WorldWideScience

Sample records for aperiodic magnetic turbulence

  1. Magnetized Turbulent Dynamo in Protogalaxies

    Energy Technology Data Exchange (ETDEWEB)

    Leonid Malyshkin; Russell M. Kulsrud

    2002-01-28

    The prevailing theory for the origin of cosmic magnetic fields is that they have been amplified to their present values by the turbulent dynamo inductive action in the protogalactic and galactic medium. Up to now, in calculation of the turbulent dynamo, it has been customary to assume that there is no back reaction of the magnetic field on the turbulence, as long as the magnetic energy is less than the turbulent kinetic energy. This assumption leads to the kinematic dynamo theory. However, the applicability of this theory to protogalaxies is rather limited. The reason is that in protogalaxies the temperature is very high, and the viscosity is dominated by magnetized ions. As the magnetic field strength grows in time, the ion cyclotron time becomes shorter than the ion collision time, and the plasma becomes strongly magnetized. As a result, the ion viscosity becomes the Braginskii viscosity. Thus, in protogalaxies the back reaction sets in much earlier, at field strengths much lower than those which correspond to field-turbulence energy equipartition, and the turbulent dynamo becomes what we call the magnetized turbulent dynamo. In this paper we lay the theoretical groundwork for the magnetized turbulent dynamo. In particular, we predict that the magnetic energy growth rate in the magnetized dynamo theory is up to ten times larger than that in the kinematic dynamo theory. We also briefly discuss how the Braginskii viscosity can aid the development of the inverse cascade of magnetic energy after the energy equipartition is reached.

  2. Wave turbulence in magnetized plasmas

    Directory of Open Access Journals (Sweden)

    S. Galtier

    2009-02-01

    Full Text Available The paper reviews the recent progress on wave turbulence for magnetized plasmas (MHD, Hall MHD and electron MHD in the incompressible and compressible cases. The emphasis is made on homogeneous and anisotropic turbulence which usually provides the best theoretical framework to investigate space and laboratory plasmas. The solar wind and the coronal heating problems are presented as two examples of application of anisotropic wave turbulence. The most important results of wave turbulence are reported and discussed in the context of natural and simulated magnetized plasmas. Important issues and possible spurious interpretations are also discussed.

  3. Turbulent transport in magnetized plasmas

    CERN Document Server

    Horton, Wendell

    2012-01-01

    This book explains how magnetized plasmas self-organize in states of electromagnetic turbulence that transports particles and energy out of the core plasma faster than anticipated by the fusion scientists designing magnetic confinement systems in the 20th century. It describes theory, experiments and simulations in a unified and up-to-date presentation of the issues of achieving nuclear fusion power.

  4. Magnetic turbulence and anomalous transport

    International Nuclear Information System (INIS)

    Garbet, X.; Mourgues, F.; Samain, A.

    1990-01-01

    The self consistency conditions for magnetic turbulence are reviewed. The main features of magnetic topology involving stochastic flux lines are summarized. Two driving sources are considered: thermal effects which require large scale residual islands and electron diamagnetism which involves fluctuation scales smaller than the ion Larmor radius and a β p threshold of order one. Stability criteria and transport coefficients are given

  5. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  6. On the thickness of accretion curtains on magnetized compact objects from analysis of their fast aperiodic time variability.

    Science.gov (United States)

    Semena, Andrey

    It is widely accepted that accretion onto magnetized compact objects is channelled to some areas close to magnetic poles of the star. Thickness of this channelled accretion flow intimately depends on details of penetration of highly conducting plasma of the flow to the compact object magnetosphere, i.e. on magnetic diffusivity etc. Until now our knowledge of these plasma properties is scarce. In our work we present our attempts to estimate the thickness of the plasma flow on top of the magnetosphere from observations of accreting intermediate polars (magnetized white dwarfs). We show that properties of aperiodic noise of accreting intermediate polars can be used to put constrains on cooling time of hot plasma, heated in the standing shock wave above the WD surface. Estimates of the cooling time and the mass accretion rate provide us a tool to measure the density of post-shock plasma and the cross-sectional area of the accretion funnel at the WD surface. We have studied aperiodic noise of emission of one of the brightest intermediate polar EX Hya with the help of data in optical and X-ray energy bands. We put an upper limit on the plasma cooling timescale tau <0.2-0.5 sec, on the fractional area of the accretion curtain footprint f < 1.6 × 10(-4) . We show that measurements of accretion column footprints, combined with results of the eclipse mapping, can be used to obtain an upper limit on the penetration depth of the accretion disc plasma at the boundary of the magnetosphere, Delta r / r ≈ 10(-3) If the magnetospheres of accreting neutron stars have similar plasma penetration depths at their boundaries, we predict that footprints of their accretion columns should be very small, with fractional areas < 10(-6) .

  7. Inverse scattering problem in turbulent magnetic fluctuations

    Directory of Open Access Journals (Sweden)

    R. A. Treumann

    2016-08-01

    Full Text Available We apply a particular form of the inverse scattering theory to turbulent magnetic fluctuations in a plasma. In the present note we develop the theory, formulate the magnetic fluctuation problem in terms of its electrodynamic turbulent response function, and reduce it to the solution of a special form of the famous Gelfand–Levitan–Marchenko equation of quantum mechanical scattering theory. The last of these applies to transmission and reflection in an active medium. The theory of turbulent magnetic fluctuations does not refer to such quantities. It requires a somewhat different formulation. We reduce the theory to the measurement of the low-frequency electromagnetic fluctuation spectrum, which is not the turbulent spectral energy density. The inverse theory in this form enables obtaining information about the turbulent response function of the medium. The dynamic causes of the electromagnetic fluctuations are implicit to it. Thus, it is of vital interest in low-frequency magnetic turbulence. The theory is developed until presentation of the equations in applicable form to observations of turbulent electromagnetic fluctuations as input from measurements. Solution of the final integral equation should be done by standard numerical methods based on iteration. We point to the possibility of treating power law fluctuation spectra as an example. Formulation of the problem to include observations of spectral power densities in turbulence is not attempted. This leads to severe mathematical problems and requires a reformulation of inverse scattering theory. One particular aspect of the present inverse theory of turbulent fluctuations is that its structure naturally leads to spatial information which is obtained from the temporal information that is inherent to the observation of time series. The Taylor assumption is not needed here. This is a consequence of Maxwell's equations, which couple space and time evolution. The inversion procedure takes

  8. Electrostatic turbulence in strongly magnetized plasmas

    International Nuclear Information System (INIS)

    Nielsen, A.H.

    1993-01-01

    Turbulence in plasmas has been investigated experimentally and numerically. On the experimental side the turbulent nature of the Kelvin-Helmholtz instability has been studied in a single-ended Q-machine. The development of coherent structures in the background of the turbulent flow has been demonstrated and the capability of structures of transporting plasma across the magnetic field-lines is explained in detail. The numerical investigations are divided into two parts: Numerical simulations of the dynamics from the Q-machine experiments using spectral methods to solve the two-dimensional Navier-Stokes equations in a cylindrical geometry. A numerical study of the Eulerian-Lagrangian transformation in a two-dimensional flow. Here the flow is made up by a large number of structures, where each individual structure is convected by the superposed flow field of all the others. (au) (33 ills., 67 refs.)

  9. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  10. Turbulent Magnetic Relaxation in Pulsar Wind Nebulae

    Science.gov (United States)

    Zrake, Jonathan; Arons, Jonathan

    2017-09-01

    We present a model for magnetic energy dissipation in a pulsar wind nebula. A better understanding of this process is required to assess the likelihood that certain astrophysical transients may be powered by the spin-down of a “millisecond magnetar.” Examples include superluminous supernovae, gamma-ray bursts, and anticipated electromagnetic counterparts to gravitational wave detections of binary neutron star coalescence. Our model leverages recent progress in the theory of turbulent magnetic relaxation to specify a dissipative closure of the stationary magnetohydrodynamic (MHD) wind equations, yielding predictions of the magnetic energy dissipation rate throughout the nebula. Synchrotron losses are self-consistently treated. To demonstrate the model’s efficacy, we show that it can reproduce many features of the Crab Nebula, including its expansion speed, radiative efficiency, peak photon energy, and mean magnetic field strength. Unlike ideal MHD models of the Crab (which lead to the so-called σ-problem), our model accounts for the transition from ultra to weakly magnetized plasma flow and for the associated heating of relativistic electrons. We discuss how the predicted heating rates may be utilized to improve upon models of particle transport and acceleration in pulsar wind nebulae. We also discuss implications for the Crab Nebula’s γ-ray flares, and point out potential modifications to models of astrophysical transients invoking the spin-down of a millisecond magnetar.

  11. Toward the Theory of Turbulence in Magnetized Plasmas

    International Nuclear Information System (INIS)

    Boldyrev, Stanislav

    2013-01-01

    The goal of the project was to develop a theory of turbulence in magnetized plasmas at large scales, that is, scales larger than the characteristic plasma microscales (ion gyroscale, ion inertial scale, etc.). Collisions of counter-propagating Alfven packets govern the turbulent cascade of energy toward small scales. It has been established that such an energy cascade is intrinsically anisotropic, in that it predominantly supplies energy to the modes with mostly field-perpendicular wave numbers. The resulting energy spectrum of MHD turbulence, and the structure of the fluctuations were studied both analytically and numerically. A new parallel numerical code was developed for simulating reduced MHD equations driven by an external force. The numerical setting was proposed, where the spectral properties of the force could be varied in order to simulate either strong or weak turbulent regimes. It has been found both analytically and numerically that weak MHD turbulence spontaneously generates a 'condensate', that is, concentration of magnetic and kinetic energy at small kllel)). A related topic that was addressed in the project is turbulent dynamo action, that is, generation of magnetic field in a turbulent flow. We were specifically concentrated on the generation of large-scale magnetic field compared to the scales of the turbulent velocity field. We investigate magnetic field amplification in a turbulent velocity field with nonzero helicity, in the framework of the kinematic Kazantsev-Kraichnan model

  12. Signal interferences from turbulent spin dynamics in solution nuclear magnetic resonance spectroscopy

    Science.gov (United States)

    Huang, Susie Y.; Lin, Yung-Ya; Lisitza, Natalia; Warren, Warren S.

    2002-06-01

    Artifacts arising from aperiodic turbulent spin dynamics in gradient-based nuclear magnetic resonance (NMR) applications are comprehensively surveyed and numerically simulated by a nonlinear Bloch equation. The unexpected dynamics, triggered by the joint action of radiation damping and the distant dipolar field, markedly deteriorate the performance of certain pulse sequences incorporating weak pulsed-field gradients and long evolution times. The effects are demonstrated in three general classes of gradient NMR applications: solvent signal suppression, diffusion measurements, and coherence pathway selection. Gradient-modulated solvent transverse magnetization can be partially rephased in a series of self-refocusing gradient echoes that blank out solute resonances in the CHESS (chemical-shift-selective spectroscopy) and WATERGATE (gradient-tailored water suppression) solvent suppression schemes. In addition, the discovered dynamics contribute to erratic echo attenuation in pulsed gradient spin echo (PGSE) and PGSE stimulated echo diffusion measurements and produce coherence leakage in gradient-selected DQFCOSY and HMQC experiments. Specific remedies for minimizing unwanted effects are presented.

  13. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  14. Primordial magnetic field amplification from turbulent reheating

    International Nuclear Information System (INIS)

    Calzetta, Esteban; Kandus, Alejandra

    2010-01-01

    We analyze the possibility of primordial magnetic field amplification by a stochastic large scale kinematic dynamo during reheating. We consider a charged scalar field minimally coupled to gravity. During inflation this field is assumed to be in its vacuum state. At the transition to reheating the state of the field changes to a many particle/anti-particle state. We characterize that state as a fluid flow of zero mean velocity but with a stochastic velocity field. We compute the scale-dependent Reynolds number Re(k), and the characteristic times for decay of turbulence, t d and pair annihilation t a , finding t a d . We calculate the rms value of the kinetic helicity of the flow over a scale L and show that it does not vanish. We use this result to estimate the amplification factor of a seed field from the stochastic kinematic dynamo equations. Although this effect is weak, it shows that the evolution of the cosmic magnetic field from reheating to galaxy formation may well be more complex than as dictated by simple flux freezing

  15. Transport of Charged Particles in Turbulent Magnetic Fields

    Science.gov (United States)

    Parashar, T.; Subedi, P.; Sonsrettee, W.; Blasi, P.; Ruffolo, D. J.; Matthaeus, W. H.; Montgomery, D.; Chuychai, P.; Dmitruk, P.; Wan, M.; Chhiber, R.

    2017-12-01

    Magnetic fields permeate the Universe. They are found in planets, stars, galaxies, and the intergalactic medium. The magnetic field found in these astrophysical systems are usually chaotic, disordered, and turbulent. The investigation of the transport of cosmic rays in magnetic turbulence is a subject of considerable interest. One of the important aspects of cosmic ray transport is to understand their diffusive behavior and to calculate the diffusion coefficient in the presence of these turbulent fields. Research has most frequently concentrated on determining the diffusion coefficient in the presence of a mean magnetic field. Here, we will particularly focus on calculating diffusion coefficients of charged particles and magnetic field lines in a fully three-dimensional isotropic turbulent magnetic field with no mean field, which may be pertinent to many astrophysical situations. For charged particles in isotropic turbulence we identify different ranges of particle energy depending upon the ratio of the Larmor radius of the charged particle to the characteristic outer length scale of the turbulence. Different theoretical models are proposed to calculate the diffusion coefficient, each applicable to a distinct range of particle energies. The theoretical ideas are tested against results of detailed numerical experiments using Monte-Carlo simulations of particle propagation in stochastic magnetic fields. We also discuss two different methods of generating random magnetic field to study charged particle propagation using numerical simulation. One method is the usual way of generating random fields with a specified power law in wavenumber space, using Gaussian random variables. Turbulence, however, is non-Gaussian, with variability that comes in bursts called intermittency. We therefore devise a way to generate synthetic intermittent fields which have many properties of realistic turbulence. Possible applications of such synthetically generated intermittent fields are

  16. Compression of turbulent magnetized gas in giant molecular clouds

    Science.gov (United States)

    Birnboim, Yuval; Federrath, Christoph; Krumholz, Mark

    2018-01-01

    Interstellar gas clouds are often both highly magnetized and supersonically turbulent, with velocity dispersions set by a competition between driving and dissipation. This balance has been studied extensively in the context of gases with constant mean density. However, many astrophysical systems are contracting under the influence of external pressure or gravity, and the balance between driving and dissipation in a contracting, magnetized medium has yet to be studied. In this paper, we present three-dimensional magnetohydrodynamic simulations of compression in a turbulent, magnetized medium that resembles the physical conditions inside molecular clouds. We find that in some circumstances the combination of compression and magnetic fields leads to a rate of turbulent dissipation far less than that observed in non-magnetized gas, or in non-compressing magnetized gas. As a result, a compressing, magnetized gas reaches an equilibrium velocity dispersion much greater than would be expected for either the hydrodynamic or the non-compressing case. We use the simulation results to construct an analytic model that gives an effective equation of state for a coarse-grained parcel of the gas, in the form of an ideal equation of state with a polytropic index that depends on the dissipation and energy transfer rates between the magnetic and turbulent components. We argue that the reduced dissipation rate and larger equilibrium velocity dispersion has important implications for the driving and maintenance of turbulence in molecular clouds and for the rates of chemical and radiative processes that are sensitive to shocks and dissipation.

  17. POLARIMETRIC STUDIES OF MAGNETIC TURBULENCE WITH AN INTERFEROMETER

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyeseung; Cho, Jungyeon [Department of Astronomy and Space Science, Chungnam National University, Deajeon (Korea, Republic of); Lazarian, A. [Department of Astronomy, University of Wisconsin, Madison (United States)

    2016-11-01

    We study statistical properties of synchrotron polarization emitted from media with magnetohydrodynamic (MHD) turbulence. We use both synthetic and MHD turbulence simulation data for our studies. We obtain the spatial spectrum and its derivative with respect to the wavelength of synchrotron polarization arising from both synchrotron radiation and Faraday rotation fluctuations. In particular, we investigate how the spectrum changes with frequency. We find that our simulations agree with the theoretical predication in Lazarian and Pogosyan. We conclude that the spectrum of synchrotron polarization and its derivative can be very informative tools to obtain detailed information about the statistical properties of MHD turbulence from radio observations of diffuse synchrotron polarization. They are especially useful for recovering the statistics of a turbulent magnetic field as well as the turbulent density of electrons. We also simulate interferometric observations that incorporate the effects of noise and finite telescope beam size, and demonstrate how we recover statistics of underlying MHD turbulence.

  18. Fluid model of the magnetic presheath in a turbulent plasma

    International Nuclear Information System (INIS)

    Stanojevic, M; Duhovnik, J; Jelic, N; Kendl, A; Kuhn, S

    2005-01-01

    A fluid model of the magnetic presheath in a turbulent boundary plasma is presented. Turbulent transport corrections of the classical three-dimensional fluid transport equations, which can be used to study magnetic presheaths in various geometries, are derived by means of the ensemble averaging procedure from the statistical theory of plasma turbulence. Then, the magnetic presheath in front of an infinite plane surface is analysed in detail. The linearized planar magnetic presheath equations are applied to the plasma-presheath-magnetic-presheath boundary (i.e. the magnetic presheath edge), whereas the original non-linear planar magnetic presheath equations are used for the entire magnetic presheath, allowing for various sets of experimentally relevant free model parameters to be applied. Important new results of this study are, among others, new expressions for the fluid Bohm criterion at the Debye sheath edge and for the ion flux density perpendicular to the wall. These new results, which exhibit corrections due to the turbulent charged particle transport, can qualitatively explain the fact that whenever the angle between the magnetic field and the wall is very small (i.e. several degrees) or zero, electric currents, measured by Langmuir probes in the boundary regions of nuclear fusion devices and in various low-temperature plasmas, are anomalously enhanced in comparison with those expected or predicted by other theoretical models

  19. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  20. On Runaway Transport under Magnetic Turbulence in Tokamaks

    Energy Technology Data Exchange (ETDEWEB)

    Castejon, F.; Equilior, S.; Rodriguez-Rodrigo, L. [CIEMAT. Madrid (Spain)

    2001-07-01

    The influence of magnetic turbulence on runaway transport has been studied. The evolution of runaway distribution function has been calculated using Electra a 2D code in momentum space and 1D in radius coordinate. The code considers the effect of averaging the turbulence by runaway orbits. Then Hard X-Ray emission spectrum is estimated and compared with experimental results of TJ-1 tokamak, obtaining a remarkable agreement. (Author) 15 refs.

  1. The Development of Drift Wave Turbulence in Magnetic Reconnection

    Science.gov (United States)

    McMurtrie, L.; Drake, J. F.; Swisdak, M. M.

    2013-12-01

    An important feature in collisionless magnetic reconnection is the development of sharp discontinuities along the separatrices bounding the Alfvenic outflow. The typical scale length of these features is ρs (the Larmor radius based on the sound speed) for guide field reconnection. Temperature gradients in the inflowing plasma (as might be found in the magnetopause) can lead to instabilities at these separatrices, specifically drift wave turbulence. We present standalone 2D and 3D PIC simulations of drift wave turbulence to investigate scaling properties and growth rates. Further investigations of the relative importance of drift wave turbulence in the development of reconnection will also be considered.

  2. Local time dependence of turbulent magnetic fields in Saturn's magnetodisc

    Science.gov (United States)

    Kaminker, V.; Delamere, P. A.; Ng, C. S.; Dennis, T.; Otto, A.; Ma, X.

    2017-04-01

    Net plasma transport in magnetodiscs around giant planets is outward. Observations of plasma temperature have shown that the expanding plasma is heating nonadiabatically during this process. Turbulence has been suggested as a source of heating. However, the mechanism and distribution of magnetic fluctuations in giant magnetospheres are poorly understood. In this study we attempt to quantify the radial and local time dependence of fluctuating magnetic field signatures that are suggestive of turbulence, quantifying the fluctuations in terms of a plasma heating rate density. In addition, the inferred heating rate density is correlated with magnetic field configurations that include azimuthal bend forward/back and magnitude of the equatorial normal component of magnetic field relative to the dipole. We find a significant local time dependence in magnetic fluctuations that is consistent with flux transport triggered in the subsolar and dusk sectors due to magnetodisc reconnection.

  3. Turbulent contributions to Ohm's law in axisymmetric magnetized plasmas

    Science.gov (United States)

    Chavdarovski, I.; Gatto, R.

    2017-07-01

    The effect of magnetic turbulence in shaping the current density in axisymmetric magnetized plasmas is analyzed using a turbulent extension of Ohm's law derived from the self-consistent action-angle transport theory. Besides the well-known hyper-resistive (helicity-conserving) contribution, the generalized Ohm's law contains an anomalous resistivity term and a turbulent bootstrap-like term proportional to the current density derivative. The numerical solution of the equation for equilibrium and turbulence profiles characteristic of conventional and advanced scenarios shows that, through the "turbulent bootstrap" effect and anomalous resistivity, power and parallel current can be generated which are a sizable portion (about 20%-25%) of the corresponding effects associated with the neoclassical bootstrap effect. The degree of alignment of the turbulence peak and the pressure gradient plays an important role in defining the steady-state regime. In a fully bootstrapped tokamak, the hyper-resistivity is essential in overcoming the intrinsic limitation of the hollow current profile.

  4. Suprathermal ion transport in turbulent magnetized plasmas

    International Nuclear Information System (INIS)

    Bovet, A. D.

    2015-01-01

    Suprathermal ions, which have an energy greater than the quasi-Maxwellian background plasma temperature, are present in many laboratory and astrophysical plasmas. In fusion devices, they are generated by the fusion reactions and auxiliary heating. Controlling their transport is essential for the success of future fusion devices that could provide a clean, safe and abundant source of electric power to our society. In space, suprathermal ions include energetic solar particles and cosmic rays. The understanding of the acceleration and transport mechanisms of these particles is still incomplete. Basic plasma devices allow detailed measurements that are not accessible in astrophysical and fusion plasmas, due to the difficulty to access the former and the high temperatures of the latter. The basic toroidal device TORPEX offers an easy access for diagnostics, well characterized plasma scenarios and validated numerical simulations of its turbulence dynamics, making it the ideal platform for the investigation of suprathermal ion transport. This Thesis presents three-dimensional measurements of a suprathermal ion beam injected in turbulent TORPEX plasmas. The combination of uniquely resolved measurements and first principle numerical simulations reveals the general non-diffusive nature of the suprathermal ion transport. A precise characterization of their transport regime shows that, depending on their energies, suprathermal ions can experience either a super diffusive transport or a subdiffusive transport in the same background turbulence. The transport character is determined by the interaction of the suprathermal ion orbits with the turbulent plasma structures, which in turn depends on the ratio between the ion energy and the background plasma temperature. Time-resolved measurements reveal a clear difference in the intermittency of suprathermal ions time-traces depending on the transport regime they experience. Conditionally averaged measurements uncover the influence of

  5. Magnetic turbulence in a table-top laser-plasma relevant to astrophysical scenarios

    Science.gov (United States)

    Chatterjee, Gourab; Schoeffler, Kevin M.; Kumar Singh, Prashant; Adak, Amitava; Lad, Amit D.; Sengupta, Sudip; Kaw, Predhiman; Silva, Luis O.; Das, Amita; Kumar, G. Ravindra

    2017-06-01

    Turbulent magnetic fields abound in nature, pervading astrophysical, solar, terrestrial and laboratory plasmas. Understanding the ubiquity of magnetic turbulence and its role in the universe is an outstanding scientific challenge. Here, we report on the transition of magnetic turbulence from an initially electron-driven regime to one dominated by ion-magnetization in a laboratory plasma produced by an intense, table-top laser. Our observations at the magnetized ion scale of the saturated turbulent spectrum bear a striking resemblance with spacecraft measurements of the solar wind magnetic-field spectrum, including the emergence of a spectral kink. Despite originating from diverse energy injection sources (namely, electrons in the laboratory experiment and ion free-energy sources in the solar wind), the turbulent spectra exhibit remarkable parallels. This demonstrates the independence of turbulent spectral properties from the driving source of the turbulence and highlights the potential of small-scale, table-top laboratory experiments for investigating turbulence in astrophysical environments.

  6. Velocity Fluctuations Driven by the Damped, Aperiodic Mode in the Intergalactic Medium

    Science.gov (United States)

    Kolberg, U.; Schlickeiser, R.; Yoon, P. H.

    2017-08-01

    On account of its finite temperature, the unmagnetized intergalactic medium (IGM) is subject to thermal fluctuations. Due to the fundamental coupling between particles and fields in a plasma, the field fluctuations generate current densities by means of the Lorentz force and thereby affect both the density and the velocity fluctuations of the particles. Recently, a new damped, aperiodic mode was discovered that dominates field fluctuations in the IGM. Apart from its impact on the transport properties of the IGM that determine the propagation of cosmic rays, previous research has shown that this mode provides turbulent magnetic seed fields of 6× {10}-18 {{G}} that are an essential ingredient in the generation of cosmic magnetic fields. The current investigation addresses the influence of the mode on the particle motion. In order to describe the corresponding state of the turbulence, both the spectrum and the integrated total value of the mode-driven proton velocity fluctuations are computed. It is found that the latter amounts to 1.16× {10}8{ T}47/2{n}-7-1/2 {cm} {{{s}}}-1 assuming a temperature of {T}e={T}p={10}4{T}4 {{K}} and a density of {n}e={n}p={10}-7{n}-7 {{cm}}-3. This value is two orders of magnitude larger than the thermal velocity. If the IGM neutrals adopt the same velocities as the protons by mutual charge exchange and elastic collisions (ambipolar diffusion), atomic lines propagating through the IGM are expected to display spectral broadening, enhanced by a factor of 90 beyond the thermal level in the case of hydrogen. This opens the window to a first direct observation of the damped aperiodic mode. Other observational techniques such as dispersion measure, rotation measure, and scintillation data are not applicable in this case because the mode is a transverse one, and, as such, it does not induce the required density fluctuations, as is shown here.

  7. Turbulence and intermittent transport at the boundary of magnetized plasmas

    DEFF Research Database (Denmark)

    Garcia, O.E.; Naulin, V.; Nielsen, A.H.

    2005-01-01

    fluctuation wave forms and transport statistics are also in a good agreement with those derived from the experiments. Associated with the turbulence bursts are relaxation oscillations in the particle and heat confinements as well as in the kinetic energy of the sheared poloidal flows. The formation of blob...... a forcing region with spatially localized sources of particles and heat outside which losses due to the motion along open magnetic-field lines dominate, corresponding to the edge region and the scrape-off layer, respectively. Turbulent states reveal intermittent eruptions of hot plasma from the edge region...

  8. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  9. JOINT INVERSE CASCADE OF MAGNETIC ENERGY AND MAGNETIC HELICITY IN MHD TURBULENCE

    International Nuclear Information System (INIS)

    Stepanov, R.; Frick, P.; Mizeva, I.

    2015-01-01

    We show that oppositely directed fluxes of energy and magnetic helicity coexist in the inertial range in fully developed magnetohydrodynamic (MHD) turbulence with small-scale sources of magnetic helicity. Using a helical shell model of MHD turbulence, we study the high Reynolds number MHD turbulence for helicity injection at a scale that is much smaller than the scale of energy injection. In a short range of scales larger than the forcing scale of magnetic helicity, a bottleneck-like effect appears, which results in a local reduction of the spectral slope. The slope changes in a domain with a high level of relative magnetic helicity, which determines that part of the magnetic energy is related to the helical modes at a given scale. If the relative helicity approaches unity, the spectral slope tends to –3/2. We show that this energy pileup is caused by an inverse cascade of magnetic energy associated with the magnetic helicity. This negative energy flux is the contribution of the pure magnetic-to-magnetic energy transfer, which vanishes in the non-helical limit. In the context of astrophysical dynamos, our results indicate that a large-scale dynamo can be affected by the magnetic helicity generated at small scales. The kinetic helicity, in particular, is not involved in the process at all. An interesting finding is that an inverse cascade of magnetic energy can be provided by a small-scale source of magnetic helicity fluctuations without a mean injection of magnetic helicity

  10. Ion and impurity transport in turbulent, anisotropic magnetic fields

    Energy Technology Data Exchange (ETDEWEB)

    Negrea, M; Petrisor, I [Department of Physics, Association Euratom-MEdC, Romania, University of Craiova, A.I. Cuza str. 13, Craiova (Romania); Isliker, H; Vogiannou, A; Vlahos, L [Section of Astrophysics, Astronomy and Mechanics, Department of Physics, University of Thessaloniki, Association Euratom-Hellenic Republic, 541 24 Thessaloniki (Greece); Weyssow, B [Physique Statistique-Plasmas, Association Euratom-Etat Belge, Universite Libre de Bruxelles, Campus Plaine, Bd. du Triomphe, 1050 Bruxelles (Belgium)

    2011-08-15

    We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

  11. Transport of solar electrons in the turbulent interplanetary magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Ablaßmayer, J.; Tautz, R. C., E-mail: robert.c.tautz@gmail.com [Zentrum für Astronomie und Astrophysik, Technische Universität Berlin, Hardenbergstraße 36, D-10623 Berlin (Germany); Dresing, N., E-mail: dresing@physik.uni-kiel.de [Institut für Experimentelle und Angewandte Physik, Christian-Albrechts-Universität zu Kiel, Leibnizstraße 11, D-24118 Kiel (Germany)

    2016-01-15

    The turbulent transport of solar energetic electrons in the interplanetary magnetic field is investigated by means of a test-particle Monte-Carlo simulation. The magnetic fields are modeled as a combination of the Parker field and a turbulent component. In combination with the direct calculation of diffusion coefficients via the mean-square displacements, this approach allows one to analyze the effect of the initial ballistic transport phase. In that sense, the model complements the main other approach in which a transport equation is solved. The major advancement is that, by recording the flux of particles arriving at virtual detectors, intensity and anisotropy-time profiles can be obtained. Observational indications for a longitudinal asymmetry can thus be explained by tracing the diffusive spread of the particle distribution. The approach may be of future help for the systematic interpretation of observations for instance by the solar terrestrial relations observatory (STEREO) and advanced composition explorer (ACE) spacecrafts.

  12. Turbulence, transport and confinement: from tokamaks to star magnetism

    International Nuclear Information System (INIS)

    Strugarek, Antoine

    2012-01-01

    This thesis is part of the general study of self-organization in hot and magnetized plasmas. We focus our work on two specific objects: stars and tokamaks. We use first principle numerical simulations to study turbulence, transport and confinement in these plasmas. The first part of this thesis introduces the main characteristics of stellar and tokamak plasmas. The reasons for studying them together are properly detailed. The second part is focused on stellar aspects. We study the interactions between the 3D turbulent motions in the solar convection zone with an internal magnetic field in the tachocline (the transition region between the instable and stable zones in the Sun). The tachocline is a very thin layer (less than five percent of the solar radius) that acts as a transport barrier of angular momentum. We show that such an internal magnetic field is not likely to explain the observed thickness of the tachocline and we give some insights on how to find alternative mechanisms to constrain it. We also explore the effect of the environment of star on its structure. We develop a methodology to study the influence of stellar wind and of the magnetic coupling of a star with its orbiting planets. We use the same methodology to analyse the magnetic interaction between a stellar wind and a planetary magnetosphere that acts as a transport barrier of matter. Then, the third part is dedicated to fusion oriented research. We present a numerical investigation on the experimental mechanisms that lead to the development of transport barriers in the plasma. These barriers are particularly important for the design of high performance fusion devices. The creation of transport barriers is obtained in turbulent first principle simulations for the very first time. The collaboration between the two scientific teams lead to the results presented in the fourth part of this thesis. An original spectral method is developed to analyse the saturation of stellar convective dynamos and of

  13. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  14. GROWTH OF A LOCALIZED SEED MAGNETIC FIELD IN A TURBULENT MEDIUM

    International Nuclear Information System (INIS)

    Cho, Jungyeon; Yoo, Hyunju

    2012-01-01

    Turbulence dynamo deals with the amplification of a seed magnetic field in a turbulent medium and has been studied mostly for uniform or spatially homogeneous seed magnetic fields. However, some astrophysical processes (e.g., jets from active galaxies, galactic winds, or ram-pressure stripping in galaxy clusters) can provide localized seed magnetic fields. In this paper, we numerically study amplification of localized seed magnetic fields in a turbulent medium. Throughout the paper, we assume that the driving scale of turbulence is comparable to the size of the system. Our findings are as follows. First, turbulence can amplify a localized seed magnetic field very efficiently. The growth rate of magnetic energy density is as high as that for a uniform seed magnetic field. This result implies that magnetic field ejected from an astrophysical object can be a viable source of a magnetic field in a cluster. Second, the localized seed magnetic field disperses and fills the whole system very fast. If turbulence in a system (e.g., a galaxy cluster or a filament) is driven at large scales, we expect that it takes a few large-eddy turnover times for the magnetic field to fill the whole system. Third, growth and turbulence diffusion of a localized seed magnetic field are also fast in high magnetic Prandtl number turbulence. Fourth, even in decaying turbulence, a localized seed magnetic field can ultimately fill the whole system. Although the dispersal rate of the magnetic field is not fast in purely decaying turbulence, it can be enhanced by an additional forcing.

  15. Size scaling of turbulent transport in magnetically confined plasmas

    International Nuclear Information System (INIS)

    Lin, Z.; Ethier, S.; Hahm, T.S.; Tang, W.M.

    2002-01-01

    Transport scaling with respect to device size in magnetically confined plasmas is critically examined for electrostatic ion-temperature-gradient turbulence using global gyrokinetic particle simulations. It is found, by varying device size normalized by ion gyroradius while keeping other dimensionless plasma parameters fixed, that fluctuation scale length is microscopic in the presence of zonal flows. The local transport coefficient exhibits a gradual transition from a Bohm-like scaling for device sizes corresponding to present-day experiments to a gyro-Bohm scaling for future larger devices

  16. Size Scaling of Turbulent Transport in Magnetically Confined Plasmas

    International Nuclear Information System (INIS)

    Z. Lin; S. Ethier; T.S. Hahm; W.M. Tang

    2002-04-01

    Transport scaling with respect to device size in magnetically confined plasmas is critically examined for electrostatic ion temperature gradient turbulence using global gyrokinetic particle simulations. It is found, by varying device size normalized by ion gyroradius while keeping other dimensionless plasma parameters fixed, that fluctuation scale length is microscopic in the presence of zonal flows. The local transport coefficient exhibits a gradual transition from a Bohm-like scaling for device sizes corresponding to present-day experiments to a gyro-Bohm scaling for future larger devices

  17. Instabilities, turbulence and transport in a magnetized plasma; Instabilites, turbulence et transport dans un plasma magnetise

    Energy Technology Data Exchange (ETDEWEB)

    Garbet, X

    2001-06-01

    The purpose of this work is to introduce the main processes that occur in a magnetized plasma. During the last 2 decades, the understanding of turbulence has made great progress but analytical formulas and simulations are far to produce reliable predictions. The values of transport coefficients in a tokamak plasma exceed by far those predicted by the theory of collisional transport. This phenomenon is called abnormal transport and might be due to plasma fluctuations. An estimation of turbulent fluxes derived from the levels of fluctuations, is proposed. A flow description of plasma allows the understanding of most micro-instabilities. The ballooning representation deals with instabilities in a toric geometry. 3 factors play an important role to stabilize plasmas: density pinch, magnetic shear and speed shear. The flow model of plasma gives an erroneous value for the stability threshold, this is due to a bad description of the resonant interaction between wave and particle. As for dynamics, flow models can be improved by adding dissipative terms so that the linear response nears the kinetic response. The kinetic approach is more accurate but is complex because of the great number of dimensions involved. (A.C.)

  18. Anisotropic Behaviour of Magnetic Power Spectra in Solar Wind Turbulence.

    Science.gov (United States)

    Banerjee, S.; Saur, J.; Gerick, F.; von Papen, M.

    2017-12-01

    Introduction:High altitude fast solar wind turbulence (SWT) shows different spectral properties as a function of the angle between the flow direction and the scale dependent mean magnetic field (Horbury et al., PRL, 2008). The average magnetic power contained in the near perpendicular direction (80º-90º) was found to be approximately 5 times larger than the average power in the parallel direction (0º- 10º). In addition, the parallel power spectra was found to give a steeper (-2) power law than the perpendicular power spectral density (PSD) which followed a near Kolmogorov slope (-5/3). Similar anisotropic behaviour has also been observed (Chen et al., MNRAS, 2011) for slow solar wind (SSW), but using a different method exploiting multi-spacecraft data of Cluster. Purpose:In the current study, using Ulysses data, we investigate (i) the anisotropic behaviour of near ecliptic slow solar wind using the same methodology (described below) as that of Horbury et al. (2008) and (ii) the dependence of the anisotropic behaviour of SWT as a function of the heliospheric latitude.Method:We apply the wavelet method to calculate the turbulent power spectra of the magnetic field fluctuations parallel and perpendicular to the local mean magnetic field (LMF). According to Horbury et al., LMF for a given scale (or size) is obtained using an envelope of the envelope of that size. Results:(i) SSW intervals always show near -5/3 perpendicular spectra. Unlike the fast solar wind (FSW) intervals, for SSW, we often find intervals where power parallel to the mean field is not observed. For a few intervals with sufficient power in parallel direction, slow wind turbulence also exhibit -2 parallel spectra similar to FSW.(ii) The behaviours of parallel and perpendicular power spectra are found to be independent of the heliospheric latitude. Conclusion:In the current study we do not find significant influence of the heliospheric latitude on the spectral slopes of parallel and perpendicular

  19. Instabilities, turbulence and transport in a magnetized plasma

    International Nuclear Information System (INIS)

    Garbet, X.

    2001-06-01

    The purpose of this work is to introduce the main processes that occur in a magnetized plasma. During the last 2 decades, the understanding of turbulence has made great progress but analytical formulas and simulations are far to produce reliable predictions. The values of transport coefficients in a tokamak plasma exceed by far those predicted by the theory of collisional transport. This phenomenon is called abnormal transport and might be due to plasma fluctuations. An estimation of turbulent fluxes derived from the levels of fluctuations, is proposed. A flow description of plasma allows the understanding of most micro-instabilities. The ballooning representation deals with instabilities in a toric geometry. 3 factors play an important role to stabilize plasmas: density pinch, magnetic shear and speed shear. The flow model of plasma gives an erroneous value for the stability threshold, this is due to a bad description of the resonant interaction between wave and particle. As for dynamics, flow models can be improved by adding dissipative terms so that the linear response nears the kinetic response. The kinetic approach is more accurate but is complex because of the great number of dimensions involved. (A.C.)

  20. Fundamental Statistical Descriptions of Plasma Turbulence in Magnetic Fields

    Energy Technology Data Exchange (ETDEWEB)

    John A. Krommes

    2001-02-16

    A pedagogical review of the historical development and current status (as of early 2000) of systematic statistical theories of plasma turbulence is undertaken. Emphasis is on conceptual foundations and methodology, not practical applications. Particular attention is paid to equations and formalism appropriate to strongly magnetized, fully ionized plasmas. Extensive reference to the literature on neutral-fluid turbulence is made, but the unique properties and problems of plasmas are emphasized throughout. Discussions are given of quasilinear theory, weak-turbulence theory, resonance-broadening theory, and the clump algorithm. Those are developed independently, then shown to be special cases of the direct-interaction approximation (DIA), which provides a central focus for the article. Various methods of renormalized perturbation theory are described, then unified with the aid of the generating-functional formalism of Martin, Siggia, and Rose. A general expression for the renormalized dielectric function is deduced and discussed in detail. Modern approaches such as decimation and PDF methods are described. Derivations of DIA-based Markovian closures are discussed. The eddy-damped quasinormal Markovian closure is shown to be nonrealizable in the presence of waves, and a new realizable Markovian closure is presented. The test-field model and a realizable modification thereof are also summarized. Numerical solutions of various closures for some plasma-physics paradigms are reviewed. The variational approach to bounds on transport is developed. Miscellaneous topics include Onsager symmetries for turbulence, the interpretation of entropy balances for both kinetic and fluid descriptions, self-organized criticality, statistical interactions between disparate scales, and the roles of both mean and random shear. Appendices are provided on Fourier transform conventions, dimensional and scaling analysis, the derivations of nonlinear gyrokinetic and gyrofluid equations

  1. Filament formation in wind-cloud interactions- II. Clouds with turbulent density, velocity, and magnetic fields

    Science.gov (United States)

    Banda-Barragán, W. E.; Federrath, C.; Crocker, R. M.; Bicknell, G. V.

    2018-01-01

    We present a set of numerical experiments designed to systematically investigate how turbulence and magnetic fields influence the morphology, energetics, and dynamics of filaments produced in wind-cloud interactions. We cover 3D, magnetohydrodynamic systems of supersonic winds impacting clouds with turbulent density, velocity, and magnetic fields. We find that lognormal density distributions aid shock propagation through clouds, increasing their velocity dispersion and producing filaments with expanded cross-sections and highly magnetized knots and subfilaments. In self-consistently turbulent scenarios, the ratio of filament to initial cloud magnetic energy densities is ∼1. The effect of Gaussian velocity fields is bound to the turbulence Mach number: Supersonic velocities trigger a rapid cloud expansion; subsonic velocities only have a minor impact. The role of turbulent magnetic fields depends on their tension and is similar to the effect of radiative losses: the stronger the magnetic field or the softer the gas equation of state, the greater the magnetic shielding at wind-filament interfaces and the suppression of Kelvin-Helmholtz instabilities. Overall, we show that including turbulence and magnetic fields is crucial to understanding cold gas entrainment in multiphase winds. While cloud porosity and supersonic turbulence enhance the acceleration of clouds, magnetic shielding protects them from ablation and causes Rayleigh-Taylor-driven subfilamentation. Wind-swept clouds in turbulent models reach distances ∼15-20 times their core radius and acquire bulk speeds ∼0.3-0.4 of the wind speed in one cloud-crushing time, which are three times larger than in non-turbulent models. In all simulations, the ratio of turbulent magnetic to kinetic energy densities asymptotes at ∼0.1-0.4, and convergence of all relevant dynamical properties requires at least 64 cells per cloud radius.

  2. Turbulence

    CERN Document Server

    Bailly, Christophe

    2015-01-01

    This book covers the major problems of turbulence and turbulent processes, including  physical phenomena, their modeling and their simulation. After a general introduction in Chapter 1 illustrating many aspects dealing with turbulent flows, averaged equations and kinetic energy budgets are provided in Chapter 2. The concept of turbulent viscosity as a closure of the Reynolds stress is also introduced. Wall-bounded flows are presented in Chapter 3, and aspects specific to boundary layers and channel or pipe flows are also pointed out. Free shear flows, namely free jets and wakes, are considered in Chapter 4. Chapter 5 deals with vortex dynamics. Homogeneous turbulence, isotropy, and dynamics of isotropic turbulence are presented in Chapters 6 and 7. Turbulence is then described both in the physical space and in the wave number space. Time dependent numerical simulations are presented in Chapter 8, where an introduction to large eddy simulation is offered. The last three chapters of the book summarize remarka...

  3. MMS Observations of Ion-Scale Magnetic Island in the Magnetosheath Turbulent Plasma

    Science.gov (United States)

    Huang, S. Y.; Sahraoui, F.; Retino, A.; Contel, O. Le; Yuan, Z. G.; Chasapis, A.; Aunai, N.; Breuillard, H.; Deng, X. H.; Zhou, M.; hide

    2016-01-01

    In this letter, first observations of ion-scale magnetic island from the Magnetospheric Multiscale mission in the magnetosheath turbulent plasma are presented. The magnetic island is characterized by bipolar variation of magnetic fields with magnetic field compression, strong core field, density depletion, and strong currents dominated by the parallel component to the local magnetic field. The estimated size of magnetic island is about 8 di, where di is the ion inertial length. Distinct particle behaviors and wave activities inside and at the edges of the magnetic island are observed: parallel electron beam accompanied with electrostatic solitary waves and strong electromagnetic lower hybrid drift waves inside the magnetic island and bidirectional electron beams, whistler waves, weak electromagnetic lower hybrid drift waves, and strong broadband electrostatic noise at the edges of the magnetic island. Our observations demonstrate that highly dynamical, strong wave activities and electron-scale physics occur within ion-scale magnetic islands in the magnetosheath turbulent plasma..

  4. Convection Enhances Magnetic Turbulence in AM CVn Accretion Disks

    Science.gov (United States)

    Coleman, Matthew S. B.; Blaes, Omer; Hirose, Shigenobu; Hauschildt, Peter H.

    2018-04-01

    We present the results of local, vertically stratified, radiation magnetohydrodynamic shearing-box simulations of magnetorotational instability (MRI) turbulence for a (hydrogen poor) composition applicable to accretion disks in AM CVn type systems. Many of these accreting white dwarf systems are helium analogs of dwarf novae (DNe). We utilize frequency-integrated opacity and equation-of-state tables appropriate for this regime to accurately portray the relevant thermodynamics. We find bistability of thermal equilibria in the effective-temperature, surface-mass-density plane typically associated with disk instabilities. Along this equilibrium curve (i.e., the S-curve), we find that the stress to thermal pressure ratio α varied with peak values of ∼0.15 near the tip of the upper branch. Similar to DNe, we found enhancement of α near the tip of the upper branch caused by convection; this increase in α occurred despite our choice of zero net vertical magnetic flux. Two notable differences we find between DN and AM CVn accretion disk simulations are that AM CVn disks are capable of exhibiting persistent convection in outburst, and ideal MHD is valid throughout quiescence for AM CVns. In contrast, DNe simulations only show intermittent convection, and nonideal MHD effects are likely important in quiescence. By combining our previous work with these new results, we also find that convective enhancement of the MRI is anticorrelated with mean molecular weight.

  5. Steady State Turbulent Transport in Magnetic Fusion Plasmas

    International Nuclear Information System (INIS)

    Lee, W.W.; Ethier, S.; Kolesnikov, R.; Wang, W.X.; Tang, W.M.

    2007-01-01

    For more than a decade, the study of microturbulence, driven by ion temperature gradient (ITG) drift instabilities in tokamak devices, has been an active area of research in magnetic fusion science for both experimentalists and theorists alike. One of the important impetus for this avenue of research was the discovery of the radial streamers associated the ITG modes in the early nineties using a Particle-In-Cell (PIC) code. Since then, ITG simulations based on the codes with increasing realism have become possible with the dramatic increase in computing power. The notable examples were the demonstration of the importance of nonlinearly generated zonal flows in regulating ion thermal transport and the transition from Bohm to GyroBoham scaling with increased device size. In this paper, we will describe another interesting nonlinear physical process associated with the parallel acceleration of the ions, that is found to play an important role for the steady state turbulent transport. Its discovery is again through the use of the modern massively parallel supercomputers

  6. First measurement of the magnetic turbulence induced Reynolds stress in a tokamak

    International Nuclear Information System (INIS)

    Xu Guosheng; Wan Baonian; Song Mei

    2003-01-01

    Reynolds stress component due to magnetic turbulence was first measured in the plasma edge region of the HT-7 superconducting tokamak using an insertable magnetic probe. A radial gradient of magnetic Reynolds stress was observed to be close to the velocity shear layer location; however, in this experiment its contribution to driving the poloidal flows is small compared to the electrostatic component. The electron heat transport driven by magnetic turbulence is quite small and cannot account for the total energy transport at the plasma edge

  7. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  8. The Uncertainty of Local Background Magnetic Field Orientation in Anisotropic Plasma Turbulence

    Energy Technology Data Exchange (ETDEWEB)

    Gerick, F.; Saur, J.; Papen, M. von, E-mail: felix.gerick@uni-koeln.de [Institute of Geophysics and Meteorology, University of Cologne, Cologne (Germany)

    2017-07-01

    In order to resolve and characterize anisotropy in turbulent plasma flows, a proper estimation of the background magnetic field is crucially important. Various approaches to calculating the background magnetic field, ranging from local to globally averaged fields, are commonly used in the analysis of turbulent data. We investigate how the uncertainty in the orientation of a scale-dependent background magnetic field influences the ability to resolve anisotropy. Therefore, we introduce a quantitative measure, the angle uncertainty, that characterizes the uncertainty of the orientation of the background magnetic field that turbulent structures are exposed to. The angle uncertainty can be used as a condition to estimate the ability to resolve anisotropy with certain accuracy. We apply our description to resolve the spectral anisotropy in fast solar wind data. We show that, if the angle uncertainty grows too large, the power of the turbulent fluctuations is attributed to false local magnetic field angles, which may lead to an incorrect estimation of the spectral indices. In our results, an apparent robustness of the spectral anisotropy to false local magnetic field angles is observed, which can be explained by a stronger increase of power for lower frequencies when the scale of the local magnetic field is increased. The frequency-dependent angle uncertainty is a measure that can be applied to any turbulent system.

  9. The density variance-Mach number relation in supersonic turbulence - I. Isothermal, magnetized gas

    Science.gov (United States)

    Molina, F. Z.; Glover, S. C. O.; Federrath, C.; Klessen, R. S.

    2012-07-01

    It is widely accepted that supersonic, magnetized turbulence plays a fundamental role for star formation in molecular clouds. It produces the initial dense gas seeds out of which new stars can form. However, the exact relation between gas compression, turbulent Mach number and magnetic field strength is still poorly understood. Here, we introduce and test an analytical prediction for the relation between the density variance and the rms Mach number ? in supersonic, isothermal, magnetized turbulent flows. We approximate the density and velocity structure of the interstellar medium as a superposition of shock waves. We obtain the density contrast considering the momentum equation for a single magnetized shock and extrapolate this result to the entire cloud. Depending on the field geometry, we then make three different assumptions based on observational and theoretical constraints: B independent of ρ, B∝ρ1/2 and B∝ρ. We test the analytically derived density variance-Mach number relation with numerical simulations, and find that for B∝ρ1/2, the variance in the logarithmic density contrast, ?, fits very well to simulated data with turbulent forcing parameter b= 0.4, when the gas is super-Alfvénic. However, this result breaks down when the turbulence becomes trans-Alfvénic or sub-Alfvénic, because in this regime the turbulence becomes highly anisotropic. Our density variance-Mach number relations simplify to the purely hydrodynamic relation as the ratio of thermal to magnetic pressure β0→∞.

  10. Sub-grid-scale description of turbulent magnetic reconnection in magnetohydrodynamics

    Energy Technology Data Exchange (ETDEWEB)

    Widmer, F., E-mail: widmer@mps.mpg.de [Max-Planck-Institut für Sonnensystemforschung, Justus-von-Liebig-Weg 3, 37077 Göttingen (Germany); Institut für Astrophysik, Georg-August-Universität, Friedrich-Hund-Platz 1, 37077 Göttingen (Germany); Büchner, J. [Max-Planck-Institut für Sonnensystemforschung, Justus-von-Liebig-Weg 3, 37077 Göttingen (Germany); Yokoi, N. [Institute of Industrial Science, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8505 (Japan)

    2016-04-15

    Magnetic reconnection requires, at least locally, a non-ideal plasma response. In collisionless space and astrophysical plasmas, turbulence could transport energy from large to small scales where binary particle collisions are rare. We have investigated the influence of small scale magnetohydrodynamics (MHD) turbulence on the reconnection rate in the framework of a compressible MHD approach including sub-grid-scale (SGS) turbulence. For this sake, we considered Harris-type and force-free current sheets with finite guide magnetic fields directed out of the reconnection plane. The goal is to find out whether unresolved by conventional simulations MHD turbulence can enhance the reconnection process in high-Reynolds-number astrophysical plasmas. Together with the MHD equations, we solve evolution equations for the SGS energy and cross-helicity due to turbulence according to a Reynolds-averaged turbulence model. The SGS turbulence is self-generated and -sustained through the inhomogeneities of the mean fields. By this way, the feedback of the unresolved turbulence into the MHD reconnection process is taken into account. It is shown that the turbulence controls the regimes of reconnection by its characteristic timescale τ{sub t}. The dependence on resistivity was investigated for large-Reynolds-number plasmas for Harris-type as well as force-free current sheets with guide field. We found that magnetic reconnection depends on the relation between the molecular and apparent effective turbulent resistivity. We found that the turbulence timescale τ{sub t} decides whether fast reconnection takes place or whether the stored energy is just diffused away to small scale turbulence. If the amount of energy transferred from large to small scales is enhanced, fast reconnection can take place. Energy spectra allowed us to characterize the different regimes of reconnection. It was found that reconnection is even faster for larger Reynolds numbers controlled by the molecular

  11. Turbulent transport of impurities in a magnetized plasma; Transport turbulent d'impuretes dans un plasma magnetise

    Energy Technology Data Exchange (ETDEWEB)

    Dubuit, N

    2006-10-15

    This work deals with the transport of impurities in magnetically confined thermonuclear plasmas. The accumulation of impurities in the core of the plasma would imply dramatic losses of energy that may lead to the extinction of the plasma. On the opposite, the injection of impurities in the plasma edge is considered as an efficient means to extract heat without damaging the first wall. The balance between these 2 contradictory constraints requires an accurate knowledge of the impurity transport inside the plasma. The effect of turbulence, the main transport mechanism for impurities is therefore a major issue. In this work, the complete formula of a turbulent flow of impurities for a given fluctuation spectrum has been inferred. The origin and features of the main accumulation processes have been identified. The main effect comes from the compressibility of the electrical shift speed in a plane perpendicular to the magnetic field. This compressibility appears to be linked to the curvature of the magnetic field. A less important effect is a thermal-diffusion process that is inversely proportional to the number of charges and then disappears for most type of impurities except the lightest. This effect implies an impurity flux proportional to the temperature gradient and its direction can change according to the average speed of fluctuations. A new version of the turbulence code TRB has been developed. This new version allows the constraints of the turbulence not by the gradients but by the flux which is more realistic. The importance of the processes described above has been confirmed by a comparison between calculation and experimental data from Tore-supra and the Jet tokamak. The prevailing role of the curvature of the magnetic field in the transport impurity is highlighted. (A.C.)

  12. Numerical design of a magnetized turbulence experiment at the National Ignition Facility

    Science.gov (United States)

    Feister, Scott; Tzeferacos, Petros; Meinecke, Jena; Bott, Archie; Caprioli, Damiano; Laune, Jt; Bell, Tony; Casner, Alexis; Koenig, Michel; Li, Chikang; Miniati, Francesco; Petrasso, Richard; Remington, Bruce; Reville, Brian; Ross, J. Steven; Ryu, Dongsu; Ryutov, Dmitri; Sio, Hong; Turnbull, David; Zylstra, Alex; Schekochihin, Alexander; Froula, Dustin; Park, Hye-Sook; Lamb, Don; Gregori, Gianluca

    2017-10-01

    The origin and amplification of magnetic fields remains an active astrophysical research topic. We discuss design (using three-dimensional FLASH simulations) of a magnetized turbulence experiment at the National Ignition Facility (NIF). NIF lasers drive together two counter-propagating plasma flows to form a hot, turbulent plasma at the center. In the simulations, plasma temperatures are high enough to reach super-critical values of magnetic Reynolds number (Rm). Biermann battery seed magnetic fields (generated during laser-target interaction) are advected into the turbulent region and amplified by fluctuation dynamo in the above-unity Prandtl number regime. Plasma diagnostics are modeled with FLASH for planning and direct comparison with NIF experimental data. This work was supported in part at the University of Chicago by the DOE NNSA, the DOE Office of Science, and the NSF. The numerical simulations were conducted at ALCF's Mira under the auspices of the DOE Office of Science ALCC program.

  13. Three-dimensional density and compressible magnetic structure in solar wind turbulence

    Science.gov (United States)

    Roberts, Owen W.; Narita, Yasuhito; Escoubet, C.-Philippe

    2018-03-01

    The three-dimensional structure of both compressible and incompressible components of turbulence is investigated at proton characteristic scales in the solar wind. Measurements of the three-dimensional structure are typically difficult, since the majority of measurements are performed by a single spacecraft. However, the Cluster mission consisting of four spacecraft in a tetrahedral formation allows for a fully three-dimensional investigation of turbulence. Incompressible turbulence is investigated by using the three vector components of the magnetic field. Meanwhile compressible turbulence is investigated by considering the magnitude of the magnetic field as a proxy for the compressible fluctuations and electron density data deduced from spacecraft potential. Application of the multi-point signal resonator technique to intervals of fast and slow wind shows that both compressible and incompressible turbulence are anisotropic with respect to the mean magnetic field direction P⟂ ≫ P∥ and are sensitive to the value of the plasma beta (β; ratio of thermal to magnetic pressure) and the wind type. Moreover, the incompressible fluctuations of the fast and slow solar wind are revealed to be different with enhancements along the background magnetic field direction present in the fast wind intervals. The differences in the fast and slow wind and the implications for the presence of different wave modes in the plasma are discussed.

  14. GENESIS OF INTERPLANETARY INTERMITTENT TURBULENCE: A CASE STUDY OF ROPE–ROPE MAGNETIC RECONNECTION

    Energy Technology Data Exchange (ETDEWEB)

    Chian, Abraham C.-L.; Loew, Murray H. [Department of Biomedical Engineering, George Washington University, Washington, DC 20052 (United States); Feng, Heng Q. [Institute of Space Physics, Luoyang Normal University, Luoyang (China); Hu, Qiang [Department of Space Science and CSPAR, University of Alabama in Huntsville, Huntsville, AL 35805 (United States); Miranda, Rodrigo A. [UnB-Gama Campus, and Plasma Physics Laboratory, Institute of Physics, University of Brasília (UnB), Brasília DF 70910-900 (Brazil); Muñoz, Pablo R. [Department of Physics and Astronomy, University of La Serena, Av. Juan Cisternas 1200, La Serena (Chile); Sibeck, David G. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Wu, De J., E-mail: abraham.chian@gmail.com [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

    2016-12-01

    In a recent paper, the relation between current sheet, magnetic reconnection, and turbulence at the leading edge of an interplanetary coronal mass ejection was studied. We report here the observation of magnetic reconnection at the interface region of two interplanetary magnetic flux ropes. The front and rear boundary layers of three interplanetary magnetic flux ropes are identified, and the structures of magnetic flux ropes are reconstructed by the Grad–Shafranov method. A quantitative analysis of the reconnection condition and the degree of intermittency reveals that rope–rope magnetic reconnection is the most likely site for genesis of interplanetary intermittency turbulence in this event. The dynamic pressure pulse resulting from this reconnection triggers the onset of a geomagnetic storm.

  15. Recent Progress on the magnetic turbulence experiment at the Bryn Mawr Plasma Laboratory

    Science.gov (United States)

    Schaffner, D. A.; Cartagena-Sanchez, C. A.; Johnson, H. K.; Fahim, L. E.; Fiedler-Kawaguchi, C.; Douglas-Mann, E.

    2017-10-01

    Recent progress is reported on the construction, implementation and testing of the magnetic turbulence experiment at the Bryn Mawr Plasma Laboratory (BMPL). The experiment at the BMPL consists of an ( 300 μs) long coaxial plasma gun discharge that injects magnetic helicity into a flux-conserving chamber in a process akin to sustained slow-formation of spheromaks. A 24cm by 2m cylindrical chamber has been constructed with a high density axial port array to enable detailed simultaneous spatial measurements of magnetic and plasma fluctuations. Careful positioning of the magnetic structure produced by the three separately pulsed coils (one internal, two external) are preformed to optimize for continuous injection of turbulent magnetized plasma. High frequency calibration of magnetic probes is also underway using a power amplifier.

  16. COSMIC-RAY SMALL-SCALE ANISOTROPIES AND LOCAL TURBULENT MAGNETIC FIELDS

    Energy Technology Data Exchange (ETDEWEB)

    López-Barquero, V. [Department of Physics, University of Wisconsin, Madison, WI 53706 (United States); Farber, R. [Department of Physics and Astronomy, Wheaton College, Norton, MA 02766 (United States); Xu, S. [Department of Astronomy, School of Physics, Peking University, Beijing 100871 (China); Desiati, P. [Wisconsin IceCube Particle Astrophysics Center (WIPAC), University of Wisconsin, Madison, WI 53703 (United States); Lazarian, A. [Department of Astronomy, University of Wisconsin, Madison, WI 53706 (United States)

    2016-10-10

    Cosmic-ray anisotropy has been observed in a wide energy range and at different angular scales by a variety of experiments over the past decade. However, no comprehensive or satisfactory explanation has been put forth to date. The arrival distribution of cosmic rays at Earth is the convolution of the distribution of their sources and of the effects of geometry and properties of the magnetic field through which particles propagate. It is generally believed that the anisotropy topology at the largest angular scale is adiabatically shaped by diffusion in the structured interstellar magnetic field. On the contrary, the medium- and small-scale angular structure could be an effect of nondiffusive propagation of cosmic rays in perturbed magnetic fields. In particular, a possible explanation for the observed small-scale anisotropy observed at the TeV energy scale may be the effect of particle propagation in turbulent magnetized plasmas. We perform numerical integration of test particle trajectories in low- β compressible magnetohydrodynamic turbulence to study how the cosmic rays’ arrival direction distribution is perturbed when they stream along the local turbulent magnetic field. We utilize Liouville’s theorem for obtaining the anisotropy at Earth and provide the theoretical framework for the application of the theorem in the specific case of cosmic-ray arrival distribution. In this work, we discuss the effects on the anisotropy arising from propagation in this inhomogeneous and turbulent interstellar magnetic field.

  17. The Efficiency of Magnetic Field Amplification at Shocks by Turbulence

    Science.gov (United States)

    Ji, Suoqing; Oh, S. Peng; Ruszkowsi, M.; Markevitch, M.

    2016-01-01

    Turbulent dynamo field amplification has often been invoked to explain the strong field strengths in thin rims in supernova shocks (approx.100 micrograms) and in radio relics in galaxy clusters (approx. micrograms). We present high-resolution magnetohydrodynamic simulations of the interaction between pre-shock turbulence, clumping and shocks, to quantify the conditions under which turbulent dynamo amplification can be significant. We demonstrate numerically converged field amplification which scales with Alfven Mach number, B/B0 varies as MA, up to MA approx.150.This implies that the post-shock field strength is relatively independent of the seed field. Amplification is dominated by compression at low MA, and stretching (turbulent amplification) at high MA. For high MA, the B-field grows exponentially and saturates at equipartition with turbulence, while the vorticity jumps sharply at the shock and subsequently decays; the resulting field is orientated predominately along the shock normal (an effect only apparent in 3D and not 2D). This agrees with the radial field bias seen in supernova remnants. By contrast, for low MA, field amplification is mostly compressional, relatively modest, and results in a predominantly perpendicular field. The latter is consistent with the polarization seen in radio relics. Our results are relatively robust to the assumed level of gas clumping. Our results imply that the turbulent dynamo may be important for supernovae, but is only consistent with the field strength, and not geometry, for cluster radio relics. For the latter, this implies strong pre-existing B-fields in the ambient cluster outskirts.

  18. Intermittency of magnetic field turbulence: Astrophysical applications of in-situ observations

    Science.gov (United States)

    Zelenyi, Lev M.; Bykov, Andrei M.; Uvarov, Yury A.; Artemyev, Anton V.

    2015-08-01

    We briefly review some aspects of magnetic turbulence intermittency observed in space plasmas. Deviation of statistical characteristics of a system (e.g. its high statistical momenta) from the Gaussian can manifest itself as domination of rare large intensity peaks often associated with the intermittency in the system's dynamics. Thirty years ago, Zeldovich stressed the importance of the non-Gaussian appearance of the sharp values of vector and scalar physical parameters in random media as a factor of magnetic field amplification in cosmic structures. Magnetic turbulence is governing the behavior of collisionless plasmas in space and especially the physics of shocks and magnetic reconnections. Clear evidence of intermittent magnetic turbulence was found in recent in-situ spacecraft measurements of magnetic fields in the near-Earth and interplanetary plasma environments. We discuss the potentially promising approaches of incorporating the knowledge gained from spacecraft in-situ measurements into modern models describing plasma dynamics and radiation in various astrophysical systems. As an example, we discuss supernova remnants (SNRs) which are known to be the sources of energy, momentum, chemical elements, and high-energy cosmic rays (CRs) in galaxies. Supernova shocks accelerate charged particles to very high energies and may strongly amplify turbulent magnetic fields via instabilities driven by CRs. Relativistic electrons accelerated in SNRs radiate polarized synchrotron emission in a broad range of frequencies spanning from the radio to gamma-rays. We discuss the effects of intermittency of magnetic turbulence on the images of polarized synchrotron X-ray emission of young SNRs and emission spectra of pulsar wind nebula.

  19. Turbulence simulations of blob formation and radial propagation in toroidally magnetized plasmas

    DEFF Research Database (Denmark)

    Garcia, O.E.; Naulin, V.; Nielsen, A.H.

    2006-01-01

    of particles and heat, which is coupled to a scrape-off layer with linear damping terms for all dependent variables corresponding to transport along open magnetic field lines. The formation of blob structures is related to profile variations caused by bursting in the global turbulence level, which is due......Two- dimensional numerical fluid turbulence simulations demonstrating the formation and radial propagation of blob structures in toroidally magnetized plasmas are presented and analysed in detail. A salient feature of the model is a linearly unstable edge plasma region with localized sources...

  20. The role of magnetic turbulence in astrophysical jet launching and cosmic ray transport

    International Nuclear Information System (INIS)

    Casse, Fabien

    2001-01-01

    The first part of my thesis shows how Keplerian discs can launch MHD jets, under some conditions. The key points of this first part are the adding of viscosity inside the disc and a relevant energy equation, In particular, I have shown both analytically and numerically that the angular momentum transport is constrained by the MHD turbulence properties. I have also shown that one must take into account a relevant energy equation in order to have a more realistic description of jets observed in the Universe. Moreover, some energy turbulent transport mechanisms cannot be described in a simple MHD approach. In order to better understand the interaction between a turbulent magnetic field and charged particles, I have undertaken a study dealing with spatial and angular diffusion of hadrons with a chaotic magnetic field generated by a magnetic turbulence. In this study, it clearly appears that the spatial diffusion coefficient along the mean magnetic field extrapolate the results of quasi-linear theory for weak turbulence. At the opposite, in the inertial range, the spatial diffusion coefficient across the mean magnetic field is inconsistent with such a theory. Indeed the spatial diffusion coefficient across the mean magnetic field has a behaviour that can be interpreted as a chaotic diffusion regime as the one predicted by Rechester and Rosenbluth. Moreover, outside this range, the behaviours of all spatial diffusion coefficients are different of those expected in the framework of quasi-linear theory. At last, it has been found that a Bohm diffusion regime never occurs whatever the magnetic chaos. (author) [fr

  1. Density effects on tokamak edge turbulence and transport with magnetic X-points

    International Nuclear Information System (INIS)

    Xu, X.Q.; Cohen, R.H.; Nevins, W.M.; Rognlien, T.D.; Ryutov, D.D.; Umansky, M.V.; Pearlstein, L.D.; Bulmer, R.H.; Russell, D.A.; Myra, J.R.; D'Ippolito, D.A.; Greenwald, M.; Snyder, P.B.; Mahdavi, M.A.

    2005-01-01

    Results are presented from the 3D electromagnetic turbulence code BOUT, the 2D transport code UEDGE, and theoretical analysis of boundary turbulence and transport in a real divertor-plasma geometry and its relationship to the density limit. Key results include: (1) a transition of the boundary turbulence from resistive X-point to resistive-ballooning as a critical plasma density is exceeded; (2) formation of an X-point MARFE in 2D UEDGE transport simulations for increasing outboard radial transport as found by BOUT for increasing density; (3) identification of convective transport by localized plasma 'blobs' in the SOL at high density during neutral fueling, and decorrelation of turbulence between the midplane and the divertor leg due to strong X-point magnetic shear; (4) a new divertor-leg instability driven at high plasma beta by a radial tilt of the divertor plate. (author)

  2. Cosmic-Ray Propagation in Turbulent Spiral Magnetic Fields Associated with Young Stellar Objects

    Science.gov (United States)

    Fatuzzo, Marco; Adams, Fred C.

    2018-04-01

    External cosmic rays impinging upon circumstellar disks associated with young stellar objects provide an important source of ionization, and, as such, play an important role in disk evolution and planet formation. However, these incoming cosmic rays are affected by a variety of physical processes internal to stellar/disk systems, including modulation by turbulent magnetic fields. Globally, these fields naturally provide both a funneling effect, where cosmic rays from larger volumes are focused into the disk region, and a magnetic mirroring effect, where cosmic rays are repelled due to the increasing field strength. This paper considers cosmic-ray propagation in the presence of a turbulent spiral magnetic field, analogous to that produced by the solar wind. The interaction of this wind with the interstellar medium defines a transition radius, analogous to the heliopause, which provides the outer boundary to this problem. We construct a new coordinate system where one coordinate follows the spiral magnetic field lines and consider magnetic perturbations to the field in the perpendicular directions. The presence of magnetic turbulence replaces the mirroring points with a distribution of values and moves the mean location outward. Our results thus help quantify the degree to which cosmic-ray fluxes are reduced in circumstellar disks by the presence of magnetic field structures that are shaped by stellar winds. The new coordinate system constructed herein should also be useful in other astronomical applications.

  3. Exploring the magnetic, turbulent Milky Way through radio waves

    NARCIS (Netherlands)

    Iacobelli, Marco

    2014-01-01

    Cosmic magnetism is a phenomenon observed across a huge range of spatial scales. Magnetic fields exists on planets, stars and nebulae up to galaxies and clusters of galaxies. As a rule of thumb, the larger the typical size of the object, the lower the magnitude of its magnetic field. Regardless

  4. THE ROLE OF TURBULENT MAGNETIC RECONNECTION IN THE FORMATION OF ROTATIONALLY SUPPORTED PROTOSTELLAR DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Santos-Lima, R.; De Gouveia Dal Pino, E. M. [Instituto de Astronomia, Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo, R. do Matao, 1226, Sao Paulo, SP 05508-090 (Brazil); Lazarian, A. [Department of Astronomy, University of Wisconsin, Madison, WI 53706 (United States)

    2012-03-01

    The formation of protostellar disks out of molecular cloud cores is still not fully understood. Under ideal MHD conditions, the removal of angular momentum from the disk progenitor by the typically embedded magnetic field may prevent the formation of a rotationally supported disk during the main protostellar accretion phase of low-mass stars. This has been known as the magnetic braking problem and the most investigated mechanism to alleviate this problem and help remove the excess of magnetic flux during the star formation process, the so-called ambipolar diffusion (AD), has been shown to be not sufficient to weaken the magnetic braking at least at this stage of the disk formation. In this work, motivated by recent progress in the understanding of magnetic reconnection in turbulent environments, we appeal to the diffusion of magnetic field mediated by magnetic reconnection as an alternative mechanism for removing magnetic flux. We investigate numerically this mechanism during the later phases of the protostellar disk formation and show its high efficiency. By means of fully three-dimensional MHD simulations, we show that the diffusivity arising from turbulent magnetic reconnection is able to transport magnetic flux to the outskirts of the disk progenitor at timescales compatible with the collapse, allowing the formation of a rotationally supported disk around the protostar of dimensions {approx}100 AU, with a nearly Keplerian profile in the early accretion phase. Since MHD turbulence is expected to be present in protostellar disks, this is a natural mechanism for removing magnetic flux excess and allowing the formation of these disks. This mechanism dismisses the necessity of postulating a hypothetical increase of the ohmic resistivity as discussed in the literature. Together with our earlier work which showed that magnetic flux removal from molecular cloud cores is very efficient, this work calls for reconsidering the relative role of AD in the processes of star

  5. Optimization of magnetic amplification by flow constraints in turbulent liquid sodium

    International Nuclear Information System (INIS)

    Nornberg, M. D.; Taylor, N. Z.; Forest, C. B.; Rahbarnia, K.; Kaplan, E.

    2014-01-01

    Direct measurements of the vector turbulent emf in a driven two-vortex flow of liquid sodium were performed in the Madison Dynamo Experiment [K. Rahbarnia et al., Astrophys. J. 759, 80 (2012)]. The measured turbulent emf is anti-parallel with the mean current and is almost entirely described by an enhanced resistivity, which increases the threshold for a kinematic dynamo. We have demonstrated that this enhanced resistivity can be mitigated by eliminating the largest-scale eddies through the introduction of baffles. By tailoring the flow to reduce large-scale components and control the helical pitch, we have reduced the power required to drive the impellers, doubled the magnetic flux generated by differential rotation, and increased the decay time of externally applied magnetic fields. Despite these improvements, the flows remain sub-critical to the dynamo instability due to the reemergence of turbulent fluctuations at high flow speeds

  6. Characterization of local turbulence in magnetic confinement devices

    International Nuclear Information System (INIS)

    Rajkovic, Milan; Skoric, Milos; Solna, Knut; Antar, Ghassan

    2007-07-01

    A multifractal analysis based on evaluation and interpretation of Large Deviation spectra is applied to plasma edge turbulence data from different devices (MAST and Tore Supra). It is demonstrated that in spite of some universal features there are unique characteristics for each device as well as for different confinement regimes. In the second part of the exposition the issue of estimating the variable power law behavior of spectral densities is addressed. The analysis of this issue is performed using fractional Brownian motion (fBm) as the underlying stochastic model whose parameters are estimated locally in time by wavelet scale spectra. In such a manner information about the inertial range as well as variability of the fBm parameters is obtained giving more information important for understanding edge turbulence and intermittency. (author)

  7. FAST MAGNETIC FIELD AMPLIFICATION IN THE EARLY UNIVERSE: GROWTH OF COLLISIONLESS PLASMA INSTABILITIES IN TURBULENT MEDIA

    Energy Technology Data Exchange (ETDEWEB)

    Falceta-Gonçalves, D. [SUPA, School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews, Fife KY16 9SS (United Kingdom); Kowal, G. [Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, Rua Arlindo Bettio, 1000, São Paulo, SP 03828-000 (Brazil)

    2015-07-20

    In this work we report on a numerical study of the cosmic magnetic field amplification due to collisionless plasma instabilities. The collisionless magnetohydrodynamic equations derived account for the pressure anisotropy that leads, in specific conditions, to the firehose and mirror instabilities. We study the time evolution of seed fields in turbulence under the influence of such instabilities. An approximate analytical time evolution of the magnetic field is provided. The numerical simulations and the analytical predictions are compared. We found that (i) amplification of the magnetic field was efficient in firehose-unstable turbulent regimes, but not in the mirror-unstable models; (ii) the growth rate of the magnetic energy density is much faster than the turbulent dynamo; and (iii) the efficient amplification occurs at small scales. The analytical prediction for the correlation between the growth timescales and pressure anisotropy is confirmed by the numerical simulations. These results reinforce the idea that pressure anisotropies—driven naturally in a turbulent collisionless medium, e.g., the intergalactic medium, could efficiently amplify the magnetic field in the early universe (post-recombination era), previous to the collapse of the first large-scale gravitational structures. This mechanism, though fast for the small-scale fields (∼kpc scales), is unable to provide relatively strong magnetic fields at large scales. Other mechanisms that were not accounted for here (e.g., collisional turbulence once instabilities are quenched, velocity shear, or gravitationally induced inflows of gas into galaxies and clusters) could operate afterward to build up large-scale coherent field structures in the long time evolution.

  8. Magnetic suppression of turbulence and the star formation activity of molecular clouds

    Science.gov (United States)

    Zamora-Avilés, Manuel; Vázquez-Semadeni, Enrique; Körtgen, Bastian; Banerjee, Robi; Hartmann, Lee

    2018-03-01

    We present magnetohydrodynamic simulations aimed at studying the effect of the magnetic suppression of turbulence (generated through various instabilities during the formation of molecular clouds by converging) on the subsequent star formation (SF) activity. We study four magnetically supercritical models with magnetic field strengths B = 0, 1, 2, and 3 μG (corresponding to mass-to-flux ratios of ∞, 4.76, 2.38, and 1.59 times the critical value), with the magnetic field, initially being aligned with the flows. We find that, for increasing magnetic field strength, the clouds formed tend to be more massive, denser, less turbulent, and with higher SF activity. This causes the onset of SF activity in the non-magnetic or more weakly magnetized cases to be delayed by a few Myr in comparison to the more strongly magnetized cases. We attribute this behaviour to the suppression of the non-linear thin shell instability (NTSI) by the magnetic field, previously found by Heitsch and coworkers. This result is contrary to the standard notion that the magnetic field provides support to the clouds, thus reducing their star formation rate. However, our result is a completely non-linear one, and could not be foreseen from simple linear considerations.

  9. The Origin of Compressible Magnetic Turbulence in the Very Local Interstellar Medium

    Science.gov (United States)

    Zank, G. P.; Du, S.; Hunana, P.

    2017-12-01

    Voyager 1 observed compressible magnetic turbulence in the Very Local Interstellar Medium (VLISM). We show that inner heliosheath (IHS) fast- and slow-mode waves incident on the heliopause (HP) generate VLISM fast-mode waves only that propagate into the VLISM. We suggest that this is the origin of compressible turbulence in the VLISM. We show that fast- and slow-mode waves transmitted across a tangential discontinuity such as the HP, are strongly refracted on crossing the HP, and subsequently propagate at highly oblique angles to the VLISM magnetic field. Thus, fast-mode waves in the VLISM contribute primarily to the compressible and not the transverse components of the VLISM fluctuating magnetic field variance. If the fast- and slow-mode waves in the IHS exhibit a Kolmogorov-like power spectral density, as appears to be observed by Voyager 1, then the corresponding transmitted spectral density in the VLISM forms an amplified Kolmogorov power law with -5/3 index. Consequently, the HP "radiates" fast-mode fluctuations into the VLISM, and the heliosphere therefore mediates the character of turbulence in the VLISM. In particular, we predict the form of the VLISM magnetic turbulence power spectral density to be a superposition of the background pristine interstellar turbulence spectrum and the fast-mode spectrum generated by the interaction of fast- and slow-mode IHS waves with the HP, i.e., a power law with an enhanced feature or "bump" corresponding to the contribution by fast-mode turbulence radiated by the HP.

  10. First result of magnetic turbulence measurements using an array of Hall detectors in the TEXTOR tokamak

    Czech Academy of Sciences Publication Activity Database

    Ďuran, Ivan; Stöckel, Jan; Mank, G.; Finken, K. H.; Fuchs, G.; Van Oost, G.

    2002-01-01

    Roč. 52, supplement D (2002), s. 38-44 ISSN 0011-4626. [Symposium on Plasma Physics and Technology/20th./. Prague, 10.06.2002-13.06.2002] Institutional research plan: CEZ:AV0Z2043910 Keywords : Hall detectors, magnetic turbulence, TEXTOR tokamak Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 0.311, year: 2002

  11. Magnetic Reconnection as a Driver for a Sub-ion-scale Cascade in Plasma Turbulence

    Czech Academy of Sciences Publication Activity Database

    Franci, L.; Cerri, S.S.; Califano, F.; Landi, S.; Papini, E.; Verdini, A.; Matteini, L.; Jenko, F.; Hellinger, Petr

    2017-01-01

    Roč. 850, č. 1 (2017), L16/1-L16/6 ISSN 2041-8205 R&D Projects: GA ČR GA15-10057S Institutional support: RVO:67985815 Keywords : magnetic reconnection * solar wind * turbulence Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics OBOR OECD: Astronomy (including astrophysics,space science) Impact factor: 5.522, year: 2016

  12. Turbulent amplification of magnetic fields in laboratory laser-produced shock waves

    International Nuclear Information System (INIS)

    Meinecke, J.; Doyle, H.W.; Bell, A.R.; Schekochihin, A.A.; Miniati, F.; Bingham, R.; Koenig, M.; Pelka, A.; Ravasio, A.; Yurchak, R.

    2014-01-01

    X-ray and radio observations of the supernova remnant Cassiopeia A reveal the presence of magnetic fields about 100 times stronger than those in the surrounding interstellar medium. Field coincident with the outer shock probably arises through a nonlinear feedback process involving cosmic rays. The origin of the large magnetic field in the interior of the remnant is less clear but it is presumably stretched and amplified by turbulent motions. Turbulence may be generated by hydrodynamic instability at the contact discontinuity between the supernova ejecta and the circumstellar gas. However, optical observations of Cassiopeia A indicate that the ejecta are interacting with a highly inhomogeneous, dense circumstellar cloud bank formed before the supernova explosion. Here we investigate the possibility that turbulent amplification is induced when the outer shock overtakes dense clumps in the ambient medium. We report laboratory experiments that indicate the magnetic field is amplified when the shock interacts with a plastic grid. We show that our experimental results can explain the observed synchrotron emission in the interior of the remnant. The experiment also provides a laboratory example of magnetic field amplification by turbulence in plasmas, a physical process thought to occur in many astrophysical phenomena. (authors)

  13. Multi-scale-nonlinear interactions among micro-turbulence, magnetic islands, and zonal flows

    International Nuclear Information System (INIS)

    Ishizawa, A.; Nakajima, N.; Okamoto, M.; Ramos, J.J.

    2006-10-01

    We investigate multi-scale-nonlinear interactions among micro-instabilities, macro-scale tearing instabilities and zonal flows, by solving reduced two-fluid equations numerically. We find that the nonlinear interactions of these instabilities trigger macro-scale MHD activity after an equilibrium is formed by a balance between the micro-turbulence and zonal flow. This MHD activity breaks magnetic surfaces then this breaking spreads the micro-turbulence over the plasma. These multi-scale-nonlinear interactions can explain the evolution of fluctuation observed in torus plasma experiments because micro-turbulence and MHD instabilities usually appear in the plasma at the same time, in spite of the fact that effects of micro-turbulence and MHD instabilities on plasma confinement have been investigated separately. For instance, MHD activities are observed in reversed shear tokamak plasmas with a transport barrier related to zonal flows and micro-turbulence, and micro-turbulence is observed in Large Helical Device plasmas that usually exhibit MHD activities. (author)

  14. Statistical properties of electrostatic turbulence in toroidal magnetized plasmas

    Czech Academy of Sciences Publication Activity Database

    Labit, B.; Diallo, A.; Fasoli, A.; Furno, I.; Iraji, D.; Muller, S.H.; Plyushchev, G.; Podesta, M.; Poli, F.M.; Ricci, P.; Theiler, C.; Horáček, Jan

    2007-01-01

    Roč. 49, 12B (2007), B281-B290 ISSN 0741-3335. [European Physical Society Conference on Plasma Physicaa/34th./. Warsaw, 02.07.2007-06.07.2007] Grant - others:-(XE) European Training fellowships and Grants (Euratom), EDGETURB Institutional research plan: CEZ:AV0Z20430508 Source of funding: R - rámcový projekt EK Keywords : Tokamak * plasma * scrape-off layer * turbulence * interchange instability Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.070, year: 2007

  15. Magnetic and turbulent evolution of the Taurus molecular cloud

    International Nuclear Information System (INIS)

    Hemeon-Heyer, M.C.

    1986-01-01

    The role of the interstellar magnetic field in the dynamics of molecular clouds is investigated from extensive mapping of the 13 CO J = 1 - 0 emission to delineate gas morphology and kinematics and polarization of background starlight to determine the magnetic field direction within the Taurus Molecular Cloud Complex. The signature for a dynamically significant magnetic field is a rotating, flattened cloud with the rotational and minor axes parallel to the direction of the magnetic field. It was found that molecular regions characterized by mean densities less than 10 3 cm -3 exhibit such magnetic signatures and are likely a result of magnetically dominated evolution. A method to spatially and kinematically isolate the subcondensations within the clouds is developed. These cores are characterized by mean densities greater than 10 4 cm -3 and are the sites of star formation. However, based on core morphology and kinematics, it appears the magnetic field no longer provides a significant stress to the mostly neutral gas. Therefore, a constraint on the mean density at which the magnetic field decouples from the gas is a molecular density of less than 10 4 cm -3 . The role of stellar winds from pre-main sequence stars as an internal energy source for molecular clouds is investigated from 12 CO and 13 CO mapping of star forming regions delineated by point sources of far infrared emission. Evidence for mass outflow is found toward three of the thirty sources surveyed

  16. Transverse Cascade and Sustenance of Turbulence in Keplerian Disks with an Azimuthal Magnetic Field

    Science.gov (United States)

    Gogichaishvili, D.; Mamatsashvili, G.; Horton, W.; Chagelishvili, G.; Bodo, G.

    2017-10-01

    The magnetorotational instability (MRI) in the sheared rotational Keplerian explains fundamental problems for both astrophysics and toroidal laboratory plasmas. The turbulence occurs before the threshold for the linear eigen modes. The work shows the turbulence occurs in nonzero toroidal magnetic field with a sheared toroidal flow velocity. We analyze the turbulence in Fourier k-space and x-space each time step to clarify the nonlinear energy-momentum transfers that produce the sustenance in the linearly stable plasma. The nonlinear process is a type 3D angular redistribution of modes in Fourier space - a transverse cascade - rather than the direct/inverse cascades. The turbulence is sustained an interplay of the linear transient growth from the radial gradient of the toroidal velocity (which is the only energy supply for the turbulence) and the transverse cascade. There is a relatively small ``vital area in Fourier space'' is crucial for the sustenance. Outside the vital area the direct cascade dominates. The interplay of the linear and nonlinear processes is generally too intertwined in k-space for a classical turbulence characterization. Subcycles occur from the interactions that maintain self-organization nonlinear turbulence. The spectral characteristics in four simulations are similar showing the universality of the sustenance mechanism of the shear flow driven MHDs-turbulence. Funded by the US Department of Energy under Grant DE-FG02-04ER54742 and the Space and Geophysics Laboratory at the University of Texas at Austin. G. Mamatsashvili is supported by the Alexander von Humboldt Foundation, Germany.

  17. Magnetospheric Multiscale Observations of Electron Vortex Magnetic Hole in the Turbulent Magnetosheath Plasma

    Energy Technology Data Exchange (ETDEWEB)

    Huang, S. Y.; Yuan, Z. G.; Wang, D. D.; Yu, X. D. [School of Electronic Information, Wuhan University, Wuhan (China); Sahraoui, F.; Contel, O. Le [Laboratoire de Physique des Plasmas, CNRS-Ecole Polytechnique-UPMC, Palaiseau (France); He, J. S. [School of Earth and Space Sciences, Peking University, Beijing (China); Zhao, J. S. [Key Laboratory of Planetary Sciences, Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing (China); Deng, X. H.; Pang, Y.; Li, H. M. [Institute of Space Science and Technology, Nanchang University, Nanchang (China); Zhou, M. [Department of Physics and Astronomy, University of California, Los Angeles, CA (United States); Fu, H. S.; Yang, J. [School of Space and Environment, Beihang University, Beijing (China); Shi, Q. Q. [Shandong Provincial Key Laboratory of Optical Astronomy and Solar-Terrestrial Environment, Institute of Space Sciences, Shandong University, Weihai (China); Lavraud, B. [Institut de Recherche and Astrophysique et Planétologie, Université de Toulouse (UPS), Toulouse (France); Pollock, C. J.; Giles, B. L. [NASA, Goddard Space Flight Center, Greenbelt, MD (United States); Torbert, R. B. [University of New Hampshire, Durham, NH (United States); Russell, C. T., E-mail: shiyonghuang@whu.edu.cn [Department of Earth, Planetary and Space Sciences, University of California, Los Angeles, CA (United States); and others

    2017-02-20

    We report on the observations of an electron vortex magnetic hole corresponding to a new type of coherent structure in the turbulent magnetosheath plasma using the Magnetospheric Multiscale mission data. The magnetic hole is characterized by a magnetic depression, a density peak, a total electron temperature increase (with a parallel temperature decrease but a perpendicular temperature increase), and strong currents carried by the electrons. The current has a dip in the core region and a peak in the outer region of the magnetic hole. The estimated size of the magnetic hole is about 0.23 ρ {sub i} (∼30 ρ {sub e}) in the quasi-circular cross-section perpendicular to its axis, where ρ {sub i} and ρ {sub e} are respectively the proton and electron gyroradius. There are no clear enhancements seen in high-energy electron fluxes. However, there is an enhancement in the perpendicular electron fluxes at 90° pitch angle inside the magnetic hole, implying that the electrons are trapped within it. The variations of the electron velocity components V {sub em} and V {sub en} suggest that an electron vortex is formed by trapping electrons inside the magnetic hole in the cross-section in the M – N plane. These observations demonstrate the existence of a new type of coherent structures behaving as an electron vortex magnetic hole in turbulent space plasmas as predicted by recent kinetic simulations.

  18. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  19. Turbulent stress measurements with phase-contrast magnetic resonance through tilted slices

    Energy Technology Data Exchange (ETDEWEB)

    MacKenzie, Jordan; Soederberg, Daniel; Lundell, Fredrik [Linne FLOW Centre, KTH Mechanics, Stockholm (Sweden); Swerin, Agne [SP Technical Research Institute of Sweden-Chemistry, Materials and Surfaces, Stockholm (Sweden); KTH Royal Institute of Technology, Surface and Corrosion Science, Stockholm (Sweden)

    2017-05-15

    Aiming at turbulent measurements in opaque suspensions, a simplistic methodology for measuring the turbulent stresses with phase-contrast magnetic resonance velocimetry is described. The method relies on flow-compensated and flow-encoding protocols with the flow encoding gradient normal to the slice. The experimental data is compared with direct numerical simulations (DNS), both directly but also, more importantly, after spatial averaging of the DNS data that resembles the measurement and data treatment of the experimental data. The results show that the most important MRI data (streamwise velocity, streamwise variance and Reynolds shear stress) is reliable up to at least anti r = 0.75 without any correction, paving the way for dearly needed turbulence and stress measurements in opaque suspensions. (orig.)

  20. 2D turbulence structure observed by a fast framing camera system in linear magnetized device PANTA

    International Nuclear Information System (INIS)

    Ohdachi, Satoshi; Inagaki, S.; Kobayashi, T.; Goto, M.

    2015-01-01

    Mesoscale structure, such as the zonal flow and the streamer plays important role in the drift-wave turbulence. The interaction of the mesoscale structure and the turbulence is not only interesting phenomena but also a key to understand the turbulence driven transport in the magnetically confined plasmas. In the cylindrical magnetized device, PANTA, the interaction of the streamer and the drift wave has been found by the bi-spectrum analysis of the turbulence. In order to study the mesoscale physics directly, the 2D turbulence is studied by a fast-framing visible camera system view from a window located at the end plate of the device. The parameters of the plasma is the following; Te∼3eV, n ∼ 1x10 19 m -3 , Ti∼0.3eV, B=900G, Neutral pressure P n =0.8 mTorr, a∼ 6cm, L=4m, Helicon source (7MHz, 3kW). Fluctuating component of the visible image is decomposed by the Fourier-Bessel expansion method. Several rotating mode is observed simultaneously. From the images, m = 1 (f∼0.7 kHz) and m = 2, 3 (f∼-3.4 kHz) components which rotate in the opposite direction can be easily distinguished. Though the modes rotate constantly in most time, there appear periods where the radially complicated node structure is formed (for example, m=3 component, t = 142.5∼6 in the figure) and coherent mode structures are disturbed. Then, a new rotating period is started again with different phase of the initial rotation until the next event happens. The typical time interval of the event is 0.5 to 1.0 times of the one rotation of the slow m = 1 mode. The wave-wave interaction might be interrupted occasionally. Detailed analysis of the turbulence using imaging technique will be discussed. (author)

  1. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  2. Periodic and aperiodic synchronization in skilled action

    Directory of Open Access Journals (Sweden)

    Fred eCummins

    2011-12-01

    Full Text Available Synchronized action is considered as a manifestation of shared skill. Most synchronized behaviors in humans and other animals are based on periodic repetition. Aperiodic synchronization of complex action is found in the experimental task of synchronous speaking, in which naive subjects read a common text in lock step. The demonstration of synchronized behavior without a periodic basis is presented as a challenge for theoretical understanding. A unified treatment of periodic and aperiodic synchronization is suggested by replacing the sequential processing model of cognitivist approaches with the more local notion of a task-specific sensorimotor coordination. On this view, skilled action is the imposition of constraints on the co-variation of movement and sensory flux such that the boundary conditions that define the skill are met. This non-cognitivist approach originates in the work of John Dewey. It allows a unification of the treatment of sensorimotor synchronization in simple rhythmic behavior and in complex skilled behavior and it suggests that skill sharing is a uniquely human trait of considerable import.

  3. Turbulent Dynamo Amplification of Magnetic Fields in Laser-Produced Plasmas: Simulations and Experiments

    Science.gov (United States)

    Tzeferacos, P.; Rigby, A.; Bott, A.; Bell, A.; Bingham, R.; Casner, A.; Cattaneo, F.; Churazov, E.; Forest, C.; Katz, J.; Koenig, M.; Li, C.-K.; Meinecke, J.; Petrasso, R.; Park, H.-S.; Remington, B.; Ross, J.; Ryutov, D.; Ryu, D.; Reville, B.; Miniati, F.; Schekochihin, A.; Froula, D.; Lamb, D.; Gregori, G.

    2017-10-01

    The universe is permeated by magnetic fields, with strengths ranging from a femtogauss in the voids between the filaments of galaxy clusters to several teragauss in black holes and neutron stars. The standard model for cosmological magnetic fields is the nonlinear amplification of seed fields via turbulent dynamo. We have conceived experiments to demonstrate and study the turbulent dynamo mechanism in the laboratory. Here, we describe the design of these experiments through large-scale 3D FLASH simulations on the Mira supercomputer at ANL, and the laser-driven experiments we conducted with the OMEGA laser at LLE. Our results indicate that turbulence is capable of rapidly amplifying seed fields to near equipartition with the turbulent fluid motions. This work was supported in part from the ERC (FP7/2007-2013, No. 256973 and 247039), and the U.S. DOE, Contract No. B591485 to LLNL, FWP 57789 to ANL, Grant No. DE-NA0002724 and DE-SC0016566 to the University of Chicago, and DE-AC02-06CH11357 to ANL.

  4. Piecewise parabolic method on a local stencil for magnetized supersonic turbulence simulation

    Science.gov (United States)

    Ustyugov, Sergey D.; Popov, Mikhail V.; Kritsuk, Alexei G.; Norman, Michael L.

    2009-11-01

    Stable, accurate, divergence-free simulation of magnetized supersonic turbulence is a severe test of numerical MHD schemes and has been surprisingly difficult to achieve due to the range of flow conditions present. Here we present a new, higher order-accurate, low dissipation numerical method which requires no additional dissipation or local “fixes” for stable execution. We describe PPML, a local stencil variant of the popular PPM algorithm for solving the equations of compressible ideal magnetohydrodynamics. The principal difference between PPML and PPM is that cell interface states are evolved rather that reconstructed at every timestep, resulting in a compact stencil. Interface states are evolved using Riemann invariants containing all transverse derivative information. The conservation laws are updated in an unsplit fashion, making the scheme fully multidimensional. Divergence-free evolution of the magnetic field is maintained using the higher order-accurate constrained transport technique of Gardiner and Stone. The accuracy and stability of the scheme is documented against a bank of standard test problems drawn from the literature. The method is applied to numerical simulation of supersonic MHD turbulence, which is important for many problems in astrophysics, including star formation in dark molecular clouds. PPML accurately reproduces in three-dimensions a transition to turbulence in highly compressible isothermal gas in a molecular cloud model. The low dissipation and wide spectral bandwidth of this method make it an ideal candidate for direct turbulence simulations.

  5. Blazar Variability from Turbulence in Jets Launched by Magnetically Arrested Accretion Flows

    Energy Technology Data Exchange (ETDEWEB)

    Riordan, Michael O’; Pe’er, Asaf [Physics Department, University College Cork, Cork (Ireland); McKinney, Jonathan C., E-mail: michael_oriordan@umail.ucc.ie [Department of Physics and Joint Space-Science Institute, University of Maryland, College Park, MD 20742 (United States)

    2017-07-10

    Blazars show variability on timescales ranging from minutes to years, the former being comparable to and in some cases even shorter than the light-crossing time of the central black hole. The observed γ -ray light curves can be described by a power-law power density spectrum (PDS), with a similar index for both BL Lacs and flat-spectrum radio quasars. We show that this variability can be produced by turbulence in relativistic jets launched by magnetically arrested accretion flows (MADs). We perform radiative transport calculations on the turbulent, highly magnetized jet launching region of a MAD with a rapidly rotating supermassive black hole. The resulting synchrotron and synchrotron self-Compton emission, originating from close to the black hole horizon, is highly variable. This variability is characterized by PDS, which is remarkably similar to the observed power-law spectrum at frequencies less than a few per day. Furthermore, turbulence in the jet launching region naturally produces fluctuations in the plasma on scales much smaller than the horizon radius. We speculate that similar turbulent processes, operating in the jet at large radii (and therefore a high bulk Lorentz factor), are responsible for blazar variability over many decades in frequency, including on minute timescales.

  6. Gyrofluid computation of magnetic perturbation effects on turbulence and edge localized bursts

    Science.gov (United States)

    Peer, J.; Kendl, A.; Ribeiro, T. T.; Scott, B. D.

    2017-08-01

    The effects of non-axisymmetric resonant magnetic perturbation fields (RMPs) on saturated drift-wave turbulence and on ballooning mode bursts in the edge pedestal of tokamak plasmas are investigated by numerical simulations with a nonlinear six-moment electromagnetic gyrofluid model including zonal profile evolution. The vacuum RMP fields are screened by plasma response currents, so that magnetic transport by perturbed parallel motion is not significantly changed. Radial transport of both particles and heat is dominated by turbulent convection even for large RMP amplitudes, where formation of quasi-stationary convective structures leads to edge profile degradation. Modelling of ideal ballooning mode unstable edge profiles for single bursts including RMP fields causes resonant mode locking and destabilization.

  7. Interaction of supra-thermal ions with turbulence in a magnetized toroidal plasma

    International Nuclear Information System (INIS)

    Plyushchev, G.

    2009-01-01

    This thesis addresses the interaction of a supra-thermal ion beam with turbulence in the simple magnetized toroidal plasma of TORPEX. The first part of the Thesis deals with the ohmic assisted discharges on TORPEX. The aim of these discharges is the investigation of the open to closed magnetic field line transition. The relevant magnetic diagnostics were developed. Ohmic assisted discharges with a maximum plasma current up to 1 kA are routinely obtained. The equilibrium conditions on the vacuum magnetic field configuration were investigated. In the second part of the Thesis, the design of the fast ion source and detector are discussed. The accelerating electric field needed for the fast ion source was optimized. The fast ion source was constructed and commissioned. To detect the fast ions a specially designed gridded energy analyzer was used. The electron energy distribution function was obtained to demonstrate the efficiency of the detector. The experiments with the fast ion beam were conducted in different plasma regions of TORPEX. In the third part of the Thesis, numerical simulations are used to interpret the measured fast ion beam behavior. It is shown that a simple single particle equation of motion explains the beam behavior in the experiments in the absence of plasma. To explain the fast ion beam experiments with the plasma a turbulent electric field must be used. The model that takes into account this turbulent electrical field qualitatively explains the shape of the fast ion current density profile in the different plasma regions of TORPEX. The vertically elongated fast ion current density profiles are explained by a spread in the fast ion velocity distribution. The theoretically predicted radial fast ion beam spreading due to the turbulent electric field was observed in the experiment. (author)

  8. Transport and deposition of neutral particles in magnetohydrodynamic turbulent channel flows at low magnetic Reynolds numbers

    Energy Technology Data Exchange (ETDEWEB)

    Dritselis, C.D., E-mail: dritseli@mie.uth.g [Department of Mechanical Engineering, University of Thessaly, Athens Avenue, 38334 Volos (Greece); Sarris, I.E.; Fidaros, D.K.; Vlachos, N.S. [Department of Mechanical Engineering, University of Thessaly, Athens Avenue, 38334 Volos (Greece)

    2011-04-15

    The effect of Lorentz force on particle transport and deposition is studied by using direct numerical simulation of turbulent channel flow of electrically conducting fluids combined with discrete particle simulation of the trajectories of uncharged, spherical particles. The magnetohydrodynamic equations for fluid flows at low magnetic Reynolds numbers are adopted. The particle motion is determined by the drag, added mass, and pressure gradient forces. Results are obtained for flows with particle ensembles of various densities and diameters in the presence of streamwise, wall-normal or spanwise magnetic fields. It is found that the particle dispersion in the wall-normal and spanwise directions is decreased due to the changes of the underlying fluid turbulence by the Lorentz force, while it is increased in the streamwise direction. The particle accumulation in the near-wall region is diminished in the magnetohydrodynamic flows. In addition, the tendency of small inertia particles to concentrate preferentially in the low-speed streaks near the walls is strengthened with increasing Hartmann number. The particle transport by turbophoretic drift and turbulent diffusion is damped by the magnetic field and, consequently, particle deposition is reduced.

  9. On magnetic field strength effect on velocity and turbulence characterization using Phase-Contrast Magnetic Resonance Imaging (PC-MRI)

    Science.gov (United States)

    van de Moortele, Pierre-Francois; Amili, Omid; Coletti, Filippo; Toloui, Mostafa

    2017-11-01

    Cardiovascular flows are predominantly laminar. Nevertheless, transient and even turbulent flows have been observed in the vicinity of the heart (e.g. valves, ascending aorta, valvular/vascular stenosis). Effective in-vivo hemodynamic-based diagnostics in these sites require both high-resolution velocity measurements (especially in the near-vessel wall regions) and accurate evaluation of blood flow turbulence level (e.g. in terms of TKE). In addition to phase contrast (PC), appropriately designed PC-MRI sequences provide intravoxel incoherent motion encoding, a unique tool for simultaneous, non-invasive evaluation of velocity 3D vector fields and Reynolds stresses in cardiovascular flows in vivo. However, limited spatial and temporal resolution of PC-MRI result in inaccuracies in the estimation of hemodynamics (e.g. WSS) and of flow turbulence characteristics. This study aims to assess whether SNR gains at higher magnetic field could overcome these limits, providing more accurate velocity and turbulence characterization at higher spatial resolution. Experiments are conducted on MR Scanners at 3 and 7 Tesla with a U-bent pipe flow shaped phantom. 3D velocity fields, Reynolds stresses and TKE are analyzed and compared to a reference PIV experiments.

  10. Fast electron generation and transport in a turbulent, magnetized plasma

    International Nuclear Information System (INIS)

    Stoneking, W.R.

    1994-05-01

    The nature of fast electron generation and transport in the Madison Symmetric Torus (MST) reversed field pinch (RFP) is investigated using two electron energy analyzer (EEA) probes and a thermocouple calorimeter. The parallel velocity distribution of the fast electron population is well fit by a drifted Maxwellian distribution with temperature of about 100 eV and drift velocity of about 2 x 10 6 m/s. Cross-calibration of the EEA with the calorimeter provides a measurement of the fast electron perpendicular temperature of 30 eV, much lower than the parallel temperature, and is evidence that the kinetic dynamo mechanism (KDT) is not operative in MST. The fast electron current is found to match to the parallel current at the edge, and the fast electron density is about 4 x 10 11 cm -3 independent of the ratio of the applied toroidal electric field to the critical electric field for runaways. First time measurements of magnetic fluctuation induced particle transport are reported. By correlating electron current fluctuations with radial magnetic fluctuations the transported flux of electrons is found to be negligible outside r/a∼0.9, but rises the level of the expected total particle losses inside r/a∼0.85. A comparison of the measured diffusion coefficient is made with the ausilinear stochastic diffusion coefficient. Evidence exists that the reduction of the transport is due to the presence of a radial ambipolar electric field of magnitude 500 V/m, that acts to equilibrate the ion and electron transport rates. The convective energy transport associated with the measured particle transport is large enough to account for the observed magnetic fluctuation induced energy transport in MST

  11. Fast electron generation and transport in a turbulent, magnetized plasma

    Energy Technology Data Exchange (ETDEWEB)

    Stoneking, Matthew Randall [Univ. of Wisconsin, Madison, WI (United States)

    1994-05-01

    The nature of fast electron generation and transport in the Madison Symmetric Torus (MST) reversed field pinch (RFP) is investigated using two electron energy analyzer (EEA) probes and a thermocouple calorimeter. The parallel velocity distribution of the fast electron population is well fit by a drifted Maxwellian distribution with temperature of about 100 eV and drift velocity of about 2 x 106 m/s. Cross-calibration of the EEA with the calorimeter provides a measurement of the fast electron perpendicular temperature of 30 eV, much lower than the parallel temperature, and is evidence that the kinetic dynamo mechanism (KDT) is not operative in MST. The fast electron current is found to match to the parallel current at the edge, and the fast electron density is about 4 x 1011 cm-3 independent of the ratio of the applied toroidal electric field to the critical electric field for runaways. First time measurements of magnetic fluctuation induced particle transport are reported. By correlating electron current fluctuations with radial magnetic fluctuations the transported flux of electrons is found to be negligible outside r/a~0.9, but rises the level of the expected total particle losses inside r/a~0.85. A comparison of the measured diffusion coefficient is made with the ausilinear stochastic diffusion coefficient. Evidence exists that the reduction of the transport is due to the presence of a radial ambipolar electric field of magnitude 500 V/m, that acts to equilibrate the ion and electron transport rates. The convective energy transport associated with the measured particle transport is large enough to account for the observed magnetic fluctuation induced energy transport in MST.

  12. Observations of electron vortex magnetic holes and related wave-particle interactions in the turbulent magnetosheath

    Science.gov (United States)

    Huang, S.; Sahraoui, F.; Yuan, Z.; He, J.; Zhao, J.; Du, J.; Le Contel, O.; Wang, X.; Deng, X.; Fu, H.; Zhou, M.; Shi, Q.; Breuillard, H.; Pang, Y.; Yu, X.; Wang, D.

    2017-12-01

    Magnetic hole is characterized by a magnetic depression, a density peak, a total electron temperature increase (with a parallel temperature decrease but a perpendicular temperature increase), and strong currents carried by the electrons. The current has a dip in the core region of the magnetic hole and a peak in the outer region of the magnetic hole. There is an enhancement in the perpendicular electron fluxes at 90° pitch angles inside the magnetic hole, implying that the electrons are trapped within it. The variations of the electron velocity components Vem and Ven suggest that an electron vortex is formed by trapping electrons inside the magnetic hole in the circular cross-section. These observations demonstrate the existence of a new type of coherent structures behaving as an electron vortex magnetic hole in turbulent space plasmas as predicted by recent kinetic simulations. We perform a statistically study using high time solution data from the MMS mission. The magnetic holes with short duration (i.e., < 0.5 s) have their cross section smaller than the ion gyro-radius. Superposed epoch analysis of all events reveals that an increase in the electron density and total temperature, significantly increase (resp. decrease) the electron perpendicular (resp. parallel) temperature, and an electron vortex inside the holes. Electron fluxes at 90° pitch angles with selective energies increase in the KSMHs, are trapped inside KSMHs and form the electron vortex due to their collective motion. All these features are consistent with the electron vortex magnetic holes obtained in 2D and 3D particle-in-cell simulations, indicating that the observed the magnetic holes seem to be best explained as electron vortex magnetic holes. It is furthermore shown that the magnetic holes are likely to heat and accelerate the electrons. We also investigate the coupling between whistler waves and electron vortex magnetic holes. These whistler waves can be locally generated inside electron

  13. Robust Optimization of Aperiodic Photonic Structures

    Science.gov (United States)

    Nohadani, Omid; Meng Teo, Kwong; Bertsimas, Dimitris

    2007-03-01

    In engineering design, the physical properties of a system can often only be described by numerical simulation. Optimization of such systems is usually accomplished heuristically without taking into account that there are implementation errors that lead to very suboptimal, and often, infeasible solutions. We present a novel robust optimization method for electromagnetic scattering problems with large degrees of freedom, and report on results when this technique is applied to optimization of aperiodic dielectric structures. The spatial configuration of 50 dielectric scattering cylinders is optimized to match a desired target function such that the optimal arrangement is robust against placement and prototype errors. Our optimization method inherently improves the robustness of the optimized solution with respect to relevant errors and is suitable for real-world design of materials with novel electromagnetic functionalities.

  14. Surface plasmon field enhancements in deterministic aperiodic structures.

    Science.gov (United States)

    Shugayev, Roman

    2010-11-22

    In this paper we analyze optical properties and plasmonic field enhancements in large aperiodic nanostructures. We introduce extension of Generalized Ohm's Law approach to estimate electromagnetic properties of Fibonacci, Rudin-Shapiro, cluster-cluster aggregate and random deterministic clusters. Our results suggest that deterministic aperiodic structures produce field enhancements comparable to random morphologies while offering better understanding of field localizations and improved substrate design controllability. Generalized Ohm's law results for deterministic aperiodic structures are in good agreement with simulations obtained using discrete dipole method.

  15. COMPRESSIBLE RELATIVISTIC MAGNETOHYDRODYNAMIC TURBULENCE IN MAGNETICALLY DOMINATED PLASMAS AND IMPLICATIONS FOR A STRONG-COUPLING REGIME

    Energy Technology Data Exchange (ETDEWEB)

    Takamoto, Makoto [Department of Earth and Planetary Science, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo, 113-0033 (Japan); Lazarian, Alexandre, E-mail: mtakamoto@eps.s.u-tokyo.ac.jp, E-mail: alazarian@facstaff.wisc.edu [Department of Astronomy, University of Wisconsin, 475 North Charter Street, Madison, WI 53706 (United States)

    2016-11-10

    In this Letter, we report compressible mode effects on relativistic magnetohydrodynamic (RMHD) turbulence in Poynting-dominated plasmas using three-dimensional numerical simulations. We decomposed fluctuations in the turbulence into 3 MHD modes (fast, slow, and Alfvén) following the procedure of mode decomposition in Cho and Lazarian, and analyzed their energy spectra and structure functions separately. We also analyzed the ratio of compressible mode to Alfvén mode energy with respect to its Mach number. We found the ratio of compressible mode increases not only with the Alfvén Mach number, but also with the background magnetization, which indicates a strong coupling between the fast and Alfvén modes. It also signifies the appearance of a new regime of RMHD turbulence in Poynting-dominated plasmas where the fast and Alfvén modes are strongly coupled and, unlike the non-relativistic MHD regime, cannot be treated separately. This finding will affect particle acceleration efficiency obtained by assuming Alfvénic critical-balance turbulence and can change the resulting photon spectra emitted by non-thermal electrons.

  16. Effect of Resonant Magnetic Perturbations on secondary structures in Drift-Wave turbulence

    Science.gov (United States)

    Leconte, Michael

    2011-10-01

    In this work, we study the effects of RMPs on turbulence, flows and confinement, in the framework of two paradigmatic models, resistive ballooning and resistive drift waves. For resistive ballooning turbulence, we use 3D global numerical simulations, including RMP fields and (externally-imposed) sheared rotation profile. Without RMPs, relaxation oscillations of the pressure profile occur. With RMPs, results show that long-lived convection cells are generated by the combined effects of pressure modulation and toroidal curvature coupling. These modify the global structure of the turbulence and eliminate relaxation oscillations. This effect is due mainly to a modification of the pressure profile linked to the presence of residual magnetic island chains. Hence convection-cell generation increases for increasing δBr/B0. For RMP effect on zonal flows in drift wave turbulence, we extend the Hasegawa-Wakatani model to include RMP fields. The effect of the RMPs is to induce a linear coupling between the zonal electric field and the zonal density gradient, which drives the system to a state of electron radial force balance for large δBr/B0. Both the vorticity flux (Reynolds stress), and particle flux are modulated. We derive an extended predator prey model which couples zonal potential and density dynamics to the evolution of turbulence intensity. This model has both turbulence drive and RMP amplitude as control parameters, and predicts a novel type of transport bifurcation in the presence of RMPs. We find a novel set of system states that are similar to the Hmode-like state of the standard predator-prey model, but for which the power threshold is now a function of the RMP strength. For small RMP amplitude and low collisionality, both the ambient turbulence and zonal flow energy increase with δBr/B0. For larger RMP strength, the turbulence energy increases, but the energy of zonal flows decreases with δBr/B0, corresponding to a damping of zonal flows. At high

  17. Effects of ExB velocity shear and magnetic shear on turbulence and transport in magnetic confinement devices

    Energy Technology Data Exchange (ETDEWEB)

    Burrell, K.H.

    1996-11-01

    One of the scientific success stories of fusion research over the past decade is the development of the ExB shear stabilization model to explain the formation of transport barriers in magnetic confinement devices. This model was originally developed to explain the transport barrier formed at the plasma edge in tokamaks after the L (low) to H (high) transition. This concept has the universality needed to explain the edge transport barriers seen in limiter and divertor tokamaks, stellarators, and mirror machines. More recently, this model has been applied to explain the further confinement improvement from H (high)-mode to VH (very high)-mode seen in some tokamaks, where the edge transport barrier becomes wider. Most recently, this paradigm has been applied to the core transport barriers formed in plasmas with negative or low magnetic shear in the plasma core. These examples of confinement improvement are of considerable physical interest; it is not often that a system self-organizes to a higher energy state with reduced turbulence and transport when an additional source of free energy is applied to it. The transport decrease that is associated with ExB velocity shear effects also has significant practical consequences for fusion research. The fundamental physics involved in transport reduction is the effect of ExB shear on the growth, radial extent and phase correlation of turbulent eddies in the plasma. The same fundamental transport reduction process can be operational in various portions of the plasma because there are a number ways to change the radial electric field Er. An important theme in this area is the synergistic effect of ExB velocity shear and magnetic shear. Although the ExB velocity shear appears to have an effect on broader classes of microturbulence, magnetic shear can mitigate some potentially harmful effects of ExB velocity shear and facilitate turbulence stabilization.

  18. Effect of Guide Field in Localization of Whistler Wave and Turbulent Spectrum in Magnetic Reconnection Sites

    Science.gov (United States)

    Pathak, N.; Sharma, R. P.; Uma, R.

    2017-12-01

    Whistler waves have ample of observations in the magnetosphere near the dayside magnetopause. Also, the role of whistler waves is well established in the context of magnetic reconnection as well as turbulence generation. In the present work, we examine the combined effect of guide field and nonlinearity in the development of turbulence in magnetic reconnection sites. We have derived the dynamical equation of 3D whistler wave propagating through Harris sheet assuming that background number density and background field are perturbed. The nonlinear dynamical equation is then solved numerically using pseudo spectral method and finite difference method. Simulation results represent the nonlinear evolution of X-O field line in the presence of nonlinearity, which causes the generation of turbulence. When the system reaches quasi steady state, we have evaluated power spectrum in magnetopause and it shows two different scaling having k-3/2 at larger saclesand k-3 at smaller scales. Energy distribution at smaller scales leads to the formation of thermal tail of energetic particles. The energy of these electrons is also calculated and comes out to be in the order of 100 keV.

  19. Transition to magnetorotational turbulence in Taylor–Couette flow with imposed azimuthal magnetic field

    International Nuclear Information System (INIS)

    A Guseva; Avila, M; Willis, A P; Hollerbach, R

    2015-01-01

    The magnetorotational instability (MRI) is thought to be a powerful source of turbulence and momentum transport in astrophysical accretion discs, but obtaining observational evidence of its operation is challenging. Recently, laboratory experiments of Taylor–Couette flow with externally imposed axial and azimuthal magnetic fields have revealed the kinematic and dynamic properties of the MRI close to the instability onset. While good agreement was found with linear stability analyses, little is known about the transition to turbulence and transport properties of the MRI. We here report on a numerical investigation of the MRI with an imposed azimuthal magnetic field. We show that the laminar Taylor–Couette flow becomes unstable to a wave rotating in the azimuthal direction and standing in the axial direction via a supercritical Hopf bifurcation. Subsequently, the flow features a catastrophic transition to spatio-temporal defects which is mediated by a subcritical subharmonic Hopf bifurcation. Our results are in qualitative agreement with the PROMISE experiment and dramatically extend their realizable parameter range. We find that as the Reynolds number increases defects accumulate and grow into turbulence, yet the momentum transport scales weakly. (paper)

  20. Kinetic-Scale Magnetic Turbulence and Finite Larmor Radius Effects at Mercury

    Science.gov (United States)

    Uritsky, V. M.; Slavin, J. A.; Khazanov, G. V.; Donovan, E. F.; Boardsen, S. A.; Anderson, B. J.; Korth, H.

    2011-01-01

    We use a nonstationary generalization of the higher-order structure function technique to investigate statistical properties of the magnetic field fluctuations recorded by MESSENGER spacecraft during its first flyby (01/14/2008) through the near-Mercury space environment, with the emphasis on key boundary regions participating in the solar wind - magnetosphere interaction. Our analysis shows, for the first time, that kinetic-scale fluctuations play a significant role in the Mercury's magnetosphere up to the largest resolvable timescale (approx.20 s) imposed by the signal nonstationariry, suggesting that turbulence at this plane I is largely controlled by finite Larmor radius effects. In particular, we report the presence of a highly turbulent and extended foreshock system filled with packets of ULF oscillations, broad-band intermittent fluctuations in the magnetosheath, ion-kinetic turbulence in the central plasma sheet of Mercury's magnetotail, and kinetic-scale fluctuations in the inner current sheet encountered at the outbound (dawn-side) magnetopause. Overall, our measurements indicate that the Hermean magnetosphere, as well as the surrounding region, are strongly affected by non-MHD effects introduced by finite sizes of cyclotron orbits of the constituting ion species. Physical mechanisms of these effects and their potentially critical impact on the structure and dynamics of Mercury's magnetic field remain to be understood.

  1. FORMING CHONDRITES IN A SOLAR NEBULA WITH MAGNETICALLY INDUCED TURBULENCE

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Yasuhiro; Turner, Neal J.; Masiero, Joseph [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Wakita, Shigeru; Matsumoto, Yuji; Oshino, Shoichi, E-mail: yasuhiro@caltech.edu [Center for Computational Astrophysics, National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo 181-8588 (Japan)

    2016-03-20

    Chondritic meteorites provide valuable opportunities to investigate the origins of the solar system. We explore impact jetting as a mechanism of chondrule formation and subsequent pebble accretion as a mechanism of accreting chondrules onto parent bodies of chondrites, and investigate how these two processes can account for the currently available meteoritic data. We find that when the solar nebula is ≤5 times more massive than the minimum-mass solar nebula at a ≃ 2–3 au and parent bodies of chondrites are ≤10{sup 24} g (≤500 km in radius) in the solar nebula, impact jetting and subsequent pebble accretion can reproduce a number of properties of the meteoritic data. The properties include the present asteroid belt mass, the formation timescale of chondrules, and the magnetic field strength of the nebula derived from chondrules in Semarkona. Since this scenario requires a first generation of planetesimals that trigger impact jetting and serve as parent bodies to accrete chondrules, the upper limit of parent bodies’ masses leads to the following implications: primordial asteroids that were originally ≥10{sup 24} g in mass were unlikely to contain chondrules, while less massive primordial asteroids likely had a chondrule-rich surface layer. The scenario developed from impact jetting and pebble accretion can therefore provide new insights into the origins of the solar system.

  2. Nonlocal interaction of inverse magnetic energy transfer in hall magnetohydrodynamic turbulence

    International Nuclear Information System (INIS)

    Araki, Keisuke; Miura, Hideaki

    2011-01-01

    A detailed analysis of forward and inverse energy transfer processes due to the Hall term effect in freely decaying, homogeneous, isotropic Hall magnetohydrodynamics (HMHD) turbulence is performed through Fourier and wavelet analyses. We analyzed three snapshot datasets that were taken from such a period to allow the turbulence to develop sufficiently with a nearly constant magnetic Reynolds number. Because the Fourier energy spectra in these snapshots show remarkable agreement after the normalization in terms of the dissipation rates and the diffusion coefficients, they are considered as a universal equilibrium state. By analyzing the numerical solutions that are generated without any external forcing, it is confirmed that the inverse energy transfer due to the Hall term effect is intrinsic to HMHD dynamics. Orthonormal divergence-free wavelet analysis reveals that nonlinear mode interactions contributing to the inverse energy transfer exhibit a nonlocal feature, while those for the forward transfer are dominated by a local feature. (author)

  3. RADIO SYNCHROTRON FLUCTUATION STATISTICS AS A PROBE OF MAGNETIZED INTERSTELLAR TURBULENCE

    International Nuclear Information System (INIS)

    Herron, C. A.; Gaensler, B. M.; Burkhart, Blakesley; Lazarian, A.; McClure-Griffiths, N. M.

    2016-01-01

    We investigate how observations of synchrotron intensity fluctuations can be used to probe the sonic and Alfvénic Mach numbers of interstellar turbulence, based on mock observations performed on simulations of magnetohydrodynamic turbulence. We find that the structure function slope and a diagnostic of anisotropy that we call the integrated quadrupole ratio modulus both depend on the Alfvénic Mach number. However, these statistics also depend on the orientation of the mean magnetic field in the synchrotron emitting region relative to our line of sight, and this creates a degeneracy that cannot be broken by observations of synchrotron intensity alone. We conclude that the polarization of synchrotron emission could be analyzed to break this degeneracy, and suggest that this will be possible with the Square Kilometre Array.

  4. RADIO SYNCHROTRON FLUCTUATION STATISTICS AS A PROBE OF MAGNETIZED INTERSTELLAR TURBULENCE

    Energy Technology Data Exchange (ETDEWEB)

    Herron, C. A.; Gaensler, B. M. [Sydney Institute for Astronomy, School of Physics, University of Sydney, New South Wales 2006 (Australia); Burkhart, Blakesley [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA (United States); Lazarian, A. [Astronomy Department, University of Wisconsin, Madison, 475 N. Charter Street, WI 53711 (United States); McClure-Griffiths, N. M., E-mail: C.Herron@physics.usyd.edu.au [Research School of Astronomy and Astrophysics, The Australian National University, Canberra, ACT 2611 (Australia)

    2016-05-01

    We investigate how observations of synchrotron intensity fluctuations can be used to probe the sonic and Alfvénic Mach numbers of interstellar turbulence, based on mock observations performed on simulations of magnetohydrodynamic turbulence. We find that the structure function slope and a diagnostic of anisotropy that we call the integrated quadrupole ratio modulus both depend on the Alfvénic Mach number. However, these statistics also depend on the orientation of the mean magnetic field in the synchrotron emitting region relative to our line of sight, and this creates a degeneracy that cannot be broken by observations of synchrotron intensity alone. We conclude that the polarization of synchrotron emission could be analyzed to break this degeneracy, and suggest that this will be possible with the Square Kilometre Array.

  5. Magnetic field line random walk in two-dimensional dynamical turbulence

    Science.gov (United States)

    Wang, J. F.; Qin, G.; Ma, Q. M.; Song, T.; Yuan, S. B.

    2017-08-01

    The field line random walk (FLRW) of magnetic turbulence is one of the important topics in plasma physics and astrophysics. In this article, by using the field line tracing method, the mean square displacement (MSD) of FLRW is calculated on all possible length scales for pure two-dimensional turbulence with the damping dynamical model. We demonstrate that in order to describe FLRW with the damping dynamical model, a new dimensionless quantity R is needed to be introduced. On different length scales, dimensionless MSD shows different relationships with the dimensionless quantity R. Although the temporal effect affects the MSD of FLRW and even changes regimes of FLRW, it does not affect the relationship between the dimensionless MSD and dimensionless quantity R on all possible length scales.

  6. Coherent structures and turbulence evolution in magnetized non-neutral plasmas

    Science.gov (United States)

    Romé, M.; Chen, S.; Maero, G.

    2018-01-01

    The evolution of turbulence of a magnetized pure electron plasma confined in a Penning-Malmberg trap is investigated by means of a two-dimensional particle-in-cell numerical code. The transverse plasma dynamics is studied both in the case of free evolution and under the influence of non-axisymmetric, multipolar radio-frequency drives applied on the circular conducting boundary. In the latter case the radio-frequency fields are chosen in the frequency range of the low-order azimuthal (diocotron) modes of the plasma in order to investigate their effect on the insurgence of azimuthal instabilities and the formation and evolution of coherent structures, possibly preventing the relaxation to a fully-developed turbulent state. Different initial density distributions (rings and spirals) are considered, so that evolutions characterized by different levels of turbulence and intermittency are obtained. The time evolution of integral and spectral quantities of interest are computed using a multiresolution analysis based on a wavelet decomposition of density maps. Qualitative features of turbulent relaxation are found to be similar in conditions of both free and forced evolution, but the analysis allows one to highlight fine details of the flow beyond the self-similarity turbulence properties, so that the influence of the initial conditions and the effect of the external forcing can be distinguished. In particular, the presence of small inhomogeneities in the initial density configuration turns out to lead to quite different final states, especially in the presence of competing unstable diocotron modes characterized by similar growth rates.

  7. Disruption of Alfvénic turbulence by magnetic reconnection in a collisionless plasma

    Science.gov (United States)

    Mallet, Alfred; Schekochihin, Alexander A.; Chandran, Benjamin D. G.

    2017-12-01

    We calculate the disruption scale \\text{D}$ at which sheet-like structures in dynamically aligned Alfvénic turbulence are destroyed by the onset of magnetic reconnection in a low- collisionless plasma. The scaling of \\text{D}$ depends on the order of the statistics being considered, with more intense structures being disrupted at larger scales. The disruption scale for the structures that dominate the energy spectrum is \\text{D}\\sim L\\bot 1/9(de\\unicode[STIX]{x1D70C}s)4/9$ , where e$ is the electron inertial scale, s$ is the ion sound scale and \\bot $ is the outer scale of the turbulence. When e$ and s/L\\bot $ are sufficiently small, the scale \\text{D}$ is larger than s$ and there is a break in the energy spectrum at \\text{D}$ , rather than at s$ . We propose that the fluctuations produced by the disruption are circularised flux ropes, which may have already been observed in the solar wind. We predict the relationship between the amplitude and radius of these structures and quantify the importance of the disruption process to the cascade in terms of the filling fraction of undisrupted structures and the fractional reduction of the energy contained in them at the ion sound scale s$ . Both of these fractions depend strongly on e$ , with the disrupted structures becoming more important at lower e$ . Finally, we predict that the energy spectrum between \\text{D}$ and s$ is steeper than \\bot -3$ , when this range exists. Such a steep `transition range' is sometimes observed in short intervals of solar-wind turbulence. The onset of collisionless magnetic reconnection may therefore significantly affect the nature of plasma turbulence around the ion gyroscale.

  8. Aperiodic space-time modulation for pure frequency mixing

    Science.gov (United States)

    Taravati, Sajjad

    2018-03-01

    This paper experimentally demonstrates the effects of inharmonic photonic transition in tailored aperiodic space-time refractive index modulated media. Such effects introduce a pure frequency mixing based on the simultaneous and distinct shifts in the spatial and temporal frequencies. The medium is characterized with a periodic temporal modulation and a tailored aperiodic spatially modulated permittivity and permeability, yielding aperiodic, large and tunable photonic band gaps. Since the medium is time periodic, an infinite number of space-time mixing products are generated with a distance equal to the temporal frequency of the pump wave. However, thanks to the tailored spatial aperiodicity of the medium and associated photonic band gaps, transition to unwanted space-time mixing products is prohibited. Interesting features include tunability of the operation frequencies of the mixer via space-time modulation parameters, high isolation, linear response, and possibility of conversion gain due to the transfer of energy and momentum of the space-time modulation to the input wave. We derive the analytical solution for such mixer with aperiodic space-modulated permittivity and permeability and periodic time modulation, and then provide the synthesis procedure which takes into account the effects of space-time modulation inhomogeneity. Finally, to see the effect of the tailoring of space modulation, we compare the experimental results of the aperiodic space-time modulated pure mixer with those of the conventional periodic uniform space-time modulated medium.

  9. Numerical simulation of ion dynamics in the magnetotail magnetic turbulence: On collisionless conductivity

    Directory of Open Access Journals (Sweden)

    A. Greco

    2000-01-01

    Full Text Available The ion dynamics in the distant Earth's magnetotail is studied in the case that a cross tail electric field and reconnection parity magnetic turbulence are present in the neutral sheet. A test particle simulation is performed for the ions, and moments of the ion distribution function are obtained as a function of the magnetic fluctuation level, δB/B0, and of the value of the cross tail electric field, Ey. It is found that magnetic turbulence can split the current carrying region into a double current sheet, in agreement with inferences from observations in the distant magnetotail. The problem of ion conductivity is addressed by varying the value of the cross tail electric field from zero to the observed one: we find that Ohm's law is not enforced, and that a non local, system dependent conductivity is necessary to describe the ion response to the electric field. Also, it appears that the relation between current and electric field may be nonlinear.

  10. Chaotic dynamics of the magnetic field generated by dynamo action in a turbulent flow

    Energy Technology Data Exchange (ETDEWEB)

    Petrelis, F; Fauve, S [Laboratoire de Physique Statistique, CNRS UMR 8550, Ecole Normale Superieure, 24 rue Lhomond, F-75005 Paris (France)], E-mail: petrelis@lps.ens.fr

    2008-12-10

    We present models related to the results of a recent experiment (the 'VKS experiment') showing the generation of a magnetic field by a fully turbulent flow of liquid sodium. We first discuss the geometry of the mean magnetic field when the two coaxial impellers driving the flow counter-rotate at the same frequency. We then show how we expect this geometry to be modified when the impellers rotate at different frequencies. We also show that, in the latter case, dynamical regimes of the magnetic field can be easily understood from the interaction of modes with dipolar (respectively quadrupolar) symmetry. In particular, this interaction generates magnetic field reversals that have been observed in the experiment and display a hierarchy of timescales similar to the Earth's magnetic field: the duration of the steady phases is widely distributed, but is always much longer than the time needed to switch polarity. In addition to reversals, several other large scale features of the generated magnetic field are obtained when varying the governing parameters of the flow. These results are also understood in the framework of the same model.

  11. Applications the Lagrangian description in aperiodic flows

    Science.gov (United States)

    Mendoza, Carolina; Mancho, Ana Maria

    2012-11-01

    We use several recently developed Lagrangian tools for describing transport in general aperiodic flows. In our approach the first step is based in a Lagrangian descriptor (the so called function M). It measures the length of particle trajectories on the ocean surface over a given interval of time. We describe its output over satellite altimetry data on the Kuroshio current. The technique is combined with the direct computation of manifolds of Distinguished Hyperbolic trajectories and a very detailed description of transport is achieved across an eddy and a jet on the Kuroshio current,. A second velocity data set is examined with the M function tool. These are obtained from the HYCOM project on the Gulf of Mexico during the time of the oil-spill. We have identified underlying Lagrangian structures and dynamics. We acknowledge to the hospitality of the university of Delaware and the assistance of Bruce Lipphardt and Helga Huntley in accessing the model data sets. We acknowledge to the grants: UPM-AL12-PAC-09, Becas de Movilidad de Caja Madrid 2011, MTM2011-26696 and ILINK-0145.

  12. Astrophysical Gyrokinetics: Kinetic and Fluid Turbulent Cascades In Magnetized Weakly Collisional Plasmas

    International Nuclear Information System (INIS)

    Schekochihin, A.A.; Cowley, S.C.; Dorland, W.; Hammett, G.W.; Howes, G.G.; Quataert, E.; Tatsuno, T.

    2009-01-01

    This paper presents a theoretical framework for understanding plasma turbulence in astrophysical plasmas. It is motivated by observations of electromagnetic and density fluctuations in the solar wind, interstellar medium and galaxy clusters, as well as by models of particle heating in accretion disks. All of these plasmas and many others have turbulent motions at weakly collisional and collisionless scales. The paper focuses on turbulence in a strong mean magnetic field. The key assumptions are that the turbulent fluctuations are small compared to the mean field, spatially anisotropic with respect to it and that their frequency is low compared to the ion cyclotron frequency. The turbulence is assumed to be forced at some system-specific outer scale. The energy injected at this scale has to be dissipated into heat, which ultimately cannot be accomplished without collisions. A kinetic cascade develops that brings the energy to collisional scales both in space and velocity. The nature of the kinetic cascade in various scale ranges depends on the physics of plasma fluctuations that exist there. There are four special scales that separate physically distinct regimes: the electron and ion gyroscales, the mean free path and the electron diffusion scale. In each of the scale ranges separated by these scales, the fully kinetic problem is systematically reduced to a more physically transparent and computationally tractable system of equations, which are derived in a rigorous way. In the 'inertial range' above the ion gyroscale, the kinetic cascade separates into two parts: a cascade of Alfvenic fluctuations and a passive cascade of density and magnetic-field strength fluctuations. The former are governed by the Reduced Magnetohydrodynamic (RMHD) equations at both the collisional and collisionless scales; the latter obey a linear kinetic equation along the (moving) field lines associated with the Alfvenic component (in the collisional limit, these compressive fluctuations

  13. The effects of magnetic perturbations on plasma transport or is magnetic turbulence important in tokamaks?

    International Nuclear Information System (INIS)

    Wootton, A.J.

    1993-01-01

    A test particle model is verified and then used to interpret estimates of fast electron diffusivities in terms of magnetic fluctuation levels. The implied fluctuation levels are themselves interpreted with another verified model to predict electron thermal diffusivities. If the fast electron diffusivities represent local values, then the implied associated thermal transport is too small to explain experimental values. That is, magnetic fluctuations are not important. However, if the fast electron diffusivities represent effective values across mixed good (i.e. with no magnetic fluctuations) and bad (with magnetic fluctuations) surfaces then the implied magnetic fluctuation levels can influence electron thermal transport. (author)

  14. Magnetic field amplification and evolution in turbulent collisionless magnetohydrodynamics: An application to the intracluster medium

    Energy Technology Data Exchange (ETDEWEB)

    Santos-Lima, R.; De Gouveia Dal Pino, E. M.; Kowal, G. [Instituto de Astronomia, Geofísica e Ciências Atmosféricas, Universidade de São Paulo, R. do Matão, 1226, São Paulo, SP 05508-090 (Brazil); Falceta-Gonçalves, D. [Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, Rua Arlindo Bettio, 1000, São Paulo, SP 03828-000 (Brazil); Lazarian, A. [Department of Astronomy, University of Wisconsin, Madison, WI 53706 (United States); Nakwacki, M. S. [Instituto de Astronomía y Física del Espacio (IAFE), CONICET (Argentina)

    2014-02-01

    The amplification of magnetic fields (MFs) in the intracluster medium (ICM) is attributed to turbulent dynamo (TD) action, which is generally derived in the collisional-MHD framework. However, this assumption is poorly justified a priori, since in the ICM the ion mean free path between collisions is of the order of the dynamical scales, thus requiring a collisionless MHD description. The present study uses an anisotropic plasma pressure that brings the plasma within a parametric space where collisionless instabilities take place. In this model, a relaxation term of the pressure anisotropy simulates the feedback of the mirror and firehose instabilities, in consistency with empirical studies. Our three-dimensional numerical simulations of forced transonic turbulence, aiming the modeling of the turbulent ICM, were performed for different initial values of the MF intensity and different relaxation rates of the pressure anisotropy. We found that in the high-β plasma regime corresponding to the ICM conditions, a fast anisotropy relaxation rate gives results that are similar to the collisional-MHD model, as far as the statistical properties of the turbulence are concerned. Also, the TD amplification of seed MFs was found to be similar to the collisional-MHD model. The simulations that do not employ the anisotropy relaxation deviate significantly from the collisional-MHD results and show more power at the small-scale fluctuations of both density and velocity as a result of the action of the instabilities. For these simulations, the large-scale fluctuations in the MF are mostly suppressed and the TD fails in amplifying seed MFs.

  15. Suppression of AGN-driven Turbulence by Magnetic Fields in a Magnetohydrodynamic Model of the Intracluster Medium

    Science.gov (United States)

    Bambic, Christopher J.; Morsony, Brian J.; Reynolds, Christopher S.

    2018-04-01

    We investigate the role of active galactic nucleus (AGN) feedback in turbulent heating of galaxy clusters. Specifically, we analyze the production of turbulence by g-modes generated by the supersonic expansion and buoyant rise of AGN-driven bubbles. Previous work that neglects magnetic fields has shown that this process is inefficient, with less than 1% of the injected energy ending up in turbulence. This inefficiency primarily arises because the bubbles are shredded apart by hydrodynamic instabilities before they can excite sufficiently strong g-modes. Using a plane-parallel model of the intracluster medium (ICM) and 3D ideal magnetohydrodynamics (MHD) simulations, we examine the role of a large-scale magnetic field that is able to drape around these rising bubbles, preserving them from hydrodynamic instabilities. We find that while magnetic draping appears better able to preserve AGN-driven bubbles, the driving of g-modes and the resulting production of turbulence is still inefficient. The magnetic tension force prevents g-modes from transitioning into the nonlinear regime, suppressing turbulence in our model ICM. Our work highlights the ways in which ideal MHD is an insufficient description for the cluster feedback process, and we discuss future work such as the inclusion of anisotropic viscosity as a means of simulating high β plasma kinetic effects. These results suggest the hypothesis that other mechanisms of heating the ICM plasma such as sound waves or cosmic rays may be responsible for the observed feedback in galaxy clusters.

  16. Detection of magnetic discontinuities in the dissipation regime of solar wind turbulence

    Science.gov (United States)

    Perri, S.; Goldstein, M. L.; Dorelli, J.; Sahraoui, F.

    2012-12-01

    Recent spacecraft observations of solar wind magnetic field fluctuations have shown the existence of a cascade of magnetic energy from the scale of the proton Larmor radius ρ_cp, where kinetic properties of ions invalidate fluid approximations, down to the electron Larmor radius ρ_ce, where electrons become demagnetized. This energy cascade has been conjectured to consist of highly oblique kinetic Alfvénic fluctuations (KAW) that are dissipated by proton and electron Landau damping. Analyzing the 450 vec/s resolution data from the STAFF search-coil magnetometer on Cluster, we report, for the first time, evidence for the existence in the solar wind of thin current sheets and discontinuities that exhibit spatial scales that range from the proton Larmor scale down to the electron Larmor scale. In the cases studied, the current sheets are very localized and have an extent between 20-200 km, size that is often close to both the proton Larmor radius and the proton inertial length. These isolated structures appear to be a manifestation of intermittency and may localize sites turbulent dissipation. Furthermore, we compare in-situ observations of thin current sheets and discontinuities in the solar wind at proton scales with results that come from two-dimensional Hall MHD turbulence simulations in the presence of a strong guide field. The initial condition in the simulations is a large scale flux rope structure which breaks down into smaller and smaller current sheets due to the turbulent energy transfer. The comparison shows good qualitative agreement between the properties of the structures observed in Cluster data and the properties of current sheets that arise in the simulations. Our results highlight two competing processes that contribute to the dissipation of solar wind turbulence when the plasma beta is of order unity; viz., kinetic (Landau) damping by protons and electrons and the general tendency of the cascade to form thin current sheets where reconnection and

  17. Electrostatic and magnetic measurements of turbulence and transport in Extrap T2

    Science.gov (United States)

    Möller, Anders; Sallander, Eva

    1999-10-01

    Langmuir probe and magnetic pick-up coil measurements are used to study edge turbulence in the Extrap T2 reversed field pinch. Magnetic fluctuations resonant outside the toroidal field reversal surface are observed where previously only fluctuations in the spectra of potential and electron density and temperature have been measured. Results are presented which imply that these fluctuations are coupled to and also correlated to the internally resonant tearing mode fluctuations. Evidence of coupling between low-frequency (<100 kHz) and high-frequency fluctuations is also presented. The normalized floating potential fluctuations are seen to increase with the edge electron temperature. This causes an increase of the potential and density fluctuation driven transport with the temperature which is faster than linear. These results, in combination, are consistent with a picture where internally resonant fluctuations couple to edge fluctuations through radial heat conduction from the stochastic core to the edge.

  18. Simulation Methods for Multiperiodic and Aperiodic Nanostructured Dielectric Waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    , L. Dal Negro, Optical gap formation and localization properties of optical modes in deterministic aperiodic photonic structures, Opt. Express 16, 18813, 2008 [2] E. Maciá, Exploiting aperiodic designs in nanophotonic devices, Rep Prog Phys 75, 036502, 2012 [3] C. Kluge, J. Adam, N. Barié, P. J....... Jakobs, M. Guttmann, M. Gerken, Multiperiodic nanostructures for photon control, Opt. Express 22, A1363-A1371, 2014 [4] L. T. Neustock, S. Jahns, J. Adam, M. Gerken, Optical waveguides with compound grating nanostructures for refractive index sensing, J. of Sensors, 6174527, 2016...

  19. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  20. Study of the magnetic turbulence in a corotating interaction region in the interplanetary medium

    Directory of Open Access Journals (Sweden)

    J. F. Valdés-Galicia

    Full Text Available We study the geometry of magnetic fluctuations in a CIR observed by Pioneer 10 at 5 AU between days 292 and 295 in 1973. We apply the methodology proposed by Bieber et al. to make a comparison of the relative importance of two geometric arrays of vector propagation of the magnetic field fluctuations: slab and two-dimensional (2D. We found that inside the studied CIR this model is not applicable due to the restrictions imposed on it. Our results are consistent with Alfvenic fluctuations propagating close to the radial direction, confirming Mavromichalaki et al.'s findings. A mixture of isotropic and magnetoacoustic waves in the region before the front shock would be consistent with our results, and a mixture of slab/2D and magnetoacoustic waves in a region after the reverse shock. We base the latter conclusions on the theoretical analysis made by Kunstmann. We discuss the reasons why the composite model can not be applied in the CIR studied although the fluctuations inside it are two dimensional.

    Key words. Solar physics · astrophysics and astronomy (magnetic fields · Space plasma physics (turbulence; waves and instabilities

  1. Concerning the electromagnetic radiation spectrum of a hot plasma with Langmuir turbulence in a magnetic field

    International Nuclear Information System (INIS)

    Tirsky, V.V.; Ledenev, V.G.; Tomozov, V.M.

    2001-01-01

    We consider the process of generation of electromagnetic waves as a consequence of the merging of two Langmuir plasmons. The case of a hot plasma in a magnetic field is investigated. It is shown that under such conditions the frequency of Langmuir plasmons can vary over the range from 0.8 to 1.1 of the Langmuir frequency of electrons. The spectrum and polarization of electromagnetic radiation are analyzed. It is shown that allowance for the thermal motion of plasma particles under the conditions involved permits electromagnetic waves in the range from 1.6 to 2.2 of the Langmuir frequency of electrons to be generated. The degree of circular polarization of the radiation can reach 50% even in the case of an isotropic spectrum of Langmuir turbulence. (orig.)

  2. Statistical moments of the angular spectrum of normal waves in a turbulent collisional magnetized plasma

    International Nuclear Information System (INIS)

    Aistov, A.V.; Gavrilenko, V.G.

    1996-01-01

    The normal incidence of a small-amplitude electromagnetic wave upon a semi-infinite turbulent collisional plasm with an oblique external magnetic field is considered. Within a small-angle-scattering approximation of the radiative transport theory, a system of differential equations is derived for statistical moments of the angular power spectrum of radiation. The dependences of the spectrum centroid, dispersion, and asymmetry on the depth of penetration are studied numerically. The nonmonotonic behavior of the dispersion is revealed, and an increase in the spectrum width with absorption anisotropy is found within some depth interval. It is shown that, at large depths, the direction of the displacement of the spectrum centroid, does not always coincide with the direction of minimum absorption

  3. MAGNETIC FIELD LINE RANDOM WALK IN ISOTROPIC TURBULENCE WITH ZERO MEAN FIELD

    Energy Technology Data Exchange (ETDEWEB)

    Sonsrettee, W.; Ruffolo, D.; Snodin, A. P.; Wongpan, P. [Department of Physics, Faculty of Science, Mahidol University, Bangkok 10400 (Thailand); Subedi, P.; Matthaeus, W. H. [Bartol Research Institute, University of Delaware, Newark, DE 19716 (United States); Chuychai, P., E-mail: bturbulence@gmail.com, E-mail: david.ruf@mahidol.ac.th, E-mail: andrew.snodin@gmail.com, E-mail: pat.wongpan@postgrad.otago.ac.nz, E-mail: piyanate@gmail.com, E-mail: prasub@udel.edu, E-mail: whm@udel.edu [Thailand Center of Excellence in Physics, CHE, Ministry of Education, Bangkok 10400 (Thailand)

    2015-01-01

    In astrophysical plasmas, magnetic field lines often guide the motions of thermal and non-thermal particles. The field line random walk (FLRW) is typically considered to depend on the Kubo number R = (b/B {sub 0})(ℓ{sub ∥}/ℓ ) for rms magnetic fluctuation b, large-scale mean field B {sub 0}, and parallel and perpendicular coherence scales ℓ{sub ∥} and ℓ , respectively. Here we examine the FLRW when R → ∞ by taking B {sub 0} → 0 for finite b{sub z} (fluctuation component along B {sub 0}), which differs from the well-studied route with b{sub z} = 0 or b{sub z} << B {sub 0} as the turbulence becomes quasi-two-dimensional (quasi-2D). Fluctuations with B {sub 0} = 0 are typically isotropic, which serves as a reasonable model of interstellar turbulence. We use a non-perturbative analytic framework based on Corrsin's hypothesis to determine closed-form solutions for the asymptotic field line diffusion coefficient for three versions of the theory, which are directly related to the k {sup –1} or k {sup –2} moment of the power spectrum. We test these theories by performing computer simulations of the FLRW, obtaining the ratio of diffusion coefficients for two different parameterizations of a field line. Comparing this with theoretical ratios, the random ballistic decorrelation version of the theory agrees well with the simulations. All results exhibit an analog to Bohm diffusion. In the quasi-2D limit, previous works have shown that Corrsin-based theories deviate substantially from simulation results, but here we find that as B {sub 0} → 0, they remain in reasonable agreement. We conclude that their applicability is limited not by large R, but rather by quasi-two-dimensionality.

  4. Generation of High-Power Sub-THz Waves in Magnetized Turbulent Electron Beam Plasmas

    Science.gov (United States)

    Thumm, M. K. A.; Arzhannikov, A. V.; Astrelin, V. T.; Burdakov, A. V.; Ivanov, I. A.; Kalinin, P. V.; Kandaurov, I. V.; Kurkuchekov, V. V.; Kuznetsov, S. A.; Makarov, M. A.; Mekler, K. I.; Polosatkin, S. V.; Popov, S. A.; Postupaev, V. V.; Rovenskikh, A. F.; Sinitsky, S. L.; Sklyarov, V. F.; Stepanov, V. D.; Trunev, Yu. A.; Timofeev, I. V.; Vyacheslavov, L. N.

    2013-02-01

    Sub-THz radiation can be generated by conversion of plasma waves into electromagnetic (EM) radiation in a plasma with strong Langmuir (LT) turbulence produced via a two-stream instability of a high current relativistic electron beam (REB). Nonlinear plasmon-plasmon merging results in the generation of photons nearby the 2nd harmonic of the plasma frequency 2ω p ("2ω p -process"). For plasma densities of 1014 - 1015 cm-3, these frequencies are in the range of sub-THz waves at 370-570 GHz. The specific power density of sub-THz-wave emission from plasmas in the multi-mirror magnetic trap GOL-3 (at BINP) during injection of a 10-μs-REB with a current density of about 1 kA/cm2 at plasma densities n e ≈ 5•1014 cm-3, electron temperatures T e ≈ 1.5 keV and magnetic induction B ≈ 4 T was measured to be approx. 1 kW/cm3 in the frequency band around 300 GHz. In the case of a weakly relativistic 100-μs-electron beam (90 keV) with 250 A/cm2 the corresponding results are 700 W/cm3 around 90 GHz with an efficiency of 1-2 % at n e ≈ 3•1013 cm-3 (total power ≈ 30 kW). Theoretical investigations show that at a density of n e ≈ 3•1015 cm-3 and a turbulence level of 5 % the generated sub-THz power can reach ≈ 1 MW/cm3.

  5. Increased electron temperature turbulence during suppression of edge localized mode by resonant magnetic perturbations in the DIII-D tokamak

    Science.gov (United States)

    Sung, C.; Wang, G.; Rhodes, T. L.; Smith, S. P.; Osborne, T. H.; Ono, M.; McKee, G. R.; Yan, Z.; Groebner, R. J.; Davis, E. M.; Zeng, L.; Peebles, W. A.; Evans, T. E.

    2017-11-01

    The first observation of increased electron temperature turbulence during edge localized mode (ELM) suppression by resonant magnetic perturbations (RMPs) is presented. These are long wavelength fluctuations (kθρs ≤ 0.2, where kθ = poloidal wavenumber and ρs = ion sound gyroradius) observed during H-mode plasmas on the DIII-D. This increase occurs only after ELMs are suppressed and are not observed during the initial RMP application. The T˜ e/Te increases ( >60%) are coincident with changes in normalized density and electron temperature gradients in the region from the top of the pedestal outward to the upper portion of the steep edge gradient. Density turbulence (kθρs ≤ 0.4) in this location was also observed to increase only after ELM suppression. These results are significant since they indicate that increased gradient-driven turbulent transport is one possible mechanism to regulate and maintain ELM-free H-mode operation. Investigation of linear stability of drift wave instabilities using the CGYRO code [Candy et al., J. Comput. Phys. 324, 73 (2016)] shows that the dominant mode moves closer to the electron mode branch from the ion mode branch only after ELMs are suppressed, correlated with the increased turbulence. The increased turbulence during ELM suppression, rather than with the initial RMP application, indicates that the often observed RMP induced "density pump-out" cannot be attributed to long wavelength edge turbulence level changes.

  6. MHD effects on turbulent dissipation process in channel flows with an imposed wall-normal magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Yoshinobu, E-mail: yamamotoy@yamanashi.ac.jp [Division of Mechanical Engineering, University of Yamanashi, 4-3-11 Takeda, Kofu 400-8511 (Japan); Kunugi, Tomoaki [Department of Nuclear Engineering, Kyoto University, C3-d2S06, Kyoto-Daigaku Katsura, Nishikyo-Ku, Kyoto 615-8540 (Japan)

    2016-11-01

    Highlights: • We succeeded the establishing DNS database for the epsilon transport equation for turbulent channel flows under high-Re and Ha conditions. • Turbulent dissipation process under the MHD effects shows the similarity under the same R condition, where R is the Reynolds number based on the Hartmann layer thickness and the laminar centerline velocity. • Modulation of the non-MHD terms is important from the view point of the turbulence modeling. - Abstract: In this study, we succeeded in establishing DNS database significantly increased the range of Reynolds number and Hartmann numbers for the epsilon transport equation in turbulent channel flows imposed on a wall-normal uniform magnetic field. Maximum friction Reynolds number based on the channel half-height is 1000 with the Hartmann number based on the channel half-height, 0, 24, and 34. The contribution of MHD source term derived from Lorentz force on the turbulent dissipation process is very small. However, modulation of the other terms in this process was remarkably observed with Hartmann number increasing. The turbulent dissipation process under the MHD effects is similar under the same R condition, where R is the Reynolds number based on the Hartmann layer thickness and the laminar centerline velocity.

  7. A method to identify aperiodic disturbances in the ionosphere

    Directory of Open Access Journals (Sweden)

    J.-S. Wang

    2014-05-01

    Full Text Available In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM, a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  8. Aperiodic Multiprocessor Scheduling for Real-Time Stream Processing Applications

    NARCIS (Netherlands)

    Wiggers, M.H.

    2009-01-01

    This thesis is concerned with the computation of buffer capacities that guarantee satisfaction of timing and resource constraints for task graphs with aperiodic task execution rates that are executed on run-time scheduled resources. Stream processing applications such as digital radio baseband

  9. Numerical simulation of turbulent Taylor-Couette flow between conducting cylinders in an axial magnetic field at low magnetic Reynolds number

    Science.gov (United States)

    Leng, Xueyuan; Kolesnikov, Yurii B.; Krasnov, Dmitry; Li, Benwen

    2018-01-01

    The effect of an axial homogeneous magnetic field on the turbulence in the Taylor-Couette flow confined between two infinitely long conducting cylinders is studied by the direct numerical simulation using a periodic boundary condition in the axial direction. The inner cylinder is rotating, and the outer one is fixed. We consider the case when the magnetic Reynolds number Rem ≪ 1, i.e., the influence of the induced magnetic field on the flow is negligible that is typical for industry and laboratory study of liquid metals. Relevance of the present study is based on the similarity of flow characteristics at moderate and high magnetic field for the cases with periodic and end-wall conditions at the large flow aspect ratio, as proven in the earlier studies. Two sets of Reynolds numbers 4000 and 8000 with several Hartmann numbers varying from 0 to 120 are employed. The results show that the mean radial induced electrical current, resulting from the interaction of axial magnetic field with the mean flow, leads to the transformation of the mean flow and the modification of the turbulent structure. The effect of turbulence suppression is dominating at a strong magnetic field, but before reaching the complete laminarization, we capture the appearance of the hairpin-like structures in the flow.

  10. Study of the Transition from MRI to Magnetic Turbulence via Parasitic Instability by a High-order MHD Simulation Code

    Science.gov (United States)

    Hirai, Kenichiro; Katoh, Yuto; Terada, Naoki; Kawai, Soshi

    2018-02-01

    Magnetic turbulence in accretion disks under ideal magnetohydrodynamic (MHD) conditions is expected to be driven by the magneto-rotational instability (MRI) followed by secondary parasitic instabilities. We develop a three-dimensional ideal MHD code that can accurately resolve turbulent structures, and carry out simulations with a net vertical magnetic field in a local shearing box disk model to investigate the role of parasitic instabilities in the formation process of magnetic turbulence. Our simulations reveal that a highly anisotropic Kelvin–Helmholtz (K–H) mode parasitic instability evolves just before the first peak in turbulent stress and then breaks large-scale shear flows created by MRI. The wavenumber of the enhanced parasitic instability is larger than the theoretical estimate, because the shear flow layers sometimes become thinner than those assumed in the linear analysis. We also find that interaction between antiparallel vortices caused by the K–H mode parasitic instability induces small-scale waves that break the shear flows. On the other hand, at repeated peaks in the nonlinear phase, anisotropic wavenumber spectra are observed only in the small wavenumber region and isotropic waves dominate at large wavenumbers unlike for the first peak. Restructured channel flows due to MRI at the peaks in nonlinear phase seem to be collapsed by the advection of small-scale shear structures into the restructured flow and resultant mixing.

  11. ION KINETIC ENERGY CONSERVATION AND MAGNETIC FIELD STRENGTH CONSTANCY IN MULTI-FLUID SOLAR WIND ALFVÉNIC TURBULENCE

    Energy Technology Data Exchange (ETDEWEB)

    Matteini, L.; Horbury, T. S.; Schwartz, S. J. [The Blackett Laboratory, Imperial College London, SW7 2AZ (United Kingdom); Pantellini, F. [LESIA, Observatoire de Paris, CNRS, UPMC, Universit Paris-Diderot, 5 Place Jules Janssen, F-92195 Meudon (France); Velli, M. [Department of Earth, Planetary, and Space Sciences, UCLA, California (United States)

    2015-03-20

    We investigate the properties of plasma fluid motion in the large-amplitude, low-frequency fluctuations of highly Alfvénic fast solar wind. We show that protons locally conserve total kinetic energy when observed from an effective frame of reference comoving with the fluctuations. For typical properties of the fast wind, this frame can be reasonably identified by alpha particles which, due to their drift with respect to protons at about the Alfvén speed along the magnetic field, do not partake in the fluid low-frequency fluctuations. Using their velocity to transform the proton velocity into the frame of Alfvénic turbulence, we demonstrate that the resulting plasma motion is characterized by a constant absolute value of the velocity, zero electric fields, and aligned velocity and magnetic field vectors as expected for unidirectional Alfvénic fluctuations in equilibrium. We propose that this constraint, via the correlation between velocity and magnetic field in Alfvénic turbulence, is the origin of the observed constancy of the magnetic field; while the constant velocity corresponding to constant energy can only be observed in the frame of the fluctuations, the corresponding constant total magnetic field, invariant for Galilean transformations, remains the observational signature in the spacecraft frame of the constant total energy in the Alfvén turbulence frame.

  12. MAGNETIC QUENCHING OF TURBULENT DIFFUSIVITY: RECONCILING MIXING-LENGTH THEORY ESTIMATES WITH KINEMATIC DYNAMO MODELS OF THE SOLAR CYCLE

    International Nuclear Information System (INIS)

    Munoz-Jaramillo, Andres; Martens, Petrus C. H.; Nandy, Dibyendu

    2011-01-01

    The turbulent magnetic diffusivity in the solar convection zone is one of the most poorly constrained ingredients of mean-field dynamo models. This lack of constraint has previously led to controversy regarding the most appropriate set of parameters, as different assumptions on the value of turbulent diffusivity lead to radically different solar cycle predictions. Typically, the dynamo community uses double-step diffusivity profiles characterized by low values of diffusivity in the bulk of the convection zone. However, these low diffusivity values are not consistent with theoretical estimates based on mixing-length theory, which suggest much higher values for turbulent diffusivity. To make matters worse, kinematic dynamo simulations cannot yield sustainable magnetic cycles using these theoretical estimates. In this work, we show that magnetic cycles become viable if we combine the theoretically estimated diffusivity profile with magnetic quenching of the diffusivity. Furthermore, we find that the main features of this solution can be reproduced by a dynamo simulation using a prescribed (kinematic) diffusivity profile that is based on the spatiotemporal geometric average of the dynamically quenched diffusivity. This bridges the gap between dynamically quenched and kinematic dynamo models, supporting their usage as viable tools for understanding the solar magnetic cycle.

  13. VERTICAL STRUCTURE OF A SUPERNOVA-DRIVEN TURBULENT, MAGNETIZED INTERSTELLAR MEDIUM

    International Nuclear Information System (INIS)

    Hill, Alex S.; Matthew Haffner, L.; Ryan Joung, M.; Mac Low, Mordecai-Mark; Benjamin, Robert A.; Klingenberg, Christian; Waagan, Knut

    2012-01-01

    Stellar feedback drives the circulation of matter from the disk to the halo of galaxies. We perform three-dimensional magnetohydrodynamic simulations of a vertical column of the interstellar medium with initial conditions typical of the solar circle in which supernovae drive turbulence and determine the vertical stratification of the medium. The simulations were run using a stable, positivity-preserving scheme for ideal MHD implemented in the FLASH code. We find that the majority (≈90%) of the mass is contained in thermally stable temperature regimes of cold molecular and atomic gas at T 4.2 K, with strong peaks in probability distribution functions of temperature in both the cold and warm regimes. The 200-10 4.2 K gas fills 50%-60% of the volume near the plane, with hotter gas associated with supernova remnants (30%-40%) and cold clouds ( 5 K) gas accounts for most of the mass and volume, while hot gas dominates at |z| > 3 kpc. The magnetic field in our models has no significant impact on the scale heights of gas in each temperature regime; the magnetic tension force is approximately equal to and opposite the magnetic pressure, so the addition of the field does not significantly affect the vertical support of the gas. The addition of a magnetic field does reduce the fraction of gas in the cold ( 4 K) gas. However, our models lack rotational shear and thus have no large-scale dynamo, which reduces the role of the field in the models compared to reality. The supernovae drive oscillations in the vertical distribution of halo gas, with the period of the oscillations ranging from ≈30 Myr in the T 6 K gas, in line with predictions by Walters and Cox.

  14. Plasma turbulence resulting from the interaction between the solar wind and the earth's magnetic field

    International Nuclear Information System (INIS)

    Roux, A.

    1989-01-01

    The interaction between the supersonic and super-Alfvenic solar wind plasma and the Earth's magnetic field leads to the formation of critical layers, such as the bow shock, the magnetopause, the polar cusp, and the inner and outer edge of the plasmasheet. The mean free path between binary colisions being much larger than the transverse scale of these layers, plasma turbulence must ensure the thermalization, the magnetic diffusion, the dissipation within these critical layers. We suggest the existence of small scale, presumably 2D structures, developing within these thin layers. The unambiguous characterization of these small-scale structures is, however, beyond the capabilities of existing spacecraft, which cannot spatially resolve them, nor disentangle spatial/temporal variations. We present a new mission concept: a cluster of four relatively simple spacecraft, which will make it possible (i) to disentangle spatial from temporal variations, (ii) to evaluate, by finite differences between spacecraft measurements, the gradients, divergences, curls of MHD parameters, and )iii) to characterize small-scale structures, via inter-spacecraft correlations. (author). 10 refs.; 10 figs

  15. Evidence for equivalence of diffusion processes of passive scalar and magnetic fields in anisotropic Navier-Stokes turbulence.

    Science.gov (United States)

    Jurčišinová, E; Jurčišin, M

    2017-05-01

    The influence of the uniaxial small-scale anisotropy on the kinematic magnetohydrodynamic turbulence is investigated by using the field theoretic renormalization group technique in the one-loop approximation of a perturbation theory. The infrared stable fixed point of the renormalization group equations, which drives the scaling properties of the model in the inertial range, is investigated as the function of the anisotropy parameters and it is shown that, at least at the one-loop level of approximation, the diffusion processes of the weak passive magnetic field in the anisotropically driven kinematic magnetohydrodynamic turbulence are completely equivalent to the corresponding diffusion processes of passively advected scalar fields in the anisotropic Navier-Stokes turbulent environments.

  16. ExB-Shear Effects on Magnetic-Flutter Diffusion of Electron-Drift Trajectories in ITG Turbulence

    Science.gov (United States)

    Dimits, A. M.; Nevins, W. M.; Wang, E.; Candy, J.; Holland, C.

    2015-11-01

    Magnetic-field stochasticity arises due to microtearing perturbations, which can be driven linearly or nonlinearly, even at very modest values of the plasma beta. The resulting magnetic-flutter contribution may or may not be a significant component of the overall electron (particle and thermal) transport. Initial investigations of the effect of ExB shear on electron-drift magnetic-flutter diffusion coefficient Dedr (r ,v||) using perturbed magnetic fields from GYRO simulations of ITG turbulence show two interesting results: 1) an absence of any peak in Dedr (r ,v||) at values of the ``resonant'' parallel velocity, v||, at which the ExB shear negates the magnetic shear, and 2) a significant increase in Dedr (r ,v||) for electrons with v|| surprisingly far from the resonant velocity. We explore these effects both through a more detailed quantification of the displacement and decorrelation rates of the orbits, as a function of parallel distance, and through a simplified model of electron drift motion in a poloidally localized turbulent magnetic field. Furthermore, we argue that a correct model will have ExB shearing of the perturbed magnetic field structures themselves, and we extend our investigations to include this effect. Prepared for US DOE by LLNL under Contract DE-AC52-07NA27344, and by GA under Contract DE-FG03-95ER54309.

  17. The Turbulence Magnetic Helicity Signature in the Interplanetary Medium: A Blackman–Tukey and Morlet Wavelet Analysis

    Science.gov (United States)

    Vasquez, Bernard J.; Markovskii, S. A.; Smith, Charles W.

    2018-03-01

    Interplanetary turbulence shows a spectral magnetic helicity signature whose properties could depend on the nature and dissipation of proton-scale fluctuations. A database of Wind spacecraft intervals of turbulence and helicity signatures is evaluated. Spectra are computed by both the Blackman–Tukey method and the Morlet wavelet method. A global mean magnetic field is used in each case, and the wavelet spectrum is averaged over time to facilitate comparison with the Blackman–Tukey spectrum. The maximum magnitude of the signature normalized by the trace of the magnetic spectral power has a frequency that correlates well between the two methods. The sign of the signature is also the same with both approaches, but the magnitudes differ. Statistically, the mean magnitudes of each method do agree, and the difference of individual magnitudes is assigned to uncertainties within each method. The Morlet wavelet method obtains fewer noisy signatures with a tighter overall correlation between magnetic helicity and cross-helicity; however, no trend is confirmed between helicity and the ratio of plasma to magnetic pressure. Subdivision of the analyzed intervals establishes that the helicity signature is persistent but variable. A portion of the variability comes from cross-helicity and possibly from the cascade rate. The observed magnetic helicity is compared to model and simulation results. Two-dimensional hybrid simulations yield results for the magnetic helicity magnitude that are larger than the mean values observed under similar conditions.

  18. Optimization of the Magnetic Field Structure for Sustained Plasma Gun Helicity Injection for Magnetic Turbulence Studies at the Bryn Mawr Plasma Laboratory

    Science.gov (United States)

    Cartagena-Sanchez, C. A.; Schaffner, D. A.; Johnson, H. K.; Fahim, L. E.

    2017-10-01

    A long-pulsed magnetic coaxial plasma gun is being implemented and characterized at the Bryn Mawr Plasma Laboratory (BMPL). A cold cathode discharged between the cylindrical electrodes generates and launches plasma into a 24cm diameter, 2m long chamber. Three separately pulsed magnetic coils are carefully positioned to generate radial magnetic field between the electrodes at the gun edge in order to provide stuffing field. Magnetic helicity is continuously injected into the flux-conserving vacuum chamber in a process akin to sustained slow-formation of spheromaks. The aim of this source, however, is to supply long pulses of turbulent magnetized plasma for measurement rather than for sustained spheromak production. The work shown here details the optimization of the magnetic field structure for this sustained helicity injection.

  19. Can a metaphor of physics contribute to MEG neuroscience research? Intermittent turbulent eddies in brain magnetic fields

    International Nuclear Information System (INIS)

    Mandell, Arnold J.

    2013-01-01

    A common manifestation of nonlinear mathematical and experimental neurobiological dynamical systems in transition, intermittence, is currently being attended by concepts from physics such as turbulent eddy and the avalanche of critical systems. Do these concepts constitute an enticing poetry of dynamical universality or do these metaphors from physics generate more specific novel and relevant concepts and experiments in the neurosciences? Using six graphics and ten measures derived from the ergodic theory of dynamical systems, we study the magnetoencephalic, MEG, records of taskless, “resting” human subjects to find consistent evidence for turbulent (chaotic) dynamics marked by intermittent turbulent eddies. This brings up an apparent discrepancy via the juxtaposition of the superposition characteristics of magnetic fields and the non-superposition properties of turbulent flow. Treating this apparent inconsistency as an existent duality, we propose a physical model for how that might be the case. This leaves open the question: has the physical metaphor, turbulent eddy, contributed to a scientific understanding of the human resting MEG?

  20. Linear astrophysical dynamos in rotating spheres: Differential rotation, anisotropic turbulent magnetic diffusivity, and solar-stellar cycle magnetic parity

    International Nuclear Information System (INIS)

    Yoshimura, H.; Wang, Z.; Wu, F.

    1984-01-01

    Differential rotation dependence of the selection mechanism for magnetic parity of solar and stellar cycles is studied by assuming various differential rotation profiles inn the dynamo equation. The parity selection depends on propagation direction of oscillating magnetic fields in the form of dynamo waves which propagate along isorotation surfaces. When there is any radial gradient in the differential rotation, dynamo waves propagate either equatorward or poleward. In the former case, field systems of the two hemispheres approach each other and collide at the equator. Then, odd parity is selected. In the latter case, field systems of the two hemispheres recede from each other and do not collide at the equator, an even parity is selected. Thus the equatorial migration of wings of the butterfly iagram of the solar cycle and its odd parity are intrinsically related. In the case of purely latitudibnal differential rotation, dynamo waves propagate purely radially and growth rates of odd and even modes are nearly the same even when dynamo strength is weak when the parity selection mechanism should work most efficiently. In this case, anisotropy of turbulent diffusivity is a decisive factor to separate odd and even modes. Unlike in the case of radial-gradient-dominated differential rotation in which any difference between diffusivities for poloidal and toroidal fields enhancess the parity selection without changing the parity, the parity selection in the case of latitudinal-gradient-dominated differential rotation depends on the difference of diffusivities for poloidal and toroidal fields. When diffusivity for poloidal fields iss larger than that for toroidal fields, odd parity is selected; and when diffusivity for toroidal fields is larger, even parity is selected

  1. Magnetic Reconnection May Control the Ion-scale Spectral Break of Solar Wind Turbulence

    Science.gov (United States)

    Vech, Daniel; Mallet, Alfred; Klein, Kristopher G.; Kasper, Justin C.

    2018-03-01

    The power spectral density of magnetic fluctuations in the solar wind exhibits several power-law-like frequency ranges with a well-defined break between approximately 0.1 and 1 Hz in the spacecraft frame. The exact dependence of this break scale on solar wind parameters has been extensively studied but is not yet fully understood. Recent studies have suggested that reconnection may induce a break in the spectrum at a “disruption scale” {λ }{{D}}, which may be larger than the fundamental ion kinetic scales, producing an unusually steep spectrum just below the break. We present a statistical investigation of the dependence of the break scale on the proton gyroradius ρ i , ion inertial length d i , ion sound radius ρ s , proton–cyclotron resonance scale ρ c , and disruption scale {λ }{{D}} as a function of {β }\\perp i. We find that the steepest spectral indices of the dissipation range occur when β e is in the range of 0.1–1 and the break scale is only slightly larger than the ion sound scale (a situation occurring 41% of the time at 1 au), in qualitative agreement with the reconnection model. In this range, the break scale shows a remarkably good correlation with {λ }{{D}}. Our findings suggest that, at least at low β e , reconnection may play an important role in the development of the dissipation range turbulent cascade and cause unusually steep (steeper than ‑3) spectral indices.

  2. THE ROLE OF TURBULENCE AND MAGNETIC FIELDS IN SIMULATED FILAMENTARY STRUCTURE

    Energy Technology Data Exchange (ETDEWEB)

    Kirk, Helen; Pudritz, Ralph [Origins Institute, McMaster University, Hamilton, ON, L8S 4M1 (Canada); Klassen, Mikhail; Pillsworth, Samantha, E-mail: helen.kirk@nrc-cnrc.gc.ca [Department of Physics and Astronomy, McMaster University,Hamilton, ON, L8S 4M1 (Canada)

    2015-04-01

    We use numerical simulations of turbulent cluster-forming regions to study the nature of dense filamentary structures in star formation. Using four hydrodynamic and magnetohydrodynamic simulations chosen to match observations, we identify filaments in the resulting column density maps and analyze their properties. We calculate the radial column density profiles of the filaments every 0.05 Myr and fit the profiles with the modified isothermal and pressure-confined isothermal cylinder models, finding reasonable fits for either model. The filaments formed in the simulations have similar radial column density profiles to those observed. Magnetic fields provide additional pressure support to the filaments, making “puffier” filaments less prone to fragmentation than in the pure hydrodynamic case, which continue to condense at a slower rate. In the higher density simulations, the filaments grow faster through the increased importance of gravity. Not all of the filaments identified in the simulations will evolve to form stars: some expand and disperse. Given these different filament evolutionary paths, the trends in bulk filament width as a function of time, magnetic field strength, or density are weak, and all cases are reasonably consistent with the finding of a constant filament width in different star-forming regions. In the simulations, the mean FWHM lies between 0.06 and 0.26 pc for all times and initial conditions, with most lying between 0.1 to 0.15 pc; the range in FWHMs is however, larger than seen in typical Herschel analyses. Finally, the filaments display a wealth of substructure similar to the recent discovery of filament bundles in Taurus.

  3. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  4. Confinement and Isotropization of Galactic Cosmic Rays by Molecular-Cloud Magnetic Mirrors When Turbulent Scattering Is Weak

    International Nuclear Information System (INIS)

    Chandran, Benjamin D. G.

    2000-01-01

    Theoretical studies of magnetohydrodynamic (MHD) turbulence and observations of solar wind fluctuations suggest that MHD turbulence in the interstellar medium is anisotropic at small scales, with smooth variations along the background magnetic field and sharp variations perpendicular to the background field. Turbulence with this anisotropy is inefficient at scattering cosmic rays, and thus the scattering rate ν may be smaller than has been traditionally assumed in diffusion models of Galactic cosmic-ray propagation, at least for cosmic-ray energies E above 1011-1012 eV at which self-confinement is not possible. In this paper, it is shown that Galactic cosmic rays can be effectively confined through magnetic reflection by molecular clouds, even when turbulent scattering is weak. Elmegreen's quasi-fractal model of molecular-cloud structure is used to argue that a typical magnetic field line passes through a molecular cloud complex once every ∼300 pc. Once inside the complex, the field line will in most cases be focused into one or more dense clumps in which the magnetic field can be much stronger than the average field in the intercloud medium (ICM). Cosmic rays following field lines into cloud complexes are most often magnetically reflected back into the ICM, since strong-field regions act as magnetic mirrors. For a broad range of cosmic-ray energies, a cosmic ray initially following some particular field line separates from that field line sufficiently slowly that the cosmic ray can be trapped between neighboring cloud complexes for long periods of time. The suppression of cosmic-ray diffusion due to magnetic trapping is calculated in this paper with the use of phenomenological arguments, asymptotic analysis, and Monte Carlo particle simulations. Formulas for the coefficient of diffusion perpendicular to the Galactic disk are derived for several different parameter regimes within the E-ν plane. In one of these parameter regimes in which scattering is weak, it

  5. Modeling of MHD turbulent heat transfer in channel flows imposed wall-normal magnetic fields under the various Prandtl number fluids

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Yoshinobu, E-mail: yamamotoy@yamanashi.ac.jp [Division of Mechanical Engineering, University of Yamanashi, 4-3-11 Takeda, Kofu 400-8511 (Japan); Kunugi, Tomoaki, E-mail: kunugi@nucleng.kyoto-u.ac.jp [Department of Nuclear Engineering, Kyoto University, C3-d2S06, Kyoto-Daigaku Katsura, Nishikyo-Ku 615-8540, Kyoto (Japan)

    2016-11-01

    Highlights: • We show the applicability to predict the heat transfer imposed on a uniform wall-normal magnetic field by means of the zero-equation heat transfer model. • Quasi-theoretical turbulent Prandtl numbers with various molecular Prandtl number fluids were obtained. • Improvements of the prediction accuracy in turbulent kinetic energy and turbulent dissipation rate under the magnetic fields were accomplished. - Abstract: Zero-equation heat transfer models based on the constant turbulent Prandtl number are evaluated using direct numerical simulation (DNS) data for fully developed channel flows imposed on a uniform wall-normal magnetic field. Quasi-theoretical turbulent Prandtl numbers are estimated by DNS data of various molecular Prandtl number fluids. From the viewpoint of highly-accurate magneto-hydrodynamic (MHD) heat transfer prediction, the parameters of the turbulent eddy viscosity of the k–É› model are optimized under the magnetic fields. Consequently, we use the zero-equation model based on a constant turbulent Prandtl number to demonstrate MHD heat transfer, and show the applicability of using this model to predict the heat transfer.

  6. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  7. Interaction between sheared flows and turbulent transport in magnetized fusion-grade plasmas; Interaction entre ecoulements cisailles et transport turbulent dans les plasmas de fusion magnetique

    Energy Technology Data Exchange (ETDEWEB)

    Leconte, M.

    2008-11-15

    The H confinement regime is set when the heating power reaches a threshold value P{sub c} and is linked to the formation of a transport barrier in the edge region of the plasma. Such a barrier is characterized by a high pressure gradient and is submitted to ELM (edge localized mode) instabilities. ELM instabilities trigger violent quasi-periodical ejections of matter and heat that induce quasi-periodical relaxations of the transport barrier called relaxation oscillations. In this work we studied the interaction between sheared flows and turbulence in fusion plasmas. In particular, we studied the complex dynamics of a transport barrier and we show through a simulation that resonant magnetic perturbations could control relaxation oscillations without a significant loss of confinement

  8. Self-consistency constraints on turbulent magnetic transport and relaxation in collisionless plasma

    International Nuclear Information System (INIS)

    Terry, P.W.; Diamond, P.H.; Hahm, T.S.

    1985-10-01

    Novel constraints on collisionless relaxation and transport in drift-Alfven turbulence are reported. These constraints arise due to the consideration of mode coupling and incoherent fluctuations and the proper application of self-consistency conditions. The result that electrostatic fluctuations alone regulate transport in drift-Alfven turbulence follows directly. Quasilinear transport predictions are discussed in light of these constraints

  9. Magnetohydrodynamic turbulence model

    Science.gov (United States)

    Hammer, James

    2005-10-01

    K-epsilon models find wide application as approximate models of fluid turbulence. The models couple equations for the turbulent kinetic energy and dissipation rate to the usual fluid equations, where the turbulence is driven by Reynolds stress or buoyancy source terms. We generalize to the case with magnetic forces in a Z-pinch geometry (azimuthal fields), using simple energy arguments to derive the turbulent source terms. The field is presumed strong enough that 3 dimensional twisting or bending of the field can be ignored, i.e. the flow is of the interchange type. The generalized source terms show the familiar correspondence between magnetic curvature and acceleration as drive terms for Rayleigh-Taylor and sausage instability. The source terms lead naturally to a modification of Ohm's law including a turbulent electric field that allows magnetic field to diffuse through material. The turbulent magnetic diffusion parallels a corresponding ohmic heating term in the equation for the turbulent kinetic energy.

  10. Engineering aperiodic nanostructured surfaces for scattering-based optical devices

    Science.gov (United States)

    Lee, Yuk Kwan Sylvanus

    Novel optical devices such as biosensors, color displays and authentication devices can be obtained from the distinctive light scattering properties of resonant nanoparticles and nanostructured arrays. These arrays can be optimized through the choice of material, particle morphology and array geometry. In this thesis, by engineering the multi-frequency colorimetric responses of deterministic aperiodic nanostructured surfaces (DANS) with various spectral Fourier properties, I designed, fabricated and characterized scattering-based devices for optical biosensing and structural coloration applications. In particular, using analytical and numerical optimization, colorimetric biosensors are designed and fabricated with conventional electron beam lithography, and characterized using dark-field scattering imaging as well as image autocorrelation analysis of scattered intensity in the visible spectral range. These sensors, which consist of aperiodic surfaces ranging from quasi-periodic to pseudo-random structures with flat Fourier spectra, sustain highly complex structural resonances that enable a novel optical sensing approach beyond the traditional Bragg scattering. To this end, I have experimentally demonstrated that DANS with engineered structural colors are capable of detecting nanoscale protein monolayers with significantly enhanced sensitivity over periodic structures. In addition, different aperiodic arrays of gold (Au) nanoparticles are integrated with polydimethylsiloxane (PDMS) microfluidic structures by soft-lithographic micro-imprint techniques. Distinctive scattering spectral shifts and spatial modifications of structural color patterns in response to refractive index variations were simultaneously measured. The successful integration of DANS with microfluidics technology has introduced a novel opto-fluidic sensing platform for label-free and multiplexed lab-on-a-chip applications. Moreover, by studying the isotropic scattering properties of homogenized

  11. Simulation methods for multiperiodic and aperiodic nanostructured dielectric waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    2017-01-01

    on Rudin–Shapiro, Fibonacci, and Thue–Morse binary sequences. The near-field and far-field properties are computed employing the finite-element method (FEM), the finite-difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). The results show that all three methods......, a comparison of experimental results and simulation results obtained with three different simulation methods is presented. We fabricated and characterized multiperiodic nanostructured dielectric waveguides with two and three compound periods as well as deterministic aperiodic nanostructured waveguides based...

  12. Investigation of Aperiodic Time Processes with Autocorrelation and Fourier Analysis

    Science.gov (United States)

    Exner, Marie Luise

    1958-01-01

    Autocorrelation and frequency analyses of a series of aperiodic time events, in particular, filtered noises and sibilant sounds, were made. The position and band width of the frequency ranges are best obtained from the frequency analysis, but the energies contained in the several bands are most easily obtained from the autocorrelation function. The mean number of zero crossings of the time function was determined from the curvature of the latter function in the vicinity of the zero crossing, and also with the aid of a decimal counter. The second method was found to be more exact.

  13. GRILLIX. A 3D turbulence code for magnetic fusion devices based on a field line map

    International Nuclear Information System (INIS)

    Stegmeir, Andreas Korbinian

    2015-01-01

    The complex geometry in the scrape-off layer of tokamaks poses problems to existing turbulence codes. The usually employed field aligned coordinates become ill defined at the separatrix. Therefore the parallel code GRILLIX was developed, which is based on a field line map. This allows simulations in additional complex geometries, especially across the separatrix. A new discretisation, based on the support operator method, for the highly anisotropic diffusion was developed and applied to a simple turbulence model (Hasegawa-Wakatani).

  14. Characterization of the Turbulent Magnetic Integral Length in the Solar Wind: From 0.3 to 5 Astronomical Units

    Science.gov (United States)

    Ruiz, M. E.; Dasso, S.; Matthaeus, W. H.; Weygand, J. M.

    2014-10-01

    The solar wind is a structured and complex system, in which the fields vary strongly over a wide range of spatial and temporal scales. As an example, the turbulent activity in the wind affects the evolution in the heliosphere of the integral turbulent scale or correlation length [ λ], usually associated with the breakpoint in the turbulent-energy spectrum that separates the inertial range from the injection range. This large variability of the fields demands a statistical description of the solar wind. We study the probability distribution function (PDF) of the magnetic-autocorrelation lengths observed in the solar wind at different distances from the Sun. We used observations from the Helios, ACE, and Ulysses spacecraft. We distinguished between the usual solar wind and one of its transient components (interplanetary coronal mass ejections, ICMEs), and also studied solar-wind samples with low and high proton beta [βp]. We find that in the last three regimes the PDF of λ is a log-normal function, consistent with the multiplicative and nonlinear processes that take place in the solar wind, the initial λ (before the Alfvénic point) being larger in ICMEs.

  15. Effects of Magnetic and Kinetic Helicities on the Growth of Magnetic Fields in Laminar and Turbulent Flows by Helical Fourier Decomposition

    Energy Technology Data Exchange (ETDEWEB)

    Linkmann, Moritz; Sahoo, Ganapati; Biferale, Luca [Department of Physics and INFN, University of Rome Tor Vergata, Via della Ricerca Scientifica 1, I-00133 Rome (Italy); McKay, Mairi; Berera, Arjun [School of Physics and Astronomy, University of Edinburgh, Peter Guthrie Tait Road, EH9 3FD, Edinburgh (United Kingdom)

    2017-02-10

    We present a numerical and analytical study of incompressible homogeneous conducting fluids using a helical Fourier representation. We analytically study both small- and large-scale dynamo properties, as well as the inverse cascade of magnetic helicity, in the most general minimal subset of interacting velocity and magnetic fields on a closed Fourier triad. We mainly focus on the dependency of magnetic field growth as a function of the distribution of kinetic and magnetic helicities among the three interacting wavenumbers. By combining direct numerical simulations of the full magnetohydrodynamics equations with the helical Fourier decomposition, we numerically confirm that in the kinematic dynamo regime the system develops a large-scale magnetic helicity with opposite sign compared to the small-scale kinetic helicity, a sort of triad-by-triad α -effect in Fourier space. Concerning the small-scale perturbations, we predict theoretically and confirm numerically that the largest instability is achived for the magnetic component with the same helicity of the flow, in agreement with the Stretch–Twist–Fold mechanism. Vice versa, in the presence of Lorentz feedback on the velocity, we find that the inverse cascade of magnetic helicity is mostly local if magnetic and kinetic helicities have opposite signs, while it is more nonlocal and more intense if they have the same sign, as predicted by the analytical approach. Our analytical and numerical results further demonstrate the potential of the helical Fourier decomposition to elucidate the entangled dynamics of magnetic and kinetic helicities both in fully developed turbulence and in laminar flows.

  16. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  17. The dynamic evolution of active-region-scale magnetic flux tubes in the turbulent solar convective envelope

    Science.gov (United States)

    Weber, Maria Ann

    2014-12-01

    The Sun exhibits cyclic properties of its large-scale magnetic field on the order of sigma22 years, with a ˜11 year frequency of sunspot occurrence. These sunspots, or active regions, are the centers of magnetically driven phenomena such as flares and coronal mass ejections. Volatile solar magnetic events directed toward the Earth pose a threat to human activities and our increasingly technological society. As such, the origin and nature of solar magnetic flux emergence is a topic of global concern. Sunspots are observable manifestations of solar magnetic fields, thus providing a photospheric link to the deep-seated dynamo mechanism. However, the manner by which bundles of magnetic field, or flux tubes, traverse the convection zone to eventual emergence at the solar surface is not well understood. To provide a connection between dynamo-generated magnetic fields and sunspots, I have performed simulations of magnetic flux emergence through the bulk of a turbulent, solar convective envelope by employing a thin flux tube model subject to interaction with flows taken from a hydrodynamic convection simulation computed through the Anelastic Spherical Harmonic (ASH) code. The convective velocity field interacts with the flux tube through the drag force it experiences as it traverses through the convecting medium. Through performing these simulations, much insight has been gained about the influence of turbulent solar-like convection on the flux emergence process and resulting active region properties. I find that the dynamic evolution of flux tubes change from convection dominated to magnetic buoyancy dominated as the initial field strength of the flux tubes increases from 15 kG to 100 kG. Additionally, active-region-scale flux tubes of 40 kG and greater exhibit properties similar to those of active regions on the Sun, such as: tilt angles, rotation rates, and morphological asymmetries. The joint effect of the Coriolis force and helical motions present in convective

  18. Sustained Magnetorotational Turbulence in Local Simulations of Stratified Disks with Zero Net Magnetic Flux

    DEFF Research Database (Denmark)

    W. Davis, S.; M. Stone, J.; Pessah, Martin Elias

    2010-01-01

    We examine the effects of density stratification on magnetohydrodynamic turbulence driven by the magnetorotational instability in local simulations that adopt the shearing box approximation. Our primary result is that, even in the absence of explicit dissipation, the addition of vertical gravity ....... Confirming the results of previous studies, we find oscillations in the large scale toroidal field with periods of ~10 orbits and describe the dynamo process that underlies these cycles....

  19. MAGNETIC FIELD STRUCTURES AND TURBULENT COMPONENTS IN THE STAR-FORMING MOLECULAR CLOUDS OMC-2 AND OMC-3

    International Nuclear Information System (INIS)

    Poidevin, Frederick; Bastien, Pierre; Matthews, Brenda C.

    2010-01-01

    The SCUBA polarized 850 μm thermal emission data of the OMC-2 region in Orion A are added to and homogeneously reduced with data already available in the OMC-3 region. The data set shows that OMC-2 is a region generally less polarized than OMC-3. Where coincident, most of the 850 μm polarization pattern is similar to that measured in 350 μm polarization data. Only 850 μm polarimetry data have been obtained in and around MMS7, FIR1 and FIR2, and in the region south of FIR6. A realignment of the polarization vectors with the filament can be seen near FIR1 in the region south of OMC-3. An analysis shows that the energy injected by CO outflows and H 2 jets associated with OMC-2 and OMC-3 does not appear to alter the polarization patterns at a scale of the 14'' resolution beam. A second-order structure function analysis of the polarization position angles shows that OMC-2 is a more turbulent region than OMC-3. OMC-3 appears to be a clear case of a magnetically dominated region with respect to the turbulence. However, for OMC-2 it is not clear that this is the case. A more in-depth analysis of five regions displayed along OMC-2/3 indicates a decrease of the mean polarization degree and an increase of the turbulent angular dispersion from north to south. A statistical analysis suggests the presence of two depolarization regimes in our maps: one regime including the effects of the cores, the other one excluding it.

  20. Structure of the solar nebula, growth and decay of magnetic fields and effects of magnetic and turbulent viscosities on the nebula

    International Nuclear Information System (INIS)

    Hayashi, Chushiro

    1982-01-01

    First, distributions of surface densities of dust materials and gases in a preplanetary solar nebula, which give a good fit to the distribution of the planetary mass, are presented and the over-all structure of this nebula, which is in thermal and gravitational equilibrium, is studied. Second, in order to see magnetic effect on the structure, electric conductivity of a gas ionized by cosmic rays and radioactivities contained in dust grains is estimated for each region of the nebula and, then, the growth and decay of seed magnetic fields, which are due to differential rotation of the nebula and to the Joule dissipation, respectively, are calculated. The results indicate that, in regions of the terrestrial planets, magnetic fields decay much faster than they grow and magnetic effects can be ignored, except for the outermost layers of very low density. This is not the case for regions of Uranus and Neptune where magnetic fields can be amplified to considerable extents. Third, the transport of angular momentum due to magnetic and mechanical turbulent viscosities and the resultant redistribution of surface density in the nebula are investigated. The results show that the density redistribution occurs, in general, in a direction to attain a distribution of surface density which has nearly the same ν-dependence as that obtained from the present distribution of the planetary mass. This redistribution seems to be possible if it occurs at a formation stage of the nebula where the presence of large viscosities is expected. Finally, a comment is given on the initial condition of a collapsing interstellar cloud from which the solar nebula is formed at the end of the collapse. (author)

  1. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Xie Yong E-mail: xie813@263.net; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-10-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells.

  2. A Meta-Analysis of Aperiodic Noise Stress on Human Performance

    National Research Council Canada - National Science Library

    Saxton, B. M; Ross, J. M; Braczyk, A; Conway, G. E; Szalma, J. L; Hancock, P. A

    2006-01-01

    Aperiodic noise, also known as intermittent noise, is a pervasive and influential source of stress across military environments, and can be defined by the changes in its intensity over a given period of time...

  3. Plasma turbulence calculations on supercomputers

    International Nuclear Information System (INIS)

    Carreras, B.A.; Charlton, L.A.; Dominguez, N.; Drake, J.B.; Garcia, L.; Leboeuf, J.N.; Lee, D.K.; Lynch, V.E.; Sidikman, K.

    1991-01-01

    Although the single-particle picture of magnetic confinement is helpful in understanding some basic physics of plasma confinement, it does not give a full description. Collective effects dominate plasma behavior. Any analysis of plasma confinement requires a self-consistent treatment of the particles and fields. The general picture is further complicated because the plasma, in general, is turbulent. The study of fluid turbulence is a rather complex field by itself. In addition to the difficulties of classical fluid turbulence, plasma turbulence studies face the problems caused by the induced magnetic turbulence, which couples field by itself. In addition to the difficulties of classical fluid turbulence, plasma turbulence studies face the problems caused by the induced magnetic turbulence, which couples back to the fluid. Since the fluid is not a perfect conductor, this turbulence can lead to changes in the topology of the magnetic field structure, causing the magnetic field lines to wander radially. Because the plasma fluid flows along field lines, they carry the particles with them, and this enhances the losses caused by collisions. The changes in topology are critical for the plasma confinement. The study of plasma turbulence and the concomitant transport is a challenging problem. Because of the importance of solving the plasma turbulence problem for controlled thermonuclear research, the high complexity of the problem, and the necessity of attacking the problem with supercomputers, the study of plasma turbulence in magnetic confinement devices is a Grand Challenge problem

  4. Bias driven coherent carrier dynamics in a two-dimensional aperiodic potential

    NARCIS (Netherlands)

    de Moura, F. A. B. F.; Viana, L. P.; Lyra, M. L.; Malyshev, Victor; Dominguez-Adame, F.

    2008-01-01

    We study the dynamics of an electron wave-packet in a two-dimensional square lattice with an aperiodic site potential in the presence of an external uniform electric field. The aperiodicity is described by epsilon(m) = V cos(pi alpha m(x)(nu x)) cos(pi alpha m(y)(nu y)) at lattice sites (m(x),m(y)),

  5. Coronae as Consequence of Large Scale Magnetic Fields in Turbulent Accretion Disks

    DEFF Research Database (Denmark)

    G. Blackman, Eric; Pessah, Martin Elias

    2009-01-01

    emission. Our results suggest that a significant fraction of the magnetic energy in accretion disks resides in large scale fields, which in turn provides circumstantial evidence for significant non-local transport phenomena and the need for large scale magnetic field generation. For the example of Seyfert...

  6. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  7. Physical interpretation of the angle-dependent magnetic helicity spectrum in the solar wind: The nature of turbulent fluctuations near the proton gyroradius scale

    Energy Technology Data Exchange (ETDEWEB)

    Klein, Kristopher G.; Howes, Gregory G. [Department of Physics and Astronomy, University of Iowa, Iowa City, IA 52242 (United States); TenBarge, Jason M. [IREAP, University of Maryland, College Park, MD 20742 (United States); Podesta, John J., E-mail: kristopher-klein@uiowa.edu [Center for Space Plasma Physics, Space Science Institute, Boulder, CO 80301 (United States)

    2014-04-20

    Motivated by recent observations of distinct parallel and perpendicular signatures in magnetic helicity measurements segregated by wave period and angle between the local magnetic field and the solar wind velocity, this paper undertakes a comparison of three intervals of Ulysses data with synthetic time series generated from a physically motivated turbulence model. From these comparisons, it is hypothesized that the observed signatures result from a perpendicular cascade of Alfvénic fluctuations and a local, non-turbulent population of ion-cyclotron or whistler waves generated by temperature anisotropy instabilities. By constraining the model's free parameters through comparison to in situ data, it is found that, on average, ∼95% of the power near dissipative scales is contained in a perpendicular Alfvénic cascade and that the parallel fluctuations are propagating nearly unidirectionally. The effects of aliasing on magnetic helicity measurements are considered and shown to be significant near the Nyquist frequency.

  8. Is the Magnetic Field in the Heliosheath Laminar or a Turbulent Sea of Bubbles?

    Science.gov (United States)

    Opher, M.; Drake, J. F.; Swisdak, M.; Schoeffler, K. M.; Richardson, J. D.; Decker, R. B.; Toth, G.

    2011-06-01

    All current global models of the heliosphere are based on the assumption that the magnetic field in the heliosheath, in the region close to the heliopause (HP), is laminar. We argue that in that region the heliospheric magnetic field is not laminar but instead consists of magnetic bubbles. We refer to it as the bubble-dominated heliosheath region. Recently, we proposed that the annihilation of the "sectored" magnetic field within the heliosheath as it is compressed on its approach to the HP produces anomalous cosmic rays and also energetic electrons. As a product of the annihilation of the sectored magnetic field, densely packed magnetic islands (which further interact to form magnetic bubbles) are produced. These magnetic islands/bubbles will be convected with ambient flows as the sector region is carried to higher latitudes filling the heliosheath. We further argue that the magnetic islands/bubbles will develop upstream within the heliosheath. As a result, the magnetic field in the heliosheath sector region will be disordered well upstream of the HP. We present a three-dimensional MHD simulation with very high numerical resolution that captures the north-south boundaries of the sector region. We show that due to the high pressure of the interstellar magnetic field a north-south asymmetry develops such that the disordered sectored region fills a large portion of the northern part of the heliosphere with a smaller extension in the southern hemisphere. We suggest that this scenario is supported by the following changes that occurred around 2008 and from 2009.16 onward: (1) the sudden decrease in the intensity of low energy electrons (0.02-1.5 MeV) detected by Voyager 2, (2) a sharp reduction in the intensity of fluctuations of the radial flow, and (3) the dramatic differences in intensity trends between galactic cosmic ray electrons (3.8-59 MeV) at Voyager 1 and 2. We argue that these observations are a consequence of Voyager 2 leaving the sector region of

  9. Tempered Lévy walk of charged particles in turbulent magnetic field

    International Nuclear Information System (INIS)

    Sibatov, R T; Uchaikin, V V; Byzykchi, A N

    2017-01-01

    Recently, various diffusion regimes of ions and electrons in interplanetary magnetic field have been recognized from the data collected by different spacecrafts. Particularly for protons, superdiffusion and normal diffusion parallel to the mean magnetic field were declared, simulation also predicts transient superdiffusive behavior. We interpret parallel motion in terms of the one-dimensional tempered Lévy walk process and show that this representation is consistent with the experimental and simulated results. (paper)

  10. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  11. TWO-DIMENSIONAL STELLAR EVOLUTION CODE INCLUDING ARBITRARY MAGNETIC FIELDS. II. PRECISION IMPROVEMENT AND INCLUSION OF TURBULENCE AND ROTATION

    International Nuclear Information System (INIS)

    Li Linghuai; Sofia, Sabatino; Basu, Sarbani; Demarque, Pierre; Ventura, Paolo; Penza, Valentina; Bi Shaolan

    2009-01-01

    In the second paper of this series we pursue two objectives. First, in order to make the code more sensitive to small effects, we remove many approximations made in Paper I. Second, we include turbulence and rotation in the two-dimensional framework. The stellar equilibrium is described by means of a set of five differential equations, with the introduction of a new dependent variable, namely the perturbation to the radial gravity, that is found when the nonradial effects are considered in the solution of the Poisson equation. Following the scheme of the first paper, we write the equations in such a way that the two-dimensional effects can be easily disentangled. The key concept introduced in this series is the equipotential surface. We use the underlying cause-effect relation to develop a recurrence relation to calculate the equipotential surface functions for uniform rotation, differential rotation, rotation-like toroidal magnetic fields, and turbulence. We also develop a more precise code to numerically solve the two-dimensional stellar structure and evolution equations based on the equipotential surface calculations. We have shown that with this formulation we can achieve the precision required by observations by appropriately selecting the convergence criterion. Several examples are presented to show that the method works well. Since we are interested in modeling the effects of a dynamo-type field on the detailed envelope structure and global properties of the Sun, the code has been optimized for short timescales phenomena (down to 1 yr). The time dependence of the code has so far been tested exclusively to address such problems.

  12. Ulysses observations of magnetic waves due to newborn interstellar pickup ions. II. Application of turbulence concepts to limiting wave energy and observability

    Energy Technology Data Exchange (ETDEWEB)

    Cannon, Bradford E. [Physics Department, Florida State University, Tallahassee, FL 32306 (United States); Smith, Charles W.; Isenberg, Philip A.; Vasquez, Bernard J.; Joyce, Colin J. [Physics Department and Space Science Center, Institute for the Study of Earth, Oceans, and Space, University of New Hampshire, Durham, NH 03824 (United States); Murphy, Neil [Jet Propulsion Laboratory, Mail Stop 180-600, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States); Nuno, Raquel G., E-mail: bc13h@my.fsu.edu, E-mail: Charles.Smith@unh.edu, E-mail: Phil.Isenberg@unh.edu, E-mail: Bernie.Vasquez@unh.edu, E-mail: cjl46@wildcats.unh.edu, E-mail: Neil.Murphy@jpl.nasa.gov, E-mail: raquel.nuno@asu.edu [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States)

    2014-06-01

    The low-frequency magnetic waves that arise from the isotropization of newborn interstellar pickup ions (PUIs) are reasonably well described by linear and quasi-linear kinetic theory in so far as those theories predict the wave frequency and polarization in the spacecraft frame. Those theories fail to describe the scarce observability of the waves. Quasilinear theory predicts that the wave power should accumulate over long periods of time as the relatively weak kinetic instability slowly adds power to the observed spectrum. At the same time it has been argued that the same wave energy must serve as a secondary source of thermal ion heating in the outer heliosphere once the initial turbulence is depleted. To the extent that turbulent transport of the wave energy acts against the spectrally confined accumulation of wave energy, turbulence should be a limiting factor in observability. We argue that turbulence does limit the observability of the waves and we use turbulence theory to predict the observed wave energy. We compare this prediction against a database of 502 wave observations attributed to newborn interstellar PUIs observed by the Ulysses spacecraft.

  13. Ulysses observations of magnetic waves due to newborn interstellar pickup ions. II. Application of turbulence concepts to limiting wave energy and observability

    International Nuclear Information System (INIS)

    Cannon, Bradford E.; Smith, Charles W.; Isenberg, Philip A.; Vasquez, Bernard J.; Joyce, Colin J.; Murphy, Neil; Nuno, Raquel G.

    2014-01-01

    The low-frequency magnetic waves that arise from the isotropization of newborn interstellar pickup ions (PUIs) are reasonably well described by linear and quasi-linear kinetic theory in so far as those theories predict the wave frequency and polarization in the spacecraft frame. Those theories fail to describe the scarce observability of the waves. Quasilinear theory predicts that the wave power should accumulate over long periods of time as the relatively weak kinetic instability slowly adds power to the observed spectrum. At the same time it has been argued that the same wave energy must serve as a secondary source of thermal ion heating in the outer heliosphere once the initial turbulence is depleted. To the extent that turbulent transport of the wave energy acts against the spectrally confined accumulation of wave energy, turbulence should be a limiting factor in observability. We argue that turbulence does limit the observability of the waves and we use turbulence theory to predict the observed wave energy. We compare this prediction against a database of 502 wave observations attributed to newborn interstellar PUIs observed by the Ulysses spacecraft.

  14. On the difference between the magnetic intermittent micro-structures in fast wind and slow wind and it's implication for the solar wind turbulence cascade

    Science.gov (United States)

    Tu, C.; Wang, X.; He, J.; Marsch, E.; Wang, L.

    2013-12-01

    The magnetic intermittent micro-structures (on time scales of 20-40s) in both fast and slow solar wind are studied by using plasma and field measurements from the WIND spacecraft. In the fast wind these structures are found to be composed of mostly rotational discontinuities (RDs) and rarely tangential current sheets (TCSs). The RDs do not show prominent plasma-parameter changes. Conversely, the TCSs have a distinct tendency to be associated with local enhancements of the proton temperature, density, and plasma beta, and a local decrease of the magnetic field magnitude. These results show that dissipation of solar wind turbulence can take place in intermittent or locally isolated small-scale regions which correspond to the TCSs found in fast wind. However in slow wind, magnetic intermittent micro-structures are found to consist of mainly magnetic field directional turnings (MFDTs, Tu & Marsch, Ann. Geophysicae, 9, 319,1991) and rarely tangential current sheets (TCSs). The MFDTs are characterized by: (1) clear variation of the field component in the L dimension of the LMN coordinate system using the MVA method; (2) at least one of B_M or B_N is near to zero, or the velocity component V_L is near to zero; (3) the magnetic magnitude does not have a clear change; (4) no significant temperature and density peaks. The TCSs found in slow wind are not associated with prominent temperature enhancements. The TCSs found in both fast and slow wind may be created by turbulence interactions. The heating effect of TCSs in slow wind is weaker because the turbulence level is lower. The origin of the RDs in fast wind and the MFDTs in slow wind will be a topic for future studies. MFDTs may be observed when crossing a magnetic helical micro-tube, which may be formed due to tearing mode instability and magnetic multi-x-point reconnection in the slow wind.

  15. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  16. A PROPOSED PARADIGM FOR SOLAR CYCLE DYNAMICS MEDIATED VIA TURBULENT PUMPING OF MAGNETIC FLUX IN BABCOCK–LEIGHTON-TYPE SOLAR DYNAMOS

    Energy Technology Data Exchange (ETDEWEB)

    Hazra, Soumitra; Nandy, Dibyendu [Department of Physical Sciences, Indian Institute of Science Education and Research, Kolkata (India)

    2016-11-20

    At present, the Babcock–Leighton flux transport solar dynamo models appear to be the most promising models for explaining diverse observational aspects of the sunspot cycle. The success of these flux transport dynamo models is largely dependent upon a single-cell meridional circulation with a deep equatorward component at the base of the Sun’s convection zone. However, recent observations suggest that the meridional flow may in fact be very shallow (confined to the top 10% of the Sun) and more complex than previously thought. Taken together, these observations raise serious concerns on the validity of the flux transport paradigm. By accounting for the turbulent pumping of magnetic flux, as evidenced in magnetohydrodynamic simulations of solar convection, we demonstrate that flux transport dynamo models can generate solar-like magnetic cycles even if the meridional flow is shallow. Solar-like periodic reversals are recovered even when meridional circulation is altogether absent. However, in this case, the solar surface magnetic field dynamics does not extend all the way to the polar regions. Very importantly, our results demonstrate that the Parker–Yoshimura sign rule for dynamo wave propagation can be circumvented in Babcock–Leighton dynamo models by the latitudinal component of turbulent pumping, which can generate equatorward propagating sunspot belts in the absence of a deep, equatorward meridional flow. We also show that variations in turbulent pumping coefficients can modulate the solar cycle amplitude and periodicity. Our results suggest the viability of an alternate magnetic flux transport paradigm—mediated via turbulent pumping—for sustaining solar-stellar dynamo action.

  17. Transport and turbulence in a magnetized plasma (application to tokamak plasmas); Transport et turbulence dans un plasma magnetise (application aux plasmas de tokamaks)

    Energy Technology Data Exchange (ETDEWEB)

    Sarazin, Y

    2004-03-01

    This document gathers the lectures made in the framework of a Ph.D level physics class dedicated to plasma physics. This course is made up of 3 parts : 1) collisions and transport, 2) transport and turbulence, and 3) study of a few exchange instabilities. More precisely the first part deals with the following issues: thermonuclear fusion, Coulomb collisions, particles trajectories in a tokamak, neo-classical transport in tokamaks, the bootstrap current, and ware pinch. The second part involves: particle transport in tokamaks, quasi-linear transport, resonance islands, resonance in tokamaks, from quasi to non-linear transport, and non-linear saturation of turbulence. The third part deals with: shift velocities in fluid theory, a model for inter-change instabilities, Rayleigh-Benard instability, Hasegawa-Wakatani model, and Hasegawa-Mima model. This document ends with a series of appendices dealing with: particle-wave interaction, determination of the curvature parameter G, Rossby waves.

  18. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure.

    Science.gov (United States)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-12-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air-cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one.

  19. Weakened Magnetization and Onset of Large-scale Turbulence in the Young Solar Wind—Comparisons of Remote Sensing Observations with Simulation

    Science.gov (United States)

    Chhiber, Rohit; Usmanov, Arcadi V.; DeForest, Craig E.; Matthaeus, William H.; Parashar, Tulasi N.; Goldstein, Melvyn L.

    2018-04-01

    Recent analysis of Solar-Terrestrial Relations Observatory (STEREO) imaging observations have described the early stages of the development of turbulence in the young solar wind in solar minimum conditions. Here we extend this analysis to a global magnetohydrodynamic (MHD) simulation of the corona and solar wind based on inner boundary conditions, either dipole or magnetogram type, that emulate solar minimum. The simulations have been calibrated using Ulysses and 1 au observations, and allow, within a well-understood context, a precise determination of the location of the Alfvén critical surfaces and the first plasma beta equals unity surfaces. The compatibility of the the STEREO observations and the simulations is revealed by direct comparisons. Computation of the radial evolution of second-order magnetic field structure functions in the simulations indicates a shift toward more isotropic conditions at scales of a few Gm, as seen in the STEREO observations in the range 40–60 R ⊙. We affirm that the isotropization occurs in the vicinity of the first beta unity surface. The interpretation based on early stages of in situ solar wind turbulence evolution is further elaborated, emphasizing the relationship of the observed length scales to the much smaller scales that eventually become the familiar turbulence inertial range cascade. We argue that the observed dynamics is the very early manifestation of large-scale in situ nonlinear couplings that drive turbulence and heating in the solar wind.

  20. Plasma turbulence in tokamaks

    Energy Technology Data Exchange (ETDEWEB)

    Caldas, Ibere L.; Heller, M.V.A.P.; Brasilio, Z.A. [Sao Paulo Univ., SP, RJ (Brazil). Inst. de Fisica

    1997-12-31

    Full text. In this work we summarize the results from experiments on electrostatic and magnetic fluctuations in tokamak plasmas. Spectral analyses show that these fluctuations are turbulent, having a broad spectrum of wavectors and a broad spectrum of frequencies at each wavector. The electrostatic turbulence induces unexpected anomalous particle transport that deteriorates the plasma confinement. The relationship of these fluctuations to the current state of plasma theory is still unclear. Furthermore, we describe also attempts to control this plasma turbulence with external magnetic perturbations that create chaotic magnetic configurations. Accordingly, the magnetic field lines may become chaotic and then induce a Lagrangian diffusion. Moreover, to discuss nonlinear coupling and intermittency, we present results obtained by using numerical techniques as bi spectral and wavelet analyses. (author)

  1. Suppression of turbulent resistivity in turbulent Couette flow

    International Nuclear Information System (INIS)

    Si, Jiahe; Sonnenfeld, Richard G.; Colgate, Arthur S.; Westpfahl, David J.; Romero, Van D.; Martinic, Joe; Colgate, Stirling A.; Li, Hui; Nornberg, Mark D.

    2015-01-01

    Turbulent transport in rapidly rotating shear flow very efficiently transports angular momentum, a critical feature of instabilities responsible both for the dynamics of accretion disks and the turbulent power dissipation in a centrifuge. Turbulent mixing can efficiently transport other quantities like heat and even magnetic flux by enhanced diffusion. This enhancement is particularly evident in homogeneous, isotropic turbulent flows of liquid metals. In the New Mexico dynamo experiment, the effective resistivity is measured using both differential rotation and pulsed magnetic field decay to demonstrate that at very high Reynolds number rotating shear flow can be described entirely by mean flow induction with very little contribution from correlated velocity fluctuations

  2. Suppression of turbulent resistivity in turbulent Couette flow

    Science.gov (United States)

    Si, Jiahe; Colgate, Stirling A.; Sonnenfeld, Richard G.; Nornberg, Mark D.; Li, Hui; Colgate, Arthur S.; Westpfahl, David J.; Romero, Van D.; Martinic, Joe

    2015-07-01

    Turbulent transport in rapidly rotating shear flow very efficiently transports angular momentum, a critical feature of instabilities responsible both for the dynamics of accretion disks and the turbulent power dissipation in a centrifuge. Turbulent mixing can efficiently transport other quantities like heat and even magnetic flux by enhanced diffusion. This enhancement is particularly evident in homogeneous, isotropic turbulent flows of liquid metals. In the New Mexico dynamo experiment, the effective resistivity is measured using both differential rotation and pulsed magnetic field decay to demonstrate that at very high Reynolds number rotating shear flow can be described entirely by mean flow induction with very little contribution from correlated velocity fluctuations.

  3. Suppression of turbulent resistivity in turbulent Couette flow

    Energy Technology Data Exchange (ETDEWEB)

    Si, Jiahe, E-mail: jsi@nmt.edu; Sonnenfeld, Richard G.; Colgate, Arthur S.; Westpfahl, David J.; Romero, Van D.; Martinic, Joe [New Mexico Institute of Mining and Technology, Socorro, New Mexico 87801 (United States); Colgate, Stirling A.; Li, Hui [Los Alamos National Laboratory, Los Alamos, New Mexico 87544 (United States); Nornberg, Mark D. [University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States)

    2015-07-15

    Turbulent transport in rapidly rotating shear flow very efficiently transports angular momentum, a critical feature of instabilities responsible both for the dynamics of accretion disks and the turbulent power dissipation in a centrifuge. Turbulent mixing can efficiently transport other quantities like heat and even magnetic flux by enhanced diffusion. This enhancement is particularly evident in homogeneous, isotropic turbulent flows of liquid metals. In the New Mexico dynamo experiment, the effective resistivity is measured using both differential rotation and pulsed magnetic field decay to demonstrate that at very high Reynolds number rotating shear flow can be described entirely by mean flow induction with very little contribution from correlated velocity fluctuations.

  4. Asymptotic period of an aperiodic Markov chain and the strong ratio limit property

    NARCIS (Netherlands)

    van Doorn, Erik A.

    We introduce the concept of asymptotic period for an irreducible and aperiodic discrete-time Markov chain on a countable state space. If the chain is transient its asymptotic period may be larger than one. We present some sufficient conditions and, in the more restricted setting of birth-death

  5. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  6. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  7. Turbulence in the solar wind

    CERN Document Server

    Bruno, Roberto

    2016-01-01

    This book provides an overview of solar wind turbulence from both the theoretical and observational perspective. It argues that the interplanetary medium offers the best opportunity to directly study turbulent fluctuations in collisionless plasmas. In fact, during expansion, the solar wind evolves towards a state characterized by large-amplitude fluctuations in all observed parameters, which resembles, at least at large scales, the well-known hydrodynamic turbulence. This text starts with historical references to past observations and experiments on turbulent flows. It then introduces the Navier-Stokes equations for a magnetized plasma whose low-frequency turbulence evolution is described within the framework of the MHD approximation. It also considers the scaling of plasma and magnetic field fluctuations and the study of nonlinear energy cascades within the same framework. It reports observations of turbulence in the ecliptic and at high latitude, treating Alfvénic and compressive fluctuations separately in...

  8. MULTIFLUID MAGNETOHYDRODYNAMIC TURBULENT DECAY

    International Nuclear Information System (INIS)

    Downes, T. P.; O'Sullivan, S.

    2011-01-01

    It is generally believed that turbulence has a significant impact on the dynamics and evolution of molecular clouds and the star formation that occurs within them. Non-ideal magnetohydrodynamic (MHD) effects are known to influence the nature of this turbulence. We present the results of a suite of 512 3 resolution simulations of the decay of initially super-Alfvenic and supersonic fully multifluid MHD turbulence. We find that ambipolar diffusion increases the rate of decay of the turbulence while the Hall effect has virtually no impact. The decay of the kinetic energy can be fitted as a power law in time and the exponent is found to be -1.34 for fully multifluid MHD turbulence. The power spectra of density, velocity, and magnetic field are all steepened significantly by the inclusion of non-ideal terms. The dominant reason for this steepening is ambipolar diffusion with the Hall effect again playing a minimal role except at short length scales where it creates extra structure in the magnetic field. Interestingly we find that, at least at these resolutions, the majority of the physics of multifluid turbulence can be captured by simply introducing fixed (in time and space) resistive terms into the induction equation without the need for a full multifluid MHD treatment. The velocity dispersion is also examined and, in common with previously published results, it is found not to be power law in nature.

  9. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  10. Spatial and spectral detection of protein monolayers with deterministic aperiodic arrays of metal nanoparticles

    Science.gov (United States)

    Lee, Sylvanus Y.; Amsden, Jason J.; Boriskina, Svetlana V.; Gopinath, Ashwin; Mitropolous, Alexander; Kaplan, David L.; Omenetto, Fiorenzo G.; Negro, Luca Dal

    2010-01-01

    Light scattering phenomena in periodic systems have been investigated for decades in optics and photonics. Their classical description relies on Bragg scattering, which gives rise to constructive interference at specific wavelengths along well defined propagation directions, depending on illumination conditions, structural periodicity, and the refractive index of the surrounding medium. In this paper, by engineering multifrequency colorimetric responses in deterministic aperiodic arrays of nanoparticles, we demonstrate significantly enhanced sensitivity to the presence of a single protein monolayer. These structures, which can be readily fabricated by conventional Electron Beam Lithography, sustain highly complex structural resonances that enable a unique optical sensing approach beyond the traditional Bragg scattering with periodic structures. By combining conventional dark-field scattering micro-spectroscopy and simple image correlation analysis, we experimentally demonstrate that deterministic aperiodic surfaces with engineered structural color are capable of detecting, in the visible spectral range, protein layers with thickness of a few tens of Angstroms. PMID:20566892

  11. Aperiodicity in one-way Markov cycles and repeat times of large earthquakes in faults

    OpenAIRE

    Tejedor, Alejandro; Gómez, Javier; Pacheco, Amalio F.

    2011-01-01

    A common use of Markov Chains is the simulation of the seismic cycle in a fault, i.e. as a renewal model for the repetition of its characteristic earthquakes. This representation is consistent with Reid's elastic rebound theory. Here it is proved that in {\\it any} one-way Markov cycle, the aperiodicity of the corresponding distribution of cycle lengths is always lower than one. This fact concurs with observations of large earthquakes in faults all over the world.

  12. Turbulent dispersion of many particles

    Science.gov (United States)

    Pratt, J.; Busse, A.; Muller, W. C.

    2017-12-01

    We demonstrate the utility of the convex hull to analyze dispersion of groups of many Lagrangian tracer particles in turbulence. We examine dispersion in turbulent flows driven by convection, relevant to geophysical flows and the spread of contaminants in the atmosphere, and in turbulent flows affected by magnetic fields, relevant to stellar winds and stellar interiors. Convex hull analysis can provide new information about local dispersion, in the form of the surface area and volume for a cluster of particles. We use dispersive information to examine the local anisotropy that occurs in these turbulent settings, and to understand fundamental characteristics of heat transfer and the small-scale dynamo.

  13. Homogenization procedures for the constitutive material modeling and analysis of aperiodic micro-structures

    Science.gov (United States)

    Aghalaya Manjunatha, Preetham

    Composite materials are the well-known substitutes for traditional metals in various industries because of their micro-structural character. Micro-structures provide a high strength-to-weight ratio, which makes them suitable for manufacturing large variety of applications ranging from simple toys to complicated space/aircraft structures. Since, these materials are widely used in high performance structures, their stress/thermal analysis issues are of major concern. Due to the high degree of material heterogeneity, it is extremely difficult to analyze such structures. Homogenization (rigorous averaging) is a process that overcomes the difficulty of modeling each micro-structure. It replaces an individual micro-structure by an equivalent material model representation (unit cell). Periodic micro-structures appear in regular intervals throughout the domain, in contrast aperiodic micro-structures follows an irregular pattern. Further, this method bridges the analysis gap between micro and macro domain of the structures. In this thesis, Homogenization procedure based on anti-periodic displacement fields for aperiodic micro-structures and aperiodic boundary conditions are considered to model the constitutive material matrix. This work could be easily implemented with the traditional finite element packages. In addition, it eventually increases the convergence accuracy and reduces the high computational expenses. Different problems are analyzed by the implementation of digital image processing schemes for the extraction of a unit cell around the Gauss quadrature points and the mesh-generation. In the future, this research defines a new path for the analysis of any random heterogeneous materials by its ease of implementation and the state-of-the-art micro-structure material modeling capabilities and digital image based micro-meshing.

  14. High Turbulence

    CERN Multimedia

    EuHIT, Collaboration

    2015-01-01

    As a member of the EuHIT (European High-Performance Infrastructures in Turbulence - see here) consortium, CERN is participating in fundamental research on turbulence phenomena. To this end, the Laboratory provides European researchers with a cryogenic research infrastructure (see here), where the first tests have just been performed.

  15. Plasma turbulence

    International Nuclear Information System (INIS)

    Horton, W.

    1998-07-01

    The origin of plasma turbulence from currents and spatial gradients in plasmas is described and shown to lead to the dominant transport mechanism in many plasma regimes. A wide variety of turbulent transport mechanism exists in plasmas. In this survey the authors summarize some of the universally observed plasma transport rates

  16. Electromotive force in strongly compressible magnetohydrodynamic turbulence

    Science.gov (United States)

    Yokoi, N.

    2017-12-01

    Variable density fluid turbulence is ubiquitous in geo-fluids, not to mention in astrophysics. Depending on the source of density variation, variable density fluid turbulence may be divided into two categories: the weak compressible (entropy mode) turbulence for slow flow and the strong compressible (acoustic mode) turbulence for fast flow. In the strong compressible turbulence, the pressure fluctuation induces a strong density fluctuation ρ ', which is represented by the density variance ( denotes the ensemble average). The turbulent effect on the large-scale magnetic-field B induction is represented by the turbulent electromotive force (EMF) (u': velocity fluctuation, b': magnetic-field fluctuation). In the usual treatment in the dynamo theory, the expression for the EMF has been obtained in the framework of incompressible or weak compressible turbulence, where only the variation of the mean density , if any, is taken into account. We see from the equation of the density fluctuation ρ', the density variance is generated by the large mean density variation ∂ coupled with the turbulent mass flux . This means that in the region where the mean density steeply changes, the density variance effect becomes relevant for the magnetic field evolution. This situation is typically the case for phenomena associated with shocks and compositional discontinuities. With the aid of the analytical theory of inhomogeneous compressible magnetohydrodynamic (MHD) turbulence, the expression for the turbulent electromotive force is investigated. It is shown that, among others, an obliqueness (misalignment) between the mean density gradient ∂ and the mean magnetic field B may contribute to the EMF as ≈χ B×∂ with the turbulent transport coefficient χ proportional to the density variance (χ ). This density variance effect is expected to strongly affect the EMF near the interface, and changes the transport properties of turbulence. In the case of an interface under the MHD slow

  17. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  18. Rapidly tunable optical parametric oscillator based on aperiodic quasi-phase matching.

    Science.gov (United States)

    Descloux, Delphine; Dherbecourt, Jean-Baptiste; Melkonian, Jean-Michel; Raybaut, Myriam; Lai, Jui-Yu; Drag, Cyril; Godard, Antoine

    2016-05-16

    A new optical parametric oscillator (OPO) architecture with high tuning speed capability is demonstrated. This device exploits the versatility offered by aperiodic quasi-phase matching (QPM) to provide a broad parametric gain spectrum without changing the temperature, angle, or position of the nonlinear crystal. Rapid tuning is then straightforwardly achieved using a fast intracavity spectral filter. This concept is demonstrated here for a picosecond synchronously pumped OPO containing an aperiodically poled MgO-doped LiNbO3 crystal and a rapidly tunable spectral filter based on a diffraction grating. Tuning over 160 nm around 3.86 μm is achieved at fixed temperature and a fast tuning over 30 nm in 40 μs is demonstrated. Different configurations are tested and compared. The cavity length detuning is analyzed and discussed. This device is successfully used to detect N2O by absorption. This approach could be generalized to other spectral ranges (e.g., visible) and temporal regimes (e.g., continuous-wave or nanosecond).

  19. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  20. Functional continuity: did field-induced oriented aperiodic constraints at Life's origin aid its sequence-based evolution?

    Science.gov (United States)

    Mitra-Delmotte, G.; Mitra, A. N.

    2014-04-01

    A non-biological analog undergoing Darwinian-like evolution could have enhanced the probability of many crucial independent bottom-up emergent steps, engendered within its premises, and smoothen the inanimate-animate transition. Now, the higher-level environment-mutable DNA sequences influence the lower-level pattern of oriented templates (enzymes, lipid membranes, RNA) in the organized cell matrix and hence their associated substrate-dynamics; note how templates are akin to local fields, kinetically constraining reactant orientations. Since the lowerlevel is likely the more primitive of the two (rather than Cairns-Smith's "readily available" rigid clay crystal sequence-based replicators as a memory-like basis for slowly mutating predecessor-patterns enroute to complex RNA-based Darwinian evolution), a gradual thermodynamic-to-kinetic transition in an isotropic medium, is proposed as driven by some order-parameter --via "available" field-responsive dipolar colloid networks, as apart from bio-organics, mineral colloids also can display liquid crystal (LC) phases (see [1]). An access to solid-like orientational order in a fluid matrix suggests how aperiodic patterns can be influenced and sustained (a la homeostasis) via external inhomogeneous fields (e.g. magnetic rocks); this renders these cooperative networks with potential as confining host-media, whose environment-sensitivity can not only influence their sterically-coupled guest-substrates but also their network properties (the latter can enable 'functions' like spontaneous transport under non-equilibrium suggesting a natural basis for their selection by the environment). In turn LC systems could have been preceded by even simpler anisotropic fluid hosts, viz., external field-induced mineral magnetic nanoparticle (MNP) aggregates. Indeed, the capacity of an MNP to couple its magnetic and rotational d.o.f.s suggests how an environment-sensitive field-influenced network of interacting dipolar colloids close to

  1. THE EFFECT OF LARGE-SCALE MAGNETIC TURBULENCE ON THE ACCELERATION OF ELECTRONS BY PERPENDICULAR COLLISIONLESS SHOCKS

    International Nuclear Information System (INIS)

    Guo Fan; Giacalone, Joe

    2010-01-01

    We study the physics of electron acceleration at collisionless shocks that move through a plasma containing large-scale magnetic fluctuations. We numerically integrate the trajectories of a large number of electrons, which are treated as test particles moving in the time-dependent electric and magnetic fields determined from two-dimensional hybrid simulations (kinetic ions and fluid electron). The large-scale magnetic fluctuations effect the electrons in a number of ways and lead to efficient and rapid energization at the shock front. Since the electrons mainly follow along magnetic lines of force, the large-scale braiding of field lines in space allows the fast-moving electrons to cross the shock front several times, leading to efficient acceleration. Ripples in the shock front occurring at various scales will also contribute to the acceleration by mirroring the electrons. Our calculation shows that this process favors electron acceleration at perpendicular shocks. The current study is also helpful in understanding the injection problem for electron acceleration by collisionless shocks. It is also shown that the spatial distribution of energetic electrons is similar to in situ observations. The process may be important to our understanding of energetic electrons in planetary bow shocks and interplanetary shocks, and explaining herringbone structures seen in some type II solar radio bursts.

  2. Aperiodic superconducting phase boundary of periodic micronetworks in a magnetic field

    International Nuclear Information System (INIS)

    Nori, F.; Niu, Q.

    1988-01-01

    We study flux quantization in periodic arrays with two elementary cells having an irrational ratio of areas. In particular, we calculate the superconducting-normal phase boundary T/sub c/(H) and we analyze the origin of its overall and fine structure as a function of the network size. We discuss our theoretical results, exploiting the electronic tight-binding analogy to the Ginzburg-Landau equations, and compare them with the experimental ones

  3. Wave turbulence

    Science.gov (United States)

    Nazarenko, Sergey

    2015-07-01

    Wave turbulence is the statistical mechanics of random waves with a broadband spectrum interacting via non-linearity. To understand its difference from non-random well-tuned coherent waves, one could compare the sound of thunder to a piece of classical music. Wave turbulence is surprisingly common and important in a great variety of physical settings, starting with the most familiar ocean waves to waves at quantum scales or to much longer waves in astrophysics. We will provide a basic overview of the wave turbulence ideas, approaches and main results emphasising the physics of the phenomena and using qualitative descriptions avoiding, whenever possible, involved mathematical derivations. In particular, dimensional analysis will be used for obtaining the key scaling solutions in wave turbulence - Kolmogorov-Zakharov (KZ) spectra.

  4. Cryogenic turbulence

    CERN Multimedia

    CERN. Geneva. Audiovisual Unit

    2005-01-01

    Understanding turbulence is vital in astrophysics, geophysics and many engineering applications, with thermal convection playing a central role. I shall describe progress that has recently been made in understanding this ubiquitous phenomenon by making controlled experiments using low-temperature helium, and a brief account of the frontier topic of superfluid turbulence will also be given. CERN might be able to play a unique role in experiments to probe these two problems.

  5. Recent developments in plasma turbulence and turbulent transport

    Energy Technology Data Exchange (ETDEWEB)

    Terry, P.W. [Univ. of Wisconsin, Madison, WI (United States)

    1997-09-22

    This report contains viewgraphs of recent developments in plasma turbulence and turbulent transport. Localized nonlinear structures occur under a variety of circumstances in turbulent, magnetically confined plasmas, arising in both kinetic and fluid descriptions, i.e., in either wave-particle or three-wave coupling interactions. These structures are non wavelike. They cannot be incorporated in the collective wave response, but interact with collective modes through their shielding by the plasma dielectric. These structures are predicted to modify turbulence-driven transport in a way that in consistent with, or in some cases are confirmed by recent experimental observations. In kinetic theory, non wavelike structures are localized perturbations of phase space density. There are two types of structures. Holes are self-trapped, while clumps have a self-potential that is too weak to resist deformation and mixing by ambient potential fluctuations. Clumps remain correlated in turbulence if their spatial extent is smaller than the correlation length of the scattering fields. In magnetic turbulence, clumps travel along stochastic magnetic fields, shielded by the plasma dielectric. A drag on the clump macro-particle is exerted by the shielding, inducing emission into the collective response. The emission in turn damps back on the particle distribution via Landau dampling. The exchange of energy between clumps and particles, as mediated by the collective mode, imposes constraints on transport. For a turbulent spectrum whose mean wavenumber along the equilibrium magnetic field is nonzero, the electron thermal flux is proportional to the ion thermal velocity. Conventional predictions (which account only for collective modes) are larger by the square root of the ion to electron mass ratio. Recent measurements are consistent with the small flux. In fluid plasma,s localized coherent structures can occur as intense vortices.

  6. Experiment-Model Comparisons of Turbulence, Transport, and Flows in a Magnetized Linear Plasma Using a Global Two-Fluid Braginskii Solver

    Science.gov (United States)

    Gilmore, M.; Fisher, D. M.; Kelly, R. F.; Hatch, M. W.; Rogers, B. N.

    2017-10-01

    Ongoing experiments and numerical modeling of the dynamics of electrostatic turbulence and transport in the presence of flow shear are being conducted in helicon plasmas in the linear HelCat (Helicon-Cathode) device. Modeling is being done using GBS, a 3D, global two-fluid Braginskii code that solves self-consistently for plasma equilibrium as well as fluctuations. Past experimental measurements of flows have been difficult to reconcile with simple expectations, such as azimuthal flows being dominated by Er x Bz rotation. Therefore, recent measurements have focused on understanding plasma flows, and the role of neutral dynamics. In the model, a set of two-fluid drift-reduced Braginskii equations are evolved using the Global Braginskii Solver Code (GBS). For low-field helicon-sourced Ar plasmas a non-negligible cross-field thermal collisional term must be added to shift the electric potential in the ion momentum and vorticity equations as the ions are unmagnetized. Significant radially and axially dependent neutral profiles are also included in the simulations to try and match those observed in HelCat. Ongoing simulations show a mode dependence on the axial magnetic field along with strong axial variations that suggest drift waves may be important in the low-field case. Supported by U.S. National Science Foundation Award 1500423.

  7. Turbulent dynamo action in stars

    International Nuclear Information System (INIS)

    Brandenburg, A.; Nordlund, A.; Ruokolainen, J.; Stein, R.F.; Tuominen, I.

    1990-01-01

    The way in which dynamo action amplifies magnetic fields in the Sun, the Earth, and indeed galaxies is a classic problem of theoretical physics. Here we present the results of direct simulations of turbulent compressible hydromagnetic convection with a stable overshoot layer underneath (to model the Sun). We find spontaneous dynamo action followed by saturation, with most of the generated magnetic field appearing as coherent flux tubes in the vicinity of strong downdrafts. Here both the generation and destruction of magnetic field is at its most vigorous, and which process ultimately dominates depends on the sizes of the magnetic Reynolds and magnetic Prandtl numbers. (orig.)

  8. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  9. Swinging multi-source industrial CT systems for aperiodic dynamic imaging.

    Science.gov (United States)

    Wu, Weiwen; Yu, Hengyong; Gong, Changcheng; Liu, Fenglin

    2017-10-02

    The goal of this paper is to develop a new architecture for industrial computed tomography (ICT) aiming at dynamically imaging an aperiodic changing object. We propose a data acquisition approach with multiple x-ray source/detector pairs targeting a continuously changeable object with corresponding timeframes. In this named swinging multi-source CT (SMCT) structure, each source and its associated detector swing forth and back within a certain angle for CT scanning. In the SMCT system design, we utilize a circular journal bearing based setup to replace the normal CT slip ring by weakening the scanning speed requirement. Inspired by the prior image constrained compressed sensing (PICCS) algorithm, we apply a modified PICCS algorithm for the SMCT (SM-PICCS). Our numerical simulation and realistic specimen experiment studies demonstrate the feasibility of the proposed approach.

  10. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  11. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  12. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  13. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...... on the IEEE 14-bus and the Nordic32 test systems where results show that the method can efficiently determine the required active power redispatch to avoid an imminent instability....

  14. Hydromagnetic turbulence in the direct interaction approximation

    International Nuclear Information System (INIS)

    Nagarajan, S.

    1975-01-01

    The dissertation is concerned with the nature of turbulence in a medium with large electrical conductivity. Three distinct though inter-related questions are asked. Firstly, the evolution of a weak, random initial magnetic field in a highly conducting, isotropically turbulent fluid is discussed. This was first discussed in the paper 'Growth of Turbulent Magnetic Fields' by Kraichnan and Nagargian. The Physics of Fluids, volume 10, number 4, 1967. Secondly, the direct interaction approximation for hydromagnetic turbulence maintained by stationary, isotropic, random stirring forces is formulated in the wave-number-frequency domain. Thirdly, the dynamical evolution of a weak, random, magnetic excitation in a turbulent electrically conducting fluid is examined under varying kinematic conditions. (G.T.H.)

  15. Soliton turbulence

    Science.gov (United States)

    Tchen, C. M.

    1986-01-01

    Theoretical and numerical works in atmospheric turbulence have used the Navier-Stokes fluid equations exclusively for describing large-scale motions. Controversy over the existence of an average temperature gradient for the very large eddies in the atmosphere suggested that a new theoretical basis for describing large-scale turbulence was necessary. A new soliton formalism as a fluid analogue that generalizes the Schrodinger equation and the Zakharov equations has been developed. This formalism, processing all the nonlinearities including those from modulation provided by the density fluctuations and from convection due to the emission of finite sound waves by velocity fluctuations, treats large-scale turbulence as coalescing and colliding solitons. The new soliton system describes large-scale instabilities more explicitly than the Navier-Stokes system because it has a nonlinearity of the gradient type, while the Navier-Stokes has a nonlinearity of the non-gradient type. The forced Schrodinger equation for strong fluctuations describes the micro-hydrodynamical state of soliton turbulence and is valid for large-scale turbulence in fluids and plasmas where internal waves can interact with velocity fluctuations.

  16. High Energy Particle Acceleration and Turbulent Magnetic Field Amplification in Shell Type Supernova Remnants. Degree awarded by Minnesota Univ.

    Science.gov (United States)

    Keohane, Jonathan Wilmore

    1998-01-01

    Thesis submitted to the faculty of the Graduate School of the University of Minnesota in partial fulfillment of the requirements for the degree of Doctor of Philosophy. Part I discusses the spatial correlation between the x-ray and radio morphologies of Cas A, and in the process address: the effect of inhomogeneous absorption on the apparent x-ray morphology, the interaction between the SNR and a molecular cloud, and the rapid move toward equipartition between the magnetic and gas energy densities. Discussions of the x-ray./radio correlation continues in Chapter 5, where we present a new, deep, ROSAT HRI image of Cas A. Chapter 7 presents ASCA spectra, with non-thermal spectral fits for 13 of the youngest SNRs in the Galaxy.

  17. Turbulent magnetohydrodynamics in liquid metals

    International Nuclear Information System (INIS)

    Berhanu, Michael

    2008-01-01

    In electrically conducting fluids, the electromagnetic field is coupled with the fluid motion by induction effects. We studied different magnetohydrodynamic phenomena, using two experiments involving turbulent flows of liquid metal. The first mid-sized uses gallium. The second, using sodium, is conducted within the VKS (Von Karman Sodium) collaboration. It has led to the observation of the dynamo effect, namely converting a part of the kinetic energy of the fluid into magnetic energy. We have shown that, depending on forcing conditions, a statistically stationary dynamo, or dynamical regimes of magnetic field can be generated. In particular, polarity reversals similar to those of Earth's magnetic field were observed. Meanwhile, experiment with Gallium has been developed to study the effects of electromagnetic induction by turbulent flows in a more homogeneous and isotropic configuration than in the VKS experiment. Using data from these two experiments, we studied the advection of magnetic field by a turbulent flow and the induced fluctuations. The development of probes measuring electrical potential difference allowed us to further highlight the magnetic braking of a turbulent flow of Gallium by Lorentz force. This mechanism is involved in the saturation of the dynamo instability. (author) [fr

  18. Turbulence modelling

    International Nuclear Information System (INIS)

    Laurence, D.

    1997-01-01

    This paper is an introduction course in modelling turbulent thermohydraulics, aimed at computational fluid dynamics users. No specific knowledge other than the Navier Stokes equations is required beforehand. Chapter I (which those who are not beginners can skip) provides basic ideas on turbulence physics and is taken up in a textbook prepared by the teaching team of the ENPC (Benque, Viollet). Chapter II describes turbulent viscosity type modelling and the 2k-ε two equations model. It provides details of the channel flow case and the boundary conditions. Chapter III describes the 'standard' (R ij -ε) Reynolds tensions transport model and introduces more recent models called 'feasible'. A second paper deals with heat transfer and the effects of gravity, and returns to the Reynolds stress transport model. (author)

  19. Magnetosheath electrostatic turbulence

    International Nuclear Information System (INIS)

    Rodriguez, P.

    1979-01-01

    By using measurements with the University of Iowa plasma wave experiment on the Imp 6 satellite a study has been conducted of the spectrum of electrostatic plasma waves in the terrestrial magnetosheath. Electrostatic plasma wave turbulence is almost continuously present throughout the magnetosheath with broadband (20 Hz to 70 kHz) rms field intensities typically 0.01--1.0 mV m -1 . Peak intensities of about 1.0 mV m -1 near the electron plasma frequency (30--60 kHz) have been detected occasionally. Two or three components can usually be identified in the spectrum of magnetosheath electrostatic turbulence: a high-frequency (> or =30kHz) component peaking at the electron plasma frequency f/sub p/e, a low-frequency component with a broad intensity maximum below the nominal ion plasma frequency f/sub p/i (approx. f/sub p/e/43), and a less well defined intermediate component in the range f/sub p/i < f< f/sub p/e. The intensity distribution of magnetosheath electrostatic turbulence clearly shows that the low-frequency component is associated with the bow shock, suggesting that the ion heating begun at the shock continues into the downstream magnetosheath. Electrostatic waves below 1 kHz are polarized along the magnetic field direction, a result consistent with the polarization of electrostatic waves at the shock. The high- and intermediate-frequency components are features of the magnetosheath spectrum which are not characteristic of the shock spectrum but are often detected in the upstream solar wind. The intensity distribution of electrostatic turbulence at the magnetosheath plasma frequency has no apparent correlation with the shock, indicating that electron plasma oscillations are a general feature of the magnetosheath. The plasma wave noise shows a tendency to decrease toward the dawn and dusk regions, consistent with a general decrease in turbulence away from the subsolar magnetosheath

  20. Impact of electro-magnetic stabilization, small- scale turbulence and multi-scale interactions on heat transport in JET

    Science.gov (United States)

    Mantica, Paola

    2016-10-01

    Heat transport experiments in JET, based on ICRH heat flux scans and temperature modulation, have confirmed the importance of two transport mechanisms that are often neglected in modeling experimental results, but are crucial to reach agreement between theory and experiment and may be significant in ITER. The first mechanism is the stabilizing effect of the total pressure gradient (including fast ions) on ITG driven ion heat transport. Such stabilization is found in non-linear gyro-kinetic electro-magnetic simulations using GENE and GYRO, and is the explanation for the observed loss of ion stiffness in the core of high NBI-power JET plasmas. The effect was recently observed also in JET plasmas with dominant ICRH heating and small rotation, due to ICRH fast ions, which is promising for ITER. Such mechanism dominates over ExB flow shear in the core and needs to be included in quasi-linear models to increase their ability to capture the relevant physics. The second mechanism is the capability of small- scale ETG instabilities to carry a significant fraction of electron heat. A decrease in Te peaking is observed when decreasing Zeff Te/Ti, which cannot be ascribed to TEMs but is in line with ETGs. Non-linear GENE single-scale simulations of ETGs and ITG/TEMs show that the ITG/TEM electron heat flux is not enough to match experiment. TEM stiffness is also much lower than measured. In the ETG single scale simulations the external flow shear is used to saturate the ETG streamers. Multi-scale simulations are ongoing, in which the ion zonal flows are the main saturating mechanism for ETGs. These costly simulations should provide the final answer on the importance of ETG-driven electron heat flux in JET. with JET contributors [F.Romanelli, Proc.25thIAEA FEC]. Supported by EUROfusion Grant 633053.

  1. Turbulence Model

    DEFF Research Database (Denmark)

    Nielsen, Mogens Peter; Shui, Wan; Johansson, Jens

    2011-01-01

    term with stresses depending linearly on the strain rates. This term takes into account the transfer of linear momentum from one part of the fluid to another. Besides there is another term, which takes into account the transfer of angular momentum. Thus the model implies a new definition of turbulence...

  2. Turbulent combustion

    Energy Technology Data Exchange (ETDEWEB)

    Talbot, L.; Cheng, R.K. [Lawrence Berkeley Laboratory, CA (United States)

    1993-12-01

    Turbulent combustion is the dominant process in heat and power generating systems. Its most significant aspect is to enhance the burning rate and volumetric power density. Turbulent mixing, however, also influences the chemical rates and has a direct effect on the formation of pollutants, flame ignition and extinction. Therefore, research and development of modern combustion systems for power generation, waste incineration and material synthesis must rely on a fundamental understanding of the physical effect of turbulence on combustion to develop theoretical models that can be used as design tools. The overall objective of this program is to investigate, primarily experimentally, the interaction and coupling between turbulence and combustion. These processes are complex and are characterized by scalar and velocity fluctuations with time and length scales spanning several orders of magnitude. They are also influenced by the so-called {open_quotes}field{close_quotes} effects associated with the characteristics of the flow and burner geometries. The authors` approach is to gain a fundamental understanding by investigating idealized laboratory flames. Laboratory flames are amenable to detailed interrogation by laser diagnostics and their flow geometries are chosen to simplify numerical modeling and simulations and to facilitate comparison between experiments and theory.

  3. Turbulence of high-beta plasma

    International Nuclear Information System (INIS)

    Khvesyuk, V.I.; Chirkov, A.Y.

    1999-01-01

    Principals of numerical modelling of turbulence in high-beta plasma (β > 0.1) are discussed. Creation of transport model for axial symmetric nonuniform confining magnetic field is considered. Numerical model of plasma turbulence in FRC is presented. The physical and mathematical models are formulated from nonuniform axial symmetric high-beta plasma. It is shown that influence of waves arise under this plasma conditions lead to chaotic motion of charged particles across magnetic field. (author)

  4. Turbulence in the Heliospheric Jets

    Science.gov (United States)

    Drake, J. F.; Swisdak, M.; Opher, M.; Hassam, A.; Ohia, O.

    2016-12-01

    The conventional picture of the heliosphere is that of a comet-shaped structure with an extended tail produced by the relative motion of the sun through the local interstellar medium (LISM). Recent MHD simulations of the global heliosphere have revealed, however, that the heliosphere drives magnetized jets to the North and South similar to those driven by the Crab Nebula and other astrophysical objects. These simulations reveal that the jets become turbulent with scale lengths as large as 100AU [1,2]. An important question is what drives this large-scale turbulence, what are the implications for mixing of interstellar and heliospheric plasma and does this turbulence drive energetic particles? An analytic model of the heliospheric jets in the simple limit in which the interstellar flow and magnetic field are neglected yields an equilibrium state that can be analyzed to explore potential instabilities [3]. Calculations suggest that because the axial magnetic field within the jets is small, the dominant instability is the sausage mode, driven by the azimuthal solar magnetic field. Other drive mechanisms, including Kelvin Helmholtz, are also being explored. 3D MHD and Hall MHD simulations are being carried out to explore the development of this turbulence, its impact on the mixing of interstellar and heliosheath plasma and the production of energetic particles. [1] Opher et al ApJ Lett. 800, L28, 2015[2] Pogorelov et al ApJ Lett. 812,L6, 2015[3] Drake et al ApJ Lett. 808, L44, 2015

  5. Stochastic acceleration by hydromagnetic turbulence

    International Nuclear Information System (INIS)

    Kulsrud, R.M.

    1979-03-01

    A general theory for particle acceleration by weak hydromagnetic turbulence with a given spectrum of waves is described. Various limiting cases, corresponding to Fermi acceleration and magnetic pumping, are discussed and two numerical examples illustrating them are given. An attempt is made to show that the expression for the rate of Fermi acceleration is valid for finite amplitudes

  6. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  7. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  8. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  9. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  10. Aperiodic and randomized dielectric mirrors: alternatives to metallic back reflectors for solar cells.

    Science.gov (United States)

    Lin, Albert; Zhong, Yan-Kai; Fu, Sze-Ming; Tseng, Chi Wei; Yan, Sheng Lun

    2014-05-05

    Dielectric mirrors have recently emerged for solar cells due to the advantages of lower cost, lower temperature processing, higher throughput, and zero plasmonic absorption as compared to conventional metallic counterparts. Nonetheless, in the past, efforts for incorporating dielectric mirrors into photovoltaics were not successful due to limited bandwidth and insufficient light scattering that prevented their wide usage. In this work, it is shown that the key for ultra-broadband dielectric mirrors is aperiodicity, or randomization. In addition, it has been proven that dielectric mirrors can be widely applicable to thin-film and thick wafer-based solar cells to provide for light trapping comparable to conventional metallic back reflectors at their respective optimal geometries. Finally, the near-field angular emission plot of Poynting vectors is conducted, and it further confirms the superior light-scattering property of dielectric mirrors, especially for diffuse medium reflectors, despite the absence of surface plasmon excitation. The preliminary experimental results also confirm the high feasibility of dielectric mirrors for photovoltaics.

  11. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  12. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  13. A dynamics investigation into edge plasma turbulence

    International Nuclear Information System (INIS)

    Thomsen, H.

    2002-08-01

    The present experimental work investigates plasma turbulence in the edge region of magnetized high-temperature plasmas. A main topic is the turbulent dynamics parallel to the magnetic field, where hitherto only a small data basis existed, especially for very long scale lengths in the order of ten of meters. A second point of special interest is the coupling of the dynamics parallel and perpendicular to the magnetic field. This anisotropic turbulent dynamics is investigated by two different approaches. Firstly, spatially and temporally high-resolution measurements of fluctuating plasma parameters are investigated by means of two-point correlation analysis. Secondly, the propagation of signals externally imposed into the turbulent plasma background is studied. For both approaches, Langmuir probe arrays were utilized for diagnostic purposes. (orig.)

  14. Scaling, Intermittency and Decay of MHD Turbulence

    International Nuclear Information System (INIS)

    Lazarian, A.; Cho, Jungyeon

    2005-01-01

    We discuss a few recent developments that are important for understanding of MHD turbulence. First, MHD turbulence is not so messy as it is usually believed. In fact, the notion of strong non-linear coupling of compressible and incompressible motions along MHD cascade is not tenable. Alfven, slow and fast modes of MHD turbulence follow their own cascades and exhibit degrees of anisotropy consistent with theoretical expectations. Second, the fast decay of turbulence is not related to the compressibility of fluid. Rates of decay of compressible and incompressible motions are very similar. Third, viscosity by neutrals does not suppress MHD turbulence in a partially ionized gas. Instead, MHD turbulence develops magnetic cascade at scales below the scale at which neutrals damp ordinary hydrodynamic motions. Forth, density statistics does not exhibit the universality that the velocity and magnetic field do. For instance, at small Mach numbers the density is anisotropic, but it gets isotropic at high Mach numbers. Fifth, the intermittency of magnetic field and velocity are different. Both depend on whether the measurements are done in a local system of reference oriented along the local magnetic field or in the global system of reference related to the mean magnetic field

  15. Dissipation range turbulent cascades in plasmas

    International Nuclear Information System (INIS)

    Terry, P. W.; Almagri, A. F.; Forest, C. B.; Nornberg, M. D.; Rahbarnia, K.; Sarff, J. S.; Fiksel, G.; Hatch, D. R.; Jenko, F.; Prager, S. C.; Ren, Y.

    2012-01-01

    Dissipation range cascades in plasma turbulence are described and spectra are formulated from the scaled attenuation in wavenumber space of the spectral energy transfer rate. This yields spectra characterized by the product of a power law and exponential fall-off, applicable to all scales. Spectral indices of the power law and exponential fall-off depend on the scaling of the dissipation, the strength of the nonlinearity, and nonlocal effects when dissipation rates of multiple fluctuation fields are different. The theory is used to derive spectra for MHD turbulence with magnetic Prandtl number greater than unity, extending previous work. The theory is also applied to generic plasma turbulence by considering the spectrum from damping with arbitrary wavenumber scaling. The latter is relevant to ion temperature gradient turbulence modeled by gyrokinetics. The spectrum in this case has an exponential component that becomes weaker at small scale, giving a power law asymptotically. Results from the theory are compared to three very different types of turbulence. These include the magnetic plasma turbulence of the Madison Symmetric Torus, the MHD turbulence of liquid metal in the Madison Dynamo Experiment, and gyrokinetic simulation of ion temperature gradient turbulence.

  16. Graphical Turbulence Guidance - Composite

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Forecast turbulence hazards identified by the Graphical Turbulence Guidance algorithm. The Graphical Turbulence Guidance product depicts mid-level and upper-level...

  17. Magnetohydrodynamic Turbulence

    Science.gov (United States)

    Montgomery, David C.

    2004-01-01

    Magnetohydrodynamic (MHD) turbulence theory is modeled on neutral fluid (Navier-Stokes) turbulence theory, but with some important differences. There have been essentially no repeatable laboratory MHD experiments wherein the boundary conditions could be controlled or varied and a full set of diagnostics implemented. The equations of MHD are convincingly derivable only in the limit of small ratio of collision mean-free-paths to macroscopic length scales, an inequality that often goes the other way for magnetofluids of interest. Finally, accurate information on the MHD transport coefficients-and thus, the Reynolds-like numbers that order magnetofluid behavior-is largely lacking; indeed, the algebraic expressions used for such ingredients as the viscous stress tensor are often little more than wishful borrowing from fluid mechanics. The one accurate thing that has been done extensively and well is to solve the (strongly nonlinear) MHD equations numerically, usually in the presence of rectangular periodic boundary conditions, and then hope for the best when drawing inferences from the computations for those astrophysical and geophysical MHD systems for which some indisputably turbulent detailed data are available, such as the solar wind or solar prominences. This has led to what is perhaps the first field of physics for which computer simulations are regarded as more central to validating conclusions than is any kind of measurement. Things have evolved in this way due to a mixture of the inevitable and the bureaucratic, but that is the way it is, and those of us who want to work on the subject have to live with it. It is the only game in town, and theories that have promised more-often on the basis of some alleged ``instability''-have turned out to be illusory.

  18. Wavenumber spectrum of whistler turbulence: Particle-in-cell simulation

    International Nuclear Information System (INIS)

    Saito, S.; Gary, S. Peter; Narita, Y.

    2010-01-01

    The forward cascade of decaying whistler turbulence is studied in low beta plasma to understand essential properties of the energy spectrum at electron scales, by using a two-dimensional electromagnetic particle-in-cell (PIC) simulation. This simulation demonstrates turbulence in which the energy cascade rate is greater than the dissipation rate at the electron inertial length. The PIC simulation shows that the magnetic energy spectrum of forward-cascaded whistler turbulence at electron inertial scales is anisotropic and develops a very steep power-law spectrum which is consistent with recent solar wind observations. A comparison of the simulated spectrum with that predicted by a phenomenological turbulence scaling model suggests that the energy cascade at the electron inertial scale depends on both magnetic fluctuations and electron velocity fluctuations, as well as on the whistler dispersion relation. Thus, not only kinetic Alfven turbulence but also whistler turbulence may explain recent solar wind observations of very steep magnetic spectra at short scales.

  19. Turbulent Liquid Metal Dynamo Experiments

    International Nuclear Information System (INIS)

    Forest, Cary

    2007-01-01

    The self-generation of magnetic fields in planets and stars--the dynamo effect--is a long-standing problem of magnetohydrodynamics and plasma physics. Until recently, research on the self-excitation process has been primarily theoretical. In this talk, I will begin with a tutorial on how magnetic fields are generated in planets and stars, describing the 'Standard Model' of self-excitation known as the alpha-omega dynamo. In this model, axisymmetric differential rotation can produce the majority of the magnetic field, but some non-axisymmetric, turbulence driven currents are also necessary. Understanding the conversion of turbulent kinetic energy in the fluid motion into electrical currents and thus magnetic fields, is a major challenge for both experiments and theory at this time. I will then report on recent results from a 1 meter diameter, spherical, liquid sodium dynamo experiment at the University of Wisconsin, in which the first clear evidence for these turbulence driven currents has been observed.

  20. Reduced Models for Gyrokinetic Turbulence

    Science.gov (United States)

    Besse, Nicolas; Bertrand, Pierre; Morel, Pierre; Gravier, Etienne

    2009-09-01

    Turbulent transport is a key issue for controlled thermonuclear fusion based on magnetic confinement. The thermal confinement of a magnetized fusion plasma is essentially determined by the turbulent heat conduction across the equilibrium magnetic field. It has long been acknowledged, that the prediction of turbulent transport requires to solve Vlasov-type gyrokinetic equations. Although the kinetic description is more accurate than fluid models (Magnetohydrodynamics (MHD), gyro-fluid), because among other things it takes into account nonlinear resonant wave-particle interaction, kinetic modeling has the drawback of a huge demand on computer resources. A unifying approach consists in considering water-bag-like weak solutions of kinetic collisionless equations, which allow to reduce the full kinetic Vlasov equation into a set of hydrodynamic equations, while keeping its kinetic behaviour. As a result this exact reduction induces a multi-fluid numerical resolution cost. Therefore, finding water-bag-like weak solutions of the gyrokinetic equations leads to the birth of the gyro-water-bag model. This model is suitable for studying linear and nonlinear low-frequency micro-instabilities and the associated anomalous transport in magnetically confined plasmas. Here we present the derivation of nonlinear gyro-water-bag models and their numerical approximations by backward Runge-Kutta semi-Lagrangian methods and forward Runge-Kutta discontinuous Galerkin schemes.

  1. Turbulence modification and multiphase turbulence transport modeling

    International Nuclear Information System (INIS)

    Besnard, D.C.; Kataoka, I.; Serizawa, A.

    1991-01-01

    It is shown here that in the derivation of turbulence transport models for multiphase flows, terms naturally appear that can be interpreted as related to turbulence modification of one field by the other. We obtain two such terms, one suggesting turbulence enhancement due to instabilities in two-phase flow, the second one showing turbulence damping due to the presence of the other field, both in gas-particle and gas-liquid cases

  2. TEM turbulence optimisation in stellarators

    Science.gov (United States)

    Proll, J. H. E.; Mynick, H. E.; Xanthopoulos, P.; Lazerson, S. A.; Faber, B. J.

    2016-01-01

    With the advent of neoclassically optimised stellarators, optimising stellarators for turbulent transport is an important next step. The reduction of ion-temperature-gradient-driven turbulence has been achieved via shaping of the magnetic field, and the reduction of trapped-electron mode (TEM) turbulence is addressed in the present paper. Recent analytical and numerical findings suggest TEMs are stabilised when a large fraction of trapped particles experiences favourable bounce-averaged curvature. This is the case for example in Wendelstein 7-X (Beidler et al 1990 Fusion Technol. 17 148) and other Helias-type stellarators. Using this knowledge, a proxy function was designed to estimate the TEM dynamics, allowing optimal configurations for TEM stability to be determined with the STELLOPT (Spong et al 2001 Nucl. Fusion 41 711) code without extensive turbulence simulations. A first proof-of-principle optimised equilibrium stemming from the TEM-dominated stellarator experiment HSX (Anderson et al 1995 Fusion Technol. 27 273) is presented for which a reduction of the linear growth rates is achieved over a broad range of the operational parameter space. As an important consequence of this property, the turbulent heat flux levels are reduced compared with the initial configuration.

  3. Dissipative structures in magnetorotational turbulence

    Science.gov (United States)

    Ross, Johnathan; Latter, Henrik N.

    2018-03-01

    Via the process of accretion, magnetorotational turbulence removes energy from a disk's orbital motion and transforms it into heat. Turbulent heating is far from uniform and is usually concentrated in small regions of intense dissipation, characterised by abrupt magnetic reconnection and higher temperatures. These regions are of interest because they might generate non-thermal emission, in the form of flares and energetic particles, or thermally process solids in protoplanetary disks. Moreover, the nature of the dissipation bears on the fundamental dynamics of the magnetorotational instability (MRI) itself: local simulations indicate that the large-scale properties of the turbulence (e.g. saturation levels, the stress-pressure relationship) depend on the short dissipative scales. In this paper we undertake a numerical study of how the MRI dissipates and the small-scale dissipative structures it employs to do so. We use the Godunov code RAMSES and unstratified compressible shearing boxes. Our simulations reveal that dissipation is concentrated in ribbons of strong magnetic reconnection that are significantly elongated in azimuth, up to a scale height. Dissipative structures are hence meso-scale objects, and potentially provide a route by which large scales and small scales interact. We go on to show how these ribbons evolve over time — forming, merging, breaking apart, and disappearing. Finally, we reveal important couplings between the large-scale density waves generated by the MRI and the small-scale structures, which may illuminate the stress-pressure relationship in MRI turbulence.

  4. Energetics of turbulent transport processes in tokamaks

    International Nuclear Information System (INIS)

    Haas, F.A.; Thyagaraja, A.

    1987-01-01

    The effect of electromagnetic turbulence on electrons and ions under Tokamak conditions is considered using a kinetic description. Taking the magnetic fluctuation spectrum as given, the density fluctuation spectrum is self-consistently calculated taking account of quasi-neutrality. The calculation is valid for arbitrary collisionality and appropriate to low frequencies typical of experiment. In addition to the usual enhancement of the radial electron energy transport, it is found that the turbulent fluctuations can heat the plasma at rates comparable to ordinary ohmic heating under well-defined conditions. Interestingly, electromagnetic turbulence appears to imply only an insignificant correction to the toroidal resistance of the plasma as estimated from Spitzer resistivity. The scalings of anomalous transport, fluctuations and heating with temperature and plasma volume are investigated. The assumption that the magnetic fluctuation spectrum of the turbulence is invariant under a wide range of conditions is shown to result in interesting consequences for JET-like plasmas. (author)

  5. Statistical turbulence theory and turbulence phenomenology

    Science.gov (United States)

    Herring, J. R.

    1973-01-01

    The application of deductive turbulence theory for validity determination of turbulence phenomenology at the level of second-order, single-point moments is considered. Particular emphasis is placed on the phenomenological formula relating the dissipation to the turbulence energy and the Rotta-type formula for the return to isotropy. Methods which deal directly with most or all the scales of motion explicitly are reviewed briefly. The statistical theory of turbulence is presented as an expansion about randomness. Two concepts are involved: (1) a modeling of the turbulence as nearly multipoint Gaussian, and (2) a simultaneous introduction of a generalized eddy viscosity operator.

  6. Effective kinematic viscosity of turbulent He II

    Czech Academy of Sciences Publication Activity Database

    Chagovets, Tymofiy; Gordeev, A. V.; Skrbek, L.

    2007-01-01

    Roč. 76, č. 2 (2007), 027301/1-027301/4 ISSN 1539-3755 R&D Projects: GA ČR GA202/05/0218 Institutional research plan: CEZ:AV0Z10100520 Keywords : ĺiquid helium II * decaying counetrflow turbulence * mutual friction * grid turbulence * rotating helium * finite channel * heat current Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.483, year: 2007

  7. Studying Magnetohydrodynamic Turbulence with Synchrotron Polarization Dispersion

    OpenAIRE

    Zhang, Jian-Fu; Lazarian, Alex; Lee, Hyeseung; Cho, Jungyeon

    2016-01-01

    We test a new technique of studying magnetohydrodynamic (MHD) turbulence suggested by Lazarian \\& Pogosyan, using synthetic synchrotron polarization observations. This paper focuses on a one-point statistics, which is termed the polarization frequency analysis, that is characterized by the variance of polarized emission as a function of the square of wavelengths along a single line of sight. We adopt a ratio $\\eta$ of the standard deviation of the line-of-sight turbulent magnetic field to the...

  8. The structure and statistics of interstellar turbulence

    Science.gov (United States)

    Kritsuk, A. G.; Ustyugov, S. D.; Norman, M. L.

    2017-06-01

    We explore the structure and statistics of multiphase, magnetized ISM turbulence in the local Milky Way by means of driven periodic box numerical MHD simulations. Using the higher order-accurate piecewise-parabolic method on a local stencil (PPML), we carry out a small parameter survey varying the mean magnetic field strength and density while fixing the rms velocity to observed values. We quantify numerous characteristics of the transient and steady-state turbulence, including its thermodynamics and phase structure, kinetic and magnetic energy power spectra, structure functions, and distribution functions of density, column density, pressure, and magnetic field strength. The simulations reproduce many observables of the local ISM, including molecular clouds, such as the ratio of turbulent to mean magnetic field at 100 pc scale, the mass and volume fractions of thermally stable Hi, the lognormal distribution of column densities, the mass-weighted distribution of thermal pressure, and the linewidth-size relationship for molecular clouds. Our models predict the shape of magnetic field probability density functions (PDFs), which are strongly non-Gaussian, and the relative alignment of magnetic field and density structures. Finally, our models show how the observed low rates of star formation per free-fall time are controlled by the multiphase thermodynamics and large-scale turbulence.

  9. Magnets

    International Nuclear Information System (INIS)

    Young, I.R.

    1984-01-01

    A magnet pole piece for an NMR imaging magnet is made of a plurality of magnetic wires with one end of each wire held in a non-magnetic spacer, the other ends of the wires being brought to a pinch, and connected to a magnetic core. The wires may be embedded in a synthetic resin and the magnetisation and uniformity thereof can be varied by adjusting the density of the wires at the spacer which forms the pole piece. (author)

  10. Turbulent transport in low-beta plasmas

    DEFF Research Database (Denmark)

    Nielsen, A.H.; Pécseli, H.L.; Juul Rasmussen, J.

    1996-01-01

    Low-frequency electrostatic fluctuations are studied experimentally in a low-P plasma, with particular attention to their importance for the anomalous plasma transport across magnetic field lines. The presence of large coherent structures in a turbulent background at the edge of the plasma column...... is demonstrated by a statistical analysis. The importance of these structures for the turbulent transport is investigated. The study is extended by a multichannel conditional analysis to illustrate detailed properties and parameter dependences of the turbulent transport. (C) 1996 American Institute of Physics....

  11. Mirror Instability in the Turbulent Solar Wind

    Energy Technology Data Exchange (ETDEWEB)

    Hellinger, Petr [Astronomical Institute, CAS, Bocni II/1401,CZ-14100 Prague (Czech Republic); Landi, Simone; Verdini, Andrea; Franci, Luca [Dipartimento di Fisica e Astronomia, Università degli Studi di Firenze Largo E. Fermi 2, I-50125 Firenze (Italy); Matteini, Lorenzo, E-mail: petr.hellinger@asu.cas.cz [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom)

    2017-04-01

    The relationship between a decaying strong turbulence and the mirror instability in a slowly expanding plasma is investigated using two-dimensional hybrid expanding box simulations. We impose an initial ambient magnetic field perpendicular to the simulation box, and we start with a spectrum of large-scale, linearly polarized, random-phase Alfvénic fluctuations that have energy equipartition between kinetic and magnetic fluctuations and a vanishing correlation between the two fields. A turbulent cascade rapidly develops, magnetic field fluctuations exhibit a Kolmogorov-like power-law spectrum at large scales and a steeper spectrum at sub-ion scales. The imposed expansion (taking a strictly transverse ambient magnetic field) leads to the generation of an important perpendicular proton temperature anisotropy that eventually drives the mirror instability. This instability generates large-amplitude, nonpropagating, compressible, pressure-balanced magnetic structures in a form of magnetic enhancements/humps that reduce the perpendicular temperature anisotropy.

  12. Statistical Mechanics of Turbulent Dynamos

    Science.gov (United States)

    Shebalin, John V.

    2014-01-01

    Incompressible magnetohydrodynamic (MHD) turbulence and magnetic dynamos, which occur in magnetofluids with large fluid and magnetic Reynolds numbers, will be discussed. When Reynolds numbers are large and energy decays slowly, the distribution of energy with respect to length scale becomes quasi-stationary and MHD turbulence can be described statistically. In the limit of infinite Reynolds numbers, viscosity and resistivity become zero and if these values are used in the MHD equations ab initio, a model system called ideal MHD turbulence results. This model system is typically confined in simple geometries with some form of homogeneous boundary conditions, allowing for velocity and magnetic field to be represented by orthogonal function expansions. One advantage to this is that the coefficients of the expansions form a set of nonlinearly interacting variables whose behavior can be described by equilibrium statistical mechanics, i.e., by a canonical ensemble theory based on the global invariants (energy, cross helicity and magnetic helicity) of ideal MHD turbulence. Another advantage is that truncated expansions provide a finite dynamical system whose time evolution can be numerically simulated to test the predictions of the associated statistical mechanics. If ensemble predictions are the same as time averages, then the system is said to be ergodic; if not, the system is nonergodic. Although it had been implicitly assumed in the early days of ideal MHD statistical theory development that these finite dynamical systems were ergodic, numerical simulations provided sufficient evidence that they were, in fact, nonergodic. Specifically, while canonical ensemble theory predicted that expansion coefficients would be (i) zero-mean random variables with (ii) energy that decreased with length scale, it was found that although (ii) was correct, (i) was not and the expected ergodicity was broken. The exact cause of this broken ergodicity was explained, after much

  13. Studying Magnetohydrodynamic Turbulence with Synchrotron Polarization Dispersion

    Science.gov (United States)

    Zhang, Jian-Fu; Lazarian, Alex; Lee, Hyeseung; Cho, Jungyeon

    2016-07-01

    We test a new technique for studying magnetohydrodynamic turbulence suggested by Lazarian & Pogosyan, using synthetic observations of synchrotron polarization. This paper focuses on a one-point statistics, which is termed polarization frequency analysis, that is characterized by the variance of polarized emission as a function of the square of the wavelength along a single line of sight. We adopt the ratio η of the standard deviation of the line-of-sight turbulent magnetic field to the line-of-sight mean magnetic field to depict the level of turbulence. When this ratio is large (η \\gg 1), which characterizes a region dominated by turbulent field, or small (η ≲ 0.2), which characterizes a region dominated by the mean field, we obtain the polarization variance \\propto {λ }-2 or \\propto {λ }-2-2m, respectively. At small η, I.e., in the region dominated by the mean field, we successfully recover the turbulent spectral index from the polarization variance. We find that our simulations agree well with the theoretical prediction of Lazarian & Pogosyan. With existing and upcoming data cubes from the Low-Frequency Array for Radio Astronomy (LOFAR) and the Square Kilometer Array (SKA), this new technique can be applied to study the magnetic turbulence in the Milky Way and other galaxies.

  14. Probing Magnetic Fields with Square Kilometre Array and its ...

    Indian Academy of Sciences (India)

    /fulltext/joaa/037/04/0042. Keywords. Magnetic fields; telescopes; galaxies: magnetic fields; ISM: magnetic fields; stars: magnetic fields; turbulence. Abstract. Origin of magnetic fields, its structure and effects on dynamical processes in stars to ...

  15. Topics in strong Langmuir turbulence

    International Nuclear Information System (INIS)

    Skoric, M.M.

    1981-01-01

    This thesis discusses certain aspects of the turbulence of a fully ionised non-isothermal plasma dominated by the Langmuir mode. Some of the basic properties of strongly turbulent plasmas are reviewed. In particular, interest is focused on the state of Langmuir turbulence, that is the turbulence of a simple externally unmagnetized plasma. The problem of the existence and dynamics of Langmuir collapse is discussed, often met as a non-linear stage of the modulational instability in the framework of the Zakharov equations (i.e. simple time-averaged dynamical equations). Possible macroscopic consequences of such dynamical turbulent models are investigated. In order to study highly non-linear collapse dynamics in its advanced stage, a set of generalized Zakharov equations are derived. Going beyond the original approximation, the author includes the effects of higher electron non-linearities and a breakdown of slow-timescale quasi-neutrality. He investigates how these corrections may influence the collapse stabilisation. Recently, it has been realised that the modulational instability in a Langmuir plasma will be accompanied by the collisionless-generation of a slow-timescale magnetic field. Accordingly, a novel physical situation has emerged which is investigated in detail. The stability of monochromatic Langmuir waves in a self-magnetized Langmuir plasma, is discussed, and the existence of a novel magneto-modulational instability shown. The wave collapse dynamics is investigated and a physical interpretation of the basic results is given. A problem of the transient analysis of an interaction of time-dependent electromagnetic pulses with linear cold plasma media is investigated. (Auth.)

  16. Numerical investigation of kinetic turbulence in relativistic pair plasmas - I. Turbulence statistics

    Science.gov (United States)

    Zhdankin, Vladimir; Uzdensky, Dmitri A.; Werner, Gregory R.; Begelman, Mitchell C.

    2018-02-01

    We describe results from particle-in-cell simulations of driven turbulence in collisionless, magnetized, relativistic pair plasma. This physical regime provides a simple setting for investigating the basic properties of kinetic turbulence and is relevant for high-energy astrophysical systems such as pulsar wind nebulae and astrophysical jets. In this paper, we investigate the statistics of turbulent fluctuations in simulations on lattices of up to 10243 cells and containing up to 2 × 1011 particles. Due to the absence of a cooling mechanism in our simulations, turbulent energy dissipation reduces the magnetization parameter to order unity within a few dynamical times, causing turbulent motions to become sub-relativistic. In the developed stage, our results agree with predictions from magnetohydrodynamic turbulence phenomenology at inertial-range scales, including a power-law magnetic energy spectrum with index near -5/3, scale-dependent anisotropy of fluctuations described by critical balance, lognormal distributions for particle density and internal energy density (related by a 4/3 adiabatic index, as predicted for an ultra-relativistic ideal gas), and the presence of intermittency. We also present possible signatures of a kinetic cascade by measuring power-law spectra for the magnetic, electric and density fluctuations at sub-Larmor scales.

  17. Hypersonic Transition and Turbulence with Non-Equilibrium Thermochemistry

    Science.gov (United States)

    2009-08-31

    unsolved problem in classical physics’ by Nobel-prize winning physicist Richard Feynman . Similar statements regarding the intricacies of turbulence have...jets and turbulence.’ MS thesis (2006). 2. B. M. Riley, J. C. Richard and S. S. Girirnaji. ’Magnetic field effects on axis-switching and notabilities...B. M. Riley, J. C. Richard and S. S. Girirnaji. ’Assessment of magneto-hydrodynamic Lattice-Boltzmann schemes in turbulence and rectangular jets

  18. Compressible turbulence in one dimension

    Science.gov (United States)

    Fleischer, Jason Wolf

    1999-11-01

    The Burgers' model of compressible fluid dynamics in one dimension is extended to include the effects of pressure back-reaction. The new system consists of two coupled equations: Burgers' equation with a pressure gradient (essentially the 1-D Navier-Stokes equation) and an advection-diffusion equation for the pressure field. It presents a minimal model of both adiabatic gas dynamics and compressible magnetohydrodynamics. From the magnetic perspective, it is the simplest possible system which allows for Alfvenization, i.e. energy transfer between the fluid and the magnetic field. For the special case of equal fluid viscosity and (magnetic) diffusivity, the system is completely integrable, reducing to two decoupled Burgers' equations in the characteristic variables v +/- vsound ( v +/- vAlfven). For arbitrary diffusivities, renormalized perturbation theory is used to calculate the effective transport coefficients for forced Burgerlence. It is shown that energy equi- dissipation, not equipartition, is fundamental to the turbulent state. Both energy and dissipation are localized to shock-like structures, in which wave steepening is inhibited by small-scale forcing and by pressure back-reaction. The spectral forms predicted by theory are confirmed by numerical simulations. It is shown that the velocity structures lead to an asymmetric velocity PDF, as in Burgers' turbulence. Pressure fluctuations, however, are symmetrically distributed. A Fokker-Planck calculation of these distributions is compared and contrasted with a path integral approach. The latter instanton solution suggests that the system maintains its characteristic directions in steady-state turbulence, supporting the results from perturbation theory. Implications for the spectra of turbulence and self-organization phenomena in compressible fluids and plasmas are also discussed.

  19. Scale-locality of magnetohydrodynamic turbulence

    Energy Technology Data Exchange (ETDEWEB)

    Aluie, Hussein [Los Alamos National Laboratory; Eyink, Gregory L [JOHNS HOPKINS UNIV.

    2009-01-01

    We investigate the scale-locality of cascades of conserved invariants at high kinetic and magnetic Reynolds numbers in the 'inertial-inductive range' of magnetohydrodynamic (MHD) turbulence, where velocity and magnetic field increments exhibit suitable power-law scaling. We prove that fluxes of total energy and cross-helicity - or, equivalently, fluxes of Elsaesser energies - are dominated by the contributions of local triads. Corresponding spectral transfers are also scale-local when defined using octave wavenumber bands. Flux and transfer of magnetic helicity may be dominated by nonlocal triads. The magnetic stretching term also may be dominated by non-local triads but we prove that it can convert energy only between velocity and magnetic modes at comparable scales. We explain the disagreement with numerical studies that have claimed conversion non locally between disparate scales. We present supporting data from a 1024{sup 3} simulation of forced MHD turbulence.

  20. Spectral properties of electromagnetic turbulence in plasmas

    Directory of Open Access Journals (Sweden)

    D. Shaikh

    2009-03-01

    Full Text Available We report on the nonlinear turbulent processes associated with electromagnetic waves in plasmas. We focus on low-frequency (in comparison with the electron gyrofrequency nonlinearly interacting electron whistlers and nonlinearly interacting Hall-magnetohydrodynamic (H-MHD fluctuations in a magnetized plasma. Nonlinear whistler mode turbulence study in a magnetized plasma involves incompressible electrons and immobile ions. Two-dimensional turbulent interactions and subsequent energy cascades are critically influenced by the electron whisters that behave distinctly for scales smaller and larger than the electron skin depth. It is found that in whistler mode turbulence there results a dual cascade primarily due to the forward spectral migration of energy that coexists with a backward spectral transfer of mean squared magnetic potential. Finally, inclusion of the ion dynamics, resulting from a two fluid description of the H-MHD plasma, leads to several interesting results that are typically observed in the solar wind plasma. Particularly in the solar wind, the high-time-resolution databases identify a spectral break at the end of the MHD inertial range spectrum that corresponds to a high-frequency regime. In the latter, turbulent cascades cannot be explained by the usual MHD model and a finite frequency effect (in comparison with the ion gyrofrequency arising from the ion inertia is essentially included to discern the dynamics of the smaller length scales (in comparison with the ion skin depth. This leads to a nonlinear H-MHD model, which is presented in this paper. With the help of our 3-D H-MHD code, we find that the characteristic turbulent interactions in the high-frequency regime evolve typically on kinetic-Alfvén time-scales. The turbulent fluctuation associated with kinetic-Alfvén interactions are compressive and anisotropic and possess equipartition of the kinetic and magnetic energies.

  1. Energy transfer in compressible magnetohydrodynamic turbulence

    Science.gov (United States)

    Grete, Philipp; O'Shea, Brian W.; Beckwith, Kris; Schmidt, Wolfram; Christlieb, Andrew

    2017-09-01

    Magnetic fields, compressibility, and turbulence are important factors in many terrestrial and astrophysical processes. While energy dynamics, i.e., how energy is transferred within and between kinetic and magnetic reservoirs, has been previously studied in the context of incompressible magnetohydrodynamic (MHD) turbulence, we extend shell-to-shell energy transfer analysis to the compressible regime. We derive four new transfer functions specifically capturing compressibility effects in the kinetic and magnetic cascade, and capturing energy exchange via magnetic pressure. To illustrate their viability, we perform and analyze four simulations of driven isothermal MHD turbulence in the sub- and supersonic regime with two different codes. On the one hand, our analysis reveals robust characteristics across regime and numerical method. For example, energy transfer between individual scales is local and forward for both cascades with the magnetic cascade being stronger than the kinetic one. Magnetic tension and magnetic pressure related transfers are less local and weaker than the cascades. We find no evidence for significant nonlocal transfer. On the other hand, we show that certain functions, e.g., the compressive component of the magnetic energy cascade, exhibit a more complex behavior that varies both with regime and numerical method. Having established a basis for the analysis in the compressible regime, the method can now be applied to study a broader parameter space.

  2. Turbulent Transport in a Three-dimensional Solar Wind

    Energy Technology Data Exchange (ETDEWEB)

    Shiota, D. [Institute for Space-Earth Environmental Research, Nagoya University, Nagoya, Aichi 464-8601 (Japan); Zank, G. P.; Adhikari, L.; Hunana, P. [Center for Space Plasma and Aeronomic Research (CSPAR), Department of Space Science, University of Alabama in Huntsville, Huntsville, AL 35805 (United States); Telloni, D. [INAF—Astrophysical Observatory of Torino, Via Osservatorio 20, I-10025 Pino Torinese (Italy); Bruno, R., E-mail: shiota@isee.nagoya-u.ac.jp [INAF-IAPS Istituto di Astrofisica e Planetologia Spaziali, Via del Fosso del Cavaliere 100, I-00133 Roma (Italy)

    2017-03-01

    Turbulence in the solar wind can play essential roles in the heating of coronal and solar wind plasma and the acceleration of the solar wind and energetic particles. Turbulence sources are not well understood and thought to be partly enhanced by interaction with the large-scale inhomogeneity of the solar wind and the interplanetary magnetic field and/or transported from the solar corona. To investigate the interaction with background inhomogeneity and the turbulence sources, we have developed a new 3D MHD model that includes the transport and dissipation of turbulence using the theoretical model of Zank et al. We solve for the temporal and spatial evolution of three moments or variables, the energy in the forward and backward fluctuating modes and the residual energy and their three corresponding correlation lengths. The transport model is coupled to our 3D model of the inhomogeneous solar wind. We present results of the coupled solar wind-turbulence model assuming a simple tilted dipole magnetic configuration that mimics solar minimum conditions, together with several comparative intermediate cases. By considering eight possible solar wind and turbulence source configurations, we show that the large-scale solar wind and IMF inhomogeneity and the strength of the turbulence sources significantly affect the distribution of turbulence in the heliosphere within 6 au. We compare the predicted turbulence distribution results from a complete solar minimum model with in situ measurements made by the Helios and Ulysses spacecraft, finding that the synthetic profiles of the turbulence intensities show reasonable agreement with observations.

  3. Magnetohydrodynamic Turbulence in the Plasmoid-mediated Regime

    Science.gov (United States)

    Comisso, L.; Huang, Y.-M.; Lingam, M.; Hirvijoki, E.; Bhattacharjee, A.

    2018-02-01

    Magnetohydrodynamic turbulence and magnetic reconnection are ubiquitous in astrophysical environments. In most situations these processes do not occur in isolation but interact with each other. This renders a comprehensive theory of these processes highly challenging. Here we propose a theory of magnetohydrodynamic turbulence driven at a large scale that self-consistently accounts for the mutual interplay with magnetic reconnection occurring at smaller scales. Magnetic reconnection produces plasmoids (flux ropes) that grow from turbulence-generated noise and eventually disrupt the sheet-like structures in which they are born. The disruption of these structures leads to a modification of the turbulent energy cascade, which in turn exerts a feedback effect on the plasmoid formation via the turbulence-generated noise. The energy spectrum in this plasmoid-mediated range steepens relative to the standard inertial range and does not follow a simple power law. As a result of the complex interplay between turbulence and reconnection, we also find that the length scale that marks the beginning of the plasmoid-mediated range and the dissipation length scale do not obey true power laws. The transitional magnetic Reynolds number above which the plasmoid formation becomes statistically significant enough to affect the turbulent cascade is fairly modest, implying that plasmoids are expected to modify the turbulent path to dissipation in many astrophysical systems.

  4. Drift wave turbulence in low-β plasmas

    DEFF Research Database (Denmark)

    Mikkelsen, Torben; Larsen, Søren Ejling; Pécseli, Hans

    1983-01-01

    of wavenumber spectra. The spectral index of the turbulent potential fluctuations is determined and the variation of the spectral intensity is investigated for varying magnetic fields. The results compare favourably with theoretical predictions. The importance of distinguishing subranges in the turbulent...

  5. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  6. Cascade of circulations in fluid turbulence.

    Science.gov (United States)

    Eyink, Gregory L

    2006-12-01

    Kelvin's theorem on conservation of circulations is an essential ingredient of Taylor's theory of turbulent energy dissipation by the process of vortex-line stretching. In previous work, we have proposed a nonlinear mechanism for the breakdown of Kelvin's theorem in ideal turbulence at infinite Reynolds number. We develop here a detailed physical theory of this cascade of circulations. Our analysis is based upon an effective equation for large-scale coarse-grained velocity, which contains a turbulent-induced vortex force that can violate Kelvin's theorem. We show that singularities of sufficient strength, which are observed to exist in turbulent flow, can lead to nonvanishing dissipation of circulation for an arbitrarily small coarse-graining length in the effective equations. This result is an analog for circulation of Onsager's theorem on energy dissipation for singular Euler solutions. The physical mechanism of the breakdown of Kelvin's theorem is diffusion of lines of large-scale vorticity out of the advected loop. This phenomenon can be viewed as a classical analog of the Josephson-Anderson phase-slip phenomenon in superfluids due to quantized vortex lines. We show that the circulation cascade is local in scale and use this locality to develop concrete expressions for the turbulent vortex force by a multiscale gradient expansion. We discuss implications for Taylor's theory of turbulent dissipation and we point out some related cascade phenomena, in particular for magnetic flux in magnetohydrodynamic turbulence.

  7. Magnetic fluctuation measurements in the thin resistive shell OHTE device operated as a reversed field pinch

    International Nuclear Information System (INIS)

    La Haye, R.J.; Lee, P.S.; Schaffer, M.J.; Tamano, T.; Taylor, P.L.

    1988-01-01

    A small set of magnetic pickup coils inside the thin resistive shell and an extensive set outside are used to monitor high frequency (3-50 kHz) MHD activity in a reversed field pinch discharge of duration long compared to the shell time constant. The MHD activity is dominated by nearly equal amplitude m=0 and m=-1 poloidal modes both of whose frequency spectra peak near the drift frequency, i.e. about 8 to 10 kHz. The m=0 and m=-1 activities are uncorrelated and exhibit strong turbulence; the autocorrelation times for both are about 40 μs, and the toroidal correlation lengths are about equal to the 20 cm shell minor radius b. The toroidal variation of the m=0 activity at a given time when Fourier analysed in toroidal mode n has a power spectrum peaking at n=4-5 or nb/R 0 approx.= 1. The n spectrum for m=-1 is nearly zero up to n=10 and substantial at 11 ≤ n ≤ 16, i.e. those modes which are pitch resonant in the plasma interior. The aperiodic development of a localized helical kink, the slinky mode, stabilizes, i.e. turns off, in turn the m=-1 high frequency activities of the n=11 and 12 modes. This is postulated to be due to the slinky mode flattening the gradient in μ near the axis (μ is the ratio between current density parallel to the magnetic field and the magnetic field strength). (author). Letter-to-the-editor. 11 refs, 5 figs

  8. High Reynolds Number Turbulence

    National Research Council Canada - National Science Library

    Smits, Alexander J

    2007-01-01

    The objectives of the grant were to provide a systematic study to fill the gap between existing research on low Reynolds number turbulent flows to the kinds of turbulent flows encountered on full-scale vehicles...

  9. Turbulent flow computation

    National Research Council Canada - National Science Library

    Drikakis, D; Geurts, Bernard

    2002-01-01

    ... discretization 3 A test-case: turbulent channel flow 4 Conclusions 75 75 82 93 98 4 Analysis and control of errors in the numerical simulation of turbulence Sandip Ghosal 1 Introduction 2 Source...

  10. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  11. Recurrence networks to study dynamical transitions in a turbulent combustor

    Science.gov (United States)

    Godavarthi, V.; Unni, V. R.; Gopalakrishnan, E. A.; Sujith, R. I.

    2017-06-01

    Thermoacoustic instability and lean blowout are the major challenges faced when a gas turbine combustor is operated under fuel lean conditions. The dynamics of thermoacoustic system is the result of complex nonlinear interactions between the subsystems—turbulent reactive flow and the acoustic field of the combustor. In order to study the transitions between the dynamical regimes in such a complex system, the time series corresponding to one of the dynamic variables is transformed to an ɛ-recurrence network. The topology of the recurrence network resembles the structure of the attractor representing the dynamics of the system. The transitions in the thermoacoustic system are then captured as the variation in the topological characteristics of the network. We show the presence of power law degree distribution in the recurrence networks constructed from time series acquired during the occurrence of combustion noise and during the low amplitude aperiodic oscillations prior to lean blowout. We also show the absence of power law degree distribution in the recurrence networks constructed from time series acquired during the occurrence of thermoacoustic instability and during the occurrence of intermittency. We demonstrate that the measures derived from recurrence network can be used as tools to capture the transitions in the turbulent combustor and also as early warning measures for predicting impending thermoacoustic instability and blowout.

  12. Turbulence and wind turbines

    DEFF Research Database (Denmark)

    Brand, Arno J.; Peinke, Joachim; Mann, Jakob

    2011-01-01

    The nature of turbulent flow towards, near and behind a wind turbine, the effect of turbulence on the electricity production and the mechanical loading of individual and clustered wind turbines, and some future issues are discussed.......The nature of turbulent flow towards, near and behind a wind turbine, the effect of turbulence on the electricity production and the mechanical loading of individual and clustered wind turbines, and some future issues are discussed....

  13. Coherence in Turbulence: New Perspective

    Science.gov (United States)

    Levich, Eugene

    2009-07-01

    . In particular, theoretical and numerical evidence is given indicating that BCC in turbulent channel/pipe flows have the depth at the walls proportional to the square root of the Reynolds number in wall units, Ly ∝ √Re, which is equivalent to the fractal dimension in normal to the walls y direction DyF = 0, 5, and the total dimension DF = Dx, zF + DyF = 2 + 0.5 = 2.5. Similar BCC structure and the same fractal dimension are suggested for geophysical turbulence, in near agreement with the recent comprehensive analysis of experimental and observational data. It is asserted that the atmospheric and oceanic events, e.g., tropical hurricanes, tornadoes and other mesoscale phenomena, and probably ocean currents are manifestations of BCC and their environs. Generally BCC should be rather seen as the turbulence core, while the whole surrounding 3D flow as being created and sustained by the intense vorticity of BCC by means of induction, in a manner similar to that for an electric current generating magnetic field. It is further argued that BCC is not only a theoretical concept important for fundamental grasp on turbulence, but may be a practical asset furnishing tools for turbulence management in regular fluids and plasmas. The concept of helical fluctuations in turbulence goes 25 years back in time, and while never totally abandoned nevertheless has been residing on the fringes of research activity. Experiment and numerical simulations had not been able to either validate or repudiate decisively the concept. However, recent large scale direct numerical simulations and proliferation of experimental and observational data showed convincingly how ubiquitous is the phenomenon of helicity fluctuations in various turbulent flows, from hurricanes and tornadoes to turbulent jets to solar wind plasma turbulence to turbulent flows in compressible fluids. This allowed a fresh look at the concept and led to a quantitative theory exposed in this paper. The paper concludes with a

  14. MAGNET

    CERN Multimedia

    by B. Curé

    2011-01-01

    The magnet operation was very satisfactory till the technical stop at the end of the year 2010. The field was ramped down on 5th December 2010, following the successful regeneration test of the turbine filters at full field on 3rd December 2010. This will limit in the future the quantity of magnet cycles, as it is no longer necessary to ramp down the magnet for this type of intervention. This is made possible by the use of the spare liquid Helium volume to cool the magnet while turbines 1 and 2 are stopped, leaving only the third turbine in operation. This obviously requires full availability of the operators to supervise the operation, as it is not automated. The cryogenics was stopped on 6th December 2010 and the magnet was left without cooling until 18th January 2011, when the cryoplant operation resumed. The magnet temperature reached 93 K. The maintenance of the vacuum pumping was done immediately after the magnet stop, when the magnet was still at very low temperature. Only the vacuum pumping of the ma...

  15. Plasma Heating and Alfvénic Turbulence Enhancement During Two Steps of Energy Conversion in Magnetic Reconnection Exhaust Region of Solar Wind

    Science.gov (United States)

    Jiansen, He; Xingyu, Zhu; Yajie, Chen; Chadi, Salem; Michael, Stevens; Hui, Li; Wenzhi, Ruan; Lei, Zhang; Chuanyi, Tu

    2018-04-01

    The magnetic reconnection exhaust is a pivotal region with enormous magnetic energy being continuously released and converted. The physical processes of energy conversion involved are so complicated that an all-round understanding based on in situ measurements is still lacking. We present the evidence of plasma heating by illustrating the broadening of proton and electron velocity distributions, which are extended mainly along the magnetic field, in an exhaust of interchange reconnection between two interplanetary magnetic flux tubes of the same polarity on the Sun. The exhaust is asymmetric across an interface, with both sides being bounded by a pair of compound discontinuities consisting of rotational discontinuity and slow shock. The energized plasmas are found to be firehose unstable, and responsible for the emanation of Alfvén waves during the second step of energy conversion. It is realized that the energy conversion in the exhaust can be a two-step process involving both plasma energization and wave emission.

  16. Gyrokinetic simulation of microtearing turbulence

    International Nuclear Information System (INIS)

    Doerk, Hauke

    2013-01-01

    In modern fusion experiments, plasma turbulence is responsible for the radial heat transport and thus determines the plasma confinement within the magnetic field of tokamak devices. Deeper theoretical understanding is needed to explain today's and future fusion experiments. The goal of fusion research is to establish nuclear fusion as a safe and sustainable energy source. In future fusion power plants, and also in large fusion experiments like the presently constructed ITER, plasma heating predominantly affects the electron species. The reason is of fundamental nature: the collisional cross section of fast ions that are produced by the heating systems is larger for thermal electrons than for thermal ions. It is thus essential to correctly predict electron thermal transport, but the overall picture still continues to evolve. Besides microinstabilities on the electron gyroradius scales, also a stochastized magnetic field can contribute to enhanced electron transport. Already since the 1970's, the so-called microtearing instability is discussed as a source of stochastic fields. This microinstability deserves its name for breaking up the magnetic field structure by forming small-scale magnetic islands. The linear microtearing instability and its nonlinear, turbulent behavior is investigated in this thesis by means of numerical simulations with the gyrokinetic turbulence code Gene. The underlying gyrokinetic equations are not only appropriate to predict turbulent transport, but also describe neoclassical transport that is drift-kinetic in nature. Besides revealing interesting physics on long time scales, solving the neoclassical equation serves as an excellent test for the numerical implementation of the collision operator in Gene. Focusing on the local limit, it is found that a modification of this implementation that considers certain symmetries is necessary to obtain a satisfactory agreement with the well-established drift-kinetic neoclassical code Neo. Also the

  17. Coherent vortical structures in two-dimensional plasma turbulence

    DEFF Research Database (Denmark)

    Pécseli, H.L.; Coutsias, E.A.; Huld, T.

    1992-01-01

    A laboratory experiment was carried out in order to study the nonlinear saturated stage of the cross-field electrostatic Kelvin-Helmholtz instability in a strongly magnetized plasma. The presence of large vortex-like structures in a background of wide-band turbulent fluctuations was demonstrated...... simulations. The importance of the large scale structures for the turbulent plasma transport across magnetic field lines was analyzed in detail....

  18. The temporal evolution of the resistive pressure-gradient-driven turbulence and anomalous transport in shear flow across the magnetic field

    Science.gov (United States)

    Lee, Hae June; Mikhailenko, Vladmir; Mikhailenko, Vladimir

    2017-10-01

    The temporal evolution of the resistive pressure-gradient-driven mode in the sheared flow is investigated by employing the shearing modes approach. It reveals an essential difference in the processes, which occur in the case of the flows with velocity shearing rate less than the growth rate of the instability in the steady plasmas, and in the case of the flows with velocity shear larger than the instability growth rate in steady plasmas. It displays the physical content of the empirical ``quench rule'' which predicts the suppression of the turbulence in the sheared flows when the velocity shearing rate becomes larger than the maximum growth rate of the possible instability. We found that the distortion of the perturbations by the sheared flow with such velocity shear introduces the time dependencies into the governing equations, which prohibits the application of the eigenmodes formalism and requires the solution of the initial value problem.

  19. Progress in turbulence research

    International Nuclear Information System (INIS)

    Bradshaw, P.

    1990-01-01

    Recent developments in experiments and eddy simulations, as an introduction to a discussion of turbulence modeling for engineers is reviewed. The most important advances in the last decade rely on computers: microcomputers to control laboratory experiments, especially for multidimensional imaging, and supercomputers to simulate turbulence. These basic studies in turbulence research are leading to genuine breakthroughs in prediction methods for engineers and earth scientists. The three main branches of turbulence research: experiments, simulations (numerically-accurate three-dimensional, time-dependent solutions of the Navier-Stokes equations, with any empiricism confined to the smallest eddies), and modeling (empirical closure of time-averaged equations for turbulent flow) are discussed. 33 refs

  20. Homogeneous turbulence dynamics

    CERN Document Server

    Sagaut, Pierre

    2018-01-01

    This book provides state-of-the-art results and theories in homogeneous turbulence, including anisotropy and compressibility effects with extension to quantum turbulence, magneto-hydodynamic turbulence  and turbulence in non-newtonian fluids. Each chapter is devoted to a given type of interaction (strain, rotation, shear, etc.), and presents and compares experimental data, numerical results, analysis of the Reynolds stress budget equations and advanced multipoint spectral theories. The role of both linear and non-linear mechanisms is emphasized. The link between the statistical properties and the dynamics of coherent structures is also addressed. Despite its restriction to homogeneous turbulence, the book is of interest to all people working in turbulence, since the basic physical mechanisms which are present in all turbulent flows are explained. The reader will find a unified presentation of the results and a clear presentation of existing controversies. Special attention is given to bridge the results obta...

  1. MAGNET

    CERN Multimedia

    B. Curé

    2012-01-01

      Following the unexpected magnet stops last August due to sequences of unfortunate events on the services and cryogenics [see CMS internal report], a few more events and initiatives again disrupted the magnet operation. All the magnet parameters stayed at their nominal values during this period without any fault or alarm on the magnet control and safety systems. The magnet was stopped for the September technical stop to allow interventions in the experimental cavern on the detector services. On 1 October, to prepare the transfer of the liquid nitrogen tank on its new location, several control cables had to be removed. One cable was cut mistakenly, causing a digital input card to switch off, resulting in a cold-box (CB) stop. This tank is used for the pre-cooling of the magnet from room temperature down to 80 K, and for this reason it is controlled through the cryogenics control system. Since the connection of the CB was only allowed for a field below 2 T to avoid the risk of triggering a fast d...

  2. MAGNET

    CERN Multimedia

    B. Curé

    2012-01-01

      The magnet was energised at the beginning of March 2012 at a low current to check all the MSS safety chains. Then the magnet was ramped up to 3.8 T on 6 March 2012. Unfortunately two days later an unintentional switch OFF of the power converter caused a slow dump. This was due to a misunderstanding of the CCC (CERN Control Centre) concerning the procedure to apply for the CMS converter control according to the beam-mode status at that time. Following this event, the third one since 2009, a discussion was initiated to define possible improvement, not only on software and procedures in the CCC, but also to evaluate the possibility to upgrade the CMS hardware to prevent such discharge from occurring because of incorrect procedure implementations. The magnet operation itself was smooth, and no power cuts took place. As a result, the number of magnetic cycles was reduced to the minimum, with only two full magnetic cycles from 0 T to 3.8 T. Nevertheless the magnet suffered four stops of the cryogeni...

  3. MAGNET

    CERN Multimedia

    Benoit Curé

    2010-01-01

    Operation of the magnet has gone quite smoothly during the first half of this year. The magnet has been at 4.5K for the full period since January. There was an unplanned short stop due to the CERN-wide power outage on May 28th, which caused a slow dump of the magnet. Since this occurred just before a planned technical stop of the LHC, during which access in the experimental cavern was authorized, it was decided to leave the magnet OFF until 2nd June, when magnet was ramped up again to 3.8T. The magnet system experienced a fault also resulting in a slow dump on April 14th. This was triggered by a thermostat on a filter choke in the 20kA DC power converter. The threshold of this thermostat is 65°C. However, no variation in the water-cooling flow rate or temperature was observed. Vibration may have been the root cause of the fault. All the thermostats have been checked, together with the cables, connectors and the read out card. The tightening of the inductance fixations has also been checked. More tem...

  4. MAGNET

    CERN Multimedia

    B. Curé

    2013-01-01

      The magnet was operated without any problem until the end of the LHC run in February 2013, apart from a CERN-wide power glitch on 10 January 2013 that affected the CMS refrigerator, causing a ramp down to 2 T in order to reconnect the coldbox. Another CERN-wide power glitch on 15 January 2013 didn’t affect the magnet subsystems, the cryoplant or the power converter. At the end of the magnet run, the reconnection of the coldbox at 2.5 T was tested. The process will be updated, in particular the parameters of some PID valve controllers. The helium flow of the current leads was reduced but only for a few seconds. The exercise will be repeated with the revised parameters to validate the automatic reconnection process of the coldbox. During LS1, the water-cooling services will be reduced and many interventions are planned on the electrical services. Therefore, the magnet cryogenics and subsystems will be stopped for several months, and the magnet cannot be kept cold. In order to avoid unc...

  5. MAGNET

    CERN Multimedia

    Benoit Curé

    2010-01-01

    The magnet was successfully operated at the end of the year 2009 despite some technical problems on the cryogenics. The magnet was ramped up to 3.8 T at the end of November until December 16th when the shutdown started. The magnet operation met a few unexpected stops. The field was reduced to 3.5 T for about 5 hours on December 3rd due to a faulty pressure sensor on the helium compressor. The following day the CERN CCC stopped unintentionally the power converters of the LHC and the experiments, triggering a ramp down that was stopped at 2.7 T. The magnet was back at 3.8 T about 6 hours after CCC sent the CERN-wide command. Three days later, a slow dump was triggered due to a stop of the pump feeding the power converter water-cooling circuit, during an intervention on the water-cooling plant done after several disturbances on the electrical distribution network. The magnet was back at 3.8 T in the evening the same day. On December 10th a break occurred in one turbine of the cold box producing the liquid ...

  6. MAGNET

    CERN Multimedia

    B. Curé

    2011-01-01

    The CMS magnet has been running steadily and smoothly since the summer, with no detected flaw. The magnet instrumentation is entirely operational and all the parameters are at their nominal values. Three power cuts on the electrical network affected the magnet run in the past five months, with no impact on the data-taking as the accelerator was also affected at the same time. On 22nd June, a thunderstorm caused a power glitch on the service electrical network. The primary water cooling at Point 5 was stopped. Despite a quick restart of the water cooling, the inlet temperature of the demineralised water on the busbar cooling circuit increased by 5 °C, up to 23.3 °C. It was kept below the threshold of 27 °C by switching off other cooling circuits to avoid the trigger of a slow dump of the magnet. The cold box of the cryogenics also stopped. Part of the spare liquid helium volume was used to maintain the cooling of the magnet at 4.5 K. The operators of the cryogenics quickly restarted ...

  7. MAGNET

    CERN Multimedia

    B. Curé

    2012-01-01

      The magnet and its sub-systems were stopped at the beginning of the winter shutdown on 8th December 2011. The magnet was left without cooling during the cryogenics maintenance until 17th January 2012, when the cryoplant operation resumed. The magnet temperature reached 93 K. The vacuum pumping was maintained during this period. During this shutdown, the yearly maintenance was performed on the cryogenics, the vacuum pumps, the magnet control and safety systems, and the power converter and discharge lines. Several preventive actions led to the replacement of the electrovalve command coils, and the 20A DC power supplies of the magnet control system. The filters were cleaned on the demineralised water circuits. The oil of the diffusion pumps was changed. On the cryogenics, warm nitrogen at 343 K was circulated in the cold box to regenerate the filters and the heat exchangers. The coalescing filters have been replaced at the inlet of both the turbines and the lubricant trapping unit. The active cha...

  8. Interstellar MHD Turbulence and Star Formation

    Science.gov (United States)

    Vázquez-Semadeni, Enrique

    This chapter reviews the nature of turbulence in the Galactic interstellar medium (ISM) and its connections to the star formation (SF) process. The ISM is turbulent, magnetized, self-gravitating, and is subject to heating and cooling processes that control its thermodynamic behavior, causing it to behave approximately isobarically, in spite of spanning several orders of magnitude in density and temperature. The turbulence in the warm and hot ionized components of the ISM appears to be trans- or subsonic, and thus to behave nearly incompressibly. However, the neutral warm and cold components are highly compressible, as a consequence of both thermal instability (TI) in the atomic gas and of moderately-to-strongly supersonic motions in the roughly isothermal cold atomic and molecular components. Within this context, we discuss: (1) the production and statistical distribution of turbulent density fluctuations in both isothermal and polytropic media; (2) the nature of the clumps produced by TI, noting that, contrary to classical ideas, they in general accrete mass from their environment in spite of exhibiting sharp discontinuities at their boundaries; (3) the density-magnetic field correlation (and, at low densities, lack thereof) in turbulent density fluctuations, as a consequence of the superposition of the different wave modes in the turbulent flow; (4) the evolution of the mass-to-magnetic flux ratio (MFR) in density fluctuations as they are built up by dynamic compressions; (5) the formation of cold, dense clouds aided by TI, in both the hydrodynamic (HD) and the magnetohydrodynamic (MHD) cases; (6) the expectation that star-forming molecular clouds are likely to be undergoing global gravitational contraction, rather than being near equilibrium, as generally believed, and (7) the regulation of the star formation rate (SFR) in such gravitationally contracting clouds by stellar feedback which, rather than keeping the clouds from collapsing, evaporates and disperses

  9. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor

    Energy Technology Data Exchange (ETDEWEB)

    Gentili, Pier Luigi, E-mail: pierluigi.gentili@unipg.it [Department of Chemistry, Biology and Biotechnology, University of Perugia, 06123 Perugia (Italy); Gotoda, Hiroshi [Department of Mechanical Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu-shi, Shiga 525-8577 (Japan); Dolnik, Milos; Epstein, Irving R. [Department of Chemistry, Brandeis University, Waltham, Massachusetts 02454-9110 (United States)

    2015-01-15

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  10. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor.

    Science.gov (United States)

    Gentili, Pier Luigi; Gotoda, Hiroshi; Dolnik, Milos; Epstein, Irving R

    2015-01-01

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  11. Interdisciplinary aspects of turbulence

    CERN Document Server

    Kupka, Friedrich

    2008-01-01

    What do combustion engines, fusion reactors, weather forecast, ocean flows, our sun, and stellar explosions in outer space have in common? Of course, the physics and the length and time scales are vastly different in all cases, but it is also well known that in all of them, on some relevant length scales, the material flows that govern the dynamical and/or secular evolution of the systems are chaotic and often unpredictable: they are said to be turbulent. The interdisciplinary aspects of turbulence are brought together in this volume containing chapters written by experts from very different fields, including geophysics, astrophysics, and engineering. It covers several subjects on which considerable progress was made during the last decades, from questions concerning the very nature of turbulence to some practical applications. These subjects include: a basic introduction into turbulence, statistical mechanics and nonlinear dynamics, turbulent convection in stars, atmospheric turbulence in the context of nume...

  12. Improved model of quasi-particle turbulence (with applications to Alfven and drift wave turbulence)

    International Nuclear Information System (INIS)

    Mendonca, J. T.; Hizanidis, K.

    2011-01-01

    We consider the classical problem of wave stability and dispersion in a turbulent plasma background. We adopt a kinetic description for the quasi-particle turbulence. We describe an improved theoretical approach, which goes beyond the geometric optics approximation and retains the recoil effects associated with the emission and absorption of low frequency waves by nearly resonant quasi-particles. We illustrate the present approach by considering two particular examples. One is the excitation of zonal flows by drift wave turbulence or driftons. The other is the coupling between ion acoustic waves and Alfven wave turbulence, eventually leading to saturation of Alfven wave growth. Both examples are relevant to anomalous transport in magnetic fusion devices. Connection with previous results is established. We show that these results are recovered in the geometric optics approximation.

  13. CHARACTERIZATION OF TURBULENCE FROM SUBMILLIMETER DUST EMISSION

    International Nuclear Information System (INIS)

    Chitsazzadeh, Shadi; Houde, Martin; Hildebrand, Roger H.; Vaillancourt, John

    2012-01-01

    In this paper, we use our recent technique for estimating the turbulent component of the magnetic field to derive the structure functions of the unpolarized emission as well as that of the Stokes Q and U parameters of the polarized emission. The solutions for the structure functions to 350 μm SHARP polarization data of OMC-1 allow the determination of the corresponding turbulent correlation length scales. The estimated values for these length scales are 9.''4 ± 0.''1, 7.''3 ± 0.''1, 12.''6 ± 0.''2 (or 20.5 ± 0.2, 16.0 ± 0.2, and 27.5 ± 0.4 mpc at 450 pc, the adopted distance for OMC-1) for the Stokes Q and U parameters, and for the unpolarized emission N, respectively. Our current results for Q and U are consistent with previous results obtained through other methods and may indicate presence of anisotropy in magnetized turbulence. We infer a weak coupling between the dust component responsible for the unpolarized emission N and the magnetic field B from the significant difference between their turbulent correlation length scales.

  14. A new maser effect in plasma turbulence

    International Nuclear Information System (INIS)

    Nambu, M.

    1983-01-01

    The present state of understanding of a new maser effect is reviewed. The new maser effect, the idea that the resonant electrons in a turbulent plasma can radiate amplified electromagnetic radiation, does not require population inversion of electrons. The new maser effect always coexists with Landau (or cyclotron) damping; thus it is a fundamental effect in plasma turbulence. In nuclear fusion, magnetic confinement will be at a disadvantage due to the enhanced radiation losses in the long wave length region, while inertial confinement will be improved by the laser effect in the X-ray region. (author)

  15. Measurement of magnetic turbulence structure and nonlinear mode coupling of tearing fluctuations in the Madison Symmetric Torus reversed field pinch edge

    International Nuclear Information System (INIS)

    Assadi, S.

    1994-01-01

    Linear and nonlinear magnetohydrodynamic (MHD) stability of current-driven modes are studied in the MST reversed field pinch. Measured low frequency (f < 35 kHz) magnetic fluctuations are consistent with the global resistive tearing instabilities predicted by 3-D MHD simulations. At frequencies above 35 kHz, the magnetic fluctuations were detected to be localized and externally resonant. Discrete dynamo events, ''sawtooth oscillations,'' have been observed in the experimental RFP plasmas. This phenomenon causes the plasma to become unstable to m = 1 tearing modes. The modes that may be important in different phases of these oscillations are identified. These results then assist in nonlinear studies and also help to interpret the spectral broadening of the measured data during a discrete dynamo event. Three-wave nonlinear coupling of spectral Fourier modes is measured in the MST by applying bispectral analysis to magnetic fluctuations measured at the plasma edge at 64 toroidal locations and 16 poloidal locations, permitting observation of coupling over 8 poloidal and 32 toroidal modes. Comparison to bispectra predicted by resistive MHD computation indicates reasonably good agreement. However, during the crash phase of the sawtooth oscillation the nonlinear coupling is strongly enhanced, concomitant with a broadened k-spectrum. During the sawtooth formation the plasma is undergoing a pure diffusive process. The dynamo only occurs during the sawtooth crash. High frequency activity prior to a sawtooth crash is caused by nonlinear frequency (small-scale) mode coupling. Growth rate and coupling coefficients of toroidal mode spectra are calculated by statistical modeling. Temporal evolution of edge toroidal mode spectra has been predicted by transfer function analysis. The driving sources of electrostatic fields are different than for the magnetic fields. The characteristics of tearing modes can be altered by external field errors and addition of impurities to the plasma

  16. Ambipolar electric fields and turbulence studies in the Wisconsin levitated toroidal octupole

    International Nuclear Information System (INIS)

    Armentrout, C.J.

    1977-01-01

    Detailed studies of hot ion plasmas (T/sub i/ > T/sub e/) in the poloidal field octupole show that the ambipolar electric field which is perpendicular to the flux surfaces is well explained by the observed properties of the microturbulence structures in the plasma. The turbulence structure has been measured by correlation techniques which are carefully described. In these experiments, signals were studied which are aperiodic in time and space, short lived compared to the decay times of the bulk plasma parameters, short ranged compared to the machine size, and are therefore classified as microturbulence structures. The resulting spatial and temporal correlation functions (CFs) are well fitted to a Gaussian function and the associated correlation lengths or times are the half width at half maximum of the CFs. The correlation length is measured to be the ion gyro radius for the hot hydrogen plasma and somewhat less for the helium plasma

  17. MAGNET

    CERN Multimedia

    B. Curé

    2011-01-01

    The magnet ran smoothly in the last few months until a fast dump occurred on 9th May 2011. Fortunately, this occurred in the afternoon of the first day of the technical stop. The fast dump was due to a valve position controller that caused the sudden closure of a valve. This valve is used to regulate the helium flow on one of the two current leads, which electrically connects the coil at 4.5 K to the busbars at room temperature. With no helium flow on the lead, the voltage drop and the temperatures across the leads increase up to the defined thresholds, triggering a fast dump through the Magnet Safety System (MSS). The automatic reaction triggered by the MSS worked properly. The helium release was limited as the pressure rise was just at the limit of the safety valve opening pressure. The average temperature of the magnet reached 72 K. It took four days to recover the temperature and refill the helium volumes. The faulty valve controller was replaced by a spare one before the magnet ramp-up resumed....

  18. Self-regulation of turbulence bursts and transport barriers

    International Nuclear Information System (INIS)

    Floriani, E; Ciraolo, G; Ghendrih, Ph; Sarazin, Y; Lima, R

    2013-01-01

    The interplay between turbulent bursts and transport barriers is analyzed with a simplified model of interchange turbulence in magnetically confined plasmas. The turbulent bursts spread into the transport barriers and, depending on the competing magnitude of the burst and stopping capability of the barrier, can burn through. Simulations of two models of transport barriers are presented: a hard barrier where interchange turbulence modes are stable in a prescribed region and a soft barrier with external plasma biasing. The response of the transport barriers to the non-linear perturbations of the turbulent bursts, addressed in a predator–prey approach, indicates that the barriers monitor an amplification factor of the turbulent bursts, with amplification smaller than one for most bursts and, in some cases, amplification factors that can significantly exceed unity. The weak barriers in corrugated profiles and magnetic structures, as well as the standard barriers, are characterized by these transmission properties, which then regulate the turbulent burst transport properties. The interplays of barriers and turbulent bursts are modeled as competing stochastic processes. For different classes of the probability density function (PDF) of these processes, one can predict the heavy tail properties of the bursts downstream from the barrier, either exponential for a leaky barrier, or with power laws for a tight barrier. The intrinsic probing of the transport barriers by the turbulent bursts thus gives access to the properties of the barriers. The main stochastic variables are the barrier width and the spreading distance of the turbulent bursts within the barrier, together with their level of correlation. One finds that in the case of a barrier with volumetric losses, such as radiation or particle losses as addressed in our present simulations, the stochastic model predicts a leaky behavior with an exponential PDF of escaping turbulent bursts in agreement with the simulation

  19. The FIELDS Instrument Suite for Solar Probe Plus Measuring the Coronal Plasma and Magnetic Field, Plasma Waves and Turbulence, and Radio Signatures of Solar Transients

    Science.gov (United States)

    Bale, S. D.; Goetz, K.; Harvey, P. R.; Turin, P.; Bonnell, J. W.; Dudok de Wit, T.; Ergun, R. E.; MacDowall, R. J.; Pulupa, M.; Choi, M. K.; hide

    2016-01-01

    NASA's Solar Probe Plus (SPP) mission will make the first in situ measurements of the solar corona and the birthplace of the solar wind. The FIELDS instrument suite on SPP will make direct measurements of electric and magnetic fields, the properties of in situ plasma waves, electron density and temperature profiles, and interplanetary radio emissions, amongst other things. Here, we describe the scientific objectives targeted by the SPP/FIELDS instrument, the instrument design itself, and the instrument concept of operations and planned data products.

  20. Simulations and Transport Models for Imbalanced Magnetohydrodynamic Turbulence

    Science.gov (United States)

    Ng, Chung-Sang; Dennis, T.

    2016-10-01

    We present results from a series of three-dimensional simulations of magnetohydrodynamic (MHD) turbulence based on reduced MHD equations. Alfven waves are launched from both ends of a long tube along the background uniform magnetic field so that turbulence develops due to collision between counter propagating Alfven waves in the interior region. Waves are launched randomly with specified correlation time Tc such that the length of the tube, L, is greater than (but of the same order of) VA *Tc such that turbulence can fill most of the tube. While waves at both ends are launched with equal power, turbulence generated is imbalanced in general, with normalized cross-helicity gets close to -1 at one end and 1 at the other end. This simulation setup allows easier comparison of turbulence properties with one-dimensional turbulence transport models, which have been applied rather successfully in modeling solar wind turbulence. However, direct comparison of such models with full simulations of solar wind turbulence is difficult due to much higher level of complexity involved. We will present our latest simulations at different resolutions with decreasing dissipation (resistivity and viscosity) levels and compare with model outputs from turbulence transport models. This work is supported by a NASA Grant NNX15AU61G.

  1. Resistive fluid turbulence and tokamak edge plasma dynamics

    International Nuclear Information System (INIS)

    Thayer, D.R.; Diamond, P.H.; Ritz, C.P.

    1988-01-01

    Electrostatic and electromagnetic turbulence has been linked to particle and heat transport in tokamaks. Here we report on several related theoretical and experimental investigations of edge plasma dynamics. The theory of thermally-driven convective cell edge turbulence has been developed to treat the coupling of the radiative-condensation instability to the resistivity-gradient expansion free energy. This model of edge turbulence has led to theoretical understanding of several anomalies in electrostatic edge turbulence found from experiment: that fluctuation levels and transport coefficients are larger than naively expected, that potential fluctuations are significantly larger than the density. Impurity gas-puffing experiments on the TEXT tokamak have been performed to test this theory, and have indicated favorable results. Resistive fluid turbulence models have also been explored and applied in the hope of understanding the extensive edge magnetic fluctuation studies. We discuss models of electromagnetic microtearing turbulence, resistive-pressure-gradient-driven turbulence, and ion temperature gradient driven turbulence. In particular we study the role of resistive fluid turbulence with separatrix effects in the L /yield/ H mode transition. 36 refs., 2 figs

  2. Strong Turbulence in Low-beta Plasmas

    DEFF Research Database (Denmark)

    Tchen, C. M.; Pécseli, Hans; Larsen, Søren Ejling

    1980-01-01

    An investigation of the spectral structure of turbulence in a plasma confined by a strong homogeneous magnetic field was made by means of a fluid description. The turbulent spectrum is divided into subranges. Mean gradients of velocity and density excite turbulent motions, and govern the production...... subrange. The spectra of velocity and potential fluctuations interact in the coupling subrange, and the energy is transferred along the spectrum in the inertia subrange. Applying the method of cascade decomposition, the spectral laws k-3, k-3, k-2 are obtained for the velocity fluctuations, and k-3, k-5, k......-3/2 for the potential fluctuations in the production, coupling and inertia subranges, respectively. The coefficient of Bohm diffusion is reproduced, and its role in electrostatic coupling is derived. Comparison is made with measured power laws reported in the literature, from Q-devices, hot...

  3. Boundary Plasma Turbulence Simulations for Tokamaks

    International Nuclear Information System (INIS)

    Xu, X.; Umansky, M.; Dudson, B.; Snyder, P.

    2008-05-01

    The boundary plasma turbulence code BOUT models tokamak boundary-plasma turbulence in a realistic divertor geometry using modified Braginskii equations for plasma vorticity, density (ni), electron and ion temperature (T e ; T i ) and parallel momenta. The BOUT code solves for the plasma fluid equations in a three dimensional (3D) toroidal segment (or a toroidal wedge), including the region somewhat inside the separatrix and extending into the scrape-off layer; the private flux region is also included. In this paper, a description is given of the sophisticated physical models, innovative numerical algorithms, and modern software design used to simulate edge-plasmas in magnetic fusion energy devices. The BOUT code's unique capabilities and functionality are exemplified via simulations of the impact of plasma density on tokamak edge turbulence and blob dynamics

  4. PDF Modeling of Turbulent Combustion

    National Research Council Canada - National Science Library

    Pope, Stephen B

    2006-01-01

    .... The PDF approach to turbulent combustion has the advantages of fully representing the turbulent fluctuations of species and temperature, and of allowing realistic combustion chemistry to be implemented...

  5. MAGNET

    CERN Multimedia

    Benoit Curé

    2010-01-01

    The magnet worked very well at 3.8 T as expected, despite a technical issue that manifested twice in the cryogenics since June. All the other magnet sub-systems worked without flaw. The issue in the cryogenics was with the cold box: it could be observed that the cold box was getting progressively blocked, due to some residual humidity and air accumulating in the first thermal exchanger and in the adsorber at 65 K. This was later confirmed by the analysis during the regeneration phases. An increase in the temperature difference between the helium inlet and outlet across the heat exchanger and a pressure drop increase on the filter of the adsorber were observed. The consequence was a reduction of the helium flow, first compensated by the automatic opening of the regulation valves. But once they were fully opened, the flow and refrigeration power reduced as a consequence. In such a situation, the liquid helium level in the helium Dewar decreased, eventually causing a ramp down of the magnet current and a field...

  6. MAGNET

    CERN Multimedia

    B. Curé

    MAGNET During the winter shutdown, the magnet subsystems went through a full maintenance. The magnet was successfully warmed up to room temperature beginning of December 2008. The vacuum was broken later on by injecting nitrogen at a pressure just above one atmosphere inside the vacuum tank. This was necessary both to prevent any accidental humidity ingress, and to allow for a modification of the vacuum gauges on the vacuum tank and maintenance of the diffusion pumps. The vacuum gauges had to be changed, because of erratic variations on the measurements, causing spurious alarms. The new type of vacuum gauges has been used in similar conditions on the other LHC experiments and without problems. They are shielded against the stray field. The lubricants of the primary and diffusion pumps have been changed. Several minor modifications were also carried out on the equipment in the service cavern, with the aim to ease the maintenance and to allow possible intervention during operation. Spare sensors have been bough...

  7. MAGNET

    CERN Multimedia

    B. Curé

    2013-01-01

    The magnet is fully stopped and at room temperature. The maintenance works and consolidation activities on the magnet sub-systems are progressing. To consolidate the cryogenic installation, two redundant helium compressors will be installed as ‘hot spares’, to avoid the risk of a magnet downtime in case of a major failure of a compressor unit during operation. The screw compressors, their motors, the mechanical couplings and the concrete blocks are already available and stored at P5. The metallic structure used to access the existing compressors in SH5 will be modified to allow the installation of the two redundant ones. The plan is to finish the installation and commissioning of the hot spare compressors before the summer 2014. In the meantime, a bypass on the high-pressure helium piping will be installed for the connection of a helium drier unit later during the Long Shutdown 1, keeping this installation out of the schedule critical path. A proposal is now being prepared for the con...

  8. MAGNET

    CERN Multimedia

    Benoit Curé.

    The magnet operation restarted end of June this year. Quick routine checks of the magnet sub-systems were performed at low current before starting the ramps up to higher field. It appeared clearly that the end of the field ramp down to zero was too long to be compatible with the detector commissioning and operations plans. It was decided to perform an upgrade to keep the ramp down from 3.8T to zero within 4 hours. On July 10th, when a field of 1.5T was reached, small movements were observed in the forward region support table and it was decided to fix this problem before going to higher field. At the end of July the ramps could be resumed. On July 28th, the field was at 3.8T and the summer CRAFT exercise could start. This run in August went smoothly until a general CERN wide power cut took place on August 3rd, due to an insulation fault on the high voltage network outside point 5. It affected the magnet powering electrical circuit, as it caused the opening of the main circuit breakers, resulting in a fast du...

  9. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  10. Energy partitioning constraints at kinetic scales in low-β turbulence

    Science.gov (United States)

    Gershman, Daniel J.; F.-Viñas, Adolfo; Dorelli, John C.; Goldstein, Melvyn L.; Shuster, Jason; Avanov, Levon A.; Boardsen, Scott A.; Stawarz, Julia E.; Schwartz, Steven J.; Schiff, Conrad; Lavraud, Benoit; Saito, Yoshifumi; Paterson, William R.; Giles, Barbara L.; Pollock, Craig J.; Strangeway, Robert J.; Russell, Christopher T.; Torbert, Roy B.; Moore, Thomas E.; Burch, James L.

    2018-02-01

    Turbulence is a fundamental physical process through which energy injected into a system at large scales cascades to smaller scales. In collisionless plasmas, turbulence provides a critical mechanism for dissipating electromagnetic energy. Here, we present observations of plasma fluctuations in low-β turbulence using data from NASA's Magnetospheric Multiscale mission in Earth's magnetosheath. We provide constraints on the partitioning of turbulent energy density in the fluid, ion-kinetic, and electron-kinetic ranges. Magnetic field fluctuations dominated the energy density spectrum throughout the fluid and ion-kinetic ranges, consistent with previous observations of turbulence in similar plasma regimes. However, at scales shorter than the electron inertial length, fluctuation power in electron kinetic energy significantly exceeded that of the magnetic field, resulting in an electron-motion-regulated cascade at small scales. This dominance is highly relevant for the study of turbulence in highly magnetized laboratory and astrophysical plasmas.

  11. Limits on the ions temperature anisotropy in turbulent intracluster medium

    Energy Technology Data Exchange (ETDEWEB)

    Santos-Lima, R. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Potsdam Univ. (Germany). Inst. fuer Physik und Astronomie; Univ. de Sao Paulo (Brazil). Inst. de Astronomia, Geofisica e Ciencias Atmosfericas; Yan, H. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Potsdam Univ. (Germany). Inst. fuer Physik und Astronomie; Gouveia Dal Pino, E.M. de [Univ. de Sao Paulo (Brazil). Inst. de Astronomia, Geofisica e Ciencias Atmosfericas; Lazarian, A. [Wisconsin Univ., Madison, WI (United States). Dept. of Astronomy

    2016-05-15

    Turbulence in the weakly collisional intracluster medium of galaxies (ICM) is able to generate strong thermal velocity anisotropies in the ions (with respect to the local magnetic field direction), if the magnetic moment of the particles is conserved in the absence of Coulomb collisions. In this scenario, the anisotropic pressure magnetohydrodynamic (AMHD) turbulence shows a very different statistical behaviour from the standard MHD one and is unable to amplify seed magnetic fields, in disagreement with previous cosmological MHD simulations which are successful to explain the observed magnetic fields in the ICM. On the other hand, temperature anisotropies can also drive plasma instabilities which can relax the anisotropy. This work aims to compare the relaxation rate with the growth rate of the anisotropies driven by the turbulence. We employ quasilinear theory to estimate the ions scattering rate due to the parallel firehose, mirror, and ion-cyclotron instabilities, for a set of plasma parameters resulting from AMHD simulations of the turbulent ICM. We show that the ICM turbulence can sustain only anisotropy levels very close to the instabilities thresholds. We argue that the AMHD model which bounds the anisotropies at the marginal stability levels can describe the Alfvenic turbulence cascade in the ICM.

  12. Light particles in turbulence

    NARCIS (Netherlands)

    Nagendra Prakash, Vivek

    2013-01-01

    This thesis deals with the broad topic of particles in turbulence, which has applications in a diverse number of fields. A vast majority of fluid flows found in nature and in the industry are turbulent and contain dispersed elements. In this thesis, I have focused on light particles (air bubbles in

  13. Dynamic paradigm of turbulence

    International Nuclear Information System (INIS)

    Mukhamedov, Alfred M.

    2006-01-01

    In this paper a dynamic paradigm of turbulence is proposed. The basic idea consists in the novel definition of chaotic structure given with the help of Pfaff system of PDE associated with the turbulent dynamics. A methodological analysis of the new and the former paradigm is produced

  14. Hyper-resistivity produced by tearing mode turbulence

    International Nuclear Information System (INIS)

    Strauss, H.R.

    1986-01-01

    Tearing mode turbulence produces a hyper-resistivity or effective anomalous electron viscosity. The hyper-resistivity is calculated for the mean magnetic field quasilinearly, and for long-wavelength modes using the direct interaction approximation. The hyper-resistivity accounts for current relaxation in reversed-field pinch experiments, and gives a magnetic fluctuation sealing of S -1 /sup // 3 . It causes enhanced tearing mode growth rates in the turbulent phase of tokamak disruptions. In astrophysics, it limits magnetic energy growth due to the dynamo effect, and may explain rapid reconnection phenomena such as solar flares

  15. Inertial range spectrum of field-aligned whistler turbulence

    DEFF Research Database (Denmark)

    Dwivedi, Navin Kumar; Singh, Shobhana

    2017-01-01

    An analytical model to study the whistler turbulence spectrum and inertial range spectral scalings related with the electric and magnetic field spectra in a weakly non-collisional magnetized plasma is developed. In the present model, the dispersion relation of whistler wave propagating along...

  16. PREFACE: Turbulent Mixing and Beyond Turbulent Mixing and Beyond

    Science.gov (United States)

    Abarzhi, Snezhana I.; Gauthier, Serge; Rosner, Robert

    2008-10-01

    The goals of the International Conference `Turbulent Mixing and Beyond' are to expose the generic problem of Turbulence and Turbulent Mixing in Unsteady Flows to a wide scientific community, to promote the development of new ideas in tackling the fundamental aspects of the problem, to assist in the application of novel approaches in a broad range of phenomena, where the non-canonical turbulent processes occur, and to have a potential impact on technology. The Conference provides the opportunity to bring together scientists from the areas which include, but are not limited to, high energy density physics, plasmas, fluid dynamics, turbulence, combustion, material science, geophysics, astrophysics, optics and telecommunications, applied mathematics, probability and statistics, and to have their attention focused on the long-standing formidable task. The Turbulent Mixing and Turbulence in Unsteady Flows, including multiphase flows, plays a key role in a wide variety of phenomena, ranging from astrophysical to nano-scales, under either high or low energy density conditions. Inertial confinement and magnetic fusion, light-matter interaction and non-equilibrium heat transfer, properties of materials under high strain rates, strong shocks, explosions, blast waves, supernovae and accretion disks, stellar non-Boussinesq and magneto-convection, planetary interiors and mantle-lithosphere tectonics, premixed and non-premixed combustion, oceanography, atmospheric flows, unsteady boundary layers, hypersonic and supersonic flows, are a few examples to list. A grip on unsteady turbulent processes is crucial for cutting-edge technology such as laser-micromachining and free-space optical telecommunications, and for industrial applications in aeronautics. Unsteady Turbulent Processes are anisotropic, non-local and multi-scale, and their fundamental scaling, spectral and invariant properties depart from the classical Kolmogorov scenario. The singular aspects and similarity of the

  17. Sources of nonadiabaticity in tokamak turbulence

    International Nuclear Information System (INIS)

    Thyagaraja, A.; Haas, F.A.

    1993-01-01

    The two-fluid equations governing the nonlinear evolution and saturation of drift wave-like turbulence and transport in tokamaks under quasi-neutral conditions in periodic cylinder geometry are investigated. Using experiment as guide and employing appropriate orderings, two non-adiabaticity parameters, Υ es and Υ em are derived as functions of the reduced frequency ωa/v thi and wave number ρ i k r characteristic of the turbulent fluctuation spectrum. These parameters correspond respectively to the electrostatic limit and the general electromagnetic case. It is shown that they must be O(1) if significant particle and ion energy transport are to be expected from the turbulence. In other words, they are measures of the departure from neo-classical particle and ion energy transport due to the turbulence. These analytic results are complementary to, and serve as guidelines for, any future direct numerical simulations of the set of seven nonlinear partial differential equations which must be solved with suitable sources of particles, momentum and energy to determine the turbulence evolution and resultant saturated power spectra of density, pressure, electrostatic potential and magnetic field. The nonadiabaticity parameters discussed suggest possible qualitative explanations of the isotope effect and reduction of anomalous transport noted in H-mode tokamak discharges. (orig.)

  18. A study of runaway electron confinement and theory of neoclassical MHD turbulence

    International Nuclear Information System (INIS)

    Kwon, Oh Jin

    1989-07-01

    This thesis consists of two major studies: a study of runaway electron confinement and a theory of neoclassical MHD turbulence. The aim of the former is to study the structure of internal magnetic turbulence in tokamaks, which is thought by many to be responsible for the heat transport. The aim of the latter is to extend existing theories of MHD turbulence in tokamaks into experimentally relevant low-collisionality regimes. This section contains a theory of neoclassical pressure-gradient-driven turbulence and a theory of neoclassical resistivity-gradient-driven turbulence

  19. Gyrokinetic simulations of ETG Turbulence*

    Science.gov (United States)

    Nevins, William

    2005-10-01

    Recent gyrokinetic simulations of electron temperature gradient (ETG) turbulence [1,2] produced different results despite similar plasma parameters. Ref.[1] differs from Ref.[2] in that [1] eliminates magnetically trapped particles ( r/R=0 ), while [2] retains magnetically trapped particles ( r/R 0.18 ). Differences between [1] and [2] have been attributed to insufficient phase-space resolution and novel physics associated with toroidicity and/or global simulations[2]. We have reproduced the results reported in [2] using a flux-tube, particle-in-cell (PIC) code, PG3EQ[3], thereby eliminating global effects as the cause of the discrepancy. We observe late-time decay of ETG turbulence and the steady-state heat transport in agreement with [2], and show this results from discrete particle noise. Discrete particle noise is a numerical artifact, so both the PG3EQ simulations reported here and those reported in Ref.[2] have little to say about steady-state ETG turbulence and the associated anomalous electron heat transport. Our attempts to benchmark PIC and continuum[4] codes at the plasma parameters used in Ref.[2] produced very large, intermittent transport. We will present an alternate benchmark point for ETG turbulence, where several codes reproduce the same transport levels. Parameter scans about this new benchmark point will be used to investigate the parameter dependence of ETG transport and to elucidate saturation mechanisms proposed in Refs.[1,2] and elsewhere[5-7].*In collaboration with A. Dimits (LLNL), J. Candy, C. Estrada-Mila (GA), W. Dorland (U of MD), F. Jenko, T. Dannert (Max-Planck Institut), and G. Hammett (PPPL). Work at LLNL performed for US DOE under Contract W7405-ENG-48.[1] F. Jenko and W. Dorland, PRL 89, 225001 (2002).[2] Z. Lin et al, 2004 Sherwood Mtg.; 2004 TTF Mtg.; Fusion Energy 2004 (IAEA, Vienna, 2005); Bull. Am. Phys. Soc. (November, 2004); 2005 TTF Mtg.; 2005 Sherwood Mtg.; Z. Lin, et al, Phys. Plasmas 12, 056125 (2005). [3] A.M. Dimits

  20. Steady-state magnetohydrodynamic clump turbulence

    International Nuclear Information System (INIS)

    Tetreault, D.J.

    1989-01-01

    The turbulent steady state of the magnetohydrodynamic (MHD) clump instability [Phys. Fluids 31, 2122 (1988)] is investigated. The steady state is determined by the balance between clump growth by turbulent mixing and clump decay by field line stochasticity. The turbulent fields driving the mixing are generated self-consistently from Ampere's law and conserve the magnetic helicity. In the steady state, the mean current and magnetic field satisfy J 0 = μB 0 , where μ depends on the mean-square fluctuation level. Above this critical point (J 0 >μB 0 ), the plasma is MHD clump unstable. MHD clump instability is a dynamical route to the force-free, Taylor state. For the steady state to exist, μ must exceed a threshold on the order of that required for B 0 /sub z/ field reversal. Steady-state MHD clump turbulence corresponds to field reversed Taylor states. From the μ threshold condition, the steady-state fluctuation spectrum (δB/sub rms//B) is calculated and shown to increase with mean driving current as θ 3 , where θ is the pinch parameter

  1. Compressibility and rotation effects on transport suppression in magnetohydrodynamic turbulence

    International Nuclear Information System (INIS)

    Yoshizawa, A.

    1996-01-01

    Compressibility and rotation effects on turbulent transports in magnetohydrodynamic (MHD) flows under arbitrary mean field are investigated using a Markovianized two-scale statistical approach. Some new aspects of MHD turbulence are pointed out in close relation to plasma compressibility. Special attention is paid to the turbulent electromotive force, which plays a central role in the generation of magnetic and velocity fluctuations. In addition to plasma rotation, the interaction between compressibility and magnetic fields is shown to bring a few factors suppressing MHD fluctuations and, eventually, density and temperature transports, even in the presence of steep mean density and temperature gradients. This finding is discussed in the context of the turbulence-suppression mechanism in the tokamak close-quote s high-confinement modes. copyright 1996 American Institute of Physics

  2. MAGNET

    CERN Multimedia

    Benoit Curé

    The magnet subsystems resumed operation early this spring. The vacuum pumping was restarted mid March, and the cryogenic power plant was restarted on March 30th. Three and a half weeks later, the magnet was at 4.5 K. The vacuum pumping system is performing well. One of the newly installed vacuum gauges had to be replaced at the end of the cool-down phase, as the values indicated were not coherent with the other pressure measurements. The correction had to be implemented quickly to be sure no helium leak could be at the origin of this anomaly. The pressure measurements have been stable and coherent since the change. The cryogenics worked well, and the cool-down went quite smoothly, without any particular difficulty. The automated start of the turbines had to be fine-tuned to get a smooth transition, as it was observed that the cooling power delivered by the turbines was slightly higher than needed, causing the cold box to stop automatically. This had no consequence as the cold box safety system acts to keep ...

  3. MAGNET

    CERN Multimedia

    B. Curé

    During the winter shutdown, the magnet subsystems went through a full maintenance. The magnet was successfully warmed up to room temperature beginning of December 2008. The vacuum was broken later on by injecting nitrogen at a pressure just above one atmosphere inside the vacuum tank. This was necessary both to prevent any accidental humidity ingress, and to allow for a modification of the vacuum gauges on the vacuum tank and maintenance of the diffusion pumps. The vacuum gauges had to be changed, because of erratic variations on the measurements, causing spurious alarms. The new type of vacuum gauges has been used in similar conditions on the other LHC experiments and without problems. They are shielded against the stray field. The lubricants of the primary and diffusion pumps have been changed. Several minor modifications were also carried out on the equipment in the service cavern, with the aim to ease the maintenance and to allow possible intervention during operation. Spare sensors have been bought. Th...

  4. Theory and Transport of Nearly Incompressible Magnetohydrodynamic Turbulence. IV. Solar Coronal Turbulence

    Science.gov (United States)

    Zank, G. P.; Adhikari, L.; Hunana, P.; Tiwari, S. K.; Moore, R.; Shiota, D.; Bruno, R.; Telloni, D.

    2018-02-01

    A new model describing the transport and evolution of turbulence in the quiet solar corona is presented. In the low plasma beta environment, transverse photospheric convective fluid motions drive predominantly quasi-2D (nonpropagating) turbulence in the mixed-polarity “magnetic carpet,” together with a minority slab (Alfvénic) component. We use a simplified sub-Alfvénic flow velocity profile to solve transport equations describing the evolution and dissipation of turbulence from 1\\hspace{0.5em}{{t}}{{o}} 15 {R}ȯ (including the Alfvén surface). Typical coronal base parameters are used, although one model uses correlation lengths derived observationally by Abramenko et al., and the other assumes values 10 times larger. The model predicts that (1) the majority quasi-2D turbulence evolves from a balanced state at the coronal base to an imbalanced state, with outward fluctuations dominating, at and beyond the Alfvén surface, i.e., inward turbulent fluctuations are dissipated preferentially; (2) the initially imbalanced slab component remains imbalanced throughout the solar corona, being dominated by outwardly propagating Alfvén waves, and wave reflection is weak; (3) quasi-2D turbulence becomes increasingly magnetized, and beyond ∼ 6 {R}ȯ , the kinetic energy is mainly in slab fluctuations; (4) there is no accumulation of inward energy at the Alfvén surface; (5) inertial range quasi-2D rather than slab fluctuations are preferentially dissipated within ∼ 3 {R}ȯ ; and (6) turbulent dissipation of quasi-2D fluctuations is sufficient to heat the corona to temperatures ∼ 2× {10}6 K within 2 {R}ȯ , consistent with observations that suggest that the fast solar wind is accelerated most efficiently between ∼ 2\\hspace{0.5em}{{a}}{{n}}{{d}} 4 {R}ȯ .

  5. Multi-Spacecraft Turbulence Analysis Methods

    Science.gov (United States)

    Horbury, Tim S.; Osman, Kareem T.

    Turbulence is ubiquitous in space plasmas, from the solar wind to supernova remnants, and on scales from the electron gyroradius to interstellar separations. Turbulence is responsible for transporting energy across space and between scales and plays a key role in plasma heating, particle acceleration and thermalisation downstream of shocks. Just as with other plasma processes such as shocks or reconnection, turbulence results in complex, structured and time-varying behaviour which is hard to measure with a single spacecraft. However, turbulence is a particularly hard phenomenon to study because it is usually broadband in nature: it covers many scales simultaneously. One must therefore use techniques to extract information on multiple scales in order to quantify plasma turbulence and its effects. The Cluster orbit takes the spacecraft through turbulent regions with a range of characteristics: the solar wind, magnetosheath, cusp and magnetosphere. In each, the nature of the turbulence (strongly driven or fully evolved; dominated by kinetic effects or largely on fluid scales), as well as characteristics of the medium (thermalised or not; high or low plasma sub- or super-Alfvenic) mean that particular techniques are better suited to the analysis of Cluster data in different locations. In this chapter, we consider a range of methods and how they are best applied to these different regions. Perhaps the most studied turbulent space plasma environment is the solar wind, see Bruno and Carbone [2005]; Goldstein et al. [2005] for recent reviews. This is the case for a number of reasons: it is scientifically important for cosmic ray and solar energetic particle scattering and propagation, for example. However, perhaps the most significant motivations for studying solar wind turbulence are pragmatic: large volumes of high quality measurements are available; the stability of the solar wind on the scales of hours makes it possible to identify statistically stationary intervals to

  6. Particle acceleration, transport and turbulence in cosmic and heliospheric physics

    Science.gov (United States)

    Matthaeus, W.

    1992-01-01

    In this progress report, the long term goals, recent scientific progress, and organizational activities are described. The scientific focus of this annual report is in three areas: first, the physics of particle acceleration and transport, including heliospheric modulation and transport, shock acceleration and galactic propagation and reacceleration of cosmic rays; second, the development of theories of the interaction of turbulence and large scale plasma and magnetic field structures, as in winds and shocks; third, the elucidation of the nature of magnetohydrodynamic turbulence processes and the role such turbulence processes might play in heliospheric, galactic, cosmic ray physics, and other space physics applications.

  7. Plasma turbulence measured by fast sweep reflectometry on Tore Supra

    International Nuclear Information System (INIS)

    Clairet, F.; Vermare, L.; Leclert, G.

    2004-01-01

    Traditionally devoted to electron density profile measurement we show that fast frequency sweeping reflectometry technique can bring valuable and innovative measurements onto plasma turbulence. While fast frequency sweeping technique is traditionally devoted to electron density radial profile measurements we show in this paper how we can handle the fluctuations of the reflected signal to recover plasma density fluctuation measurements with a high spatial and temporal resolution. Large size turbulence related to magneto-hydrodynamic (MHD) activity and the associated magnetic islands can be detected. The radial profile of the micro-turbulence, which is responsible for plasma anomalous transport processes, is experimentally determined through the fluctuation of the reflected phase signal. (authors)

  8. Plasma turbulence measured by fast sweep reflectometry on Tore Supra

    International Nuclear Information System (INIS)

    Clairet, F.; Vermare, L.; Heuraux, S.; Leclert, G.

    2004-01-01

    Traditionally devoted to electron density profile measurement we show that fast frequency sweeping reflectometry technique can bring valuable and innovative measurements onto plasma turbulence. While fast frequency sweeping technique is traditionally devoted to electron density radial profile measurements we show in this paper how we can handle the fluctuations of the reflected signal to recover plasma density fluctuation measurements with a high spatial and temporal resolution. Large size turbulence related to magneto-hydrodynamic (MHD) activity and the associated magnetic islands can be detected. The radial profile of the micro-turbulence, which is responsible for plasma anomalous transport processes, is experimentally determined through the fluctuation of the reflected phase signal

  9. Turbulent baker's maps

    International Nuclear Information System (INIS)

    Childress, S.

    1995-01-01

    The authors formulate and study an elementary one-dimensional model mimicking some of the features of fluid turbulence. The underlying vorticity field corresponds to a parallel flow. Structure on all scales down to the numerical resolution is generated by the action of baker's maps acting on the vorticity of the flow. These transformations conserve kinetic energy locally in the Euler model, while viscous diffusion of vorticity occurs in the Navier-Stokes case. The authors apply the model to the study of homogeneous fully, developed turbulence, and to turbulent channel flow

  10. Non-gaussian turbulence

    Energy Technology Data Exchange (ETDEWEB)

    Hoejstrup, J. [NEG Micon Project Development A/S, Randers (Denmark); Hansen, K.S. [Denmarks Technical Univ., Dept. of Energy Engineering, Lyngby (Denmark); Pedersen, B.J. [VESTAS Wind Systems A/S, Lem (Denmark); Nielsen, M. [Risoe National Lab., Wind Energy and Atmospheric Physics, Roskilde (Denmark)

    1999-03-01

    The pdf`s of atmospheric turbulence have somewhat wider tails than a Gaussian, especially regarding accelerations, whereas velocities are close to Gaussian. This behaviour is being investigated using data from a large WEB-database in order to quantify the amount of non-Gaussianity. Models for non-Gaussian turbulence have been developed, by which artificial turbulence can be generated with specified distributions, spectra and cross-correlations. The artificial time series will then be used in load models and the resulting loads in the Gaussian and the non-Gaussian cases will be compared. (au)

  11. Turbulence new approaches

    CERN Document Server

    Belotserkovskii, OM; Chechetkin, VM

    2005-01-01

    The authors present the results of numerical experiments carried out to examine the problem of development of turbulence and convection. On the basis of the results, they propose a physical model of the development of turbulence. Numerical algorithms and difference schema for carrying out numerical experiments in hydrodynamics, are proposed. Original algorithms, suitable for calculation of the development of the processes of turbulence and convection in different conditions, even on astrophysical objects, are presented. The results of numerical modelling of several important phenomena having both fundamental and applied importance are described.

  12. Turbulent current drive mechanisms

    Science.gov (United States)

    McDevitt, Christopher J.; Tang, Xian-Zhu; Guo, Zehua

    2017-08-01

    Mechanisms through which plasma microturbulence can drive a mean electron plasma current are derived. The efficiency through which these turbulent contributions can drive deviations from neoclassical predictions of the electron current profile is computed by employing a linearized Coulomb collision operator. It is found that a non-diffusive contribution to the electron momentum flux as well as an anomalous electron-ion momentum exchange term provide the most efficient means through which turbulence can modify the mean electron current for the cases considered. Such turbulent contributions appear as an effective EMF within Ohm's law and hence provide an ideal means for driving deviations from neoclassical predictions.

  13. Modeling of turbulent chemical reaction

    Science.gov (United States)

    Chen, J.-Y.

    1995-01-01

    Viewgraphs are presented on modeling turbulent reacting flows, regimes of turbulent combustion, regimes of premixed and regimes of non-premixed turbulent combustion, chemical closure models, flamelet model, conditional moment closure (CMC), NO(x) emissions from turbulent H2 jet flames, probability density function (PDF), departures from chemical equilibrium, mixing models for PDF methods, comparison of predicted and measured H2O mass fractions in turbulent nonpremixed jet flames, experimental evidence of preferential diffusion in turbulent jet flames, and computation of turbulent reacting flows.

  14. Aviation turbulence processes, detection, prediction

    CERN Document Server

    Lane, Todd

    2016-01-01

    Anyone who has experienced turbulence in flight knows that it is usually not pleasant, and may wonder why this is so difficult to avoid. The book includes papers by various aviation turbulence researchers and provides background into the nature and causes of atmospheric turbulence that affect aircraft motion, and contains surveys of the latest techniques for remote and in situ sensing and forecasting of the turbulence phenomenon. It provides updates on the state-of-the-art research since earlier studies in the 1960s on clear-air turbulence, explains recent new understanding into turbulence generation by thunderstorms, and summarizes future challenges in turbulence prediction and avoidance.

  15. Turbulence in a cusp Q device

    DEFF Research Database (Denmark)

    D'Angelo, N.; Pécseli, Hans; Petersen, P. I.

    1974-01-01

    Spectral measurements are reported of plasma turbulence in the Cs plasma of a Q device, modified to a magnetic cusp geometry. The excitation mechanism for the fluctuations appears to be the centrifugal instability discussed by Chen. A transition from an f−5 to an f−3 power spectrum is observed...... as one moves from the hot plates to the midplane of the cusp. ©1974 American Institute of Physics...

  16. Electromagnetic Transport From Microtearing Mode Turbulence

    Energy Technology Data Exchange (ETDEWEB)

    Guttenfelder, W; Kaye, S M; Nevins, W M; Wang, E; Bell, R E; Hammett, G W; LeBlanc, B P; Mikkelsen, D R

    2011-03-23

    This Letter presents non-linear gyrokinetic simulations of microtearing mode turbulence. The simulations include collisional and electromagnetic effects and use experimental parameters from a high beta discharge in the National Spherical Torus Experiment (NSTX). The predicted electron thermal transport is comparable to that given by experimental analysis, and it is dominated by the electromagnetic contribution of electrons free streaming along the resulting stochastic magnetic field line trajectories. Experimental values of flow shear can significantly reduce the predicted transport.

  17. Investigations on the two-dimensional aperiodic plasma photonic crystals with fractal Fibonacci sequence

    Directory of Open Access Journals (Sweden)

    Hai-Feng Zhang

    2017-07-01

    Full Text Available In this paper, the properties of photonic band gaps (PBGs and defect modes of two-dimensional (2D fractal plasma photonic crystals (PPCs under a transverse-magnetic (TM wave are theoretically investigated by a modified plane wave expansion (PWE method. The configuration of 2D PPCs is the square lattices with the iteration rule of the Fibonacci sequence whose constituents are homogeneous and isotropic. The proposed 2D PPCs is filled with the dielectric cylinders in the plasma background. The accuracy and convergence of the present modified PWE method also are validated by a numerical example. The calculated results illustrate that the enough accuracy and good convergence can be achieved compared to the conventional PWE method, if the number of meshed grids is large enough. The dispersion curves of the proposed PPCs and 2D PPCs with a conventional square lattice are theoretically computed to study the properties of PBGs and defect modes. The simulated results demonstrate that the advantaged properties can be obtained in the proposed PPCs compared to the 2D conventional PPCs with similar lattices. If the Fibonacci sequence is introduced into the 2D PPCs, the larger PBGs and higher cutoff frequency can be achieved. The lower edges of PBGs are flat, which are originated from the Mie resonances. The defect modes can be considered as the quasi-localized states since the Fibonacci sequence has the self-similarity and non-periodicity at the same time. The effects of configurational parameters on the characters of the present PPCs are investigated. The results show that the PBGs and defect modes can be easily manipulated by tuning those parameters.

  18. Three-fluid, three-dimensional magnetohydrodynamic solar wind model with eddy viscosity and turbulent resistivity

    Energy Technology Data Exchange (ETDEWEB)

    Usmanov, Arcadi V.; Matthaeus, William H. [Department of Physics and Astronomy, University of Delaware, Newark, DE 19716 (United States); Goldstein, Melvyn L., E-mail: arcadi.usmanov@nasa.gov [Code 672, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)

    2014-06-10

    We have developed a three-fluid, three-dimensional magnetohydrodynamic solar wind model that incorporates turbulence transport, eddy viscosity, turbulent resistivity, and turbulent heating. The solar wind plasma is described as a system of co-moving solar wind protons, electrons, and interstellar pickup protons, with separate energy equations for each species. Numerical steady-state solutions of Reynolds-averaged solar wind equations coupled with turbulence transport equations for turbulence energy, cross helicity, and correlation length are obtained by the time relaxation method in the corotating with the Sun frame of reference in the region from 0.3 to 100 AU (but still inside the termination shock). The model equations include the effects of electron heat conduction, Coulomb collisions, photoionization of interstellar hydrogen atoms and their charge exchange with the solar wind protons, turbulence energy generation by pickup protons, and turbulent heating of solar wind protons and electrons. The turbulence transport model is based on the Reynolds decomposition and turbulence phenomenologies that describe the conversion of fluctuation energy into heat due to a turbulent cascade. In addition to using separate energy equations for the solar wind protons and electrons, a significant improvement over our previous work is that the turbulence model now uses an eddy viscosity approximation for the Reynolds stress tensor and the mean turbulent electric field. The approximation allows the turbulence model to account for driving of turbulence by large-scale velocity gradients. Using either a dipole approximation for the solar magnetic field or synoptic solar magnetograms from the Wilcox Solar Observatory for assigning boundary conditions at the coronal base, we apply the model to study the global structure of the solar wind and its three-dimensional properties, including embedded turbulence, heating, and acceleration throughout the heliosphere. The model results are

  19. Inflow Turbulence Generation Methods

    Science.gov (United States)

    Wu, Xiaohua

    2017-01-01

    Research activities on inflow turbulence generation methods have been vigorous over the past quarter century, accompanying advances in eddy-resolving computations of spatially developing turbulent flows with direct numerical simulation, large-eddy simulation (LES), and hybrid Reynolds-averaged Navier-Stokes-LES. The weak recycling method, rooted in scaling arguments on the canonical incompressible boundary layer, has been applied to supersonic boundary layer, rough surface boundary layer, and microscale urban canopy LES coupled with mesoscale numerical weather forecasting. Synthetic methods, originating from analytical approximation to homogeneous isotropic turbulence, have branched out into several robust methods, including the synthetic random Fourier method, synthetic digital filtering method, synthetic coherent eddy method, and synthetic volume forcing method. This article reviews major progress in inflow turbulence generation methods with an emphasis on fundamental ideas, key milestones, representative applications, and critical issues. Directions for future research in the field are also highlighted.

  20. Parallel plasma fluid turbulence calculations

    International Nuclear Information System (INIS)

    Leboeuf, J.N.; Carreras, B.A.; Charlton, L.A.; Drake, J.B.; Lynch, V.E.; Newman, D.E.; Sidikman, K.L.; Spong, D.A.

    1994-01-01

    The study of plasma turbulence and transport is a complex problem of critical importance for fusion-relevant plasmas. To this day, the fluid treatment of plasma dynamics is the best approach to realistic physics at the high resolution required for certain experimentally relevant calculations. Core and edge turbulence in a magnetic fusion device have been modeled using state-of-the-art, nonlinear, three-dimensional, initial-value fluid and gyrofluid codes. Parallel implementation of these models on diverse platforms--vector parallel (National Energy Research Supercomputer Center's CRAY Y-MP C90), massively parallel (Intel Paragon XP/S 35), and serial parallel (clusters of high-performance workstations using the Parallel Virtual Machine protocol)--offers a variety of paths to high resolution and significant improvements in real-time efficiency, each with its own advantages. The largest and most efficient calculations have been performed at the 200 Mword memory limit on the C90 in dedicated mode, where an overlap of 12 to 13 out of a maximum of 16 processors has been achieved with a gyrofluid model of core fluctuations. The richness of the physics captured by these calculations is commensurate with the increased resolution and efficiency and is limited only by the ingenuity brought to the analysis of the massive amounts of data generated

  1. MAGNET

    CERN Multimedia

    B. Curé

    The first phase of the commissioning ended in August by a triggered fast dump at 3T. All parameters were nominal, and the temperature recovery down to 4.5K was carried out in two days by the cryogenics. In September, series of ramps were achieved up to 3 and finally 3.8T, while checking thoroughly the detectors in the forward region, measuring any movement of and around the HF. After the incident of the LHC accelerator on September 19th, corrective actions could be undertaken in the forward region. When all these displacements were fully characterized and repetitive, with no sign of increments in displacement at each field ramp, it was possible to start the CRAFT, Cosmic Run at Four Tesla (which was in fact at 3.8T). The magnet was ramped up to 18.16kA and the 3 week run went smoothly, with only 4 interruptions: due to the VIP visits on 21st October during the LHC inauguration day; a water leak on the cooling demineralized water circuit, about 1 l/min, that triggered a stop of the cooling pumps, and resulte...

  2. MAGNET

    CERN Multimedia

    Benoit Curé

    The cooling down to the nominal temperature of 4.5 K was achieved at the beginning of August, in conjunction with the completion of the installation work of the connection between the power lines and the coil current leads. The temperature gradient on the first exchanger of the cold box is now kept within the nominal range. A leak of lubricant on a gasket of the helium compressor station installed at the surface was observed and several corrective actions were necessary to bring the situation back to normal. The compressor had to be refilled with lubricant and a regeneration of the filters and adsorbers was necessary. The coil cool down was resumed successfully, and the cryogenics is running since then with all parameters being nominal. Preliminary tests of the 20kA coil power supply were done earlier at full current through the discharge lines into the dump resistors, and with the powering busbars from USC5 to UXC5 without the magnet connected. On Monday evening August 25th, at 8pm, the final commissionin...

  3. MAGNET

    CERN Multimedia

    Benoit Curé

    2013-01-01

    Maintenance work and consolidation activities on the magnet cryogenics and its power distribution are progressing according to the schedules. The manufacturing of the two new helium compressor frame units has started. The frame units support the valves, all the sensors and the compressors with their motors. This activity is subcontracted. The final installation and the commissioning at CERN are scheduled for March–April 2014. The overhauls of existing cryogenics equipment (compressors, motors) are in progress. The reassembly of the components shall start in early 2014. The helium drier, to be installed on the high-pressure helium piping, has been ordered and will be delivered in the first trimester of 2014. The power distribution for the helium compressors in SH5 on the 3.3kV network is progressing. The 3.3kV switches, between each compressor and its hot spare compressor, are being installed, together with the power cables for the new compressors. The 3.3kV electrical switchboards in SE5 will ...

  4. A Vorticity-Magnetic Field Dynamo Instability

    OpenAIRE

    Blackman, Eric G.; Chou, Tom

    1997-01-01

    We generalize the mean field magnetic dynamo to include local evolution of the mean vorticity in addition to the mean magnetic field. The coupled equations exhibit a general mean field dynamo instability that enables the transfer of turbulent energy to the magnetic field and vorticity on larger scales. The growth of the vorticity and magnetic field both require helical turbulence which can be supplied by an underlying global rotation. The dynamo coefficients are derived including the backreac...

  5. MHD turbulent dynamo in astrophysics: Theory and numerical simulation

    Science.gov (United States)

    Chou, Hongsong

    2001-10-01

    This thesis treats the physics of dynamo effects through theoretical modeling of magnetohydrodynamic (MHD) systems and direct numerical simulations of MHD turbulence. After a brief introduction to astrophysical dynamo research in Chapter 1, the following issues in developing dynamic models of dynamo theory are addressed: In Chapter 2, nonlinearity that arises from the back reaction of magnetic field on velocity field is considered in a new model for the dynamo α-effect. The dependence of α-coefficient on magnetic Reynolds number, kinetic Reynolds number, magnetic Prandtl number and statistical properties of MHD turbulence is studied. In Chapter 3, the time-dependence of magnetic helicity dynamics and its influence on dynamo effects are studied with a theoretical model and 3D direct numerical simulations. The applicability of and the connection between different dynamo models are also discussed. In Chapter 4, processes of magnetic field amplification by turbulence are numerically simulated with a 3D Fourier spectral method. The initial seed magnetic field can be a large-scale field, a small-scale magnetic impulse, and a combination of these two. Other issues, such as dynamo processes due to helical Alfvénic waves and the implication and validity of the Zeldovich relation, are also addressed in Appendix B and Chapters 4 & 5, respectively. Main conclusions and future work are presented in Chapter 5. Applications of these studies are intended for astrophysical magnetic field generation through turbulent dynamo processes, especially when nonlinearity plays central role. In studying the physics of MHD turbulent dynamo processes, the following tools are developed: (1)A double Fourier transform in both space and time for the linearized MHD equations (Chapter 2 and Appendices A & B). (2)A Fourier spectral numerical method for direct simulation of 3D incompressible MHD equations (Appendix C).

  6. Turbulence in Natural Environments

    Science.gov (United States)

    Banerjee, Tirtha

    Problems in the area of land/biosphere-atmosphere interaction, hydrology, climate modeling etc. can be systematically organized as a study of turbulent flow in presence of boundary conditions in an increasing order of complexity. The present work is an attempt to study a few subsets of this general problem of turbulence in natural environments- in the context of neutral and thermally stratified atmospheric surface layer, the presence of a heterogeneous vegetation canopy and the interaction between air flow and a static water body in presence of flexible protruding vegetation. The main issue addressed in the context of turbulence in the atmospheric surface layer is whether it is possible to describe the macro-states of turbulence such as mean velocity and turbulent velocity variance in terms of the micro-states of the turbulent flow, i.e., a distribution of turbulent kinetic energy across a multitude of scales. This has been achieved by a `spectral budget approach' which is extended for thermal stratification scenarios as well, in the process unifying the seemingly different and unrelated theories of turbulence such as Kolmogorov's hypothesis, Heisenberg's eddy viscosity, Monin Obukhov Similarity Theory (MOST) etc. under a common framework. In the case of a more complex scenario such as presence of a vegetation canopy with edges and gaps, the question that is addressed is in what detail the turbulence is needed to be resolved in order to capture the bulk flow features such as recirculation patterns. This issue is addressed by a simple numerical framework and it has been found out that an explicit prescription of turbulence is not necessary in presence of heterogeneities such as edges and gaps where the interplay between advection, pressure gradients and drag forces are sufficient to capture the first order dynamics. This result can be very important for eddy-covariance flux calibration strategies in non-ideal environments and the developed numerical model can be

  7. Turbulence introduction to theory and applications of turbulent flows

    CERN Document Server

    Westerweel, Jerry; Nieuwstadt, Frans T M

    2016-01-01

    This book provides a general introduction to the topic of turbulent flows. Apart from classical topics in turbulence, attention is also paid to modern topics. After studying this work, the reader will have the basic knowledge to follow current topics on turbulence in scientific literature. The theory is illustrated with a number of examples of applications, such as closure models, numerical simulations and turbulent diffusion, and experimental findings. The work also contains a number of illustrative exercises.

  8. Quantum turbulence of bellows-driven .sup.4./sup.He superflow: decay

    Czech Academy of Sciences Publication Activity Database

    Babuin, Simone; Varga, E.; Vinen, W. F.; Skrbek, L.

    2015-01-01

    Roč. 92, č. 18 (2015), "184503-1"-"184503-13" ISSN 1098-0121 Institutional support: RVO:68378271 Keywords : vortex-line density * counterflow turbulence * quantum turbulence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

  9. Doppler spectral line shapes in low frequency turbulent plasmas

    International Nuclear Information System (INIS)

    Marandet, Y.; Godbert-Mouret, L.; Koubiti, M.; Stamm, R.; Capes, H.; Guirlet, R.

    2003-01-01

    In this paper we investigate the influence of low frequency, i.e. drift wave like turbulence on the spectral line shapes in magnetized plasmas. The measured spectrum, which is obtained through both spatial and time averaging processes, is shown to contain information on turbulence. Using a statistical description of the turbulent fluctuations, we investigate the effects of density, fluid velocity and temperature fluctuations on the Doppler profile of a spectral line. The model we built, relies on 2 separations of scales, first between the atomic processes and the turbulence, allowing the use of a simple LTE model for the VDF (velocity distribution function) of the emitters. Then between turbulent scales and the measurement scales, allowing a statistical treatment of the turbulent fluctuations. The relevant quantity pertaining to turbulence for line shape calculations is found to be the joint PDF (probability distribution function) of the fluctuating plasma parameters. Using our model, we were able to investigate the limiting cases where only one variable fluctuates. At this level of approximation, the Doppler line does not contain information on the density fluctuations. A non-Gaussian PDF leads to a profile which is also non-Gaussian. Thus information on this PDF might be obtained from the measured line shape

  10. Turbulent regimes in the tokamak scrape-off layer

    International Nuclear Information System (INIS)

    Mosetto, A.

    2014-01-01

    The tokamak scrape-off layer (SOL) is the plasma region characterized by open field lines that start and end on the vessel walls. The plasma dynamics in the SOL plays a crucial role in determining the overall performance of a tokamak, since it controls the plasma-wall interactions, being responsible of exhausting the tokamak power, it regulates the overall plasma confinement, and it governs the plasma refueling and the removal of fusion ashes. Scrape-off layer physics is intrinsically non-linear and characterized by phenomena that occur on a wide range of spatio-temporal scales. Free energy sources drive a number of unstable modes that develop into turbulence and lead to transport of particles and heat across the magnetic field lines. Depending on the driving instability, different SOL turbulent regimes can be identified. As the SOL turbulent regimes determine the plasma confinement properties and the SOL width (and, consequently, the power flux on the vessel wall, for example), it is of crucial importance to understand which turbulent regimes are active in the SOL, under which conditions they develop, and which are the main properties of the associated turbulent transport. In the present thesis we define the SOL turbulent regimes, and we provide a framework to identify them, given the operational SOL parameters. Our study is based on the drift-reduced Braginskii equations and it is focused on a limited tokamak SOL configuration. We first describe the main SOL linear instabilities, such as the inertial and resistive branches of the drift waves, the resistive, inertial and ideal branches of the ballooning modes, and the ion temperature gradient mode. Then, we find the SOL turbulent regimes depending on the instability driving turbulent transport, assuming that turbulence saturates when the radial gradient associated to the pressure fluctuations is comparable to the equilibrium one. Our methodology for the turbulent regime identification is supported by the analysis

  11. Implications of Navier-Stokes turbulence theory for plasma turbulence

    International Nuclear Information System (INIS)

    Montgomery, David

    1977-01-01

    A brief discussion of Navier-Stokes turbulence theory is given with particular reference to the two dimensional case. The MHD turbulence is introduced with possible applications of techniques developed in Navier-Stokes theory. Turbulence in Vlasov plasma is also discussed from the point of view of the ''direct interaction approximation'' (DIA). (A.K.)

  12. PARTICLE ACCELERATION AND HEATING BY TURBULENT RECONNECTION

    Energy Technology Data Exchange (ETDEWEB)

    Vlahos, Loukas; Pisokas, Theophilos; Isliker, Heinz; Tsiolis, Vassilis [Department of Physics, Aristotle University of Thessaloniki, GR-52124 Thessaloniki (Greece); Anastasiadis, Anastasios [Institute for Astronomy, Astrophysics, Space Applications and Remote Sensing, National Observatory of Athens, GR-15236 Penteli (Greece)

    2016-08-10

    Turbulent flows in the solar wind, large-scale current sheets, multiple current sheets, and shock waves lead to the formation of environments in which a dense network of current sheets is established and sustains “turbulent reconnection.” We constructed a 2D grid on which a number of randomly chosen grid points are acting as scatterers (i.e., magnetic clouds or current sheets). Our goal is to examine how test particles respond inside this large-scale collection of scatterers. We study the energy gain of individual particles, the evolution of their energy distribution, and their escape time distribution. We have developed a new method to estimate the transport coefficients from the dynamics of the interaction of the particles with the scatterers. Replacing the “magnetic clouds” with current sheets, we have proven that the energization processes can be more efficient depending on the strength of the effective electric fields inside the current sheets and their statistical properties. Using the estimated transport coefficients and solving the Fokker–Planck (FP) equation, we can recover the energy distribution of the particles only for the stochastic Fermi process. We have shown that the evolution of the particles inside a turbulent reconnecting volume is not a solution of the FP equation, since the interaction of the particles with the current sheets is “anomalous,” in contrast to the case of the second-order Fermi process.

  13. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  14. Turbulent black holes.

    Science.gov (United States)

    Yang, Huan; Zimmerman, Aaron; Lehner, Luis

    2015-02-27

    We demonstrate that rapidly spinning black holes can display a new type of nonlinear parametric instability-which is triggered above a certain perturbation amplitude threshold-akin to the onset of turbulence, with possibly observable consequences. This instability transfers from higher temporal and azimuthal spatial frequencies to lower frequencies-a phenomenon reminiscent of the inverse cascade displayed by (2+1)-dimensional fluids. Our finding provides evidence for the onset of transitory turbulence in astrophysical black holes and predicts observable signatures in black hole binaries with high spins. Furthermore, it gives a gravitational description of this behavior which, through the fluid-gravity duality, can potentially shed new light on the remarkable phenomena of turbulence in fluids.

  15. Turbulence in complex terrain

    Energy Technology Data Exchange (ETDEWEB)

    Mann, Jakob [Risoe National Lab., Wind Energy and Atmosheric Physics Dept., Roskilde (Denmark)

    1999-03-01

    The purpose of this work is to develop a model of the spectral velocity-tensor in neutral flow over complex terrain. The resulting equations are implemented in a computer code using the mean flow generated by a linear mean flow model as input. It estimates turbulence structure over hills (except on the lee side if recirculation is present) in the so-called outer layer and also models the changes in turbulence statistics in the vicinity roughness changes. The generated turbulence fields are suitable as input for dynamic load calculations on wind turbines and other tall structures and is under implementation in the collection of programs called WA{sup s}P Engineering. (au) EFP-97; EU-JOULE-3. 15 refs.

  16. 3D fluid simulations of tokamak edge turbulence

    International Nuclear Information System (INIS)

    Zeiler, A.; Biskamp, D.; Drake, J.F.; Guzdar, P.N.

    1995-09-01

    3D simulations of drift resistive ballooning turbulence are presented. The turbulence is basically controlled by a parameter α, the ratio of the drift wave frequency to the ideal ballooning growth rate. If this parameters is small (α≤1, corresponding to Ohmic or L-mode plasmas), the system is dominated by ballooning turbulence, which is strongly peaked at the outside of the torus. If it is large (α≥1, corresponding to H-mode plasmas) field line curvature plays a minor role. The turbulence is nonlinearly sustained even if curvature is removed and all modes are linearly stable due to magnetic shear. In the nonlinear regime without curvature the system obeys a different scaling law compared to the low α regime. The transport scaling is discussed in both regimes and the implications for OH-, L-mode and H-mode transport are discussed. (orig.)

  17. Direct numerical simulations of two-fluid plasma turbulence

    Energy Technology Data Exchange (ETDEWEB)

    Thyagaraja, A. [UKAEA/Euratom Fusion Association, Abingdon (United Kingdom)

    1995-10-01

    Electromagnetic turbulence thought to be responsible for anomalous transport in magnetic confinement devices such as tokamaks is very complicated, involving a multitude of physical processes, length and time-scales. It cannot be investigated by traditional linear theories any more than aerodynamic fluid turbulence. The relatively longer wavelength (k {sub perpendicular} {sub to} {sub {rho}{sub i}} << 1), low frequency ({omega} {approx_equal} {omega}{sub *} << {omega}{sub ci}) drift-type modes are, however, susceptible to a direct numerical solution approach pioneered in the case of fluid turbulence by Orszag and Patera. A substantial two-fluid nonlinear code called CUTIE has been developed at Culham in recent years to study the nonlinear saturation and transport consequences of electromagnetic drift wave turbulence in simplified tokamak geometry. This development and some results obtained using such a model are briefly described in this contribution. (orig.).

  18. Correlation lengths of electrostatic turbulence

    International Nuclear Information System (INIS)

    Guiziou, L.; Garbet, X.

    1995-01-01

    This document deals with correlation length of electrostatic turbulence. First, the model of drift waves turbulence is presented. Then, the radial correlation length is determined analytically with toroidal coupling and non linear coupling. (TEC). 5 refs

  19. Statistical theory of Langmuir turbulence

    International Nuclear Information System (INIS)

    DuBois, D.F.; Rose, H.A.; Goldman, M.V.

    1979-01-01

    A statistical theory of Langmuir turbulence is developed by applying a generalization of the direction interaction approximation (DIA) of Kraichnan to the Zakharov equations describing Langmuir turbulence. 7 references

  20. Age-Related Vascular Changes Affect Turbulence in Aortic Blood Flow.

    Science.gov (United States)

    Ha, Hojin; Ziegler, Magnus; Welander, Martin; Bjarnegård, Niclas; Carlhäll, Carl-Johan; Lindenberger, Marcus; Länne, Toste; Ebbers, Tino; Dyverfeldt, Petter

    2018-01-01

    Turbulent blood flow is implicated in the pathogenesis of several aortic diseases but the extent and degree of turbulent blood flow in the normal aorta is unknown. We aimed to quantify the extent and degree of turbulece in the normal aorta and to assess whether age impacts the degree of turbulence. 22 young normal males (23.7 ± 3.0 y.o.) and 20 old normal males (70.9 ± 3.5 y.o.) were examined using four dimensional flow magnetic resonance imaging (4D Flow MRI) to quantify the turbulent kinetic energy (TKE), a measure of the intensity of turbulence, in the aorta. All healthy subjects developed turbulent flow in the aorta, with total TKE of 3-19 mJ. The overall degree of turbulence in the entire aorta was similar between the groups, although the old subjects had about 73% more total TKE in the ascending aorta compared to the young subjects (young = 3.7 ± 1.8 mJ, old = 6.4 ± 2.4 mJ, p flow velocity and suppressed the development of turbulence. In conclusion, turbulent blood flow develops in the aorta of normal subjects and is impacted by age-related geometric changes. Non-invasive assessment enables the determination of normal levels of turbulent flow in the aorta which is a prerequisite for understanding the role of turbulence in the pathophysiology of cardiovascular disease.

  1. Magnetostrophic balance as the optimal state for turbulent magnetoconvection.

    Science.gov (United States)

    King, Eric M; Aurnou, Jonathan M

    2015-01-27

    The magnetic fields of Earth and other planets are generated by turbulent convection in the vast oceans of liquid metal within them. Although direct observation is not possible, this liquid metal circulation is thought to be dominated by the controlling influences of planetary rotation and magnetic fields through the Coriolis and Lorentz forces. Theory famously predicts that planetary dynamo systems naturally settle into the so-called magnetostrophic state, where the Coriolis and Lorentz forces partially cancel, and convection is optimally efficient. Although this magnetostrophic theory correctly predicts the strength of Earth's magnetic field, no laboratory experiments have reached the magnetostrophic regime in turbulent liquid metal convection. Furthermore, computational dynamo simulations have as yet failed to produce a magnetostrophic dynamo, which has led some to question the existence of the magnetostrophic state. Here, we present results from the first, to our knowledge, turbulent, magnetostrophic convection experiments using the liquid metal gallium. We find that turbulent convection in the magnetostrophic regime is, in fact, maximally efficient. The experimental results clarify these previously disparate results, suggesting that the dynamically optimal magnetostrophic state is the natural expression of turbulent planetary dynamo systems.

  2. Issues in direct numerical simulation of plasma turbulence and transport

    Science.gov (United States)

    Thyagaraja, A.; Arter, W.; Haas, F. A.

    1991-04-01

    The problem of direct numerical simulation of plasma turbulence in magnetic confinement systems such as a tokamak is important in gaining a theoretical understanding of anomalous transport of particles, energy, momentum and impurities in such systems. Two approaches to this question are being developed. The design philosophy and the basic numerical problems encountered and solved in the construction of a two-fluid, 3-D, electro-magnetic, finite difference, time evolution code, CUTIE, are outlined. The importance of qualitative consistency, time-reversal, conservation properties, phase mixing, and boundary conditions are illustrated in the context of both passive and active electrostatic turbulence. A separate study was undertaken to aid in the understanding of drift wave turbulence in tokamak plasmas. In this connection a 3-D, time-dependant, electrostatic drift wave code called DRIFT was written. This has features which take account of toroidicity, non-adiabaticity and magnetic shear. The resulting code is very flexible, and was used to solve the Hasegawa-Mima equation efficiently in 2-D. Results from time-dependant, 3-D calculation run on a Cray-2 are presented. The aim is to obtain a proper physical understanding of plasma turbulence in typical tokamak conditions by calculating the power spectra of the turbulent fluctuations and their transport consequences. It is believed that this can only be achieved by a step-by-step approach to the numerics, making sure that the calculated effects represent genuine physics and are not mere artifacts of the numerical simulation.

  3. Magnetic Turbulence in Clusters of Galaxies

    Science.gov (United States)

    2009-01-01

    espectro de potencias de los campos magnéticos turbulentos se puede estudiar a través del análisis de la rotación de Faraday de las fuentes de radio... potencias de la fuerza de tensión magnética. Dicha cantidad estad́ıstica de cuarto orden ofrece una forma para discriminar diferentes escenarios de

  4. An overview of turbulence compensation

    NARCIS (Netherlands)

    Schutte, K.; Eekeren, A.W.M. van; Dijk, J.; Schwering, P.B.W.; Iersel, M. van; Doelman, N.J.

    2012-01-01

    In general, long range visual detection, recognition and identification are hampered by turbulence caused by atmospheric conditions. Much research has been devoted to the field of turbulence compensation. One of the main advantages of turbulence compensation is that it enables visual identification

  5. Magnetohydrodynamics turbulence: An astronomical perspective

    Indian Academy of Sciences (India)

    theories have since found applications in many areas of astrophysics. Spacecraft measurements of solar-wind turbulence show that there is more power in Alfvén waves that travel away from the. Sun than towards it. Theories of imbalanced MHD turbulence have now been proposed to address interplanetary turbulence.

  6. Turbulent resistive heating of solar coronal arches

    Science.gov (United States)

    Benford, G.

    1983-01-01

    The possibility that coronal heating occurs by means of anomalous Joule heating by electrostatic ion cyclotron waves is examined, with consideration given to currents running from foot of a loop to the other. It is assumed that self-fields generated by the currents are absent and currents follow the direction of the magnetic field, allowing the plasma cylinder to expand radially. Ion and electron heating rates are defined within the cylinder, together with longitudinal conduction and convection, radiation and cross-field transport, all in terms of Coulomb and turbulent effects. The dominant force is identified as electrostatic ion cyclotron instability, while ion acoustic modes remain stable. Rapid heating from an initial temperature of 10 eV to 100-1000 eV levels is calculated, with plasma reaching and maintaining a temperature in the 100 eV range. Strong heating is also possible according to the turbulent Ohm's law and by resistive heating.

  7. Basic issues of atmospheric turbulence and turbulent diffusion

    International Nuclear Information System (INIS)

    Fortak, H.

    1985-01-01

    A major concern of the institutions commissioned with the protection of the environment is the prognostication of the environment's exposure to various pollutant emissions. The transport and turbulent diffusion of air-borne substances largely take place within a planetary boundary layer of a thickness between 500 to 1,500 m in which the atmosphere continues to be in a turbulent state of flow. The basic theories for the origination and formation of turbulence in flow fields, for the application of these theories to turbulent flows over complex terrain structures and, finally, for the turbulent diffusion of air-borne substances within the planetary boundary layer are presented. (orig./PW) [de

  8. Numerical and theoretical investigations of resistive drift wave turbulence

    International Nuclear Information System (INIS)

    Sunn Pedersen, T.

    1995-07-01

    With regard to the development of thermonuclear fusion utilizing a plasma confined in a magnetic field, anomalous transport is a major problem and is considered to be caused by electrostatic drift wave turbulence. A simplified quasi-two-dimensional slab model of resistive drift wave turbulence is investigated numerically and theoretically. The model (Hasegawa and Wakatani), consists of two nonlinear partial differential equations for the density perturbation n and the electrostatic potential perturbation φ. It includes the effect of a background density gradient perpendicular to the magnetic field and a generalized Ohm's law for the electrons in the direction parallel to the magnetic field. It may be used to model the basic features of electrostatic turbulence and the associated transport in an edge plasma. Model equations are derived and some important properties of the system are discussed. It is described how the Fourier spectral method is applied to the Hasegawa-Wakatani equations, how the time integration is developed to ensure accurate and fast simulations in a large parameter regime, and how the accuracy of the code is checked. Numerical diagnostics are developed to verify and extend the results in publications concerning quasi-stationary turbulent states and to give an overview of the properties of the quasi-stationary turbulent state. The use of analysis tools, not previously applied to the Hasegawa-Wakatani system, and the results obtained are described. Fluid particles are tracked to obtain Lagrangian statistics for the turbulence. A new theoretical analysis of relative dispersion leads to a decomposition criterion for the particles. The significance of this is investigated numerically and characteristic time scales for particles are determined for a range of parameter values. It is indicated that the turbulent state can be characterized in the context of nonlinear dynamics and chaos theory as an attractor with a large basin of attraction. The basic

  9. TSALLIS STATISTICS AS A TOOL FOR STUDYING INTERSTELLAR TURBULENCE

    International Nuclear Information System (INIS)

    Esquivel, A.; Lazarian, A.

    2010-01-01

    We used magnetohydrodynamic (MHD) simulations of interstellar turbulence to study the probability distribution functions (PDFs) of increments of density, velocity, and magnetic field. We found that the PDFs are well described by a Tsallis distribution, following the same general trends found in solar wind and electron MHD studies. We found that the PDFs of density are very different in subsonic and supersonic turbulence. In order to extend this work to ISM observations, we studied maps of column density obtained from three-dimensional MHD simulations. From the column density maps, we found the parameters that fit to Tsallis distributions and demonstrated that these parameters vary with the sonic and Alfven Mach numbers of turbulence. This opens avenues for using Tsallis distributions to study the dynamical and perhaps magnetic states of interstellar gas.

  10. Turbulence and Flying Machines

    Indian Academy of Sciences (India)

    for Advanced Scientific. Research. She is currently working on problems of flow stability, transition to turbulence and vortex dynamics. Rama Govindarajan. This article is intended to introduce the young reader to the ... T applied by the engines and the drag force D due to the resistance of the air, i.e., under cruise condi~ions,.

  11. Incremental Similarity and Turbulence

    DEFF Research Database (Denmark)

    Barndorff-Nielsen, Ole E.; Hedevang, Emil; Schmiegel, Jürgen

    This paper discusses the mathematical representation of an empirically observed phenomenon, referred to as Incremental Similarity. We discuss this feature from the viewpoint of stochastic processes and present a variety of non-trivial examples, including those that are of relevance for turbulence...

  12. Stochastic modelling of turbulence

    DEFF Research Database (Denmark)

    Sørensen, Emil Hedevang Lohse

    previously been shown to be closely connected to the energy dissipation. The incorporation of the small scale dynamics into the spatial model opens the door to a fully fledged stochastic model of turbulence. Concerning the interaction of wind and wind turbine, a new method is proposed to extract wind turbine...

  13. Turbulence compressibility corrections

    Science.gov (United States)

    Coakley, T. J.; Horstman, C. C.; Marvin, J. G.; Viegas, J. R.; Bardina, J. E.; Huang, P. G.; Kussoy, M. I.

    1994-01-01

    The basic objective of this research was to identify, develop and recommend turbulence models which could be incorporated into CFD codes used in the design of the National AeroSpace Plane vehicles. To accomplish this goal, a combined effort consisting of experimental and theoretical phases was undertaken. The experimental phase consisted of a literature survey to collect and assess a database of well documented experimental flows, with emphasis on high speed or hypersonic flows, which could be used to validate turbulence models. Since it was anticipated that this database would be incomplete and would need supplementing, additional experiments in the NASA Ames 3.5-Foot Hypersonic Wind Tunnel (HWT) were also undertaken. The theoretical phase consisted of identifying promising turbulence models through applications to simple flows, and then investigating more promising models in applications to complex flows. The complex flows were selected from the database developed in the first phase of the study. For these flows it was anticipated that model performance would not be entirely satisfactory, so that model improvements or corrections would be required. The primary goals of the investigation were essentially achieved. A large database of flows was collected and assessed, a number of additional hypersonic experiments were conducted in the Ames HWT, and two turbulence models (kappa-epsilon and kappa-omega models with corrections) were determined which gave superior performance for most of the flows studied and are now recommended for NASP applications.

  14. Turbulence, bubbles and drops

    NARCIS (Netherlands)

    van der Veen, Roeland

    2016-01-01

    In this thesis, several questions related to drop impact and Taylor-Couette turbulence are answered. The deformation of a drop just before impact can cause a bubble to be entrapped. For many applications, such as inkjet printing, it is crucial to control the size of this entrapped bubble. To study

  15. Turbulent current layer equilibrium and current layer of the Earth magnetotail

    International Nuclear Information System (INIS)

    Antonova, E.E.; Ovchinnikov, I.L.

    1996-01-01

    Analysis of distribution of plasma and magnetic field concentration in the unidimensional current layer under the condition of equality of the current inflowing into the layer and the counter diffusion current by various dependences of the regular velocity and the turbulent diffusion coefficient on the magnetic field. Corresponding two-dimensional solutions are obtained in the tail approximation. Comparison of the model turbulent current layer with characteristics of the plasma layer of the Earth magnetosphere tail is carried out. 16 refs., 3 figs

  16. Analysis of turbulent boundary layers

    CERN Document Server

    Cebeci, Tuncer

    1974-01-01

    Analysis of Turbulent Boundary Layers focuses on turbulent flows meeting the requirements for the boundary-layer or thin-shear-layer approximations. Its approach is devising relatively fundamental, and often subtle, empirical engineering correlations, which are then introduced into various forms of describing equations for final solution. After introducing the topic on turbulence, the book examines the conservation equations for compressible turbulent flows, boundary-layer equations, and general behavior of turbulent boundary layers. The latter chapters describe the CS method for calculati

  17. Transition to turbulence in the Hartmann boundary layer

    Energy Technology Data Exchange (ETDEWEB)

    Thess, A.; Krasnov, D.; Boeck, T.; Zienicke, E. [Dept. of Mechanical Engineering, Ilmenau Univ. of Tech. (Germany); Zikanov, O. [Dept. of Mechanical Engineering, Univ. of Michigan, Dearborn, MI (United States); Moresco, P. [School of Physics and Astronomy, The Univ. of Manchester (United Kingdom); Alboussiere, T. [Lab. de Geophysique Interne et Tectonophysique, Observatoire des Science de l' Univers de Grenoble, Univ. Joseph Fourier, Grenoble (France)

    2007-07-01

    The Hartmann boundary layer is a paradigm of magnetohydrodynamic (MHD) flows. Hartmann boundary layers develop when a liquid metal flows under the influence of a steady magnetic field. The present paper is an overview of recent successful attempts to understand the mechanisms by which the Hartmann layer undergoes a transition from laminar to turbulent flow. (orig.)

  18. Decay of Solar Wind Turbulence behind Interplanetary Shocks

    International Nuclear Information System (INIS)

    Pitňa, Alexander; Šafránková, Jana; Němeček, Zdeněk; Franci, Luca

    2017-01-01

    We investigate the decay of magnetic and kinetic energies behind IP shocks with motivation to find a relaxation time when downstream turbulence reaches a usual solar wind value. We start with a case study that introduces computation techniques and quantifies a contribution of kinetic fluctuations to the general energy balance. This part of the study is based on high-time (31 ms) resolution plasma data provided by the Spektr-R spacecraft. On the other hand, a statistical part is based on 92 s Wind plasma and magnetic data and its results confirm theoretically established decay laws for kinetic and magnetic energies. We observe the power-law behavior of the energy decay profiles and we estimated the power-law exponents of both kinetic and magnetic energy decay rates as −1.2. We found that the decay of MHD turbulence does not start immediately after the IP shock ramp and we suggest that the proper decay of turbulence begins when a contribution of the kinetic processes becomes negligible. We support this suggestion with a detailed analysis of the decay of turbulence at the kinetic scale.

  19. Decay of Solar Wind Turbulence behind Interplanetary Shocks

    Energy Technology Data Exchange (ETDEWEB)

    Pitňa, Alexander; Šafránková, Jana; Němeček, Zdeněk [Charles University, Faculty of Mathematics and Physics, V Holesovickach 2, Prague, CZ-18000 (Czech Republic); Franci, Luca, E-mail: offelius@gmail.com [Dipartimento di Fisica e Astronomia, Universita degli Studi di Firenze, I-50125 Firenze (Italy)

    2017-07-20

    We investigate the decay of magnetic and kinetic energies behind IP shocks with motivation to find a relaxation time when downstream turbulence reaches a usual solar wind value. We start with a case study that introduces computation techniques and quantifies a contribution of kinetic fluctuations to the general energy balance. This part of the study is based on high-time (31 ms) resolution plasma data provided by the Spektr-R spacecraft. On the other hand, a statistical part is based on 92 s Wind plasma and magnetic data and its results confirm theoretically established decay laws for kinetic and magnetic energies. We observe the power-law behavior of the energy decay profiles and we estimated the power-law exponents of both kinetic and magnetic energy decay rates as −1.2. We found that the decay of MHD turbulence does not start immediately after the IP shock ramp and we suggest that the proper decay of turbulence begins when a contribution of the kinetic processes becomes negligible. We support this suggestion with a detailed analysis of the decay of turbulence at the kinetic scale.

  20. Equipartition and transport in two-dimensional electrostatic turbulence

    DEFF Research Database (Denmark)

    Naulin, V.; Nycander, J.; Juul Rasmussen, J.

    1998-01-01

    Turbulent equipartition is investigated for the nonlinear evolution of pressure driven flute modes of a plasma in an inhomogeneous magnetic field. The Rayleigh-Taylor instability is recovered by linear stability analysis, and occurs when the pressure profile is more peaked than the profile of the...

  1. Effective viscosity in quantum turbulence: a steady-state approach

    Czech Academy of Sciences Publication Activity Database

    Babuin, Simone; Varga, E.; Skrbek, L.; Lévêque, E.; Roche, P.-E.

    2014-01-01

    Roč. 106, č. 2 (2014), "24006-1"-"24006-6" ISSN 0295-5075 Institutional support: RVO:68378271 Keywords : quantum turbulence * effective viscosity * superfluid hydrodynamics Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.095, year: 2014

  2. Depression of Nonlinearity in Decaying Isotropic MHD Turbulence

    International Nuclear Information System (INIS)

    Servidio, S.; Matthaeus, W. H.; Dmitruk, P.

    2008-01-01

    Spectral method simulations show that undriven magnetohydrodynamic turbulence spontaneously generates coherent spatial correlations of several types, associated with local Beltrami fields, directional alignment of velocity and magnetic fields, and antialignment of magnetic and fluid acceleration components. These correlations suppress nonlinearity to levels lower than what is obtained from Gaussian fields, and occur in spatial patches. We suggest that this rapid relaxation leads to non-Gaussian statistics and spatial intermittency

  3. PREFACE Turbulent Mixing and Beyond

    Science.gov (United States)

    Abarzhi, Snezhana I.; Gauthier, Serge; Niemela, Joseph J.

    2010-12-01

    The goals of the International Conference 'Turbulent Mixing and Beyond', TMB-2009, are to expose the generic problem of non-equilibrium turbulent processes to a broad scientific community, to promote the development of new ideas in tackling the fundamental aspects of the problem, to assist in the application of novel approaches in a broad range of phenomena, where the turbulent processes occur, and to have a potential impact on technology. The Conference provides the opportunity to bring together researchers from different areas, which include but are not limited to fluid dynamics, plasmas, high energy density physics, astrophysics, material science, combustion, atmospheric and Earth sciences, nonlinear and statistical physics, applied mathematics, probability and statistics, data processing and computations, optics and telecommunications, and to have their attention focused on the long-standing formidable task of non-equilibrium processes. Non-equilibrium turbulent processes play a key role in a broad variety of phenomena spanning astrophysical to atomistic scales and high or low energy density regimes. Inertial confinement and magnetic fusion, light-matter interaction and non-equilibrium heat transfer, strong shocks and explosions, material transformation under high strain rate, supernovae and accretion disks, stellar non-Boussinesq and magneto-convection, planetary interiors and mantle-lithosphere tectonics, premixed and non-premixed combustion, non-canonical wall-bounded flows, hypersonic and supersonic boundary layers, dynamics of atmosphere and oceanography, are just a few examples. A grip on non-equilibrium turbulent processes is crucial for cutting-edge technology such as laser micro-machining, nano-electronics, free-space optical telecommunications, and for industrial applications in the areas of aeronautics and aerodynamics. Non-equilibrium turbulent processes are anisotropic, non-local, multi-scale and multi-phase, and often are driven by shocks or

  4. Transitional-turbulent spots and turbulent-turbulent spots in boundary layers.

    Science.gov (United States)

    Wu, Xiaohua; Moin, Parviz; Wallace, James M; Skarda, Jinhie; Lozano-Durán, Adrián; Hickey, Jean-Pierre

    2017-07-03

    Two observations drawn from a thoroughly validated direct numerical simulation of the canonical spatially developing, zero-pressure gradient, smooth, flat-plate boundary layer are presented here. The first is that, for bypass transition in the narrow sense defined herein, we found that the transitional-turbulent spot inception mechanism is analogous to the secondary instability of boundary-layer natural transition, namely a spanwise vortex filament becomes a [Formula: see text] vortex and then, a hairpin packet. Long streak meandering does occur but usually when a streak is infected by a nearby existing transitional-turbulent spot. Streak waviness and breakdown are, therefore, not the mechanisms for the inception of transitional-turbulent spots found here. Rather, they only facilitate the growth and spreading of existing transitional-turbulent spots. The second observation is the discovery, in the inner layer of the developed turbulent boundary layer, of what we call turbulent-turbulent spots. These turbulent-turbulent spots are dense concentrations of small-scale vortices with high swirling strength originating from hairpin packets. Although structurally quite similar to the transitional-turbulent spots, these turbulent-turbulent spots are generated locally in the fully turbulent environment, and they are persistent with a systematic variation of detection threshold level. They exert indentation, segmentation, and termination on the viscous sublayer streaks, and they coincide with local concentrations of high levels of Reynolds shear stress, enstrophy, and temperature fluctuations. The sublayer streaks seem to be passive and are often simply the rims of the indentation pockets arising from the turbulent-turbulent spots.

  5. Transitional-turbulent spots and turbulent-turbulent spots in boundary layers

    Science.gov (United States)

    Wu, Xiaohua; Moin, Parviz; Wallace, James M.; Skarda, Jinhie; Lozano-Durán, Adrián; Hickey, Jean-Pierre

    2017-07-01

    Two observations drawn from a thoroughly validated direct numerical simulation of the canonical spatially developing, zero-pressure gradient, smooth, flat-plate boundary layer are presented here. The first is that, for bypass transition in the narrow sense defined herein, we found that the transitional-turbulent spot inception mechanism is analogous to the secondary instability of boundary-layer natural transition, namely a spanwise vortex filament becomes a ΛΛ vortex and then, a hairpin packet. Long streak meandering does occur but usually when a streak is infected by a nearby existing transitional-turbulent spot. Streak waviness and breakdown are, therefore, not the mechanisms for the inception of transitional-turbulent spots found here. Rather, they only facilitate the growth and spreading of existing transitional-turbulent spots. The second observation is the discovery, in the inner layer of the developed turbulent boundary layer, of what we call turbulent-turbulent spots. These turbulent-turbulent spots are dense concentrations of small-scale vortices with high swirling strength originating from hairpin packets. Although structurally quite similar to the transitional-turbulent spots, these turbulent-turbulent spots are generated locally in the fully turbulent environment, and they are persistent with a systematic variation of detection threshold level. They exert indentation, segmentation, and termination on the viscous sublayer streaks, and they coincide with local concentrations of high levels of Reynolds shear stress, enstrophy, and temperature fluctuations. The sublayer streaks seem to be passive and are often simply the rims of the indentation pockets arising from the turbulent-turbulent spots.

  6. BOOK REVIEW: Plasma and Fluid Turbulence: Theory and Modelling

    Science.gov (United States)

    Yoshizawa, A.; Itoh, S. I.; Itoh, K.

    2003-03-01

    The area of turbulence has been covered by many books over the years. This has, of course, mainly been fluid turbulence, while the area of plasma turbulence has been treated much less. This book by Yoshizawa et al covers both plasma and fluid turbulence, in a way that does justice to both areas at the same time as cross-disciplinary aspects are illuminated. The book should be useful to physicists working in both areas partly because it examines fundamental aspects in a pedagogical way, partly because it is up to date and partly because of the cross-disciplinary aspects which enrich both areas. It is written as an advanced textbook. The reader should have previous knowledge of at least one of the areas and also some background in statistical physics. The book starts with the very important and highly up to date area of structure formation which is relevant both to fluids and plasmas. Here, pipe flow of fluids is treated as an introduction to the area, then follows discussion of the generation of magnetic fields by turbulent motion in stellar objects and stucture formation in plasmas confined by a magnetic field. Also the concept of bifurcation is introduced. This part builds up knowledge from the simple fluid case to the problems of magnetic confinement of plasmas in a very pedagogical way. It continues by introducing the fundamentals of fluid turbulence. This is done very systematically and concepts useful for industrial applications like the K-e method and several ways of heuristic modelling are introduced. Also the two dimensional vortex equation, which is also relevant to magnetized plasmas is introduced. In chapter 5 the statistical theory of turbulence is treated. It starts with a very nice and easy to understand example of renormalization of a simple nonlinear equation where the exact solution is known. It introduces the method of partial renormalization, Greens functions and the direct interaction approximation (DIA). The book then continues with an

  7. Satellite sensing of submerged fossil turbulence and zombie turbulence

    Science.gov (United States)

    Gibson, Carl H.

    2004-11-01

    Surface brightness anomalies from a submerged municipal wastewater outfall trapped by buoyancy in an area 0.1 km^2 are surprisingly detected from space satellites in areas > 200 km^2. How is this possible? Microstructure measurements near the outfall diffuser reveal enhanced turbulence and temperature dissipation rates above the 50 m trapping depth. Near-vertical radiation of internal waves by fossil and zombie turbulence microstructure patches produce wind ripple smoothing with 30-50 m internal wave patterns in surface Fourier brightness anomalies near the outfall. Detections at 10-14 km distances are at 100-220 m bottom boundary layer (BBL) fossil turbulence scales. Advected outfall fossils form zombie turbulence patches in internal wave patterns as they extract energy, vorticity, turbulence and ambient vertical internal wavelength information as their density gradients are tilted by the waves. As the zombies fossilize, patterned energy radiates near-vertically to produce the detected Fourier anomalies. Zombie turbulence patches beam extracted energy in a preferred direction with a special frequency, like energized metastable molecules in a chemical maser. Thus, kilowatts to produce the submerged field of advected fossil outfall turbulence patches are amplified by beamed zombie turbulence maser action (BZTMA) into megawatts of turbulence dissipation to affect sea surface brightness on wide surface areas using gigawatts of BBL fossil turbulence wave energy available.

  8. Low-Mach-number turbulence in interstellar gas revealed by radio polarization gradients.

    Science.gov (United States)

    Gaensler, B M; Haverkorn, M; Burkhart, B; Newton-McGee, K J; Ekers, R D; Lazarian, A; McClure-Griffiths, N M; Robishaw, T; Dickey, J M; Green, A J

    2011-10-05

    The interstellar medium of the Milky Way is multiphase, magnetized and turbulent. Turbulence in the interstellar medium produces a global cascade of random gas motions, spanning scales ranging from 100 parsecs to 1,000 kilometres (ref. 4). Fundamental parameters of interstellar turbulence such as the sonic Mach number (the speed of sound) have been difficult to determine, because observations have lacked the sensitivity and resolution to image the small-scale structure associated with turbulent motion. Observations of linear polarization and Faraday rotation in radio emission from the Milky Way have identified unusual polarized structures that often have no counterparts in the total radiation intensity or at other wavelengths, and whose physical significance has been unclear. Here we report that the gradient of the Stokes vector (Q, U), where Q and U are parameters describing the polarization state of radiation, provides an image of magnetized turbulence in diffuse, ionized gas, manifested as a complex filamentary web of discontinuities in gas density and magnetic field. Through comparison with simulations, we demonstrate that turbulence in the warm, ionized medium has a relatively low sonic Mach number, M(s) ≲ 2. The development of statistical tools for the analysis of polarization gradients will allow accurate determinations of the Mach number, Reynolds number and magnetic field strength in interstellar turbulence over a wide range of conditions.

  9. On the problem of turbulent arcs modelling

    International Nuclear Information System (INIS)

    Yas'ko, O.I.

    1998-01-01

    A new hypothesis is proposed which considers mass as a charge which produces a special field during its movement likewise the electric charge creates magnetic one. This approach throws new light on vortexes formation since interaction of moving mass with the considered field exerts swirling effect. Some aspects of turbulence in flows near walls and in blown electric arc discharge were considered to validate the hypothesis in the cases of cold and high-temperature flows. The theoretical results are found to comply with experiment well. (author)

  10. Area of turbulence

    CERN Multimedia

    Anaïs Schaeffer

    2015-01-01

    As a member of the EuHIT (European High-Performance Infrastructures in Turbulence - see here) consortium, CERN is participating in fundamental research on turbulence phenomena. To this end, the Laboratory provides European researchers with a cryogenic research infrastructure (see here), where the first tests have just been performed.   The last day of data collection, tired but satisfied after seven intense days of measurements. Around the cryostat, from left to right: Philippe-E. Roche, Éléonore Rusaouen (CNRS),
Olivier Pirotte, Jean-Marc Quetsch (CERN), Nicolas Friedlin (CERN),
Vladislav Benda (CERN). Not in the photo: Laurent Le Mao (CERN), Jean-Marc Debernard (CERN), 
Jean-Paul Lamboy (CERN), Nicolas Guillotin (CERN), Benoit Chabaud (Grenoble Uni), and Gregory Garde (CNRS). CERN has a unique cryogenic facility in hall SM18, consisting of 21 liquid-helium-cooled test stations. While this equipment was, of course, designed for testing parts of CERN's acce...

  11. Aerotaxis in Bacterial Turbulence

    Science.gov (United States)

    Fernandez, Vicente; Bisson, Antoine; Bitton, Cindy; Waisbord, Nicolas; Smriga, Steven; Rusconi, Roberto; Stocker, Roman

    2012-11-01

    Concentrated suspensions of motile bacteria exhibit correlated dynamics on spatial scales much larger than an individual bacterium. The resulting flows, visually similar to turbulence, can increase mixing and decrease viscosity. However, it remains unclear to what degree the collective dynamics depend on the motile behavior of bacteria at the individual level. Using a new microfluidic device to create controlled horizontal oxygen gradients, we studied the two dimensional behavior of dense suspensions of Bacillus subtilis. This system makes it possible to assess the interplay between the coherent large-scale motions of the suspension, oxygen transport, and the directional response of cells to oxygen gradients (aerotaxis). At the same time, this device has enabled us to examine the onset of bacterial turbulence and its influence on the propagation of the diffusing oxygen front, as the bacteria begin in a dormant state and transition to swimming when exposed to oxygen.

  12. Random functions and turbulence

    CERN Document Server

    Panchev, S

    1971-01-01

    International Series of Monographs in Natural Philosophy, Volume 32: Random Functions and Turbulence focuses on the use of random functions as mathematical methods. The manuscript first offers information on the elements of the theory of random functions. Topics include determination of statistical moments by characteristic functions; functional transformations of random variables; multidimensional random variables with spherical symmetry; and random variables and distribution functions. The book then discusses random processes and random fields, including stationarity and ergodicity of random

  13. Turbulence and other processes for the scale-free texture of the fast solar wind

    Science.gov (United States)

    Hnat, B.; Chapman, S. C.; Gogoberidze, G.; Wicks, R. T.

    2012-04-01

    The higher-order statistics of magnetic field magnitude fluctuations in the fast quiet solar wind are quantified systematically, scale by scale. We find a single global non-Gaussian scale-free behavior from minutes to over 5 hours. This spans the signature of an inertial range of magnetohydrodynamic turbulence and a ˜1/f range in magnetic field components. This global scaling in field magnitude fluctuations is an intrinsic component of the underlying texture of the solar wind which co-exists with the signature of MHD turbulence but extends to lower frequencies. Importantly, scaling and non- Gaussian statistics of fluctuations are not unique to turbulence and can imply other physical mechanisms- our results thus place a strong constraint on theories of the dynamics of the solar corona and solar wind. Intriguingly, the magnetic field and velocity components also show scale-dependent dynamic alignment outside of the inertial range of MHD turbulence.

  14. Nonlinear simulation of electromagnetic current diffusive interchange mode turbulence

    International Nuclear Information System (INIS)

    Yagi, M.; Itoh, S.I.; Fukuyama, A.

    1998-01-01

    The anomalous transport in toroidal plasmas has been investigated extensively. It is pointed out that the nonlinear instability is important in driving the microturbulence[1], i.e., the self-sustained plasma turbulence. This concept is explained as follows; when the electron motion along the magnetic field line is resisted by the background turbulence, it gives rise to the effective resistivity and enhances the level of the turbulence. The nonlinear simulation of the electrostatic current diffusive interchange mode (CDIM) in the two dimensional sheared slab geometry has been performed as an example. The occurrence of the nonlinear instability and the self-sustainment of the plasma turbulence were confirmed by this simulation[2]. On the other hand, the electromagnetic turbulence is sustained in the high pressure limit. The possibility of the self-organization with more variety has been pointed out[3]. It is important to study the electromagnetic turbulence based on the nonlinear simulation. In this paper, the model equation for the electrostatic CDIM turbulence[2] is extended for both electrostatic and electromagnetic turbulence. (1) Not only E x B convective nonlinearity but also the electromagnetic nonlinearity which is related to the parallel flow are incorporated into the model equation. (2) The electron and ion pressure evolution equations are solved separately, making it possible to distinguish the electron and ion thermal diffusivities. The two dimensional nonlinear simulation of the electromagnetic CDIM is performed based on the extended fluid model. This paper is organized as follows. The model equation is explained in section II. The result of simulation is shown in section III. The conclusion and discussion are given in section IV. (author)

  15. 4th European Turbulence Conference

    CERN Document Server

    1993-01-01

    The European Turbulence Conferences have been organized under the auspices of the European Mechanics Committee (Euromech) to provide a forum for discussion and exchange of recent and new results in the field of turbulence. The first conference was organized in Lyon in 1986 with 152 participants. The second and third conferences were held in Berlin (1988) and Stockholm (1990) with 165 and 172 participants respectively. The fourth was organized in Delft from 30 June to 3 July 1992 by the J.M. Burgers Centre. There were 214 participants from 22 countries. This steadily growing number of participants demonstrates both the success and need for this type of conference. The main topics of the Fourth European Turbulence Conference were: Dynamical Systems and Transition; Statistical Physics and Turbulence; Experiments and Novel Experimental Techniques; Particles and Bubbles in Turbulence; Simulation Methods; Coherent Structures; Turbulence Modelling and Compressibility Effects. In addition a special session was held o...

  16. Edge Turbulence Imaging on NSTX and Alcator C-Mod

    International Nuclear Information System (INIS)

    S.J. Zweben; R.A. Maqueda; J.L. Terry; B. Bai; C.J. Boswell; C.E. Bush; D. D'Ippolito; E.D. Fredrickson; M. Greenwald; K. Hallatschek; S. Kaye; B. LaBombard; R. Maingi; J. Myra; W.M. Nevins; B.N. Rogers; D.P. Stotler; J. Wilgen; and X.Q. Xu

    2002-01-01

    Edge turbulence images have been made using an ultra-high speed CCD camera on both NSTX and Alcator C-Mod. In both cases, the D-alpha or HeI (587.6 nm) line emission from localized deuterium or helium gas puffs was viewed along a local magnetic field line near the outer midplane. Fluctuations in this line emission reflect fluctuations in electron density and/or electron temperature through the atomic excitation rates, which can be modeled using the DEGAS-2 code. The 2-D structure of the measured turbulence can be compared with theoretical simulations based on 3-D fluid models

  17. Experimental investigations of structure and dynamics of drift-wave turbulence in stellarator geometry

    International Nuclear Information System (INIS)

    Birkenmeier, Gregor

    2012-01-01

    For more than 60 years, fusion scientists try to confine a plasma by means of external magnetic fields in order to achieve appropriately high densities and temperatures for the ignition of nuclear fusion. Despite of great progress in the design of confinement concepts, which are considered for the confinement of burning plasmas in the near future, theoretical plasma physics promises further confinement improvements using novel magnetic field geometries. Therefor, the key is the minimization of turbulent transport by choosing appropiate magnetic field geometries, which necessitates a fundamental understanding of the influence of magnetic field geometry on plasma turbulence. There are several theoretical works on turbulent plasma dynamics in three-dimensional geometries, but only a few experimental studies for validation of the theoretical results exist. Hence, the present work aims at providing experimental data for comparison with theory and to gain insights into the interplay between drift-wave turbulence and magnetic field geometry. By means of two multi-probe arrays, local density and potential fluctuations are measured in low-temperature plasmas at 128 positions on a single flux surface of the stellarator TJ-K with high temporal resolution. Using methods of statistical timeseries analysis structure sizes and dynamic properties of the drift-wave turbulence in TJ-K are determined. Thereby, it is shown that the size of turbulent structures perpendicular to the magnetic field is reduced in regions of high absolute local magnetic shear. In addition, a poloidal displacement with respect to the magnetic field lines and a complex propagation pattern of parallelly extended turbulent structures is found. Also, poloidal profiles of turbulent transport are calculated from the probe data. The maximum transport is found to be poloidally localized in a region of negative normal curvature (unfavourable curvature). In addition, the results point to an influence of geodesic

  18. Transport of and radiation production by transrelativistic and nonrelativistic particles moving through sub-Larmor-scale electromagnetic turbulence.

    Science.gov (United States)

    Keenan, Brett D; Ford, Alexander L; Medvedev, Mikhail V

    2015-09-01

    Plasmas with electromagnetic fields turbulent at sub-Larmor scales are a feature of a wide variety of high-energy-density environments and are essential to the description of many astrophysical and laboratory plasma phenomena. Radiation from particles, whether they are relativistic or nonrelativistic, moving through small-scale magnetic turbulence has spectral characteristics distinct from both synchrotron and cyclotron radiation. The radiation, carrying information on the statistical properties of the magnetic turbulence, is also intimately related to the particle diffusive transport. We have investigated, both theoretically and numerically, the transport of nonrelativistic and trans-relativistic particles in plasmas with high-amplitude isotropic sub-Larmor-scale magnetic turbulence, and its relation to the spectra of radiation simultaneously produced by these particles. Consequently, the diffusive and radiative properties of plasmas turbulent on sub-Larmor scales may serve as a powerful tool to diagnosis laboratory and astrophysical plasmas.

  19. Electrostatic Turbulence and Anomalous Effects in Reconnection Diffusion Region

    Science.gov (United States)

    Khotyaintsev, Y. V.; Graham, D. B.; Norgren, C.; Vaivads, A.; Li, W.; Divin, A. V.; Andre, M.; Markidis, S.; Lindqvist, P. A.; Peng, I. B.; Argall, M. R.; Ergun, R.; Le Contel, O.; Magnes, W.; Russell, C. T.; Giles, B. L.; Torbert, R. B.; Burch, J. L.

    2017-12-01

    Magnetic reconnection is a fundamental process whereby microscopicplasma processes cause macroscopic changes in magnetic field topology,so that initially separated plasmas become magnetically connected.Waves can produce particle diffusion, and anomalous resistivity, aswell as heat the plasma and accelerate plasma particles, all of whichcan impact ongoing reconnection. We report electrostatic turbulencedeveloping within the diffusion region of asymmetric magnetopausereconnection using observations by the Magnetospheric Multiscalemission and large-scale particle-in-cell simulations, and characterizeanomalous effects and plasma heating within the diffusion region. Ourobservations demonstrate that electrostatic turbulence plays animportant role in the electron-scale physics of asymmetricreconnection.

  20. Polar spacecraft observations of the turbulent outer cusp/magnetopause boundary layer of Earth

    Directory of Open Access Journals (Sweden)

    J. S. Pickett

    1999-01-01

    Full Text Available The orbit of the Polar spacecraft has been ideally suited for studying the turbulent region of the cusp that is located near or just outside the magnetopause current sheet at 7-9 RE. The wave data obtained in this region show that electromagnetic turbulence is dominant in the frequency range 1-10 Hz. The waves responsible for this turbulence usually propagate perpendicular to the local magnetic field and have an index of refraction that generally falls between the estimated cold plasma theoretical values of the electromagnetic lower hybrid and whistler modes and may be composed of both modes in concert with kinetic Alfvén waves and/or fast magnetosonic waves. Fourier spectra of the higher frequency wave data also show the electromagnetic turbulence at frequencies up to and near the electron cyclotron frequency. This higher frequency electromagnetic turbulence is most likely associated with whistler mode waves. The lower hybrid drift and current gradient instabilities are suggested as possible mechanisms for producing the turbulence. The plasma and field environment of this turbulent region is examined and found to be extremely complex. Some of the wave activity is associated with processes occurring locally, such as changes in the DC magnetic field, while others are associated with solar wind and interplanetary magnetic field changes.

  1. Polar Spacecraft Observations of the Turbulent Outer Cusp/Magnetopause Boundary Layer of Earth

    Science.gov (United States)

    Pickett, J. S.; Menietti, J. D.; Dowell, J. H.; Gurnett, D. A.; Scudder, J. D.

    1999-01-01

    The orbit of the Polar spacecraft has been ideally suited for studying the turbulent region of the cusp that is located near or just outside the magnetopause current sheet at 7-9 R(sub E). The wave data obtained in this region show that electromagnetic turbulence is dominant in the frequency range 1-10 Hz. The waves responsible for this turbulence usually propagate perpendicular to the local magnetic field and have an index of refraction that generally falls between the estimated cold plasma theoretical values of the electromagnetic lower hybrid and whistler modes and may be composed of both modes in concert with kinetic Alfven waves and/or fast magnetosonic waves. Fourier spectra of the higher frequency wave data also show the electromagnetic turbulence at frequencies up to and near the electron cyclotron frequency. This higher frequency electromagnetic turbulence is most likely associated with whistler mode waves. The lower hybrid drift and current gradient instabilities are suggested as possible mechanisms for producing the turbulence. The plasma and field environment of this turbulent region is examined and found to be extremely complex. Some of the wave activity is associated with processes occurring locally, such as changes in the DC magnetic field, while others are associated with solar wind and interplanetary magnetic field changes.

  2. Long-term Evolution of Decaying Magnetohydrodynamic Turbulence in the Multiphase Interstellar Medium

    Science.gov (United States)

    Kim, Chang-Goo; Basu, Shantanu

    2013-12-01

    Supersonic turbulence in the interstellar medium (ISM) is believed to decay rapidly within a flow crossing time irrespective of the degree of magnetization. However, this general consensus of decaying magnetohydrodynamic (MHD) turbulence relies on local isothermal simulations, which are unable to take into account the roles of the global structures of magnetic fields and the ISM. Utilizing three-dimensional MHD simulations including interstellar cooling and heating, we investigate decaying MHD turbulence within cold neutral medium sheets embedded in a warm neutral medium. The early evolution of turbulent kinetic energy is consistent with previous results for decaying compressible MHD turbulence characterized by rapid energy decay with a power-law form of Evpropt -1 and by a short decay time compared with the flow crossing time. If initial magnetic fields are strong and perpendicular to the sheet, however, long-term evolution of the kinetic energy shows that a significant amount of turbulent energy (~0.2E 0) still remains even after 10 flow crossing times for models with periodic boundary conditions. The decay rate is also greatly reduced as the field strength increases for such initial and boundary conditions, but not if the boundary conditions are those for a completely isolated sheet. We analyze velocity power spectra of the remaining turbulence to show that in-plane, incompressible motions parallel to the sheet dominate at later times.

  3. Aspects of atmospheric turbulence related to scintillometry

    NARCIS (Netherlands)

    Braam, M.

    2014-01-01

    Aspects of atmospheric turbulence related to scintillometry Atmospheric turbulence is the main vertical transport mechanism in the atmospheric boundary layer. The surface fluxes related to this turbulent transport are the sensible (

  4. Turbulence closure: turbulence, waves and the wave-turbulence transition – Part 1: Vanishing mean shear

    Directory of Open Access Journals (Sweden)

    H. Z. Baumert

    2009-03-01

    Full Text Available This paper extends a turbulence closure-like model for stably stratified flows into a new dynamic domain in which turbulence is generated by internal gravity waves rather than mean shear. The model turbulent kinetic energy (TKE, K balance, its first equation, incorporates a term for the energy transfer from internal waves to turbulence. This energy source is in addition to the traditional shear production. The second variable of the new two-equation model is the turbulent enstrophy (Ω. Compared to the traditional shear-only case, the Ω-equation is modified to account for the effect of the waves on the turbulence time and space scales. This modification is based on the assumption of a non-zero constant flux Richardson number in the limit of vanishing mean shear when turbulence is produced exclusively by internal waves. This paper is part 1 of a continuing theoretical development. It accounts for mean shear- and internal wave-driven mixing only in the two limits of mean shear and no waves and waves but no mean shear, respectively.

    The new model reproduces the wave-turbulence transition analyzed by D'Asaro and Lien (2000b. At small energy density E of the internal wave field, the turbulent dissipation rate (ε scales like ε~E2. This is what is observed in the deep sea. With increasing E, after the wave-turbulence transition has been passed, the scaling changes to ε~E1. This is observed, for example, in the highly energetic tidal flow near a sill in Knight Inlet. The new model further exhibits a turbulent length scale proportional to the Ozmidov scale, as observed in the ocean, and predicts the ratio between the turbulent Thorpe and Ozmidov length scales well within the range observed in the ocean.

  5. Magnetizing the universe

    Indian Academy of Sciences (India)

    Resistance dissipating currents (∼ 20,000 yr for earth). Lorentz force Driving motions, which are damped by. Viscosity or become turbulent and then decay. EM induction by Motions can maintain magnetic fields. ∂B. ∂t. = −∇ × E, E = −U × B +. J σ . Motion in a magnetic field induces electric fields. If this electric field has a ...

  6. Plasma Turbulence in Earth's Magnetotail Observed by the Magnetospheric Multiscale Mission

    Science.gov (United States)

    Mackler, D. A.; Avanov, L. A.; Boardsen, S. A.; Pollock, C. J.

    2017-12-01

    Magnetic reconnection, a process in which the magnetic topology undergoes multi-scale changes, is a significant mechanism for particle energization as well as energy dissipation. Reconnection is observed to occur in thin current sheets generated between two regions of magnetized plasma merging with a non-zero shear angle. Within a thinning current sheet, the dominant scale size approaches first the ion and then electron kinetic scale. The plasma becomes demagnetized, field lines transform, then once again the plasma becomes frozen-in. The reconnection process accelerates particles, leading to heated jets of plasma. Turbulence is another fundamental process in collision less plasmas. Despite decades of turbulence studies, an essential science question remains as to how turbulent energy dissipates at small scales by heating and accelerating particles. Turbulence in both plasmas and fluids has a fundamental property in that it follows an energy cascade into smaller scales. Energy introduced into a fluid or plasma can cause large scale motion, introducing vorticity, which merge and interact to make increasingly smaller eddies. It has been hypothesized that turbulent energy in magnetized plasmas may be dissipated by magnetic reconnection, just as viscosity dissipates energy in neutral fluid turbulence. The focus of this study is to use the new high temporal resolution suite of instruments on board the Magnetospheric MultiScale (MMS) mission to explore this hypothesis. An observable feature of the energy cascade in a turbulent magnetized plasma is its similarity to classical hydrodynamics in that the Power Spectral Density (PSD) of turbulent fluctuations follows a Kolmogorov-like power law (Image-5/3). We use highly accurate (0.1 nT) Flux Gate Magnetometer (FGM) data to derive the PSD as a function of frequency in the magnetic fluctuations. Given that we are able to confirm the turbulent nature of the flow field; we apply the method of Partial Variance of Increments (PVI

  7. Electrostatic and electromagnetic turbulence associated with the Earth's bow shock

    International Nuclear Information System (INIS)

    Rodriguez, P.

    1974-01-01

    The electric and magnetic field spectral densities of plasma waves in the earth's bow shock have been measured in the frequency range 20 Hz to 200 kHz using two 16-channel spectrum analyzers on the IMP-6 spacecraft. Electrostatic noise with a spectrum similar to the turbulence in the shock, but with lower intensities, is observed throughout the magnetosheath region, downstream of the shock. The intensity of the electrostatic component of turbulence in the bow shock increases as the upstream electron to ion temperature ratio increases, and decreases as the upstream sound velocity increases; both of these variations for the electrostatic component are consistent with ion sound wave turbulence. (U.S.)

  8. Drift wave instability and turbulence in advanced stellarator configurations

    International Nuclear Information System (INIS)

    Kendl, A.

    2001-08-01

    In the following chapter, an overview and references on the physics and geometry of helical advanced stellarators is given. On the basis of this configuration, the influence of magnetic field geometry is then discussed in a basic model of drift-Alfven wave turbulence which contains the necessary physics that applies to the plasma edge. By means of linear models, core physics in the form of ITG and dissipative trapped electron modes is further included in our survey. These models are, of course, by far not comprehensive in order to cover the complex physics of plasma turbulence in three-dimensional fusion devices, where a large range of parameter and mode regimes is present. Optimization criteria for a possible systematic minimization of turbulent transport in Helias configurations therefore still have to be regarded as tentative. The results presented here should, however, encourage for more detailed future computations. (orig.)

  9. Magnetic fields in diffuse media

    CERN Document Server

    Pino, Elisabete; Melioli, Claudio

    2015-01-01

    This volume presents the current knowledge of magnetic fields in diffuse astrophysical media. Starting with an overview of 21st century instrumentation to observe astrophysical magnetic fields, the chapters cover observational techniques, origin of magnetic fields, magnetic turbulence, basic processes in magnetized fluids, the role of magnetic fields for cosmic rays, in the interstellar medium and for star formation. Written by a group of leading experts the book represents an excellent overview of the field. Nonspecialists will find sufficient background to enter the field and be able to appreciate the state of the art.

  10. Effect of angular momentum alignment and strong magnetic fields on the formation of protostellar discs

    Science.gov (United States)

    Gray, William J.; McKee, Christopher F.; Klein, Richard I.

    2018-01-01

    Star-forming molecular clouds are observed to be both highly magnetized and turbulent. Consequently, the formation of protostellar discs is largely dependent on the complex interaction between gravity, magnetic fields, and turbulence. Studies of non-turbulent protostellar disc formation with realistic magnetic fields have shown that these fields are efficient in removing angular momentum from the forming discs, preventing their formation. However, once turbulence is included, discs can form in even highly magnetized clouds, although the precise mechanism remains uncertain. Here, we present several high-resolution simulations of turbulent, realistically magnetized, high-mass molecular clouds with both aligned and random turbulence to study the role that turbulence, misalignment, and magnetic fields have on the formation of protostellar discs. We find that when the turbulence is artificially aligned so that the angular momentum is parallel to the initial uniform field, no rotationally supported discs are formed, regardless of the initial turbulent energy. We conclude that turbulence and the associated misalignment between the angular momentum and the magnetic field are crucial in the formation of protostellar discs in the presence of realistic magnetic fields.

  11. Conditional Eddies in Plasma Turbulence

    DEFF Research Database (Denmark)

    Johnsen, Helene; Pécseli, Hans; Trulsen, J.

    1986-01-01

    Conditional structures, or eddies, in turbulent flows are discussed with special attention to electrostatic turbulence in plasmas. The potential variation of these eddies is obtained by sampling the fluctuations only when a certain condition is satisfied in a reference point. The resulting...

  12. Active turbulence in active nematics

    Science.gov (United States)

    Thampi, S. P.; Yeomans, J. M.

    2016-07-01

    Dense, active systems show active turbulence, a state characterised by flow fields that are chaotic, with continually changing velocity jets and swirls. Here we review our current understanding of active turbulence. The development is primarily based on the theory and simulations of active liquid crystals, but with accompanying summaries of related literature.

  13. Advances in compressible turbulent mixing

    Energy Technology Data Exchange (ETDEWEB)

    Dannevik, W.P.; Buckingham, A.C.; Leith, C.E. [eds.

    1992-01-01

    This volume includes some recent additions to original material prepared for the Princeton International Workshop on the Physics of Compressible Turbulent Mixing, held in 1988. Workshop participants were asked to emphasize the physics of the compressible mixing process rather than measurement techniques or computational methods. Actual experimental results and their meaning were given precedence over discussions of new diagnostic developments. Theoretical interpretations and understanding were stressed rather than the exposition of new analytical model developments or advances in numerical procedures. By design, compressibility influences on turbulent mixing were discussed--almost exclusively--from the perspective of supersonic flow field studies. The papers are arranged in three topical categories: Foundations, Vortical Domination, and Strongly Coupled Compressibility. The Foundations category is a collection of seminal studies that connect current study in compressible turbulent mixing with compressible, high-speed turbulent flow research that almost vanished about two decades ago. A number of contributions are included on flow instability initiation, evolution, and transition between the states of unstable flow onset through those descriptive of fully developed turbulence. The Vortical Domination category includes theoretical and experimental studies of coherent structures, vortex pairing, vortex-dynamics-influenced pressure focusing. In the Strongly Coupled Compressibility category the organizers included the high-speed turbulent flow investigations in which the interaction of shock waves could be considered an important source for production of new turbulence or for the enhancement of pre-existing turbulence. Individual papers are processed separately.

  14. Effects of anisotropic turbulent thermal diffusion on spherical magnetoconvection in the Earth's core

    Science.gov (United States)

    Ivers, D. J.; Phillips, C. G.

    2018-03-01

    We re-consider the plate-like model of turbulence in the Earth's core, proposed by Braginsky and Meytlis (1990), and show that it is plausible for core parameters not only in polar regions but extends to mid- and low-latitudes where rotation and gravity are not parallel, except in a very thin equatorial layer. In this model the turbulence is highly anisotropic with preferred directions imposed by the Earth's rotation and the magnetic field. Current geodynamo computations effectively model sub-grid scale turbulence by using isotropic viscous and thermal diffusion values significantly greater than the molecular values of the Earth's core. We consider a local turbulent dynamo model for the Earth's core in which the mean magnetic field, velocity and temperature satisfy the Boussinesq induction, momentum and heat equations with an isotropic turbulent Ekman number and Roberts number. The anisotropy is modelled only in the thermal diffusion tensor with the Earth's rotation and magnetic field as preferred directions. Nonlocal organising effects of gravity and rotation (but not aspect ratio in the Earth's core) such as an inverse cascade and nonlocal transport are assumed to occur at longer length scales, which computations may accurately capture with sufficient resolution. To investigate the implications of this anisotropy for the proposed turbulent dynamo model we investigate the linear instability of turbulent magnetoconvection on length scales longer than the background turbulence in a rotating sphere with electrically insulating exterior for no-slip and isothermal boundary conditions. The equations are linearised about an axisymmetric basic state with a conductive temperature, azimuthal magnetic field and differential rotation. The basic state temperature is a function of the anisotropy and the spherical radius. Elsasser numbers in the range 1-20 and turbulent Roberts numbers 0.01-1 are considered for both equatorial symmetries of the magnetic basic state. It is found

  15. Electromagnetic transport components and sheared flows in drift-Alfven turbulence

    DEFF Research Database (Denmark)

    Naulin, V.

    2003-01-01

    Results from three-dimensional numerical simulations of drift-Alfven turbulence in a toroidal geometry with sheared magnetic field are presented. The simulations show a relation between self-generated poloidal shear flows and magnetic field perturbations. For large values of the plasma beta we...

  16. Turbulence-driven shear flow and self-regulating drift wave turbulence in a cylindrical plasma device

    Science.gov (United States)

    Yan, Zheng

    This dissertation provides an experimental test of the basic theory of the self-regulating drift wave turbulence (DWT)/sheared zonal flow (ZF) system in a cylindrical plasma device. The work is carried out from three approaches: the first explores the statistical properties of the turbulent Reynolds stress and its link to the ZF generation, the second investigates the dynamical behavior of the DWT/ZF system and the third investigates the variation of the DWT driven ZF verses magnetic field strength and ion-neutral drag. A radially sheared azimuthally symmetric plasma flow is generated by the DWT turbulent Reynolds stress which is directly measured by a multi-tip Langmuir probe. A statistical analysis shows that the cross-phase between the turbulent radial and azimuthal velocity components is the key factor determining the detailed Reynolds stress profile. The coincidence of the radial location of the non-Gaussian distribution of the turbulent Reynolds stress and the ion saturation current, as well as the properties of the joint probability distribution function (PDF) between the radial particle flux and turbulent Reynolds stress suggest that the bursts of the particle transport appear to be associated with radial transport of azimuthal momentum as well. The results link the behavior of the Reynolds stress, its statistical properties, generation of bursty radially going azimuthal momentum transport events, and the formation of the large-scale ZF. From both Langmuir probe and fast-faming imaging measurements this shear flow is found to evolve with low frequency (˜250-300Hz). The envelope of the higher frequency (above 5kHz) floating potential fluctuations associated with the DWT, the density gradient, and the turbulent radial particle flux are all modulated out of phase with the strength of the ZF. The divergence of the turbulent Reynolds stress is also modulated at the same slow time scale in a phase-coherent manner consistent with a turbulence-driven shear flow

  17. Gyro-water-bag approach in nonlinear gyrokinetic turbulence

    Science.gov (United States)

    Besse, Nicolas; Bertrand, Pierre

    2009-06-01

    Turbulent transport is a key issue for controlled thermonuclear fusion based on magnetic confinement. The thermal confinement of a magnetized fusion plasma is essentially determined by the turbulent heat conduction across the equilibrium magnetic field. It has long been acknowledged, that the prediction of turbulent transport requires to solve Vlasov-type gyrokinetic equations. Although the kinetic description is more accurate than fluid models (MHD, gyro-fluid), because among other things it takes into account nonlinear resonant wave-particle interaction, kinetic modeling has the drawback of a huge computer resource request. An unifying approach consists in considering water-bag-like weak solutions of kinetic collisionless equations, which allow to reduce the full kinetic Vlasov equation into a set of hydrodynamic equations, while keeping its kinetic behaviour. As a result this exact reduction induces a multi-fluid numerical resolution cost. Therefore finding water-bag-like weak solutions of the gyrokinetic equations leads to the birth of the gyro-water-bag model. This model is suitable for studying linear and nonlinear low-frequency micro-instabilities and the associated anomalous transport in magnetically-confined plasmas. The present paper addresses the derivation of the nonlinear gyro-water-bag model, its quasilinear approximation and their numerical approximations by Runge-Kutta semi-Lagrangian methods and Runge-Kutta discontinuous Galerkin schemes respectively.

  18. Intermittent Anisotropic Turbulence Detected by THEMIS in the Magnetosheath

    Science.gov (United States)

    Macek, W. M.; Wawrzaszek, A.; Kucharuk, B.; Sibeck, D. G.

    2017-12-01

    Following our previous study of Time History of Events and Macroscale Interactions during Substorms (THEMIS) data, we consider intermittent turbulence in the magnetosheath depending on various conditions of the magnetized plasma behind the Earth’s bow shock and now also near the magnetopause. Namely, we look at the fluctuations of the components of the Elsässer variables in the plane perpendicular to the scale-dependent background magnetic fields and along the local average ambient magnetic fields. We have shown that Alfvén fluctuations often exhibit strong anisotropic non-gyrotropic turbulent intermittent behavior resulting in substantial deviations of the probability density functions from a normal Gaussian distribution with a large kurtosis. In particular, for very high Alfvénic Mach numbers and high plasma beta, we have clear anisotropy with non-Gaussian statistics in the transverse directions. However, along the magnetic field, the kurtosis is small and the plasma is close to equilibrium. On the other hand, intermittency becomes weaker for moderate Alfvén Mach numbers and lower values of the plasma parameter beta. It also seems that the degree of intermittency of turbulence for the outgoing fluctuations propagating relative to the ambient magnetic field is usually similar as for the ingoing fluctuations, which is in agreement with approximate equipartition of energy between these oppositely propagating Alfvén waves. We believe that the different characteristics of this intermittent anisotropic turbulent behavior in various regions of space and astrophysical plasmas can help identify nonlinear structures responsible for deviations of the plasma from equilibrium.

  19. Turbulent stress measurements of fibre suspensions in a straight pipe

    Science.gov (United States)

    MacKenzie, Jordan; Söderberg, Daniel; Swerin, Agne; Lundell, Fredrik

    2018-02-01

    The focus of the present work is an experimental study of the behaviour of semi-dilute, opaque fibre suspensions in fully developed cylindrical pipe flows. Measurements of the normal and turbulent shear stress components and the mean flow were acquired using phase-contrast magnetic resonance velocimetry. Two fibre types, namely, pulp fibre and nylon fibre, were considered in this work and are known to differ in elastic modulus. In total, three different mass concentrations and seven Reynolds numbers were tested to investigate the effects of fibre interactions during the transition from the plug flow to fully turbulent flow. It was found that in fully turbulent flows of nylon fibres, the normal, ⟨uzuz ⟩ +, and shear, ⟨uzur ⟩ + (note that ⟨.⟩ is the temporal average, u is the fluctuating velocity, z is the axial or streamwise component, and r is the radial direction), turbulent stresses increased with Reynolds number regardless of the crowding number (a concentration measure). For pulp fibre, the turbulent stresses increased with Reynolds number when a fibre plug was present in the flow and were spatially similar in magnitude when no fibre plug was present. Pressure spectra revealed that the stiff, nylon fibre reduced the energy in the inertial-subrange with an increasing Reynolds and crowding number, whereas the less stiff pulp fibre effectively cuts the energy cascade prematurely when the network was fully dispersed.

  20. Turbulent premixed flames on fractal-grid-generated turbulence

    Science.gov (United States)

    Soulopoulos, N.; Kerl, J.; Sponfeldner, T.; Beyrau, F.; Hardalupas, Y.; Taylor, A. M. K. P.; Vassilicos, J. C.

    2013-12-01

    A space-filling, low blockage fractal grid is used as a novel turbulence generator in a premixed turbulent flame stabilized by a rod. The study compares the flame behaviour with a fractal grid to the behaviour when a standard square mesh grid with the same effective mesh size and solidity as the fractal grid is used. The isothermal gas flow turbulence characteristics, including mean flow velocity and rms of velocity fluctuations and Taylor length, were evaluated from hot-wire measurements. The behaviour of the flames was assessed with direct chemiluminescence emission from the flame and high-speed OH-laser-induced fluorescence. The characteristics of the two flames are considered in terms of turbulent flame thickness, local flame curvature and turbulent flame speed. It is found that, for the same flow rate and stoichiometry and at the same distance downstream of the location of the grid, fractal-grid-generated turbulence leads to a more turbulent flame with enhanced burning rate and increased flame surface area.

  1. Gyrokinetic Simulations of Solar Wind Turbulence from Ion to Electron Scales

    International Nuclear Information System (INIS)

    Howes, G. G.; TenBarge, J. M.; Dorland, W.; Numata, R.; Quataert, E.; Schekochihin, A. A.; Tatsuno, T.

    2011-01-01

    A three-dimensional, nonlinear gyrokinetic simulation of plasma turbulence resolving scales from the ion to electron gyroradius with a realistic mass ratio is presented, where all damping is provided by resolved physical mechanisms. The resulting energy spectra are quantitatively consistent with a magnetic power spectrum scaling of k -2.8 as observed in in situ spacecraft measurements of the 'dissipation range' of solar wind turbulence. Despite the strongly nonlinear nature of the turbulence, the linear kinetic Alfven wave mode quantitatively describes the polarization of the turbulent fluctuations. The collisional ion heating is measured at subion-Larmor radius scales, which provides evidence of the ion entropy cascade in an electromagnetic turbulence simulation.

  2. Marshall N. Rosenbluth Outstanding Doctoral Thesis Award: Magnetorotational turbulence and dynamo

    Science.gov (United States)

    Squire, Jonathan

    2017-10-01

    Accretion disks are ubiquitous in astrophysics and power some of the most luminous sources in the universe. In many disks, the transport of angular momentum, and thus the mass accretion itself, is thought to be caused by the magnetorotational instability (MRI). As the MRI saturates into strong turbulence, it also generates ordered magnetic fields, acting as a magnetic dynamo powered by the background shear flow. However, despite its importance for astrophysical accretion processes, basic aspects of MRI turbulence-including its saturation amplitude-remain poorly understood. In this talk, I will outline progress towards improving this situation, focusing in particular on the nonlinear shear dynamo and how this controls the turbulence. I will discuss how novel statistical simulation methods can be used to better understand this shear dynamo, in particular the distinct mechanisms that may play a role in MRI turbulence and how these depend on important physical parameters.

  3. MHD from a Microscopic Concept and Onset of Turbulence in Hartmann Flow

    International Nuclear Information System (INIS)

    Jirkovsky, L.; Bo-ot, L. Ma.; Chiang, C. M.

    2010-01-01

    We derive higher order magneto-hydrodynamic (MHD) equations from a microscopic picture using projection and perturbation formalism. In an application to Hartmann flow we find velocity profiles flattening towards the center at the onset of turbulence in hydrodynamic limit. Comparison with the system under the effect of a uniform magnetic field yields difference in the onset of turbulence consistent with observations, showing that the presence of magnetic field inhibits onset of instability or turbulence. The laminar-turbulent transition is demonstrated in a phase transition plot of the development in time of the relative average velocities vs. Reynolds number showing a sharp increase of the relative average velocity at the transition point as determined by the critical Reynolds number. (physics of gases, plasmas, and electric discharges)

  4. A Full Eulerian Vlasov-Maxwell Study of Turbulent Dynamics and Dissipation

    Science.gov (United States)

    TenBarge, J. M.; Juno, J.; Hakim, A.

    2016-12-01

    The development of a detailed understanding of turbulence in magnetized plasmas has been a long standing goal of the broader scientific community, both as a fundamental physics process and because of its applicability to a wide variety of phenomena. Turbulence in a magnetized plasma is the primary mechanism responsible for transforming energy at large injection scales into small-scale motions, which are ultimately dissipated as heat in systems such as the solar corona and wind. At large scales, the turbulence is well described by fluid models of the plasma; however, understanding the processes responsible for heating a weakly collisional plasma such as the solar wind requires a kinetic description. We present the first fully kinetic Eulerian Vlasov-Maxwell study of turbulence using the Gkeyll simulation code. We focus on the pristine distribution function dynamics that are possible with the Eulerian approach. We also present the signatures and form of dissipation as diagnosed via field-particle correlation functions.

  5. Turbulent deflagrations, autoignitions, and detonations

    KAUST Repository

    Bradley, Derek

    2012-09-01

    Measurements of turbulent burning velocities in fan-stirred explosion bombs show an initial linear increase with the fan speed and RMS turbulent velocity. The line then bends over to form a plateau of high values around the maximum attainable burning velocity. A further increase in fan speed leads to the eventual complete quenching of the flame due to increasing localised extinctions because of the flame stretch rate. The greater the Markstein number, the more readily does flame quenching occur. Flame propagation along a duct closed at one end, with and without baffles to increase the turbulence, is subjected to a one-dimensional analysis. The flame, initiated at the closed end of the long duct, accelerates by the turbulent feedback mechanism, creating a shock wave ahead of it, until the maximum turbulent burning velocity for the mixture is attained. With the confining walls, the mixture is compressed between the flame and the shock plane up to the point where it might autoignite. This can be followed by a deflagration to detonation transition. The maximum shock intensity occurs with the maximum attainable turbulent burning velocity, and this defines the limit for autoignition of the mixture. For more reactive mixtures, autoignition can occur at turbulent burning velocities that are less than the maximum attainable one. Autoignition can be followed by quasi-detonation or fully developed detonation. The stability of ensuing detonations is discussed, along with the conditions that may lead to their extinction. © 2012 by Pleiades Publishing, Ltd.

  6. Numerical methods for turbulent flow

    Science.gov (United States)

    Turner, James C., Jr.

    1988-01-01

    It has generally become accepted that the Navier-Strokes equations predict the dynamic behavior of turbulent as well as laminar flows of a fluid at a point in space away form a discontinuity such as a shock wave. Turbulence is also closely related to the phenomena of non-uniqueness of solutions of the Navier-Strokes equations. These second order, nonlinear partial differential equations can be solved analytically for only a few simple flows. Turbulent flow fields are much to complex to lend themselves to these few analytical methods. Numerical methods, therefore, offer the only possibility of achieving a solution of turbulent flow equations. In spite of recent advances in computer technology, the direct solution, by discrete methods, of the Navier-Strokes equations for turbulent flow fields is today, and in the foreseeable future, impossible. Thus the only economically feasible way to solve practical turbulent flow problems numerically is to use statistically averaged equations governing mean-flow quantities. The objective is to study some recent developments relating to the use of numerical methods to study turbulent flow.

  7. Comparison of turbulence mitigation algorithms

    Science.gov (United States)

    Kozacik, Stephen T.; Paolini, Aaron; Sherman, Ariel; Bonnett, James; Kelmelis, Eric

    2017-07-01

    When capturing imagery over long distances, atmospheric turbulence often degrades the data, especially when observation paths are close to the ground or in hot environments. These issues manifest as time-varying scintillation and warping effects that decrease the effective resolution of the sensor and reduce actionable intelligence. In recent years, several image processing approaches to turbulence mitigation have shown promise. Each of these algorithms has different computational requirements, usability demands, and degrees of independence from camera sensors. They also produce different degrees of enhancement when applied to turbulent imagery. Additionally, some of these algorithms are applicable to real-time operational scenarios while others may only be suitable for postprocessing workflows. EM Photonics has been developing image-processing-based turbulence mitigation technology since 2005. We will compare techniques from the literature with our commercially available, real-time, GPU-accelerated turbulence mitigation software. These comparisons will be made using real (not synthetic), experimentally obtained data for a variety of conditions, including varying optical hardware, imaging range, subjects, and turbulence conditions. Comparison metrics will include image quality, video latency, computational complexity, and potential for real-time operation. Additionally, we will present a technique for quantitatively comparing turbulence mitigation algorithms using real images of radial resolution targets.

  8. Transition to turbulence

    International Nuclear Information System (INIS)

    Pomeau, Y.

    1981-07-01

    In this work it is reviewed a few known types of transition to turbulence, as the cascade of period doubling and the intermittent transition. This happens in dynamical systems with a few degrees of freedom, as modelled by the iteration of non linear maps. Then it is presented specific transitions for systems with many degrees of freedom. It is condidered first the occurence of a low frequency broadband noise in large cells at the onset of Rayleigh-Benard convection; then the transition by intermittent bursts in parallel flows. In this last case, one is concerned with localized and finite amplitude perturbations. Simple geometric arguments show that these fluctuations, when they are isolated and with a well definite relative speed, exist for a single value of the Reynolds number only [fr

  9. Turbulent convection in liquid metal with and without rotation.

    Science.gov (United States)

    King, Eric M; Aurnou, Jonathan M

    2013-04-23

    The magnetic fields of Earth and other planets are generated by turbulent, rotating convection in liquid metal. Liquid metals are peculiar in that they diffuse heat more readily than momentum, quantified by their small Prandtl numbers, Pr rotating Rayleigh-Bénard convection experiments in the liquid metal gallium (Pr = 0.025) over a range of nondimensional buoyancy forcing (Ra) and rotation periods (E). Our primary diagnostic is the efficiency of convective heat transfer (Nu). In general, we find that the convective behavior of liquid metal differs substantially from that of moderate Pr fluids, such as water. In particular, a transition between rotationally constrained and weakly rotating turbulent states is identified, and this transition differs substantially from that observed in moderate Pr fluids. This difference, we hypothesize, may explain the different classes of magnetic fields observed on the Gas and Ice Giant planets, whose dynamo regions consist of Pr 1 fluids, respectively.

  10. Numerical and Experimental Investigation of Turbulent Transport Control via Shaping of Radial Plasma Flow Profiles

    Energy Technology Data Exchange (ETDEWEB)

    Gilmore, Mark Allen [Univ. of New Mexico, Albuquerque, NM (United States)

    2017-02-05

    Turbulence, and turbulence-driven transport are ubiquitous in magnetically confined plasmas, where there is an intimate relationship between turbulence, transport, instability driving mechanisms (such as gradients), plasma flows, and flow shear. Though many of the detailed physics of the interrelationship between turbulence, transport, drive mechanisms, and flow remain unclear, there have been many demonstrations that transport and/or turbulence can be suppressed or reduced via manipulations of plasma flow profiles. This is well known in magnetic fusion plasmas [e.g., high confinement mode (H-mode) and internal transport barriers (ITB’s)], and has also been demonstrated in laboratory plasmas. However, it may be that the levels of particle transport obtained in such cases [e.g. H-mode, ITB’s] are actually lower than is desirable for a practical fusion device. Ideally, one would be able to actively feedback control the turbulent transport, via manipulation of the flow profiles. The purpose of this research was to investigate the feasibility of using both advanced model-based control algorithms, as well as non-model-based algorithms, to control cross-field turbulence-driven particle transport through appropriate manipulation of radial plasma flow profiles. The University of New Mexico was responsible for the experimental portion of the project, while our collaborators at the University of Montana provided plasma transport modeling, and collaborators at Lehigh University developed and explored control methods.

  11. Statistical properties of turbulence: An overview

    Indian Academy of Sciences (India)

    the turbulent advection of passive scalars, turbulence in the one-dimensional Burgers equation, and fluid turbulence in the presence of polymer ... However, it is not easy to state what would consti- tute a solution of the turbulence ...... flow with Lagrangian tracers and use a cubic spline interpolation method to calculate their ...

  12. The inverse problem for the refractometry diagnostics of electromagnetic turbulence in plasma

    International Nuclear Information System (INIS)

    Lazarian, A.

    1994-01-01

    Turbulence is an important property of laboratory plasmas. A number of relevant diagnostics are based on the interaction of an electromagnetic beam with plasma. Here we discuss a refractometry technique, where information on plasma properties is obtained by probing plasma with a plane polarized electromagnetic beam. It is shown that the problem of recovering statistical properties of plasma turbulence from the line integrated data can be solved uniquely using a realistic model of plasma. Analytical expressions relating statistics of both the random density and random magnetic fields to the measured statistics have been found. This information is of importance in studies of plasma turbulence. (author)

  13. The fundamental difference between shear alpha viscosity and turbulent magnetorotational stresses

    DEFF Research Database (Denmark)

    Pessah, Martin Elias; Chan, Chi-kwan; Psaltis, Dimitrios

    2006-01-01

    Numerical simulations of turbulent, magnetized, differentially rotating flows driven by the magnetorotational instability are often used to calculate the effective values of alpha viscosity that is invoked in analytical models of accretion discs. In this paper we use various dynamical models...... of turbulent magnetohydrodynamic stresses, as well as numerical simulations of shearing boxes, to show that angular momentum transport in MRI-driven accretion discs cannot be described by the standard model for shear viscosity. In particular, we demonstrate that turbulent magnetorotational stresses...... are not linearly proportional to the local shear and vanish identically for angular velocity profiles that increase outwards....

  14. Effect of turbulent collisions on diffusion in stationary plasma turbulence

    International Nuclear Information System (INIS)

    Xia, H.; Ishihara, O.

    1990-01-01

    Recently the velocity diffusion process was studied by the generalized Langevin equation derived by the projection operator method. The further study shows that the retarded frictional function plays an important role in suppressing particle diffusion in the velocity space in stronger turbulence as much as the resonance broadening effect. The retarded frictional effect, produced by the effective collisions due to the plasma turbulence is assumed to be a Gaussian, but non-Markovian and non-wide-sense stationary process. The relations between the proposed formulation and the extended resonance broadening theory is discussed. The authors also carry out test particle numerical experiment for Langmuir turbulence to test the theories. In a stronger turbulence a deviation of the diffusion rate from the one predicted by both the quasilinear and the extended resonance theories has been observed and is explained qualitatively by the present formulation

  15. Wind energy impact of turbulence

    CERN Document Server

    Hölling, Michae; Ivanell, Stefan

    2014-01-01

    This book presents the results of the seminar ""Wind Energy and the Impact of Turbulence on the Conversion Process"" which was supported from three societies, namely the EUROMech, EAWE and ERCOFATC and took place in Oldenburg, Germany in spring 2012.The seminar was one of the first scientific meetings devoted to the common topic of wind energy and basic turbulence. The established community of researchers working on the challenging puzzle of turbulence for decades met the quite young community of researchers, who face the upcoming challenges in the fast growing field of wind energy application

  16. Turbulence via information field dynamics

    Science.gov (United States)

    Ensslin, Torsten A.

    2015-08-01

    Turbulent flows exhibit-scale free regimes, for which information on the statistical properties of the dynamics exists for many length-scales. The simulation of turbulent systems can benefit from the inclusion of such information on sub-grid process. How can statistical information about the flow on small scales be optimally be incorporated into simulation schemes? Information field dynamics (IFD) is a novel information theoretical framework to design schemes that exploit such statistical knowledge on sub-grid flow fluctuations. In this talk, I will introduce the basic idea of IFD, present its first toy applications, and discuss the next steps towards its usage in complex turbulence simulations.

  17. On Lean Turbulent Combustion Modeling

    Directory of Open Access Journals (Sweden)

    Constantin LEVENTIU

    2014-06-01

    Full Text Available This paper investigates a lean methane-air flame with different chemical reaction mechanisms, for laminar and turbulent combustion, approached as one and bi-dimensional problem. The numerical results obtained with Cantera and Ansys Fluent software are compared with experimental data obtained at CORIA Institute, France. First, for laminar combustion, the burn temperature is very well approximated for all chemical mechanisms, however major differences appear in the evaluation of the flame front thickness. Next, the analysis of turbulence-combustion interaction shows that the numerical predictions are suficiently accurate for small and moderate turbulence intensity.

  18. Turbulent transport in 2D collisionless guide field reconnection

    Science.gov (United States)

    Muñoz, P. A.; Büchner, J.; Kilian, P.

    2017-02-01

    Transport in hot and dilute, i.e., collisionless, astrophysical and space, plasmas is called "anomalous." This transport is due to the interaction between the particles and the self-generated turbulence by their collective interactions. The anomalous transport has very different and not well known properties compared to the transport due to binary collisions, dominant in colder and denser plasmas. Because of its relevance for astrophysical and space plasmas, we explore the excitation of turbulence in current sheets prone to component- or guide-field reconnection, a process not well understood yet. This configuration is typical for stellar coronae, and it is created in the laboratory for which a 2.5D geometry applies. In our analysis, in addition to the immediate vicinity of the X-line, we also include regions outside and near the separatrices. We analyze the anomalous transport properties by using 2.5D Particle-in-Cell code simulations. We split off the mean slow variation (in contrast to the fast turbulent fluctuations) of the macroscopic observables and determine the main transport terms of the generalized Ohm's law. We verify our findings by comparing with the independently determined slowing-down rate of the macroscopic currents (due to a net momentum transfer from particles to waves) and with the transport terms obtained by the first order correlations of the turbulent fluctuations. We find that the turbulence is most intense in the "low density" separatrix region of guide-field reconnection. It is excited by streaming instabilities, is mainly electrostatic and "patchy" in space, and so is the associated anomalous transport. Parts of the energy exchange between turbulence and particles are reversible and quasi-periodic. The remaining irreversible anomalous resistivity can be parametrized by an effective collision rate ranging from the local ion-cyclotron to the lower-hybrid frequency. The contributions to the parallel and the perpendicular (to the magnetic

  19. Velocity Statistics Distinguish Quantum Turbulence from Classical Turbulence

    International Nuclear Information System (INIS)

    Paoletti, M. S.; Fisher, Michael E.; Sreenivasan, K. R.; Lathrop, D. P.

    2008-01-01

    By analyzing trajectories of solid hydrogen tracers, we find that the distributions of velocity in decaying quantum turbulence in superfluid 4 He are strongly non-Gaussian with 1/v 3 power-law tails. These features differ from the near-Gaussian statistics of homogenous and isotropic turbulence of classical fluids. We examine the dynamics of many events of reconnection between quantized vortices and show by simple scaling arguments that they produce the observed power-law tails

  20. Turbulent convection in liquid metal with and without rotation

    OpenAIRE

    King, Eric M.; Aurnou, Jonathan M.

    2013-01-01

    The magnetic fields of Earth and other planets are generated by turbulent, rotating convection in liquid metal. Liquid metals are peculiar in that they diffuse heat more readily than momentum, quantified by their small Prandtl numbers, . Most analog models of planetary dynamos, however, use moderate fluids, and the systematic influence of reducing is not well understood. We perform rotating Rayleigh–Bénard convection experiments in the liquid metal gallium over a range of nondimensional bu...

  1. Intermittency in MHD turbulence and coronal nanoflares modelling

    Directory of Open Access Journals (Sweden)

    P. Veltri

    2005-01-01

    Full Text Available High resolution numerical simulations, solar wind data analysis, and measurements at the edges of laboratory plasma devices have allowed for a huge progress in our understanding of MHD turbulence. The high resolution of solar wind measurements has allowed to characterize the intermittency observed at small scales. We are now able to set up a consistent and convincing view of the main properties of MHD turbulence, which in turn constitutes an extremely efficient tool in understanding the behaviour of turbulent plasmas, like those in solar corona, where in situ observations are not available. Using this knowledge a model to describe injection, due to foot-point motions, storage and dissipation of MHD turbulence in coronal loops, is built where we assume strong longitudinal magnetic field, low beta and high aspect ratio, which allows us to use the set of reduced MHD equations (RMHD. The model is based on a shell technique in the wave vector space orthogonal to the strong magnetic field, while the dependence on the longitudinal coordinate is preserved. Numerical simulations show that injected energy is efficiently stored in the loop where a significant level of magnetic and velocity fluctuations is obtained. Nonlinear interactions give rise to an energy cascade towards smaller scales where energy is dissipated in an intermittent fashion. Due to the strong longitudinal magnetic field, dissipative structures propagate along the loop, with the typical speed of the Alfvén waves. The statistical analysis on the intermittent dissipative events compares well with all observed properties of nanoflare emission statistics. Moreover the recent observations of non thermal velocity measurements during flare occurrence are well described by the numerical results of the simulation model. All these results naturally emerge from the model dynamical evolution without any need of an ad-hoc hypothesis.

  2. Applying Magneto-rheology to Reduce Blood Viscosity and Suppress Turbulence to Prevent Heart Attacks

    Science.gov (United States)

    Tao, R.

    Heart attacks are the leading causes of death in USA. Research indicates one common thread, high blood viscosity, linking all cardiovascular diseases. Turbulence in blood circulation makes different regions of the vasculature vulnerable to development of atherosclerotic plaque. Turbulence is also responsible for systolic ejection murmurs and places heavier workload on heart, a possible trigger of heart attacks. Presently, neither medicine nor method is available to suppress turbulence. The only method to reduce the blood viscosity is to take medicine, such as aspirin. However, using medicine to reduce the blood viscosity does not help suppressing turbulence. In fact, the turbulence gets worse as the Reynolds number goes up with the viscosity reduction by the medicine. Here we report our new discovery: application of a strong magnetic field to blood along its flow direction, red blood cells are polarized in the magnetic field and aggregated into short chains along the flow direction. The blood viscosity becomes anisotropic: Along the flow direction the viscosity is significantly reduced, but in the directions perpendicular to the flow the viscosity is considerably increased. In this way, the blood flow becomes laminar, turbulence is suppressed, the blood circulation is greatly improved, and the risk for heart attacks is reduced. While these effects are not permanent, they last for about 24 hours after one magnetic therapy treatment.

  3. Flux expansion effect on turbulent transport in 3D global simulations

    Directory of Open Access Journals (Sweden)

    D. Galassi

    2017-08-01

    Full Text Available The flux expansion effect on the Scrape-Off Layer equilibrium is inspected through TOKAM3X 3D turbulence simulations. Three magnetic equilibria with analytically controlled flux expansion are built, representing respectively a positive, a null and a negative Shafranov shift. Turbulent E × B fluxes across flux surfaces show similar amplitudes and poloidal distributions in all cases. The ballooning nature of the interchange instability is recovered, with an enhancement of turbulence in the vicinity of the limiter, probably due to a Kelvin–Helmoltz instability. Interestingly, the poloidally averaged density decay length is found to be shorter almost by a factor 2 in the case of flux surfaces compressed at the low-field side midplane, with respect to the opposite case, indicating the presence of unfavorable conditions for the turbulent transport. The difference in the magnetic field line shape is pointed out as a mechanism which affects the turbulent transport across the flux surfaces. Indeed the unstable region has a larger parallel extension when flux expansion in the low-field side is larger. Moreover, the configuration with a lower magnetic shear at the low-field side midplane shows a more unstable behavior. The role of this parameter in turbulence stabilization is qualitatively evaluated. The difference in the distribution of transport along the parallel direction is shown to affect also the parallel flows, which are analyzed for the three proposed cases.

  4. PLASMA TURBULENCE AND KINETIC INSTABILITIES AT ION SCALES IN THE EXPANDING SOLAR WIND

    Energy Technology Data Exchange (ETDEWEB)

    Hellinger, Petr; Trávnícek, Pavel M. [Astronomical Institute, CAS, Bocni II/1401, CZ-14100 Prague (Czech Republic); Matteini, Lorenzo [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom); Landi, Simone; Verdini, Andrea; Franci, Luca, E-mail: petr.hellinger@asu.cas.cz [Dipartimento di Fisica e Astronomia, Università degli Studi di Firenze Largo E. Fermi 2, I-50125 Firenze (Italy)

    2015-10-01

    The relationship between a decaying strong turbulence and kinetic instabilities in a slowly expanding plasma is investigated using two-dimensional (2D) hybrid expanding box simulations. We impose an initial ambient magnetic field perpendicular to the simulation box, and we start with a spectrum of large-scale, linearly polarized, random-phase Alfvénic fluctuations that have energy equipartition between kinetic and magnetic fluctuations and vanishing correlation between the two fields. A turbulent cascade rapidly develops; magnetic field fluctuations exhibit a power-law spectrum at large scales and a steeper spectrum at ion scales. The turbulent cascade leads to an overall anisotropic proton heating, protons are heated in the perpendicular direction, and, initially, also in the parallel direction. The imposed expansion leads to generation of a large parallel proton temperature anisotropy which is at later stages partly reduced by turbulence. The turbulent heating is not sufficient to overcome the expansion-driven perpendicular cooling and the system eventually drives the oblique firehose instability in a form of localized nonlinear wave packets which efficiently reduce the parallel temperature anisotropy. This work demonstrates that kinetic instabilities may coexist with strong plasma turbulence even in a constrained 2D regime.

  5. Stochastic differential equations and turbulent dispersion

    Science.gov (United States)

    Durbin, P. A.

    1983-01-01

    Aspects of the theory of continuous stochastic processes that seem to contribute to an understanding of turbulent dispersion are introduced and the theory and philosophy of modelling turbulent transport is emphasized. Examples of eddy diffusion examined include shear dispersion, the surface layer, and channel flow. Modeling dispersion with finite-time scale is considered including the Langevin model for homogeneous turbulence, dispersion in nonhomogeneous turbulence, and the asymptotic behavior of the Langevin model for nonhomogeneous turbulence.

  6. Premixed autoignition in compressible turbulence

    Science.gov (United States)

    Konduri, Aditya; Kolla, Hemanth; Krisman, Alexander; Chen, Jacqueline

    2016-11-01

    Prediction of chemical ignition delay in an autoignition process is critical in combustion systems like compression ignition engines and gas turbines. Often, ignition delay times measured in simple homogeneous experiments or homogeneous calculations are not representative of actual autoignition processes in complex turbulent flows. This is due the presence of turbulent mixing which results in fluctuations in thermodynamic properties as well as chemical composition. In the present study the effect of fluctuations of thermodynamic variables on the ignition delay is quantified with direct numerical simulations of compressible isotropic turbulence. A premixed syngas-air mixture is used to remove the effects of inhomogeneity in the chemical composition. Preliminary results show a significant spatial variation in the ignition delay time. We analyze the topology of autoignition kernels and identify the influence of extreme events resulting from compressibility and intermittency. The dependence of ignition delay time on Reynolds and turbulent Mach numbers is also quantified. Supported by Basic Energy Sciences, Dept of Energy, United States.

  7. Structure and modeling of turbulence

    International Nuclear Information System (INIS)

    Novikov, E.A.

    1995-01-01

    The open-quotes vortex stringsclose quotes scale l s ∼ LRe -3/10 (L-external scale, Re - Reynolds number) is suggested as a grid scale for the large-eddy simulation. Various aspects of the structure of turbulence and subgrid modeling are described in terms of conditional averaging, Markov processes with dependent increments and infinitely divisible distributions. The major request from the energy, naval, aerospace and environmental engineering communities to the theory of turbulence is to reduce the enormous number of degrees of freedom in turbulent flows to a level manageable by computer simulations. The vast majority of these degrees of freedom is in the small-scale motion. The study of the structure of turbulence provides a basis for subgrid-scale (SGS) models, which are necessary for the large-eddy simulations (LES)

  8. Energy transfer in compressible turbulence

    Science.gov (United States)

    Bataille, Francoise; Zhou, YE; Bertoglio, Jean-Pierre

    1995-01-01

    This letter investigates the compressible energy transfer process. We extend a methodology developed originally for incompressible turbulence and use databases from numerical simulations of a weak compressible turbulence based on Eddy-Damped-Quasi-Normal-Markovian (EDQNM) closure. In order to analyze the compressible mode directly, the well known Helmholtz decomposition is used. While the compressible component has very little influence on the solenoidal part, we found that almost all of the compressible turbulence energy is received from its solenoidal counterpart. We focus on the most fundamental building block of the energy transfer process, the triadic interactions. This analysis leads us to conclude that, at low turbulent Mach number, the compressible energy transfer process is dominated by a local radiative transfer (absorption) in both inertial and energy containing ranges.

  9. Turbulence Instrumentation for Stratospheric Airships

    National Research Council Canada - National Science Library

    Duell, Mark L; Saupe, Lawrence M; Barbeau, Brent E; Robinson, Kris D; Jumper, George Y

    2007-01-01

    .... The High Altitude Airship is designed to investigate these phenomena. In order to sense atmospheric turbulence at altitudes of the expected flight of the High Altitude Airship of around 65,000ft, a prototype ionic anemometer was constructed...

  10. Stochastic Subspace Modelling of Turbulence

    DEFF Research Database (Denmark)

    Sichani, Mahdi Teimouri; Pedersen, B. J.; Nielsen, Søren R.K.

    2009-01-01

    positive definite cross-spectral density matrix a frequency response matrix is constructed which determines the turbulence vector as a linear filtration of Gaussian white noise. Finally, an accurate state space modelling method is proposed which allows selection of an appropriate model order......, and estimation of a state space model for the vector turbulence process incorporating its phase spectrum in one stage, and its results are compared with a conventional ARMA modelling method.......Turbulence of the incoming wind field is of paramount importance to the dynamic response of civil engineering structures. Hence reliable stochastic models of the turbulence should be available from which time series can be generated for dynamic response and structural safety analysis. In the paper...

  11. Turbulence in unmagnetized Vlasov plasmas

    International Nuclear Information System (INIS)

    Kuo, S.P.

    1985-01-01

    The classical technique of transformation and characteristics is employed to analyze the problem of strong turbulence in unmagnetized plasmas. The effect of resonance broadening and perturbation expansion are treated simultaneously, without time secularities. The renormalization procedure of Dupree and Tetreault is used in the transformed Vlasov equation to analyze the turbulence and to derive explicitly a diffusion equation. Analyses are extended to inhomogeneous plasmas and the relationship between the transformation and ponderomotive force is obtained. (author)

  12. Quantify the complexity of turbulence

    Science.gov (United States)

    Tao, Xingtian; Wu, Huixuan

    2017-11-01

    Many researchers have used Reynolds stress, power spectrum and Shannon entropy to characterize a turbulent flow, but few of them have measured the complexity of turbulence. Yet as this study shows, conventional turbulence statistics and Shannon entropy have limits when quantifying the flow complexity. Thus, it is necessary to introduce new complexity measures- such as topology complexity and excess information-to describe turbulence. Our test flow is a classic turbulent cylinder wake at Reynolds number 8100. Along the stream-wise direction, the flow becomes more isotropic and the magnitudes of normal Reynolds stresses decrease monotonically. These seem to indicate the flow dynamics becomes simpler downstream. However, the Shannon entropy keeps increasing along the flow direction and the dynamics seems to be more complex, because the large-scale vortices cascade to small eddies, the flow is less correlated and more unpredictable. In fact, these two contradictory observations partially describe the complexity of a turbulent wake. Our measurements (up to 40 diameters downstream the cylinder) show that the flow's degree-of-complexity actually increases firstly and then becomes a constant (or drops slightly) along the stream-wise direction. University of Kansas General Research Fund.

  13. Dissipation of Molecular Cloud Turbulence by Magnetohydrodynamic Shockwaves

    Science.gov (United States)

    Lehmann, Andrew; Wardle, Mark

    2015-08-01

    The character of star formation is intimately related to the supersonic magnetohydrodynamic (MHD) turbulent dynamics of the giant molecular clouds in which stars form. A significant amount of the turbulent energy dissipates in low velocity shock waves. These shocks cause molecular line cooling of the compressed and heated gas, and so their radiative signatures probe the nature of the turbulence. In MHD fluids the three distinct families of shocks—fast, intermediate and slow—differ in how they compress and heat the molecular gas, and so observational differences between them may also distinguish driving modes of turbulent regions.Here we use a two-fluid model to compare the characteristics of one-dimensional fast and slow MHD shocks. Fast MHD shocks are magnetically driven, forcing ion species to stream through the neutral gas ahead of the shock front. This magnetic precursor heats the gas sufficiently to create a large, warm transition zone where all the fluid variables only weakly change in the shock front. In contrast, slow MHD shocks are driven by gas pressure where neutral species collide with ion species in a thin hot slab that closely resembles an ordinary gas dynamic shock.We computed observational diagnostics for fast and slow shocks at velocities vs = 2-4 km/s and preshock Hydrogen nuclei densities n(H) = 102-4 cm-3. We followed the abundances of molecules relevant for a simple oxygen chemistry and include cooling by CO, H2 and H2O. Estimates of intensities of CO rotational lines show that high-J lines, above J = 6→5, are more strongly excited in slow MHD shocks. We discuss how these shocks could help interpret recently observed anomalously strong mid- and high-J CO lines emitted by warm gas in the Milky Way and external galaxies, and implications for simulations of MHD turbulence.

  14. Turbulence in Accretion Discs. The Global Baroclinic Instability

    Science.gov (United States)

    Klahr, Hubert; Bodenheimer, Peter

    The transport of angular momentum away from the central object is a sufficient condition for a protoplanetary disk to accrete matter onto the star and spin it down. Magnetic fields cannot be of importance for this process in a large part of the cold and dusty disk where the planets supposedly form. Our new hypothesis on the angular momentum transport based on radiation hydro simulations is as follows: We present the global baroclinic instability as a source for vigorous turbulence leading to angular momentum transport in Keplerian accretion disks. We show by analytical considerations and three-dimensional radiation hydro simulations that, in particular, protoplanetary disks have a negative radial entropy gradient, which makes them baroclinic. Two-dimensional numerical simulations show that this baroclinic flow is unstable and produces turbulence. These findings are currently tested for numerical effects by performing barotropic simulations which show that imposed turbulence rapidly decays. The turbulence in baroclinic disks draws energy from the background shear, transports angular momentum outward and creates a radially inward bound accretion of matter, thus forming a self consistent process. Gravitational energy is transformed into turbulent kinetic energy, which is then dissipated, as in the classical accretion paradigm. We measure accretion rates in 2D and 3D simulations of dot M= - 10-9 to -10-7 Msolar yr-1 and viscosity parameters of α = 10-4 - 10-2, which fit perfectly together and agree reasonably with observations. The turbulence creates pressure waves, Rossby waves, and vortices in the (r-φ) plane of the disk. We demonstrate in a global simulation that these vortices tend to form out of little background noise and to be long-lasting features, which have already been suggested to lead to the formation of planets.

  15. Is Molecular Cloud Turbulence Driven by External Supernova Explosions?

    Science.gov (United States)

    Seifried, Daniel; Walch, Stefanie; Haid, Sebastian; Girichidis, Philipp; Naab, Thorsten

    2018-03-01

    We present high-resolution (∼0.1 pc), hydrodynamical and magnetohydrodynamical simulations to investigate whether the observed level of molecular cloud (MC) turbulence can be generated and maintained by external supernova (SN) explosions. The MCs are formed self-consistently within their large-scale galactic environment following the non-equilibrium formation of H2 and CO, including (self-) shielding and important heating and cooling processes. The MCs inherit their initial level of turbulence from the diffuse ISM, where turbulence is injected by SN explosions. However, by systematically exploring the effect of individual SNe going off outside the clouds, we show that at later stages the importance of SN-driven turbulence is decreased significantly. This holds for different MC masses as well as for MCs with and without magnetic fields. The SN impact also decreases rapidly with larger distances. Nearby SNe (d ∼ 25 pc) boost the turbulent velocity dispersions of the MC by up to 70% (up to a few km s‑1). For d > 50 pc, however, their impact decreases fast with increasing d and is almost negligible. For all probed distances the gain in velocity dispersion decays rapidly within a few 100 kyr. This is significantly shorter than the average timescale for an MC to be hit by a nearby SN under solar neighborhood conditions (∼2 Myr). Hence, at these conditions SNe are not able to sustain the observed level of MC turbulence. However, in environments with high gas surface densities and SN rates, like the Central Molecular Zone, observed elevated MC dispersions could be triggered by external SNe.

  16. A non-local shell model of hydrodynamic and magnetohydrodynamic turbulence

    Energy Technology Data Exchange (ETDEWEB)

    Plunian, F [Laboratoire de Geophysique Interne et Tectonophysique, CNRS, Universite Joseph Fourier, Maison des Geosciences, BP 53, 38041 Grenoble Cedex 9 (France); Stepanov, R [Institute of Continuous Media Mechanics, Korolyov 1, 614013 Perm (Russian Federation)

    2007-08-15

    We derive a new shell model of magnetohydrodynamic (MHD) turbulence in which the energy transfers are not necessarily local. Like the original MHD equations, the model conserves the total energy, magnetic helicity, cross-helicity and volume in phase space (Liouville's theorem) apart from the effects of external forcing, viscous dissipation and magnetic diffusion. The model of hydrodynamic (HD) turbulence is derived from the MHD model setting the magnetic field to zero. In that case the conserved quantities are the kinetic energy and the kinetic helicity. In addition to a statistically stationary state with a Kolmogorov spectrum, the HD model exhibits multiscaling. The anomalous scaling exponents are found to depend on a free parameter {alpha} that measures the non-locality degree of the model. In freely decaying turbulence, the infra-red spectrum also depends on {alpha}. Comparison with theory suggests using {alpha} = -5/2. In MHD turbulence, we investigate the fully developed turbulent dynamo for a wide range of magnetic Prandtl numbers in both kinematic and dynamic cases. Both local and non-local energy transfers are clearly identified.

  17. Dual Phase-space Cascades in 3D Hybrid-Vlasov–Maxwell Turbulence

    Science.gov (United States)

    Cerri, S. S.; Kunz, M. W.; Califano, F.

    2018-03-01

    To explain energy dissipation via turbulence in collisionless, magnetized plasmas, the existence of a dual real- and velocity-space cascade of ion-entropy fluctuations below the ion gyroradius has been proposed. Such a dual cascade, predicted by the gyrokinetic theory, has previously been observed in gyrokinetic simulations of two-dimensional, electrostatic turbulence. For the first time, we show evidence for a dual phase-space cascade of ion-entropy fluctuations in a three-dimensional simulation of hybrid-kinetic, electromagnetic turbulence. Some of the scalings observed in the energy spectra are consistent with a generalized theory for the cascade that accounts for the spectral anisotropy of critically balanced, intermittent, sub-ion-Larmor-scale fluctuations. The observed velocity-space cascade is also anisotropic with respect to the magnetic-field direction, with linear phase mixing along magnetic-field lines proceeding mainly at spatial scales above the ion gyroradius and nonlinear phase mixing across magnetic-field lines proceeding at perpendicular scales below the ion gyroradius. Such phase-space anisotropy could be sought in heliospheric and magnetospheric data of solar-wind turbulence and has far-reaching implications for the dissipation of turbulence in weakly collisional astrophysical plasmas.

  18. Radiation Hydrodynamical Turbulence in Protoplanetary Disks: Numerical Models and Observational Constraints

    Science.gov (United States)

    Flock, Mario; Nelson, Richard P.; Turner, Neal J.; Bertrang, Gesa H.-M.; Carrasco-González, Carlos; Henning, Thomas; Lyra, Wladimir; Teague, Richard

    2017-12-01

    Planets are born in protostellar disks, which are now observed with enough resolution to address questions about internal gas flows. Magnetic forces are possibly drivers of the flows, but ionization state estimates suggest that much of the gas mass decouples from magnetic fields. Thus, hydrodynamical instabilities could play a major role. We investigate disk dynamics under conditions typical for a T Tauri system, using global 3D radiation-hydrodynamics simulations with embedded particles and a resolution of 70 cells per scale height. Stellar irradiation heating is included with realistic dust opacities. The disk starts in joint radiative balance and hydrostatic equilibrium. The vertical shear instability (VSI) develops into turbulence that persists up to at least 1600 inner orbits (143 outer orbits). Turbulent speeds are a few percent of the local sound speed at the midplane, increasing to 20%, or 100 m s-1, in the corona. These are consistent with recent upper limits on turbulent speeds from optically thin and thick molecular line observations of TW Hya and HD 163296. The predominantly vertical motions induced by the VSI efficiently lift particles upward. Grains 0.1 and 1 mm in size achieve scale heights greater than expected in isotropic turbulence. We conclude that while kinematic constraints from molecular line emission do not directly discriminate between magnetic and nonmagnetic disk models, the small dust scale heights measured in HL Tau and HD 163296 favor turbulent magnetic models, which reach lower ratios of the vertical kinetic energy density to the accretion stress.

  19. Electrohydrodynamic (EHD) vortices in helical turbulence

    International Nuclear Information System (INIS)

    Kikuchi, H.

    1996-01-01

    The study of large-scale coherent hydrodynamic (HD) vortex generation has been extended to electrified charged dusty vortices to be termed as electrohydrodynamic (EHD) vortices, incorporating helical turbulence in electric and magnetic fields into that in fluid velocity, which are all created by an external DC electric field on the background. A new equation of EHD vortices is introduced on the basis of a set of EHD or electromagnetohydrodynamic (EMHD) equations, including equations of state and a full set of Maxwell's equations by using functional techniques for estimating equations for an ensemble average, turbulent background, and additional random field. In fact, EHD vortices for a charged dusty fluid can be more explosive with larger instabilities than HD vortices. In addition, it is inferred that an external DC electric field could provide the origin of additional self-organization to a coalescence of fluid vortex and electric field lines as a manifestation of a new frozen-in field concept for electric fields when the electric Reynolds number is sufficiently high. This is discussed on the basis of a set of general transport equations for fluid vorticity, magnetic and electric fields that are rederived concisely. In particular, a novel concept of electric field line merging-reconnection is developed in close relation to fluid vortex line merging, indicating a coalescence of fluid vortex breakdown or merging point and electric field line reconnection point, X-type or O-type with possible application to tornadic thunderstorms. In fact, a thundercloud charge distribution so as to provide a coalescence of fluid vortex and electric field lines is quite possible without theoretical inconsistency, and is thought most likely to occur from observations available so far. (orig.)

  20. Turbulent Concentration of mm-Size Particles in the Protoplanetary Nebula: Scale-Dependent Cascades

    Science.gov (United States)

    Cuzzi, J. N.; Hartlep, T.

    2015-01-01

    The initial accretion of primitive bodies (here, asteroids in particular) from freely-floating nebula particles remains problematic. Traditional growth-by-sticking models encounter a formidable "meter-size barrier" (or even a mm-to-cm-size barrier) in turbulent nebulae, making the preconditions for so-called "streaming instabilities" difficult to achieve even for so-called "lucky" particles. Even if growth by sticking could somehow breach the meter size barrier, turbulent nebulae present further obstacles through the 1-10km size range. On the other hand, nonturbulent nebulae form large asteroids too quickly to explain long spreads in formation times, or the dearth of melted asteroids. Theoretical understanding of nebula turbulence is itself in flux; recent models of MRI (magnetically-driven) turbulence favor low-or- no-turbulence environments, but purely hydrodynamic turbulence is making a comeback, with two recently discovered mechanisms generating robust turbulence which do not rely on magnetic fields at all. An important clue regarding planetesimal formation is an apparent 100km diameter peak in the pre-depletion, pre-erosion mass distribution of asteroids; scenarios leading directly from independent nebula particulates to large objects of this size, which avoid the problematic m-km size range, could be called "leapfrog" scenarios. The leapfrog scenario we have studied in detail involves formation of dense clumps of aerodynamically selected, typically mm-size particles in turbulence, which can under certain conditions shrink inexorably on 100-1000 orbit timescales and form 10-100km diameter sandpile planetesimals. There is evidence that at least the ordinary chondrite parent bodies were initially composed entirely of a homogeneous mix of such particles. Thus, while they are arcane, turbulent concentration models acting directly on chondrule size particles are worthy of deeper study. The typical sizes of planetesimals and the rate of their formation can be

  1. Complexity methods applied to turbulence in plasma astrophysics

    Science.gov (United States)

    Vlahos, L.; Isliker, H.

    2016-09-01

    In this review many of the well known tools for the analysis of Complex systems are used in order to study the global coupling of the turbulent convection zone with the solar atmosphere where the magnetic energy is dissipated explosively. Several well documented observations are not easy to interpret with the use of Magnetohydrodynamic (MHD) and/or Kinetic numerical codes. Such observations are: (1) The size distribution of the Active Regions (AR) on the solar surface, (2) The fractal and multi fractal characteristics of the observed magnetograms, (3) The Self-Organised characteristics of the explosive magnetic energy release and (4) the very efficient acceleration of particles during the flaring periods in the solar corona. We review briefly the work published the last twenty five years on the above issues and propose solutions by using methods borrowed from the analysis of complex systems. The scenario which emerged is as follows: (a) The fully developed turbulence in the convection zone generates and transports magnetic flux tubes to the solar surface. Using probabilistic percolation models we were able to reproduce the size distribution and the fractal properties of the emerged and randomly moving magnetic flux tubes. (b) Using a Non Linear Force Free (NLFF) magnetic extrapolation numerical code we can explore how the emerged magnetic flux tubes interact nonlinearly and form thin and Unstable Current Sheets (UCS) inside the coronal part of the AR. (c) The fragmentation of the UCS and the redistribution of the magnetic field locally, when the local current exceeds a Critical threshold, is a key process which drives avalanches and forms coherent structures. This local reorganization of the magnetic field enhances the energy dissipation and influences the global evolution of the complex magnetic topology. Using a Cellular Automaton and following the simple rules of Self Organized Criticality (SOC), we were able to reproduce the statistical characteristics of the

  2. Turbulence in Three Dimensional Simulations of Magnetopause Reconnection

    Science.gov (United States)

    Drake, J. F.; Price, L.; Swisdak, M.; Burch, J. L.; Cassak, P.; Dahlin, J. T.; Ergun, R.

    2017-12-01

    We present two- and three-dimensional particle-in-cell simulations of the 16 October 2015 MMS magnetopause reconnection event. While the two-dimensional simulation is laminar, turbulence develops at both the x-line and along the magnetic separatrices in the three-dimensional simulation. This turbulence is electromagnetic in nature, is characterized by a wavevector k given by kρ e ˜(m_e/m_i)0.25 with ρ e the electron Larmor radius, and appears to have the ion pressure gradient as its source of free energy. Taken together, these results suggest the instability is a variant of the lower-hybrid drift instability. The turbulence produces electric field fluctuations in the out-of-plane direction (the direction of the reconnection electric field) with an amplitude of around ± 10 mV/m, which is much greater than the reconnection electric field of around 0.1 mV/m. Such large values of the out-of-plane electric field have been identified in the MMS data. The turbulence in the simulation controls the scale lengths of the density profile and current layers in asymmetric reconnection, driving them closer to √ {ρ eρ_i } than the ρ e or de scalings seen in 2D reconnection simulations, where de is the electron inertial length. The turbulence is strong enough to make the magnetic field around the reconnection island chaotic and produces both anomalous resistivity and anomalous viscosity. Each contribute significantly to breaking the frozen-in condition in the electron diffusion region. The crescent-shaped features in velocity space seen both in MMS observations and in two-dimensional simulations survive, even in the turbulent environment of the three-dimensional system. We compare and contrast these results to a three-dimensional simulation of the 8 December 2015 MMS magnetopause reconnection event in which the reconnecting and out-of-plane guide fields are comparable. LHDI is still present in this event, although its appearance is modified by the presence of the guide

  3. Turbulent and neoclassical toroidal momentum transport in tokamak plasmas

    International Nuclear Information System (INIS)

    Abiteboul, J.

    2012-10-01

    The goal of magnetic confinement devices such as tokamaks is to produce energy from nuclear fusion reactions in plasmas at low densities and high temperatures. Experimentally, toroidal flows have been found to significantly improve the energy confinement, and therefore the performance of the machine. As extrinsic momentum sources will be limited in future fusion devices such as ITER, an understanding of the physics of toroidal momentum transport and the generation of intrinsic toroidal rotation in tokamaks would be an important step in order to predict the rotation profile in experiments. Among the mechanisms expected to contribute to the generation of toroidal rotation is the transport of momentum by electrostatic turbulence, which governs heat transport in tokamaks. Due to the low collisionality of the plasma, kinetic modeling is mandatory for the study of tokamak turbulence. In principle, this implies the modeling of a six-dimensional distribution function representing the density of particles in position and velocity phase-space, which can be reduced to five dimensions when considering only frequencies below the particle cyclotron frequency. This approximation, relevant for the study of turbulence in tokamaks, leads to the so-called gyrokinetic model and brings the computational cost of the model within the presently available numerical resources. In this work, we study the transport of toroidal momentum in tokamaks in the framework of the gyrokinetic model. First, we show that this reduced model is indeed capable of accurately modeling momentum transport by deriving a local conservation equation of toroidal momentum, and verifying it numerically with the gyrokinetic code GYSELA. Secondly, we show how electrostatic turbulence can break the axisymmetry and generate toroidal rotation, while a strong link between turbulent heat and momentum transport is identified, as both exhibit the same large-scale avalanche-like events. The dynamics of turbulent transport are

  4. The flux tube paradigm and its role in MHD turbulence in the solar atmosphere

    Science.gov (United States)

    Matthaeus, W. H.; Greco, A.; Servidio, S.; Wan, M.; Osman, K.; Ruffolo, D. J.

    2011-12-01

    Descriptions of magnetic field and plasma structures in terms of flux tubes, plasmoids and other bundles of magnetic field lines are familiar in the vocabulary of observational and theoretical space physics. "Spaghetti models" and flux ropes are well known examples. Flux tubes and families of field lines can also be defined in a medium that admits magnetic fluctuations, including strong MHD turbulence, but their behavior can become complicated. In 3D fluctuations the smooth flux tube description itself becomes in some sense unstable, as nearby field lines diverge and flux surfaces shred. This lends complexity to the structure of flux tubes, and can give rise to temporarily trapped field lines and charged test particle trajectories, with immediate implications for transport, e.g., of solar energetic particles. The properties of the turbulent magnetic field can also be strongly influenced by the dynamics of turbulence. Large scale self organizing behavior, or inverse cascade, can enhance very long wavelength structure, favoring Bohm scaling of diffusion coefficients. Meanwhile smaller scale flux tube structures are integral features of the inertial range of turbulence, giving rise to a cellularization of the plasma due to rapid dynamical relaxation processes. These drive the turbulent system locally towards low-acceleration states, including Alfvenic, Beltrami and force-free states. Cell boundaries are natural positions for formation of near discontinuous boundaries, where dynamical activity can be enhanced. A primary example is appearance of numerous discontinuities and active reconnection sites in turbulence, which appear to support a wide distribution of reconnection rates associated with coherent current structures. These discontinuities are also potential sites of enhanced heating, as expected in Kolmogorov's Refined Similarity Hypothesis. All of these features are related to self organization, cascade and intermittency of the turbulence. Examples of these

  5. The theory of gyrokinetic turbulence: A multiple-scales approach

    Science.gov (United States)

    Plunk, Gabriel Galad

    Gyrokinetics is a rich and rewarding playground to study some of the mysteries of modern physics -- such as turbulence, universality, self-organization and dynamic criticality -- which are found in physical systems that are driven far from thermodynamic equilibrium. One such system is of particular importance, as it is central in the development of fusion energy -- this system is the turbulent plasma found in magnetically confined fusion device. In this thesis I present work, motivated by the quest for fusion energy, which seeks to uncover some of the inner workings of turbulence in magnetized plasmas. I present three projects, based on the work of me and my collaborators, which take a tour of different aspects and approaches to the gyrokinetic turbulence problem. I begin with the fundamental theory of gyrokinetics, and a novel formulation of its extension to the equations for mean-scale transport -- the equations which must be solved to determine the performance of Magnetically confined fusion devices. The results of this work include (1) the equations of evolution for the mean scale (equilibrium) density, temperature and magnetic field of the plasma, (2) a detailed Poynting's theorem for the energy balance and (3) the entropy balance equations. The second project presents gyrokinetic secondary instability theory as a mechanism to bring about saturation of the basic instabilities that drive gyrokinetic turbulence. Emphasis is put on the ability for this analytic theory to predict basic properties of the nonlinear state, which can be applied to a mixing length phenomenology of transport. The results of this work include (1) an integral equation for the calculation of the growth rate of the fully gyrokinetic secondary instability with finite Larmor radius (FLR) affects included exactly, (2) the demonstration of the robustness of the secondary instability at fine scales (krhoi for ion temperature gradient (ITG) turbulence and krhoe ≪ 1 for electron temperature

  6. Analysis and comparison of different methods to characterize turbulent environment

    Science.gov (United States)

    Kozak, Liudmyla; Lui, Antony; Kronberg, Elena; Grigorenko, Elena; Savin, Sergey; Budaev, Vyacheslav

    2017-04-01

    The methods and approaches that can be used to analyze the hydrodynamic and magnetohydrodynamic turbulent flows are selected. It is shown that the best methods to characterize the types of turbulent processes are the methods of statistical physics. Within the statistical approach we considered the fractal analysis (determination of fractal length and height of the maximum of the probability density fluctuations of the studied parameters), and multifractal analysis (study of a power dependence of high order statistical moments and construction of multifractal spectrum). It is indicated that the statistical analysis of properties of turbulent processes can be supplemented by the spectral studies: Fourier and wavelet analysis. In order to test the methods and approaches we have used the magnetic field measurements from the space mission Cluster-II with a sampling frequency of 22.5 Hz in different regions of Earth's magnetosphere and solar wind plasma. We got a good agreement between different approaches and their mutual complementing to provide a general view of the turbulence. The work is done in the frame of the grant Az. 90 312 from the Volkswagen Foundation.

  7. Turbulence experiments on the PKU Plasma Test (PPT) device

    Science.gov (United States)

    Xu, Tianchao; Xiao, Chijie; Yang, Xiaoyi; Chen, Yihang; Yu, Yi; Xu, Min; Wang, Long; Lin, Chen; Wang, Xiaogang

    2017-10-01

    The PKU Plasma Test (PPT) device is a linear plasma device in Peking University, China. It has a vacuum chamber with 1000mm length and 500mm diameter. A pair of Helmholtz coils can generate toroidal magnetic field up to 2000 Gauss, and plasma was generated by a helicon source. Probes and fast camera were used to diagnose the parameters and got the turbulence spectrums, coherent structure, etc. The dynamics of turbulence, coherent structure and parameter profiles have been analyzed, and it has been found that the turbulence states are related to the equilibrium profiles; Some coherent structures exist and show strongly interactions with the background turbulences; The spatial and temporal evolutions of these coherent structures are related to the amplitude of the density gradient and electric field. These results will help on further studies of plasma transport. This work was supported by the National Natural Science Foundation of China under 11575014 and 11375053, CHINA MOST under 2012YQ030142 and ITER-CHINA program 2015GB120001.

  8. Magnetic Reconnection

    International Nuclear Information System (INIS)

    Yamada, Masaaki; Kulsrud, Russell; Ji, Hantao

    2009-01-01

    We review the fundamental physics of magnetic reconnection in laboratory and space plasmas, by discussing results from theory, numerical simulations, observations from space satellites, and the recent results from laboratory plasma experiments. After a brief review of the well-known early work, we discuss representative recent experimental and theoretical work and attempt to interpret the essence of significant modern findings. In the area of local reconnection physics, many significant findings have been made with regard to two-fluid physics and are related to the cause of fast reconnection. Profiles of the neutral sheet, Hall currents, and the effects of guide field, collisions, and micro-turbulence are discussed to understand the fundamental processes in a local reconnection layer both in space and laboratory plasmas. While the understanding of the global reconnection dynamics is less developed, notable findings have been made on this issue through detailed documentation of magnetic self-organization phenomena in fusion plasmas. Application of magnetic reconnection physics to astrophysical plasmas is also briefly discussed.

  9. Magnetic Reconnection

    Energy Technology Data Exchange (ETDEWEB)

    Masaaki Yamada, Russell Kulsrud and Hantao Ji

    2009-09-17

    We review the fundamental physics of magnetic reconnection in laboratory and space plasmas, by discussing results from theory, numerical simulations, observations from space satellites, and the recent results from laboratory plasma experiments. After a brief review of the well-known early work, we discuss representative recent experimental and theoretical work and attempt to interpret the essence of significant modern findings. In the area of local reconnection physics, many significant findings have been made with regard to two- uid physics and are related to the cause of fast reconnection. Profiles of the neutral sheet, Hall currents, and the effects of guide field, collisions, and micro-turbulence are discussed to understand the fundamental processes in a local reconnection layer both in space and laboratory plasmas. While the understanding of the global reconnection dynamics is less developed, notable findings have been made on this issue through detailed documentation of magnetic self-organization phenomena in fusion plasmas. Application of magnetic reconnection physics to astrophysical plasmas is also brie y discussed.

  10. SIMULATIONS OF THE KELVIN–HELMHOLTZ INSTABILITY DRIVEN BY CORONAL MASS EJECTIONS IN THE TURBULENT CORONA

    Energy Technology Data Exchange (ETDEWEB)

    Gómez, Daniel O.; DeLuca, Edward E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St, Cambridge, MA 02138 (United States); Mininni, Pablo D. [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and Instituto de Física de Buenos Aires, Ciudad Universitaria, 1428 Buenos Aires (Argentina)

    2016-02-20

    Recent high-resolution Atmospheric Imaging Assembly/Solar Dynamics Observatory images show evidence of the development of the Kelvin–Helmholtz (KH) instability, as coronal mass ejections (CMEs) expand in the ambient corona. A large-scale magnetic field mostly tangential to the interface is inferred, both on the CME and on the background sides. However, the magnetic field component along the shear flow is not strong enough to quench the instability. There is also observational evidence that the ambient corona is in a turbulent regime, and therefore the criteria for the development of the instability are a priori expected to differ from the laminar case. To study the evolution of the KH instability with a turbulent background, we perform three-dimensional simulations of the incompressible magnetohydrodynamic equations. The instability is driven by a velocity profile tangential to the CME–corona interface, which we simulate through a hyperbolic tangent profile. The turbulent background is generated by the application of a stationary stirring force. We compute the instability growth rate for different values of the turbulence intensity, and find that the role of turbulence is to attenuate the growth. The fact that KH instability is observed sets an upper limit on the correlation length of the coronal background turbulence.

  11. SHOCKFIND - an algorithm to identify magnetohydrodynamic shock waves in turbulent clouds

    Science.gov (United States)

    Lehmann, Andrew; Federrath, Christoph; Wardle, Mark

    2016-11-01

    The formation of stars occurs in the dense molecular cloud phase of the interstellar medium. Observations and numerical simulations of molecular clouds have shown that supersonic magnetized turbulence plays a key role for the formation of stars. Simulations have also shown that a large fraction of the turbulent energy dissipates in shock waves. The three families of MHD shocks - fast, intermediate and slow - distinctly compress and heat up the molecular gas, and so provide an important probe of the physical conditions within a turbulent cloud. Here, we introduce the publicly available algorithm, SHOCKFIND, to extract and characterize the mixture of shock families in MHD turbulence. The algorithm is applied to a three-dimensional simulation of a magnetized turbulent molecular cloud, and we find that both fast and slow MHD shocks are present in the simulation. We give the first prediction of the mixture of turbulence-driven MHD shock families in this molecular cloud, and present their distinct distributions of sonic and Alfvénic Mach numbers. Using subgrid one-dimensional models of MHD shocks we estimate that ˜0.03 per cent of the volume of a typical molecular cloud in the Milky Way will be shock heated above 50 K, at any time during the lifetime of the cloud. We discuss the impact of this shock heating on the dynamical evolution of molecular clouds.

  12. Turbulent/non-turbulent interfaces in jets and wakes

    Science.gov (United States)

    Zecchetto, Marco; Silva, Carlos; Lasef Team

    2017-11-01

    The characteristics of the turbulent/non-turbulent interface (TNTI) at the edges of jets and wakes at high Reynolds numbers are compared by using new direct numerical simulations (DNS) of temporally evolving planar jets (PJET) and wakes (PWAKE). The new simulations attain a Reynolds number based on the Taylor micro-scale of Reλ 350 which are the highest Reynolds number used so far in numerical investigations of TNTI. The similarities and differences between the TNTIs from PJET and PWAKE are assessed in relation to i) their structure and scaling, ii) the vorticity dynamics and, iii) and entrainment velocity. Portuguese Foundation for Science and Technology (FST); PRACE.

  13. The spatio-temporal structure of electrostatic turbulence in the WEGA stellarator

    Energy Technology Data Exchange (ETDEWEB)

    Marsen, Stefan

    2008-03-15

    The main object of this work is to provide a detailed characterisation of electrostatic turbulence in WEGA and to identify the underlying instability mechanism driving turbulence. The spatio-temporal structure of turbulence is studied using multiple Langmuir probes providing a sufficiently high spatial and temporal resolution. Turbulence in WEGA is dominated by drift wave dynamics. The phase shift between density and potential fluctuations is close to zero, fluctuations are mainly driven by the density gradient, and the phase velocity of turbulent structures points in the direction of the electron diamagnetic drift. The structure of turbulence is studied mainly in the plasma edge region inside the last closed flux surface. WEGA can be operated in two regimes differing in the magnetic field strength by almost one order of magnitude (57 mT and 500 mT, respectively). At 57 mT large structures with a poloidal extent comparable to the machine dimensions are observed, whereas at 500 mT turbulent structures are much smaller. The poloidal structure size scales nearly linearly with the inverse magnetic field strength. This scaling may be argued to be related to the drift wave dispersion scale, {rho}{sub s}={radical}(m{sub i}k{sub B}T{sub e})/(qB). However, the structure size remains unchanged when the ion mass is changed by using different discharge gases. Inside the last closed flux surface the poloidal E x B drift in WEGA is negligible. The three-dimensional structure is studied in detail using probes which are toroidally separated but aligned along connecting magnetic field lines. A small but finite parallel wavenumber is found. The ratio between the average parallel and perpendicular wavenumber is in the order of anti {kappa} {sub parallel} / anti {kappa}{sub {theta}} {approx} 10{sup -2}. The parallel phase velocity of turbulent structures is in-between the ion sound velocity and the Alfven velocity. In the parallel dynamics a fundamental difference between the two

  14. Numerical Test of Analytical Theories for Perpendicular Diffusion in Small Kubo Number Turbulence

    International Nuclear Information System (INIS)

    Heusen, M.; Shalchi, A.

    2017-01-01

    In the literature, one can find various analytical theories for perpendicular diffusion of energetic particles interacting with magnetic turbulence. Besides quasi-linear theory, there are different versions of the nonlinear guiding center (NLGC) theory and the unified nonlinear transport (UNLT) theory. For turbulence with high Kubo numbers, such as two-dimensional turbulence or noisy reduced magnetohydrodynamic turbulence, the aforementioned nonlinear theories provide similar results. For slab and small Kubo number turbulence, however, this is not the case. In the current paper, we compare different linear and nonlinear theories with each other and test-particle simulations for a noisy slab model corresponding to small Kubo number turbulence. We show that UNLT theory agrees very well with all performed test-particle simulations. In the limit of long parallel mean free paths, the perpendicular mean free path approaches asymptotically the quasi-linear limit as predicted by the UNLT theory. For short parallel mean free paths we find a Rechester and Rosenbluth type of scaling as predicted by UNLT theory as well. The original NLGC theory disagrees with all performed simulations regardless what the parallel mean free path is. The random ballistic interpretation of the NLGC theory agrees much better with the simulations, but compared to UNLT theory the agreement is inferior. We conclude that for this type of small Kubo number turbulence, only the latter theory allows for an accurate description of perpendicular diffusion.

  15. Numerical Test of Analytical Theories for Perpendicular Diffusion in Small Kubo Number Turbulence

    Energy Technology Data Exchange (ETDEWEB)

    Heusen, M.; Shalchi, A., E-mail: husseinm@myumanitoba.ca, E-mail: andreasm4@yahoo.com [Department of Physics and Astronomy, University of Manitoba, Winnipeg, MB R3T 2N2 (Canada)

    2017-04-20

    In the literature, one can find various analytical theories for perpendicular diffusion of energetic particles interacting with magnetic turbulence. Besides quasi-linear theory, there are different versions of the nonlinear guiding center (NLGC) theory and the unified nonlinear transport (UNLT) theory. For turbulence with high Kubo numbers, such as two-dimensional turbulence or noisy reduced magnetohydrodynamic turbulence, the aforementioned nonlinear theories provide similar results. For slab and small Kubo number turbulence, however, this is not the case. In the current paper, we compare different linear and nonlinear theories with each other and test-particle simulations for a noisy slab model corresponding to small Kubo number turbulence. We show that UNLT theory agrees very well with all performed test-particle simulations. In the limit of long parallel mean free paths, the perpendicular mean free path approaches asymptotically the quasi-linear limit as predicted by the UNLT theory. For short parallel mean free paths we find a Rechester and Rosenbluth type of scaling as predicted by UNLT theory as well. The original NLGC theory disagrees with all performed simulations regardless what the parallel mean free path is. The random ballistic interpretation of the NLGC theory agrees much better with the simulations, but compared to UNLT theory the agreement is inferior. We conclude that for this type of small Kubo number turbulence, only the latter theory allows for an accurate description of perpendicular diffusion.

  16. Atmospheric turbulence and diffusion research

    International Nuclear Information System (INIS)

    Hosker, R.P. Jr.

    1993-01-01

    The Atmospheric Turbulence and Diffusion Division (well known in the atmospheric dispersion community as the Atmospheric Turbulence and Diffusion Laboratory, ATDL) is one of several field facilities of NOAAs Air Resources Laboratory, headquartered in Silver Spring, Maryland. The laboratory conducts research on matters of atmospheric diffusion and turbulent exchange, concerning air quality. ATDD focuses attention on the physics of the lower atmosphere, with special emphasis on the processes contributing to atmospheric transport, dispersion, deposition, and air-surface exchange, and on the development of predictive capabilities using the results of this research. Research is directed toward issues of national and global importance related to the missions of DOE, to DOE's Oak Ridge Field Office, and to NOAA. The program is divided into four major projects: plume transport and diffusion in the planetary boundary layer, complex topography, canopy micrometeorology, and air-surface exchange

  17. Clumps in drift wave turbulence

    DEFF Research Database (Denmark)

    Pecseli, H. L.; Mikkelsen, Torben

    1986-01-01

    In a statistical analysis pair correlation of particles is eventually destroyed by small scale fluctuations giving rise to relative particle diffusion. However, in any one given realization of the statistical ensemble particles may remain correlated in certain regions of space. A perfectly frozen......, two-dimensional random flow serves as a particularly simple illustration. For this case particles can be trapped for all times in a local vortex (macro-clump). A small test-cloud of particles (micro-clump) chosen arbitrarily in a realization will on the other hand expand on average. A formulation...... is proposed in terms of conditional eddies, in order to discriminate turbulent flows where macro-clumps may be observed. The analysis is illustrated by results from experimental investigations of strongly turbulent, resistive drift-wave fluctuations. The related problem for electrostatic turbulence...

  18. SPECIAL ISSUE DEVOTED TO THE 80TH BIRTHDAY OF S.A. AKHMANOV: Peculiarities of periodic and aperiodic energy-exchange regimes in the cascade quasi-synchronous parametric frequency conversion

    Science.gov (United States)

    Petnikova, V. M.; Shuvalov, Vladimir V.

    2009-07-01

    The domains of existence and peculiarities of exact analytic solutions of the problem of quasi-synchronous interaction of four plane collinear monochromatic waves — modes in a quadratically nonlinear medium during cascade frequency conversion are analysed. It is shown that the unusual types of multicomponent cnoidal and solitary soliton-like waves (of periodic and aperiodic energy-exchange regimes) are realised. Two of the four components of the latter are proportional to the real and imaginary parts of the well-known Lorentzian dependence, which is commonly used to describe the dispersion of contributions from resonance transitions to the complex permittivity in the case of homogeneous line broadening.

  19. The acceleration and propagation of energetic particles in turbulent cosmic plasmas

    International Nuclear Information System (INIS)

    Achterberg, A.

    1981-01-01

    This thesis concentrates on the acceleration and propagation of energetic particles in turbulent cosmic plasmas. The stochastic acceleration of relativistic electrons by long-wavelength weak magnetohydrodynamic turbulence is considered and a model is discussed that allows the determination of both the electron energy spectrum and the wavenumber spectrum of the magnetohydrodynamic turbulence in a consistent way. The question of second phase acceleration in large solar flares and the precise form of the force exerted on the background plasma when Alfven waves are generated by fast particles are considered. The energy balance in the shock wave acceleration, the propagation of energetic particles in a high β plasma (β>10 2 ) and sheared flow as a possible source of plasma turbulence for a magnetized plasma with field-aligned flow, are discussed. (Auth./C.F.)

  20. Ion and relativistic electron acceleration by Alfven and whistler turbulence in solar flares

    Science.gov (United States)

    Miller, James A.; Ramaty, Reuven

    1987-01-01

    A model is proposed in which turbulent Alfven and whistler waves simultaneously produce the proton and electron spectra implied by the gamma-ray observations noted during the impulsive phase of the June 3, 1982 flare. The results demonstrate that protons can be accelerated to several GeV in less than about 10 sec by Alfven turbulence whose energy density is greater than a few erg/cu cm. It is also found that electrons may be accelerated to tens of MeV on similar time scales by whistler and Alfven turbulence. A lower limit on the energy density of the Alfven turbulence is obtained which is small compared to the total magnetic energy density.

  1. Finite Element Aircraft Simulation of Turbulence

    Science.gov (United States)

    1997-02-01

    A Simulation of Rotor Blade Element Turbulence (SORBET) model has been : developed for realtime aircraft simulation that accommodates stochastic : turbulence and distributed discrete gusts as a function of the terrain. This : model is applicable to c...

  2. Chemical Reactions in Turbulent Mixing Flows

    National Research Council Canada - National Science Library

    Mimotakis, Paul

    1998-01-01

    .... New measures to characterize level sets in turbulence were developed and successfully employed to characterize experimental data of liquid-phase turbulent-jet flows as well as three-dimensional...

  3. Frontogenesis and turbulent mixing

    Science.gov (United States)

    Zhang, S.; Chen, F.; Shang, Q.

    2017-12-01

    ageostrophic secondary circulation together with the cross-frontal ageostrophic speed. The mixed characteristic is weak in summer, but the large turbulent dissipation and mixing rate measured in the frontal region, which show that the front promoted exchange of material and energy in the upper ocean.

  4. Turbulence transport with nonlocal interactions

    Energy Technology Data Exchange (ETDEWEB)

    Linn, R.R.; Clark, T.T.; Harlow, F.H.; Turner, L.

    1998-03-01

    This preliminary report describes a variety of issues in turbulence transport analysis with particular emphasis on closure procedures that are nonlocal in wave-number and/or physical space. Anomalous behavior of the transport equations for large scale parts of the turbulence spectrum are resolved by including the physical space nonlocal interactions. Direct and reverse cascade processes in wave-number space are given a much richer potential for realistic description by the nonlocal formulations. The discussion also describes issues, many still not resolved, regarding new classes of self-similar form functions.

  5. Plasma turbulence effects on aurorae

    International Nuclear Information System (INIS)

    Mishin, E.V.; Telegin, V.A.

    1989-01-01

    Analysis of modern state of microprocesses physics in plasma of aurorare, initiated by energetic electron flow intrusion, is presented. It is shown that there is a number of phenomena, which cannot be explained under non-collision (collective) mechanisms of interaction are applied. Effects of plasma turbulence in the area of auroral arcs are considered. Introduction of a new structural element to auroral arc - plasma-turbulence (PT) layer is substantiated. Numerical simulation of electron kinetics, changes in neutral composition, as well as generation of IR- and UV-radiation in PT layer has been realized

  6. Circular Polarization in Turbulent Blazar Jets

    Directory of Open Access Journals (Sweden)

    Nicholas Roy MacDonald

    2017-11-01

    Full Text Available Circular polarization (CP provides an invaluable probe into the underlying plasma content of relativistic jets. CP can be generated within the jet through a physical process known as linear birefringence. This is a physical mechanism through which initially linearly polarized emission produced in one region of the jet is attenuated by Faraday rotation as it passes through other regions of the jet with distinct magnetic field orientations. Marscher developed the turbulent extreme multi-zone (TEMZ model of blazar emission which mimics these types of magnetic geometries with collections of thousands of plasma cells passing through a standing conical shock. I have recently developed a radiative transfer algorithm to generate synthetic images of the time-dependent circularly polarized intensity emanating from the TEMZ model at different radio frequencies. In this study, we produce synthetic multi-epoch observations that highlight the temporal variability in the circular polarization produced by the TEMZ model. We also explore the effect that different plasma compositions within the jet have on the resultant levels of CP.

  7. Observing magnetic objects in fluids

    NARCIS (Netherlands)

    Hageman, Tijmen Antoon Geert

    2018-01-01

    This thesis describes two topics dealing with objects moving through fluids. The first project considers centimetre-sized magnetic particles submerged in a turbulent water flow. We have studied how these particles interact with each other and self-assemble into clusters. By investigating their

  8. Computation of inverse magnetic cascades

    International Nuclear Information System (INIS)

    Montgomery, D.

    1981-10-01

    Inverse cascades of magnetic quantities for turbulent incompressible magnetohydrodynamics are reviewed, for two and three dimensions. The theory is extended to the Strauss equations, a description intermediate between two and three dimensions appropriate to tokamak magnetofluids. Consideration of the absolute equilibrium Gibbs ensemble for the system leads to a prediction of an inverse cascade of magnetic helicity, which may manifest itself as a major disruption. An agenda for computational investigation of this conjecture is proposed

  9. Turbulent pressure fluctuations measured during CHATS

    Science.gov (United States)

    Steven P. Oncley; William J. Massman; Edward G. Patton

    2008-01-01

    Fast-response pressure fluctuations were included in the Canopy Horizontal Array of Turbulence Study (CHATS) at several heights within and just above the canopy in a walnut orchard. Two independent systems were intercompared and then separated. We present an evaluation of turbulence statistics - including the pressure transport term in the turbulence kinetic energy...

  10. PROTOSTELLAR OUTFLOW EVOLUTION IN TURBULENT ENVIRONMENTS

    International Nuclear Information System (INIS)

    Cunningham, Andrew J.; Frank, Adam; Carroll, Jonathan; Blackman, Eric G.; Quillen, Alice C.

    2009-01-01

    The link between turbulence in star-forming environments and protostellar jets remains controversial. To explore issues of turbulence and fossil cavities driven by young stellar outflows, we present a series of numerical simulations tracking the evolution of transient protostellar jets driven into a turbulent medium. Our simulations show both the effect of turbulence on outflow structures and, conversely, the effect of outflows on the ambient turbulence. We demonstrate how turbulence will lead to strong modifications in jet morphology. More importantly, we demonstrate that individual transient outflows have the capacity to re-energize decaying turbulence. Our simulations support a scenario in which the directed energy/momentum associated with cavities is randomized as the cavities are disrupted by dynamical instabilities seeded by the ambient turbulence. Consideration of the energy power spectra of the simulations reveals that the disruption of the cavities powers an energy cascade consistent with Burgers'-type turbulence and produces a driving scale length associated with the cavity propagation length. We conclude that fossil cavities interacting either with a turbulent medium or with other cavities have the capacity to sustain or create turbulent flows in star-forming environments. In the last section, we contrast our work and its conclusions with previous studies which claim that jets cannot be the source of turbulence.

  11. Spatial distribution of turbulence in the Wendelstein 7-AS stellarator

    Science.gov (United States)

    Basse, N. P.; Michelsen, P. K.; Zoletnik, S.; Saffman, M.; Endler, M.; Hirsch, M.

    2002-08-01

    In this paper measurements of short wavelength electron density fluctuations using collective scattering of infrared light are presented. The Wendelstein 7-AS (W7-AS) stellarator (Renner H et al 1989 Plasma Phys. Control. Fusion 31 1579) and the diagnostic are briefly described. A series of plasma discharges with reproducible confinement transitions was created by ramping up the plasma current. Utilizing the fact that the density fluctuation wavenumber κ is anisotropic in the directions parallel and perpendicular to the local magnetic field, the diagnostic can provide a radial profile of the turbulence during both normal and degraded confinement. The found profiles display an increase of core turbulence for the reduced confinement state. The results are discussed and compared to similar tokamak measurements.

  12. Transport and turbulence in TORE SUPRA ohmic discharges

    International Nuclear Information System (INIS)

    Garbet, X.; Payan, J.; Laviron, C.; Devynck, P.; Saha, S.K.; Capes, H.; Chen, X.P.; Coulon, J.P.; Gil, C.; Harris, G.; Hutter, T.; Pecquet, A.L.

    1992-01-01

    The mechanisms underlying the energy confinement behaviour in ohmic tokamak discharges are not yet understood. It is well known that the confinement time increases with the average density and saturates above a critical value of the density, but several explanations exist for this saturation. The present study is an analysis of a set of ohmic discharges in Tore Supra with I p =1.6 MA, B=4 T, R=2.35 m and a=0.78 m, where the average density was increased from 0.9 to 4.2 10 19 m -3 . For these plasma parameters, the energy confinement time given by magnetic measurements saturates for e > ≥ 2.5 10 19 m -3 . It is emphasized here that the onset of ionic turbulence is unlikely in Tore Supra. This conclusion relies on a transport analysis and turbulence measurements by CO 2 laser scattering, whose results are presented in this paper

  13. The modification of turbulent transport by orbit averaging

    Energy Technology Data Exchange (ETDEWEB)

    Mynick, H.E.; Zweben, S.J.

    1991-05-01

    The effect on plasma turbulence of orbit averaging by thermal ions is considered, and illustrated for two modes of potential importance for tokamaks. The effect can reduce the ion response below that in earlier treatments, modifying the predicted mode growth rate, which in turn modifies the turbulent transport. For both modes, the effect modifies earlier transport expressions with a neoclassical factor,'' which makes the scalings of the resultant transport coefficients with plasma current and magnetic field closer to those found experimentally. Additionally, for the trapped electron mode, this mechanism provides a potential explanation of the observed more favorable scaling of {chi}{sub i} with T{sub i} in supershots than in L-modes. 21 refs., 2 figs.

  14. Scaling laws and intermittent structures in solar wind MHD turbulence

    Science.gov (United States)

    Veltri, Pierluigi; Mangeney, André

    1999-06-01

    Thirteen months of velocity and magnetic field data from ISEE space experiment have been used to calculate spectra and structure functions using Haar wavelets technique in the range from 1 minute to about 1 day. Using conditioned structure function definition we have been able to eliminate the intermittency effects in the spectra and thus to evidentiate which kind of phenomenology of nonlinear cascade between Kolmogorov and Kraichnan is taking place in Solar Wind turbulence. By the same technique the most intermittent structures in solar wind turbulence can also be identified and they turn out to be either shock waves or one dimensional current sheets, at variance with ordinary fluid intermittency, where the most intermittent structures are two dimensional vortices.

  15. Anisotropic third-moment estimates of the energy cascade in solar wind turbulence using multispacecraft data.

    Science.gov (United States)

    Osman, K T; Wan, M; Matthaeus, W H; Weygand, J M; Dasso, S

    2011-10-14

    The first direct determination of the inertial range energy cascade rate, using an anisotropic form of Yaglom's law for magnetohydrodynamic turbulence, is obtained in the solar wind with multispacecraft measurements. The two-point mixed third-order structure functions of Elsässer fluctuations are integrated over a sphere in magnetic field-aligned coordinates, and the result is consistent with a linear scaling. Therefore, volume integrated heating and cascade rates are obtained that, unlike previous studies, make only limited assumptions about the underlying spectral geometry of solar wind turbulence. These results confirm the turbulent nature of magnetic and velocity field fluctuations in the low frequency limit, and could supply the energy necessary to account for the nonadiabatic heating of the solar wind.

  16. TURBULENCE-GENERATED PROTON-SCALE STRUCTURES IN THE TERRESTRIAL MAGNETOSHEATH

    Energy Technology Data Exchange (ETDEWEB)

    Vörös, Zoltán; Narita, Yasuhito [Space Research Institute, Austrian Academy of Sciences, Graz (Austria); Yordanova, Emiliya [Swedish Institute of Space Physics, Uppsala (Sweden); Echim, Marius M. [Belgian Institute for Space Aeronomy, Bruxelles (Belgium); Consolini, Giuseppe, E-mail: zoltan.voeroes@oeaw.ac.at [INAF-Istituto di Astrofisica e Planetologia Spaziali, Roma (Italy)

    2016-03-01

    Recent results of numerical magnetohydrodynamic simulations suggest that in collisionless space plasmas, turbulence can spontaneously generate thin current sheets. These coherent structures can partially explain the intermittency and the non-homogenous distribution of localized plasma heating in turbulence. In this Letter, Cluster multi-point observations are used to investigate the distribution of magnetic field discontinuities and the associated small-scale current sheets in the terrestrial magnetosheath downstream of a quasi-parallel bow shock. It is shown experimentally, for the first time, that the strongest turbulence-generated current sheets occupy the long tails of probability distribution functions associated with extremal values of magnetic field partial derivatives. During the analyzed one-hour time interval, about a hundred strong discontinuities, possibly proton-scale current sheets, were observed.

  17. Phenomenology of non-Alfvenic turbulence in a uniformly expanding medium

    Science.gov (United States)

    Matthaeus, W. H.; Zank, G. P.

    1995-01-01

    Transport and decay of magnetohydrodynamic (MHD) turbulence in a weakly inhomogeneous uniformly expanding medium involves a fairly complex formalism, even for the case where no spectral information is required. Here we argue that the phenomenology for decay simplifies greatly if: (1) the cross helicity (Alfvenicity) is small, (2) the dynamical influence of the large scale magnetic field is negligible either because of spectral anisotropy or because the expansion speed is much greater than the corresponding Alfven speed, and (3) the ratio of kinetic energy to magnetic energy for the fluctuations is either unity or some other constant. These conditions are acceptable as an approximation to solar wind turbulence in the outer heliosphere. In these circumstances a reasonable MHD energy-containing phenomenology is essentially that of locally homogeneous Kolmogoroff turbulence in a uniformly expanding medium. Analytical solutions for this model are presented for both undriven and driven cases.

  18. Model experiment to study sonic boom propagation through turbulence. Part II. Effect of turbulence intensity and propagation distance through turbulence.

    Science.gov (United States)

    Lipkens, B; Blackstock, D T

    1998-09-01

    A model experiment was reported to be successful in simulating the propagation of sonic booms through a turbulent atmosphere [B. Lipkens and D. T. Blackstock, J. Acoust. Soc. Am. 103, 148-158 (1998)]. In this study the effect on N wave characteristics of turbulence intensity and propagation distance through turbulence are investigated. The main parameters of interest are the rise time and the peak pressure. The effect of turbulence intensity and propagation distance is to flatten the rise time and peak pressure distributions. Rise time and peak pressure distributions always have positive skewness after propagation through turbulence. Average rise time grows with turbulence intensity and propagation distance. The scattering of rise time data is one-sided, i.e., rise times are almost always increased by turbulence. Average peak pressure decreases slowly with turbulence intensity and propagation distance. For the reported data a threefold increase in average rise time is observed and a maximum decrease of about 20% in average peak pressure. Rise times more than ten times that of the no turbulence value are observed. At most, the maximum peak pressure doubles after propagation through turbulence, and the minimum peak pressure values are about one-half the no-turbulence values. Rounded waveforms are always more common than peaked waveforms.

  19. Generalized similarity in magnetohydrodynamic turbulence as seen in the solar corona and solar wind

    Science.gov (United States)

    Chapman, S. C.; Leonardis, E.; Nicol, R. M.; Foullon, C.

    2010-12-01

    A key property of turbulence is that it can be characterized and quantified in a robust and reproducible way in terms of the ensemble averaged statistical properties of fluctuations. Importantly, fluctuations associated with a turbulent field show similarity or scaling in their statistics and we test for this in observations of magnetohydrodynamic turbulence in the solar corona and solar wind with both power spectra and Generalized Structure Functions. Realizations of turbulence that are finite sized are known to exhibit a generalized or extended self-similarity (ESS). ESS was recently demonstrated in magnetic field timeseries of Ulysses single point in-situ observations of fluctuations of quiet solar wind for which a single robust scaling function was found [1-2]. Flows in solar coronal prominences can be highly variable, with dynamics suggestive of turbulence. The Hinode SOT instrument provides observations (images) at simultaneous high spatial and temporal resolution which span several decades in both spatial and temporal scales. We focus on specific Calcium II H-line observations of solar quiescent prominences with dynamic, highly variable small-scale flows. We analyze these images from the perspective of a finite sized turbulent flow. We discuss this evidence of ESS in the SOT images and in Ulysses solar wind observations- is there a single universal scaling of the largest eddies in the finite range magnetohydrodynamic turbulent flow? [1] S. C. Chapman, R. M. Nicol, Generalized Similarity in Finite Range Solar Wind Magnetohydrodynamic Turbulence, Phys. Rev. Lett., 103, 241101 (2009) [2] S. C. Chapman, R. M. Nicol, E. Leonardis, K. Kiyani, V. Carbone, Observation of universality in the generalized similarity of evolving solar wind turbulence as seen by ULYSSES, Ap. J. Letters, 695, L185, (2009)

  20. Evaluation of turbulence mitigation methods

    Science.gov (United States)

    van Eekeren, Adam W. M.; Huebner, Claudia S.; Dijk, Judith; Schutte, Klamer; Schwering, Piet B. W.

    2014-05-01

    Atmospheric turbulence is a well-known phenomenon that diminishes the recognition range in visual and infrared image sequences. There exist many different methods to compensate for the effects of turbulence. This paper focuses on the performance of two software-based methods to mitigate the effects of low- and medium turbulence conditions. Both methods are capable of processing static and dynamic scenes. The first method consists of local registration, frame selection, blur estimation and deconvolution. The second method consists of local motion compensation, fore- /background segmentation and weighted iterative blind deconvolution. A comparative evaluation using quantitative measures is done on some representative sequences captured during a NATO SET 165 trial in Dayton. The amount of blurring and tilt in the imagery seem to be relevant measures for such an evaluation. It is shown that both methods improve the imagery by reducing the blurring and tilt and therefore enlarge the recognition range. Furthermore, results of a recognition experiment using simulated data are presented that show that turbulence mitigation using the first method improves the recognition range up to 25% for an operational optical system.