background. We adopt a kinetic description for the quasi-particle turbulence. We describe an improved theoretical approach, which goes beyond the geometric optics approximation and retains the recoil effects associated with the emission and absorption of low frequency waves by nearly resonant quasi-particles. We illustrate the present approach by considering two particular examples. One is the excitation of zonal flows by drift wave turbulence or driftons. The other is the coupling between ion acoustic waves and Alfven wave turbulence, eventually leading to saturation of Alfven wave growth. Both examples are relevant to anomalous transport in magnetic fusion devices. Connection with previous results is established. We show that these results are recovered in the geometric optics approximation.

Magnetohydrodynamic turbulence revisited

International Nuclear Information System (INIS)

Goldreich, P.; Sridhar, S.

1997-01-01

In 1965, Kraichnan proposed that MHD turbulence occurs as a result of collisions between oppositely directed Alfvacute en wave packets. Recent work has generated some controversy over the nature of nonlinear couplings between colliding Alfvacute en waves. We find that the resolution to much of the confusion lies in the existence of a new type of turbulence, intermediate turbulence, in which the cascade of energy in the inertial range exhibits properties intermediate between those of weak and strong turbulent cascades. Some properties of intermediate MHD turbulence are the following: (1) in common with weak turbulent cascades, wave packets belonging to the inertial range are long-lived; (2) however, components of the strain tensor are so large that, similar to the situation in strong turbulence, perturbation theory is not applicable; (3) the breakdown of perturbation theory results from the divergence of neighboring field lines due to wave packets whose perturbations in velocity and magnetic fields are localized, but whose perturbations in displacement are not; (4) three-wave interactions dominate individual collisions between wave packets, but interactions of all orders n≥3 make comparable contributions to the intermediate turbulent energy cascade; (5) successive collisions are correlated since wave packets are distorted as they follow diverging field lines; (6) in common with the weak MHD cascade, there is no parallel cascade of energy, and the cascade to small perpendicular scales strengthens as it reaches higher wavenumbers; (7) for an appropriate weak excitation, there is a natural progression from a weak, through an intermediate, to a strong cascade. copyright 1997 The American Astronomical Society

Confinement of ohmically heated plasmas and turbulent heating in high-magnetic field tokamak TRIAM-1

Energy Technology Data Exchange (ETDEWEB)

Hiraki, N; Itoh, S; Kawai, Y; Toi, K; Nakamura, K [Kyushu Univ., Fukuoka (Japan). Research Inst. for Applied Mechanics

1979-12-01

TRIAM-1, the tokamak device with high toroidal magnetic field, has been constructed to establish the scaling laws of advanced tokamak devices such as Alcator, and to study the possibility of the turbulent heating as a further economical heating method of the fusion oriented plasmas. The plasma parameters obtained by ohmic heating alone are as follows; central electron temperature T sub(e0) = 640 eV, central ion temperature T sub(i0) = 280 eV and line-average electron density n average sub(e) = 2.2 x 10/sup 14/ cm/sup -3/. The empirical scaling laws are investigated concerning T sub(e0), T sub(i0) and n average sub(e). The turbulent heating has been carried out by applying the high electric field in the toroidal direction to the typical tokamak discharge with T sub(i0) asymptotically equals 200 eV. The efficient ion heating is observed and T sub(i0) attains to about 600 eV.

Physical interpretation of the angle-dependent magnetic helicity spectrum in the solar wind: The nature of turbulent fluctuations near the proton gyroradius scale

Energy Technology Data Exchange (ETDEWEB)

Klein, Kristopher G.; Howes, Gregory G. [Department of Physics and Astronomy, University of Iowa, Iowa City, IA 52242 (United States); TenBarge, Jason M. [IREAP, University of Maryland, College Park, MD 20742 (United States); Podesta, John J., E-mail: kristopher-klein@uiowa.edu [Center for Space Plasma Physics, Space Science Institute, Boulder, CO 80301 (United States)

2014-04-20

Motivated by recent observations of distinct parallel and perpendicular signatures in magnetic helicity measurements segregated by wave period and angle between the local magnetic field and the solar wind velocity, this paper undertakes a comparison of three intervals of Ulysses data with synthetic time series generated from a physically motivated turbulence model. From these comparisons, it is hypothesized that the observed signatures result from a perpendicular cascade of Alfvénic fluctuations and a local, non-turbulent population of ion-cyclotron or whistler waves generated by temperature anisotropy instabilities. By constraining the model's free parameters through comparison to in situ data, it is found that, on average, ∼95% of the power near dissipative scales is contained in a perpendicular Alfvénic cascade and that the parallel fluctuations are propagating nearly unidirectionally. The effects of aliasing on magnetic helicity measurements are considered and shown to be significant near the Nyquist frequency.

Physical interpretation of the angle-dependent magnetic helicity spectrum in the solar wind: The nature of turbulent fluctuations near the proton gyroradius scale

International Nuclear Information System (INIS)

Klein, Kristopher G.; Howes, Gregory G.; TenBarge, Jason M.; Podesta, John J.

2014-01-01

Motivated by recent observations of distinct parallel and perpendicular signatures in magnetic helicity measurements segregated by wave period and angle between the local magnetic field and the solar wind velocity, this paper undertakes a comparison of three intervals of Ulysses data with synthetic time series generated from a physically motivated turbulence model. From these comparisons, it is hypothesized that the observed signatures result from a perpendicular cascade of Alfvénic fluctuations and a local, non-turbulent population of ion-cyclotron or whistler waves generated by temperature anisotropy instabilities. By constraining the model's free parameters through comparison to in situ data, it is found that, on average, ∼95% of the power near dissipative scales is contained in a perpendicular Alfvénic cascade and that the parallel fluctuations are propagating nearly unidirectionally. The effects of aliasing on magnetic helicity measurements are considered and shown to be significant near the Nyquist frequency.

Characterizing electrostatic turbulence in tokamak plasmas with high MHD activity

Energy Technology Data Exchange (ETDEWEB)

Guimaraes-Filho, Z O; Santos Lima, G Z dos; Caldas, I L; Nascimento, I C; Kuznetsov, Yu K [Instituto de Fisica, Universidade de Sao Paulo, Caixa Postal 66316, 05315-970, Sao Paulo, SP (Brazil); Viana, R L, E-mail: viana@fisica.ufpr.b [Departamento de Fisica, Universidade Federal do Parana, Caixa Postal 19044, 81531-990, Curitiba, PR (Brazil)

2010-09-01

One of the challenges in obtaining long lasting magnetic confinement of fusion plasmas in tokamaks is to control electrostatic turbulence near the vessel wall. A necessary step towards achieving this goal is to characterize the turbulence level and so as to quantify its effect on the transport of energy and particles of the plasma. In this paper we present experimental results on the characterization of electrostatic turbulence in Tokamak Chauffage Alfven Bresilien (TCABR), operating in the Institute of Physics of University of Sao Paulo, Brazil. In particular, we investigate the effect of certain magnetic field fluctuations, due to magnetohydrodynamical (MHD) instabilities activity, on the spectral properties of electrostatic turbulence at plasma edge. In some TCABR discharges we observe that this MHD activity may increase spontaneously, following changes in the edge safety factor, or after changes in the radial electric field achieved by electrode biasing. During the high MHD activity, the magnetic oscillations and the plasma edge electrostatic turbulence present several common linear spectral features with a noticeable dominant peak in the same frequency. In this article, dynamical analyses were applied to find other alterations on turbulence characteristics due to the MHD activity and turbulence enhancement. A recurrence quantification analysis shows that the turbulence determinism radial profile is substantially changed, becoming more radially uniform, during the high MHD activity. Moreover, the bicoherence spectra of these two kinds of fluctuations are similar and present high bicoherence levels associated with the MHD frequency. In contrast with the bicoherence spectral changes, that are radially localized at the plasma edge, the turbulence recurrence is broadly altered at the plasma edge and the scrape-off layer.

Recent results on analytical plasma turbulence theory: Realizability, intermittency, submarginal turbulence, and self-organized criticality

International Nuclear Information System (INIS)

Krommes, J.A.

2000-01-01

Recent results and future challenges in the systematic analytical description of plasma turbulence are described. First, the importance of statistical realizability is stressed, and the development and successes of the Realizable Markovian Closure are briefly reviewed. Next, submarginal turbulence (linearly stable but nonlinearly self-sustained fluctuations) is considered and the relevance of nonlinear instability in neutral-fluid shear flows to submarginal turbulence in magnetized plasmas is discussed. For the Hasegawa-Wakatani equations, a self-consistency loop that leads to steady-state vortex regeneration in the presence of dissipation is demonstrated and a partial unification of recent work of Drake (for plasmas) and of Waleffe (for neutral fluids) is given. Brief remarks are made on the difficulties facing a quantitatively accurate statistical description of submarginal turbulence. Finally, possible connections between intermittency, submarginal turbulence, and self-organized criticality (SOC) are considered and outstanding questions are identified

Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

Science.gov (United States)

Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

2017-11-01

A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Gyrokinetic simulation of microtearing turbulence

International Nuclear Information System (INIS)

Doerk, Hauke

2013-01-01

In modern fusion experiments, plasma turbulence is responsible for the radial heat transport and thus determines the plasma confinement within the magnetic field of tokamak devices. Deeper theoretical understanding is needed to explain today's and future fusion experiments. The goal of fusion research is to establish nuclear fusion as a safe and sustainable energy source. In future fusion power plants, and also in large fusion experiments like the presently constructed ITER, plasma heating predominantly affects the electron species. The reason is of fundamental nature: the collisional cross section of fast ions that are produced by the heating systems is larger for thermal electrons than for thermal ions. It is thus essential to correctly predict electron thermal transport, but the overall picture still continues to evolve. Besides microinstabilities on the electron gyroradius scales, also a stochastized magnetic field can contribute to enhanced electron transport. Already since the 1970's, the so-called microtearing instability is discussed as a source of stochastic fields. This microinstability deserves its name for breaking up the magnetic field structure by forming small-scale magnetic islands. The linear microtearing instability and its nonlinear, turbulent behavior is investigated in this thesis by means of numerical simulations with the gyrokinetic turbulence code Gene. The underlying gyrokinetic equations are not only appropriate to predict turbulent transport, but also describe neoclassical transport that is drift-kinetic in nature. Besides revealing interesting physics on long time scales, solving the neoclassical equation serves as an excellent test for the numerical implementation of the collision operator in Gene. Focusing on the local limit, it is found that a modification of this implementation that considers certain symmetries is necessary to obtain a satisfactory agreement with the well-established drift-kinetic neoclassical code Neo. Also the

Inertial-range spectrum of whistler turbulence

Directory of Open Access Journals (Sweden)

Y. Narita

2010-02-01

Full Text Available We develop a theoretical model of an inertial-range energy spectrum for homogeneous whistler turbulence. The theory is a generalization of the Iroshnikov-Kraichnan concept of the inertial-range magnetohydrodynamic turbulence. In the model the dispersion relation is used to derive scaling laws for whistler waves at highly oblique propagation with respect to the mean magnetic field. The model predicts an energy spectrum for such whistler waves with a spectral index −2.5 in the perpendicular component of the wave vector and thus provides an interpretation about recent discoveries of the second inertial-range of magnetic energy spectra at high frequencies in the solar wind.

Compressibility and rotation effects on transport suppression in magnetohydrodynamic turbulence

International Nuclear Information System (INIS)

Yoshizawa, A.

1996-01-01

Compressibility and rotation effects on turbulent transports in magnetohydrodynamic (MHD) flows under arbitrary mean field are investigated using a Markovianized two-scale statistical approach. Some new aspects of MHD turbulence are pointed out in close relation to plasma compressibility. Special attention is paid to the turbulent electromotive force, which plays a central role in the generation of magnetic and velocity fluctuations. In addition to plasma rotation, the interaction between compressibility and magnetic fields is shown to bring a few factors suppressing MHD fluctuations and, eventually, density and temperature transports, even in the presence of steep mean density and temperature gradients. This finding is discussed in the context of the turbulence-suppression mechanism in the tokamak close-quote s high-confinement modes. copyright 1996 American Institute of Physics

Ambipolar electric fields and turbulence studies in the Wisconsin levitated toroidal octupole

International Nuclear Information System (INIS)

Armentrout, C.J.

1977-01-01

Detailed studies of hot ion plasmas (T/sub i/ > T/sub e/) in the poloidal field octupole show that the ambipolar electric field which is perpendicular to the flux surfaces is well explained by the observed properties of the microturbulence structures in the plasma. The turbulence structure has been measured by correlation techniques which are carefully described. In these experiments, signals were studied which are aperiodic in time and space, short lived compared to the decay times of the bulk plasma parameters, short ranged compared to the machine size, and are therefore classified as microturbulence structures. The resulting spatial and temporal correlation functions (CFs) are well fitted to a Gaussian function and the associated correlation lengths or times are the half width at half maximum of the CFs. The correlation length is measured to be the ion gyro radius for the hot hydrogen plasma and somewhat less for the helium plasma

Flux surface shaping effects on tokamak edge turbulence and flows

Energy Technology Data Exchange (ETDEWEB)

Kendl, A. [Innsbruck Univ., Institut fuer Theoretische Physik, Association EURATOM (Austria); Scott, B.D. [Max-Planck-Institut fuer Plasmaphysik, EURATOM Association, Garching bei Muenchen (Germany)

2004-07-01

The influence of shaping of magnetic flux surfaces in tokamaks on gyro-fluid edge turbulence is studied numerically. Magnetic field shaping in tokamaks is mainly due to elongation, triangularity, shift and the presence of a divertor X-point. A series of tokamak configurations with varying elongation 1 {<=} {kappa} {>=} 2 and triangularity 0 {<=} {delta} {<=} 0.4, and an actual ASDEX Upgrade divertor configuration are obtained with the equilibrium code HELENA and implemented into the gyro-fluid turbulence code GEM. The study finds minimal impact on the zonal flow physics itself, but strong impact on the turbulence and transport. (authors)

Flux surface shaping effects on tokamak edge turbulence and flows

International Nuclear Information System (INIS)

Kendl, A.; Scott, B.D.

2004-01-01

The influence of shaping of magnetic flux surfaces in tokamaks on gyro-fluid edge turbulence is studied numerically. Magnetic field shaping in tokamaks is mainly due to elongation, triangularity, shift and the presence of a divertor X-point. A series of tokamak configurations with varying elongation 1 ≤ κ ≥ 2 and triangularity 0 ≤ δ ≤ 0.4, and an actual ASDEX Upgrade divertor configuration are obtained with the equilibrium code HELENA and implemented into the gyro-fluid turbulence code GEM. The study finds minimal impact on the zonal flow physics itself, but strong impact on the turbulence and transport. (authors)

Electron acceleration by wave turbulence in a magnetized plasma

Science.gov (United States)

Rigby, A.; Cruz, F.; Albertazzi, B.; Bamford, R.; Bell, A. R.; Cross, J. E.; Fraschetti, F.; Graham, P.; Hara, Y.; Kozlowski, P. M.; Kuramitsu, Y.; Lamb, D. Q.; Lebedev, S.; Marques, J. R.; Miniati, F.; Morita, T.; Oliver, M.; Reville, B.; Sakawa, Y.; Sarkar, S.; Spindloe, C.; Trines, R.; Tzeferacos, P.; Silva, L. O.; Bingham, R.; Koenig, M.; Gregori, G.

2018-05-01

Astrophysical shocks are commonly revealed by the non-thermal emission of energetic electrons accelerated in situ1-3. Strong shocks are expected to accelerate particles to very high energies4-6; however, they require a source of particles with velocities fast enough to permit multiple shock crossings. While the resulting diffusive shock acceleration4 process can account for observations, the kinetic physics regulating the continuous injection of non-thermal particles is not well understood. Indeed, this injection problem is particularly acute for electrons, which rely on high-frequency plasma fluctuations to raise them above the thermal pool7,8. Here we show, using laboratory laser-produced shock experiments, that, in the presence of a strong magnetic field, significant electron pre-heating is achieved. We demonstrate that the key mechanism in producing these energetic electrons is through the generation of lower-hybrid turbulence via shock-reflected ions. Our experimental results are analogous to many astrophysical systems, including the interaction of a comet with the solar wind9, a setting where electron acceleration via lower-hybrid waves is possible.

Statistical characteristics of turbulence in giant molecular clouds. Part 1

International Nuclear Information System (INIS)

Ogul'chansky, Ya.Yu.

1989-01-01

Using the invariant group of transformations of equations for characteristic functional of turbulence in compressible medium the spectral characteristics in inertial range are obtained. The influence of magnetic field on the turbulent spectra is evaluated. The application of the results obtained to supersonical turbulence in giant molecular clouds is discussed. 42 refs

Spacecraft observations of solar wind turbulence: an overview

International Nuclear Information System (INIS)

Horbury, T S; Forman, M A; Oughton, S

2005-01-01

Spacecraft measurements in the solar wind offer the opportunity to study magnetohydrodynamic (MHD) turbulence in a collisionless plasma in great detail. We review some of the key results of the study of this medium: the presence of large amplitude Alfven waves propagating predominantly away from the Sun; the existence of an active turbulent cascade; and the presence of intermittency similar to that in neutral fluids. We also discuss the presence of anisotropy in wavevector space relative to the local magnetic field direction. Some models suggest that MHD turbulence can evolve to a state with power predominantly in wavevectors either parallel to the magnetic field ('slab' fluctuations) or approximately perpendicular to it ('2D'). We review the existing evidence for such anisotropy, which has important consequences for the transport of energetic particles. Finally, we present the first results of a new analysis which provides the most accurate measurements to date of the wave-vector anisotropy of wavevector power in solar wind MHD turbulence

Properties of Turbulence in the Reconnection Exhaust: Numerical Simulations Compared with Observations

Energy Technology Data Exchange (ETDEWEB)

Pucci, F.; Olshevsky, V.; Lapenta, G. [Center for Mathematical Plasma Astrophysics, Department Wiskunde, KU Leuven, 200B Celestijnenlaan, Leuven, B-3001 (Belgium); Servidio, S.; Malara, F. [Dipartimento di Fisica, Università della Calabria, I-87036 Cosenza (Italy); Sorriso-Valvo, L. [Nanotec-CNR, U.O.S. di Cosenza, Via P. Bucci, Cubo 31C, Arcavacata di Rende, I-87036 (Italy); Matthaeus, W. H. [Department of Physics and Astronomy, University of Delaware, 217 Sharp Lab, Newark, DE 19716 (United States); Goldman, M. V.; Newman, D. L., E-mail: francesco.pucci@kuleuven.be [University of Colorado, Boulder, CO 80309 (United States)

2017-05-20

The properties of the turbulence that develops in the outflows of magnetic reconnection have been investigated using self-consistent plasma simulations, in three dimensions. As commonly observed in space plasmas, magnetic reconnection is characterized by the presence of turbulence. Here we provide a direct comparison of our simulations with reported observations of reconnection events in the magnetotail, investigating the properties of the electromagnetic field and the energy conversion mechanisms. In particular, simulations show the development of a turbulent cascade consistent with spacecraft observations, statistics of the dissipation mechanisms in the turbulent outflows similar to the ones observed in reconnection jets in the magnetotail, and that the properties of turbulence vary as a function of the distance from the reconnecting X-line.

Self-regulation of turbulence bursts and transport barriers

International Nuclear Information System (INIS)

Floriani, E; Ciraolo, G; Ghendrih, Ph; Sarazin, Y; Lima, R

2013-01-01

The interplay between turbulent bursts and transport barriers is analyzed with a simplified model of interchange turbulence in magnetically confined plasmas. The turbulent bursts spread into the transport barriers and, depending on the competing magnitude of the burst and stopping capability of the barrier, can burn through. Simulations of two models of transport barriers are presented: a hard barrier where interchange turbulence modes are stable in a prescribed region and a soft barrier with external plasma biasing. The response of the transport barriers to the non-linear perturbations of the turbulent bursts, addressed in a predator–prey approach, indicates that the barriers monitor an amplification factor of the turbulent bursts, with amplification smaller than one for most bursts and, in some cases, amplification factors that can significantly exceed unity. The weak barriers in corrugated profiles and magnetic structures, as well as the standard barriers, are characterized by these transmission properties, which then regulate the turbulent burst transport properties. The interplays of barriers and turbulent bursts are modeled as competing stochastic processes. For different classes of the probability density function (PDF) of these processes, one can predict the heavy tail properties of the bursts downstream from the barrier, either exponential for a leaky barrier, or with power laws for a tight barrier. The intrinsic probing of the transport barriers by the turbulent bursts thus gives access to the properties of the barriers. The main stochastic variables are the barrier width and the spreading distance of the turbulent bursts within the barrier, together with their level of correlation. One finds that in the case of a barrier with volumetric losses, such as radiation or particle losses as addressed in our present simulations, the stochastic model predicts a leaky behavior with an exponential PDF of escaping turbulent bursts in agreement with the simulation

Small-scale dynamo at low magnetic Prandtl numbers

Science.gov (United States)

Schober, Jennifer; Schleicher, Dominik; Bovino, Stefano; Klessen, Ralf S.

2012-12-01

The present-day Universe is highly magnetized, even though the first magnetic seed fields were most probably extremely weak. To explain the growth of the magnetic field strength over many orders of magnitude, fast amplification processes need to operate. The most efficient mechanism known today is the small-scale dynamo, which converts turbulent kinetic energy into magnetic energy leading to an exponential growth of the magnetic field. The efficiency of the dynamo depends on the type of turbulence indicated by the slope of the turbulence spectrum v(ℓ)∝ℓϑ, where v(ℓ) is the eddy velocity at a scale ℓ. We explore turbulent spectra ranging from incompressible Kolmogorov turbulence with ϑ=1/3 to highly compressible Burgers turbulence with ϑ=1/2. In this work, we analyze the properties of the small-scale dynamo for low magnetic Prandtl numbers Pm, which denotes the ratio of the magnetic Reynolds number, Rm, to the hydrodynamical one, Re. We solve the Kazantsev equation, which describes the evolution of the small-scale magnetic field, using the WKB approximation. In the limit of low magnetic Prandtl numbers, the growth rate is proportional to Rm(1-ϑ)/(1+ϑ). We furthermore discuss the critical magnetic Reynolds number Rmcrit, which is required for small-scale dynamo action. The value of Rmcrit is roughly 100 for Kolmogorov turbulence and 2700 for Burgers. Furthermore, we discuss that Rmcrit provides a stronger constraint in the limit of low Pm than it does for large Pm. We conclude that the small-scale dynamo can operate in the regime of low magnetic Prandtl numbers if the magnetic Reynolds number is large enough. Thus, the magnetic field amplification on small scales can take place in a broad range of physical environments and amplify week magnetic seed fields on short time scales.

Small-scale dynamo at low magnetic Prandtl numbers.

Science.gov (United States)

Schober, Jennifer; Schleicher, Dominik; Bovino, Stefano; Klessen, Ralf S

2012-12-01

The present-day Universe is highly magnetized, even though the first magnetic seed fields were most probably extremely weak. To explain the growth of the magnetic field strength over many orders of magnitude, fast amplification processes need to operate. The most efficient mechanism known today is the small-scale dynamo, which converts turbulent kinetic energy into magnetic energy leading to an exponential growth of the magnetic field. The efficiency of the dynamo depends on the type of turbulence indicated by the slope of the turbulence spectrum v(ℓ)∝ℓ^{ϑ}, where v(ℓ) is the eddy velocity at a scale ℓ. We explore turbulent spectra ranging from incompressible Kolmogorov turbulence with ϑ=1/3 to highly compressible Burgers turbulence with ϑ=1/2. In this work, we analyze the properties of the small-scale dynamo for low magnetic Prandtl numbers Pm, which denotes the ratio of the magnetic Reynolds number, Rm, to the hydrodynamical one, Re. We solve the Kazantsev equation, which describes the evolution of the small-scale magnetic field, using the WKB approximation. In the limit of low magnetic Prandtl numbers, the growth rate is proportional to Rm^{(1-ϑ)/(1+ϑ)}. We furthermore discuss the critical magnetic Reynolds number Rm_{crit}, which is required for small-scale dynamo action. The value of Rm_{crit} is roughly 100 for Kolmogorov turbulence and 2700 for Burgers. Furthermore, we discuss that Rm_{crit} provides a stronger constraint in the limit of low Pm than it does for large Pm. We conclude that the small-scale dynamo can operate in the regime of low magnetic Prandtl numbers if the magnetic Reynolds number is large enough. Thus, the magnetic field amplification on small scales can take place in a broad range of physical environments and amplify week magnetic seed fields on short time scales.

The connection of the interplanetary magnetic field turbulence and rigidity spectrum of Forbush decrease of the galactic cosmic ray intensity

International Nuclear Information System (INIS)

Wawrzynczak, A; Alania, M V

2015-01-01

We analyze the temporal changes in the rigidity spectrum of Forbush decrease (Fd) of the galactic cosmic ray (GCR) intensity observed in November 2004. We compute the rigidity spectrum in two energy ranges based on the daily data from the worldwide network of neutron monitors and Nagoya ground muon telescope. We demonstrate that the changes in the rigidity spectrum of Fd are linked to the evolution/decay of the interplanetary magnetic field (IMF) turbulence during various phases of the Fd. We analyze the time-evolution of the state of the turbulence of the IMF in various frequency ranges during the Fd. Performed analysis show that the decrease of the exponent ν of the Power Spectral Density (PSD ∝ f −ν , where f is frequency) of the IMF turbulence with decreasing frequency lead to the soft rigidity spectrum of Fd for GCR particles with relatively higher energies. (paper)

Diffusive Shock Acceleration and Turbulent Reconnection

Science.gov (United States)

Garrel, Christian; Vlahos, Loukas; Isliker, Heinz; Pisokas, Theophilos

2018-05-01

Diffusive Shock Acceleration (DSA) cannot efficiently accelerate particles without the presence of self-consistently generated or pre-existing strong turbulence (δB/B ˜ 1) in the vicinity of the shock. The problem we address in this article is: if large amplitude magnetic disturbances are present upstream and downstream of a shock then Turbulent Reconnection (TR) will set in and will participate not only in the elastic scattering of particles but also in their heating and acceleration. We demonstrate that large amplitude magnetic disturbances and Unstable Current Sheets (UCS), spontaneously formed in the strong turbulence in the vicinity of a shock, can accelerate particles as efficiently as DSA in large scale systems and on long time scales. We start our analysis with "elastic" scatterers upstream and downstream and estimate the energy distribution of particles escaping from the shock, recovering the well known results from the DSA theory. Next we analyze the additional interaction of the particles with active scatterers (magnetic disturbances and UCS) upstream and downstream of the shock. We show that the asymptotic energy distribution of the particles accelerated by DSA/TR has very similar characteristics with the one due to DSA alone, but the synergy of DSA with TR is much more efficient: The acceleration time is an order of magnitude shorter and the maximum energy reached two orders of magnitude higher. We claim that DSA is the dominant acceleration mechanism in a short period before TR is established, and then strong turbulence will dominate the heating and acceleration of the particles. In other words, the shock serves as the mechanism to set up a strongly turbulent environment, in which the acceleration mechanism will ultimately be the synergy of DSA and TR.

THE FORMATION OF ROTATIONAL DISCONTINUITIES IN COMPRESSIVE THREE-DIMENSIONAL MHD TURBULENCE

Energy Technology Data Exchange (ETDEWEB)

Yang, Liping; Feng, Xueshang [SIGMA Weather Group, State Key Laboratory for Space Weather, Center for Space Science and Applied Research, Chinese Academy of Sciences, 100190, Beijing (China); Zhang, Lei; He, Jiansen; Tu, Chuanyi; Wang, Linghua; Wang, Xin [School of Earth and Space Sciences, Peking University, 100871 Beijing (China); Marsch, Eckart [Institute for Experimental and Applied Physics, Christian Albrechts University at Kiel, D-24118 Kiel (Germany); Zhang, Shaohua, E-mail: jshept@gmail.com [Center of Spacecraft Assembly Integration and Test, China Academy of Space Technology, Beijing 100094 (China)

2015-08-20

Measurements of solar wind turbulence reveal the ubiquity of discontinuities. In this study we investigate how the discontinuities, especially rotational discontinuities (RDs), are formed in MHD turbulence. In a simulation of the decaying compressive three-dimensional (3D) MHD turbulence with an imposed uniform background magnetic field, we detect RDs with sharp field rotations and little variations of magnetic field intensity, as well as mass density. At the same time, in the de Hoffman–Teller frame, the plasma velocity is nearly in agreement with the Alfvén speed, and is field-aligned on both sides of the discontinuity. We take one of the identified RDs to analyze its 3D structure and temporal evolution in detail. By checking the magnetic field and plasma parameters, we find that the identified RD evolves from the steepening of the Alfvén wave with moderate amplitude, and that steepening is caused by the nonuniformity of the Alfvén speed in the ambient turbulence.

Turbulent regimes in the tokamak scrape-off layer

International Nuclear Information System (INIS)

Mosetto, A.

2014-01-01

The tokamak scrape-off layer (SOL) is the plasma region characterized by open field lines that start and end on the vessel walls. The plasma dynamics in the SOL plays a crucial role in determining the overall performance of a tokamak, since it controls the plasma-wall interactions, being responsible of exhausting the tokamak power, it regulates the overall plasma confinement, and it governs the plasma refueling and the removal of fusion ashes. Scrape-off layer physics is intrinsically non-linear and characterized by phenomena that occur on a wide range of spatio-temporal scales. Free energy sources drive a number of unstable modes that develop into turbulence and lead to transport of particles and heat across the magnetic field lines. Depending on the driving instability, different SOL turbulent regimes can be identified. As the SOL turbulent regimes determine the plasma confinement properties and the SOL width (and, consequently, the power flux on the vessel wall, for example), it is of crucial importance to understand which turbulent regimes are active in the SOL, under which conditions they develop, and which are the main properties of the associated turbulent transport. In the present thesis we define the SOL turbulent regimes, and we provide a framework to identify them, given the operational SOL parameters. Our study is based on the drift-reduced Braginskii equations and it is focused on a limited tokamak SOL configuration. We first describe the main SOL linear instabilities, such as the inertial and resistive branches of the drift waves, the resistive, inertial and ideal branches of the ballooning modes, and the ion temperature gradient mode. Then, we find the SOL turbulent regimes depending on the instability driving turbulent transport, assuming that turbulence saturates when the radial gradient associated to the pressure fluctuations is comparable to the equilibrium one. Our methodology for the turbulent regime identification is supported by the analysis

Topics in strong Langmuir turbulence

International Nuclear Information System (INIS)

Skoric, M.M.

1981-01-01

This thesis discusses certain aspects of the turbulence of a fully ionised non-isothermal plasma dominated by the Langmuir mode. Some of the basic properties of strongly turbulent plasmas are reviewed. In particular, interest is focused on the state of Langmuir turbulence, that is the turbulence of a simple externally unmagnetized plasma. The problem of the existence and dynamics of Langmuir collapse is discussed, often met as a non-linear stage of the modulational instability in the framework of the Zakharov equations (i.e. simple time-averaged dynamical equations). Possible macroscopic consequences of such dynamical turbulent models are investigated. In order to study highly non-linear collapse dynamics in its advanced stage, a set of generalized Zakharov equations are derived. Going beyond the original approximation, the author includes the effects of higher electron non-linearities and a breakdown of slow-timescale quasi-neutrality. He investigates how these corrections may influence the collapse stabilisation. Recently, it has been realised that the modulational instability in a Langmuir plasma will be accompanied by the collisionless-generation of a slow-timescale magnetic field. Accordingly, a novel physical situation has emerged which is investigated in detail. The stability of monochromatic Langmuir waves in a self-magnetized Langmuir plasma, is discussed, and the existence of a novel magneto-modulational instability shown. The wave collapse dynamics is investigated and a physical interpretation of the basic results is given. A problem of the transient analysis of an interaction of time-dependent electromagnetic pulses with linear cold plasma media is investigated. (Auth.)

Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

Science.gov (United States)

Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

2017-11-07

Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

Study of the magnetic turbulence in a corotating interaction region in the interplanetary medium

Directory of Open Access Journals (Sweden)

J. F. Valdés-Galicia

1999-11-01

Full Text Available We study the geometry of magnetic fluctuations in a CIR observed by Pioneer 10 at 5 AU between days 292 and 295 in 1973. We apply the methodology proposed by Bieber et al. to make a comparison of the relative importance of two geometric arrays of vector propagation of the magnetic field fluctuations: slab and two-dimensional (2D. We found that inside the studied CIR this model is not applicable due to the restrictions imposed on it. Our results are consistent with Alfvenic fluctuations propagating close to the radial direction, confirming Mavromichalaki et al.'s findings. A mixture of isotropic and magnetoacoustic waves in the region before the front shock would be consistent with our results, and a mixture of slab/2D and magnetoacoustic waves in a region after the reverse shock. We base the latter conclusions on the theoretical analysis made by Kunstmann. We discuss the reasons why the composite model can not be applied in the CIR studied although the fluctuations inside it are two dimensional.Key words. Solar physics · astrophysics and astronomy (magnetic fields · Space plasma physics (turbulence; waves and instabilities

Study of the magnetic turbulence in a corotating interaction region in the interplanetary medium

Directory of Open Access Journals (Sweden)

J. F. Valdés-Galicia

Full Text Available We study the geometry of magnetic fluctuations in a CIR observed by Pioneer 10 at 5 AU between days 292 and 295 in 1973. We apply the methodology proposed by Bieber et al. to make a comparison of the relative importance of two geometric arrays of vector propagation of the magnetic field fluctuations: slab and two-dimensional (2D. We found that inside the studied CIR this model is not applicable due to the restrictions imposed on it. Our results are consistent with Alfvenic fluctuations propagating close to the radial direction, confirming Mavromichalaki et al.'s findings. A mixture of isotropic and magnetoacoustic waves in the region before the front shock would be consistent with our results, and a mixture of slab/2D and magnetoacoustic waves in a region after the reverse shock. We base the latter conclusions on the theoretical analysis made by Kunstmann. We discuss the reasons why the composite model can not be applied in the CIR studied although the fluctuations inside it are two dimensional.

Key words. Solar physics · astrophysics and astronomy (magnetic fields · Space plasma physics (turbulence; waves and instabilities

Ulysses observations of magnetic waves due to newborn interstellar pickup ions. II. Application of turbulence concepts to limiting wave energy and observability

Energy Technology Data Exchange (ETDEWEB)

Cannon, Bradford E. [Physics Department, Florida State University, Tallahassee, FL 32306 (United States); Smith, Charles W.; Isenberg, Philip A.; Vasquez, Bernard J.; Joyce, Colin J. [Physics Department and Space Science Center, Institute for the Study of Earth, Oceans, and Space, University of New Hampshire, Durham, NH 03824 (United States); Murphy, Neil [Jet Propulsion Laboratory, Mail Stop 180-600, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States); Nuno, Raquel G., E-mail: bc13h@my.fsu.edu, E-mail: Charles.Smith@unh.edu, E-mail: Phil.Isenberg@unh.edu, E-mail: Bernie.Vasquez@unh.edu, E-mail: cjl46@wildcats.unh.edu, E-mail: Neil.Murphy@jpl.nasa.gov, E-mail: raquel.nuno@asu.edu [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States)

2014-06-01

The low-frequency magnetic waves that arise from the isotropization of newborn interstellar pickup ions (PUIs) are reasonably well described by linear and quasi-linear kinetic theory in so far as those theories predict the wave frequency and polarization in the spacecraft frame. Those theories fail to describe the scarce observability of the waves. Quasilinear theory predicts that the wave power should accumulate over long periods of time as the relatively weak kinetic instability slowly adds power to the observed spectrum. At the same time it has been argued that the same wave energy must serve as a secondary source of thermal ion heating in the outer heliosphere once the initial turbulence is depleted. To the extent that turbulent transport of the wave energy acts against the spectrally confined accumulation of wave energy, turbulence should be a limiting factor in observability. We argue that turbulence does limit the observability of the waves and we use turbulence theory to predict the observed wave energy. We compare this prediction against a database of 502 wave observations attributed to newborn interstellar PUIs observed by the Ulysses spacecraft.

Ulysses observations of magnetic waves due to newborn interstellar pickup ions. II. Application of turbulence concepts to limiting wave energy and observability

International Nuclear Information System (INIS)

Cannon, Bradford E.; Smith, Charles W.; Isenberg, Philip A.; Vasquez, Bernard J.; Joyce, Colin J.; Murphy, Neil; Nuno, Raquel G.

2014-01-01

The low-frequency magnetic waves that arise from the isotropization of newborn interstellar pickup ions (PUIs) are reasonably well described by linear and quasi-linear kinetic theory in so far as those theories predict the wave frequency and polarization in the spacecraft frame. Those theories fail to describe the scarce observability of the waves. Quasilinear theory predicts that the wave power should accumulate over long periods of time as the relatively weak kinetic instability slowly adds power to the observed spectrum. At the same time it has been argued that the same wave energy must serve as a secondary source of thermal ion heating in the outer heliosphere once the initial turbulence is depleted. To the extent that turbulent transport of the wave energy acts against the spectrally confined accumulation of wave energy, turbulence should be a limiting factor in observability. We argue that turbulence does limit the observability of the waves and we use turbulence theory to predict the observed wave energy. We compare this prediction against a database of 502 wave observations attributed to newborn interstellar PUIs observed by the Ulysses spacecraft.

Intermittent Anisotropic Turbulence Detected by THEMIS in the Magnetosheath

Science.gov (United States)

Macek, W. M.; Wawrzaszek, A.; Kucharuk, B.; Sibeck, D. G.

2017-12-01

Following our previous study of Time History of Events and Macroscale Interactions during Substorms (THEMIS) data, we consider intermittent turbulence in the magnetosheath depending on various conditions of the magnetized plasma behind the Earth’s bow shock and now also near the magnetopause. Namely, we look at the fluctuations of the components of the Elsässer variables in the plane perpendicular to the scale-dependent background magnetic fields and along the local average ambient magnetic fields. We have shown that Alfvén fluctuations often exhibit strong anisotropic non-gyrotropic turbulent intermittent behavior resulting in substantial deviations of the probability density functions from a normal Gaussian distribution with a large kurtosis. In particular, for very high Alfvénic Mach numbers and high plasma beta, we have clear anisotropy with non-Gaussian statistics in the transverse directions. However, along the magnetic field, the kurtosis is small and the plasma is close to equilibrium. On the other hand, intermittency becomes weaker for moderate Alfvén Mach numbers and lower values of the plasma parameter beta. It also seems that the degree of intermittency of turbulence for the outgoing fluctuations propagating relative to the ambient magnetic field is usually similar as for the ingoing fluctuations, which is in agreement with approximate equipartition of energy between these oppositely propagating Alfvén waves. We believe that the different characteristics of this intermittent anisotropic turbulent behavior in various regions of space and astrophysical plasmas can help identify nonlinear structures responsible for deviations of the plasma from equilibrium.

Polar spacecraft observations of the turbulent outer cusp/magnetopause boundary layer of Earth

Directory of Open Access Journals (Sweden)

J. S. Pickett

1999-01-01

Full Text Available The orbit of the Polar spacecraft has been ideally suited for studying the turbulent region of the cusp that is located near or just outside the magnetopause current sheet at 7-9 RE. The wave data obtained in this region show that electromagnetic turbulence is dominant in the frequency range 1-10 Hz. The waves responsible for this turbulence usually propagate perpendicular to the local magnetic field and have an index of refraction that generally falls between the estimated cold plasma theoretical values of the electromagnetic lower hybrid and whistler modes and may be composed of both modes in concert with kinetic Alfvén waves and/or fast magnetosonic waves. Fourier spectra of the higher frequency wave data also show the electromagnetic turbulence at frequencies up to and near the electron cyclotron frequency. This higher frequency electromagnetic turbulence is most likely associated with whistler mode waves. The lower hybrid drift and current gradient instabilities are suggested as possible mechanisms for producing the turbulence. The plasma and field environment of this turbulent region is examined and found to be extremely complex. Some of the wave activity is associated with processes occurring locally, such as changes in the DC magnetic field, while others are associated with solar wind and interplanetary magnetic field changes.

Polar Spacecraft Observations of the Turbulent Outer Cusp/Magnetopause Boundary Layer of Earth

Science.gov (United States)

Pickett, J. S.; Menietti, J. D.; Dowell, J. H.; Gurnett, D. A.; Scudder, J. D.

1999-01-01

The orbit of the Polar spacecraft has been ideally suited for studying the turbulent region of the cusp that is located near or just outside the magnetopause current sheet at 7-9 R(sub E). The wave data obtained in this region show that electromagnetic turbulence is dominant in the frequency range 1-10 Hz. The waves responsible for this turbulence usually propagate perpendicular to the local magnetic field and have an index of refraction that generally falls between the estimated cold plasma theoretical values of the electromagnetic lower hybrid and whistler modes and may be composed of both modes in concert with kinetic Alfven waves and/or fast magnetosonic waves. Fourier spectra of the higher frequency wave data also show the electromagnetic turbulence at frequencies up to and near the electron cyclotron frequency. This higher frequency electromagnetic turbulence is most likely associated with whistler mode waves. The lower hybrid drift and current gradient instabilities are suggested as possible mechanisms for producing the turbulence. The plasma and field environment of this turbulent region is examined and found to be extremely complex. Some of the wave activity is associated with processes occurring locally, such as changes in the DC magnetic field, while others are associated with solar wind and interplanetary magnetic field changes.

''Turbulent Equipartition'' Theory of Toroidal Momentum Pinch

International Nuclear Information System (INIS)

Hahm, T.S.; Diamond, P.H.; Gurcan, O.D.; Rewaldt, G.

2008-01-01

The mode-independent part of magnetic curvature driven turbulent convective (TuroCo) pinch of the angular momentum density (Hahm et al., Phys. Plasmas 14,072302 (2007)) which was originally derived from the gyrokinetic equation, can be interpreted in terms of the turbulent equipartition (TEP) theory. It is shown that the previous results can be obtained from the local conservation of 'magnetically weighted angular momentum density', nm i U # parallel# R/B 2 , and its homogenization due to turbulent flows. It is also demonstrated that the magnetic curvature modification of the parallel acceleration in the nonlinear gyrokinetic equation in the laboratory frame, which was shown to be responsible for the TEP part of the TurCo pinch of angular momentum density in the previous work, is closely related to the Coriolis drift coupling to the perturbed electric field. In addition, the origin of the diffusive flux in the rotating frame is highlighted. Finally, it is illustrated that there should be a difference in scalings between the momentum pinch originated from inherently toroidal effects and that coming from other mechanisms which exist in a simpler geometry.

The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

Science.gov (United States)

Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

2017-12-01

The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

TURBULENCE-GENERATED PROTON-SCALE STRUCTURES IN THE TERRESTRIAL MAGNETOSHEATH

Energy Technology Data Exchange (ETDEWEB)

Vörös, Zoltán; Narita, Yasuhito [Space Research Institute, Austrian Academy of Sciences, Graz (Austria); Yordanova, Emiliya [Swedish Institute of Space Physics, Uppsala (Sweden); Echim, Marius M. [Belgian Institute for Space Aeronomy, Bruxelles (Belgium); Consolini, Giuseppe, E-mail: zoltan.voeroes@oeaw.ac.at [INAF-Istituto di Astrofisica e Planetologia Spaziali, Roma (Italy)

2016-03-01

Recent results of numerical magnetohydrodynamic simulations suggest that in collisionless space plasmas, turbulence can spontaneously generate thin current sheets. These coherent structures can partially explain the intermittency and the non-homogenous distribution of localized plasma heating in turbulence. In this Letter, Cluster multi-point observations are used to investigate the distribution of magnetic field discontinuities and the associated small-scale current sheets in the terrestrial magnetosheath downstream of a quasi-parallel bow shock. It is shown experimentally, for the first time, that the strongest turbulence-generated current sheets occupy the long tails of probability distribution functions associated with extremal values of magnetic field partial derivatives. During the analyzed one-hour time interval, about a hundred strong discontinuities, possibly proton-scale current sheets, were observed.

The magnetic field and turbulence of the cosmic web measured using a brilliant fast radio burst.

Science.gov (United States)

Ravi, V; Shannon, R M; Bailes, M; Bannister, K; Bhandari, S; Bhat, N D R; Burke-Spolaor, S; Caleb, M; Flynn, C; Jameson, A; Johnston, S; Keane, E F; Kerr, M; Tiburzi, C; Tuntsov, A V; Vedantham, H K

2016-12-09

Fast radio bursts (FRBs) are millisecond-duration events thought to originate beyond the Milky Way galaxy. Uncertainty surrounding the burst sources, and their propagation through intervening plasma, has limited their use as cosmological probes. We report on a mildly dispersed (dispersion measure 266.5 ± 0.1 parsecs per cubic centimeter), exceptionally intense (120 ± 30 janskys), linearly polarized, scintillating burst (FRB 150807) that we directly localize to 9 square arc minutes. On the basis of a low Faraday rotation (12.0 ± 0.7 radians per square meter), we infer negligible magnetization in the circum-burst plasma and constrain the net magnetization of the cosmic web along this sightline to burst scintillation suggests weak turbulence in the ionized intergalactic medium. Copyright © 2016, American Association for the Advancement of Science.

Observations of electron vortex magnetic holes and related wave-particle interactions in the turbulent magnetosheath

Science.gov (United States)

Huang, S.; Sahraoui, F.; Yuan, Z.; He, J.; Zhao, J.; Du, J.; Le Contel, O.; Wang, X.; Deng, X.; Fu, H.; Zhou, M.; Shi, Q.; Breuillard, H.; Pang, Y.; Yu, X.; Wang, D.

2017-12-01

Magnetic hole is characterized by a magnetic depression, a density peak, a total electron temperature increase (with a parallel temperature decrease but a perpendicular temperature increase), and strong currents carried by the electrons. The current has a dip in the core region of the magnetic hole and a peak in the outer region of the magnetic hole. There is an enhancement in the perpendicular electron fluxes at 90° pitch angles inside the magnetic hole, implying that the electrons are trapped within it. The variations of the electron velocity components Vem and Ven suggest that an electron vortex is formed by trapping electrons inside the magnetic hole in the circular cross-section. These observations demonstrate the existence of a new type of coherent structures behaving as an electron vortex magnetic hole in turbulent space plasmas as predicted by recent kinetic simulations. We perform a statistically study using high time solution data from the MMS mission. The magnetic holes with short duration (i.e., < 0.5 s) have their cross section smaller than the ion gyro-radius. Superposed epoch analysis of all events reveals that an increase in the electron density and total temperature, significantly increase (resp. decrease) the electron perpendicular (resp. parallel) temperature, and an electron vortex inside the holes. Electron fluxes at 90° pitch angles with selective energies increase in the KSMHs, are trapped inside KSMHs and form the electron vortex due to their collective motion. All these features are consistent with the electron vortex magnetic holes obtained in 2D and 3D particle-in-cell simulations, indicating that the observed the magnetic holes seem to be best explained as electron vortex magnetic holes. It is furthermore shown that the magnetic holes are likely to heat and accelerate the electrons. We also investigate the coupling between whistler waves and electron vortex magnetic holes. These whistler waves can be locally generated inside electron

Nearly incompressible MHD turbulence in the solar wind

International Nuclear Information System (INIS)

Matthaeus, W.H.; Zhou, Y.

1989-01-01

Observational studies indicate that solar wind plasma and magnetic field fluctuations may be meaningfully viewed as an example of magnetohydrodynamic turbulence. This paper presents a brief summary of some relevant results of turbulence theory and reviews a turbulence style description of 'typical' solar wind conditions. Recent results, particularly those regarding the radial evolution of inertial range cross helicity, support the viewpoint that interplanetary turbulence is active and evolving with heliocentric distance. A number of observed properties can be understood by appeal to incompressible turbulence mechanisms. This connection may be understood by appeal to incompressible turbulence mechanisms. This connection may be understood in terms of theories of pseudosound density fluctuations and nearly incompressible magnetohydrodynamics, which are also reviewed here. Finally, we summarize a recent two-scale dynamical theory of the radial and temporal evolution of the turbulence, which may provide an additional framework for understanding the observations. (author). 49 refs

Zonal flow dynamics and control of turbulent transport in stellarators.

Science.gov (United States)

Xanthopoulos, P; Mischchenko, A; Helander, P; Sugama, H; Watanabe, T-H

2011-12-09

The relation between magnetic geometry and the level of ion-temperature-gradient (ITG) driven turbulence in stellarators is explored through gyrokinetic theory and direct linear and nonlinear simulations. It is found that the ITG radial heat flux is sensitive to details of the magnetic configuration that can be understood in terms of the linear behavior of zonal flows. The results throw light on the question of how the optimization of neoclassical confinement is related to the reduction of turbulence.

Chaotic Dynamos Generated by a Turbulent Flow of Liquid Sodium

International Nuclear Information System (INIS)

Ravelet, F.; Monchaux, R.; Aumaitre, S.; Chiffaudel, A.; Daviaud, F.; Dubrulle, B.; Berhanu, M.; Fauve, S.; Mordant, N.; Petrelis, F.; Bourgoin, M.; Odier, Ph.; Plihon, N.; Pinton, J.-F.; Volk, R.

2008-01-01

We report the observation of several dynamical regimes of the magnetic field generated by a turbulent flow of liquid sodium (VKS experiment). Stationary dynamos, transitions to relaxation cycles or to intermittent bursts, and random field reversals occur in a fairly small range of parameters. Large scale dynamics of the magnetic field result from the interactions of a few modes. The low dimensional nature of these dynamics is not smeared out by the very strong turbulent fluctuations of the flow

Magnetorotational instability and dynamo action in gravito-turbulent astrophysical discs

Science.gov (United States)

Riols, A.; Latter, H.

2018-02-01

Though usually treated in isolation, the magnetorotational and gravitational instabilities (MRI and GI) may coincide at certain radii and evolutionary stages of protoplanetary discs and active galactic nuclei. Their mutual interactions could profoundly influence several important processes, such as accretion variability and outbursts, fragmentation and disc truncation, or large-scale magnetic field production. Direct numerical simulations of both instabilities are computationally challenging and remain relatively unexplored. In this paper, we aim to redress this neglect via a set of 3D vertically stratified shearing-box simulations, combining self-gravity and magnetic fields. We show that gravito-turbulence greatly weakens the zero-net-flux MRI. In the limit of efficient cooling (and thus enhanced GI), the MRI is completely suppressed, and yet strong magnetic fields are sustained by the gravito-turbulence. This turbulent `spiral wave' dynamo may have widespread application, especially in galactic discs. Finally, we present preliminary work showing that a strong net-vertical-flux revives the MRI and supports a magnetically dominated state in which the GI is secondary.

The Hanle effect in a random magnetic field. Dependence of the polarization on statistical properties of the magnetic field

Science.gov (United States)

Frisch, H.; Anusha, L. S.; Sampoorna, M.; Nagendra, K. N.

2009-07-01

Context: The Hanle effect is used to determine weak turbulent magnetic fields in the solar atmosphere, usually assuming that the angular distribution is isotropic, the magnetic field strength constant, and that micro-turbulence holds, i.e. that the magnetic field correlation length is much less than a photon mean free path. Aims: To examine the sensitivity of turbulent magnetic field measurements to these assumptions, we study the dependence of Hanle effect on the magnetic field correlation length, its angular, and strength distributions. Methods: We introduce a fairly general random magnetic field model characterized by a correlation length and a magnetic field vector distribution. Micro-turbulence is recovered when the correlation length goes to zero and macro-turbulence when it goes to infinity. Radiative transfer equations are established for the calculation of the mean Stokes parameters and they are solved numerically by a polarized approximate lambda iteration method. Results: We show that optically thin spectral lines and optically very thick ones are insensitive to the correlation length of the magnetic field, while spectral lines with intermediate optical depths (around 10-100) show some sensitivity to this parameter. The result is interpreted in terms of the mean number of scattering events needed to create the surface polarization. It is shown that the single-scattering approximation holds good for thin and thick lines but may fail for lines with intermediate thickness. The dependence of the polarization on the magnetic field vector probability density function (PDF) is examined in the micro-turbulent limit. A few PDFs with different angular and strength distributions, but equal mean value of the magnetic field, are considered. It is found that the polarization is in general quite sensitive to the shape of the magnetic field strength PDF and somewhat to the angular distribution. Conclusions: The mean field derived from Hanle effect analysis of

Coherent and turbulent fluctuations in TFTR

International Nuclear Information System (INIS)

McGuire, K.; Arunasalam, V.; Bell, M.G.

1987-04-01

Classification of the sawteeth observed in the TFTR tokamak has been carried out to highlight the differences between the many types observed. Three types of sawteeth are discussed: ''simple,'' ''small,'' and ''compound.'' During the enhanced confinement discharges on TFTR, sawteeth related to q = 1 are usually not present, but a sawtooth-like event is sometimes observed. β approaches the Troyon limit only at low q/sub cyl/ with a clear reduction of achievable β/sub n/ at high q/sub cyl/. This suggests that a β/sub p/ limit, rather than the Troyon-Gruber limit, applies at high q/sub cyl/ in the enhanced confinement discharges. These discharges also reach the stability boundary for n → ∞ ideal MHD ballooning modes. Turbulence measurements in the scrape-off region with Langmuir and magnetic probes show strong edge density turbulence n/n = 0.3 - 0.5, with weak magnetic turbulence B/sub θ/B/sub θ/ > 5 x 10 -6 measured at the wall, but these measurements are very sensitive to local edge conditions

Seed islands driven by turbulence and NTM dynamics

Science.gov (United States)

Muraglia, M.; Agullo, O.; Poye, A.; Benkadda, S.; Horton, W.; Dubuit, N.; Garbet, X.; Sen, A.

2014-10-01

Magnetic reconnection is an issue for tokamak plasmas. Growing magnetic islands expel energetic particles from the plasma core leading to high energy fluxes in the SOL and may cause damage to the plasma facing components. The islands grow from seeds from the bootstrap current effects that oppose the negative delta-prime producing nonlinear island growth. Experimentally, the onset of NTM is quantified in terms of the beta parameter and the sawtooth period. Indeed, in experiments, (3;2) NTM magnetic islands are often triggered by sawtooth precursors. However (2;1) magnetic islands can appear without noticeable MHD event and the seed islands origin for the NTM growth is still an open question. Macroscale MHD instabilities (magnetic islands) coexist with micro-scale turbulent fluctuations and zonal flows which impact island dynamics. Nonlinear simulations show that the nonlinear beating of the fastest growing small-scale ballooning interchange modes on a low order rational surface drive a magnetic islands located on the same surface. The island size is found to be controlled by the turbulence level and modifies the NTM threshold and dynamics.

Initial results of H-mode edge pedestal turbulence evolution with quadrature reflectometer measurements on DIII-D

Energy Technology Data Exchange (ETDEWEB)

Wang, G. [University of California, Los Angeles, CA 90095 (United States)]. E-mail: wangg@fusion.gat.com; Peebles, W.A. [University of California, Los Angeles, CA 90095 (United States); Doyle, E.J. [University of California, Los Angeles, CA 90095 (United States); Rhodes, T.L. [University of California, Los Angeles, CA 90095 (United States); Zeng, L. [University of California, Los Angeles, CA 90095 (United States); Nguyen, X. [University of California, Los Angeles, CA 90095 (United States); Osborne, T.H. [General Atomics, San Diego, CA 92186-5608 (United States); Snyder, P.B. [General Atomics, San Diego, CA 92186-5608 (United States); Kramer, G.J. [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Nazikian, R. [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Groebner, R.J. [General Atomics, San Diego, CA 92186-5608 (United States); Burrell, K.H. [General Atomics, San Diego, CA 92186-5608 (United States); Leonard, A.W. [General Atomics, San Diego, CA 92186-5608 (United States); Fenstermacher, M.E. [Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Strait, E.J. [General Atomics, San Diego, CA 92186-5608 (United States)

2007-06-15

High-resolution quadrature reflectometer measurements of density fluctuation levels have been obtained on DIII-D for H-mode edge pedestal studies. Initial results are presented from the L-H transition to the first ELM for two cases: (i) a low pedestal beta discharge, in which density turbulence in the pedestal has little change during the ELM-free phase, and (ii) a high pedestal beta discharge in which both density and magnetic turbulence are observed to increase before the first ELM. These high beta data are consistent with the existence of electromagnetic turbulence suggested by some transport models. During Type-I ELM cycles, when little magnetic turbulence can be observed, pedestal turbulence increases just after an ELM crash and then decreases before next ELM strikes, in contrast to a drop after ELM crash and then it re-grows when strong magnetic turbulence shows similar behavior. Clear ELM precursors are observed on {<=}20% of Type-I ELMs observed to date.

Dissipative structures in magnetorotational turbulence

Science.gov (United States)

Ross, Johnathan; Latter, Henrik N.

2018-03-01

Via the process of accretion, magnetorotational turbulence removes energy from a disk's orbital motion and transforms it into heat. Turbulent heating is far from uniform and is usually concentrated in small regions of intense dissipation, characterised by abrupt magnetic reconnection and higher temperatures. These regions are of interest because they might generate non-thermal emission, in the form of flares and energetic particles, or thermally process solids in protoplanetary disks. Moreover, the nature of the dissipation bears on the fundamental dynamics of the magnetorotational instability (MRI) itself: local simulations indicate that the large-scale properties of the turbulence (e.g. saturation levels, the stress-pressure relationship) depend on the short dissipative scales. In this paper we undertake a numerical study of how the MRI dissipates and the small-scale dissipative structures it employs to do so. We use the Godunov code RAMSES and unstratified compressible shearing boxes. Our simulations reveal that dissipation is concentrated in ribbons of strong magnetic reconnection that are significantly elongated in azimuth, up to a scale height. Dissipative structures are hence meso-scale objects, and potentially provide a route by which large scales and small scales interact. We go on to show how these ribbons evolve over time — forming, merging, breaking apart, and disappearing. Finally, we reveal important couplings between the large-scale density waves generated by the MRI and the small-scale structures, which may illuminate the stress-pressure relationship in MRI turbulence.

MHD from a Microscopic Concept and Onset of Turbulence in Hartmann Flow

International Nuclear Information System (INIS)

Jirkovsky, L.; Bo-ot, L. Ma.; Chiang, C. M.

2010-01-01

We derive higher order magneto-hydrodynamic (MHD) equations from a microscopic picture using projection and perturbation formalism. In an application to Hartmann flow we find velocity profiles flattening towards the center at the onset of turbulence in hydrodynamic limit. Comparison with the system under the effect of a uniform magnetic field yields difference in the onset of turbulence consistent with observations, showing that the presence of magnetic field inhibits onset of instability or turbulence. The laminar-turbulent transition is demonstrated in a phase transition plot of the development in time of the relative average velocities vs. Reynolds number showing a sharp increase of the relative average velocity at the transition point as determined by the critical Reynolds number. (physics of gases, plasmas, and electric discharges)

Suppression of plasma turbulence during optimised shear configurations in JET

International Nuclear Information System (INIS)

Conway, G.D.; Borba, D.N.; Alper, B.

1999-08-01

Density turbulence suppression is observed in the internal transport barrier (ITB) region of JET discharges with optimised magnetic shear. The suppression occurs in two stages. First, low frequency turbulence is reduced across the plasma core by a toroidal velocity shear generated by intense auxiliary heating. Then when the ITB forms, high frequency turbulence is reduced locally within the steep pressure gradient region of the ITB, consistent with the effects of enhanced E x B poloidal shear. The turbulence suppression is correlated with reduced plasma transport and improved fusion performance. Much effort has been spent in recent years in developing alternative scenarios for operating tokamak fusion reactors. One particular scenario involves reversing or reducing the central magnetic shear to form an internal transport barrier (ITB). The result is reduced plasma core energy transport and enhanced fusion performance. It is believed that ITBs may be formed through a combination of E x B velocity shear and magnetic shear stabilisation of plasma turbulence and instabilities. In this Letter we present results from JET optimised shear discharges showing that turbulence suppression during ITB formation occurs in two stages. First low frequency turbulence is reduced across the plasma core, coinciding with a region of strong toroidal velocity shear; then high frequency turbulence is locally suppressed around the ITB region, consistent with enhanced pressure gradient driven E x B poloidal shear. The measurements were made using a system of X-mode reflectometers consisting of two, dual-channel toroidal correlation reflectometers at 75 GHz (covering plasma outboard edge) and 105 GHz (core and inboard edge), and a 92-96 GHz swept frequency radial correlation reflectometer (plasma core). Reflectometry is a powerful tool for measuring density fluctuations. The highly localised reflection of the microwave beam gives excellent spatial localisation. Measurements can be made

Generation and evolution of anisotropic turbulence and related energy transfer in drifting proton-alpha plasmas

Science.gov (United States)

Maneva, Y. G.; Poedts, S.

2018-05-01

The power spectra of magnetic field fluctuations in the solar wind typically follow a power-law dependence with respect to the observed frequencies and wave-numbers. The background magnetic field often influences the plasma properties, setting a preferential direction for plasma heating and acceleration. At the same time the evolution of the solar-wind turbulence at the ion and electron scales is influenced by the plasma properties through local micro-instabilities and wave-particle interactions. The solar-wind-plasma temperature and the solar-wind turbulence at sub- and sup-ion scales simultaneously show anisotropic features, with different components and fluctuation power in parallel with and perpendicular to the orientation of the background magnetic field. The ratio between the power of the magnetic field fluctuations in parallel and perpendicular direction at the ion scales may vary with the heliospheric distance and depends on various parameters, including the local wave properties and nonthermal plasma features, such as temperature anisotropies and relative drift speeds. In this work we have performed two-and-a-half-dimensional hybrid simulations to study the generation and evolution of anisotropic turbulence in a drifting multi-ion species plasma. We investigate the evolution of the turbulent spectral slopes along and across the background magnetic field for the cases of initially isotropic and anisotropic turbulence. Finally, we show the effect of the various turbulent spectra for the local ion heating in the solar wind.

Quantum turbulence of bellows-driven .sup.4./sup.He superflow: decay

Czech Academy of Sciences Publication Activity Database

Babuin, Simone; Varga, E.; Vinen, W. F.; Skrbek, L.

2015-01-01

Roč. 92, č. 18 (2015), "184503-1"-"184503-13" ISSN 1098-0121 Institutional support: RVO:68378271 Keywords : vortex-line density * counterflow turbulence * quantum turbulence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

Turbulence, transport, and zonal flows in the Madison symmetric torus reversed-field pinch

Science.gov (United States)

Williams, Z. R.; Pueschel, M. J.; Terry, P. W.; Hauff, T.

2017-12-01

The robustness and the effect of zonal flows in trapped electron mode (TEM) turbulence and Ion Temperature Gradient (ITG) turbulence in the reversed-field pinch (RFP) are investigated from numerical solutions of the gyrokinetic equations with and without magnetic external perturbations introduced to model tearing modes. For simulations without external magnetic field perturbations, zonal flows produce a much larger reduction of transport for the density-gradient-driven TEM turbulence than they do for the ITG turbulence. Zonal flows are studied in detail to understand the nature of their strong excitation in the RFP and to gain insight into the key differences between the TEM- and ITG-driven regimes. The zonal flow residuals are significantly larger in the RFP than in tokamak geometry due to the low safety factor. Collisionality is seen to play a significant role in the TEM zonal flow regulation through the different responses of the linear growth rate and the size of the Dimits shift to collisionality, while affecting the ITG only minimally. A secondary instability analysis reveals that the TEM turbulence drives zonal flows at a rate that is twice that of the ITG turbulence. In addition to interfering with zonal flows, the magnetic perturbations are found to obviate an energy scaling relation for fast particles.

Structure of the solar nebula, growth and decay of magnetic fields and effects of magnetic and turbulent viscosities on the nebula

International Nuclear Information System (INIS)

Hayashi, Chushiro

1982-01-01

First, distributions of surface densities of dust materials and gases in a preplanetary solar nebula, which give a good fit to the distribution of the planetary mass, are presented and the over-all structure of this nebula, which is in thermal and gravitational equilibrium, is studied. Second, in order to see magnetic effect on the structure, electric conductivity of a gas ionized by cosmic rays and radioactivities contained in dust grains is estimated for each region of the nebula and, then, the growth and decay of seed magnetic fields, which are due to differential rotation of the nebula and to the Joule dissipation, respectively, are calculated. The results indicate that, in regions of the terrestrial planets, magnetic fields decay much faster than they grow and magnetic effects can be ignored, except for the outermost layers of very low density. This is not the case for regions of Uranus and Neptune where magnetic fields can be amplified to considerable extents. Third, the transport of angular momentum due to magnetic and mechanical turbulent viscosities and the resultant redistribution of surface density in the nebula are investigated. The results show that the density redistribution occurs, in general, in a direction to attain a distribution of surface density which has nearly the same ν-dependence as that obtained from the present distribution of the planetary mass. This redistribution seems to be possible if it occurs at a formation stage of the nebula where the presence of large viscosities is expected. Finally, a comment is given on the initial condition of a collapsing interstellar cloud from which the solar nebula is formed at the end of the collapse. (author)

Relativistic Turbulence with Strong Synchrotron and Synchrotron-Self-Compton Cooling

Science.gov (United States)

Uzdensky, D. A.

2018-03-01

Many relativistic plasma environments in high-energy astrophysics, including pulsar wind nebulae, hot accretion flows onto black holes, relativistic jets in active galactic nuclei and gamma-ray bursts, and giant radio lobes, are naturally turbulent. The plasma in these environments is often so hot that synchrotron and inverse-Compton (IC) radiative cooling becomes important. In this paper we investigate the general thermodynamic and radiative properties (and hence the observational appearance) of an optically thin relativistically hot plasma stirred by driven magnetohydrodynamic (MHD) turbulence and cooled by radiation. We find that if the system reaches a statistical equilibrium where turbulent heating is balanced by radiative cooling, the effective electron temperature tends to attain a universal value θ = kT_e/m_e c^2 ˜ 1/√{τ_T}, where τT = neσTL ≪ 1 is the system's Thomson optical depth, essentially independent of the strength of turbulent driving and hence of the magnetic field. This is because both MHD turbulent dissipation and synchrotron cooling are proportional to the magnetic energy density. We also find that synchrotron self-Compton (SSC) cooling and perhaps a few higher-order IC components are automatically comparable to synchrotron in this regime. The overall broadband radiation spectrum then consists of several distinct components (synchrotron, SSC, etc.), well separated in photon energy (by a factor ˜ τ_T^{-1}) and roughly equal in power. The number of IC peaks is checked by Klein-Nishina effects and depends logarithmically on τT and the magnetic field. We also examine the limitations due to synchrotron self-absorption, explore applications to Crab PWN and blazar jets, and discuss links to radiative magnetic reconnection.

PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

International Nuclear Information System (INIS)

Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

2014-01-01

Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

Energy Technology Data Exchange (ETDEWEB)

Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)

2014-03-01

Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief

Magnetic resonance measurement of turbulent kinetic energy for the estimation of irreversible pressure loss in aortic stenosis.

Science.gov (United States)

Dyverfeldt, Petter; Hope, Michael D; Tseng, Elaine E; Saloner, David

2013-01-01

The authors sought to measure the turbulent kinetic energy (TKE) in the ascending aorta of patients with aortic stenosis and to assess its relationship to irreversible pressure loss. Irreversible pressure loss caused by energy dissipation in post-stenotic flow is an important determinant of the hemodynamic significance of aortic stenosis. The simplified Bernoulli equation used to estimate pressure gradients often misclassifies the ventricular overload caused by aortic stenosis. The current gold standard for estimation of irreversible pressure loss is catheterization, but this method is rarely used due to its invasiveness. Post-stenotic pressure loss is largely caused by dissipation of turbulent kinetic energy into heat. Recent developments in magnetic resonance flow imaging permit noninvasive estimation of TKE. The study was approved by the local ethics review board and all subjects gave written informed consent. Three-dimensional cine magnetic resonance flow imaging was used to measure TKE in 18 subjects (4 normal volunteers, 14 patients with aortic stenosis with and without dilation). For each subject, the peak total TKE in the ascending aorta was compared with a pressure loss index. The pressure loss index was based on a previously validated theory relating pressure loss to measures obtainable by echocardiography. The total TKE did not appear to be related to global flow patterns visualized based on magnetic resonance-measured velocity fields. The TKE was significantly higher in patients with aortic stenosis than in normal volunteers (p < 0.001). The peak total TKE in the ascending aorta was strongly correlated to index pressure loss (R(2) = 0.91). Peak total TKE in the ascending aorta correlated strongly with irreversible pressure loss estimated by a well-established method. Direct measurement of TKE by magnetic resonance flow imaging may, with further validation, be used to estimate irreversible pressure loss in aortic stenosis. Copyright © 2013 American

Real-time remedial action against aperiodic small signal rotor angle instability

DEFF Research Database (Denmark)

Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

2016-01-01

This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

Reconnection-driven Magnetohydrodynamic Turbulence in a Simulated Coronal-hole Jet

Energy Technology Data Exchange (ETDEWEB)

Uritsky, Vadim M.; Roberts, Merrill A. [Catholic University of America, 620 Michigan Avenue NE, Washington, DC 20064 (United States); DeVore, C. Richard; Karpen, Judith T., E-mail: vadim.uritsky@nasa.gov [Heliophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)

2017-03-10

Extreme-ultraviolet and X-ray jets occur frequently in magnetically open coronal holes on the Sun, especially at high solar latitudes. Some of these jets are observed by white-light coronagraphs as they propagate through the outer corona toward the inner heliosphere, and it has been proposed that they give rise to microstreams and torsional Alfvén waves detected in situ in the solar wind. To predict and understand the signatures of coronal-hole jets, we have performed a detailed statistical analysis of such a jet simulated by an adaptively refined magnetohydrodynamics model. The results confirm the generation and persistence of three-dimensional, reconnection-driven magnetic turbulence in the simulation. We calculate the spatial correlations of magnetic fluctuations within the jet and find that they agree best with the Müller–Biskamp scaling model including intermittent current sheets of various sizes coupled via hydrodynamic turbulent cascade. The anisotropy of the magnetic fluctuations and the spatial orientation of the current sheets are consistent with an ensemble of nonlinear Alfvén waves. These properties also reflect the overall collimated jet structure imposed by the geometry of the reconnecting magnetic field. A comparison with Ulysses observations shows that turbulence in the jet wake is in quantitative agreement with that in the fast solar wind.

Suppressing electron turbulence and triggering internal transport barriers with reversed magnetic shear in the National Spherical Torus Experiment

Energy Technology Data Exchange (ETDEWEB)

Peterson, J. L. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Bell, R.; Guttenfelder, W.; Hammett, G. W.; Kaye, S. M.; LeBlanc, B.; Mikkelsen, D. R. [Princeton Plasma Physics Laboratory, Princeton University, Princeton, New Jersey 08543 (United States); Candy, J. [General Atomics, San Diego, California 92186 (United States); Smith, D. R. [Department of Engineering Physics, University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States); Yuh, H. Y. [Nova Photonics Inc., Princeton, New Jersey 08540 (United States)

2012-05-15

The National Spherical Torus Experiment (NSTX) [M. Ono et al., Nucl. Fusion 40, 557 (2000)] can achieve high electron plasma confinement regimes that are super-critically unstable to the electron temperature gradient driven (ETG) instability. These plasmas, dubbed electron internal transport barriers (e-ITBs), occur when the magnetic shear becomes strongly negative. Using the gyrokinetic code GYRO [J. Candy and R. E. Waltz, J. Comput. Phys. 186, 545 (2003)], the first nonlinear ETG simulations of NSTX e-ITB plasmas reinforce this observation. Local simulations identify a strongly upshifted nonlinear critical gradient for thermal transport that depends on magnetic shear. Global simulations show e-ITB formation can occur when the magnetic shear becomes strongly negative. While the ETG-driven thermal flux at the outer edge of the barrier is large enough to be experimentally relevant, the turbulence cannot propagate past the barrier into the plasma interior.

Turbulence anisotropy and coherent structures in electromagnetically generated vortex patterns

International Nuclear Information System (INIS)

Kenjereš, S

2011-01-01

Numerical investigations addressing influence of the localised electromagnetic forcing on turbulent thermal convection of a weakly electrically conductive fluid in a wall-bounded rectangular enclosure are performed over a wide range of working parameters (10 4 ≤Ra≤5×10 5 , Pr = 7). An asymmetrical electromagnetic forcing (EMF) is applied originating from combined effects of the imposed magnetic fields (originating from an array of 5×7 permanent magnets with |b 0 | max = 1 T each, located beneath the lower thermally active wall) and electric fields (originating from two electrodes supplied with dc current of different intensities, 0≤I≤10 A). Subgrid turbulent stress is modelled by electromagnetically extended Smagorinsky model and subgrid turbulent heat flux is represented by a simple gradient diffusion hypothesis. Simulations revealed two interesting findings: the electromagnetic forcing generated significant overall heat transfer increase (more than 500% for lower values of Ra) compared to its neutral case, and, the turbulence anisotropy was reduced in the central part of the enclosure.

Radiation Hydrodynamical Turbulence in Protoplanetary Disks: Numerical Models and Observational Constraints

Science.gov (United States)

Flock, Mario; Nelson, Richard P.; Turner, Neal J.; Bertrang, Gesa H.-M.; Carrasco-González, Carlos; Henning, Thomas; Lyra, Wladimir; Teague, Richard

2017-12-01

Planets are born in protostellar disks, which are now observed with enough resolution to address questions about internal gas flows. Magnetic forces are possibly drivers of the flows, but ionization state estimates suggest that much of the gas mass decouples from magnetic fields. Thus, hydrodynamical instabilities could play a major role. We investigate disk dynamics under conditions typical for a T Tauri system, using global 3D radiation-hydrodynamics simulations with embedded particles and a resolution of 70 cells per scale height. Stellar irradiation heating is included with realistic dust opacities. The disk starts in joint radiative balance and hydrostatic equilibrium. The vertical shear instability (VSI) develops into turbulence that persists up to at least 1600 inner orbits (143 outer orbits). Turbulent speeds are a few percent of the local sound speed at the midplane, increasing to 20%, or 100 m s-1, in the corona. These are consistent with recent upper limits on turbulent speeds from optically thin and thick molecular line observations of TW Hya and HD 163296. The predominantly vertical motions induced by the VSI efficiently lift particles upward. Grains 0.1 and 1 mm in size achieve scale heights greater than expected in isotropic turbulence. We conclude that while kinematic constraints from molecular line emission do not directly discriminate between magnetic and nonmagnetic disk models, the small dust scale heights measured in HL Tau and HD 163296 favor turbulent magnetic models, which reach lower ratios of the vertical kinetic energy density to the accretion stress.

TEM turbulence optimisation in stellarators

Science.gov (United States)

Proll, J. H. E.; Mynick, H. E.; Xanthopoulos, P.; Lazerson, S. A.; Faber, B. J.

2016-01-01

With the advent of neoclassically optimised stellarators, optimising stellarators for turbulent transport is an important next step. The reduction of ion-temperature-gradient-driven turbulence has been achieved via shaping of the magnetic field, and the reduction of trapped-electron mode (TEM) turbulence is addressed in the present paper. Recent analytical and numerical findings suggest TEMs are stabilised when a large fraction of trapped particles experiences favourable bounce-averaged curvature. This is the case for example in Wendelstein 7-X (Beidler et al 1990 Fusion Technol. 17 148) and other Helias-type stellarators. Using this knowledge, a proxy function was designed to estimate the TEM dynamics, allowing optimal configurations for TEM stability to be determined with the STELLOPT (Spong et al 2001 Nucl. Fusion 41 711) code without extensive turbulence simulations. A first proof-of-principle optimised equilibrium stemming from the TEM-dominated stellarator experiment HSX (Anderson et al 1995 Fusion Technol. 27 273) is presented for which a reduction of the linear growth rates is achieved over a broad range of the operational parameter space. As an important consequence of this property, the turbulent heat flux levels are reduced compared with the initial configuration.

Development and anisotropy of three-dimensional turbulence in a current sheet

International Nuclear Information System (INIS)

Onofri, M.; Veltri, P.; Malara, F.

2007-01-01

The nonlinear evolution of three-dimensional reconnection instabilities are studied in a current sheet where many resonant surfaces are simultaneously present at different locations of the simulation domain. The nonlinear evolution produces the development of anisotropic magnetohydrodynamic turbulence. The development of the energy spectrum is followed until the energy is transported to the dissipative length scale and the anisotropy of the spectrum is analyzed. The energy cascade is affected by the Alfven effect and it takes place mainly in the direction perpendicular to the local average magnetic field. Anisotropy is also affected by propagation of perturbations across the main magnetic field, due to the growth of a transverse component related to reconnection. The direction of anisotropy varies with the position in space. The spectral index is different both from what is found in homogeneous isotropic turbulence and from the values predicted for magnetohydrodynamic turbulence with a uniform large-scale magnetic field

Self-sustained collisional drift-wave turbulence in a sheared magnetic field

International Nuclear Information System (INIS)

Scott, B.D.

1990-01-01

Although collisional drift waves in a sheared slab configuration are linearly damped, it is found that the corresponding turbulence is self-sustaining if initialized at nonlinear amplitude. The influence of the free-energy source represented by the temperature and density gradients on the turbulent system involving bidirectional spectral energy transfer is responsible for this change of regime. Several important features of tokamak edge fluctuations are reproduced by these single-rational-surface nonlinear dynamics. As a result, drift-wave turbulence must still be considered as an underlying dynamic of anomalous transport in tokamak edges

Multiscale Pressure-Balanced Structures in Three-dimensional Magnetohydrodynamic Turbulence

Energy Technology Data Exchange (ETDEWEB)

Yang, Liping; Zhang, Lei; Feng, Xueshang [SIGMA Weather Group, State Key Laboratory for Space Weather, National Space Science Center, Chinese Academy of Sciences, 100190, Beijing (China); He, Jiansen; Tu, Chuanyi; Wang, Linghua [School of Earth and Space Sciences, Peking University, 100871 Beijing (China); Li, Shengtai [Theoretical Division, MS B284, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Marsch, Eckart [Institute for Experimental and Applied Physics, Christian Albrechts University at Kiel, D-24118 Kiel (Germany); Wang, Xin, E-mail: jshept@gmail.com [School of Space and Environment, Beihang University, 100191 Beijing (China)

2017-02-10

Observations of solar wind turbulence indicate the existence of multiscale pressure-balanced structures (PBSs) in the solar wind. In this work, we conduct a numerical simulation to investigate multiscale PBSs and in particular their formation in compressive magnetohydrodynamic turbulence. By the use of the higher-order Godunov code Athena, a driven compressible turbulence with an imposed uniform guide field is simulated. The simulation results show that both the magnetic pressure and the thermal pressure exhibit a turbulent spectrum with a Kolmogorov-like power law, and that in many regions of the simulation domain they are anticorrelated. The computed wavelet cross-coherence spectra of the magnetic pressure and the thermal pressure, as well as their space series, indicate the existence of multiscale PBSs, with the small PBSs being embedded in the large ones. These multiscale PBSs are likely to be related to the highly oblique-propagating slow-mode waves, as the traced multiscale PBS is found to be traveling in a certain direction at a speed consistent with that predicted theoretically for a slow-mode wave propagating in the same direction.

Redistribution of energetic particles by background turbulence

International Nuclear Information System (INIS)

Hauff, T.; Jenko, F.

2007-01-01

The quest to understand the turbulent transport of particles, momentum and energy in magnetized plasmas remains a key challenge in fusion research. A basic issue being .still relatively poorly understood is the turbulent ExB advection of charged test particles with large gyroradii. Especially the interaction of alpha particles or impurities with the background turbulence is of great interest. In order to understand the dependence of the particle diffusivity on the interaction mechanisms between FLR effects and the special structure of a certain type of turbulence, direct numerical simulations are done in artificially created two dimensional turbulent electrostatic fields, assuming a constant magnetic field. Finite gyroradius effects are introduced using the gyrokinetic approximation which means that the gyrating particle is simply replaced by a charged ring. Starting from an idealized isotropic potential with Gaussian autocorrelation function, numerous test particle simulations are done varying both the gyroradius and the Kubo number of the potential. It is found that for Kubo numbers larger than about unity, the particle diffusivity is almost independent of the gyroradius as long as the latter does not exceed the correlation length of the electrostatic potential, whereas for small Kubo numbers the diffusivity is monotonically reduced. The underlying physical mechanisms of this behavior are identified and an analytic approach is developed which favorably agrees with the simulation results. The investigations are extended by introducing anisotropic structures like streamers and zonal flows into the artificial potential, leading to quantitative modulations of the gyroradius dependence of the diffusion coefficient. Analytic models are used to explain these various effects. After having developed a general overview on the behavior in simplified artificial potentials, test particle simulations in realistic turbulence created by the gyrokinetic turbulence code GENE are

EFFECTS OF ELECTROMAGNETIC TURBULENCE IN THE NEOCLASSICAL OHM's LAW

International Nuclear Information System (INIS)

HINTON, F.L; WALTZ, R.E; CANDY, J.

2003-01-01

OAK-B135 An Ohm's law for tokamak plasmas has been derived, which includes the effect of electromagnetic turbulence as well as the neoclassical conductivity and bootstrap current. The most important current-driving effects of the turbulence have been identified, expressions for the driven (dynamo) current have been derived and these have been evaluated using the GYRO electromagnetic turbulence code. The most important current drive mechanism, the divergence of the radial flux of parallel electron momentum induced by magnetic flutter, drives a current density which have positive peaks on low order rational surfaces, with compensating negative dips nearby, thus driving zero total current. Another current drive mechanism, the beating of the parallel electric field fluctuations with the electron density fluctuations, drives a current density which is much smaller than that driven by the magnetic flutter mechanism, but could drive a nonzero total current

3D Measurements of coupled freestream turbulence and secondary flow effects on film cooling

Science.gov (United States)

Ching, David S.; Xu, Haosen H. A.; Elkins, Christopher J.; Eaton, John K.

2018-06-01

The effect of freestream turbulence on a single round film cooling hole is examined at two turbulence levels of 5 and 8% and compared to a baseline low freestream turbulence case. The hole is inclined at 30° and has length to diameter ratio L/D=4 and unity blowing ratio. Turbulence is generated with grid upstream of the hole in the main channel. The three-dimensional, three-component mean velocity field is acquired with magnetic resonance velocimetry (MRV) and the three-dimensional temperature field is acquired with magnetic resonance thermometry (MRT). The 8% turbulence grid produces weak mean secondary flows in the mainstream (peak crossflow velocities are 7% of U_bulk) which push the jet close to the wall and significantly change the adiabatic effectiveness distribution. By contrast, the 5% grid has a simpler structure and does not produce a measurable secondary flow structure. The grid turbulence causes little change to the temperature field, indicating that the turbulence generated in the shear layers around the jet dominates the freestream turbulence. The results suggest that secondary flows induced by complex turbulence generators may have caused some of the contradictory results in previous works.

Numerical and theoretical investigations of resistive drift wave turbulence

International Nuclear Information System (INIS)

Sunn Pedersen, T.

1995-07-01

With regard to the development of thermonuclear fusion utilizing a plasma confined in a magnetic field, anomalous transport is a major problem and is considered to be caused by electrostatic drift wave turbulence. A simplified quasi-two-dimensional slab model of resistive drift wave turbulence is investigated numerically and theoretically. The model (Hasegawa and Wakatani), consists of two nonlinear partial differential equations for the density perturbation n and the electrostatic potential perturbation φ. It includes the effect of a background density gradient perpendicular to the magnetic field and a generalized Ohm's law for the electrons in the direction parallel to the magnetic field. It may be used to model the basic features of electrostatic turbulence and the associated transport in an edge plasma. Model equations are derived and some important properties of the system are discussed. It is described how the Fourier spectral method is applied to the Hasegawa-Wakatani equations, how the time integration is developed to ensure accurate and fast simulations in a large parameter regime, and how the accuracy of the code is checked. Numerical diagnostics are developed to verify and extend the results in publications concerning quasi-stationary turbulent states and to give an overview of the properties of the quasi-stationary turbulent state. The use of analysis tools, not previously applied to the Hasegawa-Wakatani system, and the results obtained are described. Fluid particles are tracked to obtain Lagrangian statistics for the turbulence. A new theoretical analysis of relative dispersion leads to a decomposition criterion for the particles. The significance of this is investigated numerically and characteristic time scales for particles are determined for a range of parameter values. It is indicated that the turbulent state can be characterized in the context of nonlinear dynamics and chaos theory as an attractor with a large basin of attraction. The basic

Turbulent transport and shear at the E x B velocity in wall plasma of the TF-2 tokamak

International Nuclear Information System (INIS)

Budaev, V.P.

1999-01-01

Turbulence of near-the-wall plasma and potentialities of affecting the turbulence and periphery transport of the TF-2 tokamak by inducing radial electric fields and ergodization of periphery magnetic structure have been investigated, the results are presented. Essential role of the E x B velocity shear in suppression of the turbulence and turbulent transport in periphery has been pointed out. Decrease in transport losses stemming from effect of radial electric fields is brought about suppression of turbulence amplitude, decrease in correlations and decrease in the width of the wave numbers spectrum. Profiles of plasma density, electron temperature, turbulence level, electric fields over entire periphery of discharge change as a result. Ergodization of magnetic structure also results in the change of properties of periphery turbulence and turbulent transport [ru

Reduction effect of neutral density on the excitation of turbulent drift waves in a linear magnetized plasma with flow

International Nuclear Information System (INIS)

Saitou, Y.; Yonesu, A.; Shinohara, S.; Ignatenko, M. V.; Kasuya, N.; Kawaguchi, M.; Terasaka, K.; Nishijima, T.; Nagashima, Y.; Kawai, Y.; Yagi, M.; Itoh, S.-I.; Azumi, M.; Itoh, K.

2007-01-01

The importance of reducing the neutral density to reach strong drift wave turbulence is clarified from the results of the extended magnetohydrodynamics and Monte Carlo simulations in a linear magnetized plasma. An upper bound of the neutral density relating to the ion-neutral collision frequency for the excitation of drift wave instability is shown, and the necessary flow velocity to excite this instability is also estimated from the neutral distributions. Measurements of the Mach number and the electron density distributions using Mach probe in the large mirror device (LMD) of Kyushu University [S. Shinohara et al., Plasma Phys. Control. Fusion 37, 1015 (1995)] are reported as well. The obtained results show a controllability of the neutral density and provide the basis for neutral density reduction and a possibility to excite strong drift wave turbulence in the LMD

Bispectral experimental estimation of the nonlinear energy transfer in two-dimensional plasma turbulence

DEFF Research Database (Denmark)

Manz, P.; Ramisch, M.; Stroth, U.

2008-01-01

Experimental density and potential fluctuation data from a 2D probe array have been analysed to study the turbulent cascade in a toroidally confined magnetized plasma. The bispectral analysis technique used is from Ritz et al ( 1989 Phys. Fluids B 1 153) and Kim et al ( 1996 Phys. Plasmas 3 3998...... scales. This is the first experimental evidence for the dual turbulent cascade in a magnetized plasma....

Particle acceleration by electromagnetic ion cyclotron turbulence

International Nuclear Information System (INIS)

Crew, G.B.; Chang, Tom

1990-01-01

The LF EM-turbulence which furnishes energy for the acceleration of ions in various regions of the earth's magnetosphere efficiently accomplishes its transfer of energy from waves to particles through ion cyclotron resonance (ICR) with the left-hand polarized component of the turbulence; the result of this interaction is a heating of the particle distribution. A general theoretical treatment of ICR heating in a weakly inhomogeneous magnetic geometry is presented, en route to a more detailed examination of auroral ion conics' formation. A substantial simplification of the analysis of the altitude-asymptotic form of the conic distribution is obtained via the similarity transformation introduced into the properties of the electric field spectral density and the earth's dipolar magnetic field. 60 refs

Influence of the Solar Cycle on Turbulence Properties and Cosmic-Ray Diffusion

Science.gov (United States)

Zhao, L.-L.; Adhikari, L.; Zank, G. P.; Hu, Q.; Feng, X. S.

2018-04-01

The solar cycle dependence of various turbulence quantities and cosmic-ray (CR) diffusion coefficients is investigated by using OMNI 1 minute resolution data over 22 years. We employ Elsässer variables z ± to calculate the magnetic field turbulence energy and correlation lengths for both the inwardly and outwardly directed interplanetary magnetic field (IMF). We present the temporal evolution of both large-scale solar wind (SW) plasma variables and small-scale magnetic fluctuations. Based on these observed quantities, we study the influence of solar activity on CR parallel and perpendicular diffusion using quasi-linear theory and nonlinear guiding center theory, respectively. We also evaluate the radial evolution of the CR diffusion coefficients by using the boundary conditions for different solar activity levels. We find that in the ecliptic plane at 1 au (1), the large-scale SW temperature T, velocity V sw, Alfvén speed V A , and IMF magnitude B 0 are positively related to solar activity; (2) the fluctuating magnetic energy density , residual energy E D , and corresponding correlation functions all have an obvious solar cycle dependence. The residual energy E D is always negative, which indicates that the energy in magnetic fluctuations is larger than the energy in kinetic fluctuations, especially at solar maximum; (3) the correlation length λ for magnetic fluctuations does not show significant solar cycle variation; (4) the temporally varying shear source of turbulence, which is most important in the inner heliosphere, depends on the solar cycle; (5) small-scale fluctuations may not depend on the direction of the background magnetic field; and (6) high levels of SW fluctuations will increase CR perpendicular diffusion and decrease CR parallel diffusion, but this trend can be masked if the background IMF changes in concert with turbulence in response to solar activity. These results provide quantitative inputs for both turbulence transport models and CR

Turbulent current layer equilibrium and current layer of the Earth magnetotail

International Nuclear Information System (INIS)

Antonova, E.E.; Ovchinnikov, I.L.

1996-01-01

Analysis of distribution of plasma and magnetic field concentration in the unidimensional current layer under the condition of equality of the current inflowing into the layer and the counter diffusion current by various dependences of the regular velocity and the turbulent diffusion coefficient on the magnetic field. Corresponding two-dimensional solutions are obtained in the tail approximation. Comparison of the model turbulent current layer with characteristics of the plasma layer of the Earth magnetosphere tail is carried out. 16 refs., 3 figs

Characterization of edge turbulence in relation to edge magnetic field configuration in Ohmic L-mode plasmas in the Mega Amp Spherical Tokamak

Science.gov (United States)

Hnat, B.; Dudson, B. D.; Dendy, R. O.; Counsell, G. F.; Kirk, A.; MAST Team

2008-08-01

Ion saturation current (Isat) measurements of edge plasma turbulence are analysed for six MAST L-mode plasmas that differ primarily in their edge magnetic field configurations. The analysis techniques are designed to capture the strong nonlinearities of the datasets. First, absolute moments of the data are examined to obtain accurate values of scaling exponents. This confirms dual scaling behaviour in all samples, with the temporal scale τ ≈ 40-60 µs separating the two regimes. Strong universality is then identified in the functional form of the probability density function (PDF) for Isat fluctuations, which is well approximated by the Fréchet distribution on temporal scales τ 40 µs, the PDFs appear to converge to the Gumbel distribution, which has been previously identified as a universal feature of many other complex phenomena. The optimal fitting parameters k = 1.15 for Fréchet and a = 1.35 for Gumbel provide a simple quantitative characterization of the full spectrum of fluctuations. It is concluded that, to good approximation, the properties of the edge turbulence are independent of the edge magnetic field configuration.

Spectrum of resistivity gradient driven turbulence

International Nuclear Information System (INIS)

Terry, P.W.; Diamond, P.H.; Shaing, K.C.; Garcia, L.; Carreras, B.A.

1986-01-01

The resistivity fluctuation correlation function and electrostatic potential spectrum of resistivity gradient driven turbulence are calculated analytically and compared to the results of three dimensional numerical calculations. Resistivity gradient driven turbulence is characterized by effective Reynolds' numbers of order unity. Steady-state solution of the renormalized spectrum equations yields an electrostatic potential spectrum (circumflex phi 2 )/sub ktheta/ approx. k/sub theta//sup -3.25/. Agreement of the analytically calculated potential spectrum and mean-square radial velocity with the results of multiple helicity numerical calculations is excellent. This comparison constitutes a quantitative test of the analytical turbulence theory used. The spectrum of magnetic fluctuations is also calculated, and agrees well with that obtained from the numerical computations. 13 refs., 8 figs

Intermittency in MHD turbulence and coronal nanoflares modelling

Directory of Open Access Journals (Sweden)

P. Veltri

2005-01-01

Full Text Available High resolution numerical simulations, solar wind data analysis, and measurements at the edges of laboratory plasma devices have allowed for a huge progress in our understanding of MHD turbulence. The high resolution of solar wind measurements has allowed to characterize the intermittency observed at small scales. We are now able to set up a consistent and convincing view of the main properties of MHD turbulence, which in turn constitutes an extremely efficient tool in understanding the behaviour of turbulent plasmas, like those in solar corona, where in situ observations are not available. Using this knowledge a model to describe injection, due to foot-point motions, storage and dissipation of MHD turbulence in coronal loops, is built where we assume strong longitudinal magnetic field, low beta and high aspect ratio, which allows us to use the set of reduced MHD equations (RMHD. The model is based on a shell technique in the wave vector space orthogonal to the strong magnetic field, while the dependence on the longitudinal coordinate is preserved. Numerical simulations show that injected energy is efficiently stored in the loop where a significant level of magnetic and velocity fluctuations is obtained. Nonlinear interactions give rise to an energy cascade towards smaller scales where energy is dissipated in an intermittent fashion. Due to the strong longitudinal magnetic field, dissipative structures propagate along the loop, with the typical speed of the Alfvén waves. The statistical analysis on the intermittent dissipative events compares well with all observed properties of nanoflare emission statistics. Moreover the recent observations of non thermal velocity measurements during flare occurrence are well described by the numerical results of the simulation model. All these results naturally emerge from the model dynamical evolution without any need of an ad-hoc hypothesis.

Turbulent current heating of dense plasma

International Nuclear Information System (INIS)

Suprunenko, V.A.; Sukhomlin, E.A.; Volkov, E.D.; Perepelkij, N.F.

1976-01-01

Based upon experimental results an attempt is made for systematizing and analysing conditions of experiments in anomalous resistance and turbulent heating of a plasma. The extensive program of such investigations aims at a direct practical study on quasistationary heating and plasma containment in magnetic traps. It has been shown that in real conditions turbulent heating turns out to be a far more complicated phenomenon than that described within the framework of theories developed so far. It has been established that the phenomenon alters in the transition through the critical values of electric and magnetic fields. This makes it possible to separate four characteristic experimental regimes. For all the regimes the stabilization of the electron current drift rate is typical. On the basis of the experimental results obtained an explanation is given of the sporadic character of the ultrathermal radiation in a quasistationary discharge

Characterization of local turbulence in magnetic confinement devices

International Nuclear Information System (INIS)

Rajkovic, Milan; Skoric, Milos; Solna, Knut; Antar, Ghassan

2007-07-01

A multifractal analysis based on evaluation and interpretation of Large Deviation spectra is applied to plasma edge turbulence data from different devices (MAST and Tore Supra). It is demonstrated that in spite of some universal features there are unique characteristics for each device as well as for different confinement regimes. In the second part of the exposition the issue of estimating the variable power law behavior of spectral densities is addressed. The analysis of this issue is performed using fractional Brownian motion (fBm) as the underlying stochastic model whose parameters are estimated locally in time by wavelet scale spectra. In such a manner information about the inertial range as well as variability of the fBm parameters is obtained giving more information important for understanding edge turbulence and intermittency. (author)

Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

Science.gov (United States)

Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

2016-01-01

We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.

Science.gov (United States)

Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S

2016-01-15

Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

On the helicity of open magnetic fields

International Nuclear Information System (INIS)

Prior, C.; Yeates, A. R.

2014-01-01

We reconsider the topological interpretation of magnetic helicity for magnetic fields in open domains, and relate this to the relative helicity. Specifically, our domains stretch between two parallel planes, and each of these ends may be magnetically open. It is demonstrated that, while the magnetic helicity is gauge-dependent, its value in any gauge may be physically interpreted as the average winding number among all pairs of field lines with respect to some orthonormal frame field. In fact, the choice of gauge is equivalent to the choice of reference field in the relative helicity, meaning that the magnetic helicity is no less physically meaningful. We prove that a particular gauge always measures the winding with respect to a fixed frame, and propose that this is normally the best choice. For periodic fields, this choice is equivalent to measuring relative helicity with respect to a potential reference field. However, for aperiodic fields, we show that the potential field can be twisted. We prove by construction that there always exists a possible untwisted reference field.

ENERGY DISSIPATION PROCESSES IN SOLAR WIND TURBULENCE

Energy Technology Data Exchange (ETDEWEB)

Wang, Y.; Wei, F. S.; Feng, X. S.; Sun, T. R.; Zuo, P. B. [SIGMA Weather Group, State Key Laboratory for Space Weather, National Space Science Center, Chinese Academy of Sciences, Beijing 100190 (China); Xu, X. J. [Space Science Institute, Macau University of Science and Technology, Macao (China); Zhang, J., E-mail: yw@spaceweather.ac.cn [School of Physics, Astronomy and Computational Sciences, George Mason University, 4400 University Drive, MSN 3F3, Fairfax, Virginia 22030 (United States)

2015-12-15

Turbulence is a chaotic flow regime filled by irregular flows. The dissipation of turbulence is a fundamental problem in the realm of physics. Theoretically, dissipation ultimately cannot be achieved without collisions, and so how turbulent kinetic energy is dissipated in the nearly collisionless solar wind is a challenging problem. Wave particle interactions and magnetic reconnection (MR) are two possible dissipation mechanisms, but which mechanism dominates is still a controversial topic. Here we analyze the dissipation region scaling around a solar wind MR region. We find that the MR region shows unique multifractal scaling in the dissipation range, while the ambient solar wind turbulence reveals a monofractal dissipation process for most of the time. These results provide the first observational evidences for intermittent multifractal dissipation region scaling around a MR site, and they also have significant implications for the fundamental energy dissipation process.

Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

Science.gov (United States)

Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

2018-03-01

We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number

Science.gov (United States)

Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.

2017-09-01

Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

Energy Technology Data Exchange (ETDEWEB)

Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

2012-02-01

The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

Gyrokinetic Simulations of Solar Wind Turbulence from Ion to Electron Scales

International Nuclear Information System (INIS)

Howes, G. G.; TenBarge, J. M.; Dorland, W.; Numata, R.; Quataert, E.; Schekochihin, A. A.; Tatsuno, T.

2011-01-01

A three-dimensional, nonlinear gyrokinetic simulation of plasma turbulence resolving scales from the ion to electron gyroradius with a realistic mass ratio is presented, where all damping is provided by resolved physical mechanisms. The resulting energy spectra are quantitatively consistent with a magnetic power spectrum scaling of k -2.8 as observed in in situ spacecraft measurements of the 'dissipation range' of solar wind turbulence. Despite the strongly nonlinear nature of the turbulence, the linear kinetic Alfven wave mode quantitatively describes the polarization of the turbulent fluctuations. The collisional ion heating is measured at subion-Larmor radius scales, which provides evidence of the ion entropy cascade in an electromagnetic turbulence simulation.

Modification of Edge Plasma Turbulence by External Magnetic Pertubations

International Nuclear Information System (INIS)

Boedo, J.; McKee, G.; Rudakov, D.; Reiser, D.; Evans, T.; Moyer, R.; Schaffer, M.; Watkins, J.; Allen, S.; Fenstermacher, M.; Groth, M.; Holland, C.; Hollmann, E.; Lasnier, C.; Leonard, A.; Mahdavi, M.; McLean, A.; Tynan, G.; Wang, G.; West, W.; Zeng, L.

2006-01-01

Magnetostatic perturbations applied to the DIII-D plasma using a n=3 coil set have significant impact on the plasma edge, such as edge localized mode (ELM) suppression [1], but also affect the background turbulence levels. Discharges with parameters R=1.75 m, a=0.56 m, B T ∼ 1.6 T, I p ∼ 1 MA and n e ∼ 3 x 10 13 cm -3 -n e ∼ 7 x 10 13 cm -3 (low, v* e ∼ 0.1 and moderate, v* e ∼ 1 electron pedestal collisionality) were used as a target for the perturbation, [applied at 3 s Fig. 1(a) and 2 s Fig. 1(b)]. The global density and energy content, among many other parameters, are unaffected, raising the issue of what mechanism replaces the particle and heat exhaust otherwise mediated by ELMs. Mixed ELMs (high frequency, low amplitude Type II ELMs interspersed with Type I) in the moderate collisionality regime and Type I ELMs in the low collisionality regime, are replaced by intermittency and broadband turbulence or semiperiodic events. It is important to notice that the coils can be energized in high poloidal mode spectra (upper and lower coils produce fields in the same direction) or odd configuration (upper and lower coils produce fields in the opposite direction) and also rotated 60 deg toroidally. Although we will focus on scanning probe [2] data obtained in the scrape-off layer (SOL), other diagnostics, beam emission spectroscopy (BES), reflectometry [3], were used to study the changes in the plasma turbulence when the ELMs are suppressed and the underlying turbulence and transport change. Thomson scattering n e and T e profiles (Fig. 2) accumulated over 200 ms before (red) and during (blue) I-coil perturbation are fitted with y = a + b* tanh[(r-c)/d] resulting in a,b staying constant while d varies from -0.009 to -0.011 and c from -0.013 to -0.009, i.e. the profiles mostly broaden and shift outward, changes which may be connected to an increase in radial turbulent transport assuming no deformation of the separatrix. This broadening is seen in both low and

Nonlinear wave collapse and strong turbulence

International Nuclear Information System (INIS)

Robinson, P.A.

1997-01-01

The theory and applications of wave self-focusing, collapse, and strongly nonlinear wave turbulence are reviewed. In the last decade, the theory of these phenomena and experimental realizations have progressed rapidly. Various nonlinear wave systems are discussed, but the simplest case of collapse and strong turbulence of Langmuir waves in an unmagnetized plasma is primarily used in explaining the theory and illustrating the main ideas. First, an overview of the basic physics of linear waves and nonlinear wave-wave interactions is given from an introductory perspective. Wave-wave processes are then considered in more detail. Next, an introductory overview of the physics of wave collapse and strong turbulence is provided, followed by a more detailed theoretical treatment. Later sections cover numerical simulations of Langmuir collapse and strong turbulence and experimental applications to space, ionospheric, and laboratory plasmas, including laser-plasma and beam-plasma interactions. Generalizations to self-focusing, collapse, and strong turbulence of waves in other systems are also discussed, including nonlinear optics, solid-state systems, magnetized auroral and astrophysical plasmas, and deep-water waves. The review ends with a summary of the main ideas of wave collapse and strong-turbulence theory, a collection of open questions in the field, and a brief discussion of possible future research directions. copyright 1997 The American Physical Society

Turbulent transport in the MST reversed-field pinch

International Nuclear Information System (INIS)

Rempel, T.D.; Almagri, A.F.; Assadi, S.; Den Hartog, D.J.; Hokin, S.A.; Prager, S.C.; Sarff, J.S.; Shen, W.; Sidikman, K.L.; Spragins, C.W.; Sprott, J.C.; Stoneking, M.R.; Zita, E.J.

1991-11-01

Measurements of edge turbulence and the associated transport are ongoing in the Madison Symmetric Torus (R = 1.5 m, a = 0.52 m) reversed-field pinch using magnetic and electrostatic probes. Magnetic fluctuations are dominated by m = 1 and n ∼ 2R/a tearing modes. Particle losses induced by magnetic field fluctuations have been found to be ambipolar ( parallel B r > = O). Electrostatic fluctuations are broadband and turbulent, with mode widths δm ∼ 3--7 and δn ∼70--150. Particle, parallel current, and energy transport arising from coherent motion with the fluctuating ExB drift has been measured. Particle transport via this channel is comparable to the total particle loss from MST. Energy transport (from phi >/B o ) due to electrostatic fluctuations is relatively small, and parallel current transport (from parallel E chi >/B o ) may be small as well

Turbulent transport modeling in the edge plasma of tokamaks: verification, validation, simulation and synthetic diagnostics

International Nuclear Information System (INIS)

Colin-Bellot, Clothilde

2015-01-01

The possibility to produce power by using magnetically confined fusion is a scientific and technological challenge. The perspective of ITER conveys strong signals to intensify modeling effort on magnetized fusion plasmas. The success of the fusion operation is conditioned by the quality of plasma confinement in the core of the reactor and by the control of plasma exhaust on the wall. Both phenomena are related to turbulent cross-field transport that is at the heart of the notion of magnetic confinement studies, particle and heat losses. The study of edge phenomena is therefore complicated by a particularly complex magnetic geometry.This calls for an improvement of our capacity to develop numerical tools able to reproduce turbulent transport properties reliable to predict particle and energy fluxes on the plasma facing components. This thesis introduces the TOKAM3X fluid model to simulate edge plasma turbulence. A special focus is made on the code Verification and the Validation. It is a necessary step before using a code as a predictive tool. Then new insights on physical properties of the edge plasma turbulence are explored. In particular, the poloidal asymmetries induced by turbulence and observed experimentally in the Low-Field-Side of the devices are investigated in details. Great care is dedicated to the reproduction of the MISTRAL base case which consists in changing the magnetic configuration and observing the impact on parallel flows in the poloidal plane. The simulations recover experimental measurements and provide new insights on the effect of the plasma-wall contact position location on the turbulent features, which were not accessible in experiments. (author) [fr

Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications

Science.gov (United States)

Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit

2018-05-01

We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.

Small-scale kinematic dynamo and non-dynamo in inertial-range turbulence

International Nuclear Information System (INIS)

Eyink, Gregory L; Neto, Antonio F

2010-01-01

We investigate the Lagrangian mechanism of the kinematic 'fluctuation' magnetic dynamo in a turbulent plasma flow at small magnetic Prandtl numbers. The combined effect of turbulent advection and plasma resistivity is to carry infinitely many field lines to each space point, with the resultant magnetic field at that point given by the average over all the individual line vectors. As a consequence of the roughness of the advecting velocity, this remains true even in the limit of zero resistivity. We show that the presence of the dynamo effect requires sufficient angular correlation of the passive line vectors that arrive simultaneously at the same space point. We illustrate this in detail for the Kazantsev-Kraichnan model of the kinematic dynamo with a Gaussian advecting velocity that is spatially rough and white noise in time. In the regime where dynamo action fails, we also obtain the precise rate of decay of the magnetic energy. These exact results for the model are obtained by a generalization of the 'slow-mode expansion' of Bernard, Gawedzki and Kupiainen to non-Hermitian evolution. Much of our analysis applies also to magnetohydrodynamic turbulence.

Statistical moments of the angular spectrum of normal waves in a turbulent collisional magnetized plasma

International Nuclear Information System (INIS)

Aistov, A.V.; Gavrilenko, V.G.

1996-01-01

The normal incidence of a small-amplitude electromagnetic wave upon a semi-infinite turbulent collisional plasm with an oblique external magnetic field is considered. Within a small-angle-scattering approximation of the radiative transport theory, a system of differential equations is derived for statistical moments of the angular power spectrum of radiation. The dependences of the spectrum centroid, dispersion, and asymmetry on the depth of penetration are studied numerically. The nonmonotonic behavior of the dispersion is revealed, and an increase in the spectrum width with absorption anisotropy is found within some depth interval. It is shown that, at large depths, the direction of the displacement of the spectrum centroid, does not always coincide with the direction of minimum absorption

VELOCITY FIELD OF COMPRESSIBLE MAGNETOHYDRODYNAMIC TURBULENCE: WAVELET DECOMPOSITION AND MODE SCALINGS

International Nuclear Information System (INIS)

Kowal, Grzegorz; Lazarian, A.

2010-01-01

We study compressible magnetohydrodynamic turbulence, which holds the key to many astrophysical processes, including star formation and cosmic-ray propagation. To account for the variations of the magnetic field in the strongly turbulent fluid, we use wavelet decomposition of the turbulent velocity field into Alfven, slow, and fast modes, which presents an extension of the Cho and Lazarian decomposition approach based on Fourier transforms. The wavelets allow us to follow the variations of the local direction of the magnetic field and therefore improve the quality of the decomposition compared to the Fourier transforms, which are done in the mean field reference frame. For each resulting component, we calculate the spectra and two-point statistics such as longitudinal and transverse structure functions as well as higher order intermittency statistics. In addition, we perform a Helmholtz- Hodge decomposition of the velocity field into incompressible and compressible parts and analyze these components. We find that the turbulence intermittency is different for different components, and we show that the intermittency statistics depend on whether the phenomenon was studied in the global reference frame related to the mean magnetic field or in the frame defined by the local magnetic field. The dependencies of the measures we obtained are different for different components of the velocity; for instance, we show that while the Alfven mode intermittency changes marginally with the Mach number, the intermittency of the fast mode is substantially affected by the change.

Structure of the electromagnetic field in three-dimensional Hall magnetohydrodynamic turbulence

International Nuclear Information System (INIS)

Dmitruk, Pablo; Matthaeus, W.H.

2006-01-01

Numerical simulations of freely evolving three-dimensional compressible magnetohydrodynamics (MHD) are performed, with and without the Hall term in Ohm's law. The parameter controlling the presence of the Hall term is the ratio of the ion skin depth to the macroscopic scale of the turbulence. The ion skin depth is set to be slightly larger than the dissipation length scale (controlled by the resistivity) for the Hall MHD simulations, while it is set to zero for non-Hall MHD simulations. Small initial cross helicity, hybrid helicity, and magnetic helicity are considered. The system is left to evolve for a few turbulent characteristic times and the magnetic field and electric field are analyzed in real and wavenumber space. Distributions (histograms) of the fields are also computed. It is found that the turbulent magnetic field (as well as the velocity field) is almost unaffected by the presence of the Hall term, while the electric field is affected at scales smaller than the ion skin depth, that is, close to the dissipation range in these simulations. The importance of each term in Ohm's law for the electric field is analyzed in wavenumber space. Furthermore, reconnection-like zones are identified, where the importance of each term in Ohm's law can be seen in real space. Reconnection-like zones with magnetic field B=0 (or small) and B≠0 are found within the turbulent state of the system

Transitional-turbulent spots and turbulent-turbulent spots in boundary layers.

Science.gov (United States)

Wu, Xiaohua; Moin, Parviz; Wallace, James M; Skarda, Jinhie; Lozano-Durán, Adrián; Hickey, Jean-Pierre

2017-07-03

Two observations drawn from a thoroughly validated direct numerical simulation of the canonical spatially developing, zero-pressure gradient, smooth, flat-plate boundary layer are presented here. The first is that, for bypass transition in the narrow sense defined herein, we found that the transitional-turbulent spot inception mechanism is analogous to the secondary instability of boundary-layer natural transition, namely a spanwise vortex filament becomes a [Formula: see text] vortex and then, a hairpin packet. Long streak meandering does occur but usually when a streak is infected by a nearby existing transitional-turbulent spot. Streak waviness and breakdown are, therefore, not the mechanisms for the inception of transitional-turbulent spots found here. Rather, they only facilitate the growth and spreading of existing transitional-turbulent spots. The second observation is the discovery, in the inner layer of the developed turbulent boundary layer, of what we call turbulent-turbulent spots. These turbulent-turbulent spots are dense concentrations of small-scale vortices with high swirling strength originating from hairpin packets. Although structurally quite similar to the transitional-turbulent spots, these turbulent-turbulent spots are generated locally in the fully turbulent environment, and they are persistent with a systematic variation of detection threshold level. They exert indentation, segmentation, and termination on the viscous sublayer streaks, and they coincide with local concentrations of high levels of Reynolds shear stress, enstrophy, and temperature fluctuations. The sublayer streaks seem to be passive and are often simply the rims of the indentation pockets arising from the turbulent-turbulent spots.

Energy transfer in compressible magnetohydrodynamic turbulence for isothermal self-gravitating fluids

Science.gov (United States)

Banerjee, Supratik; Kritsuk, Alexei G.

2018-02-01

Three-dimensional, compressible, magnetohydrodynamic turbulence of an isothermal, self-gravitating fluid is analyzed using two-point statistics in the asymptotic limit of large Reynolds numbers (both kinetic and magnetic). Following an alternative formulation proposed by Banerjee and Galtier [Phys. Rev. E 93, 033120 (2016), 10.1103/PhysRevE.93.033120; J. Phys. A: Math. Theor. 50, 015501 (2017), 10.1088/1751-8113/50/1/015501], an exact relation has been derived for the total energy transfer. This approach results in a simpler relation expressed entirely in terms of mixed second-order structure functions. The kinetic, thermodynamic, magnetic, and gravitational contributions to the energy transfer rate can be easily separated in the present form. By construction, the new formalism includes such additional effects as global rotation, the Hall term in the induction equation, etc. The analysis shows that solid-body rotation cannot alter the energy flux rate of compressible turbulence. However, the contribution of a uniform background magnetic field to the flux is shown to be nontrivial unlike in the incompressible case. Finally, the compressible, turbulent energy flux rate does not vanish completely due to simple alignments, which leads to a zero turbulent energy flux rate in the incompressible case.

Boundary Plasma Turbulence Simulations for Tokamaks

International Nuclear Information System (INIS)

Xu, X.; Umansky, M.; Dudson, B.; Snyder, P.

2008-05-01

The boundary plasma turbulence code BOUT models tokamak boundary-plasma turbulence in a realistic divertor geometry using modified Braginskii equations for plasma vorticity, density (ni), electron and ion temperature (T e ; T i ) and parallel momenta. The BOUT code solves for the plasma fluid equations in a three dimensional (3D) toroidal segment (or a toroidal wedge), including the region somewhat inside the separatrix and extending into the scrape-off layer; the private flux region is also included. In this paper, a description is given of the sophisticated physical models, innovative numerical algorithms, and modern software design used to simulate edge-plasmas in magnetic fusion energy devices. The BOUT code's unique capabilities and functionality are exemplified via simulations of the impact of plasma density on tokamak edge turbulence and blob dynamics

Plasma turbulence resulting from the interaction between the solar wind and the earth's magnetic field

International Nuclear Information System (INIS)

Roux, A.

1989-01-01

The interaction between the supersonic and super-Alfvenic solar wind plasma and the Earth's magnetic field leads to the formation of critical layers, such as the bow shock, the magnetopause, the polar cusp, and the inner and outer edge of the plasmasheet. The mean free path between binary colisions being much larger than the transverse scale of these layers, plasma turbulence must ensure the thermalization, the magnetic diffusion, the dissipation within these critical layers. We suggest the existence of small scale, presumably 2D structures, developing within these thin layers. The unambiguous characterization of these small-scale structures is, however, beyond the capabilities of existing spacecraft, which cannot spatially resolve them, nor disentangle spatial/temporal variations. We present a new mission concept: a cluster of four relatively simple spacecraft, which will make it possible (i) to disentangle spatial from temporal variations, (ii) to evaluate, by finite differences between spacecraft measurements, the gradients, divergences, curls of MHD parameters, and )iii) to characterize small-scale structures, via inter-spacecraft correlations. (author). 10 refs.; 10 figs

Applying Magneto-rheology to Reduce Blood Viscosity and Suppress Turbulence to Prevent Heart Attacks

Science.gov (United States)

Tao, R.

Heart attacks are the leading causes of death in USA. Research indicates one common thread, high blood viscosity, linking all cardiovascular diseases. Turbulence in blood circulation makes different regions of the vasculature vulnerable to development of atherosclerotic plaque. Turbulence is also responsible for systolic ejection murmurs and places heavier workload on heart, a possible trigger of heart attacks. Presently, neither medicine nor method is available to suppress turbulence. The only method to reduce the blood viscosity is to take medicine, such as aspirin. However, using medicine to reduce the blood viscosity does not help suppressing turbulence. In fact, the turbulence gets worse as the Reynolds number goes up with the viscosity reduction by the medicine. Here we report our new discovery: application of a strong magnetic field to blood along its flow direction, red blood cells are polarized in the magnetic field and aggregated into short chains along the flow direction. The blood viscosity becomes anisotropic: Along the flow direction the viscosity is significantly reduced, but in the directions perpendicular to the flow the viscosity is considerably increased. In this way, the blood flow becomes laminar, turbulence is suppressed, the blood circulation is greatly improved, and the risk for heart attacks is reduced. While these effects are not permanent, they last for about 24 hours after one magnetic therapy treatment.

On the algebraic characterization of aperiodic tilings related to ADE-root systems

International Nuclear Information System (INIS)

Kellendonk, J.

1992-09-01

The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

The DNA electronic specific heat at low temperature: The role of aperiodicity

Energy Technology Data Exchange (ETDEWEB)

Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

2012-07-16

The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

Complexity methods applied to turbulence in plasma astrophysics

Science.gov (United States)

Vlahos, L.; Isliker, H.

2016-09-01

In this review many of the well known tools for the analysis of Complex systems are used in order to study the global coupling of the turbulent convection zone with the solar atmosphere where the magnetic energy is dissipated explosively. Several well documented observations are not easy to interpret with the use of Magnetohydrodynamic (MHD) and/or Kinetic numerical codes. Such observations are: (1) The size distribution of the Active Regions (AR) on the solar surface, (2) The fractal and multi fractal characteristics of the observed magnetograms, (3) The Self-Organised characteristics of the explosive magnetic energy release and (4) the very efficient acceleration of particles during the flaring periods in the solar corona. We review briefly the work published the last twenty five years on the above issues and propose solutions by using methods borrowed from the analysis of complex systems. The scenario which emerged is as follows: (a) The fully developed turbulence in the convection zone generates and transports magnetic flux tubes to the solar surface. Using probabilistic percolation models we were able to reproduce the size distribution and the fractal properties of the emerged and randomly moving magnetic flux tubes. (b) Using a Non Linear Force Free (NLFF) magnetic extrapolation numerical code we can explore how the emerged magnetic flux tubes interact nonlinearly and form thin and Unstable Current Sheets (UCS) inside the coronal part of the AR. (c) The fragmentation of the UCS and the redistribution of the magnetic field locally, when the local current exceeds a Critical threshold, is a key process which drives avalanches and forms coherent structures. This local reorganization of the magnetic field enhances the energy dissipation and influences the global evolution of the complex magnetic topology. Using a Cellular Automaton and following the simple rules of Self Organized Criticality (SOC), we were able to reproduce the statistical characteristics of the

CICART Center For Integrated Computation And Analysis Of Reconnection And Turbulence

International Nuclear Information System (INIS)

Bhattacharjee, Amitava

2016-01-01

CICART is a partnership between the University of New Hampshire (UNH) and Dartmouth College. CICART addresses two important science needs of the DoE: the basic understanding of magnetic reconnection and turbulence that strongly impacts the performance of fusion plasmas, and the development of new mathematical and computational tools that enable the modeling and control of these phenomena. The principal participants of CICART constitute an interdisciplinary group, drawn from the communities of applied mathematics, astrophysics, computational physics, fluid dynamics, and fusion physics. It is a main premise of CICART that fundamental aspects of magnetic reconnection and turbulence in fusion devices, smaller-scale laboratory experiments, and space and astrophysical plasmas can be viewed from a common perspective, and that progress in understanding in any of these interconnected fields is likely to lead to progress in others. The establishment of CICART has strongly impacted the education and research mission of a new Program in Integrated Applied Mathematics in the College of Engineering and Applied Sciences at UNH by enabling the recruitment of a tenure-track faculty member, supported equally by UNH and CICART, and the establishment of an IBM-UNH Computing Alliance. The proposed areas of research in magnetic reconnection and turbulence in astrophysical, space, and laboratory plasmas include the following topics: (A) Reconnection and secondary instabilities in large high-Lundquist-number plasmas, (B) Particle acceleration in the presence of multiple magnetic islands, (C) Gyrokinetic reconnection: comparison with fluid and particle-in-cell models, (D) Imbalanced turbulence, (E) Ion heating, and (F) Turbulence in laboratory (including fusion-relevant) experiments. These theoretical studies make active use of three high-performance computer simulation codes: (1) The Magnetic Reconnection Code, based on extended two-fluid (or Hall MHD) equations, in an Adaptive Mesh

Impact of large scale flows on turbulent transport

Energy Technology Data Exchange (ETDEWEB)

Sarazin, Y [Association Euratom-CEA, CEA/DSM/DRFC centre de Cadarache, 13108 St-Paul-Lez-Durance (France); Grandgirard, V [Association Euratom-CEA, CEA/DSM/DRFC centre de Cadarache, 13108 St-Paul-Lez-Durance (France); Dif-Pradalier, G [Association Euratom-CEA, CEA/DSM/DRFC centre de Cadarache, 13108 St-Paul-Lez-Durance (France); Fleurence, E [Association Euratom-CEA, CEA/DSM/DRFC centre de Cadarache, 13108 St-Paul-Lez-Durance (France); Garbet, X [Association Euratom-CEA, CEA/DSM/DRFC centre de Cadarache, 13108 St-Paul-Lez-Durance (France); Ghendrih, Ph [Association Euratom-CEA, CEA/DSM/DRFC centre de Cadarache, 13108 St-Paul-Lez-Durance (France); Bertrand, P [LPMIA-Universite Henri Poincare Nancy I, Boulevard des Aiguillettes BP239, 54506 Vandoe uvre-les-Nancy (France); Besse, N [LPMIA-Universite Henri Poincare Nancy I, Boulevard des Aiguillettes BP239, 54506 Vandoe uvre-les-Nancy (France); Crouseilles, N [IRMA, UMR 7501 CNRS/Universite Louis Pasteur, 7 rue Rene Descartes, 67084 Strasbourg (France); Sonnendruecker, E [IRMA, UMR 7501 CNRS/Universite Louis Pasteur, 7 rue Rene Descartes, 67084 Strasbourg (France); Latu, G [LSIIT, UMR 7005 CNRS/Universite Louis Pasteur, Bd Sebastien Brant BP10413, 67412 Illkirch (France); Violard, E [LSIIT, UMR 7005 CNRS/Universite Louis Pasteur, Bd Sebastien Brant BP10413, 67412 Illkirch (France)

2006-12-15

The impact of large scale flows on turbulent transport in magnetized plasmas is explored by means of various kinetic models. Zonal flows are found to lead to a non-linear upshift of turbulent transport in a 3D kinetic model for interchange turbulence. Such a transition is absent from fluid simulations, performed with the same numerical tool, which also predict a much larger transport. The discrepancy cannot be explained by zonal flows only, despite they being overdamped in fluids. Indeed, some difference remains, although reduced, when they are artificially suppressed. Zonal flows are also reported to trigger transport barriers in a 4D drift-kinetic model for slab ion temperature gradient (ITG) turbulence. The density gradient acts as a source drive for zonal flows, while their curvature back stabilizes the turbulence. Finally, 5D simulations of toroidal ITG modes with the global and full-f GYSELA code require the equilibrium density function to depend on the motion invariants only. If not, the generated strong mean flows can completely quench turbulent transport.

Impact of large scale flows on turbulent transport

International Nuclear Information System (INIS)

Sarazin, Y; Grandgirard, V; Dif-Pradalier, G; Fleurence, E; Garbet, X; Ghendrih, Ph; Bertrand, P; Besse, N; Crouseilles, N; Sonnendruecker, E; Latu, G; Violard, E

2006-01-01

The impact of large scale flows on turbulent transport in magnetized plasmas is explored by means of various kinetic models. Zonal flows are found to lead to a non-linear upshift of turbulent transport in a 3D kinetic model for interchange turbulence. Such a transition is absent from fluid simulations, performed with the same numerical tool, which also predict a much larger transport. The discrepancy cannot be explained by zonal flows only, despite they being overdamped in fluids. Indeed, some difference remains, although reduced, when they are artificially suppressed. Zonal flows are also reported to trigger transport barriers in a 4D drift-kinetic model for slab ion temperature gradient (ITG) turbulence. The density gradient acts as a source drive for zonal flows, while their curvature back stabilizes the turbulence. Finally, 5D simulations of toroidal ITG modes with the global and full-f GYSELA code require the equilibrium density function to depend on the motion invariants only. If not, the generated strong mean flows can completely quench turbulent transport

Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

Science.gov (United States)

Koju, Vijay

Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

Convection Enhances Magnetic Turbulence in AM CVn Accretion Disks

Science.gov (United States)

Coleman, Matthew S. B.; Blaes, Omer; Hirose, Shigenobu; Hauschildt, Peter H.

2018-04-01

We present the results of local, vertically stratified, radiation magnetohydrodynamic shearing-box simulations of magnetorotational instability (MRI) turbulence for a (hydrogen poor) composition applicable to accretion disks in AM CVn type systems. Many of these accreting white dwarf systems are helium analogs of dwarf novae (DNe). We utilize frequency-integrated opacity and equation-of-state tables appropriate for this regime to accurately portray the relevant thermodynamics. We find bistability of thermal equilibria in the effective-temperature, surface-mass-density plane typically associated with disk instabilities. Along this equilibrium curve (i.e., the S-curve), we find that the stress to thermal pressure ratio α varied with peak values of ∼0.15 near the tip of the upper branch. Similar to DNe, we found enhancement of α near the tip of the upper branch caused by convection; this increase in α occurred despite our choice of zero net vertical magnetic flux. Two notable differences we find between DN and AM CVn accretion disk simulations are that AM CVn disks are capable of exhibiting persistent convection in outburst, and ideal MHD is valid throughout quiescence for AM CVns. In contrast, DNe simulations only show intermittent convection, and nonideal MHD effects are likely important in quiescence. By combining our previous work with these new results, we also find that convective enhancement of the MRI is anticorrelated with mean molecular weight.

THE ROLE OF TURBULENCE AND MAGNETIC FIELDS IN SIMULATED FILAMENTARY STRUCTURE

Energy Technology Data Exchange (ETDEWEB)

Kirk, Helen; Pudritz, Ralph [Origins Institute, McMaster University, Hamilton, ON, L8S 4M1 (Canada); Klassen, Mikhail; Pillsworth, Samantha, E-mail: helen.kirk@nrc-cnrc.gc.ca [Department of Physics and Astronomy, McMaster University,Hamilton, ON, L8S 4M1 (Canada)

2015-04-01

We use numerical simulations of turbulent cluster-forming regions to study the nature of dense filamentary structures in star formation. Using four hydrodynamic and magnetohydrodynamic simulations chosen to match observations, we identify filaments in the resulting column density maps and analyze their properties. We calculate the radial column density profiles of the filaments every 0.05 Myr and fit the profiles with the modified isothermal and pressure-confined isothermal cylinder models, finding reasonable fits for either model. The filaments formed in the simulations have similar radial column density profiles to those observed. Magnetic fields provide additional pressure support to the filaments, making “puffier” filaments less prone to fragmentation than in the pure hydrodynamic case, which continue to condense at a slower rate. In the higher density simulations, the filaments grow faster through the increased importance of gravity. Not all of the filaments identified in the simulations will evolve to form stars: some expand and disperse. Given these different filament evolutionary paths, the trends in bulk filament width as a function of time, magnetic field strength, or density are weak, and all cases are reasonably consistent with the finding of a constant filament width in different star-forming regions. In the simulations, the mean FWHM lies between 0.06 and 0.26 pc for all times and initial conditions, with most lying between 0.1 to 0.15 pc; the range in FWHMs is however, larger than seen in typical Herschel analyses. Finally, the filaments display a wealth of substructure similar to the recent discovery of filament bundles in Taurus.

EXTENDED SCALING LAWS IN NUMERICAL SIMULATIONS OF MAGNETOHYDRODYNAMIC TURBULENCE

International Nuclear Information System (INIS)

Mason, Joanne; Cattaneo, Fausto; Perez, Jean Carlos; Boldyrev, Stanislav

2011-01-01

Magnetized turbulence is ubiquitous in astrophysical systems, where it notoriously spans a broad range of spatial scales. Phenomenological theories of MHD turbulence describe the self-similar dynamics of turbulent fluctuations in the inertial range of scales. Numerical simulations serve to guide and test these theories. However, the computational power that is currently available restricts the simulations to Reynolds numbers that are significantly smaller than those in astrophysical settings. In order to increase computational efficiency and, therefore, probe a larger range of scales, one often takes into account the fundamental anisotropy of field-guided MHD turbulence, with gradients being much slower in the field-parallel direction. The simulations are then optimized by employing the reduced MHD equations and relaxing the field-parallel numerical resolution. In this work we explore a different possibility. We propose that there exist certain quantities that are remarkably stable with respect to the Reynolds number. As an illustration, we study the alignment angle between the magnetic and velocity fluctuations in MHD turbulence, measured as the ratio of two specially constructed structure functions. We find that the scaling of this ratio can be extended surprisingly well into the regime of relatively low Reynolds number. However, the extended scaling easily becomes spoiled when the dissipation range in the simulations is underresolved. Thus, taking the numerical optimization methods too far can lead to spurious numerical effects and erroneous representation of the physics of MHD turbulence, which in turn can affect our ability to identify correctly the physical mechanisms that are operating in astrophysical systems.

Relationship between turbulence energy and density variance in the solar neighbourhood molecular clouds

Science.gov (United States)

Kainulainen, J.; Federrath, C.

2017-11-01

The relationship between turbulence energy and gas density variance is a fundamental prediction for turbulence-dominated media and is commonly used in analytic models of star formation. We determine this relationship for 15 molecular clouds in the solar neighbourhood. We use the line widths of the CO molecule as the probe of the turbulence energy (sonic Mach number, ℳs) and three-dimensional models to reconstruct the density probability distribution function (ρ-PDF) of the clouds, derived using near-infrared extinction and Herschel dust emission data, as the probe of the density variance (σs). We find no significant correlation between ℳs and σs among the studied clouds, but we cannot rule out a weak correlation either. In the context of turbulence-dominated gas, the range of the ℳs and σs values corresponds to the model predictions. The data cannot constrain whether the turbulence-driving parameter, b, and/or thermal-to-magnetic pressure ratio, β, vary among the sample clouds. Most clouds are not in agreement with field strengths stronger than given by β ≲ 0.05. A model with b2β/ (β + 1) = 0.30 ± 0.06 provides an adequate fit to the cloud sample as a whole. Based on the average behaviour of the sample, we can rule out three regimes: (i) strong compression combined with a weak magnetic field (b ≳ 0.7 and β ≳ 3); (ii) weak compression (b ≲ 0.35); and (iii) a strong magnetic field (β ≲ 0.1). When we include independent magnetic field strength estimates in the analysis, the data rule out solenoidal driving (b < 0.4) for the majority of the solar neighbourhood clouds. However, most clouds have b parameters larger than unity, which indicates a discrepancy with the turbulence-dominated picture; we discuss the possible reasons for this.

Cascade of circulations in fluid turbulence.

Science.gov (United States)

Eyink, Gregory L

2006-12-01

Kelvin's theorem on conservation of circulations is an essential ingredient of Taylor's theory of turbulent energy dissipation by the process of vortex-line stretching. In previous work, we have proposed a nonlinear mechanism for the breakdown of Kelvin's theorem in ideal turbulence at infinite Reynolds number. We develop here a detailed physical theory of this cascade of circulations. Our analysis is based upon an effective equation for large-scale coarse-grained velocity, which contains a turbulent-induced vortex force that can violate Kelvin's theorem. We show that singularities of sufficient strength, which are observed to exist in turbulent flow, can lead to nonvanishing dissipation of circulation for an arbitrarily small coarse-graining length in the effective equations. This result is an analog for circulation of Onsager's theorem on energy dissipation for singular Euler solutions. The physical mechanism of the breakdown of Kelvin's theorem is diffusion of lines of large-scale vorticity out of the advected loop. This phenomenon can be viewed as a classical analog of the Josephson-Anderson phase-slip phenomenon in superfluids due to quantized vortex lines. We show that the circulation cascade is local in scale and use this locality to develop concrete expressions for the turbulent vortex force by a multiscale gradient expansion. We discuss implications for Taylor's theory of turbulent dissipation and we point out some related cascade phenomena, in particular for magnetic flux in magnetohydrodynamic turbulence.

Quantification of intravoxel velocity standard deviation and turbulence intensity by generalizing phase-contrast MRI.

Science.gov (United States)

Dyverfeldt, Petter; Sigfridsson, Andreas; Kvitting, John-Peder Escobar; Ebbers, Tino

2006-10-01

Turbulent flow, characterized by velocity fluctuations, is a contributing factor to the pathogenesis of several cardiovascular diseases. A clinical noninvasive tool for assessing turbulence is lacking, however. It is well known that the occurrence of multiple spin velocities within a voxel during the influence of a magnetic gradient moment causes signal loss in phase-contrast magnetic resonance imaging (PC-MRI). In this paper a mathematical derivation of an expression for computing the standard deviation (SD) of the blood flow velocity distribution within a voxel is presented. The SD is obtained from the magnitude of PC-MRI signals acquired with different first gradient moments. By exploiting the relation between the SD and turbulence intensity (TI), this method allows for quantitative studies of turbulence. For validation, the TI in an in vitro flow phantom was quantified, and the results compared favorably with previously published laser Doppler anemometry (LDA) results. This method has the potential to become an important tool for the noninvasive assessment of turbulence in the arterial tree.

Behaviour of turbulence models near a turbulent/non-turbulent interface revisited

International Nuclear Information System (INIS)

Ferrey, P.; Aupoix, B.

2006-01-01

The behaviour of turbulence models near a turbulent/non-turbulent interface is investigated. The analysis holds as well for two-equation as for Reynolds stress turbulence models using Daly and Harlow diffusion model. The behaviour near the interface is shown not to be a power law, as usually considered, but a more complex parametric solution. Why previous works seemed to numerically confirm the power law solution is explained. Constraints for turbulence modelling, i.e., for ensuring that models have a good behaviour near a turbulent/non-turbulent interface so that the solution is not sensitive to small turbulence levels imposed in the irrotational flow, are drawn

Three-fluid, three-dimensional magnetohydrodynamic solar wind model with eddy viscosity and turbulent resistivity

Energy Technology Data Exchange (ETDEWEB)

Usmanov, Arcadi V.; Matthaeus, William H. [Department of Physics and Astronomy, University of Delaware, Newark, DE 19716 (United States); Goldstein, Melvyn L., E-mail: arcadi.usmanov@nasa.gov [Code 672, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)

2014-06-10

We have developed a three-fluid, three-dimensional magnetohydrodynamic solar wind model that incorporates turbulence transport, eddy viscosity, turbulent resistivity, and turbulent heating. The solar wind plasma is described as a system of co-moving solar wind protons, electrons, and interstellar pickup protons, with separate energy equations for each species. Numerical steady-state solutions of Reynolds-averaged solar wind equations coupled with turbulence transport equations for turbulence energy, cross helicity, and correlation length are obtained by the time relaxation method in the corotating with the Sun frame of reference in the region from 0.3 to 100 AU (but still inside the termination shock). The model equations include the effects of electron heat conduction, Coulomb collisions, photoionization of interstellar hydrogen atoms and their charge exchange with the solar wind protons, turbulence energy generation by pickup protons, and turbulent heating of solar wind protons and electrons. The turbulence transport model is based on the Reynolds decomposition and turbulence phenomenologies that describe the conversion of fluctuation energy into heat due to a turbulent cascade. In addition to using separate energy equations for the solar wind protons and electrons, a significant improvement over our previous work is that the turbulence model now uses an eddy viscosity approximation for the Reynolds stress tensor and the mean turbulent electric field. The approximation allows the turbulence model to account for driving of turbulence by large-scale velocity gradients. Using either a dipole approximation for the solar magnetic field or synoptic solar magnetograms from the Wilcox Solar Observatory for assigning boundary conditions at the coronal base, we apply the model to study the global structure of the solar wind and its three-dimensional properties, including embedded turbulence, heating, and acceleration throughout the heliosphere. The model results are

Energy Dissipation and Dynamics in Large Guide Field Turbulence Driven Reconnection at the Magnetopause

Science.gov (United States)

TenBarge, J. M.; Shay, M. A.; Sharma, P.; Juno, J.; Haggerty, C. C.; Drake, J. F.; Bhattacharjee, A.; Hakim, A.

2017-12-01

Turbulence and magnetic reconnection are the primary mechanisms responsible for the conversion of stored magnetic energy into particle energy in many space and astrophysical plasmas. The magnetospheric multiscale mission (MMS) has given us unprecedented access to high cadence particle and field data of turbulence and magnetic reconnection at earth's magnetopause. The observations include large guide field reconnection events generated within the turbulent magnetopause. Motivated by these observations, we present a study of large guide reconnection using the fully kinetic Eulerian Vlasov-Maxwell component of the Gkeyll simulation framework, and we also employ and compare with gyrokinetics to explore the asymptotically large guide field limit. In addition to studying the configuration space dynamics, we leverage the recently developed field-particle correlations to diagnose the dominant sources of dissipation and compare the results of the field-particle correlation to other energy dissipation measures.

PROPERTIES OF INTERSTELLAR TURBULENCE FROM GRADIENTS OF LINEAR POLARIZATION MAPS

International Nuclear Information System (INIS)

Burkhart, Blakesley; Lazarian, A.; Gaensler, B. M.

2012-01-01

Faraday rotation of linearly polarized radio signals provides a very sensitive probe of fluctuations in the interstellar magnetic field and ionized gas density resulting from magnetohydrodynamic (MHD) turbulence. We used a set of statistical tools to analyze images of the spatial gradient of linearly polarized radio emission (|∇P|) for both observational data from a test image of the Southern Galactic Plane Survey (SGPS) and isothermal three-dimensional simulations of MHD turbulence. Visually, in both observations and simulations, a complex network of filamentary structures is seen. Our analysis shows that the filaments in |∇P| can be produced both by interacting shocks and random fluctuations characterizing the non-differentiable field of MHD turbulence. The latter dominates for subsonic turbulence, while the former is only present in supersonic turbulence. We show that supersonic and subsonic turbulence exhibit different distributions as well as different morphologies in the maps of |∇P|. Particularly, filaments produced by shocks show a characteristic 'double jump' profile at the sites of shock fronts resulting from delta function-like increases in the density and/or magnetic field, while those produced by subsonic turbulence show a single jump profile. In order to quantitatively characterize these differences, we use the topology tool known as the genus curve as well as the probability distribution function moments of the image distribution. We find that higher values for the moments correspond to cases of |∇P| with larger sonic Mach numbers. The genus analysis of the supersonic simulations of |∇P| reveals a 'swiss cheese' topology, while the subsonic cases have characteristics of a 'clump' topology. Based on the analysis of the genus and the higher order moments, the SGPS test region data have a distribution and morphology that match subsonic- to transonic-type turbulence, which confirms what is now expected for the warm ionized medium.

PROPERTIES OF INTERSTELLAR TURBULENCE FROM GRADIENTS OF LINEAR POLARIZATION MAPS

Energy Technology Data Exchange (ETDEWEB)

Burkhart, Blakesley; Lazarian, A. [Astronomy Department, University of Wisconsin, Madison, 475 N. Charter St., WI 53711 (United States); Gaensler, B. M. [Sydney Institute for Astronomy, School of Physics, University of Sydney, NSW 2006 (Australia)

2012-04-20

Faraday rotation of linearly polarized radio signals provides a very sensitive probe of fluctuations in the interstellar magnetic field and ionized gas density resulting from magnetohydrodynamic (MHD) turbulence. We used a set of statistical tools to analyze images of the spatial gradient of linearly polarized radio emission (|{nabla}P|) for both observational data from a test image of the Southern Galactic Plane Survey (SGPS) and isothermal three-dimensional simulations of MHD turbulence. Visually, in both observations and simulations, a complex network of filamentary structures is seen. Our analysis shows that the filaments in |{nabla}P| can be produced both by interacting shocks and random fluctuations characterizing the non-differentiable field of MHD turbulence. The latter dominates for subsonic turbulence, while the former is only present in supersonic turbulence. We show that supersonic and subsonic turbulence exhibit different distributions as well as different morphologies in the maps of |{nabla}P|. Particularly, filaments produced by shocks show a characteristic 'double jump' profile at the sites of shock fronts resulting from delta function-like increases in the density and/or magnetic field, while those produced by subsonic turbulence show a single jump profile. In order to quantitatively characterize these differences, we use the topology tool known as the genus curve as well as the probability distribution function moments of the image distribution. We find that higher values for the moments correspond to cases of |{nabla}P| with larger sonic Mach numbers. The genus analysis of the supersonic simulations of |{nabla}P| reveals a 'swiss cheese' topology, while the subsonic cases have characteristics of a 'clump' topology. Based on the analysis of the genus and the higher order moments, the SGPS test region data have a distribution and morphology that match subsonic- to transonic-type turbulence, which confirms what is now

MHD turbulence in the solar wind: evolution and anisotropy

International Nuclear Information System (INIS)

Horbury, T. S.; Forman, M. A.; Oughton, S.

2005-01-01

Spacecraft measurements in the solar wind offer the opportunity to study magnetohydrodynamic turbulence in a collisionless plasma in great detail. We review some of the key results of the study of this medium: the presence of large amplitude Alfven waves propagating predominantly away from the Sun; the existence of an active turbulent cascade; and intermittency similar to that in neutral fluids. The presence of a magnetic field leads to anisotropy of the fluctuations, which are predominantly perpendicular to this direction, as well as anisotropy of the spectrum. Some models suggest that MHD turbulence can evolve to a state with power predominantly in wave vectors either parallel to the magnetic field (slab fluctuations) or approximately perpendicular to it (2D). We present results of a new, wavelet-based analysis of magnetic field fluctuations in the solar wind, and demonstrate that the 2D component has a spectral index near the Kolmogorov value of 5/3, while slab fluctuations have a spectral index near 2. We also estimate the relative power levels in slab and 2D fluctuations, as well as the level of compressive fluctuations. Deviations of the data from the simple slab/2D model suggest the presence of power in intermediate directions and we compare our data with critical balance models. (Author)

Electron Scale Structures and Magnetic Reconnection Signatures in the Turbulent Magnetosheath

Science.gov (United States)

Yordanova, E.; Voros, Z.; Varsani, A.; Graham, D. B.; Norgren, C.; Khotyaintsev, Yu. V.; Vaivads, A.; Eriksson, E.; Nakamura, R.; Lindqvist, P.-A.;

Laminar and Turbulent Dynamos in Chiral Magnetohydrodynamics. II. Simulations

Science.gov (United States)

Schober, Jennifer; Rogachevskii, Igor; Brandenburg, Axel; Boyarsky, Alexey; Fröhlich, Jürg; Ruchayskiy, Oleg; Kleeorin, Nathan

2018-05-01

Using direct numerical simulations (DNS), we study laminar and turbulent dynamos in chiral magnetohydrodynamics with an extended set of equations that accounts for an additional contribution to the electric current due to the chiral magnetic effect (CME). This quantum phenomenon originates from an asymmetry between left- and right-handed relativistic fermions in the presence of a magnetic field and gives rise to a chiral dynamo. We show that the magnetic field evolution proceeds in three stages: (1) a small-scale chiral dynamo instability, (2) production of chiral magnetically driven turbulence and excitation of a large-scale dynamo instability due to a new chiral effect (α μ effect), and (3) saturation of magnetic helicity and magnetic field growth controlled by a conservation law for the total chirality. The α μ effect becomes dominant at large fluid and magnetic Reynolds numbers and is not related to kinetic helicity. The growth rate of the large-scale magnetic field and its characteristic scale measured in the numerical simulations agree well with theoretical predictions based on mean-field theory. The previously discussed two-stage chiral magnetic scenario did not include stage (2), during which the characteristic scale of magnetic field variations can increase by many orders of magnitude. Based on the findings from numerical simulations, the relevance of the CME and the chiral effects revealed in the relativistic plasma of the early universe and of proto-neutron stars are discussed.

Generation of zonal flows in rotating fluids and magnetized plasmas

DEFF Research Database (Denmark)

Juul Rasmussen, J.; Garcia, O.E.; Naulin, V.

2006-01-01

The spontaneous generation of large-scale flows by the rectification of small-scale turbulent fluctuations is of great importance both in geophysical flows and in magnetically confined plasmas. These flows regulate the turbulence and may set up effective transport barriers. In the present....... The analogy to large-scale flow generation in drift-wave turbulence dynamics in magnetized plasma is briefly discussed....

Interaction between sheared flows and turbulent transport in magnetized fusion-grade plasmas; Interaction entre ecoulements cisailles et transport turbulent dans les plasmas de fusion magnetique

Energy Technology Data Exchange (ETDEWEB)

Leconte, M.

2008-11-15

The H confinement regime is set when the heating power reaches a threshold value P{sub c} and is linked to the formation of a transport barrier in the edge region of the plasma. Such a barrier is characterized by a high pressure gradient and is submitted to ELM (edge localized mode) instabilities. ELM instabilities trigger violent quasi-periodical ejections of matter and heat that induce quasi-periodical relaxations of the transport barrier called relaxation oscillations. In this work we studied the interaction between sheared flows and turbulence in fusion plasmas. In particular, we studied the complex dynamics of a transport barrier and we show through a simulation that resonant magnetic perturbations could control relaxation oscillations without a significant loss of confinement

3D Anisotropy of Solar Wind Turbulence, Tubes, or Ribbons?

Science.gov (United States)

Verdini, Andrea; Grappin, Roland; Alexandrova, Olga; Lion, Sonny

2018-01-01

We study the anisotropy with respect to the local magnetic field of turbulent magnetic fluctuations at magnetofluid scales in the solar wind. Previous measurements in the fast solar wind obtained axisymmetric anisotropy, despite that the analysis method allows nonaxisymmetric structures. These results are probably contaminated by the wind expansion that introduces another symmetry axis, namely, the radial direction, as indicated by recent numerical simulations. These simulations also show that while the expansion is strong, the principal fluctuations are in the plane perpendicular to the radial direction. Using this property, we separate 11 yr of Wind spacecraft data into two subsets characterized by strong and weak expansion and determine the corresponding turbulence anisotropy. Under strong expansion, the small-scale anisotropy is consistent with the Goldreich & Sridhar critical balance. As in previous works, when the radial symmetry axis is not eliminated, the turbulent structures are field-aligned tubes. Under weak expansion, we find 3D anisotropy predicted by the Boldyrev model, that is, turbulent structures are ribbons and not tubes. However, the very basis of the Boldyrev phenomenology, namely, a cross-helicity increasing at small scales, is not observed in the solar wind: the origin of the ribbon formation is unknown.

Stochastic acceleration by hydromagnetic turbulence

International Nuclear Information System (INIS)

Kulsrud, R.M.

1979-03-01

A general theory for particle acceleration by weak hydromagnetic turbulence with a given spectrum of waves is described. Various limiting cases, corresponding to Fermi acceleration and magnetic pumping, are discussed and two numerical examples illustrating them are given. An attempt is made to show that the expression for the rate of Fermi acceleration is valid for finite amplitudes

Impact of resonant magnetic perturbations on zonal modes, drift-wave turbulence and the L–H transition threshold

International Nuclear Information System (INIS)

Leconte, M.; Diamond, P.H.; Xu, Y.

2014-01-01

We study the effects of resonant magnetic perturbations (RMPs) on turbulence, flows and confinement in the framework of resistive drift-wave turbulence. This work was motivated, in parts, by experiments reported at the IAEA 2010 conference (Xu et al 2011 Nucl. Fusion 51 062030) which showed a decrease of long-range correlations during the application of RMPs. We derive and apply a zero-dimensional predator–prey model coupling the drift-wave–zonal-mode system (Leconte and Diamond 2012 Phys. Plasmas 19 055903) to the evolution of mean quantities. This model has both density-gradient drive and RMP amplitude as control parameters and predicts a novel type of transport bifurcation in the presence of RMPs. This model allows a description of the full L–H transition evolution with RMPs, including the mean sheared flow evolution. The key results are the following: (i) the L–I and I–H power thresholds both increase with RMP amplitude | b-tilde x |, the relative increase of the L–I threshold scales as ΔP LI ∝| b-tilde x | 2 ν ∗ −2 ρ s −2 , where ν * is edge collisionality and ρ s is the sound gyroradius. (ii) RMPs are predicted to decrease the hysteresis between the forward and back-transition. (iii) Taking into account the mean density evolution, the density profile—sustained by the particle source—has an increased turbulent diffusion compared with the reference case without RMPs which provides one possible explanation for the density pump-out effect. (paper)

Magnetosheath electrostatic turbulence

International Nuclear Information System (INIS)

Rodriguez, P.

1979-01-01

By using measurements with the University of Iowa plasma wave experiment on the Imp 6 satellite a study has been conducted of the spectrum of electrostatic plasma waves in the terrestrial magnetosheath. Electrostatic plasma wave turbulence is almost continuously present throughout the magnetosheath with broadband (20 Hz to 70 kHz) rms field intensities typically 0.01--1.0 mV m -1 . Peak intensities of about 1.0 mV m -1 near the electron plasma frequency (30--60 kHz) have been detected occasionally. Two or three components can usually be identified in the spectrum of magnetosheath electrostatic turbulence: a high-frequency (> or =30kHz) component peaking at the electron plasma frequency f/sub p/e, a low-frequency component with a broad intensity maximum below the nominal ion plasma frequency f/sub p/i (approx. f/sub p/e/43), and a less well defined intermediate component in the range f/sub p/i < f< f/sub p/e. The intensity distribution of magnetosheath electrostatic turbulence clearly shows that the low-frequency component is associated with the bow shock, suggesting that the ion heating begun at the shock continues into the downstream magnetosheath. Electrostatic waves below 1 kHz are polarized along the magnetic field direction, a result consistent with the polarization of electrostatic waves at the shock. The high- and intermediate-frequency components are features of the magnetosheath spectrum which are not characteristic of the shock spectrum but are often detected in the upstream solar wind. The intensity distribution of electrostatic turbulence at the magnetosheath plasma frequency has no apparent correlation with the shock, indicating that electron plasma oscillations are a general feature of the magnetosheath. The plasma wave noise shows a tendency to decrease toward the dawn and dusk regions, consistent with a general decrease in turbulence away from the subsolar magnetosheath

Study of two-dimensional interchange turbulence

International Nuclear Information System (INIS)

Sugama, Hideo; Wakatani, Masahiro.

1990-04-01

An eddy viscosity model describing enstrophy transfer in two-dimensional turbulence is presented. This model is similar to that of Canuto et al. and provides an equation for the energy spectral function F(k) as a function of the energy input rate to the system per unit wavenumber, γ s (k). In the enstrophy-transfer inertial range, F(k)∝ k -3 is predicted by the model. The eddy viscosity model is applied to the interchange turbulence of a plasma in shearless magnetic field. Numerical simulation of the two-dimensional interchange turbulence demonstrates that the energy spectrum in the high wavenumber region is well described by this model. The turbulent transport driven by the interchange turbulence is expressed in terms of the Nusselt number Nu, the Rayleigh number Ra and Prantl number Pr in the same manner as that of thermal convection problem. When we use the linear growth rate for γ s (k), our theoretical model predicts that Nu ∝ (Ra·Pr) 1/2 for a constant background pressure gradient and Nu ∝ (Ra·Pr) 1/3 for a self-consistent background pressure profile with the stress-free slip boundary conditions. The latter agrees with our numerical result showing Nu ∝ Ra 1/3 . (author)

On Electron-Scale Whistler Turbulence in the Solar Wind

Science.gov (United States)

Narita, Y.; Nakamura, R.; Baumjohann, W.; Glassmeier, K.-H.; Motschmann, U.; Giles, B.; Magnes, W.; Fischer, D.; Torbert, R. B.; Russell, C. T.

2016-01-01

For the first time, the dispersion relation for turbulence magnetic field fluctuations in the solar wind is determined directly on small scales of the order of the electron inertial length, using four-point magnetometer observations from the Magnetospheric Multiscale mission. The data are analyzed using the high-resolution adaptive wave telescope technique. Small-scale solar wind turbulence is primarily composed of highly obliquely propagating waves, with dispersion consistent with that of the whistler mode.

Scaling of plasma turbulence resulting from parametric instabilities

International Nuclear Information System (INIS)

Ott, E.

1976-01-01

Dimensional analysis is used to obtain results on the turbulent state resulting from parametric instabilities of an initially cold plasma. The results include the possibility of an applied magnetic field, multiple ion species, and arbitrary dimensionality

Plasma shaping effects on tokamak scrape-off layer turbulence

Science.gov (United States)

Riva, Fabio; Lanti, Emmanuel; Jolliet, Sébastien; Ricci, Paolo

2017-03-01

The impact of plasma shaping on tokamak scrape-off layer (SOL) turbulence is investigated. The drift-reduced Braginskii equations are written for arbitrary magnetic geometries, and an analytical equilibrium model is used to introduce the dependence of turbulence equations on tokamak inverse aspect ratio (ε ), Shafranov’s shift (Δ), elongation (κ), and triangularity (δ). A linear study of plasma shaping effects on the growth rate of resistive ballooning modes (RBMs) and resistive drift waves (RDWs) reveals that RBMs are strongly stabilized by elongation and negative triangularity, while RDWs are only slightly stabilized in non-circular magnetic geometries. Assuming that the linear instabilities saturate due to nonlinear local flattening of the plasma gradient, the equilibrium gradient pressure length {L}p=-{p}e/{{\

Turbulence in a cusp Q device

DEFF Research Database (Denmark)

D'Angelo, N.; Pécseli, Hans; Petersen, P. I.

1974-01-01

Spectral measurements are reported of plasma turbulence in the Cs plasma of a Q device, modified to a magnetic cusp geometry. The excitation mechanism for the fluctuations appears to be the centrifugal instability discussed by Chen. A transition from an f−5 to an f−3 power spectrum is observed...

3D fluid simulations of tokamak edge turbulence

International Nuclear Information System (INIS)

Zeiler, A.; Biskamp, D.; Drake, J.F.; Guzdar, P.N.

1995-09-01

3D simulations of drift resistive ballooning turbulence are presented. The turbulence is basically controlled by a parameter α, the ratio of the drift wave frequency to the ideal ballooning growth rate. If this parameters is small (α≤1, corresponding to Ohmic or L-mode plasmas), the system is dominated by ballooning turbulence, which is strongly peaked at the outside of the torus. If it is large (α≥1, corresponding to H-mode plasmas) field line curvature plays a minor role. The turbulence is nonlinearly sustained even if curvature is removed and all modes are linearly stable due to magnetic shear. In the nonlinear regime without curvature the system obeys a different scaling law compared to the low α regime. The transport scaling is discussed in both regimes and the implications for OH-, L-mode and H-mode transport are discussed. (orig.)

Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

Science.gov (United States)

Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

2018-03-01

Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

Plasma turbulence imaging using high-power laser Thomson scattering

Science.gov (United States)

Zweben, S. J.; Caird, J.; Davis, W.; Johnson, D. W.; Le Blanc, B. P.

2001-01-01

The two-dimensional (2D) structure of plasma density turbulence in a magnetically confined plasma can potentially be measured using a Thomson scattering system made from components of the Nova laser of Lawrence Livermore National Laboratory. For a plasma such as the National Spherical Torus Experiment at the Princeton Plasma Physics Laboratory, the laser would form an ≈10-cm-wide plane sheet beam passing vertically through the chamber across the magnetic field. The scattered light would be imaged by a charge coupled device camera viewing along the direction of the magnetic field. The laser energy required to make 2D images of density turbulence is in the range 1-3 kJ, which can potentially be obtained from a set of frequency-doubled Nd:glass amplifiers with diameters in the range of 208-315 mm. A laser pulse width of ⩽100 ns would be short enough to capture the highest frequency components of the expected density fluctuations.

CICART Center For Integrated Computation And Analysis Of Reconnection And Turbulence

Energy Technology Data Exchange (ETDEWEB)

Bhattacharjee, Amitava [Univ. of New Hampshire, Durham, NH (United States)

2016-03-27

CICART is a partnership between the University of New Hampshire (UNH) and Dartmouth College. CICART addresses two important science needs of the DoE: the basic understanding of magnetic reconnection and turbulence that strongly impacts the performance of fusion plasmas, and the development of new mathematical and computational tools that enable the modeling and control of these phenomena. The principal participants of CICART constitute an interdisciplinary group, drawn from the communities of applied mathematics, astrophysics, computational physics, fluid dynamics, and fusion physics. It is a main premise of CICART that fundamental aspects of magnetic reconnection and turbulence in fusion devices, smaller-scale laboratory experiments, and space and astrophysical plasmas can be viewed from a common perspective, and that progress in understanding in any of these interconnected fields is likely to lead to progress in others. The establishment of CICART has strongly impacted the education and research mission of a new Program in Integrated Applied Mathematics in the College of Engineering and Applied Sciences at UNH by enabling the recruitment of a tenure-track faculty member, supported equally by UNH and CICART, and the establishment of an IBM-UNH Computing Alliance. The proposed areas of research in magnetic reconnection and turbulence in astrophysical, space, and laboratory plasmas include the following topics: (A) Reconnection and secondary instabilities in large high-Lundquist-number plasmas, (B) Particle acceleration in the presence of multiple magnetic islands, (C) Gyrokinetic reconnection: comparison with fluid and particle-in-cell models, (D) Imbalanced turbulence, (E) Ion heating, and (F) Turbulence in laboratory (including fusion-relevant) experiments. These theoretical studies make active use of three high-performance computer simulation codes: (1) The Magnetic Reconnection Code, based on extended two-fluid (or Hall MHD) equations, in an Adaptive Mesh

The magnetic field of molecular clouds

Science.gov (United States)

Padoan, P.

2018-01-01

The magnetic field of molecular clouds (MCs) plays an important role in the process of star formation: it determines the statistical properties of supersonic turbulence that controls the fragmentation of MCs, controls the angular momentum transport during the protostellar collapse, and affects the stability of circumstellar disks. In this work, we focus on the problem of the determination of the magnetic field strength. We review the idea that the MC turbulence is super-Alfvénic, and we argue that MCs are bound to be born super-Alfvénic. We show that this scenario is supported by results from a recent simulation of supernova-driven turbulence on a scale of 250 pc, where the turbulent cascade is resolved on a wide range of scales, including the interior of MCs.

Species Entropies in the Kinetic Range of Collisionless Plasma Turbulence: Particle-in-cell Simulations

Science.gov (United States)

Gary, S. Peter; Zhao, Yinjian; Hughes, R. Scott; Wang, Joseph; Parashar, Tulasi N.

2018-06-01

Three-dimensional particle-in-cell simulations of the forward cascade of decaying turbulence in the relatively short-wavelength kinetic range have been carried out as initial-value problems on collisionless, homogeneous, magnetized electron-ion plasma models. The simulations have addressed both whistler turbulence at β i = β e = 0.25 and kinetic Alfvén turbulence at β i = β e = 0.50, computing the species energy dissipation rates as well as the increase of the Boltzmann entropies for both ions and electrons as functions of the initial dimensionless fluctuating magnetic field energy density ε o in the range 0 ≤ ε o ≤ 0.50. This study shows that electron and ion entropies display similar rates of increase and that all four entropy rates increase approximately as ε o , consistent with the assumption that the quasilinear premise is valid for the initial conditions assumed for these simulations. The simulations further predict that the time rates of ion entropy increase should be substantially greater for kinetic Alfvén turbulence than for whistler turbulence.

Self-consistency constraints on turbulent magnetic transport and relaxation in collisionless plasma

International Nuclear Information System (INIS)

Terry, P.W.; Diamond, P.H.; Hahm, T.S.

1985-10-01

Novel constraints on collisionless relaxation and transport in drift-Alfven turbulence are reported. These constraints arise due to the consideration of mode coupling and incoherent fluctuations and the proper application of self-consistency conditions. The result that electrostatic fluctuations alone regulate transport in drift-Alfven turbulence follows directly. Quasilinear transport predictions are discussed in light of these constraints

Synergy of Stochastic and Systematic Energization of Plasmas during Turbulent Reconnection

Science.gov (United States)

Pisokas, Theophilos; Vlahos, Loukas; Isliker, Heinz

2018-01-01

The important characteristic of turbulent reconnection is that it combines large-scale magnetic disturbances (δ B/B∼ 1) with randomly distributed unstable current sheets (UCSs). Many well-known nonlinear MHD structures (strong turbulence, current sheet(s), shock(s)) lead asymptotically to the state of turbulent reconnection. We analyze in this article, for the first time, the energization of electrons and ions in a large-scale environment that combines large-amplitude disturbances propagating with sub-Alfvénic speed with UCSs. The magnetic disturbances interact stochastically (second-order Fermi) with the charged particles and play a crucial role in the heating of the particles, while the UCSs interact systematically (first-order Fermi) and play a crucial role in the formation of the high-energy tail. The synergy of stochastic and systematic acceleration provided by the mixture of magnetic disturbances and UCSs influences the energetics of the thermal and nonthermal particles, the power-law index, and the length of time the particles remain inside the energy release volume. We show that this synergy can explain the observed very fast and impulsive particle acceleration and the slightly delayed formation of a superhot particle population.

Diagnosis of Acceleration, Reconnection, Turbulence, and Heating

Science.gov (United States)

Dufor, Mikal T.; Jemiolo, Andrew J.; Keesee, Amy; Cassak, Paul; Tu, Weichao; Scime, Earl E.

2017-10-01

The DARTH (Diagnosis of Acceleration, Reconnection, Turbulence, and Heating) experiment is an intermediate-scale, experimental facility designed to study magnetic reconnection at and below the kinetic scale of ions and electrons. The experiment will have non-perturbative diagnostics with high temporal and three-dimensional spatial resolution, giving it the capability to investigate kinetic-scale physics. Of specific scientific interest are particle acceleration, plasma heating, turbulence and energy dissipation during reconnection. Here we will describe the magnetic field system and the two plasma guns used to create flux ropes that then merge through magnetic reconnection. We will also describe the key diagnostic systems: laser induced fluorescence (LIF) for ion vdf measurements, a 300 GHz microwave scattering system for sub-mm wavelength fluctuation measurements and a Thomson scattering laser for electron vdf measurements. The vacuum chamber is designed to provide unparalleled access for these particle diagnostics. The scientific goals of DARTH are to examine particle acceleration and heating during, the role of three-dimensional instabilities during reconnection, how reconnection ceases, and the role of impurities and asymmetries in reconnection. This work was supported by the by the O'Brien Energy Research Fund.

A new maser effect in plasma turbulence